id
stringlengths 11
16
| query
stringlengths 279
826k
| answer
stringlengths 174
4.34k
|
|---|---|---|
PubmedSumm7800 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: malignant middle cerebral artery ( mca ) infarction may occur in up to 10% of patients who have acute ischemic stroke and have a mortality rate of approximately 80% . because of the limitations of medical therapies , decompressive hemicraniectomy has been proposed for patients with space - occupying hemispheric infarction .
this therapy can prevent secondary tissue damage by creating compensatory space to accommodate the swollen brain .
however , given the lack of data , neurosurgeons may be reluctant to perform this procedure .
recently , the pooled analysis of 3 small randomized trials demonstrated decompressive hemicraniectomy can reduce mortality and morbidity related to malignant infarction of the mca . it is expected that the procedure would be increased due to positive effect on outcomes .
the aims of the present study were to determine the proportion of patients with ischemic stroke who would have been potentially eligible for hemicraniectomy and to observe the utilization of decompressive hemicraniectomy with malignant mca territory infarction in mainland china .
we included patients with acute ischemic stroke admitted consecutively to neurological wards of the west china hospital , sichuan university , between december 2007 and march 2011 .
all patients had a clinical diagnosis of stroke according to world health organization ( who ) criteria and intracranial hemorrhage was further excluded by ct or mri scan in the hospital .
inclusion criteria were as follows : infarction more than two - thirds the mca territory as defined by computed tomography and/or magnetic resonance imaging ; neuroradiologic evidence of local brain swelling such as midline shift of 5 mm or more indicating space - occupying edema ; prestroke modified rankin scale ( mrs ) < 2 .
this research project was approved by the scientific research department of west china hospital , which conformed to the local ethic criteria .
the following demographic and clinical data were recorded and evaluated : age , sex , location of infarction , national institutes of health stroke scale ( nihss ) scores , glasgow coma scale ( gcs ) scores , and history of vascular risk factors such as hypertension , diabetes mellitus , hypercholesterolemia , history of transient ischemic attack ( tia ) , coronary heart disease , history of stroke , and smoking status .
patients were followed up by telephone call , clinic interview , or letter inquiry using a structured data form .
we compared the differences between 2 groups using t test , mann whitney u test , or test where appropriate .
the multivariate logistic regression model was used to identify the independent predictors for fatality and outcome at 1 months and 1 year . for comparison ,
we divided the included patients as surgery group ( underwent decompressive hemicraniectomy ) and nonsurgery group ( without surgery ) . early was defined as that surgery was performed within 48 h of symptom onset and late was surgery performed after 48 h of significant deterioration .
all statistical analyses were performed with spss 18.0 ( spss inc , chicago , il ) for windows package .
we included patients with acute ischemic stroke admitted consecutively to neurological wards of the west china hospital , sichuan university , between december 2007 and march 2011 .
all patients had a clinical diagnosis of stroke according to world health organization ( who ) criteria and intracranial hemorrhage was further excluded by ct or mri scan in the hospital .
inclusion criteria were as follows : infarction more than two - thirds the mca territory as defined by computed tomography and/or magnetic resonance imaging ; neuroradiologic evidence of local brain swelling such as midline shift of 5 mm or more indicating space - occupying edema ; prestroke modified rankin scale ( mrs ) < 2 .
this research project was approved by the scientific research department of west china hospital , which conformed to the local ethic criteria .
the following demographic and clinical data were recorded and evaluated : age , sex , location of infarction , national institutes of health stroke scale ( nihss ) scores , glasgow coma scale ( gcs ) scores , and history of vascular risk factors such as hypertension , diabetes mellitus , hypercholesterolemia , history of transient ischemic attack ( tia ) , coronary heart disease , history of stroke , and smoking status .
patients were followed up by telephone call , clinic interview , or letter inquiry using a structured data form .
we compared the differences between 2 groups using t test , mann whitney u test , or test where appropriate .
the multivariate logistic regression model was used to identify the independent predictors for fatality and outcome at 1 months and 1 year . for comparison ,
we divided the included patients as surgery group ( underwent decompressive hemicraniectomy ) and nonsurgery group ( without surgery ) . early was defined as that surgery was performed within 48 h of symptom onset and late was surgery performed after 48 h of significant deterioration .
all statistical analyses were performed with spss 18.0 ( spss inc , chicago , il ) for windows package .
ten percent ( 219/2174 ) of patients with acute ischemic stroke had malignant mca infarction .
of them , 31 patients ( 14.2% ) underwent the decompressive surgery the average age was 53 12 ; number of males 14 ; median nihss score was 21 .
a favorable outcome was achieved in 32.2% of the patients at the end of 1 year . based on data from our center , 10% suffered from malignant infarction and 31.1% ( 68/219 )
patients did meet the criteria that they were 60 years of age and the timing to hospital < 48 hours after stroke onset . among 68 patients who did meet above criteria , 18 patients ( 26.5% ) underwent to decompressive hemicraniectomy .
the patients in surgery group were younger ( 53.19 years vs. 63.68 years ; p < 0.001 ) and had a higher median nihss score ( 21 vs. 17 , p = 0.018 ) on admission than nonsurgery group .
the other characteristics on sex , infarct hemisphere , gcs scores , and risk factors were comparable between surgery group and nonsurgery group ( p > 0.05 ) ( table 1 ) .
characteristics of patients with and without hemicraniectomy upon univariate analysis , patients in surgery group had a higher proportion of good outcome than patients in nonsurgery group in 1 year follow - up ( 32.2% vs. 13.3% , p = 0.006 ; or = 3.59 ; 95% ci , 1.508.62 ) .
the case fatality rate of patients in surgery group was significantly lower than those of in nonsurgery group in 1 month and 1 year follow - ups ( 32.3% and 38.7% vs. 51.1% and 61.2% , respectively , p < 0.05 ) ( table 2 ) .
after adjusting for confounders including age , sex , nihss score , and gcs score on admission , decompressive hemicraniectomy was an independent predictor for 1-year good outcome ( or = 3.44 , 95% ci , 1.279.31 ) ( table 3 )
. outcomes at 1 month and 1 year follow - up of patients with and without hemicraniectomy multivariate logistic regression for outcomes at 1-mo and 1-yr follow - up in surgery group , the characteristics in sex , infarct hemisphere , nihss score , and gcs score were comparable between early hemicraniectomy and late hemicraniectomy ( p > 0.05 ) ( table 4 ) .
the patients 60 years of age have a lower median nihss score and gcs score ( 20 and 9 vs. 24 and 5 ; p , 0.039 and 0.023 ) than the patients > 60 years of age ( table 5 ) .
comparison between early and late in surgery group comparison between patients
60 years and > 60 years in surgery group there were no significant differences on case - fatality rate after 1 month and 1 year ( 28.6% and 28.6% vs. 35.3% and 47.1% , p > 0.05 ) between early surgery and late surgery .
there was no significant difference on functional outcome after 1 year ( p > 0.05 ) ( table 4 ) .
there were no significant differences on case - fatality rate after 1 month and 1 year ( 26.1% and 30.4% vs. 50.0% and 62.5% ,
p > 0.05 ) or on functional outcome after 1 year between patients younger than 60 years old and patients older than 60 years old ( table 5 ) .
our study showed that 10% ( 219/2174 ) patients admitted for acute ischemic stroke had malignant mca infarction in according with previous studies and 31.1% ( 68/219 ) patients did meet the criteria that they were 60 years of age and the timing to hospital < 48 hours after stroke onset .
there is almost certainly a multifactorial cause , such as clinicians do not consider mrs < 4 as a favorable outcome although it was considered a favorable outcome in the pooled analysis or relatives of patients hesitate to receive the surgery or spiritual reasons , financial concerns , etc .
in addition , the proportion of patients meeting criteria for hemicraniectomy is low , which needs to be improved by early evaluation and expansion of the clinical indications of hemicraniectomy .
future studies should investigate population - based eligibility and appropriate patient selection for hemicraniectomy in the real world
situation .. in the present series , the case - fatality rates for 1 month and 1 year after surgery were 32.3% and 38.7% , respectively ; these are comparable with previous reports
in fact , the surgical group did better despite having a significantly higher nihss on presentation while the nonsurgical group was clinically better on presentation , they did clinically
worse on follow - up . compared to the pooled analysis , patients in our study : were older ( 25% patients were aged more than 60 years ) ; were selected for surgery late after symptom onset ( 17 patients underwent surgery after 48 h ) .
there still exists controversy on the cut - off point of age to perform surgery . in a meta - analysis
arac et al carried out an extensive review of the literature to find that the outcome was much worse in patients over 60 years of age compared to that under 60 years of age .
we found that patients over 60 years of age had a worse function outcome but had no significant difference in case fatality rates between patients younger than 60 years old and patients older than 60 years old .
but , kuroki et al described that the decompressive surgery outcome is better than the conservative treatment even in patients older than 70 years old .
the chinese randomized trial recruited 29 elderly subjects between the ages of 6080 and showed that decompressive hemicraniectomy can reduce mortality and increase the chances of surviving with no severe disability ( mrs = 4 ) in elderly patients .
recently , 112 patients 61 years of age or older ( median , 70 years ; range , 6182 ) with malignant middle - cerebral - artery infarction were assigned to either conservative treatment or hemicraniectomy , and the result showed hemicraniectomy increased survival without severe disability among patients 61 years of age or older . from the data available , elder patients will benefit from the decompressive surgery .
some studies have reported that the timing of surgery is not correlated with the functional outcome of patients ; however , early surgical intervention has been regarded as an important factor for better functional outcome by other studies .
our study included that 17 patients underwent to decompressive hemicraniectomy beyond 48 hours and showed that there were not significant differences between within 48 hours and beyond 48 hours on case - fatality rate and functional outcome .
of course , it may be related to the limited power ( n = 31 ) .
first , this is a retrospective hospital - based study and may be subject to selection bias .
one could imagine that patients too ill for surgery or patients whose families opted for pallitive care or hospice skew the
second , patients selection for decompressive craniectomy is not confined to criteria of 60 years of age and the timing to hospital < 48 hours after stroke onset .
in addition , there may be some sort of selection bias by the surgeons for decompressive craniectomy .
however , it reflects decompressive craniectomy for malignant middle cerebral artery infarction in a real - world experience . whether a patient could perform the surgery
this study shows better outcomes in the surgical group , which are consistent with findings in previous prospective randomized trials .
Output:
| abstractdecompressive hemicraniectomy with malignant middle cerebral artery ( mca ) infarction is effective but remains underutilized . the aim of this study was to observe the utilization of this intervention in mainland china.we included patients with malignant mca infarction who admitted in west china hospital between december 2007 to march 2011 .
the outcomes were death and favorable outcome ( mrs
< 4 ) at 1 month and 1 year .
the multivariate logistic regression model was used to identify the independent predictors for outcomes.ten percent ( 219/2174 ) of patients with acute ischemic stroke had malignant mca infarction and 31.1% ( 68/219 ) patients meet the criteria that 60 years of age and the timing to hospital < 48 hours after stroke onset . of them ,
18 patients ( 26.5% ) underwent to decompressive hemicraniectomy . in total , 31 patients ( 14.2% ) underwent the decompressive surgery .
the average age was 53 12 years ; median nihss score was 21 .
the case fatality rate of patients in surgery group was significantly lower than those of in nonsurgery group at 1 month and 1 year follow - ups ( 32.3% and 38.7% vs. 51.1% and 61.2% , respectively , p < 0.05 ) .
patients in surgery group had a higher proportion of good outcome at 1 year follow - up ( 32.2% vs. 13.3% , p = 0.006 ) . after adjusting for confounders including age , sex , nihss score , and gcs score on admission ,
decompressive hemicraniectomy was an independent predictor of good outcome for 1 year ( or = 3.44 , 95% ci , 1.279.31).this study shows better outcomes in the surgical group , which are consistent with findings in previous prospective randomized trials .
however , this beneficial intervention remains underutilized in clinical settings . |
PubmedSumm7801 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: portal biliopathy is defined as the development of extensive venous collateral vessels , due to obstruction of the extrahepatic portal vein , causing impediment to portal venous drainage .
it develops from morphological changes of dilatation and stenosis of intrahepatic , extrahepatic and pancreatic ducts .
it is also designated as cholangiopathy associated with portal hypertension , or portal cavernoma associated cholangiopathy .
majority of patients are asymptomatic , but rarely some experience symptoms such as abdominal pain , jaundice , and fever .
magnetic resonance cholangiopancreatography ( mrcp ) and endoscopic retrograde cholangiopancreatography ( ercp ) are considered to be the diagnostic tools of choice , once symptoms are manifested [ 1 - 3 ] .
proper treatment is required to prevent complication such as biliary sepsis in cases of symptomatic portal biliopathy .
there are few reports on radiologic findings of portal biliopathy in korea , however , a symptomatic case was not previously reported .
a 56-year - old man visited the emergency room with fever , chill , and abdominal pain .
the past medical history indicated that he was diagnosed with hepatitis - related liver cirrhosis and was started on an anti - viral agent since 15 years ago .
he was diagnosed with a small hepatocellular carcinoma in s2 of the liver 8 years ago and performed trans - catheter arterial chemoembolization twice .
he had been suffered from chronic portal veous thrombosis in main portal vein and portal hypertension .
he had a history of embolization of a splenic arterial pseudoaneurysm with severe splenomegaly and pancytopenia 5 years ago .
he had multiple hospital admissions for esophageal and gastric variceal bleeding , hepatic encephalopathy and spontaneous bacterial peritonitis .
on presentation at our emergency room , he was in a febrile state and looked acutely ill with icteric sclera and abdominal tenderness and palpable abdominal mass on the left upper quadrant were found on physical examination .
the vital signs on initial presentation were as follows : blood pressure of 104/66 mmhg , heart rate of 79 beats per minute , and body temperature of 38.2. the initial blood test showed hemoglobin of 10.2 g / dl , white blood cell count of 3,240/l , platelet count of 20,000/l , prothrombin time international normalized ratio of 1.95 , albumin of 2.7 g / dl , total bilirubin of 29.4 mg / dl , direct bilirubin of 20.1 mg / dl , aspartate aminotransferase of 58 iu / l , alanine aminotransferase of 32 iu / l , alkaline phosphatase of 229 iu / l , c reactive protein of 15.2 mg / dl , and creatinine of 1.5 mg / dl .
hepatitis b e ( hbe ) antigen , anti - hbe antibody and hbv dna were not detected .
alpha - fetoprotein was 2.3 ng / ml . a plain radiograph of the chest showed no active lung lesion .
abdominal ct scan showed chronic thrombosis in the main portal vein , cavernous transformation , extensive splenic varix , large gall stones and pericholecystic infiltration of the gallbladder ( fig .
additionally , cirrhotic change of the liver , mild ascites and mild bile duct dilatation were seen ( fig .
irregular filling defect in the cbd on mrcp by cavernous transformation of the portal vein indicated portal bilopathy ( fig .
therapeutic endoscopic sphincterostomy and drainage were performed to widen the obstruction of biliary tract caused by compression .
more specifically , a double pigtail stent of 7 fr . in diameter and 10 cm in length was inserted through endoscopic retrograde biliary drainage ( erbd ) ( fig .
3b ) . fever , jaundice and abdominal pain subsided on the 2nd day after erbd .
there was a significant decrease in total bilirubin level from 29.4 to 8.9 mg / dl , 7 days after erbd .
4 ) . there were no symptoms including fever , chill , jaundice , abdominal pain during the follow up .
total bilirubin ranged from 1.5 to 2.0 mg / dl for 6 months until stent removal .
however , esophageal variceal bleeding and hepatic encephalopathy were developed during the 6 months follow - up period .
furthermore , gastrointestinal bleeding from gastric antral vascular ectasia was treated with argon plasma coagulation under hospitalization .
portal biliopathy is defined as the development of extensive venous collateral vessels , due to the obstruction of extra- and intrahepatic ducts , causing impediment to portal venous drainage .
the underlying pathogenesis of the disease starts with the compression of venous collaterals on the bile duct and prolonged portal vein thrombosis .
this induces sclerosis on veins around the bile duct leading to a series of events explained by the ischemic and infective theory .
approximately 5 - 17% of cases advance to the symptomatic stage , experiencing abdominal pain , jaundice , recurrent fever , and chilling [ 1 - 3 ] .
patients with such symptoms are known to be comorbid with cholethiasis approximately upto 84 % .
the production of the stone is explained by cholestasis due to increased fibrosis and decreased motility of the biliary tract in portal biliopathy .
increase in serum bilirubin , alkaline phosphate and transaminase is caused by insufficient biliary drainage of portal biliopathy .
it exhibits increased portal vein diameter , hyper - echogenicity on tissue of the hilum and distended paracholedochal veins .
however , it was difficult to explore on the cbd using this modality , especially when there was no extrinsic compression by enlarged paracholedochal veins .
abdominal ct has the advantage of visualizing collateral circulation , enabling investigation on cavernous formation of the portal vein and the compressive effect of collateral circulation on the bile duct and gallbladder varices .
recently , mrcp is more often used and has become the choice non - invasive diagnostic modality for evaluating the biliary tract ; it not only shows the nature and changes of intra- and extra - hepatic bile duct over time , but is also useful to rule out malignancy .
ercp is recommended as an invasive diagnostic tool , since it can show the irregularity , length and degree of narrowed bile duct , segmental upstream dilatation , ductal displacement , calculi , pruning of intrahepatic ducts , and the filling defects in cbd .
it is also useful for differential diagnosis of recurrent pyogenic cholangitis , cbd stones with stricture , and biliary ascariasis [ 8 - 10 ] .
some studies have suggested that it is advantageous for the differential diagnoses of diseases including bile duct stone , pericholedochal varices and tumor .
endoscopic ultrasound is used for the diagnosis of portal biliopathy , but it is not recommended as a routine exam .
he suffered from variceal bleeding due to portal hypertension but had no biliary symptoms before admission .
symptoms including recurrent fever , chill , jaundice , and abdominal pain developed over time .
ct revealed typical development of multiple collateral vessels , gallstone and portal cavernoma presumably caused by portal vein thrombosis , however cbd stone was not observed .
mrcp was followed immediately and showed typical filling defects on the distal bile duct due to compression from extrinsic cavernomatous transformation without cbd stone .
mrcp is a non - invasive diagnostic modality for detection of small biliary stone with high sensitivity and specificity ( > 90% ) .
asymptomatic portal biliopathy does not require treatment . on the other hand , treatment to reduce symptoms and to prevent complication such as cholecystitis , cholangitis , chronic obstructive jaundice , biliary sepsis and biliary cirrhosis ,
endoscopic treatment should be considered as an initial therapeutic modality when there are symptoms caused by biliary stricture or obstruction , since it effectively alleviates symptoms of biliary obstruction .
endoscopic treatment also has some disadvantages ; it requires regular follow - up exams for monitoring stent migration and for a replacement of stent when occluded .
a case study on endoscopic stent indicated that patients with prolonged indwelling stent suffered from recurrent cholangitis .
though endoscopic treatment is the first choice for portal biliopathy , a favorable outcome may not always be achieved .
transjugular intrahepatic portosystemic shunt ( tips ) could be considered when symptoms persist even after endoscopic biliary decompression .
biliary intestinal bypass is the next treatment choice , when tips fails to significantly reduce symptoms .
surgical intervention should be considered in patients if the symptoms from the stricture or obstruction of bile duct continue , or when regular follow - up exams is expected to be difficult for a patient . in this case , endoscopic treatment was considered as the initial therapeutic modality since our patient experienced symptoms of biliary obstruction .
the subject successfully received balloon catheter dilation , endoscopic papillotomy and stent insertion and was discharged from the hospital .
there was no complication from the procedure itself , such as recurrent cholangitis or stent obstruction .
the stent was removed 6 months after the erbd insertion . despite successful endoscopic treatment on portal biliopathy
, complications from portal hypertension including hepatic encephalopathy , and variceal bleeding and gave bleeding could not be avoided in the patient .
complications of portal hypertension or cirrhosis should be carefully monitored and promptly managed during the follow - up in portal biliopathy patients . in conclusion , when a patient with portal hypertension and prominent extrahepatic collaterals experiences jaundice , fever , and abdominal pain , portal biliopathy should be considered in the differential diagnosis .
once portal biliopathy is confirmed , the treatment plan should be established according to each patient s clinical symptoms and disease status .
however , this treatment is limited since it does not radically resolve primary portal hypertension and complications of hepatic decompensation .
Output:
| portal biliopathy is defined as abnormalities in the extra- and intrahepatic ducts and gallbladder of patients with portal hypertension .
this condition is associated with extrahepatic venous obstruction and dilatation of the venous plexus of the common bile duct , resulting in mural irregularities and compression of the biliary tree .
most patients with portal biliopathy remain asymptomatic , but approximately 10% of them advance to symptomatic abdominal pain , jaundice , and fever .
magnetic resonance cholangiopancreatography and endoscopic retrograde cholangiopancreatography are currently used as diagnostic tools because they are noninvasive and can be used to assess the regularity , length , and degree of bile duct narrowing .
management of portal biliopathy is aimed at biliary decompression and reducing the portal pressure .
portal biliopathy has rarely been reported in korea .
we present a symptomatic case of portal biliopathy that was complicated by cholangitis and successfully treated with biliary endoscopic procedures . |
PubmedSumm7802 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: acute interstitial pneumonia ( aip ) is an idiopathic lung disease characterized by rapidly progressive respiratory failure occurring in patients without pre - existing systemic or lung diseases with diffuse alveolar damage histologically ( 1 , 2 ) . since the term " acute interstitial pneumonia " was first introduced in 1986 ( 3 , 4 ) , some reported case reviews of aip ( 4 - 8 ) , with only 2 pediatric case reports ( 3 , 8) .
this is a case report of a 3-yr - old girl diagnosed as having aip from autopsy , whose two other siblings showed the similar radiological findings .
this is the first case report of aip in three children from the same family ; one of them was histologically confirmed , another was clinically and radiologically quite similar , and the other was radiologically suspected as having aip .
a 3-yr - old previously healthy girl presented with progressive dyspnea and chest discomfort . over the preceding 1 week , she had been admitted to a local general hospital for a sudden onset of dyspnea followed by 3 weeks of upper respiratory symptoms , mild rhinorrhea and dry cough without fever .
her 2-yr - old brother showed the same clinical symptoms presented at the same time ; however , she did not have any other known familial history of certain disease .
there was no evidence of systemic infection , immune suppression , exposure to toxic agents , pre - existing lung disease , or collagen - vascular disease . on physical examination
she showed tachypnea ( respiratory rate 48/min ) and chest wall retraction , and was requiring 5 l oxygen with face mask .
there were bilateral ground - glass opacification on simple chest radiograph and also bilateral ground - glass attenuation with diffuse alveolar consolidation on chest high - resolution computed tomography ( hrct ) ( fig .
arterial blood gas analysis gave ph 7.40 , pao2 88 mmhg , paco2 46 mmhg , sao2 96% ( 5
l / min of oxygen with face mask ) , and the white blood cell count was 9,330/l with 78% neutrophils .
c - reactive protein was negative , and other chemistry results were all within normal limits .
viral investigations including respiratory syncytial virus , adenovirus , influenza , parainfluenza , cytomegalovirus , ebstein - barr virus , herpes simplex virus , and evaluation for mycoplasma pneumoniae showed negative results .
rheumatoid factor and anti - nuclear antibody were both negative . under a presumptive diagnosis of interstitial lung disease , intravenous antibiotics and dexamethasone were administered . despite these
she presented with severe dyspnea and chest discomfort with pneumomediastinum and subcutaneous emphysema on chest radiograph .
pneumomediastinum was aggravated and resulted in pulmonary hemorrhage . because of ongoing hypoxemia and decreased mentality , endotracheal intubation was performed at 13th hospital day .
the patient died on the 14th day of admission after four times of cardiac arrest .
the histopathologic findings on autopsy of the lungs revealed diffusely thickened alveolar septal interstitium by uniform , organizing loose fibrosis and foci of hyaline membranes as well as prominent interstitial and alveolar edema with focal hyperplasia of type ii pneumocytes , which were indicative of organizing diffuse alveolar damage ( dad ) and episodes of acute lung injuries ( fig .
her 2-yr - old brother showed a same clinical course with diffuse bilateral ground - glass opacities on his hrct and also died after 4 weeks of intensive care due to respiratory failure aggravated by pneumothorax and subcutaneous emphysema .
it was unable to undergo any follow - up hrct , lung biopsy , or bronchoalveolar lavage because of his critical condition .
their 8-yr - old sister had no symptoms but underwent hrct for screening , which showed a mild degree of bilateral ground - glass opacities .
her pulmonary function test ( pft ) revealed patterns of restrictive lung disease . however , her follow - up hrct and pft showed improvement after five weeks of oral steroid administration .
in 1944 , hamman and rich initially described four previously healthy patients with fatal fulminant lung disease that , on autopsy , was characterized as extensive pulmonary fibrosis ( 8) . in 1986 , katzenstein and coworkers introduced the term " aip " to describe eight patients characterized by idiopathic interstitial lung disease causing a rapid onset of respiratory failure , which was distinguished from other chronic forms of interstitial pneumonia ( 3 ) .
since then , some reports have reviewed the cases of aip ( 4 - 8 ) , but among them , there were only 2 pediatric cases reports ( 4 , 8) showing a much lower incidence then in adult .
clinical manifestation of aip usually begins with prodromal ' flu - like ' upper respiratory infection symptoms , followed by rapid progression of dyspnea and respiratory failure that requires mechanical ventilation . in our case ,
the patient presented the same clinical course as in the previously reviewed cases ; beginning with mild cough and rhinorrhea , which was aggravated into respiratory failure requiring mechanical ventilation .
most of the cases reported as aip had extensive bilateral air - space opacification with sparing of costophrenic angles on their chest radiograph . as aip moves from exudative to organizing stage
, the radiograph shows less consolidation and presents a ground - glass appearance with irregular linear opacities ( 7 ) .
the most common ct findings in aip patients are diffuse ground - glass attenuation with a mosaic pattern and consolidation ( often in the dependent regions of the lungs ) ( 2 ) . in the early exudative phase ,
the lung shows areas of ground - glass attenuation that are most often bilateral and patchy , with areas of focal sparing of lung lobules giving a geographic appearance .
the later , organizing stage of aip is associated with distortion of bronchovascular bundles and traction bronchiectasis and cysts . in our case
, there was bilateral diffuse consolidation of lungs with peripheral sparing zones on chest radiograph , and chest hrct showed diffuse ground - glass opacities and consolidations with sparing zones in the peripheral portion of each lobe , suggesting the early exudative phase of aip .
this study was performed at the beginning of the patient 's respiratory difficulty , but follow - up hrct was not performed due to the patients critical condition .
even though we could not undergo another follow - up hrct , her chest radiograph showed an increase of bilateral haziness and findings of spontaneous pneumomediastinum and subcutaneous emphysema with bronchiectatic changes , suggesting a progression into the late organizing phase .
her 2-yr - old brother also showed same findings on chest ct , which was aggravated into bronchiectatic changes and pneumomediastinum on his chest radiograph .
their 8-yr - old sister who did not have any symptoms only showed a mild degree of bilateral ground - glass opacities without progression to bronchiectactic changes of lung parenchyma .
the histologic findings of aip include the features of acute and/or organizing phases of dad .
the exudative phase shows edema , hyaline membranes , and interstitial acute inflammation ( 7 ) . in the organizing phase , organizing fibrin , loose organizing fibrosis within alveolar lumens with incorporation within alveolar septa , and type ii pneumocyte hyperplasia are seen ( 2 ) . in this case , the patient underwent autopsy and histologic finings showed hyaline membrane with interstitial edema and proliferation of interstitial fibroblasts suggesting the presence of both acute exudative and late organizing phases .
treatment of aip is usually supportive and initially consists of oxygen supplement and noninvasive mechanical ventilation , but mechanical ventilation with positive - end - expiratory pressure is required in most patients .
patients are often treated with corticosteroids , which may improve the outcome as in patients with adult respiratory distress syndrome ( ards ) ( 1 ) .
treatment with newer agents such as surfactant , anti - cytokine antibodies , and inhaled nitric oxide traditionally used for ards , might be beneficial but are largely untested ( 3 ) .
however , we did not use any newer agents other than corticosteroids in this case . even though corticosteroid was not effective in two patients who died of aip , it was effective in their asymptomatic older sister who had an incidental finding of ground - glass opacities on chest ct .
her chest ct and pft findings were improved after administration of oral steroid agent . despite occurring in previously healthy persons ,
aip is associated with a poor prognosis ( 5 ) . according to a review of patient characteristics in the published series of aip by bouros et al . in 2000 , the mean 6-month mortality of patients with aip was 78% ( range , 60 - 100% ) ( 1 ) .
olson et al . reported a 41% survival rate from 29 patients ( 1 ) , two other small published series , total 2 of 13 patients survived ( 3 , 9 ) .
the prevalence of aip in childhood is rare , and only two cases of aip have been previously reported ; one of them survived after intravenous antibiotics and corticosteroid treatment ( 8) , and the other died on 40th day of admission ( 3 ) . in this case , the patient showed the same clinical course and radiologic , histologic findings as the previously reported aip cases in adults .
notably , two other siblings , her 2-yr - old brother and 8-yr - old sister , also showed the similar radiologic findings indicative of aip , even though they had some different degrees of symptoms and destruction of lung parenchyma . considering the coincidence in three children
however , we did not perform any genetic studies such as surfactant protein b and c. on the other hand , we could not exclude the possibility of an infectious origin , although the studies for infection were all negative . in summary , this rare case of aip in children gave us a chance to review the clinical course , radiologic and pathologic findings of aip in children , which showed no significant difference from those of adult cases in the literature ( 1 , 2 , 7 , 10 ) .
furthermore , we first experienced three different phases of aip in one family : one clinically , radiologically , and histoloically confirmed aip ; another clinically and radiologically highly suspected as having aip ; and the other only radioloically suspected as having aip .
Output:
| acute interstitial pneumonia ( aip ) is a rapidly progressive condition of unknown cause that occurs in a previously healthy individual and produces the histologic findings of diffuse alveolar damage .
since the term aip was first introduced in 1986 , there have been very few case reports of aip in children . here
we present a case of aip in a 3-yr - old girl whose other two siblings showed similar radiologic findings . the patient was confirmed to have aip from autopsy showing histological findings of diffuse alveolar damage and proliferation of fibroblasts .
her 3-yr - old brother was also clinically and radiologically highly suspected as having aip , and the other asymptomatic 8-yr - old sister was radiologically suspected as having aip . |
PubmedSumm7803 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: after more than 50 years of experience penicillamine remains the most effective treatment for patients with wilson disease for which there is ample evidence [ 1 , 2 ] .
however it also has a wide variety of toxicities , most of these can be explained in terms of chemical or immunological reactions .
the present theories are unsatisfactory and this paper proposes a new hypothesis for the neurotoxicity of penicillamine which , if correct , may lead to the introduction of a predictive test which will be of great value in deciding whether or not this drug can be used as an initial therapy . in 1948 ,
when he established the role of copper in the pathogenesis of wilson disease , cumings put possible therapy on a sound scientific basis by suggesting that the chelating agent bal , british antilewisite , might be beneficial in the management of this disease by removing the excess copper .
this hypothesis was later supported by his own observations and those of denny brown and porter in boston .
later denny brown appeared to have abandoned the copper theory in favour of uzman 's hypothesis that the disease was due to an abnormality of peptide metabolism and that copper was merely deposited as a secondary phenomenon in dying neurones [ 68 ] .
how denny brown was able to continue to propagate the use of bal as an effective therapy in view of his theories on pathogenesis remains unclear .
however the peptide theory was finally disproved by asatoor milne and walshe when they showed that there were no abnormal peptides in the urine of wilson disease patients and that the abnormal aminoaciduria could , in most cases , be corrected by treatment with penicillamine .
when , in 1956 , i proposed that penicillamine might be of use as a chelating agent for copper removal virtually nothing was known of its potential toxicity except that the l - isomer , when fed to ethanolamine deficient rats , caused loss of weight .
as the isomer liberated from penicillin is the the d isomer this did not seem relevant .
i speculated on its potential toxicity and pointed out that as this aminoacid , in the d form , was present in the urines of all patients treated with penicillin it was therefore unlikely to have any immediate toxic effects and supported this by safely taking a gram myself .
however the possibility of long - term toxicity had to be considered and i suggested dimethyl cysteine ( penicillamine ) might enter into the same metabolic pathways as cysteine and thereby cause a block .
occurring in the liver a metabolic block might lead to a conditioned cysteine deficiency and hepatic necrosis .
although a small number of patients have complained of excessive hair loss there have been no reports of total alopecia and hepatic necrosis also has not been reported . in practice , with increasing time of dosage and increasing number of patients treated , a wide spectrum of toxicities have been reported .
however , before any serious side effects were recorded came the report in 1963 and that penicillamine formed a mixed disulphide with cysteine and that this could be used for the treatment of another , unrelated metabolic disease , cystinuria and hartley and walshe were able to show that half the penicillamine excreted in urine was in this form . the first serious side effect to be reported was the nephrotic syndrome and this led directly to the development of trientine as an alternative orally active chelating agent .
as penicillamine toxicity became more of a problem the subject was dealt with in some detail in four symposia , 1968 , 1974 , , 1977 , and 1981 , held on this drug .
these can be best summarised in a diagram of 1985 , ( figure 1 ) . in the 1981 symposium i pointed out that penicillamine toxicity can be resolved into chemically and immunologically mediated reactions .
chemical toxicity is dose dependent and , if the drug is withdrawn in time , readily reversible .
for instance the skin lesions , cutis laxa , elastosis perforans , and epidermolysis can be explained in terms of the action of penicillamine on the copper - dependent enzyme lysyl oxidase which mediates collagen cross - linkage .
similarly the ability of this drug to cause pyridoxine deficiency results from its ability to form a thiazolidine with the vitamin .
although , in fact , d - penicillamine has only a very weak action compared with that of the l isomer .
much more serious are the immune reactions , such as sle , the nephrotic syndrome , goodpasture syndrome , and ehlers danlos syndrome and these all require immediate drug withdrawal .
a few toxicities remain unexplained , for example , the very rare mammary gigantism and the immediate and rapid increase in any or all of the neurological signs already present , whether they be dystonic , parkinsonian , or pseudosclerotic , once treatment has been started .
the latter is serious and may leave the patient severely disabled or even prove fatal if treatment is not stopped immediately .
walshe and yealland found this in 11 of 137 patients with predominantly neurological signs .
it has been suggested that this complication is due to the sudden release of ionic copper but this would seem unlikely as the copper so released is penicillamine bound and should be nontoxic . one possible mechanism has been suggested by miki however copper - penicillamine chelates are effective in catalyzing the oxidation of ghost membranes , which may be due to favourable alterations in the redox potential of copper .
this acceleration of penicillamine may explain the initial aggravation of neurological symptoms often observed with its use .
another possible aggravating factor is the low level of urate found in the plasma following the renal leek of this metabolite as this has antioxidant properties . in support of this is the observation that patients with parkinson 's disease have a slower progression of their disease if the have higher serum and cerebrospinal fluid urate levels .
i have suggested an alternative explanation that in these patient there is a particularly unfavourable mutation , or combination of mutations .
since most patients are compound heterozygotes and as there are approximately 300 mutations on the affected gene , a p - type atpase , it becomes difficult or almost impossible to prove , or disprove this hypothesis . in view of the importance of this aspect treatment
it would be advantageous to find a predictive test which could be used before embarking on any particular line of treatment .
i propose the following theory , this as example of what rudolph peters called lethal synthesis , that is a nontoxic compound , is changed , by enzyme action in the body , into a toxic one .
suppose that patients who react by a sudden neurological deterioration on starting treatment with penicillamine convert or break down the molecule into a powerful enzyme inhibitor .
normally penicillamine is either excreted unchanged or as the disulphide or as the mixed penicillamine - cysteine disulphide .
using radiolabelled penicillamine i found no evidence of other breakdown products in either the patient studied or in a normal control .
however if the sh group is removed from the molecule a free sh radical or h2s , both highly toxic , might be released into the circulation and could prove powerful inhibitors of sh dependent enzymes in the krebs cycle , as also would other possible breakdown products , methyl mercaptan ( ch3sh ) , and ethyl mercaptan ( ch3ch3sh ) .
sudden inhibition of energy production by glucose oxidation would certainly prove disastrous to the cns as neurons , especially those already damaged by copper , are heavily dependent on energy production from glucose .
the removal of the sh alone would leave valine , an alternative name for penicillamine is thiovaline , a normally occurring amino acid , as an end product of this reaction .
this leaves a possible test for this reaction the molecular weight of penicillamine is 149 , that of valine 117 .
it follows that if a test dose of 1 gm of penicillamine be given to a patient and if all the sh were to be rapidly removed from the molecule this would leave 785 mg of valine in the circulation .
thus if an increase in plasma or urine valine levels was to be detected , this might provide a valuable test for identifying those patients particularly vulnerable to this form of penicillamine toxicity .
an alternative approach would be to look for the appearance of the sh compounds , hypothesised above , in plasma .
another possible reaction has also been suggested that if rs - radicals of penicillamine react with protein disulphide bridges with resultant formation of trisulphides , irreversible damage might be done .
r + rssr or by a sequence of reactions trisulphide formations in proteins will exchange with the tertiary structure and in many cases would be harmful .
thus although penicillamine scavenges free radicals efficiently and repairs alkyl radicals rapidly , the thiyl radicals formed may not be harmless .
if lethal synthesis explains this rare aspect of penicillamine neurotoxicity it does not necessarily explain the toxic reactions of other treatments , though it might be applicable to trientine it can not be relevant to deterioration noted with zinc or tetrathiomolybdate where other mechanisms must be involved .
Output:
| penicillamine , dimethyl cysteine , thiovaline , remains the drug of choice for the treatment of patience with wilson disease .
it is also of value in the treatment of cysteinuria and rheumatoid
arthritis , it has also been suggested that it has value in the management of other rare diseases
. it also has multiple toxicities .
the majority of these can be explained as chemical toxicity , for instance its weak antipyridoxine action and its ability to interfere with lysyloxidea resulting in skin lesions .
more important are its ability to induce immune reactions such as sle , immune complex nephritis , the ehlers danlos syndrome and goodpasture 's syndrome .
however the sudden increase in neurological signs which may occur in a small number of patients remains unexplained .
the theory is proposed that this is due to
lethal synthesis . in susceptible patients
the sh radical is liberated from penicillamine and will inhibit sh dependent enzymes in the krebs cycle leading to death in neurones .
other
toxic metabolites may also be produced such as methyl mercaptan and ethyl mercaptan either of which could produce a similar metabolic block . |
PubmedSumm7804 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: however , fractures of the pelvis constitute up to 23% of admissions to level i trauma centers .
similar to adults , octogenarians have pelvic fractures that can be associated with high - energy trauma and injury to other physiological systems that may lead to an increased incidence of complications and mortality . multiple fractures and
organ damage may occur with low velocity injury because of the osteoporotic nature of the octogenarian skeleton and the increased association with chronic comorbidities and sarcopenia [ 2 , 3 ] .
thus , an elderly person presenting with a pelvic fracture should be evaluated early for having a multiorgan injury with an increased potential for harm , complications , and death .
previous studies on octogenarian pelvic fractures analyzed the elderly population as a whole , including both the elderly ( 6579 years old ) and the octogenarians ( 80 years old ) [ 1 , 4 ] .
low velocity injuries in the elderly have been the focus studies that evaluated patients with osteoporosis and pelvis fractures [ 57 ] .
patients older than 80 comprise a period of life that is fraught with multiple comorbidities that are managed by their primary care physician .
decline in the reproductive , cardiovascular , and skeletal systems , as well as alterations in body composition during this stage of life , can often contribute to varying responses to injury [ 3 , 8 ] .
physiological changes in the elderly lead to a theoretical decreased ability to withstand the effect of traumatic injury .
physiologic changes include a decrease in weight , lean body mass , muscle size , and bone mass .
moreover , there is a decrease in blood pressure , blood volume , hematocrit cardiovascular , and lung vital capacity .
thus , depending on the placement of an elderly person on the physiological curve , he or she may respond to trauma differently than an adult . the authors hypothesized that octogenarian patients with pelvic fractures have a higher risk of complications and mortality as compared to younger elderly and adult patients after admission to a trauma center .
because of the relative rarity of high velocity pelvic fractures in elderly and octogenarian patients , data was collected from the national trauma data bank ( ntdb ) .
we identified the study populations that were entered into the national trauma data bank ( ntdb version 7.1 ) .
there were over 2.7 million patient records from the years 2002 to 2006 that were entered into the ntdb .
the ntdb contains patient data compiled from medical records before , during , and after admission .
this information is submitted to the american college of surgeons for quality control and maintenance .
the ntdb reports all injuries by using the international classification of diseases , 9th revision , clinical modification ( icd-9-cm ) diagnostic codes .
the data was imported and merged into a single dataset from the 13 ntdb files using sas version 9.2 ( sas institute , cary , nc ) .
abbreviated injury scale ( ais ) scores for lower extremities were linked to a pelvic fracture code ( see later ) . linking to the pelvic fracture code ensured that ais values were recorded for only pelvic injuries .
for the purpose of this study , all burn or penetrating injuries were excluded reducing the group to1.7 million patients . if a patient 's multiple icd-9 dcode ( diagnosis codes ) entries contained at least one of the following codes , the patient was considered to have a pelvic fracture : 808.2 , 808.3 , 808.4 , 808.41 , 808.42 , 808.43 , 808.49 , 808.5 , 808.51 , 808.52 , 808.53 , 808.59 , 808.8 , and 808.9 .
acetabular fractures were excluded from the study . if the icd-9 codes were 808.2 , 808.41 , 808.42 , 808.43 , 808.49 , or 808.8 , the pelvic fractures were closed pubis , ilium , ischium , multiple , other , or unspecified , respectively .
if the icd-9 codes were 808.3 , 808.51 , 808.52 , 808.53 , 808.59 , or 808.9 , the pelvic fractures were open pubis , ilium , ischium , multiple , other , or unspecified , respectively .
those entries without a pelvic fracture were removed , giving a total of 54,459 patients with pelvic fractures . in order to analyze the elderly population and compare it to the adult population , children aged 17 years and younger were excluded yielding a study population of 45,081 patients .
this final study population was subdivided into octogenarian , defined as all patients older than 79 years , elderly , defined as ages 65 to 79 years old , and adults , defined to be ages 18 to 64 years old .
this subdivision was performed because of many previous studies that evaluated strength , performance , and outcomes in groups younger or older than 80 years old [ 1013 ] .
a severe complication was defined as having renal failure , acute respiratory distress syndrome ( ards ) , or a pulmonary embolism recorded in the ntdb .
analysis of prehospital risk factors was considered to determine the association with the main outcome variables of mortality and severe complications .
these risk factors included sex , race , age , arrival in shock ( systolic blood pressure less than 90 mmhg ) , head injury ( a positive head computed tomography ) , injury severity score ( iss ) , and mechanism of injury .
descriptive statistics were performed on the entire study population . to determine associations between risk factors and the main outcomes of interest
, bivariate analysis was conducted between the main end points and each pre - hospital risk factor .
for example , iss became greater than or equal to 16 and less than 16 .
for this assessment , open fractures and unknown mechanisms of injury were excluded , yielding a study group of 31,475 .
a subpopulation of severe pelvic injuries was also created to determine if any octogenarian subgroup has better outcomes . for this population , an ais of less than 3 and all patients with lower extremity fractures besides pelvic fractures were excluded .
this created a study subgroup of 3,101 patients with isolated severe pelvic fractures . for both the main study population and the subgroup of severe pelvic injury , prehospital risk factors were determined to be significant using the mantel - haenszel test .
this method produced crude odds ratios and 95% confidence intervals , and those variables of significance were included for multivariate analysis .
mechanism of injury was not included in the final multivariate analysis due to the inconsistency and unreliability of the data . logistic regression analyses including those variables deemed to be of significance
were performed to determine the association between the prehospital risk factors and the two main outcomes ( death and severe complication ) .
in order to assess the importance of age and outcome after sustaining a pelvic fracture , each model included a specific age group ( octogenarian or elderly ) as compared to adults as referent . the hosmer - lemeshow goodness - of - fit test was performed on each model to determine whether or not the observed event rates matched the expectant event rates .
descriptive statistics of demographics , injury mechanism , injury severity , treatment , and complications are presented in table 1 .
the study population was divided into octogenarian of more than 79 years of age ( n = 5 , 647 ) , elderly between the ages of 65 and 79 ( n = 6 , 408 ) , and adults between the ages of 18 and 64 ( n = 32 , 660 ) .
adults had more males ( 61.1% ) than the elderly ( 40.9% ) or octogenarian ( 24.1% ) groups .
most of the individuals were reported to be caucasian ( 75.5% ) , with hispanics ( 8.7% ) and african americans ( 8.3% ) being the next largest ethnic groups .
there was a marked increase in the percent of caucasian patients in the octogenarian group ( 90.2% ) relative to the adult group ( 71.1% ) .
for the total population , the survival rate after sustaining a pelvis fracture was 90.0% .
when separated by age group , adults with pelvis fractures had the best survival ( 91.2% ) .
the elderly and octogenarian with pelvis fractures had worse survival relative to adults ( 86.6% and 86.8% , resp . ) .
the elderly had the highest percentage of complications ( 16.2% ) relative to adults ( 11.4% ) and octogenarians ( 14.5% ) .
the percent of patients that survived by age group for the whole population is presented in figure 1 .
most of the pelvic fractures were closed ( 96.4% ) . however , open fractures occurred in 4.5% of adults and only 0.7% of octogenarian patients .
pubic rami fractures had the highest prevalence ( 42.7% ) , with the octogenarian patients having the highest percentage ( 48% ) relative to the elderly ( 44.7% ) and adults ( 41.4% ) .
the most common known mechanism of injury was motor vehicle accident ( 34.8% ) , with low - energy fall ( 15.6% ) and high - energy fall ( 10.8% ) following .
as expected , the octogenarian patients had a high rate of low energy falls ( 49.6% ) relative the elderly ( 32.6% ) and adult ( 6.3% ) patients .
a large percentage of the population had no mechanism of injury reported ( 27.8% ) .
these individuals were excluded from the final analysis if it included the mechanism of injury . in terms of injury severity score ( iss ) , most patients had a score less than 16 ( 52.1% ) .
when divided by age , more octogenarian patients ( 76.7% ) had an iss less than 16 compared to elderly ( 62.0% ) or adults ( 45.9% ) . in terms of hemodynamic instability on arrival , the octogenarian group had a higher percentage of patients with systolic blood pressure ( bp ) greater than 140 mmhg ( 49.5% ) compared to the elderly ( 40.9% ) and the adults ( 25.9% ) .
the increase in blood pressure in octogenarians may be due to comorbid conditions previous to admission .
for adults , elderly , and octogenarians , the rate of bp less than 90 mmhg was similar ( 16.5%17.1% ) .
variables that were found to be significant in the bivariate analysis were included in the final multiple logistic regression models for death and severe complication as outcomes using predictors upon arrivals to the emergency room .
adjusted odds ratios and 95% confidence intervals are presented in table 2 . as compared to the adult population ,
the elderly had 2.35-fold increase in odds of death ( 95% ci : 2.102.62 ) and 2.19-fold higher odds of severe complications ( 95% ci : 1.982.42 ) .
holding other variables constant , octogenarians had 3.60-fold higher odds of mortality ( 95% ci : 3.194.04 ) and 2.87-fold higher odds of complications ( 95% ci : 2.573.21 ) relative to adults . sustaining a head injury had a 1.62-fold increase in the odds of death ( ci : 1.421.84 ) and 1.59-fold higher odds of complication ( 95% ci : 1.411.79 ) .
an iss of greater than or equal to 16 increased the odds of death and complications to 10.4- ( 95% ci : 9.2611.7 ) and 9.54- ( 95% ci : 8.2610.60 ) fold , respectively .
a subgroup analysis was performed for patients determined to have a serious , isolated , and closed pelvic injury ( ais 3 ) .
table 3 demonstrates the descriptive statistics for this subpopulation ( n = 3 , 101 ) .
for the variables survival and severe complication , adults survived slightly more ( 94.2% ) than the elderly population ( 92.4% ) and more than the octogenarian population ( 90.3% ) .
however , there were more severe complication rates in the elderly ( 11.0% ) and octogenarian ( 11.7% ) relative to the adult group ( 8.0% ) .
the most common mechanism of injury was low velocity fall for the octogenarian population ( 56.2% ) and the elderly population ( 45.4% ) . however , the most common mechanism of injury for the adult population was motor vehicle accident ( 55.8% ) .
similar to the whole population , the severe pelvic injury group demonstrated more octogenarian patients with an iss less than 16 ( 78.0% ) . in terms of hemodynamic instability on arrival ,
octogenarian patients had the highest percentage of patients with systolic blood pressure greater than 140 mmhg ( 52.5% ) .
the percentage of patients that survived and stayed in the hospital less than one week was largest in octogenarians ( 71.1% ) relative to elderly ( 57.7% ) and adults ( 52.7% ) .
by contrast , the octogenarian patients that survived had the highest rate of icu stay less than one week ( 93.4% ) relative to the adults ( 88.8% ) and the elderly ( 87.0% ) .
the severe pelvic fracture subpopulation data was analyzed using bivariate analysis ( table 4 ) .
individuals that suffered from hypovolemic shock , head injury , or iss 16 , had an increase in odds of death and severe complications .
of all the reported mechanisms of injury , motor vehicle accident had 2.28-fold increased odds of death ( 95% ci : 1.703.07 ) and 2.17-fold higher odds of severe complications ( 95% ci : 1.682.80 ) .
low energy falls had decreased odds of death ( or : 0.16 , 95% ci : 0.100.30 ) and severe complications ( or : 0.21 , 95% ci : 0.120.35 ) .
variables that were found to be significant in the bivariate analysis were included in the final multiple logistic regression models for death and severe complication as outcomes ( table 5 ) . when controlling for pre - hospital conditions and using the adult group as a referent , the octogenarian group had 4.7-fold higher odds of death ( 95% ci : 2.987.34 ) and 4.57-fold higher odd of complications ( 95% ci : 3.016.96 ) after sustaining a pelvic fracture .
moreover , the elderly had 1.81-fold increase in odds of death ( 95% ci : 1.162.80 ) and 2.18-fold increased odds of severe complications ( 95% ci : 1.493.19 ) after sustaining a serious pelvic fracture . in this model ,
an iss of greater than 16 yielded 15.1-fold increased odds of death ( 95% ci : 8.7626.61 ) and 18.3-fold increase in severe complications ( 95% ci : 11.229.9 ) .
hypovolemic shock also had 7.65-fold increase odds of death ( 95% ci : 5.4510.7 ) and 6.31-fold higher odds of severe complications ( 95% ci : 4.608.66 ) .
this study found increased odds of complications and mortality in the octogenarian population with pelvic fractures as compared to younger elderly patients and adults .
multivariate logistic regression analysis showed that octogenarians had a large increase odds ratio of death even though the mechanisms of injury and iss were less severe compared to adults .
the management of elderly and octogenarian patients with pelvis fractures is fraught with increased mortality relative to their adult counterparts .
the numbers of patients older than 80 years are increasing , and they are enjoying a more active lifestyle . in light of their increased fragility and decreased reaction times , it is likely that they will continue to have an increase in the incidence of severe traumas [ 1 , 14 , 15 ] .
moreover , 69% of patients older than 65 years of age have increased comorbidities on admission to the trauma center relative to their younger adult counterparts .
there are few studies that evaluate the outcomes of elderly patients with pelvis fractures [ 47 , 1721 ] .
this study differs from previous studies regarding pelvic fractures in the elderly population by considering the octogenarian ( 80 years old ) and young elderly ( 6579 years old ) populations in the united states that were admitted to trauma centers as separate groups .
we have analyzed records gathered from the ntdb regarding pelvis fractures to characterize the risks of mortality and complications in 6,408 elderly and 5,647 octogenarians and compared them to 32,660 adults .
analysis of the data illustrates that relative to adults , octogenarians , more than elderly patients , had an increased odds ratio of mortality and severe complications .
commensurate with other research , this study found that for the total population with pelvic injuries admitted to trauma centers , hypovolemic shock , head injury , iss 16 , and higher velocity mechanisms of injury have an increased risk of death . in this study , and commensurate with other studies , low velocity falls were the most common mechanism of injury for elderly ( 30% ) and octogenarian ( 50% ) patients with pelvis fractures . in a study that surveyed
falls in patients older than 65 , injury with iss greater than 15 occurred in 32% of the elderly versus 15% in the young .
moreover , they found that 27% of elderly patients and 14% of young patients had ais scores attributed to the pelvis .
the conclusion was that it could take lower velocity trauma in elderly patients to cause high severity injuries . however , in a study examining age - related outcomes that stratified patients who sustained blunt pelvic injury into more or less than 55 year old , the elderly and young had the same mechanism of injury that brought them to that tertiary care facility .
overall , there was 10.4-fold increased odds ratio for the risk of death if the iss was 16 .
there were lower velocity mechanisms and a smaller percentage of patients with iss 16 in both the elderly ( 38.0% ) and octogenarian ( 23.3% ) relative to adults ( 54.1% ) . despite lower energy mechanisms and iss , multivariate logistic regression analysis for
the entire population showed that being an octogenarian had 3.6-fold increase in odds ratio of death relative to the adult population .
moreover , elderly patient 's odds ratio of death was 2.35-fold higher relative to the adult population .
patients with pelvis ais 3 were analyzed for complications and were associated with hypovolemic shock , head injury , and iss 16 .
more specifically , adults with ais 3 survived slightly more ( 94% ) then elderly ( 92% ) and octogenarians ( 90.3% ) .
the rest of the surviving octogenarian population had minimal complications and a decreased hospital length of stay relative to the elderly and adults . when analyzing the average percent survival relative to age , the trend was for decreasing in survival as age increased .
more specifically , as patient 's ages increased from 18 to 89 years , there is approximately a 1% decrease in survivorship per 10 years .
that is , pelvic fracture patient survival decreases from 92.5% at age 20 to 85.5% at age 88 .
the elderly and octogenarian patients had less surgery relative to the adult population in spite of a higher complication and mortality rate .
this finding was in contrast to recommendations that angiographic embolization should be performed if bleeding into the pelvis is found in the elderly patient regardless of haemodynamic instability .
regarding hospital stay , we found that the elderly population that survived had a shorter hospitalization relative to their adult counterparts .
this may be explained by the fact that the overwhelming number of elderly and octogenarian patients had pelvis fractures as a result of low velocity injuries .
moreover , these results underscore the importance of osteoporosis therapy in the prevention of pelvic and other osteoporotic fractures in the elderly and octogenarian populations .
the main strengths of the current study are that this is the largest cohort of elderly and octogenarian patients with pelvis fractures under investigation .
moreover , the representations of more than 900 academic and nonacademic centers of various trauma designation levels provide broad generalizability .
the national trauma data bank is a convenience sample that contains data entered by many contributing united states hospitals and is not a total population database .
another limitation was that since the ntdb does not code separately for pelvic ais , the pelvic ais score was computed by excluding all patients with other lower extremity injuries from the lower extremity ais score .
however , this allowed the comparison of similar injuries and to better isolate the effect of age
. finally , there could be interaction between variables that were not included in the model .
these variables might not have been collected by the ntdb or may be latent factors not identified . such discrepancies may have altered the final parameter estimates by either inflating or deflating their values .
one potential limitation of the study is that we did not compare the comorbid conditions of the study sample to the entire ntdb .
however , in a canadian study , the authors found that more than 90% of octogenarians admitted to the emergency room with pelvis fractures had medical comorbidities .
however , we do not have similar data on the younger age group of patients and therefore could not include this information in this study .
another potential limitation of the study is that we did not include severe bleeding as a severe complication .
this parameter is a cause of hemodynamic shock , but it is difficult to quantify and accurately report in a dataset like the ntdb .
other limitations may include the fact that body mass index ( bmi ) can be a factor in the development of pulmonary embolism but may be protective of mortality in patients with pelvis fractures [ 17 , 26 ] .
this data was not sufficiently present to include in our prediction models . in conclusion ,
the results of this study illustrate that the patients older than 80 years with pelvis fractures have a much higher mortality and complications rate than patients younger than 80 years old .
these results emphasize the need for continued focus and study of the elderly patient with a pelvis fracture .
Output:
| purpose .
this study examined whether octogenarians and elderly patients with pelvic fractures have a different risk of complication and mortality as compared to adults . methods .
data was gathered from the national trauma data bank from 2002 to 2006 . there were 32,660 patients 1865 , 6,408 patients 6579 , and 5,647 patients 80 years old with pelvic fractures .
descriptive statistics and bivariate and multivariate analyses were performed with the adult population as a referent .
results .
multivariate analysis showed 4.7-fold higher odds of death and 4.57 odds of complications in the octogenarian group after a pelvic fracture compared to adults .
the elderly had 1.81-fold higher odds of death and 2.18-fold higher odds of severe complications after sustaining a severe pelvic fracture relative to adults .
an iss 16 yielded 15.1-fold increased odds of mortality and 18.3-fold higher odds of severe complications .
hypovolemic shock had 7.65-fold increased odds of death and 6.31-fold higher odds of severe complications . between the ages of 18 and 89 years
, there is approximately a 1% decrease in survivorship every 10 years . conclusions .
this study illustrates that patients older than 80 years old with pelvis fractures have a higher mortality and complications rate than elderly or adult patients . |
PubmedSumm7805 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: it can save lives ( both mother and child ) in the event of serious complications.1 the debate about the ideal cs rate is ongoing and shows no sign of abating.19 whereas in the past the discussion revolved largely around medical issues and whether or not cs could be justified , the question of the woman s right to choose her own mode of delivery without a medical indication has now taken center stage.10,11 this right to cs is an extension of the a child if i want , when i want , and with whom i want view which some see as the rights of women with regard to their own bodies .
however , others believe that women who request a cs are victims of overmedicalization or the influence of doctors who can no longer bear the screams and sweat of a delivery room and prefer a more rapid and lucrative cs.10,1214 the woman s right to choose her delivery method has been a matter of debate , mostly in countries with a high cs rate . in other countries , such as those in sub - saharan africa , where the cs rate is less than 2% , improving accessibility is a priority . how can low cs rates be explained in these settings ?
however , some authors1518 also point to the importance of social acceptability of cs by women and their families in sub - saharan africa .
they see cs not only as an inability or failure of the woman to deliver vaginally15 but also as a threat to the family s financial stability.1921 those involved in maternal health programs need to understand women s perceptions of cs so as to overcome existing barriers ( eg , through reduction of the direct costs of cs or improved transport to a referral hospital ) and see their efforts come to fruition .
the objective of this paper was to explore women s experience with and perception of cs in burkina faso and the social and economic implications of cs within the household .
we conducted a qualitative study using focus groups and individual semistructured interviews ( supplementary material ) .
this study was part of a larger multidisciplinary action research project ( aquasou)22 aiming to improve the quality of and access to emergency obstetric care in the health district of bogodogo , burkina faso .
it was based on the coordination and synergy of three complementary approaches , ie , public health , social anthropology , and political and social mobilization .
bogodogo district is one of five districts in the center health region and covers a population of approximately half a million people , of whom 67% are from rural areas .
the district comprises 41 first - level facilities ( public and private ) which refer complicated cases to the district hospital .
the district hospital in bogodogo has 57 beds for pediatrics , surgery , medicine , maternity ( 24 beds ) , an outpatient clinic , a laboratory , and a medical imaging unit ( radiography and ultrasound ) .
the operating theater opened on august 1 , 2003 , but emergency obstetric surgery has only been possible for 24 hours on 7 days a week since october 1 , 2004 .
admissions to the maternity ward ( operational since november 2001 ) have increased rapidly , doubling in number between 2002 and 2005 ( from 2,053 to 4,182 ) . in 2004 ,
the hospital performed 193 cs versus 506 in 2005 and 735 in 2009 . the interviews and
focus groups were conducted 10 years ago when the hospital was increasing its cs offer but out - of - pocket expenditure was still high .
no exemption system was in place in 2003 and 2004 to decrease the financial burden to the household .
in 2005 , the district initiated a cost - sharing system to decrease the direct household costs for a cs from 74.000 cfa ( us$136 ) to 25.000 cfa ( us$46 ) .
in late 2006 , the government launched a national subsidy for delivery and emergency obstetric care so as to cover 80% of the direct costs , and the direct costs of cs were officially reduced to 11.000 cfa ( us$22 ) .
these women s views on cs can be considered as a baseline prior to introduction of the national subsidy . given that some research teams are now evaluating the impact of exemption policies on the perception of cs in west africa
, this paper will allow comparison before and after the introduction of an exemption policy for obstetric services .
a team of one anthropologist and one health provider ( midwife or theater nurse ) conducted home visits for patients who underwent a cesarean birth at bogodogo district hospital in ouagadougou .
a health care provider was added to the research team following a situational analysis conducted during the first year of the aquasou project that demonstrated a lack of health provider knowledge of patients social conditions.23 the objective of the home visits was two - fold : the first was to collect the women s experience of cesarean birth and second to open the eyes of health care providers by observing the women s living conditions and listening to their testimonies and individual perceptions of care .
the expected outcome of the second objective was an improvement in relationships between health care providers and patients .
only the maternity ward staff took part initially , but operating theater personnel subsequently came on board .
thirty - five of 112 women who underwent cs in the operating theater between september 2003 and september 2004 were visited in their homes .
one of the anthropologists proposed a home visit to the women before they left the facility , and most agreed after consultation with their husbands .
the exact address of the household and ( if applicable ) a mobile phone number were then recorded by the researcher to ensure location of the home .
interviews were conducted in moore ( the national language ) and written notes were taken by the interviewer .
after each visit , a report was drafted in french by the interviewer and he / she was expected to provide feedback to his / her colleagues during a subsequent team meeting . in february 2004 , five focus groups were conducted with women who attended various maternity wards in the health district of bogodogo ( four urban facilities and one rural facility ) .
these focus groups collected data to assess the perceptions of cs by women in the community .
home interviews were embedded in the action research and served as an exploratory phase to prepare for user - provider meetings in the second part of the project .
each group consisted of about 15 women , which allowed us to look into the subject in greater depth .
the composition of the groups was determined during antenatal consultations in the four urban facilities and one rural facility .
the activity was proposed to the women , and if they accepted , details , days , and hours of the discussion were given .
the first objective was to collect data on women s perception of pregnancy , childbirth , and associated problems , including the different views on social support received during pregnancy , ie , who are the people involved in the financial expense of pregnancy and childbirth .
the women were asked whether they were satisfied with the care they received and what they would like to see changed regarding access to and organization of the facilities they used .
the second objective was to secure input for the next step , which was organization of user - provider meetings to improve the quality of care .
these focus groups allowed the project s promoters to identify the main touchy or problematic issues from the women s perspective to be discussed with the providers , eg , informal payment and lack of communication .
individual home visit interviews and discussions in the user focus groups were conducted in moore ( the national language ) , audio - recorded , and transcribed into the french language using microsoft word .
a content analysis was undertaken manually according to the analysis methodology of qualitative data.24,25 no software was used .
the authors first read all the interviews to identify the different themes , and each interview was then analyzed according to the themes identified during the first round of reading .
the results were triangulated by the two social anthropologists ( fo and sz ) . permission to perform the aquasou action research and its different nested studies was obtained from the ministry of health of burkina faso ( ms / sg / dgsp / dsf/27.02.2002 ) and the regional directorate of the health center region .
ethical regulations regarding participant consent and treatment of the data were followed according to the tenets of the declaration of helsinki .
bogodogo district is one of five districts in the center health region and covers a population of approximately half a million people , of whom 67% are from rural areas .
the district comprises 41 first - level facilities ( public and private ) which refer complicated cases to the district hospital .
the district hospital in bogodogo has 57 beds for pediatrics , surgery , medicine , maternity ( 24 beds ) , an outpatient clinic , a laboratory , and a medical imaging unit ( radiography and ultrasound ) .
the operating theater opened on august 1 , 2003 , but emergency obstetric surgery has only been possible for 24 hours on 7 days a week since october 1 , 2004 .
admissions to the maternity ward ( operational since november 2001 ) have increased rapidly , doubling in number between 2002 and 2005 ( from 2,053 to 4,182 ) . in 2004 ,
the hospital performed 193 cs versus 506 in 2005 and 735 in 2009 . the interviews and
focus groups were conducted 10 years ago when the hospital was increasing its cs offer but out - of - pocket expenditure was still high .
no exemption system was in place in 2003 and 2004 to decrease the financial burden to the household .
in 2005 , the district initiated a cost - sharing system to decrease the direct household costs for a cs from 74.000 cfa ( us$136 ) to 25.000 cfa ( us$46 ) .
in late 2006 , the government launched a national subsidy for delivery and emergency obstetric care so as to cover 80% of the direct costs , and the direct costs of cs were officially reduced to 11.000 cfa ( us$22 ) .
these women s views on cs can be considered as a baseline prior to introduction of the national subsidy . given that some research teams are now evaluating the impact of exemption policies on the perception of cs in west africa
, this paper will allow comparison before and after the introduction of an exemption policy for obstetric services .
a team of one anthropologist and one health provider ( midwife or theater nurse ) conducted home visits for patients who underwent a cesarean birth at bogodogo district hospital in ouagadougou .
a health care provider was added to the research team following a situational analysis conducted during the first year of the aquasou project that demonstrated a lack of health provider knowledge of patients social conditions.23 the objective of the home visits was two - fold : the first was to collect the women s experience of cesarean birth and second to open the eyes of health care providers by observing the women s living conditions and listening to their testimonies and individual perceptions of care .
the expected outcome of the second objective was an improvement in relationships between health care providers and patients .
only the maternity ward staff took part initially , but operating theater personnel subsequently came on board .
thirty - five of 112 women who underwent cs in the operating theater between september 2003 and september 2004 were visited in their homes .
one of the anthropologists proposed a home visit to the women before they left the facility , and most agreed after consultation with their husbands .
the exact address of the household and ( if applicable ) a mobile phone number were then recorded by the researcher to ensure location of the home .
interviews were conducted in moore ( the national language ) and written notes were taken by the interviewer .
after each visit , a report was drafted in french by the interviewer and he / she was expected to provide feedback to his / her colleagues during a subsequent team meeting .
in february 2004 , five focus groups were conducted with women who attended various maternity wards in the health district of bogodogo ( four urban facilities and one rural facility ) .
these focus groups collected data to assess the perceptions of cs by women in the community .
home interviews were embedded in the action research and served as an exploratory phase to prepare for user - provider meetings in the second part of the project .
each group consisted of about 15 women , which allowed us to look into the subject in greater depth .
the composition of the groups was determined during antenatal consultations in the four urban facilities and one rural facility .
the activity was proposed to the women , and if they accepted , details , days , and hours of the discussion were given .
the first objective was to collect data on women s perception of pregnancy , childbirth , and associated problems , including the different views on social support received during pregnancy , ie , who are the people involved in the financial expense of pregnancy and childbirth .
the women were asked whether they were satisfied with the care they received and what they would like to see changed regarding access to and organization of the facilities they used .
the second objective was to secure input for the next step , which was organization of user - provider meetings to improve the quality of care .
these focus groups allowed the project s promoters to identify the main touchy or problematic issues from the women s perspective to be discussed with the providers , eg , informal payment and lack of communication .
individual home visit interviews and discussions in the user focus groups were conducted in moore ( the national language ) , audio - recorded , and transcribed into the french language using microsoft word .
a content analysis was undertaken manually according to the analysis methodology of qualitative data.24,25 no software was used .
the authors first read all the interviews to identify the different themes , and each interview was then analyzed according to the themes identified during the first round of reading .
permission to perform the aquasou action research and its different nested studies was obtained from the ministry of health of burkina faso ( ms / sg / dgsp / dsf/27.02.2002 ) and the regional directorate of the health center region .
ethical regulations regarding participant consent and treatment of the data were followed according to the tenets of the declaration of helsinki .
women with a cs who were later interviewed were representative of the patients hospitalized for cs in the district hospital ( bogodogo district [ 73% ] and other districts [ 27% ] ) , and all originated from urban or semiurban areas .
their average age was 27 ( range , 2233 ) years , all were married , and had an average of two children at the time of interview .
regarding employment , 38% were employed in the formal sector ( work with an employment contract ) .
women in the focus group originated from urban ( 80% ) or rural ( 20% ) areas , and were aged 1840 years .
most had primary schooling , and were housewives working in the informal sector ( street sellers ) .
almost all women interviewed mentioned the unpredictability of health problems during pregnancy , and felt that no two pregnancies are alike .
. you can be pregnant and it hurts , it hurts all the way until the delivery .
[ member of the patient focus group linked to an urban maternity ward ] childbirths , like pregnancies , are all different , with some being quick and easy , while others are difficult , with women suffering a prolonged labor .
the statement that childbirth is war is found in popular representations of childbirth in nigeria,26 but might just as well be a claim of women in burkina faso .
the method of delivery is also a source of anxiety : you fear that you are between life and death ; some people die in childbirth , or you can give birth and not be healthy .
in addition , you get frightened if you believe you may have to undergo an operation .
[ member of a patient focus group linked to an urban maternity ward ] a 31-year - old woman , who had studied accountancy and underwent cs described her fears when she learnt she had to have the operation : i had pain in my lower abdomen , and i was in the maternity ward .
the midwife asked me to do an ultrasound so she could know the presentation of the baby [ ] .
when i went to the ultrasound , the guy told me what it was going to be ( an operation ) .
he told me no , because it was too low , the baby was stuck and had no room to turn .
[ ] people tell so many things , there is a mystery around it .
[ a woman interviewed at home ] the women s stories generally referred to fears of medical procedures , including cs , as reflected in the statement : once a cs , always a cs ! , highlighting the fear of repetition .
another aspect often mentioned by the women was a lack of information during their antenatal consultations about the possibility of a cesarean birth .
the interviewees regularly referred to their fear of poor and slow healing of the scar after a cs and the resulting physical side effects , eg , back pain and fatigue .
there was intense fear associated with the risk of dying during childbirth , which is probably higher in women who know women who have died during childbirth .
it was serious , she arrived there in the morning , and at 10 pm she had still not given birth .
they told her to push , she did not want to push , she did not push , she tightened her buttocks , until she was referred to the hospital .
they brought her inside , they came out to hand over the baby , they returned inside .
when they returned we saw that they were taking her body to the morgue . seeing
[ member of a patient focus group linked to an urban maternity ward ] for others , fear of cs was related to hearing other people s horror stories and tales of serious consequences , such as paralysis of the lower limbs .
fear of childbirth , and more specifically of cs , is inseparable from the medical , social , and financial implications facing women : if you re going to give birth , you re scared because you do not know how it will happen .
you can get a prescription but the money turns out to be a problem [ ] [ member of a patient focus group linked to an urban maternity ward ] men are expected to meet the obstetric care expenses.27,28 very few women know the cost of their cs .
this fact does not imply negligence on the part of the women , but reflects the distribution of tasks within marriage .
, men may think it indiscrete if a woman asks this type of question . [ ] when you give birth , except your husband , no one else will come and pay the expenses .
even if your husband has no money , he will borrow and has to reimburse later . [ ] if you have given birth , the man must do anything to get the money and come and pay .
[ member of a patient focus group linked to an urban maternity ward ] families are rarely prepared to cover the additional costs of childbirth . in fact , the urgency solves the problem ( when things get hot , we find it [ ] )
. however , there seems to be a gap between the social norm and reality . in urban areas and in the context of economic crisis ,
negotiations and arrangements between men and women about the costs of pregnancy and childbirth are not uncommon . among men ,
there are those who are able to pay the costs of delivery , those who do not want to pay , and a large group who do not have the means to pay . in the latter case
the strategy adopted by the woman is to ensure that the members of her entourage ( family members and caregivers ) do not find out that she is the one who pays .
for the woman , it is an act of saving her husband s reputation and showing that he is capable of meeting the costs of pregnancy and childbirth .
for example , as i know that my husband did not have the means , i gave him money on the day i was coming out of hospital , take it , go and pay and we ll get out , it was my husband who paid , [ women laugh ] .
[ member of patient focus group linked to an urban maternity ward ] a teacher explained , for example , that she had covered the costs of her three pregnancies since her husband lost his job .
even for the health care providers , the rule is that the man pays the costs of delivery .
exchanges between caregivers and the patient s companions are limited to giving prescriptions and claiming consultation fees . in poorer settings , it is difficult to prepare financially for childbirth .
other than the profits from a small business , women try to save on the money their husbands give them to buy condiments , but do not tell them about these savings .
, men do not feel concerned by the problems faced by their wives during pregnancy .
in addition to the woman s psychological anxiety , pregnancy and childbirth seem to add tensions to her relationship with her partner . the man seems to reach a critical point where his reputation in his close circle is at stake , and rests on his capacity to pay hospitalization bills .
motherhood thus becomes a threat to the social status of both the man and the woman .
fear or refusal of certain medical procedures ( including emergency referral to the hospital ) is mainly due to concern about incurring higher costs in a complex medical environment where patients receive little information.29 communication or the lack of it was a recurrent theme in the various interviews conducted at home and in the focus groups .
in addition to this lack of information , the interactions between health care providers and users seem underpinned by a breakdown of communication .
for example , some women said that they were not informed of the decision to perform a cs in the delivery room .
she did not have the chance to see them and said she had not been informed about the cs : they put me on a stretcher in the maternity ward to bring me to the operating theater .
[ young woman , mother of one child , during interview conducted at home in february 2004 ] in many cases , information given by staff is not understood because it is too vague .
one of the objectives of having a health care provider on the team of interviewers during the home visits was to improve this communication and help providers to realize that the information given can have a significant impact in the weeks following a cesarean birth .
for example , rosalie , a 25-year - old woman who was told that she needed an operation because her baby was too large ( her medical file stated generally contracted pelvis ) , said that she would ensure that her next child was smaller .
she told the interviewers when she was interviewed at home that she would avoid eating food that boosted her baby s growth .
another woman who was told to avoid soaking the wound in water after a cs interpreted this as meaning that she could not wash herself . during the home visit , several days after her return home , the caregiver noticed the smell and physical appearance of this young mother .
the home visit provided the opportunity to show the mother how to wash herself . in order to facilitate free discussion ,
initially , many patients were surprised or scared when midwives and anthropologists visited them in their homes .
a caregiver visiting a patient at home to listen to her story was unheard of in the local history of burkina faso .
one woman , whose husband the team wanted to interview , later confided the reason for her reluctance :
i was scared and wondered what my husband had done for the team wanting to see him ! however ,
after some initial surprise , when families realized that they had done nothing wrong and that the health care provider was open and attentive , there was a high demand from mothers for information on personal hygiene , eating habits , and resumption of sexual activity after cs .
almost all women interviewed mentioned the unpredictability of health problems during pregnancy , and felt that no two pregnancies are alike .
. you can be pregnant and it hurts , it hurts all the way until the delivery .
[ member of the patient focus group linked to an urban maternity ward ] childbirths , like pregnancies , are all different , with some being quick and easy , while others are difficult , with women suffering a prolonged labor .
the statement that childbirth is war is found in popular representations of childbirth in nigeria,26 but might just as well be a claim of women in burkina faso .
the method of delivery is also a source of anxiety : you fear that you are between life and death ; some people die in childbirth , or you can give birth and not be healthy .
in addition , you get frightened if you believe you may have to undergo an operation .
[ member of a patient focus group linked to an urban maternity ward ] a 31-year - old woman , who had studied accountancy and underwent cs described her fears when she learnt she had to have the operation : i had pain in my lower abdomen , and i was in the maternity ward .
the midwife asked me to do an ultrasound so she could know the presentation of the baby [ ] .
when i went to the ultrasound , the guy told me what it was going to be ( an operation ) .
he told me no , because it was too low , the baby was stuck and had no room to turn .
[ ] people tell so many things , there is a mystery around it .
[ a woman interviewed at home ] the women s stories generally referred to fears of medical procedures , including cs , as reflected in the statement : once a cs , always a cs ! , highlighting the fear of repetition .
another aspect often mentioned by the women was a lack of information during their antenatal consultations about the possibility of a cesarean birth .
the interviewees regularly referred to their fear of poor and slow healing of the scar after a cs and the resulting physical side effects , eg , back pain and fatigue .
there was intense fear associated with the risk of dying during childbirth , which is probably higher in women who know women who have died during childbirth .
it was serious , she arrived there in the morning , and at 10 pm she had still not given birth .
they told her to push , she did not want to push , she did not push , she tightened her buttocks , until she was referred to the hospital .
they brought her inside , they came out to hand over the baby , they returned inside .
when they returned we saw that they were taking her body to the morgue . seeing
[ member of a patient focus group linked to an urban maternity ward ] for others , fear of cs was related to hearing other people s horror stories and tales of serious consequences , such as paralysis of the lower limbs .
fear of childbirth , and more specifically of cs , is inseparable from the medical , social , and financial implications facing women : if you re going to give birth , you re scared because you do not know how it will happen .
you can get a prescription but the money turns out to be a problem [ ] [ member of a patient focus group linked to an urban maternity ward ] men are expected to meet the obstetric care expenses.27,28 very few women know the cost of their cs .
this fact does not imply negligence on the part of the women , but reflects the distribution of tasks within marriage .
, men may think it indiscrete if a woman asks this type of question . [ ] when you give birth , except your husband , no one else will come and pay the expenses .
even if your husband has no money , he will borrow and has to reimburse later . [ ] if you have given birth , the man must do anything to get the money and come and pay .
[ member of a patient focus group linked to an urban maternity ward ] families are rarely prepared to cover the additional costs of childbirth .
in fact , the urgency solves the problem ( when things get hot , we find it [ ] )
. however , there seems to be a gap between the social norm and reality . in urban areas and in the context of economic crisis ,
negotiations and arrangements between men and women about the costs of pregnancy and childbirth are not uncommon . among men , there are those who are able to pay the costs of delivery , those who do not want to pay , and a large group who do not have the means to pay . in the latter case
the strategy adopted by the woman is to ensure that the members of her entourage ( family members and caregivers ) do not find out that she is the one who pays .
for the woman , it is an act of saving her husband s reputation and showing that he is capable of meeting the costs of pregnancy and childbirth .
for example , as i know that my husband did not have the means , i gave him money on the day i was coming out of hospital , take it , go and pay and we ll get out , it was my husband who paid , [ women laugh ] .
[ member of patient focus group linked to an urban maternity ward ] a teacher explained , for example , that she had covered the costs of her three pregnancies since her husband lost his job . even for the health care providers ,
exchanges between caregivers and the patient s companions are limited to giving prescriptions and claiming consultation fees . in poorer settings , it is difficult to prepare financially for childbirth .
other than the profits from a small business , women try to save on the money their husbands give them to buy condiments , but do not tell them about these savings .
, men do not feel concerned by the problems faced by their wives during pregnancy .
in addition to the woman s psychological anxiety , pregnancy and childbirth seem to add tensions to her relationship with her partner . the man seems to reach a critical point where his reputation in his close circle is at stake , and rests on his capacity to pay hospitalization bills .
motherhood thus becomes a threat to the social status of both the man and the woman .
fear or refusal of certain medical procedures ( including emergency referral to the hospital ) is mainly due to concern about incurring higher costs in a complex medical environment where patients receive little information.29
communication or the lack of it was a recurrent theme in the various interviews conducted at home and in the focus groups .
in addition to this lack of information , the interactions between health care providers and users seem underpinned by a breakdown of communication .
for example , some women said that they were not informed of the decision to perform a cs in the delivery room .
she did not have the chance to see them and said she had not been informed about the cs : they put me on a stretcher in the maternity ward to bring me to the operating theater .
[ young woman , mother of one child , during interview conducted at home in february 2004 ] in many cases , information given by staff is not understood because it is too vague .
one of the objectives of having a health care provider on the team of interviewers during the home visits was to improve this communication and help providers to realize that the information given can have a significant impact in the weeks following a cesarean birth .
for example , rosalie , a 25-year - old woman who was told that she needed an operation because her baby was too large ( her medical file stated generally contracted pelvis ) , said that she would ensure that her next child was smaller .
she told the interviewers when she was interviewed at home that she would avoid eating food that boosted her baby s growth .
another woman who was told to avoid soaking the wound in water after a cs interpreted this as meaning that she could not wash herself . during the home visit , several days after her return home ,
the home visit provided the opportunity to show the mother how to wash herself . in order to facilitate free discussion ,
initially , many patients were surprised or scared when midwives and anthropologists visited them in their homes .
a caregiver visiting a patient at home to listen to her story was unheard of in the local history of burkina faso .
one woman , whose husband the team wanted to interview , later confided the reason for her reluctance :
i was scared and wondered what my husband had done for the team wanting to see him !
however , after some initial surprise , when families realized that they had done nothing wrong and that the health care provider was open and attentive , there was a high demand from mothers for information on personal hygiene , eating habits , and resumption of sexual activity after cs .
several papers from nigeria , a country that , like burkina faso , has a low rate of cs , have reported women s experiences of cesarean birth.15,17,18 in a study of 413 women in nigeria reported by aziken et al , high costs ( 19.8% ) ranked third in the list of reasons for refusing cs , after fear of dying ( 31.7% ) and fear of pain ( 29.1% ) .
the feeling of failure followed in fourth place ( 7.2%).15 many women reported general mental distress after cs .
it is noteworthy that , in nigeria , women who can not deliver vaginally are believed to have not prayed enough , to have been unfaithful to their husbands , or to be witches.15 in another nigerian study including 6,224 patients , ezechi et al reported that only 33.3% of women believed that cs was carried out for a medical indication.17 other reasons given were that hospitals and staff want to make a profit ( 42.7% ) or that young doctors want to practice performing the procedure ( 29.3% ) . in a study of cs in 145 women from ghana , women who preferred vaginal deliveries said that vaginal is best , with no long - term pain , less risk of dying , and less cost.16 women who preferred
cs described it as a quick and easy delivery method accompanied by fewer labor pains .
there were no significant associations between choice of delivery mode and the individual characteristics of the women ( ie , age , marital status , education , and place of residence ) .
women who underwent a cs wanted to avoid the pain of labor and childbirth , and women who chose to deliver vaginally wanted to avoid post - cs pain .
fear of dying during or following a cs is real in many african countries , where we see an increased mortality rate even in women undergoing elective cs without risk factors.18,30 mazzoni et al did a systematic review to explore women s preference for cs , and found an overall pooled preference for cs of 15.6% . in a subgroup meta - analysis by region worldwide , the highest preference for cs was found in the americas , comprising the usa , canada , and latin america ( 21.3% , 95% confidence interval 16.426.7),31 and within the american subgroups , the preference for cs was higher in latin america than in the usa or canada .
unfortunately , the african region was under - represented in this meta - analysis , with only one study from south africa meeting the inclusion criteria .
an exploration of women s preferences for cs in the different regions of africa would be interesting .
if we refer to soulet s definition : the vulnerability is understood as endogenous to the characteristics of the social system , interacting with the system properties and those individuals who are members .
but those who can not [ ] actively participate in the continuous production of the collective life , become highly vulnerable.32 an african woman who undergoes a cs runs a greater risk of dying than her latin american or asian counterparts , according to a major world health organization study on maternal health.11,30,33 supply problems with essential drugs and poor quality services result in low quality care and can lead to fatal anesthetic accidents .
cs carried out in cases of prolonged labor and the resulting infections leave the cs scar vulnerable .
the risk of uterine rupture increases in a subsequent pregnancy , and may be fatal if it occurs at home or in a small health center distant from the hospital . in the severe maternal morbidity in west africa ( moma ) study , cs increased the risk of uterine rupture during subsequent pregnancies by eleven - fold . in settings of poor access to emergency obstetric care , a third of women who suffered a uterine rupture died ( 33.3% ) , while half lost their child ( 52%).34 care is expensive and not covered by social security systems .
a cs may leave a family in debt , and can endanger a couple s relationship when the husband blames the wife for impoverishment of the family .
he may even choose another woman to bear his future children for fear that the present one may need more cesarean births.17,21,35 in some communities , a woman may feel rejected by other women if she is not able to deliver vaginally . a study by ezechi et al reported that 26.8% of patients in nigeria who had a cs said that they would rather die than have another.17 the reasons given for refusing a second intervention were feelings of failure ( 81.2% ) and the financial implications ( 66.5% ) .
this study emphasizes the importance of showing that one is strong enough to deliver vaginally .
the aversion towards cs is deeply rooted in culture and tradition , and the level of education in this sample of 6,224 women had very little influence on their opinion regarding the issue .
ezechi et al described how one woman was rejected by her in - laws after a cs .
she was accused of not knowing how to care for the child because she had not experienced the pain of childbirth . during the next pregnancy
, she remained brave as long as possible in a small mission clinic but was transferred to the emergency services of the hospital with uterine rupture .
several papers from nigeria , a country that , like burkina faso , has a low rate of cs , have reported women s experiences of cesarean birth.15,17,18 in a study of 413 women in nigeria reported by aziken et al , high costs ( 19.8% ) ranked third in the list of reasons for refusing cs , after fear of dying ( 31.7% ) and fear of pain ( 29.1% ) .
the feeling of failure followed in fourth place ( 7.2%).15 many women reported general mental distress after cs .
it is noteworthy that , in nigeria , women who can not deliver vaginally are believed to have not prayed enough , to have been unfaithful to their husbands , or to be witches.15 in another nigerian study including 6,224 patients , ezechi et al reported that only 33.3% of women believed that cs was carried out for a medical indication.17 other reasons given were that hospitals and staff want to make a profit ( 42.7% ) or that young doctors want to practice performing the procedure ( 29.3% ) . in a study of cs in 145 women from ghana , women who preferred vaginal deliveries said that vaginal is best , with no long - term pain , less risk of dying , and less cost.16 women who preferred
cs described it as a quick and easy delivery method accompanied by fewer labor pains .
there were no significant associations between choice of delivery mode and the individual characteristics of the women ( ie , age , marital status , education , and place of residence ) .
women who underwent a cs wanted to avoid the pain of labor and childbirth , and women who chose to deliver vaginally wanted to avoid post - cs pain .
fear of dying during or following a cs is real in many african countries , where we see an increased mortality rate even in women undergoing elective cs without risk factors.18,30 mazzoni et al did a systematic review to explore women s preference for cs , and found an overall pooled preference for cs of 15.6% . in a subgroup meta - analysis by region worldwide , the highest preference for cs was found in the americas , comprising the usa , canada , and latin america ( 21.3% , 95% confidence interval 16.426.7),31 and within the american subgroups , the preference for cs was higher in latin america than in the usa or canada .
unfortunately , the african region was under - represented in this meta - analysis , with only one study from south africa meeting the inclusion criteria .
an exploration of women s preferences for cs in the different regions of africa would be interesting .
if we refer to soulet s definition : the vulnerability is understood as endogenous to the characteristics of the social system , interacting with the system properties and those individuals who are members .
but those who can not [ ] actively participate in the continuous production of the collective life , become highly vulnerable.32 an african woman who undergoes a cs runs a greater risk of dying than her latin american or asian counterparts , according to a major world health organization study on maternal health.11,30,33 supply problems with essential drugs and poor quality services result in low quality care and can lead to fatal anesthetic accidents .
cs carried out in cases of prolonged labor and the resulting infections leave the cs scar vulnerable .
the risk of uterine rupture increases in a subsequent pregnancy , and may be fatal if it occurs at home or in a small health center distant from the hospital . in the severe maternal morbidity in west africa ( moma )
study , cs increased the risk of uterine rupture during subsequent pregnancies by eleven - fold . in settings of poor access to emergency obstetric care , a third of women who suffered a uterine rupture died ( 33.3% ) , while half lost their child ( 52%).34 care is expensive and not covered by social security systems . a cs may leave a family in debt , and can endanger a couple s relationship when the husband blames the wife for impoverishment of the family
. he may even choose another woman to bear his future children for fear that the present one may need more cesarean births.17,21,35 in some communities , a woman may feel rejected by other women if she is not able to deliver vaginally . a study by ezechi et al reported that 26.8% of patients in nigeria who had a cs said that they would rather die than have another.17 the reasons given for refusing a second intervention were feelings of failure ( 81.2% ) and the financial implications ( 66.5% ) .
this study emphasizes the importance of showing that one is strong enough to deliver vaginally .
the aversion towards cs is deeply rooted in culture and tradition , and the level of education in this sample of 6,224 women had very little influence on their opinion regarding the issue .
ezechi et al described how one woman was rejected by her in - laws after a cs .
she was accused of not knowing how to care for the child because she had not experienced the pain of childbirth . during the next pregnancy
, she remained brave as long as possible in a small mission clinic but was transferred to the emergency services of the hospital with uterine rupture .
cultural perceptions associate vaginal birth with femininity . a cesarean birth is not valued by women or their families because it is seen as a failure to reach woman - mother status . given that this status exists only through the eyes of others , the sense of failure acquires its full meaning indirectly via discourse with family or community members .
. the cost of cs can be quite substantial for urban and rural households . even if exemption schemes exist
, the costs remain important for the family and especially for the man , who assumes social responsibility for health care spending .
finally , both parties are left with questions about the need for such an intervention in the future .
popular perceptions are also related to the quality of care that women receive for their cs .
testimonies of their fears point to a crisis of confidence with regard to the procedure and the impact it can have on women s health .
fear of dying and fear of side effects reveal the level of distrust in health care services .
poor quality of care and the economic burden of cs place women in a multifaceted situation of vulnerability within their families .
cs has a medical , emotional , social , and economic impact for poor african women .
impact of cs can not be underestimated and the intervention can not be performed without a medical indication in such a context of substandard care .
maternal health program managers need to understand women s perceptions of cs so as to overcome existing barriers to this life - saving procedure .
we encourage researchers to conduct similar research among users of maternity wards and women who have undergone cs to see if the increased affordability of cs has changed their experiences and perceptions of the procedure .
for women with cesarean section , bogodogo district , ouagadougou number of children profession spouse s level of education address / telephone number notion of a difficult pregnancy how was this pregnancy ?
if so , when did this happen ? where ? can you tell us a little about how it happened ?
explain the criteria of choice for the medical facility have you attended the discussion sessions ( causeries ) given by the midwife during pregnancy ?
what did the midwives say during these sessions ? during the antenatal consultation , what did caregivers tell you personally ?
do you have any idea when the pain started ? who did you discuss it with ?
what care did you receive , if any ? how did you come to maternity ward ? who decided to send you ? who accompanied you to the maternity ward ? who helped you to give birth
cost and financial players of pregnancy and childbirth for the antenatal consultation , how much did you pay ? how much did you pay for delivery ?
knowledge of the health facility did you know about the existence of the maternity ward ?
for the next delivery , would you choose to give birth in the maternity ward ?
Output:
| backgroundthis paper explores women s experience and perception of cesarean birth in burkina faso and its social and economic implications within the household.methodsfive focus groups comprising mothers or pregnant women were conducted among residents of bogodogo health district in ouagadougou to assess the perceptions of cesarean section ( cs ) by women in the community .
in addition , 35 individual semistructured interviews were held at the homes of women who had just undergone cs in the referral hospital , and were conducted by an anthropologist and a midwife.resultshome visits to women with cs identified common fears about the procedure , such as once you have had a cs , you will always have to deliver by cs .
the central and recurring theme in the interviews was communication between patients and care providers , ie , women were often not informed of the imminence of cs in the delivery room .
information given by health care professionals was often either not explicit enough or not understood .
the women received insufficient information about postoperative personal hygiene , diet , resumption of sexual activity , and contraception .
overall , analysis of the experiences of women who had undergone cs highlighted feelings of guilt in the aftermath of cs .
other concerns included the feeling of not being a good mother who can give birth normally , alongside concerns about needing a cs in future pregnancies , the high costs that this might incur for their households , general fatigue , and possible medical complications after surgery.conclusionpoor quality of care and the economic burden of cs place women in a multifaceted situation of vulnerability within the family .
cs has a medical , emotional , social , and economic impact on poor african women that can not be ignored .
managers of maternal health programs need to understand women s perceptions of cs so as to overcome existing barriers to this life - saving procedure . |
PubmedSumm7806 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the online version of this article ( doi:10.1007/s13300 - 014 - 0080 - 0 ) contains supplementary material , which is available to authorized users .
type 2 diabetes mellitus ( t2 dm ) is a serious progressive disorder characterized by insulin resistance and relative insulin deficiency resulting in increased blood glucose level .
the prevalence of t2 dm is growing worldwide , mainly due to growth in urbanization and the resulting substantial changes in lifestyle .
the total number of adults aged 2079 with diabetes is projected to increase from 382 million in 2013 to 592 million in 2035 .
it has been estimated that 6.4% of adults aged 2079 had diabetes in sweden in 2013 .
t2 dm is the most common form of diabetes worldwide , and is an established risk factor for several fatal and non - fatal micro- and macrovascular complications .
an estimated 8% of the total swedish health expenditure went to diabetes - related healthcare .
previous studies have shown that good glycemic control is crucial to decrease the risk of diabetes - related complications [ 36 ] .
the american diabetes association recommends glycated hemoglobin ( hba1c ) < 7% as treatment goal for most patients with t2 dm , and the year 2010 guidelines from the national board of health and welfare in sweden advocates similar treatment goals for newly diagnosed , people who were diagnosed at younger age , and people with low risk of cardiovascular diseases .
a typical treatment pattern for t2 dm , advocated by international and swedish guidelines , begins with lifestyle modifications , then adds metformin monotherapy when blood glucose control is unsatisfactory , followed by the addition of other medication such as sulfonylurea or basal insulin including intermediate - acting neutral protamine hagedorn ( nph ) insulin .
the progressivity of the disease implies that many patients eventually will need multiple dose insulin treatment if second - line treatment does not result in achievement of sufficient control of blood glucose levels [ 810 ] . despite these guidelines and
the availability of a range of drugs , a large proportion of t2 dm patients fail to achieve and maintain the treatment goals , mainly due to the progressive nature of the disease and the inadequacy of conventional treatments . a survey conducted in 2008 by the swedish national diabetes register showed that while there was an improvement in the proportion of t2 dm patients reaching hba1c 7% compared with 1999 , a substantial proportion of patients ( 48% ) still did not achieve this treatment goal .
in addition , conventional medications such as sulfonylurea or insulin are associated with side effects including weight gain and hypoglycemia [ 14 , 15 ] .
hence , there is a need for new therapies with better efficacy and fewer side effects . in response to this ,
incretin - based therapies have attracted growing interests during recent years , as clinical trials indicated that they might provide improved glycemic control with low risk of hypoglycemia and seem weight neutral , or even weight reducing [ 14 , 1618 ] .
these therapies are mainly recommended as second - line therapy among patients who fail to achieve or maintain the blood glucose treatment goals on metformin alone .
two classes of incretin - based therapies are available : glucagon - like peptide-1 ( glp-1 ) receptor agonists and dipeptidyl peptidase-4 ( dpp-4 ) inhibitors .
currently , two glp-1 agonists ( liraglutide and exenatide ) and three dpp-4 inhibitors ( sitagliptin , saxagliptin , and vildagliptin ) have been approved for use in sweden . while the short - term treatment efficacy and safety of incretin - based therapies have been investigated , there is limited evidence on the long - term efficacy and cost - effectiveness of these therapies . increased use of these newer , more expensive drugs in routine practice has substantial budgetary implications for health systems .
moreover , while there is consensus on using metformin as the first - line oral anti - hyperglycemic alongside lifestyle modifications in t2 dm patients when lifestyle interventions are insufficient for glycemic control , there is disagreement over the preferred agent for second - line therapy .
hence , it is of value to evaluate and compare the cost - effectiveness of these second - line therapies to aid well - informed decisions regarding second - line therapy for patients with t2 dm inadequately controlled by metformin monotherapy .
the aim of this study was to estimate the lifetime costs and benefits of three second - line treatment alternatives : adding glp-1 agonists , dpp-4 inhibitors , or nph insulin to metformin among t2 dm patients failing to reach hba1c 7% with metformin alone in sweden .
in addition , considering the treatment strategies included in this study , we implicitly evaluated the cost - effectiveness of starting nph insulin as the second - line therapy or later as third - line therapy after applying incretin - based agents .
the authors conducted this cost utility analysis using the swedish institute for health economics cohort model for t2 dm ( ihecm - t2 dm ) .
this model was previously described and used to compare cost - effectiveness of liraglutide versus sulphonylurea or sitagliptin in sweden .
the ihecm - t2 dm is a cohort model consisting of two parallel markov chains covering 120 microvascular health states and 100 macrovascular health states .
the microvascular health states include three subgroups : retinopathy , neuropathy , and nephropathy based on the work of eastman et al . , brown et al . , and bagust et al .
the macrovascular health states include four subgroups : ischemic heart disease , myocardial infarction , stroke and , heart failure based on united kingdom prospective diabetes study ( ukpds ) outcomes models [ 24 , 25 ] and the swedish national diabetes register ( ndr ) equations . for macrovascular complications ,
in the current study , the authors used equations from the ndr in the base case and from the ukpds outcome model-1 in a sensitivity analysis . with this structure
, patients can develop multiple complications within each model cycle and over the simulation period .
the ihecm - t2 dm has a yearly cycle and a time horizons of up to 40 years can be used .
in addition , the user can choose between two sets of mortality risk equations [ 24 , 25 ] .
the model also includes evolution of biomarkers over time , treatment algorithms , and treatment - related side effects such as hypoglycemia .
eight biomarkers are included in the model and evolution of these biomarkers over time is determined by the initial treatment effects and an annual drift .
treatment algorithms include up to eight changes in anti - hyperglycemic treatment composition to account for possible combinations of glucose - lowering agents and treatment intensifications ; this algorithm depends on a user - defined switching threshold of hba1c .
the model starts with assigning baseline clinical and demographic characteristics of the cohort , history of complications before diagnosis , and prevalence of diabetes - related complications .
this article does not contain any new studies with human or animal subjects performed by any of the authors .
the baseline characteristics of the simulated cohort were based on a survey conducted by the swedish national diabetes register . as in this study
, the authors evaluated the three second - line therapies as add - on to metformin , they used the data on a sample of patients on metformin monotherapy with hba1c > 7% consisting 30% of patients on metformin monotherapy in ekstrom et al.s study ( table 1 , data were provided by the swedish national diabetes register).table 1baseline characteristics of patients on metformin monotherapy with hba1c > 7% in the swedish national diabetes register ( ndr)variable
n
value ( sd)age ( years)12,17264.7 11.6diabetes duration ( years)10,9885.6 4.6male ( % ) 7,00057.5smoker ( % ) 1,71017.5hba1c ( % ) 12,1727.7 0.8systolic bp ( mmhg)11,649137 16diastolic bp ( mmhg)11,64979 9total cholesterol ( mmol / l)9,3814.9 1.1hdl ( mmol / l)8,3221.2 0.3ldl ( mmol / l)7,3552.8 0.9triglycerides ( mmol / l)8,2002.1 1.3bmi10,38530.9 5.3
bmi body mass index , bp blood pressure , hba1c glycated hemoglobin , hdl high - density lipoprotein , ldl low - density lipoprotein , sd standard deviation baseline characteristics of patients on metformin monotherapy with hba1c >
7% in the swedish national diabetes register ( ndr )
bmi body mass index , bp blood pressure , hba1c glycated hemoglobin , hdl high - density lipoprotein , ldl low - density lipoprotein , sd standard deviation three treatment strategies evaluated in the study are presented in fig . 1 .
in strategies 1 and 2 , patients received the glp-1 receptor agonists and the dpp-4 inhibitors as add - on to metformin , respectively . in both these strategies
, patients progressed to nph insulin 40 insulin units ( iu)/day + metformin when hba1c exceeded 7.5% and to intensified nph insulin 60 iu / day + metformin when hba1c 8% ( the base case analysis ) . in sensitivity analyses ,
these hba1c threshold values changed to 8% ( switch to nph insulin 40 iu / day ) and 8.5/9% ( switch to nph insulin 60 iu / day ) . in strategy 3 , patients received nph insulin 40 iu / day + metformin as initial second - line treatment , then progressed to nph insulin 60 iu / day + metformin on reaching the hba1c threshold value of 8% ( the base case analysis ) and 8.5/9% ( the sensitivity analyses ) .
comparing strategy 3 with strategies 1 and 2 would provide more insight about timing of insulin initiation in t2 dm patients . in the current study ,
the glp-1 receptor agonists included liraglutide 1.2 mg daily and exenatide 2 mg once weekly , and the dpp-4 inhibitors are sitagliptin 100 mg daily , saxagliptin 5 mg daily , and vildagliptin 100 mg daily.fig .
dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units schematic of treatment strategies applied in the base case analysis .
dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units treatment effects were considered as absolute change from baseline in hba1c and weight and the rates of mild , moderate , and major hypoglycemia ( table 2 ) [ 2834 ] .
the treatment effects for each drug class were extracted from the literature ; where data at drug class level were not available , the authors used data from head - to - head randomized controlled trials for a single agent in each drug class .
the model considers non - severe daytime hypoglycemia as mild and non - severe nocturnal hypoglycemia as moderate hypoglycemia.table 2efficacy of treatments used in the study modelvariableglp-1
+ metdpp-4 + metnph insulin 40 iu / day + metnph insulin 60 iu / day + metchange in hba1c ( % ) 0.96 0.69 1.12 0.69change in body weight ( kg)1.80 0.00 3.30 1.80mild hypoglycemia ( per patient per year)0.14 0.14 3.16 3.16 moderate hypoglycemia ( per patient per year)0.05 0.07 1.014 1.014 major hypoglycemia ( per patient per year)0.006 0.01 0.06 0.06 systolic blood pressure ( mmhg)3.20 4.00 2.00 0.00diastolic blood pressure ( mmhg)1.60 1.47 1.00 0.00total cholesterol ( mmol / l)0.01 0.00 0.20 0.00hdl cholesterol ( mmol / l)0.01 0.01 0.00 0.00ldl cholesterol ( mmol / l)0.09 0.09 0.10 0.00triglyceride ( mmol / l)0.10 0.23 0.40 0.00
dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , hdl high - density lipoprotein , iu insulin units , ldl low - density lipoprotein , met metformin , nph neutral protamine hagedorn efficacy of treatments used in the study model
dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , hdl high - density lipoprotein , iu insulin units , ldl low - density lipoprotein , met metformin , nph neutral protamine hagedorn the authors used data from the literature to estimate the treatment effects due to intensification of insulin from 40 iu / day to 60 iu / day [ 35 , 36 ] .
a recent meta - analysis found no direct association between dosage of insulin and risk of hypoglycemia , and so the authors applied the same rate of hypoglycemia events for both insulin treatments in this study . to account for association between hypoglycemic events and changes in hba1c , the reported event rate from a study is transferred to expected event rate using coefficient ( 1.43 ) from a previous study .
as in previous studies , no treatment effect on other biomarkers was assumed in the base case analysis [ 3942 ] .
when data on treatment effects of nph insulin were not available , the authors used the results from glargine insulin , since previous studies reported no significant difference in treatment effects between nph and glargine insulin [ 4345 ] .
treatment effects were applied for the first year after treatment , and then a constant annual drift was assumed for different treatment strategies .
the annual drifts in weight were 0.42 kg for insulin and 0.23 kg for other treatments in the base case analysis . in the sensitivity analyses , the authors considered 0.23 kg and 0.1 kg change in weight for all treatments .
they assumed 0.3 mmhg and 0.03 mg / dl annual drifts in blood pressure and lipid levels , respectively .
prevalence of t2dm - related complications at baseline was extracted from national and international published sources [ 26 , 50 , 51 ] . in the base case
, costs were accounted from a societal perspective ( 2013 swedish krona , sek , 1 sek = 0.115 euros ) and included healthcare costs , productivity losses , and net consumption losses .
costs for drugs , self - monitoring blood glucose ( smbg ) test strips , and smbg lancets were collected through the dental and pharmaceutical benefits agency in sweden ( tlv ) . in the base case analysis
, the authors calculated a weighted average cost for glp-1 agonists and dpp-4 inhibitors according to consumption of single agents in each class in sweden in 2013 , while in a sensitivity analysis , they applied the price of the lowest cost agent for each drug class ( liraglutide for glp-1 agonists class and vildagliptin for dpp-4 inhibitors class ) . in the base case analysis , based on recommendations by owens et al .
, the authors assumed that no smbg is required for patients on dpp-4 inhibitors and glp-1 agonists regimens , and daily monitoring is required for patients on nph insulin regimens .
costs associated with t2dm - related complications and treatment side effects were derived from sweden - specific published sources adjusted for 2013 using the swedish consumer price index ( table 1 in supplement ) .
due to lack of data on productivity losses due to t2dm - related complications , we assumed that only severe stages of micro- and macrovascular complications caused loss of production .
annual cost of consumption includes costs in added life years and is calculated as the difference in market consumption and production during gained life years . including these costs is required by the tlv in sweden . for the current study , these costs were extracted from a previous study in sweden inflated to year 2012 using consumer price index ( see supplement for more details ) .
baseline utility was modeled using data from a recent study on eq-5d scores in swedish t2 dm patients with no complications .
health state utilities for t2dm - related complications and utility decrements associated with age , gender , duration of diabetes , and bmi were derived , whenever possible , from sweden - specific published sources , supplemented with data from other sources if necessary ( table 2 in supplement ) .
no utility decrement associated with modality of treatment was applied in the base case analysis .
decrement associated with hypoglycemia was extracted from a previous study which used data from the swedish respondents in a multinational study . a 3% annual discount rate for costs and quality - adjusted life years ( qalys )
was applied in the base case analysis over a 35-year time horizon . while there is no formal willingness - to - pay ( wtp ) threshold for cost - effectiveness ratios in sweden , interventions with less than 500,000 sek per qaly gained
the authors conducted a series of one - way sensitivity analyses to assess the impact of variation in the model inputs and assumptions on the results of the base case analysis . in a sensitivity analysis , they excluded the net consumption and productivity losses ( applying healthcare payer perspective ) .
the number of weekly smbg performed by patients in the glp-1 agonists + metformin and dpp-4 inhibitors + metformin groups was varied ( 3 , 5 , and 7 ) , as were the time horizons ( 10 and 20 years ) and the discount rate for costs and qalys ( 0 and 5% ) .
a utility decrement of 0.049 for insulin therapy was applied . the annual drift in hba1c
was set to 0.10% and 0.20% unit , the cost of one smbg was varied by 10% and 25% , and the cost of t2dm - related complications varied by 20% .
no major hypoglycemia and no moderate / major hypoglycemia were assumed for all treatment groups .
the treatment effects on hba1c were changed to the lower and upper limits of 95% ci of the main estimate .
in addition , the treatment effect on hba1c for nph insulin 60 iu / day was set to 0.56% , 0.35% , and 0.18% . a probabilistic sensitivity analysis ( psa )
was conducted to assess the joint uncertainty of the input parameters using a monte carlo simulation with 1,000 iterations .
non - parametric bootstrapping with 1,000 bootstrap samples was then used to calculate the mean and bootstrap bias - corrected ( bbc ) 95% confidence interval ( ci ) of costs and qalys as well as incremental cost - effectiveness ratios ( icers ) . in the psa ,
costs of treatments and t2dm - related complications varied within a range of 20% from the base case values .
microsoft excel and stata 13 ( statacorp lp , college station , tx , usa ) were used for the analyses .
the authors conducted this cost utility analysis using the swedish institute for health economics cohort model for t2 dm ( ihecm - t2 dm ) .
this model was previously described and used to compare cost - effectiveness of liraglutide versus sulphonylurea or sitagliptin in sweden .
the ihecm - t2 dm is a cohort model consisting of two parallel markov chains covering 120 microvascular health states and 100 macrovascular health states .
the microvascular health states include three subgroups : retinopathy , neuropathy , and nephropathy based on the work of eastman et al . , brown et al . , and bagust et al .
the macrovascular health states include four subgroups : ischemic heart disease , myocardial infarction , stroke and , heart failure based on united kingdom prospective diabetes study ( ukpds ) outcomes models [ 24 , 25 ] and the swedish national diabetes register ( ndr ) equations . for macrovascular complications ,
in the current study , the authors used equations from the ndr in the base case and from the ukpds outcome model-1 in a sensitivity analysis . with this structure
, patients can develop multiple complications within each model cycle and over the simulation period .
the ihecm - t2 dm has a yearly cycle and a time horizons of up to 40 years can be used .
in addition , the user can choose between two sets of mortality risk equations [ 24 , 25 ] .
the model also includes evolution of biomarkers over time , treatment algorithms , and treatment - related side effects such as hypoglycemia .
eight biomarkers are included in the model and evolution of these biomarkers over time is determined by the initial treatment effects and an annual drift .
treatment algorithms include up to eight changes in anti - hyperglycemic treatment composition to account for possible combinations of glucose - lowering agents and treatment intensifications ; this algorithm depends on a user - defined switching threshold of hba1c .
the model starts with assigning baseline clinical and demographic characteristics of the cohort , history of complications before diagnosis , and prevalence of diabetes - related complications .
this article does not contain any new studies with human or animal subjects performed by any of the authors .
this article does not contain any new studies with human or animal subjects performed by any of the authors .
the baseline characteristics of the simulated cohort were based on a survey conducted by the swedish national diabetes register . as in this study
, the authors evaluated the three second - line therapies as add - on to metformin , they used the data on a sample of patients on metformin monotherapy with hba1c > 7% consisting 30% of patients on metformin monotherapy in ekstrom et al.s study ( table 1 , data were provided by the swedish national diabetes register).table 1baseline characteristics of patients on metformin monotherapy with hba1c > 7% in the swedish national diabetes register ( ndr)variable
n
value ( sd)age ( years)12,17264.7 11.6diabetes duration ( years)10,9885.6 4.6male ( % ) 7,00057.5smoker ( % ) 1,71017.5hba1c ( % ) 12,1727.7 0.8systolic bp ( mmhg)11,649137 16diastolic bp ( mmhg)11,64979 9total cholesterol ( mmol / l)9,3814.9 1.1hdl ( mmol / l)8,3221.2 0.3ldl ( mmol / l)7,3552.8 0.9triglycerides ( mmol / l)8,2002.1 1.3bmi10,38530.9 5.3
bmi body mass index , bp blood pressure , hba1c glycated hemoglobin , hdl high - density lipoprotein , ldl low - density lipoprotein , sd standard deviation baseline characteristics of patients on metformin monotherapy with hba1c > 7% in the swedish national diabetes register ( ndr )
bmi body mass index , bp blood pressure , hba1c glycated hemoglobin , hdl high - density lipoprotein , ldl low - density lipoprotein , sd standard deviation three treatment strategies evaluated in the study are presented in fig . 1 . in strategies 1 and 2
, patients received the glp-1 receptor agonists and the dpp-4 inhibitors as add - on to metformin , respectively . in both these strategies
, patients progressed to nph insulin 40 insulin units ( iu)/day + metformin when hba1c exceeded 7.5% and to intensified nph insulin 60 iu / day + metformin when hba1c 8% ( the base case analysis ) . in sensitivity analyses ,
these hba1c threshold values changed to 8% ( switch to nph insulin 40 iu / day ) and 8.5/9% ( switch to nph insulin 60 iu / day ) . in strategy 3 , patients received nph insulin 40 iu / day + metformin as initial second - line treatment , then progressed to nph insulin 60 iu / day + metformin on reaching the hba1c threshold value of 8% ( the base case analysis ) and 8.5/9% ( the sensitivity analyses ) .
comparing strategy 3 with strategies 1 and 2 would provide more insight about timing of insulin initiation in t2 dm patients . in the current study ,
the glp-1 receptor agonists included liraglutide 1.2 mg daily and exenatide 2 mg once weekly , and the dpp-4 inhibitors are sitagliptin 100 mg daily , saxagliptin 5 mg daily , and vildagliptin 100 mg daily.fig .
dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units schematic of treatment strategies applied in the base case analysis .
dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units treatment effects were considered as absolute change from baseline in hba1c and weight and the rates of mild , moderate , and major hypoglycemia ( table 2 ) [ 2834 ] .
the treatment effects for each drug class were extracted from the literature ; where data at drug class level were not available , the authors used data from head - to - head randomized controlled trials for a single agent in each drug class .
the model considers non - severe daytime hypoglycemia as mild and non - severe nocturnal hypoglycemia as moderate hypoglycemia.table 2efficacy of treatments used in the study modelvariableglp-1 + metdpp-4 + metnph insulin 40 iu / day + metnph insulin 60 iu / day + metchange in hba1c ( % ) 0.96 0.69 1.12 0.69change in body weight ( kg)1.80 0.00 3.30 1.80mild hypoglycemia ( per patient per year)0.14 0.14 3.16 3.16 moderate hypoglycemia ( per patient per year)0.05 0.07 1.014 1.014 major hypoglycemia ( per patient per year)0.006 0.01 0.06 0.06 systolic blood pressure ( mmhg)3.20 4.00 2.00 0.00diastolic blood pressure ( mmhg)1.60 1.47 1.00 0.00total cholesterol ( mmol / l)0.01 0.00 0.20 0.00hdl cholesterol ( mmol / l)0.01 0.01 0.00 0.00ldl cholesterol ( mmol / l)0.09 0.09 0.10 0.00triglyceride ( mmol / l)0.10 0.23 0.40 0.00
dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , hdl high - density lipoprotein , iu insulin units , ldl low - density lipoprotein , met metformin , nph neutral protamine hagedorn efficacy of treatments used in the study model
dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , hdl high - density lipoprotein , iu insulin units , ldl low - density lipoprotein , met metformin , nph neutral protamine hagedorn the authors used data from the literature to estimate the treatment effects due to intensification of insulin from 40 iu / day to 60 iu / day [ 35 , 36 ] .
a recent meta - analysis found no direct association between dosage of insulin and risk of hypoglycemia , and so the authors applied the same rate of hypoglycemia events for both insulin treatments in this study . to account for association between hypoglycemic events and changes in hba1c , the reported event rate from a study is transferred to expected event rate using coefficient ( 1.43 ) from a previous study .
as in previous studies , no treatment effect on other biomarkers was assumed in the base case analysis [ 3942 ] .
when data on treatment effects of nph insulin were not available , the authors used the results from glargine insulin , since previous studies reported no significant difference in treatment effects between nph and glargine insulin [ 4345 ] .
treatment effects were applied for the first year after treatment , and then a constant annual drift was assumed for different treatment strategies .
the annual drifts in weight were 0.42 kg for insulin and 0.23 kg for other treatments in the base case analysis . in the sensitivity analyses , the authors considered 0.23 kg and 0.1 kg change in weight for all treatments .
they assumed 0.3 mmhg and 0.03 mg / dl annual drifts in blood pressure and lipid levels , respectively .
prevalence of t2dm - related complications at baseline was extracted from national and international published sources [ 26 , 50 , 51 ] .
in the base case , costs were accounted from a societal perspective ( 2013 swedish krona , sek , 1 sek = 0.115 euros ) and included healthcare costs , productivity losses , and net consumption losses .
costs for drugs , self - monitoring blood glucose ( smbg ) test strips , and smbg lancets were collected through the dental and pharmaceutical benefits agency in sweden ( tlv ) . in the base case analysis
, the authors calculated a weighted average cost for glp-1 agonists and dpp-4 inhibitors according to consumption of single agents in each class in sweden in 2013 , while in a sensitivity analysis , they applied the price of the lowest cost agent for each drug class ( liraglutide for glp-1 agonists class and vildagliptin for dpp-4 inhibitors class ) . in the base case analysis , based on recommendations by owens et al . , the authors assumed that no smbg is required for patients on dpp-4 inhibitors and glp-1 agonists regimens , and daily monitoring is required for patients on nph insulin regimens .
costs associated with t2dm - related complications and treatment side effects were derived from sweden - specific published sources adjusted for 2013 using the swedish consumer price index ( table 1 in supplement ) .
productivity losses were measured using human capital approach . due to lack of data on productivity losses due to t2dm - related complications
, we assumed that only severe stages of micro- and macrovascular complications caused loss of production .
annual cost of consumption includes costs in added life years and is calculated as the difference in market consumption and production during gained life years . including these costs is required by the tlv in sweden . for the current study
, these costs were extracted from a previous study in sweden inflated to year 2012 using consumer price index ( see supplement for more details ) .
baseline utility was modeled using data from a recent study on eq-5d scores in swedish t2 dm patients with no complications .
health state utilities for t2dm - related complications and utility decrements associated with age , gender , duration of diabetes , and bmi were derived , whenever possible , from sweden - specific published sources , supplemented with data from other sources if necessary ( table 2 in supplement ) .
no utility decrement associated with modality of treatment was applied in the base case analysis .
decrement associated with hypoglycemia was extracted from a previous study which used data from the swedish respondents in a multinational study .
a 3% annual discount rate for costs and quality - adjusted life years ( qalys ) was applied in the base case analysis over a 35-year time horizon . while there is no formal willingness - to - pay ( wtp ) threshold for cost - effectiveness ratios in sweden , interventions with less than 500,000 sek per qaly gained
the authors conducted a series of one - way sensitivity analyses to assess the impact of variation in the model inputs and assumptions on the results of the base case analysis . in a sensitivity analysis , they excluded the net consumption and productivity losses ( applying healthcare payer perspective ) .
the number of weekly smbg performed by patients in the glp-1 agonists + metformin and dpp-4 inhibitors + metformin groups was varied ( 3 , 5 , and 7 ) , as were the time horizons ( 10 and 20 years ) and the discount rate for costs and qalys ( 0 and 5% ) .
a utility decrement of 0.049 for insulin therapy was applied . the annual drift in hba1c
was set to 0.10% and 0.20% unit , the cost of one smbg was varied by 10% and 25% , and the cost of t2dm - related complications varied by 20% .
no major hypoglycemia and no moderate / major hypoglycemia were assumed for all treatment groups .
the treatment effects on hba1c were changed to the lower and upper limits of 95% ci of the main estimate .
in addition , the treatment effect on hba1c for nph insulin 60 iu / day was set to 0.56% , 0.35% , and 0.18% . a probabilistic sensitivity analysis ( psa )
was conducted to assess the joint uncertainty of the input parameters using a monte carlo simulation with 1,000 iterations .
non - parametric bootstrapping with 1,000 bootstrap samples was then used to calculate the mean and bootstrap bias - corrected ( bbc ) 95% confidence interval ( ci ) of costs and qalys as well as incremental cost - effectiveness ratios ( icers ) . in the psa ,
costs of treatments and t2dm - related complications varied within a range of 20% from the base case values .
microsoft excel and stata 13 ( statacorp lp , college station , tx , usa ) were used for the analyses .
the simulated profiles of hba1c change over time for three treatments as add - on to metformin are shown in fig .
2 . it can be seen that using the base case threshold values , before switching to insulin therapy , patients on strategies 1 and 2 were expected to receive glp-1 agonists and dpp-4 inhibitors , respectively , for 6 and 4 years .
figure 1 in the supplement displays the 35-year cumulative incidence of some major micro- and macrovascular events projected by the ihecm - t2 dm .
for all events , the lowest and highest incidences were observed in the strategies 1 and 3 , respectively.fig .
hba1c glycated hemoglobin simulated profiles of hba1c in the treatment strategies over the modeled time horizon .
glycated hemoglobin the results of cost utility analysis for the base case are given in table 3 .
treatment strategy 1 was associated with an 0.10 and 0.25 units improvement in discounted qalys compared with strategies 2 and 3 , respectively .
in addition , treatment strategy 2 was associated with an improvement of 0.15 discounted qalys compared with strategy 3 . on the other hand , from a societal perspective
, the treatment strategy 1 was associated with sek 34,865 and sek 40,802 higher discounted costs compared with strategies 2 and 3 , respectively .
the icers for strategy 1 versus strategies 2 and 3 were sek 353,172 and sek 160,618 , respectively , and the icer for strategy 2 versus strategy 3 was sek 36,050 . assuming a wtp of sek 500,000 per qaly gained in sweden , strategy 1 could be considered cost - effective compared to either strategies 2 and 3.table 3the results of the base - case cost utility analysisstrategy 1strategy 2strategy 3difference strategy 1 versus strategy 2difference strategy 1 versus strategy 3difference strategy 2 versus strategy 3discounted qalys4.754.654.500.100.250.15discounted costs healthcare costs501,594470,084471,99631,51029,5981,912 productivity losses8,9729,47310,5995011,6271,126 net consumption losses1,652,3411,648,4851,639,5103,85712,8318,974total costs2,162,9072,128,0422,122,10534,86540,8025,936icer ( sek)353,172160,61836,050
icer incremental cost - effectiveness ratio , qaly quality - adjusted life years , sek swedish krona the results of the base - case cost utility analysis
icer incremental cost - effectiveness ratio , qaly quality - adjusted life years , sek swedish krona overall , the univariate analyses showed that our base case analysis was robust to variation in the inputs and assumptions applied in the model .
figure 3 presents the results of the univariate sensitivity analyses as percentage changes in the icer from the base case for comparison of strategy 1 versus strategy 2 .
the disutility associated with every unit of bmi over 25 ( 0.006 in the base case ) was a key driver of the results , and excluding it from the analysis caused the icer to rise to sek 661,917 , an 87.3% increase from the base case . while the result of the base case was sensitive to hba1c threshold values , disutility due to mild / moderate hypoglycemia and insulin treatment , and incidence of moderate / major hypoglycemia , in all these cases the icer remained below sek 500,000 ( range : sek 204,517495,368 ) . in the psa ,
the estimated icer was sek 319,217 ( bbc 95% ci : sek 309,849330,212 ) . assuming a wtp of sek 500,000 per qaly gained , strategy 1 had a 74.7% likelihood of being considered cost - effective in comparison to strategy 2.fig .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose results of one - way sensitivity analyses : strategy 1 versus strategy 2 .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose the results of the univariate sensitivity analyses for strategy 1 versus strategy 3 are shown in fig . 4 as percentage changes in the icer from the base case .
the key model drivers were disutility of mild / moderate hypoglycemia , the disutility of insulin and bmi over 25 , and incidence of moderate / major hypoglycemia
. however , in all these cases , the icer remained below sek 500,000 ( range : sek 85,629256,830 ) .
the psa showed that the icer was sek 153,277 ( bbc 95% ci : sek 150,788155,766 ) .
assuming a wtp of sek 500,000 per qaly gained , strategy 1 was expected to have a 100% probability of being cost - effective in comparison to strategy 3.fig .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose results of one - way sensitivity analyses : strategy 1 versus strategy 3 .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose figure 5 displays the results of the univariate sensitivity analyses for strategy 2 versus strategy 3 as percentage changes in the icer from the base case .
the key model drivers were incidence of moderate / major hypoglycemia , the disutility of mild / moderate hypoglycemia , including costs of 7 smbg per week for the dpp-4 inhibitors , and the disutility of insulin .
moreover , excluding net consumption and productivity loss , and applying the price of the cheapest dpp-4 agent , translated into dominance of strategy 2 versus strategy 3 .
the icer from the psa was sek 40,277 ( bbc 95% ci : sek 37,43643,119 ) .
assuming a wtp of sek 500,000 per qaly gained , strategy 2 was expected to have a 98.1% probability of being cost - effective in comparison to strategy 3.fig .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose results of one - way sensitivity analyses : strategy 2 versus strategy 3 .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose
overall , the univariate analyses showed that our base case analysis was robust to variation in the inputs and assumptions applied in the model .
figure 3 presents the results of the univariate sensitivity analyses as percentage changes in the icer from the base case for comparison of strategy 1 versus strategy 2 .
the disutility associated with every unit of bmi over 25 ( 0.006 in the base case ) was a key driver of the results , and excluding it from the analysis caused the icer to rise to sek 661,917 , an 87.3% increase from the base case . while the result of the base case was sensitive to hba1c threshold values , disutility due to mild / moderate hypoglycemia and insulin treatment , and incidence of moderate / major hypoglycemia , in all these cases the icer remained below sek 500,000 ( range : sek 204,517495,368 ) . in the psa ,
the estimated icer was sek 319,217 ( bbc 95% ci : sek 309,849330,212 ) . assuming a wtp of sek 500,000 per qaly gained , strategy 1 had a 74.7% likelihood of being considered cost - effective in comparison to strategy 2.fig .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose results of one - way sensitivity analyses : strategy 1 versus strategy 2 .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose the results of the univariate sensitivity analyses for strategy 1 versus strategy 3 are shown in fig . 4 as percentage changes in the icer from the base case .
the key model drivers were disutility of mild / moderate hypoglycemia , the disutility of insulin and bmi over 25 , and incidence of moderate / major hypoglycemia
. however , in all these cases , the icer remained below sek 500,000 ( range : sek 85,629256,830 ) .
the psa showed that the icer was sek 153,277 ( bbc 95% ci : sek 150,788155,766 ) .
assuming a wtp of sek 500,000 per qaly gained , strategy 1 was expected to have a 100% probability of being cost - effective in comparison to strategy 3.fig .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose results of one - way sensitivity analyses : strategy 1 versus strategy 3 .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose figure 5 displays the results of the univariate sensitivity analyses for strategy 2 versus strategy 3 as percentage changes in the icer from the base case .
the key model drivers were incidence of moderate / major hypoglycemia , the disutility of mild / moderate hypoglycemia , including costs of 7 smbg per week for the dpp-4 inhibitors , and the disutility of insulin .
none of these changes had a significant impact on the cost utility conclusions . moreover , excluding net consumption and productivity loss , and applying the price of the cheapest dpp-4 agent , translated into dominance of strategy 2 versus strategy 3 .
the icer from the psa was sek 40,277 ( bbc 95% ci : sek 37,43643,119 ) .
assuming a wtp of sek 500,000 per qaly gained , strategy 2 was expected to have a 98.1% probability of being cost - effective in comparison to strategy 3.fig .
bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose results of one - way sensitivity analyses : strategy 2 versus strategy 3 . bmi body mass index , ci confidence interval , dpp-4 dipeptidyl peptidase-4 , glp-1 glucagon - like peptide-1 , hba1c glycated hemoglobin , iu insulin units , smbg self - monitoring blood glucose
the authors applied a cohort model ( ihecm - t2 dm ) to examine the long - term costs and health benefits of three different treatment strategies as add - on to metformin monotherapy in a representative sample of t2 dm patients not achieving hba1c < 7% on metformin monotherapy in sweden .
the results show that , assuming a wtp value of 500,000 sek , the treatment strategy with glp-1 agents is cost - effective in comparison to treatment strategies with either dpp-4 inhibitors or nph insulin from both a societal and a healthcare payer perspective . compared with treatment strategies of dpp-4 inhibitors and nph insulin ,
the cost per qaly gained with glp-1 agonists was approximately sek 353,000 and sek 161,000 , respectively .
the results from this study indicate that later transition to nph insulin ( i.e. , as third - line therapy after providing incretin - based therapies ) is cost - effective with the icers less than 200,000 sek .
while there was no significant difference in hypoglycemic episodes between glp-1 agonists and dpp-4 inhibitors , glp-1 agonists were associated with a higher reduction in hba1c and greater weight loss .
these effects influence health outcomes in two ways : first , there is a direct effect in terms of lower cumulative incidence of t2dm - related complications , and second , there is an indirect effect through delay in switching to nph insulin .
the higher reduction in hba1c meant that patients on glp-1 agonists initiated nph insulin therapy later than patients on dpp-4 inhibitors , resulting in fewer expected episodes of hypoglycemia in the lifetime perspective .
these health benefits partly offset the higher price of glp-1 agonists compared with dpp-4 inhibitors , and this is in line with previous modeling studies comparing liraglutide with sitagliptin [ 20 , 6163 ] .
the one - way sensitivity analyses in this study showed that this finding was most sensitive to the disutility due to bmi : assuming no disutility due to bmi > 25 resulted in an icer higher than sek 500,000 per qaly gained .
this is mainly due to significant difference between these two drug classes in weight changes ( 1.8 kg reduction versus no change ) and implies that besides the effects on improved glycemic control , the effects on weight also play important role in cost - effectiveness of treatments in the t2 dm context . in line with a previous study
, this finding suggests that there should be a sub - group of patients with bmi > 25 where treatment strategy with glp-1 agonists is even more cost - effective in comparison to dpp-4 inhibitors .
in particular , a previous study in sweden showed that bmi is a significant predictor of other biomarkers in t2 dm patients .
this implies that taking this association into account might decrease the icer in favor of glp-1 agonists , due to its effect on weight loss .
the results were robust to other assumptions , and the icer remained below sek 500,000 .
the icer reported in the current study is higher than in a previous study in sweden that used the same model to compare liraglutide versus sitagliptin .
differences in utility decrement , the baseline characteristics , and treatment effects might be potential explanations for different icer values .
the icer is also higher than in previous studies in other countries [ 6163 ] . beside differences mentioned earlier
, there are differences in perspective ( societal versus healthcare payer ) , and applied model that limits comparability of this study with previous ones .
all these studies applied the core diabetes model , which mainly uses risk equations from the ukpds outcome model-1 for macro- and microvascular complications .
the authors used a different model ( i.e. , the ihecm - t2 dm ) , which applies different risk equations including swedish - specific macrovascular risk equations [ 2123 , 26 ] . in the comparison of incretin - based therapies against nph insulin , while nph insulin was associated with higher hba1c reduction , it resulted in weight gain and a higher number of hypoglycemic episodes .
the estimated icer of both incretin - based second - line treatment strategies ( 1 and 2 ) remained below sek 500,000 .
this finding is in line with a previous cost utility analysis comparing the dpp-4 inhibitor saxagliptin against nph insulin as add - on to metformin in poland . in these treatment strategies , patients on incretin - based therapies benefit from an extra treatment compared with patients who initiate nph insulin as second - line treatment , and
this finding implies that the health benefits of providing second - line treatment prior to insulin introduction offset the higher prices of these medications .
however , it should be noted that the cost - effectiveness of incretin - based therapies decreased as the hba1c switching threshold value to nph insulin increased .
this implies that as the number of years on these treatments increases , the marginal costs of the treatments outweigh the marginal benefits , and the icer rises .
the similar finding was observed in a previous study in sweden using the same model .
the one - way sensitivity analyses showed that the results were most sensitive to the assumptions related to incidence of hypoglycemia and disutility of hypoglycemia and insulin .
the main strengths of the current study include : applying the baseline characteristics from a large sample of t2 dm patients from routine practice in sweden , using utility decrements for a number of complications from a swedish sample with t2 dm , applying swedish - specific risk equations for macrovascular complications , and extracting treatment effects on the main biomarkers ( i.e. , hba1c and weight ) from a meta - analysis instead of a single clinical trial .
in addition , the authors used hba1c threshold to determine the treatment pathway , reflecting clinical practice and national guidelines .
these strengths improve the external validity and relevance of these results for policy making in the swedish setting .
the results of the current study should be interpreted in light of a number of cautions .
the authors included only hypoglycemia as a treatment - related adverse event in the model .
the results of the 1860-lira - dpp-4 ( liraglutide dipeptidyl peptidase-4 inhibitor ) trial showed no significant difference in other adverse events between liraglutide and sitagliptin .
on the other hand , previous studies [ 30 , 66 ] reported higher episodes of non - hypoglycemia - related adverse events such as nausea for glp-1 and dpp-4 agents compared with insulin glargine
. if insulin glargine and nph insulin are comparable with respect to adverse events , then the authors reported icers in comparing glp-1/dpp-4 against nph insulin are underestimated to some extent .
however , the authors do not expect this to have influenced the final conclusion , as these icers are long way from our assumed sek 500,000 wtp value . as they had no clinical trial data regarding the effects of treatment on diabetes - related complications , the authors applied the commonly used method of using biomarkers ( e.g. , hba1c and weight ) as surrogate markers for these complications .
due to lack of data , the authors did not take into account the possibilities of treatment discontinuation by patients and different annual drifts for different treatments .
however , these are common modeling practices , and the authors tried to consider the possibility of different annual drifts in the psa , assuming a normal distribution for annual drift in biomarkers .
it should be mentioned that their conclusions are based on a baseline hba1c of 7.7% 0.8 , and generalizability to patients with lower and higher hba1c values at baseline is limited .
especially , as it was recommended by the american diabetes association and the european association for the study of diabetes , starting treatment with insulin should be strongly considered for patients with dramatically high hba1c or significant hyperglycemic symptoms . pooling agents into classes ( i.e. , glp-1 and dpp-4 ) implies that agents within a drug class have similar efficacy .
the results of meta - analysis on individual agents in the authors main source ( i.e. , ref . ) supported this assumption and conducting the class - level analysis .
from both a societal and a healthcare payer perspective , treatment with glp-1 agonists is a cost - effective treatment strategy in comparison to dpp-4 inhibitors and nph insulin as second - line therapy among t2 dm patients inadequately controlled with metformin alone in a swedish setting .
supplementary material 1 ( pdf 195 kb ) supplementary material 2 ( pdf 291 kb )
b. eliasson has participated in advisory board for eli lilly , sanofi , msd ; and received payment for lectures by sanofi , msd , and novo nordisk .
this article does not contain any new studies with human or animal subjects performed by any of the authors .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited .
Output:
| introductionthis study aimed to assess the costs and benefits of three alternative second - line treatment strategies for swedish patients with type 2 diabetes mellitus ( t2 dm ) who fail to reach glycated hemoglobin ( hba1c ) 7% with metformin treatment alone : glucagon - like peptide-1 ( glp-1 ) receptor agonists , dipeptidyl peptidase-4 ( dpp-4 ) inhibitors , and neutral protamine hagedorn ( nph ) insulin.methodsa previously developed cohort model for t2 dm was applied over a 35-year time horizon .
data on t2 dm patients on metformin monotherapy with hba1c > 7% were collected from the swedish national diabetes register .
treatment effects were taken from published studies .
costs and effects were discounted at 3% per annum , and the analysis was conducted from a societal perspective .
the robustness of the results was evaluated using one - way and probabilistic sensitivity analyses.resultstreatment with glp-1 agonists was associated with a discounted incremental benefit of 0.10 and 0.25 quality - adjusted life years ( qalys ) and higher discounted costs of swedish krona ( sek ) 34,865 and sek 40,802 compared with dpp-4 inhibitors and nph insulin , respectively .
assuming willingness - to - pay ( wtp ) of sek 500,000 per qaly , treatment strategy with glp-1 agonists was a cost - effective option with incremental cost - effectiveness ratios of sek 353,172 and sek 160,618 per qaly gained versus dpp-4 inhibitors and nph insulin , respectively .
the results were most sensitive to incidence rate of moderate / major hypoglycemia and disutilities associated with insulin treatment , body mass index ( bmi ) , and hypoglycemia.conclusionassuming a wtp of sek 500,000 per qaly , treatment strategy with glp-1 agonists is a cost - effective strategy in comparison to dpp-4 inhibitors and nph insulin among t2 dm patients inadequately controlled with metformin alone in a swedish setting.electronic supplementary materialthe online version of this article ( doi:10.1007/s13300 - 014 - 0080 - 0 ) contains supplementary material , which is available to authorized users . |
PubmedSumm7807 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: as the number of international mega - sports events was increased the athletes and spectators get together in larger numbers .
also , the business sports commerce benefiting host nations and local community has been growing ( smith et al . ,
focus toward the sports events tends to be on the top of the athletes or matches .
however , the other values in the variable sports events should be notified , specially related to its contributions to social change .
the people interactions between the athletes , spectators , or volunteers could be a big issue reflecting the increase of social relationships .
this study searches the role of sporting event in understanding special olympic movement and her contributing to the educational effects on the social rehabilitation of the students with intellectual disabilities .
the analysis of the special olympics ( so ) was done mainly dealing with the sports experiences to the students with intellectual disabilities to find the collaborating efforts to their social rehabilitation by participating on the so events .
volunteers and supporters are another characteristic as an integral part of so and more than millions of people including sponsors or donors are committed to so programs .
coaches , event volunteers , and spectators help the athletes be the best regardless of their disabilities such as the intellectually retarded .
the mission of so is to provide round sports training and athletic competition in the kind of olympic style sport events for the people with intellectual disabilities mainly and including people with developmental disabilities . since 1960 s , so has provided training and sport opportunities for the people with developmental disability ( klein et al . , 1993 ) .
the potentials of children could be leaded by socialization and proper communication in their social growth .
the effective role in children and teenager socialization was found in the activities of sports ( afrooz , 2001 ) .
therefore , the transition from so to special school environment , based sport and recreational program could be the good alternatives in the special school educational curriculum .
( 2001 ) noted the possible transition from so to community based program which suggest the availability of transition to special school as well .
the suggestions of possible application of so were examined by wilhite and kleiber ( 1992 ) that those with mild developmental disabilities could be better served through community based sport and recreation program from so .
most of events and programs in so are appropriately challenged for the participants with moderate to severe activity abilities ( dattilo and schleien , 1994 ) .
( 2015 ) recently examined the prevalence of podiatric conditions so athletes and indicated the dedication of so to empowering people with intellectual disabilities to be changed as physically fit and the sports training for competition in so provided an important resource .
parents who were looking for the balance in the experiences of their children with developmental disabilities knew the participation in both so and community programs could be a good chance for their children .
for example , the skillful performers play roles is dominated while less skillful players are met the limiting opportunities based on physical movements , activity contexts , and their position role .
the gap of skills can be a prominent factor for the children who possess less physical skills to fall further behind their peers at same age group .
the community based activity programs can provide the children with disabilities who continue to gain skill and expertise ( wall , 2004 ) .
if parents and other supporters were not active in the intervention the children and adolescents with developmental disabilities the children could be lead to uninteresting and empty existence ( levy - schiff et al . ,
1990 ) , and as adults who are prone to live in home based boundary with ultimate limited physical activity and passive solitary leisure participation , few friends out of his or her family are interacting with ( jobling , 2001 ) . the active lifestyles may be created by the balanced physical activity for the people with developmental disabilities thereby to provide community based sport event programed in the daily schedule of the individual with disability could not be neglected as same work schedules such as medical appointments or educational needs ( freedman et al . , 1995 ) .
so has been put to the empirical exam dealing with purported physical and motor performance as well as social and psychological outcomes ( castagno , 2001 ; farrell et al .
2004 ) emphasized creating opportunities to participate in the activities administered by self - determined manner which could lead to the well - being of children with developmental disabilities .
because so was illustrated by the family reports of how the social integration , goal setting , self - efficacy , and motivational enhancement including self - awareness of the children with intellectually disabilities were achieved .
the activity programs based on community are sometimes contrasted to so events in the contexts which could be difficult to the children with disabilities due to the high level of skill requirements .
so programs often provided the proper skill expectations and the repeated instructional methods which could be more applicable as an educational program in special school than other programs .
the momentum of the movement of special olympics korea ( sok ) was geared up by the last winter games held in korea because the cognitions of the koreans toward sok were lot changed by the great works of the people served for the games , therefore , the role of sok and its application for the social rehabilitation for the children with intellectual disabilities could be very assistive to set up the appropriate programs for the students in the special schools specified by the population with intellectual disabilities in korea .
so competitions are open to athletes ages 8 and up and in case of young people with intellectual disabilities the category ages 27 is open .
so program mainly concentrated on fun activities that are important to mental and physical growth for the children engage in games and activities .
the better social behavior and skills were evident by the parent s notes after participating in so training and events .
the confidence boost makes it easier for them to play and talk with other children on the playground and elsewhere .
a study by the center for social development and education in boston found that the activities also had the effect of helping children with intellectual disabilities learn routines and approaches to learning , along with how to follow rules and directions .
family members support their athletes to the best of their ability , which may involve attending or volunteering at the events . by being involved
they can boost their athlete s self - esteem and will be looked at as a constant source of encouragement .
special olympics train coaches through the coaching excellence program , which includes partnering with sports organizations .
so movement includes many events that families and volunteers can get involved with , but the biggest event is the law enforcement torch run which can be exampled as a case of curricular application for the students with intellectual disabilities . in the event , many police officers including chiefs , secret service , fbi agents , military police , sheriffs , state troopers , prison guards , and other law enforcement personnel who are wearing their own uniforms participate but those individuals , specially duty related with law enforcement , are felt very friendly for the children with intellectual disabilities . the friendly feeling is a good start to begin the social rehabilitation for the children with disabilities . the social rehabilitation of the children with intellectually disabilities could be well managed by the people in law enforcement torch run .
ahead of a special olympics competition , law enforcement officers carry the torch in intervals along a planned route covering most of the state or country to the site of the opening ceremonies of the chapter or special olympics world summer or winter games .
many researchers expressed the effects of so and its educational values wherever reviewing the variable factors related to the information about the social relations and the possibilities to improve the sociability of the children with intellectual disabilities . in conclusion ,
the role of so and its application for the sociability of the children with intellectual disabilities would be meaningful in the curriculum and the teaching methods for the student in the special schools in korea .
Output:
| the purpose of this study was to apply special olympics ( so ) movement and its curricula events to the social rehabilitation of the students with intellectual disabilities in korean special school .
so is the sport organization for the people with intellectual disabilities enjoyed by the athletes more than 4.4 million in 170 countries .
the role of so has been expanded and its value was increased in effecting social change and promoting social contact between the people with intellectual disabilities and the individuals without disabilities .
many researchers proved the effects of so program for the individuals with intellectual disabilities to become physically and mentally appropriately fit to the society , therefore , those programs could be the educational resources in korean special school . |
PubmedSumm7808 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in cell systems , magnesium represents an abundant species as it is present in the millimolar range ( 2 ) . in line with this , it is largely utilized for electrostatic stabilization and electrophilic activation of substrates by polarization of x o ( x = p , c ) bonds .
a special case is represented by water , which can be bound rather efficiently in the inner sphere coordination and is available for catalytic complex hydration as well as for hydrolytic processes .
this is most likely related to mg ability to form stable complexes with phosphate - containing species , including atp , which is normally associated with the metal ion when acting in a physiological environment ( 1,3 ) . moreover , essential biomacromolecules such as dna and rna efficiently bind to mg as it participates in neutralization of the polyanionic charge of the nucleic acid .
in fact , this metal ion is characterized by a small atomic radius ( 0.72 ) and an elevated hardness , which makes it especially suitable for coordination to oxygen atoms , which are hard ligands ( 36 ) . as a corollary of reduced ionic dimensions ,
outer - sphere mechanisms , in which the substrate is connected to the enzymatic machinery through solvent bridge(s ) , are often operating to deal with coordination problems . in this connection
, a hydrogen bonding network often serves for catalytic activation and proper presentation of the reacting species .
an interesting issue arising from biochemical and biophysical studies has to do with the number of metal ions participating in hydrolytic processes involving the phosphodiester bond in nucleic acids ( 5,7 ) .
there is not a unique metal ion : enzyme stoichiometry reported for dna - processing enzymes such as nucleases ( 8) . indeed one , two or three metal ion - mediated mechanisms are currently proposed . among these
, a widely accepted mechanistic model envisages the concerted action of two mg ions located closely to each other and eventually sharing common coordination sites in the protein ( 9 ) .
notable examples are t4 rnase h , t5 5-exonuclease , endonuclease v as well as other restriction endonucleases ( 1014 ) .
two - metal ion mechanisms in non - redox processes bear a number of advantages over processes involving a single ion ( 1517 ) :
activation barriers arising from nuclear reorganization of the solvent and the enzyme can be reduced in binuclear versus mononuclear centres having the same net charge , due to greater charge delocalization.polyatomic substrates can generally be accommodated better at binuclear centres.electrostatic activation of substrate or ionization of a proton from an active - site water molecule will occur more readily at a charged binuclear centre , than at the corresponding mononuclear one . the binuclear electrostatic effect is estimated at least 3 pk units to the free energy of dissociation of a proton from a water ligand compared to the corresponding mononuclear aquo species.formation of a low - energy transition state , for example the negatively charged trigonal - bipyramidal transition state formed during phosphodiester bond hydrolysis ( 2 net charge ) by nucleases and rnase h , is predicted to be energetically favoured by symmetrical coordination of the axial ligands to the metal ions of a binuclear centre .
this geometry is achieved in exonucleases via formation of two bidentate bridges involving an equatorial phosphate o atom .
the second metal ion in binuclear complexes can attenuate the strength of the bridging - ligand field potential as shown by epr studies on mn , an ion which can often replace magnesium in nucleic acid processing enzymes .
a weakened bridging - ligand field potential may enhance the binding affinity to other ligands , above all water , thereby increasing the lewis acidity ( 17 ) .
activation barriers arising from nuclear reorganization of the solvent and the enzyme can be reduced in binuclear versus mononuclear centres having the same net charge , due to greater charge delocalization .
electrostatic activation of substrate or ionization of a proton from an active - site water molecule will occur more readily at a charged binuclear centre , than at the corresponding mononuclear one .
the binuclear electrostatic effect is estimated at least 3 pk units to the free energy of dissociation of a proton from a water ligand compared to the corresponding mononuclear aquo species .
formation of a low - energy transition state , for example the negatively charged trigonal - bipyramidal transition state formed during phosphodiester bond hydrolysis ( 2 net charge ) by nucleases and rnase h , is predicted to be energetically favoured by symmetrical coordination of the axial ligands to the metal ions of a binuclear centre .
this geometry is achieved in exonucleases via formation of two bidentate bridges involving an equatorial phosphate o atom .
the preference for mg should result from the chemical environment and the need for placing two metal ions at a distance of 4 . the stringent requirement for two mg coordination is likely to be the basis for catalytic specificity by the two - metal ion mechanism .
in fact , unlike other divalent ions , two mg ions can be optimally coordinated at the appropriate distance ( between 3 and 4 ) to facilitate phosphoryl transfer .
in contrast , catalytic specificity of one - metal ion - dependent nucleases , for which metal requirement and substrate specificity are less severe , seems to derive from substrate binding .
nevertheless , a link between one- and two - metal ion catalysis has been very recently proposed ( 18 ) .
in fact , structural and functional analysis of nucleotidyl transfer enzymes shows that the two apparently unrelated types of mechanism share a catalitically equivalent metal ion , the second metal ion being eventually replaced by a basic amino acid in the one - metal ion systems . an additional interesting aspect of mg - mediated biochemical reactions involving nucleic acid cleavage is the possibility of a moving metal mechanism in which one of the mg ions moves from a more buried to a more exposed site as a result of the structural and electronic changes that occur during substrate cleavage .
in fact , based on the different positions of the metal ions at the ecorv active site a catalytic mechanism using two metal ions in three different positions has been proposed ( 19,20 ) .
further studies on the mechanism of t5 flap endonuclease are also consistent with a two - metal ion process for chemical catalysis .
however , the overall biochemical process carried out by this enzyme is more complex and apparently requires three ions to be completely rationalized ( 21 ) .
they participate in essential cellular processes , such as dna replication , transcription and chromosome condensation , which require enzymes able to regulate the ensuing topological changes produced in the nucleic acid .
their biological , biophysical and structural properties have been carefully reviewed and their molecular mechanism(s ) of action thoroughly described ( 22,23 ) .
briefly , topoisomerases produce a topological change in a dna chain by the unwinding or the supercoiling of the double helix thereby releasing the torsional strain imposed by dna processing .
this can occur only by transient formation of a break along the dna phosphodiester backbone , followed by strand passage through the gate and finally by the resealing of the backbone break .
the topoisomerase - mediated cleavage process consists of a nucleophilic attack of a tyrosine residue located in the catalytic pocket to a phosphodiester bond of the nucleic acid backbone .
the transphosphorylation reaction produces a covalent protein nucleic acid linkage and a free hydroxyl moiety at the split deoxyribose group .
the topological change is generated by controlled rotation of the cleaved strand around the intact filament or by strand passing of a dna filament through the gate produced by cleavage .
this is followed by the resealing of the original bond through phosphoryl transfer from the tyrosine residue to the split deoxyribose hydroxyl .
dna linkage concludes the catalytic cycle ( 24,25 ) . depending upon the number of dna strands involved in the cleavage reaction topoisomerases
can be divided into type i ( single - strand break ) and type ii ( double - strand break ) .
each cellular organism contains at least one type i and one type ii topoisomerase component .
further categorizations take into account the proteins amino - acidic sequence and structure , the reaction mechanism and the sugar position ( 5 or 3 ) at which the protein becomes covalently linked to the nucleic acid through the phosphate group .
table 1.principal biochemical features of the dna topoisomerasestypesubfamilynameorganism(s)atp requiredmg requiredlinkage to tyrosinemechanismtoprimiiatopo ieubacteria , archaea , plants/+5strand passageyestopo iiieubacteria , archaea , eukaryotes/+5strand passageyesreverse gyraseeubacteria , archaea++5strand passageyesibtopo ieukaryotes , viruses , plants//3controlled rotationnoictopo varchaea//3controlled rotationnoiiiiatopo iieukaryotes++5strand passageyesgyraseeubacteria , archaea , plants++5strand passageyestopo iveubacteria++5strand passageyesiibtopo viarchaea , plants++5strand passageyes principal biochemical features of the dna topoisomerases interestingly , topoisomerase ia and topoisomerase ii bind covalently to the 5-phosphoryl group of the cleaved dna , whereas topoisomerases ib and ic are linked to the 3-phosphoryl group .
atp ( type ii family and reverse gyrase ) regulates the conformational changes required for enzyme action through binding and hydrolysis processes .
divalent metal ions , essentially mg , are also important as they perform both structural and catalytic functions , besides acting in complex with atp .
in fact , topoisomerase ia and topoisomerases ii require mg to relax supercoiled dna ( 22,26 ) . in the case of the type
ib enzymes a metal ion is not required to participate in the catalytic cycle and does not directly bind the protein .
however , mg effectively stimulates catalytic activity , probably facilitating the rate - limiting dna - release step at the end of the enzymatic cycle ( 27,28 ) .
mg can assist the transphosphorylation process in several ways , as summarized in figure 1 .
in fact , it can operate according to a general base ( outer sphere ) mechanism , stabilize the incoming negative tyrosinate species , neutralize the pentacoordinate negatively charged transition state and/or assist in the stabilization of the negatively charged leaving group ( 3 ) .
even if a number of investigations have been performed to simulate nucleic acid hydrolytic processes , no accurate quantum mechanical studies on this metal ion - mediated process are available as yet .
in particular , it would be of interest to fully understand the factors that induce preferential attack of outer sphere tyrosine versus inner sphere water in topoisomerases , the reverse occurring in the related class of nucleases .
indeed , conserved tyrosine residues are often located in the active site of dna nucleases and polymerases ( klenow fragment , t5 flap endonuclease , staphylococcal nuclease ) , yet they do not appear to participate in catalysis but aid stabilizing ternary complex formation .
this is an example of how nature can effectively produce different catalytic effects by enabling enzymes to perform distinct chemical reactions even in the presence of essentially the same functions at the active site .
figure 1.roles of mg in topoisomerase - mediated transphosphorylation catalysis : ( a ) activation of attacking nucleophile ( outer sphere ) ; ( b ) stabilization of tyrosinate ; ( c ) stabilization of transition state ; and ( d ) stabilization of leaving group .
roles of mg in topoisomerase - mediated transphosphorylation catalysis : ( a ) activation of attacking nucleophile ( outer sphere ) ; ( b ) stabilization of tyrosinate ; ( c ) stabilization of transition state ; and ( d ) stabilization of leaving group .
starting from the above mentioned mechanistic similarities in phosphodiester processing enzymes and from biochemical evidence , iterative profile searches were extended to a number of enzymes including dnag - type primases , small primase - like proteins from bacteria and archaea , type ia and type ii topoisomerases , bacterial and archaeal nucleases of the old family and bacterial dna repair proteins of the recr / m family ( 29 ) .
these studies revealed a conserved domain spanning about 100 residues , called toprim , characterized by the invariant presence of a glutamate residue and an aspartate - x - aspartate ( dxd ) motif .
a structurally similar arrangement is observed at the level of the dxd element . as a consequence of toprim folding ,
the three acidic residues get close in space and become available for concerted interactions , as confirmed by the x - ray crystallographic studies of several toprim - containing enzymes , including the saccharomyces cerevisiae topoisomerase ii ( figure 2 ) ( 30 ) .
given its chemical nature and the requirement for mg , the triad motif has been proposed to represent the metal ion(s ) binding element in the catalytic core .
( a ) schematic representation of the location of the conserved aspartate and glutamate residues with blue arrows representing tracts of -barrel secondary structures and red cylinders helical arrangements .
( b ) three - dimensional structures of the dxdxd and e catalytic toprim residues coordinated to a mg ion in s. cerevisiae topoisomerase ii bound to dna ( obtained from the pdb i d 2rgr ) .
( a ) schematic representation of the location of the conserved aspartate and glutamate residues with blue arrows representing tracts of -barrel secondary structures and red cylinders helical arrangements . ( b
) three - dimensional structures of the dxdxd and e catalytic toprim residues coordinated to a mg ion in s. cerevisiae topoisomerase ii bound to dna ( obtained from the pdb i d 2rgr ) .
the fact that both atp - dependent and -independent topoisomerases , previously considered to be very diverse , share a common catalytic domain with a conserved glutamate plus dxd motif indicates that they basically share a unified reaction mechanism , with the single exception of topoisomerase ib ( 31 ) , which was already shown to stand alone in the topoisomerase family ( table 1 ) .
moreover , a distinct structural , functional and evolutionary relationship between topoisomerase ib and site - specific recombinases has been demonstrated ( 32 ) , confirming that this family is indeed unrelated to the toprim domain - containing topoisomerases .
the details of toprim interactions with divalent ions and the mechanistic and catalytic consequences of metal ion binding have been the object of several investigations both on topoisomerase ia and ii families .
the positions of the key catalytic residues for several members of the above families are schematically presented in table 2
.
table 2.sequence alignment of the catalytically relevant residues in toprim - containing topoisomerasestype iagluasp asp glutyrchain length topo i ( e. coli)9111 113 115319865 topo i ( y. pestis)9117 119 121325871 topo iii ( e. coli)7103 105 107328653 reverse gyrase ( a. fulgidus)512631 633 6358091054type iiagluasp asp asptyrchain length topoii ( human )454541 543 5458051531 topoii ( human )477557 559 5618261626 topoii ( s. cerevisiae)450527 529 5317821428 gyrase ( e. coli)gyrb424498 500 502gyra122804 + 875 topoiv ( e. coli)pare418490 492 494parc120630 + 752type iibtyrglu asp aspchain length topovi ( sulfolobus shibatae)subunit a106209 261 263389gyrase , topoisomerase ivand topoisomerase vi consist of two subunits .
sequence alignment of the catalytically relevant residues in toprim - containing topoisomerases gyrase , topoisomerase ivand topoisomerase vi consist of two subunits .
early studies on the ia subfamily of type i dna topoisomerases confirmed the importance of magnesium as a cofactor in enzyme activity .
in fact , the classical toprim sequence is reinforced by the generally found dxdxe motif ( 33,34 ) , which contains a further acidic glutamate to grant more efficient metal ion binding , possibly allowing greater structural adaptability of the toprim complex and more efficient transphosphorylation catalysis ( 35 ) .
a positive relationship was found between the relaxation activity of the escherichia coli enzyme and the concentration of mg from 0 mm to 10 mm , with near saturation of the metal requirement at 2.5 mm ( 36 ) .
subsequently , the enzyme was found to be able to bind stoichiometric amounts of mg , producing a stable metal enzyme complex .
this promoted the relaxation of negatively supercoiled dna and produced dna cleavage without further addition of mg , inferring that mg ions could bind to specific site(s ) on the enzyme even in the absence of the dna substrate .
this suggested that the contact of the metal ion to one or more dna phosphates might occur through replacement of at least one of the original protein
mg coordination bonds , yet still allowing catalysis without the need for extensive ion - mediated protein dna interactions . among protein residues ,
glu-9 , asp-111 , asp-113 and glu-115 appeared to be the likely candidates involved in mg binding ( 34 ) .
surprisingly , site - directed mutagenesis producing alanine substitution in several strictly conserved key residues showed that , in the toprim domain , only substitution at glu-9 was able to affect the transesterification process ( 37 ) .
the conclusion followed that mg is mainly required for conformational changes in the enzyme dna complexes rather than for dna strand cleavage and rejoining and that the amount of mg required for removal of negative supercoils is much higher than that for dna rejoining .
notably , asp-113 was not selected for mutagenesis in this case , which might imply that metal ion binding is compatible with just one of the acidic groups in the dxd sequence .
this issue was considered by investigating asp-111 and asp-113 double mutants , which were found to lose over 90% of their activity in the relaxation assay in the presence of mg .
in addition , metal ion concentrations well above those used for the wild - type enzyme ( and therefore inhibitory ) were needed by double mutants for maximal relaxation activity .
inductively coupled plasma analysis showed the loss of 12 mg ions per enzyme molecule due to mutation , consistent with a 1:1 or 2:1 metal ion : topoisomerase stoichiometry in the wild - type enzyme .
these results demonstrate a functional role for the acidic residues in the binding of mg to induce the conformational change required for the relaxation of supercoiled dna ( 33 ) .
another interesting mutant in toprim domain was characterized by yersinia pestis topoisomerase i. indeed , from sequence analysis and site - directed mutagenesis , it was shown that changing a single strictly conserved gly residue to ser ( g116s ) in the y. pestis topoisomerase i ( or in the corresponding position of the e. coli enzyme ) can result in a mutant enzyme that entails sos - inducing and cell - killing properties through a stabilization of the covalent complex with dna ( 38 ) .
the purified enzyme lost relaxation activity , yet it still formed a covalent complex and retained the ability to cleave dna .
these results suggest that a mutation close to the dxd diad could interfere with mg binding and so impair the enzyme re - ligation step .
perhaps , this might happen because the ser oh displaces the deoxyribose hydroxyl from its correct location in the metal ion coordination sphere .
hence , perturbation of the active site region of bacterial topoisomerase i can result in stabilization of the cleavage complex , thereby producing bacterial cell death in a similar way to eukaryotic topoisomerase poisons .
several other mutants at the toprim glycine of y. pestis topoisomerase i were examined ( 39 ) . while the gly to ala substitution allowed both dna cleavage and re - ligation , the 17 amino acid substitutions subsequently tested completely suppressed dna cleavage activity .
this is apparently a consequence of the steric hindrance generated when replacing the small and flexible , strictly conserved , gly side chain with larger groups . on the other hand ,
activity retained by the ser mutant could be remarkably increased by introducing a second mutation on the met residue adjacent to the active site tyrosine .
induction of the double mutant topoisomerase resulted in up to 40-fold increase in cell killing rate when compared to the single gly116ser mutant .
fluorescence studies monitoring tryptophan emission upon addition of mg indicated very similar mg - binding affinity of the double mutant with reference to the single mutant .
accordingly , the relaxation activity of the double mutant did not increase by increasing mg concentration in the relaxation reaction buffer .
hence , reduced re - ligation has nothing to do with impaired metal ion binding , but with structural changes in the toprim sequence .
introduction of a new positive charge into the active site was achieved by producing a met to arg substitution next to the nucleophilic tyrosine .
the mutant topoisomerase i showed a shift to basic ph values for optimal activity and a decreased mg binding affinity .
as might be expected , the electrostatic potential map of the minimized mutant structure showed a significant increase in positive electrostatic potential with concomitant decrease in electron density at the level of the acidic triad .
these changes in electrostatic potential in the active site region due to the met to arg substitution are clearly expected to affect the mg binding affinity of the mutant topoisomerase and inhibit dna re - ligation .
given the close similarity in the catalytic metal ion binding domain and the mg requirement for activity , the results obtained with type ii topoisomerases correlate well with those previously discussed for type ia enzymes .
the role of divalent metal ions in eukaryotic topoisomerase ii - mediated reactions was recognized long ago ( 4143 ) .
magnesium ions were found to promote enzyme substrate interactions in at least two ways : ( i ) direct involvement in enzyme - mediated dna cleavage reactions and ( ii ) participation in atpase reactions and functions by providing the enzyme with a magnesium atp substrate .
in contrast , the divalent cation did not affect the quaternary structure of the enzyme as shown by sedimentation velocity experiments in the presence / absence of mg .
in addition , it did not affect the site - specificity of topoisomerase ii binding to dna , nor did it interfere with the enzyme 's ability to discern the topological state of its nucleic acid substrate .
it is useful to note that in the topoisomerase ii family the dxd motif is generally extended to a dxdxd conserved pattern that offers an additional carboxylic site to generate a structural and electronic network for coordination and correct positioning of the catalytically relevant magnesium ion(s ) once more in a similar way to the ia family characterized by the dxdxe motif ( 29,33 ) .
mutagenesis studies were performed on the human topoisomerase ii -isoform in the breakage - reunion domain containing the highly conserved acidic residues . in particular , a glu 477 to gln mutation was found to greatly impair both dna decatenation and relaxation activity .
in addition , it reduced the level of cleavage by more than two orders of magnitude and magnesium concentration had to be increased for dna damage detection .
strand passage also required higher concentrations of the metal ion in the mutant with reference to the wild - type enzyme .
this was considered as evidence for a reduced binding affinity of the topoisomerase to the magnesium ion(s ) required for dna cleavage .
the above findings also highlight the participation of glu477 in metal ion coordination during catalysis ( 44 ) .
the prokaryotic topoisomerase , gyrase , was also examined in terms of mg effects on the enzymatic functions of dna cleavage and re - ligation using site - directed mutagenesis .
the toprim acidic residues glu424 , asp498 , asp500 and asp502 , located in the b - subunit , were mutated separately to alanine . besides the above mutations , the glutamate 424 and the aspartate 498 residues were mutated to glutamine and asparagine , respectively ( 45 ) .
as expected , these residues were found to play an important role for the cleavage re - ligation reaction .
in fact , the activity of all mutants was reduced significantly to between 4% and 20% of the wild - type enzyme and , remarkably , it showed a dependence upon metal ion concentration which was modified in comparison to the wt activity profile . a notable decrease in dna cleavage
was also detected for the mutant enzymes when compared to their wt counterpart in the presence of gyrase poisons ( quinolones ) or calcium ions which are known to produce effects similar to the drugs .
also , a substantial increase in mg concentration was required to detect cleavage in the absence of poisons . to note , mutations were able to alter metal ion specificity and , using magnesium and calcium ions , the actual enzyme activity measured in the presence of both metals was greater than the sum of the individual metal ion concentration dependencies .
the conclusion follows that at least two metal ions participate in the gyrase - mediated dna cleavage rejoining processes .
a model applicable to type ia and type ii topoisomerases ( and to other enzymes containing the toprim fold ) has been proposed for this process , according to which polarization of the tyrosine residue and stabilization of the 3-hydroxyl group are mediated by mg . in the two - metal ion model , one mg stabilizes the pentacovalent phosphate transition state as well as the 3- oxyanion group to make it a better leaving group .
the other metal ion stabilizes the negatively charged transition state , and polarizes the attacking tyrosine residue , so as to render it more susceptible to deprotonation .
this corresponds to the modes of metal ion participation in the catalytic events depicted in figure 1 .
both ions are coordinated to the toprim acidic residues , thus forming an organized structural network close to the active tyrosine and appropriate for processing the nucleic acid phosphodiester linkage .
the dna - rejoining reaction is considered to proceed similarly , with the first ion activating the 3-hydroxyl group and the second facilitating the leaving of the tyrosine residue in a multi - centred relay mechanism .
for a deeper insight into the metal ion effects on dna gyrase activity , the enzyme b subunit , its 43 kda and 47 kda domains , and two mutants in the toprim domain ( asp498ala and asp500cys ) were examined in a biophysical study ( circular dichroism and protein melting experiments ) ( 46 ) .
it turned out that mg ions did not modify the conformational properties of the enzyme subunit at room temperature , but were able to produce selective and differential effects on protein stability .
in particular , the protein 's melting profiles were generally shifted towards lower temperature , showing that divalent cations produced destabilizing effects on gyrase b folding .
these effects were essentially located in the 47 kda c - terminal domain , containing the toprim sequence . melting studies on the gyrase b mutants showed that the asp498 mutant had little effect on the binding of magnesium , whereas the asp500 mutation impaired mg affinity to a large extent , suggesting effective contacts between this residue and the metal ion in the wild - type enzyme .
hence , the toprim domain is confirmed as the principal selective site for metal ion complexation .
these results point to a double role played by divalent metal ions in the catalytic steps in which the dna gyrase b subunit participates : a direct involvement of cations bound to the toprim domain in the dna cutting rejoining process and a striking increase in protein flexibility produced by ion binding .
the latter event facilitates the huge conformational changes essential for the catalytic cycle to be performed and possibly allows the toprim domain to be properly positioned relative to the tyr122 residue in the active form of the enzyme . on the other hand ,
the gyra subunit was much less prone to structural modifications upon addition of divalent ions .
however , it is worth recalling that a glu84pro mutation in parc , the gyra equivalent in topoisomerase iv , inhibits the formation of covalent topoisomerase iv
dna complexes when mg , but not ca , is used as a cofactor ( 47 ) .
this points to the participation of residue 84 in interactions with magnesium , the mutation possibly affecting the coordination of the divalent cation in the topoisomerase iv dna complex
. however , no mg was found in the crystal structures of gyra or corresponding topoisomerase ii sequences . on the other hand
, the presence of the target dna might be required to allow glu84 ( or its equivalent in gyra ) to participate in metal ion - mediated interactions within the cleavable complex .
this general issue was raised during an investigation on the effects of the presence of the nucleic acid in complex with reconstituted dna gyrase ( 48 ) .
the addition of divalent metal to the reconstituted enzyme required higher metal ion concentrations to produce structural changes comparable to those in gyrb , which confirms a supposed scaffold role of gyra in regulating the overall enzyme structure .
chiroptical studies showed two distinct conformational changes in the presence of mn ( a metal ion conferring full activity to the enzyme ) , which points to the presence of at least two discrete metal ion binding sites , each affecting protein folding to a different extent . combining this and the previous information obtained
using gyrb suggests that the two distinct conformationally relevant binding events occur in the toprim region .
the first structural transition is associated to a 1:1 stoichiometry , while the subsequent conformational change probably corresponds to the second coordination event .
most interestingly , however , the catalytically significant coordination arrangement can be observed only in the presence of the dna chain , which points to an active role played by the nucleic acid within the gyrase catalytic complex .
apparently , the polynucleotide substrate represents a crucial component in properly recruiting the metal ion cofactors necessary to correctly perform the cleavage rejoining cycle of the type ii enzyme .
moreover , the data obtained after reconstitution of gyrase with two gyrb mutants underline a differential role played by residues at position 498 and 500 .
it is proposed that residue asp498 participates in the coordination sphere of the second metal ion , whereas residue asp500 is mainly involved in the first complexation event .
the crystal structure of the dna binding and cleavage core of s. cerevisiae type iia topoisomerase bound to prospective gate - segment dna has been recently reported and the structural organization of the catalytic site dissected at atomic resolution ( 30 ) .
interestingly , a magnesium ion is modelled at the level of the toprim glu450 , asp527 and asp 529 residues , essentially confirming the coordination scheme thus far discussed .
this would at first glance contradict the two - metal ion mechanism discussed above and supported by convincing evidence in both type ia and type ii topoisomerases .
conceivably , a second metal ion could be accommodated in the catalytic site of the yeast topoisomerase , but is probably missing in the crystal structure because of the absence of a scissile phosphate in the cleavage position of the oligonucleotide substrate .
indeed , as suggested by recent work ( 48 ) , the second metal ion needs the presence of the ( scissile ) dna phosphate to be appropriately coordinated in the catalytic pocket .
the proposed mechanism appears to hold also for the human type ii topoisomerase as reported in a very recent investigation using a series of divalent metal ions with varying thiophilicities in conjunction with dna cleavage substrates in which the 3-bridging oxygen of the scissile bond is replaced by a sulphur atom ( 49 ) .
critical interactions between the divalent cations and the latter bond , important for the dna cleavage event mediated by the enzyme , were determined using the thiolated substrates .
kinetic measurements carried out on the above substrates using different cationic species alone or in combination strongly suggest that two divalent metal ions are required for catalysis .
amino acids likely to interact with the metal ions in the active site of topoisomerase ii are asp541 , asp543 , asp545 ( dxdxd motif ) and glu461 .
conceivably , one of the divalent cations binds the 3-phosphate oxygen to facilitate the cleavage event , while the other is postulated to stabilize the dna transition state and/or help deprotonate the active site tyrosine ( figure 1 ) .
the results thus far discussed show unambiguously that divalent metal ions , particularly magnesium , play a major , indispensable role in promoting the dna cleavage rejoining activity of topoisomerases through both participation in the catalytic events and assistance in the appropriate structural changes to assemble / disassemble the active site .
interestingly , in both ia and ii enzymes the metal ions are tightly anchored to the protein backbone through four conserved , closely located , carboxyl side chain residues ( asp , glu ) , more abundant than other toprim - containing enzymes . considering that topoisomerases perform two sequential phosphoryl transfer reactions with large conformational changes in - between ,
this might be related to the need to keep the 3-oh end produced by the cleavage reaction firmly connected to the acidic sequence , hence in place to perform re - ligation ( 34 ) .
it is worth considering a key difference in the relaxation step between type ia and ib topoisomerases .
in fact , while type ia enzymes perform a strand passage mechanism changing the linking number one by one , type ib enzymes conduct multiple linking number changes by a free rotation mechanism . apparently , participation of the metal ion grants stricter control in the resealing of the cut dna strand each time strand passage occurs .
this is reasonable considering the multiple coordination ability of mg when compared to the proton relay catalytic mechanism characteristic of the ib topoisomerases ( 50 ) .
hence , it appears that a very organized ionic network is formed close to the transphosphorylation centre , connecting the anionic centres in toprim and the anionic centre in the nucleic acid through divalent ( magnesium ) ions .
remarkably , this is true also for dna gyrase for which toprim is located in one subunit and the active tyrosine in the other .
a two - ion model is generally suggested for toprim containing type ia and type ii enzymes ( 33,45,48,49 ) .
this probably facilitates a relay - like mechanism , in which the two metals are possibly not fixed in space , but may undergo coordination rearrangements to cope with the different spatial and electronic requirements for proper support of the cleavage and , subsequently , the rejoining process . considering that the second mg is probably recruited by the nucleic acid binding to the enzyme , only one ion could be constitutively associated to the enzyme .
this tightly bound magnesium would explain the discrepancies deriving from reports questioning the absolute requirement of the metal ion in the phosphodiester cleavage process .
in addition to increasing relaxation activity in topoisomerase ia , increasing mg concentration also produces changes in the dna cleavage patterns ( 51 ) .
this behaviour is not simply explicable in terms of the two - ion mechanism , but might be related to progressive changes in plasmid conformation ( winding ) caused by the metal ion ( 52 ) , which is known to bind efficiently to the nucleic acid producing tightly bound ion pairs ( 53 ) .
protein conformational changes at metal ion concentrations well above physiological could additionally contribute . in connection with this ,
another invariant finding in ion - mediated topoisomerase function is the bell - shaped dependence of the cleavage process efficiency upon divalent ion concentration .
this is probably the result of the competition between different binding events involving the three partners ( topoisomerase , dna and ion ) .
as mentioned above , both the protein and the nucleic acid efficiently bind divalent metals .
we can therefore envisage the formation of binary topoisomerase metal and dna metal complexes , along with the productive ternary complex . upon increasing metal ion concentration
, ternary complex formation continues to increase up to the point at which the splitting of this complex into two binary systems occurs simply according to mass law .
in fact , the process
is obviously shifted to the right by increasing the concentration of the metal ion above a given threshold .
this is determined , besides the concentrations of the interacting species , by the relative affinities of the metal for ternary versus binary complexes and is further confirmed by the fact that different metals exhibit different concentration windows for optimal cleavage .
it is , however , worth mentioning that active site - mutated type ia topoisomerases still exhibit single - stranded dna ( ssdna ) binding ability which is not affected by mg .
since the metal ion is likely to bind a double - stranded nucleic acid more tightly than a ssdna due to the higher charge density exhibited by the former ( 54 ) , the metal ion concentration required to split the ternary complex in topoisomerases ia could be significantly higher in comparison to that required in topoisomerases ii .
moreover , type i and type ii enzymes could be further conformationally affected to different extents by increasing ionic strength , thus exhibiting distinct profiles of inactivation as a function of added metal ion . as pointed out above , a great deal of information on the molecular mechanisms of the action of topoisomerases has been gained not only by site - directed mutagenesis , but also by changing the nature of the catalytic metal ion .
in particular , both ca and mn were able to modulate enzyme activity and allowed the fine details of the mode of action to be understood ( 48,49 ) . like magnesium
it is characterized by a larger ionic radius ( 1 ) , hence a lower charge density and a higher flexibility to accommodate ligand groups in its coordination sphere ( 55 ) .
these properties render it less effective in transesterification catalysis , in particular in the re - ligation process .
the functional role of mn rests on its properties as a lewis acid and an electrostatic stabilizer .
it represents a good substitute for mg due to the similar length of its radius ( 0.83 ) and its borderline hard
the latter feature can be helpful to detect specific contacts between the enzyme or the nucleic acid species since substitution of oxygen atoms with sulphur ( or introduction of sulphur - containing groups ) would substantially enhance manganese binding .
these important details of the two - metal ion model would not be available without metal ion replacement studies . not only do divalent metal ions participate in topoisomerase catalysis , but they might also play a role in enzyme poisoning .
in fact , a number of topoisomerase ii - directed drugs ( no compound aimed at topoisomerase ia has been thus far described ) , including quinolones ( 57 ) , quinobenzoxazines ( 58 ) , bisbenzoxazoles , ( 59 ) anthraquinones ( 60 ) , anthracyclines ( 61 ) and epipodophyllotoxins ( 62 ) have been reported to participate in metal ion binding ( in many instances mg ) when forming stable complexes with biological macromolecules .
it is conceivable that metal ion binding ability can be exploited when the drug is sitting in the cleavage complex and inhibits the dna resealing process
. it would not be surprising that metal - chelating groups of the drug molecules participate in the mg coordination sphere , displacing the 3-hydroxyl ligand from proper positioning and also reducing favourable electronic effects thus enhancing the activation energy barrier in the dna resealing step .
further investigations are warranted to dissect this point and to assess its potential use in rational drug design and development . in this connection ,
topoisomerase ia might be exploited as a novel target for antibacterial action by developing small molecules able to specifically interfere with the mg - dependent re - ligation process .
this would be beneficial for successful treatment of bacterial infections resistant to current topoisomerase ii inhibitors ( 63 ) . to confirm that such a strategy might be rewarding ,
a similar approach has proven fruitful in the inhibition of divalent ion - dependent strand transfer by hiv-1 integrase .
in fact , raltegravir , which acts by chelating the ion cofactor(s ) located at the active site of this enzyme , has recently been approved by the u.s .
therefore , a detailed knowledge of metal ion participation in topoisomerase - related processes might not only hold mechanistic relevance , but also open new avenues for targeted therapeutic intervention . in conclusion ,
type ia and type ii topoisomerases perform their catalytic job with a mechanism resembling several other types of dna - processing and rna - processing enzymes including dna - and rna - polymerases , restriction endonucleases , transposases , primases and integrases ( 16 ) .
interestingly , the apparently divergent functions of these enzymes exhibit a substantially conserved reaction pattern , which can yield a unified view of the making and cleaving phosphodiester bond reactions in nucleic acids .
in fact , divalent ions , almost invariably magnesium in the two - ion mechanism , are required to allow and modulate polarization of the reacting phosphate group to facilitate some of the fundamental biochemical processes needed for cell life and proliferation .
these ions are firmly held in the catalytic pocket by carboxylate groups belonging to invariant aspartic / glutamic acid residues and are ready to coordinate the dna / rna substrate to produce an activated complex .
interestingly , topoisomerases perform both the cleaving and rejoining step alternatively produced by the other enzymes , in this connection representing the bridge between the phosphodiester bond makers and disrupters and confirming that common active site chemical and structural features have evolved to govern apparently opposite biochemical processes for nucleic acids manipulation .
padova university ( grant number cpda078422/07 ) and associazione italiana per la ricerca sul cancro .
funding for open access charge : padova university ( grant number cpda078422/07 ) and associazione italiana per la ricerca sul cancro .
Output:
| the catalytic steps through which dna topoisomerases produce their biological effects and the interference of drug molecules with the enzyme
dna cleavage complex have been thoroughly investigated both from the biophysical and the biochemical point of view .
this provides the basic structural insight on how this family of essential enzymes works in living systems and how their functions can be impaired by natural and synthetic compounds . besides other factors
, the physiological environment is known to affect substantially the biological properties of topoisomerases , a key role being played by metal ion cofactors , especially divalent ions ( mg2 + ) , that are crucial to bestow and modulate catalytic activity by exploiting distinctive chemical features such as ionic size , hardness and characteristics of the coordination sphere including coordination number and geometry .
indeed , metal ions mediate fundamental aspects of the topoisomerase - driven transphosphorylation process by affecting the kinetics of the forward and the reverse steps and by modifying the enzyme conformation and flexibility .
of particular interest in type ia and type ii enzymes are ionic interactions involving the toprim fold , a protein domain conserved through evolution that contains a number of acidic residues essential for catalysis . a general two - metal ion mechanism is widely accepted to account for the biophysical and biochemical data thus far available . |
PubmedSumm7809 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: pg ( mw 10 kda ) was synthesized by anionic , ringopening , multibranching polymerization of glycidol with slow monomer addition.37 , 38 according to our previous work , 10 kda pg has better dispersity and be synthesized more easily .
alexa fluor 488 wga and hoechst 33342 cell markers were obtained from molecular probes inc .
other reagents were obtained from beijing chemical reagent co. ( beijing , china ) . the water used throughout the study was purified with a milliq integral a10 system from millipore co. ( usa ) .
firstly , we synthesized pgnh2 with 30 % amine functionality according to the literature.23 , 24 for h nmr spectra of pgnh2 , see figure s11 .
pgnh2 was dissolved into methanol with a concentration of 20 mg ml as a stock solution .
firstly , pgnh2 stock solution ( 600 l ) , methanol ( 2 ml ) , and a specific volume teos were mixed and stirred in a sealed vessel for 12 h. in this recipe , 10 , 50 , 100 , or 200 l of teos was added for parallel controls .
then , a mixture of ammonium hydroxide ( 1.5 ml ) and water ( 1.5 ml ) were quickly added into the above solution and stirred vigorously for 6 h. the products were centrifuged at a high speed ( 10 000 rpm , 5 min ) and washed with methanol and water several times .
the final obtained products were marked as pgsns10 , pgsns50 , pgsns100 , and pgsns200 , respectively , according to the different volumes of teos in the recipe .
4 mg ) were incubated in 0.5 mg ml dox aqueous solution ( 1.33 ml ) for 24 h. the loading efficiency was calculated according to the change of characteristic absorption of dox ( 480 nm ) before and after incubation with pgsns100 . then
the samples ( denoted as pgsnsdox ) were split equally into two parts and dispersed into 1.2 ml of either phosphatebuffered saline ( pbs ) ( ph 7.2 ) or mes buffer ( ph 5.0 ) .
therefore , the concentrations of the pgsnsdox samples in different buffers were the same ( ca .
1.6 mg ml ) . at a preset time point , the sample suspension was centrifuged , and then 0.3 ml of the supernatant was removed .
the absorbance at 480 nm of the supernatant was measured using a uv / vis spectrometer .
after that , 0.3 ml of fresh buffer solution was added to the sample suspension .
the pgsns100 sample was dispersed into pbs at a low concentration ( 0.1 mg ml ) following shaking of the culture at 37 c . at a preset time point ,
a series of aliquots ( 5 l ) of the solution was removed and dropped on a copper grid for tem observation . at the same time , 5 ml of the dispersed solution was taken out and filtered by using millipore tubular ultrafiltration centrifugation modules ( molecular weight cut off 10 000 ) .
hela and mcf7 cells were cultured at 37 c in a dmem medium ( gibco brl , usa ) complemented with fbs ( 10 % ) , lglutamine ( 2 mm ) , penicillin ( 100 u ml ) , and streptomycin ( 25 mg ml ) in a humidified atmosphere with 5 % co2 . for the following experiments ,
cells were detached from culture flasks by using pbs containing edta ( 0.02 % ) and trypsin ( 0.05 % ) , and seeded to a 35 mm glassbottom petri dish for clsm observation or 96well plates for cytotoxicity measurements .
after the cells were incubated in the logarithmic growth phase , the 2 mg ml pgsnbased dispersed sample solutions ( 50 l ) were added for 4 h of coculturing .
then , the cells were washed twice with pbs to remove the dispersed nanoparticles and dead cells in the growth media . the cell nuclei and membranes
were stained with hoechst 33342 and alexa 488 wga ( 0.025 mg ml , 10 l ) for 15 min , respectively .
after that , the cells were washed with pbs three times , and supplemented with fresh cell culture medium .
the cytotoxicity assay was conducted with mcf7 cells in 96well plates grown to 7080 % confluency .
every 4 wells were taken as one group and incubated with different concentration of pgsn , pgsndox and dox for 48 h , respectively .
the dox loading amount was 0.18 mg per mg of pgsns . for every well in each group
, cells were cultured in 0.007 , 0.02 , 0.04 , 0.06 , and 0.08 mg ml pgsns or pgsnsdox suspension ( in cell culture media ) as parallel experiments . at the same time
, the same amount of dox was added to the cells in another group and cultured as a positive control .
then , sterile filtered cck8 in pbs ( 10 l ) was added to each well and incubated with the cells for 1 h at 37 c , followed by measuring the absorbance at 450 nm with elisa ( tecan infinite 200 ) .
cell viability was expressed as the percentage of viable cells compared with blank control ( cells without particles ) .
fluorophore cy7 was labeled on the surface of pgsns before applying fluorescence imaging in vivo . in detail , the cy7 nhs ester reacted with pgsns directly in ph 8.0 buffer solution for 24 h in the dark .
cy7labeled pgsns ( cy7pgsns ) were purified by repeatedly washing with saline before further application .
tumorbearing mice were prepared by inoculating 0.2 ml of pbs containing 210 mcf7 cells at the left hind leg of female balb / c nude mice ( 202 g ) , and the tumor was allowed to grow for approximately 7 days .
when the tumor volume reached 600 mm , 200 l cy7pgsn nanoparticles ( in pbs , 1 mg ml ) was injected through the tail vein . for in vivo imaging , mice were placed on the warmed stage and anaesthetized with 2.5 % isoflurane .
image acquisition was performed at different time intervals on an in vivo imaging system . meanwhile ,
the fluorescence intensities of the tumor and the background were analyzed by using the corresponding software .
when the average tumor volume reached 120 mm , the balb / c nude mice ( n=15 ) were randomly and equally divided into three groups .
free dox ( 200 l , in pbs ) or pgsnsdox ( 200 l , in pbs ) was intravenously injected into the tail vein of every animal in the other two respective groups .
the concentration of free dox was 0.12 mg ml . the dispersed solution of pgsnsdox had a concentration of 2.5 mg ml , containing an equal amount of dox , that is , 0.12 mg ml .
mice were treated either with the drug or saline ( control ) every 2 days with a total of 5 doses per rat .
on the seventh day of posttumor implantation , the mice were sacrificed randomly , and the tissue was extracted and fixed by 4 % formaldehyde solution overnight ; tumors were completely excised , and the tumor volume was calculated by using equation ( 1):(1)volume(mm3)=v=0.5ab2
where a and b are the maximum and minimum diameters of the tumor , respectively .
the tumor growth inhibition was calculated by using equation ( 2):(2)tumorgrowthinhibition(%)=[(volumeincontrolgroup - volumeintreatedgroup)(volumeincontrolgroup)]100
where volume always refers to the volume of the tumor at the endpoint .
statistical significance was evaluated by using the oneway analysis of variance ( anova ) and student 's ttest .
multiple comparisons were statistically analyzed by using spss software version 13.0 ( significance was established at p<0.05 ) .
clsm images were taken with an olympus fv1000 confocal system , which has a 60oilimmersion objective and a numerical aperture of 1.4 .
the tem images and selectedarea electron diffraction ( saed ) patterns were acquired by using a jem1011 and jem2011(jeol , japan ) .
the scanning electron microscopy ( sem ) images were obtained with an s4800 instrument with 10 kv accelerating voltage ( hitachi , japan ) .
the degradation of pgsns was monitored by using both tem morphology investigation and analysis of the above supernatant through icp oes ( thermo icap 6300 ) . in vivo fluorescence imaging
was performed at different time intervals on the in vivo imaging system ( fx pro , carestream health ) .
the excitation and emission bandpass filters were at 740 and 760 nm , respectively .
the fluorescence intensities of the tumor and the background were analyzed by using corresponding software .
zeta potential and size distribution were documented by using a dynamic light scattering technique ( zetasizer nano , malvern ) .
pg ( mw 10 kda ) was synthesized by anionic , ringopening , multibranching polymerization of glycidol with slow monomer addition.37 , 38 according to our previous work , 10 kda pg has better dispersity and be synthesized more easily .
alexa fluor 488 wga and hoechst 33342 cell markers were obtained from molecular probes inc .
other reagents were obtained from beijing chemical reagent co. ( beijing , china ) . the water used throughout the study was purified with a milliq integral a10 system from millipore co. ( usa ) .
firstly , we synthesized pgnh2 with 30 % amine functionality according to the literature.23 , 24 for h nmr spectra of pgnh2 , see figure s11 .
pgnh2 was dissolved into methanol with a concentration of 20 mg ml as a stock solution .
firstly , pgnh2 stock solution ( 600 l ) , methanol ( 2 ml ) , and a specific volume teos were mixed and stirred in a sealed vessel for 12 h. in this recipe , 10 , 50 , 100 , or 200 l of teos was added for parallel controls .
then , a mixture of ammonium hydroxide ( 1.5 ml ) and water ( 1.5 ml ) were quickly added into the above solution and stirred vigorously for 6 h. the products were centrifuged at a high speed ( 10 000 rpm , 5 min ) and washed with methanol and water several times .
the final obtained products were marked as pgsns10 , pgsns50 , pgsns100 , and pgsns200 , respectively , according to the different volumes of teos in the recipe .
4 mg ) were incubated in 0.5 mg ml dox aqueous solution ( 1.33 ml ) for 24 h. the loading efficiency was calculated according to the change of characteristic absorption of dox ( 480 nm ) before and after incubation with pgsns100 .
the samples ( denoted as pgsnsdox ) were split equally into two parts and dispersed into 1.2 ml of either phosphatebuffered saline ( pbs ) ( ph 7.2 ) or mes buffer ( ph 5.0 ) .
therefore , the concentrations of the pgsnsdox samples in different buffers were the same ( ca .
the sample suspension was centrifuged , and then 0.3 ml of the supernatant was removed .
the absorbance at 480 nm of the supernatant was measured using a uv / vis spectrometer .
after that , 0.3 ml of fresh buffer solution was added to the sample suspension .
the pgsns100 sample was dispersed into pbs at a low concentration ( 0.1 mg ml ) following shaking of the culture at 37 c . at a preset time point ,
a series of aliquots ( 5 l ) of the solution was removed and dropped on a copper grid for tem observation . at the same time , 5 ml of the dispersed solution was taken out and filtered by using millipore tubular ultrafiltration centrifugation modules ( molecular weight cut off 10 000 ) .
hela and mcf7 cells were cultured at 37 c in a dmem medium ( gibco brl , usa ) complemented with fbs ( 10 % ) , lglutamine ( 2 mm ) , penicillin ( 100 u ml ) , and streptomycin ( 25 mg ml ) in a humidified atmosphere with 5 % co2 . for the following experiments ,
cells were detached from culture flasks by using pbs containing edta ( 0.02 % ) and trypsin ( 0.05 % ) , and seeded to a 35 mm glassbottom petri dish for clsm observation or 96well plates for cytotoxicity measurements .
after the cells were incubated in the logarithmic growth phase , the 2 mg ml pgsnbased dispersed sample solutions ( 50 l ) were added for 4 h of coculturing .
then , the cells were washed twice with pbs to remove the dispersed nanoparticles and dead cells in the growth media . the cell nuclei and membranes
were stained with hoechst 33342 and alexa 488 wga ( 0.025 mg ml , 10 l ) for 15 min , respectively .
after that , the cells were washed with pbs three times , and supplemented with fresh cell culture medium .
the cytotoxicity assay was conducted with mcf7 cells in 96well plates grown to 7080 % confluency .
every 4 wells were taken as one group and incubated with different concentration of pgsn , pgsndox and dox for 48 h , respectively .
for every well in each group , cells were cultured in 0.007 , 0.02 , 0.04 , 0.06 , and 0.08 mg ml pgsns or pgsnsdox suspension ( in cell culture media ) as parallel experiments . at the same time
, the same amount of dox was added to the cells in another group and cultured as a positive control .
then , sterile filtered cck8 in pbs ( 10 l ) was added to each well and incubated with the cells for 1 h at 37 c , followed by measuring the absorbance at 450 nm with elisa ( tecan infinite 200 ) .
cell viability was expressed as the percentage of viable cells compared with blank control ( cells without particles ) .
fluorophore cy7 was labeled on the surface of pgsns before applying fluorescence imaging in vivo . in detail , the cy7 nhs ester reacted with pgsns directly in ph 8.0 buffer solution for 24 h in the dark .
cy7labeled pgsns ( cy7pgsns ) were purified by repeatedly washing with saline before further application .
tumorbearing mice were prepared by inoculating 0.2 ml of pbs containing 210 mcf7 cells at the left hind leg of female balb / c nude mice ( 202 g ) , and the tumor was allowed to grow for approximately 7 days .
when the tumor volume reached 600 mm , 200 l cy7pgsn nanoparticles ( in pbs , 1 mg ml ) was injected through the tail vein . for in vivo imaging , mice were placed on the warmed stage and anaesthetized with 2.5 % isoflurane .
image acquisition was performed at different time intervals on an in vivo imaging system . meanwhile ,
the fluorescence intensities of the tumor and the background were analyzed by using the corresponding software .
when the average tumor volume reached 120 mm , the balb / c nude mice ( n=15 ) were randomly and equally divided into three groups .
free dox ( 200 l , in pbs ) or pgsnsdox ( 200 l , in pbs ) was intravenously injected into the tail vein of every animal in the other two respective groups .
the concentration of free dox was 0.12 mg ml . the dispersed solution of pgsnsdox had a concentration of 2.5 mg ml , containing an equal amount of dox , that is , 0.12 mg ml .
mice were treated either with the drug or saline ( control ) every 2 days with a total of 5 doses per rat .
on the seventh day of posttumor implantation , the mice were sacrificed randomly , and the tissue was extracted and fixed by 4 % formaldehyde solution overnight ; tumors were completely excised , and the tumor volume was calculated by using equation ( 1):(1)volume(mm3)=v=0.5ab2
where a and b are the maximum and minimum diameters of the tumor , respectively .
the tumor growth inhibition was calculated by using equation ( 2):(2)tumorgrowthinhibition(%)=[(volumeincontrolgroup - volumeintreatedgroup)(volumeincontrolgroup)]100
where volume always refers to the volume of the tumor at the endpoint .
statistical significance was evaluated by using the oneway analysis of variance ( anova ) and student 's ttest .
multiple comparisons were statistically analyzed by using spss software version 13.0 ( significance was established at p<0.05 ) .
clsm images were taken with an olympus fv1000 confocal system , which has a 60oilimmersion objective and a numerical aperture of 1.4 .
the tem images and selectedarea electron diffraction ( saed ) patterns were acquired by using a jem1011 and jem2011(jeol , japan ) .
the scanning electron microscopy ( sem ) images were obtained with an s4800 instrument with 10 kv accelerating voltage ( hitachi , japan ) .
the degradation of pgsns was monitored by using both tem morphology investigation and analysis of the above supernatant through icp oes ( thermo icap 6300 ) . in vivo fluorescence imaging
was performed at different time intervals on the in vivo imaging system ( fx pro , carestream health ) .
the excitation and emission bandpass filters were at 740 and 760 nm , respectively .
the fluorescence intensities of the tumor and the background were analyzed by using corresponding software .
zeta potential and size distribution were documented by using a dynamic light scattering technique ( zetasizer nano , malvern ) .
as a service to our authors and readers , this journal provides supporting information supplied by the authors .
such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset .
technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .
Output:
| abstractmesoporous silicabased nanoparticles are generally accepted as a potential platform for drug loading with a lot of advantages , except for their complex purification procedures and structures that are difficult to decompose . in this work ,
biocompatible hyperbranched polyglycerol is introduced to synthesize mesoporous silica nanoparticles ( msns ) .
the materials possess good biocompatibility , controlled release , and biodegradability .
they also show passive targeting capability through the enhanced permeability and retention effect and can be excreted from the biological system .
the method avoids the needs to employ traditional surfactants and complicated purified procedures , which make these msns an efficient delivery system for cancer therapy . |
PubmedSumm7810 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the eukaryotic genome is functionally and spatially organized . during interphase , chromosomes fold into topologically associated domains ( tads ) and divide into heterochromatin and euchromatin . also , chromosomes associate with nuclear structures and occupy distinct territories within the nucleus . within these territories ,
individual genes are positioned with respect to each other and with respect to stable nuclear structures .
for example , in metazoa large transcriptionally repressed lamina associate domains ( lads ) position along the nuclear periphery and interact with the nuclear lamina .
importantly , the spatial organization of the genome is dynamic and the position of individual genes often changes upon activation or repression .
for example , during development , lads can be remodeled to accommodate the repositioning of genes ; the -globin and myod genes move away from the nuclear lamina upon transcriptional activation
. many active genes also interact with nuclear pore proteins ( nups ) in diverse organisms including yeast , flies , worms , and mammalian cells . in both yeast and metazoa
these interactions occur at the nuclear periphery , presumably in contact with the nuclear pore complex ( npc ) , whereas in higher eukaryotes these interactions often occur in the nucleoplasm with soluble nups
active genes colocalize with rnap ii foci in subnuclear compartments called transcription factories . in flies ,
likewise , in yeast , trna genes , silenced telomeres and npc - associated loci each exhibit specific interchromosomal clustering .
these observations support the idea that the spatial organization of the eukaryotic genome compartmentalizes the nucleus into functionally distinct subnuclear environments and that the spatial positioning of a gene both impacts and reflects its transcriptional state .
as a model for these phenomena , we have studied the spatial repositioning of inducible yeast genes from the nucleoplasm to the nuclear periphery .
inducible genes such as ino1 , prm1 and his4 are recruited from the nucleoplasm to the nuclear periphery upon activation .
these genes are inducible under very different conditions ( ino1 is activated by inositol starvation , prm1 is induced by mating pheromone and his4 is induced by amino acid starvation ) and they are targeted to the periphery only under the conditions that lead to their expression .
this recruitment leads to a physical interaction with the nuclear pore complex ( npc ) and promotes stronger expression .
targeting to the periphery is controlled by cis - acting transcription factor ( tf ) binding sites located within the promoters of these genes .
these elements and the tfs that bind to them are not only necessary for recruitment , but are also sufficient to target an ectopic locus to the nuclear periphery .
thus , these cis - acting binding sites function as dna zip codes to control the dynamic , conditional positioning and interchromosomal clustering of genes .
this suggests that one of the functions of tfs is to control the spatial organization of the genome .
targeting of ino1 to the nuclear periphery is mediated by 2 dna elements called grs i and grs ii .
the tfs put3 ( zn - binuclear cluster family ) and cbf1 ( basic helix - loop - helix family ) bind to grsi and grsii , respectively and these tfs are necessary for grs i- and grs ii - mediated targeting to the nuclear periphery .
the grs i element is necessary and sufficient to mediate interchromosomal clustering with other grs i - containing loci .
ino1 transcription is regulated by the ino2/ino4 tfs , which bind to the uasino elements in the promoter .
such a separation between the elements controlling transcription and gene positioning is also seen in other promoters ( our unpublished results ) .
thus , although gene positioning and transcription are coupled , they can be mediated by distinct elements and factors .
in contrast , the positioning of his4 and prm1 is controlled by the same tfs that regulate their expression , gcn4 and ste12 , respectively .
inserting dna elements corresponding to the binding sites of gcn4 ( gcn4bs ) and ste12 ( pheromone - response elements , 3xpre ) at the ectopic site ura3 , which is normally localized to the nucleoplasm , is sufficient to reposition the locus to the nuclear periphery .
furthermore , mutant strains lacking gcn4 or ste12 fail to target his4 or prm1 to the nuclear periphery , respectively . finally , artificially tethering gcn4 or ste12 to the ura3 locus via a lexa dna binding domain is sufficient to cause ura3 to reposition to the nuclear periphery .
therefore , these tfs are both necessary and sufficient to control peripheral localization and interchromosomal clustering .
put3 , cbf1 , gcn4 and set12 represent 4 different families of transcription factors that mediate spatial repositioning and clustering of these genes .
indeed , in erythroid cells , the transcription factor klf1 is necessary for clustering of its target genes into specialized transcription factories and in flies , interactions of genes with nup98 is mediated by the mbd - r2 dna binding factor .
however , not all transcription factors possess this function . as mentioned above , ino2/ino4 binding to the uasino element within the ino1 promoter is neither necessary nor sufficient to recruit chromatin to the nuclear periphery .
the activation domain of put3 and gcn4 is dispensable for targeting to the nuclear periphery ( our unpublished results ) .
furthermore , inactivating rna polymerase ii or promoter mutations that block ino1 transcription does not block zip code - dependent recruitment to the nuclear periphery .
one important , unaddressed question is how these changes in gene positioning are dynamically regulated .
repositioning of ino1 , his4 and prm1 to the nuclear periphery and interchromosomal clustering is conditional and occurs under specific environmental stimuli .
this reflects how each zip code is regulated , which is revealed when the zip code is inserted at an ectopic site .
grsi and grsii are regulated through a context - dependent mechanism : when inserted at an ectopic site , these elements lead to constitutive targeting to the nuclear periphery . in other words , they are negatively regulated in the context of the ino1 promoter and only permitted to function when ino1 is induced . using systematic mutagenesis of cis and trans acting regulators ,
we find that targeting of ino1 to the nuclear periphery by put3 and cbf1 is regulated through local recruitment of rpd3(l ) histone deacetylase complex ( fig . 1 ) .
rpd3(l ) is recruited to the ino1 promoter under repressing conditions by the transcriptional repressors opi1 and ume6 .
rpd3(l ) regulates zip code activity by blocking transcription factor binding through its histone deacetylase activity .
this regulation was abolished by either perturbing the recruitment of rpd3 or inactivating its catalytic activity ( rpd3 h188a ) , resulting in constitutive targeting of ino1 to the nuclear periphery .
furthermore , rpd3(l ) regulation could be recapitulated at the ectopic ura3 locus by artificially tethering either opi1 or ume6 near grs i or grs ii , blocking targeting to the nuclear periphery and interchromosomal clustering ( fig . 1 , left panel ) . to test
if this was general function of repressors in yeast , 21 different repressors were tethered beside the grs i. a majority of repressors could block grs i function ; 16 of the 21 repressors tested blocked put3-mediated recruitment to the nuclear periphery and 11 of these required rpd3 .
thus , 5 repressors block put3 binding by either recruiting a different histone deacetylase or through alternative mechanisms .
these results suggest that put3s ability to reposition genes can be blocked through several different mechanisms .
because put3 controls the positioning of genes that are not perfectly co - regulated , cells could use these different strategies to independently regulate put3-mediated targeting in different contexts , depending on the environmental stimulus .
figure 1.multiple strategies in regulating transcription factor ( tf)-mediated recruitment to the nuclear periphery over different time scales .
top : ( left ) put3 and cbf1 bind to grsi and grsii respectively in the promoter of ino1 and mediate its recruitment to the nuclear periphery upon inositol starvation .
these tfs are regulated by the local recruitment of rpd3(l ) histone deacetylase by transcriptional repressors opi1 and ume6 .
repression is relieved between 60120 min leading to peripheral localization and interchromosomal clustering of ino1 .
( middle ) ste12 mediates the recruitment of prm1 to the nuclear periphery upon mating pheromone stimulation .
( right ) gcn4-mediated recruitment of his4 to the nuclear periphery is controlled by gcn4 abundance .
gcn4 is translationally regulated . through increased protein levels of gcn4 , maximal peripheral targeting occurs between 3060 min .
multiple strategies in regulating transcription factor ( tf)-mediated recruitment to the nuclear periphery over different time scales .
top : ( left ) put3 and cbf1 bind to grsi and grsii respectively in the promoter of ino1 and mediate its recruitment to the nuclear periphery upon inositol starvation .
these tfs are regulated by the local recruitment of rpd3(l ) histone deacetylase by transcriptional repressors opi1 and ume6 .
repression is relieved between 60120 min leading to peripheral localization and interchromosomal clustering of ino1 .
( middle ) ste12 mediates the recruitment of prm1 to the nuclear periphery upon mating pheromone stimulation .
( right ) gcn4-mediated recruitment of his4 to the nuclear periphery is controlled by gcn4 abundance .
gcn4 is translationally regulated . through increased protein levels of gcn4 , maximal peripheral targeting occurs between 3060 min .
unlike put3 , regulation of ste12- and gcn4-mediated repositioning is context - independent ; inserting the gcn4bs or the 3xpre at ura3 led to repositioning to the nuclear periphery upon histidine starvation or pheromone treatment , respectively .
furthermore , loss of rpd3 had no effect on recruitment of prm1 or his4 to the nuclear periphery and the 3xpre was completely resistant to tethering of opi1 or ume6 . instead
ste12 is constitutively bound and ste12-dependent transcription is inhibited by 2 repressors , dig1 and dig2 . upon mating pheromone stimulation
, dig1 and dig2 are phosphorylated by the mapk fus3 , causing them to dissociate from ste12 .
dissociation of both dig1 and dig2 is required for prm1 transcriptional activation , but loss of dig2 alone led to constitutive ste12-mediated peripheral localization and interchromosomal clustering .
furthermore , mutation of serine 34 to alanine in dig2 - blocking phosphorylation - also blocked targeting to the nuclear periphery . likewise ,
mutation of serine 34 to aspartate - mimicking phosphorylation - led to constitutive targeting to the nuclear periphery .
thus , ste12-mediated gene positioning is regulated through post - translational modification of an inhibitor ( fig . 1 , middle panel ) .
gcn4-mediated targeting to the nuclear periphery is regulated by a third mechanism ; the occupancy of gcn4 binding to its target genes , controlled by its abundance . unlike the other mechanisms discussed above , which behave in a switch - like manner , gcn4-mediated targeting to the nuclear periphery and interchomosomal clustering occurs at a lower level under uninducing conditions and at a maximal level under inducing conditions .
it is well - established that gcn4-mediated transcription is regulated through the abundance of gcn4 . in the presence of amino acids , gcn4 is poorly translated due to several short , upstream open reading frames ( uorfs ) in the 5 end of the gcn4 mrna . when cells are starved for amino acids , translational initiation
is slowed , permitting the ribosome to skip the uorfs and increase the translation of gcn4 .
increasing gcn4 protein production by mutating the uorfs resulted in constitutive recruitment and clustering of his4 .
thus , under uninducing conditions , low levels of gcn4 lead to modest targeting to the nuclear periphery and measurable interchromosomal clustering .
however , under inducing conditions , higher gcn4 protein levels increase the occupancy of the gcn4bs and this leads to maximal peripheral targeting and interchromosomal clustering ( fig . 1
a number of factors have been implicated in the targeting of genes to the npc , including mrna export factors , the saga histone acetyltransferase and components of the npc itself .
we find that the saga complex , for example , is required for targeting of ino1 and his4 to the nuclear periphery , but is dispensable for targeting of prm1 to the nuclear periphery .
if saga functions to bridge the interaction between chromatin and the npc , as has been suggested , this result indicates that transcription factors use more than one mechanism to promote repositioning to the nuclear periphery .
the saga complex is a multi - subunit histone modifying enzyme that has broad impacts on gene expression . because the regulation of put3 , cbf1 and gcn4 occurs at the level of tf occupancy whereas ste12 is regulated downstream of binding , it is possible that saga may either facilitate tf dna binding or alter the abundance of the tfs themselves .
these results highlight the critical role of tfs in controlling gene positioning and interchromosomal interactions .
tf - mediated gene positioning can be regulated through at least 4 different mechanisms : regulation of tf binding by the rpd3(l ) hdac , regulation of tf binding ( or function ) by repressors independent of rpd3(l ) , regulation of tf occupancy through changes in tf abundance and regulation of tf function through post - translational modification of an inhibitor .
these different strategies operate over different time scales to alter the positioning of individual genes and the arrangement of chromosomes with respect to each other : mapk signaling leads to rapid repositioning and clustering of ste12 targets within 1530 min , while changes in gcn4 protein levels leads to a moderate rate of repositioning and clustering within 3060 min and rpd3(l ) regulated gene positioning is derepressed over 60120 min ( fig . 1 ) .
thus , reflecting the regulation of tf function , cells employ different strategies to regulate dynamic tf - mediated gene positioning over very different temporal regimes .
the authors acknowledge members of the brickner lab , past and present , for contributing to the work described and for helpful discussions .
Output:
| abstractin yeast , inducible genes such as ino1 , prm1 and his4 reposition from the nucleoplasm to nuclear periphery upon activation .
this leads to a physical interaction with nuclear pore complex ( npc ) , interchromosomal clustering , and stronger transcription .
repositioning to the nuclear periphery is controlled by cis - acting transcription factor ( tf ) binding sites located within the promoters of these genes and the tfs that bind to them .
such elements are both necessary and sufficient to control positioning of genes to the nuclear periphery .
we have identified 4 tfs capable of controlling the regulated positioning of genes to the nuclear periphery in budding yeast under different conditions : put3 , cbf1 , gcn4 and ste12 . in each case
, we have defined the molecular basis of regulated relocalization to the nuclear periphery .
put3- and cbf1-mediated targeting to nuclear periphery is regulated through local recruitment of rpd3(l ) histone deacetylase complex by transcriptional repressors .
rpd3(l ) , through its histone deacetylase activity , prevents tf - mediated gene positioning by blocking tf binding .
many yeast transcriptional repressors were capable of blocking put3-mediated recruitment ; 11 of these required rpd3 .
thus , it is a general function of transcription repressors to regulate tf - mediated recruitment .
however , ste12 and gcn4-mediated recruitment is regulated independently of rpd3(l ) and transcriptional repressors .
ste12-mediated recruitment is regulated by phosphorylation of an inhibitor called dig2 , and gcn4-mediated gene targeting is up - regulated by increasing gcn4 protein levels .
the ability to control spatial position of genes in yeast represents a novel function for tfs and different regulatory strategies provide dynamic control of the yeast genome through different time scales . |
PubmedSumm7811 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: rhinosporidiosis is a chronic granulomatous infectious disease caused by rhinosporidum seeberi with high prevalence in parts of indian subcontinent and sri lanka .
it produces polypoidal lesions that are friable , bleed profusely during resection and have a high tendency to recur .
the common site of occurrence is nose and nasopharynx but can present at unusual sites .
the involvement of tracheobronchial tree is rare , but can pose challenging problems for diagnosis , surgical excision as well as anesthetic management .
we are reporting a case of 35-year - old man who had recurrent nasal rhinosporidiosis and was found to have left bronchial and urethral involvement .
the bronchial rhinosporidiosis lesion was excised successfully under local anesthesia without any complications and no recurrence on 1-year follow up noted .
a 35-year - old male presented to the department of ent with mass in right nasal cavity and nasal blockage of 1-year duration .
on anterior rhinoscopic examination , pinkish mulberry like mass was present in the floor of right nasal cavity . left nasal cavity was clear . on oral cavity examination mass was hanging in oropharynx which bleeds on touch . on nasal endoscopy examination , rhinosporodiosis mass was found attached to floor of right nasal cavity and choana hanging toward nasopharynx .
after all routine examination and x - ray chest , patient was sent for the premedical and preanaesthetic checkup regarding the fitness for the surgery . during examination , it was found that patient has decreased air entry on left lung .
hrct thorax showed hyperlucent left lung field suggestive of air trapping with irregular soft tissue density mass ( size 1.4 1.2 cm ) seen in distal part of left main bronchus suggestive of papillomatous lesion .
it was decided to do the bronchoscopic excision of mass and cauterization of base under local anesthesia .
anesthetists were kept in standby with all the facility available for general anesthesia , tracheostomy and any other emergency .
the mass was first cauterized and then completely excised with bronchoscopic snare [ figure 2 ] .
the area was rechecked to find that no mass should left behind and whether cauterization has been done properly .
thereafter oral intubation was done and nasal mass was cauterized and excised completely under general anesthesia .
histopathological examination from the bronchial mass confirmed as rhinosporodiosis showing squamous metaplasia of bronchial epithelium and spores within the sporangia [ figure 3 ] .
bronchoscopy revealed pinkish mulberry like rhinosporidiosis mass in left main bronchus view after complete excision and cauterization of rhinosporidial mass microphotograph showing squamous metaplasia of bronchial epithelium and presence of sporangia with spores ( h and e 10 )
the taxonomic relationship of r. seeberi with other organisms remained controversial for more than a century .
the organism was first described by malbran in 1892 as a sporozoan , as a protozoan by seeber and as a phycomycetes by ashworth in 1923 .
recently , molecular studies have shown r. seeberi to be a protistal microbe in the newly described class mesomycetozoea at the animal - fungal boundary . though it occurs universally
, rhinosporidiosis is endemic in south asia being mainly reported from southern india and sri lanka .
it commonly involves the nose , nasopharynx , lacrimal sac , and conjunctiva in that order of frequency .
it occasionally involves the lips , palate , uvula , larynx , trachea , penis , vagina , and bone .
thomas et al.(1956 ) reported a case of bronchial rhinosporidiosis in which biopsy through bronchoscopy was carried out without much bleeding , followed by a lobectomy as local excision was found to be impossible .
( 2010 ) reported a case of recurrent nasopharyngeal rhinosporidiosis with right bronchial involvement which was successfully excised under general anesthesia using one lung ventilation .
the surgical excision was done through tracheostoma route to avoid the external approach for the fear of implantation . here
, we presented a case of rhinosporidiosis with left bronchial involvement which was successfully excised under local anesthesia .
the bronchial involvement could be more likely due to secondary implantation following the previous surgeries for nasal rhinosporidiosis .
initially no chest pathology was suspected , it incidentally found during the preanesthetic checkup that there was a decreased air entry in the left side of lung , and then the patient was referred to the chest physician for the evaluation .
the preoperative ct scan chest of the patient showed papillomatous mass in the distal part of left main bronchus .
ct imaging is the preferred investigation in such situations because it provides better details about the extent of the lesion .
when the confirmation was done about the extent and size of the lesion by ct , flexible fiberoptic bronchoscopy was done under local anesthesia .
mass was completely cauterized with the help of bronchoscopic snare and excised mass was removed carefully by the basket .
reported that diagnosis of tracheobronchial rhinosporidiosis by means of bronchoscopic biopsy is dangerous because of the high risk of bleeding and the inability to visualize the full extent of the mass , especially when it obstructs the distal view .
they excised the mass by using a combined approach of rigid bronchoscopy and wide tracheostomy . in our case bleeding
was very minimal due to prior good cauterization and the smaller size of the mass .
several antibacterial and antifungal drugs have been tested clinically but the only drug which was found to have some antirhinosporidial effect is dapsone which appears to arrest the maturation of the sporangia but the result are not satisfactory and the disease may recur after months or years .
we did not consider any drug therapy for the prevention of recurrence in follow up period .
rhinosporidiosis in bronchus could be secondary to implantation of spores from previous surgeries for nasal and nasopharyngeal rhinosporidiosis . to the best of our knowledge and review ,
this is the third case of bronchial rhinosporidiosis reported in world literature ; and the first case where the bronchial rhinosporidiosis mass was excised under local anesthesia without complication .
Output:
| rhinosporidiosis is a granulomatous disease that usually affects the nasal mucosa and nasopharynx .
the disease is widely prevalent in the tropics , especially in southern india and sri lanka . in central india , rhinosporidiosis is endemic in raipur , chhattisgarh .
involvement of the tracheobronchial tree is extremely rare .
only two cases of bronchial rhinosporidiosis had been reported in world literature .
we report a third case of bronchial rhinosporidiosis which occurred in a patient with coexisting nasal and nasopharyngeal rhinosporidiosis .
bronchoscopic guidance excision of mass and electric cauterization of base was done under local anesthesia . |
PubmedSumm7812 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: based on the concept of emotional stability as defined in the literature , 250 items were developed covering initially the following 6 dimensions of emotional stability :
pessimism vs. optimismanxiety vs. calmaggression vs. tolerance.dependence vs. autonomy.emotions vs. logicapathy vs. empathy
pessimism vs. optimism aggression vs. tolerance .
the items were given to the judges , who were qualified psychologists with minimum 10 years of experience in the field of personality assessment .
out of these , 90 items were such where the judges could not reach a consensus , therefore these items were eliminated and only 160 items were retained for the initial trial . besides this , the judges felt that there was an overlapping of items in the last two subscales i.e. emotions vs. logic and apathy vs. empathy .
hence the items of these subscales were merged together and the scale had only 5 dimensions .
pessimists are gloomy and depressed , disappointed with their existence and at odds with the world .
they have low self - esteem , are introverts , have feelings of guilt , interpersonal dependency , and remain passive in social situations . on the other hand optimists are generally cheerful and positive in their outlook .
they are satisfied with themselves , find life rewarding , and are at peace with the world .
they show persistence in seeking goals in spite of setbacks and obstacles , operating from the hope of success rather than fear of failure . they perceive failures as being due to manageable circumstances rather than a personal flaw .
example : do you seem to have more than your share of bad luck ? .
people who are apathetic are detached , shrewd , worldly and expedient and harbor self- interest in their dealings with other people .
people who are empathic in nature consider other 's feelings along with related factors in the process of making intelligent decisions .
example : does it worry you if someone is annoyed with you for a mistake , which you have actually not committed ?
the dependent person lacks self - reliance , thinks of himself as a helpless pawn of fate , is pushed around by other people and events and shows a high degree of authoritarian submission ( the unquestioning obedience to institutional power ) .
the persons high on autonomy enjoy a great deal of freedom and independence , make their own decisions , view themselves as a master of their own fate and take realistic actions to solve their own problems .
example : do you place your trust in supernatural powers such as god or fate to see you through safely ? anxious persons are easily upset by things that go wrong and are inclined to worry unreasonably about things that may or may not happen .
people who are calm are placid , serene and resistant to irrational fears and anxieties . because of this ability they can stay calm under pressure .
example : do you often feel restless as though you want something but do not really know what ?
aggressive individuals are given to the direct or indirect expression of anger , for example , behavior such as temper tantrums , fighting , violent arguments and sarcasm , or participation in adventurous activities like mountaineering , car rallies etc .
they take no nonsense from anyone and feel compelled to return fire or get back at anyone who transgresses against them .
tolerant individuals are gentle , even tempered , with no personal conflicts and are not given to violence either direct or indirect .
an answer sheet was developed , wherein the subjects had 5 alternatives to answer each question i.e. always ,
never. since the test was a combination of both positive and negative items the scores for positive items ranged from 5 to1 and for negative items it ranged from 1 to 5 .
pessimists are gloomy and depressed , disappointed with their existence and at odds with the world .
they have low self - esteem , are introverts , have feelings of guilt , interpersonal dependency , and remain passive in social situations . on the other hand optimists are generally cheerful and positive in their outlook .
they are satisfied with themselves , find life rewarding , and are at peace with the world .
they show persistence in seeking goals in spite of setbacks and obstacles , operating from the hope of success rather than fear of failure .
example : do you seem to have more than your share of bad luck ? .
people who are apathetic are detached , shrewd , worldly and expedient and harbor self- interest in their dealings with other people .
people who are empathic in nature consider other 's feelings along with related factors in the process of making intelligent decisions .
example : does it worry you if someone is annoyed with you for a mistake , which you have actually not committed ?
the dependent person lacks self - reliance , thinks of himself as a helpless pawn of fate , is pushed around by other people and events and shows a high degree of authoritarian submission ( the unquestioning obedience to institutional power ) .
the persons high on autonomy enjoy a great deal of freedom and independence , make their own decisions , view themselves as a master of their own fate and take realistic actions to solve their own problems .
example : do you place your trust in supernatural powers such as god or fate to see you through safely ?
anxious persons are easily upset by things that go wrong and are inclined to worry unreasonably about things that may or may not happen
people who are calm are placid , serene and resistant to irrational fears and anxieties . because of this ability they can stay calm under pressure .
example : do you often feel restless as though you want something but do not really know what ?
aggressive individuals are given to the direct or indirect expression of anger , for example , behavior such as temper tantrums , fighting , violent arguments and sarcasm , or participation in adventurous activities like mountaineering , car rallies etc .
they take no nonsense from anyone and feel compelled to return fire or get back at anyone who transgresses against them .
tolerant individuals are gentle , even tempered , with no personal conflicts and are not given to violence either direct or indirect .
an answer sheet was developed , wherein the subjects had 5 alternatives to answer each question i.e. always ,
never. since the test was a combination of both positive and negative items the scores for positive items ranged from 5 to1 and for negative items it ranged from 1 to 5 .
based on stratified random sampling method , the scale was administered on 200 college students in the age range of 17 to 21 years . item analysis was carried out by calculating the t values for each item using allen 's , formula .
the t values for 160 items ranged from .94 to 9.73 . out of these a total of 50 items with highest
the above mentioned scale is a 50 item self - administered 5 point rating scale comprising of 10 items from each of the abovementioned dimensions .
the scores range from 5 to 1 for positive items and from 1 to 5 for negative items .
hence the minimum score on the scale can be 50 and the maximum score can be 250 .
cronbach 's alpha was computed as an index of internal consistency for the 50 items of the scale on a sample of 400 college students in the age range of 17 to 21 years .
content validity was seen through collective agreement among the judges as well as empirically through item analysis .
construct validity of the scale was measured in terms of inter - correlation between subscales of emotional stability scale and total scale .
correlation matrix in table 1 reveals that the inter - correlation among various subscales ranged from .135 between aggression vs. tolerance and apathy vs. empathy to .503 between dependence vs. autonomy and pessimism vs. optimism .
all the subscales showed significantly positive correlation with the total score on the test ranging from .33 ( aggression vs. tolerance ) to .63 ( anxiety vs. calm ) .
inter - correlation between emotional stability subscales and total scale the norms are given in the form of cumulative percentages based on the frequency distributions of the total score . based on the obtained frequencies as shown in table 2 , 181 can be taken as minimum cut off score for a normal individual . in terms of mean and standard deviations
12.79 ) , which means the scores in the range of 174 to 200 can be considered as normal .
a 50 item 5 point rating scale is developed based on the psychometric principles of test development to measure various dimensions of emotional stability .
however further research in the area can be taken up to develop the norms for various age groups .
Output:
| background : emotional stability remains the central theme in personality studies .
the concept of stable emotional behavior at any level is that which reflects the fruits of normal emotional development .
the study aims at development of an emotional stability scale.materials and methods : based on available literature the components of emotional stability were identified and 250 items were developed , covering each component .
two - stage elimination of items was carried out , i.e. through judges opinions and item analysis.results:fifty items with highest
t values covering 5 dimensions of emotional stability viz pessimism vs. optimism , anxiety vs. calm , aggression vs. tolerance . , dependence vs. autonomy . ,
apathy vs. empathy were retained in the final scale .
reliability as checked by cronbach 's alpha was .81 and by split half method it was .79 .
content validity and construct validity were checked .
norms are given in the form of cumulative percentages.conclusion:based on the psychometric principles a 50 item , self - administered 5 point lickert type rating scale was developed for measurement of emotional stability . |
PubmedSumm7813 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: plasmids and constructs human socs-3 cdna was amplified from
a human testis cdna library ( bd biosciences ) by pcr using specific primers
( forward , 5-atggtcacccacagcaagtttccc-3 ; reverse ,
5-ttaaagcggggcatcgtactggtc-3 ) and pyrobest dna polymerase
( takara ) .
the pcr conditions were as follow : preincubation at 98 c for 20
s and then 28 cycles of denaturation at 98 c for 15 s , annealing at 70
c for 20 s , and extension at 72 c for 2 min 30 s. the pcr products
were electrophoresed on 1.5% agarose gels , and fragments were extracted using
a qiaex ii kit ( qiagen ) .
these extracted fragments were amplified by pcr under
the same conditions using specific primers containing ecori and bamhi sites .
the pcr products were digested with ecori and bamhi and cloned into the same
sites of pgbt9 ( bd biosciences ) . for generation of flag - socs-3 ( wt ) , socs-3
cdna
was digested by ecori and sali from socs-3pgbt9 and cloned into the ecori
and xhoi sites of flag - pcdna3 ( invitrogen ) .
cdna fragments of socs-3 deletions
were amplified from full - length socs-3 cdna by pcr using specific primers and
pyrobest dna polymerase ( takara ) .
gfp - dp-1 and 6xmyc - dp-1 expression plasmids
were previously described
( 27 ) .
hdp-2 cdna also was
amplified from a human testis cdna library ( bd biosciences ) by pcr using
specific primers ( forward ,
5-atgattataagcacaccacagagactaaccagttcagg-3 ; reverse ,
5-gaaacgtaggctttctcttgtctttattctggggag-3 ) .
hdp-2 and hdp-3 cdnas were amplified by pcr using
specific primers containing ecori and xhoi sites .
yeast cultures , the preparation of
yeast selection media , and yeast transformations were carried out according to
the manufacturer 's protocol ( bd biosciences ) . in the first step of the
two - hybrid library screening procedure , 100 ng of pgbt9-hsocs-3 plasmid ( bait )
was used to transform ah109 yeast strain containing 4 reporter genes , i.e.
lacz , mel1 , his3 , and ade2 .
the transformants were mated with a
pretransformed human skeletal muscle cdna library in yeast strain y190 ( bd
biosciences ) . in the second step ,
the transformants were selected for growth
on media lacking tryptophan , leucine , histidine , and adenine and containing
glucose as the carbon source .
interactors were selected by plating on the same
medium containing the substrate of -galactosidase .
plasmids were extracted from leu+ colonies and
used to transform escherichia coli ( dh5 ) .
cell culture and transfection of hek 293 cells human
embryonic kidney ( hek ) 293 cells were cultured at 37 c with 5%
co2 in dulbecco 's modified eagle 's medium ( dmem ; sigma ) containing
100 units / ml penicillin , 100 g / ml streptomycin , and 10% fetal calf serum
( thermo trace ) as previously described
( 27 ) . for the luciferase and
cell growth assays , plasmids and sirnas were introduced into hek 293 cells
using lipofectamine 2000 ( invitrogen ) . in other experiments , polyfect
transfection reagent ( qiagen ) was also used for plasmid transfection . for
establishing hek 293 cells stably expressing flag - socs-3 ,
the cells were
cultured at 90% confluence in 6-well dishes and then transfected with 4 g
of plasmid expressing flag - socs-3 .
one day later , the transfected cells were
subcultured and grown in the presence of 1 mg / ml of g418 ( invitrogen ) . after 2
weeks , single g418-resistant colonies
these colonies were then maintained in medium containing 1
mg / ml of g418 and analyzed individually for expression of flag - socs3 .
immunoprecipitation and immunoblotting assays hek 293 cells
( 1 10 ) were transfected with flag - socs-3 and 6xmyc - dp-1
expression plasmids using polyfect ( qiagen ) and then cultured for 24 h. the
transfected cells were lysed in tne buffer ( 10 mm tris - hcl , ph 7.9 ,
150 mm nacl , 1 mm edta ) containing 0.1% nonidet p-40 and
a protease inhibitor mixture ( roche applied science ) .
c57bl/6jjcl mouse
( 1214 weeks old)-derived lung and testis were homogenized in tne buffer
using a pellet pestle ( kontes ) .
after centrifugation at 13,500 rpm for 10 min
at 4 c , the supernatants ( 5 mg of total proteins ) were used for each
immunoprecipitation ( ip ) assay .
proteins in the cell lysate or tissue extracts
were precipitated for 1 h at 4 c with anti - flag m2-agarose ( sigma ) or
anti - socs-3 polyclonal antibody ( ibl ) bound to protein a - sepharose ( sigma ) .
the immunocomplexes were washed five times with tne buffer . after having been
washed ,
the antigen of the immunocomplexes obtained with anti - flag m2-agarose
was eluted using flag peptide ( sigma ) , and the supernatant was suspended in
2 sds - page sample buffer and boiled for 2 min at 98 c .
the
immunocomplexes formed with anti - socs-3 polyclonal antibody bound to protein
a - sepharose were directly suspended in 2 sds - page sample buffer and
boiled .
the samples were separated by sds - page and analyzed by immunoblotting
using mouse anti - flag m2 monoclonal antibody ( sigma , 1:1,000 dilution ) , mouse
anti - myc monoclonal antibody 9e10 ( santa cruz biotechnology , 1:1,000
dilution ) , anti - socs-3 antibody or anti - dp-1 monoclonal antibody ( genetex ,
1:1,000 dilution ) as first antibodies .
after four washes with tbst , incubation
with secondary antibody was performed using peroxidase - conjugated goat
anti - rabbit igg ( for anti - socs-3 , abcam , 1:2,000 dilution ) or
peroxidase - conjugated rabbit anti - mouse igg ( for other monoclonal antibodies ,
dako japan , 1:1,000 dilution ) . finally , after four more washes with tbst , the
immunoblots were apposed to hyperfilm ( ge healthcare ) , which was then exposed
for 15 s to 2 min
hek 293
cells were divided into several 35-mm glass bottom culture dishes ( mattec
corp . ) and transfected with the gfp - empty , gfp - dp-1 , and/or flag - socs-3
plasmids .
transfected cells were grown for 24 h at 37 c in dmem
containing 10% fetal bovine serum .
the cells were then washed three times with
pbs ( - ) and fixed in 4% paraformaldehyde / pbs for 30 min at room temperature .
they were then again washed three times with pbs ( - ) . for the detection of
flag - socs-3 ,
after the wash with pbs ( - ) , the cells were incubated with
anti - flag m2 antibody ( sigma ) in blocking solution at 1:1000 dilution for 1 h.
they were subsequently washed five times with 0.1% triton x-100/pbs ( pbst ) and
thereafter incubated with cy-5-labeled anti - mouse igg ( chemicon international )
in blocking solution at 1:1000 dilution for 1 h. finally , the cells were
washed five times with pbst , and the coverslip was mounted with vectashield
( vector lab , inc . ) .
samples were examined using an lsm 510 meta confocal
imaging system ( carl zeiss ) .
hek 293 cells stably expressed flag - socs-3 were
also cultured in 35-mm glass bottom dishes and fixed by the same methods .
the
fixed cells were then incubated with anti - socs-3 polyclonal antibody ( ibl ) and
anti - dp-1 monoclonal antibody spm178 ( genetex ) in blocking solution at 1:1000
dilution for 1 h. they were subsequently washed five times with pbst and
thereafter incubated with cy-5-labeled anti - mouse igg ( chemicon international ,
1:1000 dilution ) and alexa fluor 488-labeled anti - rabbit igg ( molecular
probes , 1:2000 dilution ) in blocking solution for 1 h. the samples were then
examined using an fv-1000 confocal imaging system ( olympus ) .
hek 293 cells were cultured in 24-well
microplates and transfected with 100 ng of cyclin - e - luc or apre - luc reporter
plasmids , 10 ng of prl - tk - luc internal control plasmid , and the desired
expression plasmids ( 100 ng of each expression plasmid ) .
the total amount of
plasmid dna was kept constant by balancing with empty expression plasmids .
transfected cells were cultured for 24 h. for the apre - luc assay , cells were
incubated for 6 h with or without 10
luciferase activity was detected with a veritas microplate luminometer
( promega ) and dual - luciferase reporter assay system ( promega ) .
chromatin immunoprecipitation ( chip)hek 293 cells were
cultured in 12-well microplates and transfected with expression plasmids and
sirna .
cells were fixed by directly adding formaldehyde to the medium ( final
concentration 1% ) .
15 min later , the fixed cells were washed with ice - cold pbs
containing protease inhibitors .
the cells were solubilized in lysis buffer ,
and then chromatin was sheared to an average dna fragment size of
200500 bp by sonication .
chip assays were performed using one day chip
assay kit ( diagenode ) according to the manufacturer 's protocol .
antibodies
used for immunoprecipitation included anti - dp-1 monoclonal antibody spm178
( genetex ) and anti - e2f monoclonal antibody ( upstate ) . with the use of prime
star ( takara )
, the eluted dna was amplified by pcr with the following primers
for the cyclin - e promoter ( encompassing the 3 major e2f binding sites ;
forward , 5-cgcccgccgtgtttacattccac-3 ; reverse ,
5-cgaggcgcagggacggggaatc-3 ) .
hek 293 cells were cultured in 10-cm dishes
and transfected with the desired plasmids .
24 h later , the cells were
harvested and then stained with cycletest plus ( bd biosciences ) .
subsequently ,
flow cytometric analysis was carried out in a facscalibur flow cytometer ( bd
biosciences ) using cellquest software .
were transfected
with the indicated expression plasmids , and then cultured for 2 days in 10%
fetal bovine serum containing dmem .
cell growth was examined by performing a
celltiter - glo luminescent cell viability assay ( promega ) .
short - interfering rna ( sirna ) transfection the following
sirna oligonucleotides were used to interrupt the expression of endogenous and
exogenous socs-3 or dp-1 : socs3 stealth select rnai ( catalog number ,
hss113313 , invitrogen ) , dp-1 stealth select rnai ( catalog number , hss144254 ,
invitrogen ) , and stealth rnai negative control med gc duplex 3 ( catalog
number , 12935 - 113 , invitrogen ) .
hek 293 cells were transfected with these
sirnas according to the manufacturer 's protocol ( invitrogen ) with the aid of
lipofectamine 2000 ( invitrogen ) .
identification of dp-1 as a socs-3-interacting protein using
yeast two - hybrid screening and a human testis cdna library , we sought proteins
that could interact with socs-3 .
we initially found that 28 of 76 clones were
the c - terminal portion of the transcription factor dp-1 . by this screening
,
four types of dp-1 clones ( 103410 , 192410 , 238410 ,
240410 amino acids ) were identified .
these results suggest that the
c - terminal domain of dp-1 ( 240410 amino acids ) was the region
interacting with socs-3 . socs-3
interacts with dp-1 in cells in vitro and in vivo the
interaction between socs-3 and dp-1 in hek 293 cells was investigated by
conducting an immunoprecipitation - western blot assay .
the cell lysates were
examined for the expression of flag - socs-3 and 6 myc - dp-1 proteins
( fig .
the lysates were first immunoprecipitated with flag antibody
beads , which were then washed and examined by western blotting assay with a
flag or myc antibody . as shown in fig .
1 , socs-3 bound dp-1 ( fig .
in addition , dp-1 also interacted
with socs-1 and socs-2 ( data not shown ) .
1a ) , we
determined the critical region in socs-3 required for interaction with dp-1 .
socs-3 having an n- or c - terminal truncation , c188 and n45 , were
able to bind dp-1 ( fig .
1ba , lanes 3 and 4 ) , but c141
could not ( fig .
therefore , we created a further
deletion between 141 and 188 and examined the ability of this mutant to bind
dp-1 .
in addition , although we prepared c - terminally truncated forms of
dp-1 to address the domain interacting with socs-3 , these proteins were
expressed at low levels , making such an assessment impossible ( data not
shown ) .
b , interaction of flag - socs-3 with 6xmyc - dp-1 was
analyzed using the immunoprecipitation - western blotting assay .
hek 293 cells
were transiently transfected with plasmids expressing either flag - socs-3 or
6myc - dp-1 .
the immunoprecipitates ( a and b ) or cell
lysates ( c and d ) were blotted with anti - flag ( b
and c ) or anti - myc ( a and d ) antibodies .
c , interaction of socs-3 with endogenous dp-1 in cells in
vitro and in vivo was analyzed using the
immunoprecipitation - western blotting assay .
lysates of hek 293 cells ( lane
1 ) , hek 293 cells stably expressing flag - socs-3 ( lane 2 ) and
extracts prepared in tne buffer by homogenization of lung and testis excised
from a normal c57bl/6jjcl male mouse ( 1214 weeks old , lanes 3
and 4 ) were used for immunoprecipitation - western blotting .
d , interaction of flag - socs-3 with 6xmyc - dp-1 ( wt , lane 1 ) ,
dp-1 ( , lane 2 ) , dp-1 ( , lane 3 ) , dp-2 ( wt ,
lane 4 ) , and dp-3 ( wt , lane 5 ) , was analyzed using the
immunoprecipitation - western blotting assay .
b , interaction of flag - socs-3 with 6xmyc - dp-1 was
analyzed using the immunoprecipitation - western blotting assay .
hek 293 cells
were transiently transfected with plasmids expressing either flag - socs-3 or
6myc - dp-1 .
the immunoprecipitates ( a and b ) or cell
lysates ( c and d ) were blotted with anti - flag ( b
and c ) or anti - myc ( a and d ) antibodies .
c , interaction of socs-3 with endogenous dp-1 in cells in
vitro and in vivo was analyzed using the
immunoprecipitation - western blotting assay .
lysates of hek 293 cells ( lane
1 ) , hek 293 cells stably expressing flag - socs-3 ( lane 2 ) and
extracts prepared in tne buffer by homogenization of lung and testis excised
from a normal c57bl/6jjcl male mouse ( 1214 weeks old , lanes 3
and 4 ) were used for immunoprecipitation - western blotting .
d , interaction of flag - socs-3 with 6xmyc - dp-1 ( wt , lane 1 ) ,
dp-1 ( , lane 2 ) , dp-1 ( , lane 3 ) , dp-2 ( wt ,
lane 4 ) , and dp-3 ( wt , lane 5 ) , was analyzed using the
immunoprecipitation - western blotting assay .
next , to confirm this interaction in cells in vitro as well as
in vivo , we used hek 293 cells stably expressing flag - socs-3 and
mouse lung or testis .
as shown in fig .
1c , we observed the interactions between socs-3 and dp-1
in a stable - expressed hek 293 transfectant of flag - socs-3 as well as in mouse
lung and testis extracts ( fig .
furthermore , it was of interest to us to examine whether socs-3 also would
be able to interact with other dp molecules ( dp-1 , , dp-2 , and
dp-3 ) . therefore , we investigated this point using the immunoprecipitation
assay .
1d , we observed that dp-3 also was able to interact with
socs3 ( fig .
1da ,
lane 5 ) but that dp-1 , , and dp-2 was not
( fig .
these results strongly suggest that socs-3 is able to
interact with dp-1 in cells in vitro and in vivo and that
the 156172 region of socs-3 and the c terminus of dp-1 are required for
this interaction .
co - localization of socs-3 and dp-1although we found that
socs-3 interacted with dp-1 in hek 293 cells , it is important to observe
visually this cellular interaction .
therefore , we used confocal microscopy to
examine the localization of dp-1 and socs-3 and their interaction . hek 293
cells were transiently transfected with green fluorescent protein ( gfp)-fused
dp-1 or flag - tagged socs-3 expression plasmid or both .
the localization of
each protein was observed at 18 h after the transfection . when these
expression plasmids were used separately , although gfp was expressed
throughout the cells ( fig .
2a ) , gfp - dp-1 was predominantly located in the cytoplasm
( fig .
several
studies ( 28 ,
33 ,
34 ) also have demonstrated
that dp-1 overexpressed in hek 293 cells in the cytoplasm . on the other hand ,
2c ) . in
addition , we observed that both proteins were co - localized in the cytoplasm
after co - transfection ( fig .
2 g , yellow to orange fluorescence ) ;
thus the expression pattern of these proteins remained unaltered
( fig .
2 , d g ) .
next , to confirm this co - localization we used hek 293 cells stably expressing
flag - socs-3 . as shown in fig .
k , although endogenously expressed dp-1 was
mainly expressed in the nucleus ( fig .
2h ) , the co - localization was observed in the cytoplasm
( fig .
these
results suggest that the interacting event between socs-3 and dp-1 occurred in
the cytoplasm of hek 293 cells .
hek 293 cells were transiently transfected with pegfp - c2 empty plasmid
( a ) pegfp - c2-dp-1 ( b ) , or pcdna3-flag - socs-3 ( c ) .
hek 293 cells were also co - transfected with pegfp - c2-dp-1 and
pcdna3-flag - socs-3 ( d g ) .
dp-1 was detected by gfp
fluorescence ( d ) , whereas socs-3 was detected with anti - flag antibody
and cy5-conjugated secondary antibody ( e ) .
dic image ( f ) ,
and merged gfp / cy5 fluorescence ( g ) are also shown .
hek 293 cells
stably expressing flag - socs-3 were also examined ( h k ) .
dp-1
was detected with anti - dp-1 monoclonal antibody and cy5-labeled secondary
antibody ( h ) , whereas socs-3 was detected with anti - socs-3 polyclonal
antibody and alexa fluor 488-labeled anti - rabbit igg ( i ) .
the dic
image ( j ) and merged alexa fluor 488/cy5 fluorescence ( k )
are also shown .
yellow - to - orange staining indicates co - localized
socs-3 and dp-1 ( g and k ) .
hek 293 cells were transiently transfected with pegfp - c2 empty plasmid
( a ) pegfp - c2-dp-1 ( b ) , or pcdna3-flag - socs-3 ( c ) .
hek 293 cells were also co - transfected with pegfp - c2-dp-1 and
pcdna3-flag - socs-3 ( d g ) .
dp-1 was detected by gfp
fluorescence ( d ) , whereas socs-3 was detected with anti - flag antibody
and cy5-conjugated secondary antibody ( e ) .
dic image ( f ) ,
and merged gfp / cy5 fluorescence ( g ) are also shown .
hek 293 cells
stably expressing flag - socs-3 were also examined ( h k ) . dp-1
was detected with anti - dp-1 monoclonal antibody and cy5-labeled secondary
antibody ( h ) , whereas socs-3 was detected with anti - socs-3 polyclonal
antibody and alexa fluor 488-labeled anti - rabbit igg ( i ) . the dic
image ( j ) and merged alexa fluor 488/cy5 fluorescence ( k )
are also shown .
yellow - to - orange staining indicates co - localized
socs-3 and dp-1 ( g and k ) .
socs-3 inhibits the transcriptional activity of
dp-1/e2f because it was of interest to us to explore whether socs-3
actually would be able to regulate the transcriptional activity of dp-1 , we
next investigated the effect of socs-3 on this transcriptional activity in hek
293 cells .
as shown in a previous study
( 35 ) , because expression of
the endogenous dp-1 is widely observed in several cell lines and the level of
dp-1 is considered to be sufficient to exhibit e2f / dp-1 transcriptional
activity , using the cyclin - e - luc assay we explored the effect of socs-3 on
endogenously expressed dp-1 in hek 293 cells .
first , we examined whether the
e2f / dp-1 transcriptional activity in the cells depended on endogenously
expressed dp-1 .
3a , lane 2 , cyclin - e - luc activity was
dramatically inhibited by dp-1 sirna .
these observations suggest that
endogenous dp-1 plays an important role in e2f / dp-1 transcriptional activity
in the cells .
therefore , we next addressed whether socs-3 could actually
inhibit e2f / dp-1-dependent transcriptional activity in an endogenous
dp-1-driven cyclin - e - luc activity .
as expected , scos-3 ( wt ) expression
inhibited about 50% of the transcriptional activity
( fig .
however , such inhibitory effect was not observed with socs-3
( 156172 ) , in which the dp-1-binding region is absent
( fig .
importantly , because this inhibitory action of socs-3 was eliminated
completely by socs-3 sirna ( fig .
3a , lane 6 ) , these results strongly suggest that
the inhibitory effect of socs-3 on endogenous dp-1-dependent transcriptional
activity is specific to socs-3 .
in addition , to support the contribution of endogenous dp-1 and exogenous
socs-3 , we investigated the expression of both proteins by western blotting .
3b ,
the endogenous dp-1 expression in hek 293 cells was almost completely
inhibited by dp-1 sirna . also , the expression of exogenous socs-3 at the
protein level in socs-3-expressing cells was inhibited by socs-3 sirna
( fig .
next , using
the chip assay , we explored the interference of socs-3 with the binding of
dp-1/e2f-1 to the cyclin - e promoter .
together , these
results suggest to us the possibility that socs-3 may retard cell cycle
progression by inhibiting dp-1-elicited transcriptional activity of the
cyclin - e gene .
a , hek 293 cells were transiently transfected with the indicated
expression plasmids and sirna together with reporter ( cyclin - e - luc ) and
internal control ( prl - tk - luc ) plasmids .
after transfection , the cells were
incubated for 2430 h , and then cell extracts were prepared .
firefly luciferase activity ( cyclin - e - luc ) from triplicate samples
was determined and normalized against renilla luciferase ( prl - tk - luc )
activity .
effects of sirna were analyzed by western blotting with anti - dp-1
antibody ( b ) and anti - socs-3 antibody ( c ) .
d , chip
assays for binding of dp-1/e2f-1 to the cyclin - e promoter . hek 293 cells were
transiently transfected with the indicated expression plasmids and sirna and
then were fixed and subjected to the chip assay .
pcr amplification of dna
precipitated with anti - dp-1 ( lanes 37 ) and anti - e2f-1
( lanes 812 ) using primers for the cyclin - e promoter . input
lane ( lane 1 ) shows products after pcr amplification of chromatin dna
before the addition of an antibody .
pcr products were separated by 2% agarose
gel electrophoresis and visualized by ethidium bromide staining .
a , hek 293 cells were transiently transfected with the indicated
expression plasmids and sirna together with reporter ( cyclin - e - luc ) and
internal control ( prl - tk - luc ) plasmids .
after transfection , the cells were
incubated for 2430 h , and then cell extracts were prepared .
firefly luciferase activity ( cyclin - e - luc ) from triplicate samples
was determined and normalized against renilla luciferase ( prl - tk - luc )
activity .
effects of sirna were analyzed by western blotting with anti - dp-1
antibody ( b ) and anti - socs-3 antibody ( c ) .
d , chip
assays for binding of dp-1/e2f-1 to the cyclin - e promoter . hek 293 cells were
transiently transfected with the indicated expression plasmids and sirna and
then were fixed and subjected to the chip assay .
pcr amplification of dna
precipitated with anti - dp-1 ( lanes 37 ) and anti - e2f-1
( lanes 812 ) using primers for the cyclin - e promoter .
input
lane ( lane 1 ) shows products after pcr amplification of chromatin dna
before the addition of an antibody .
pcr products were separated by 2% agarose
gel electrophoresis and visualized by ethidium bromide staining .
a , hek 293 cells were transfected with the indicated expression
plasmids , cultured for 24 h , harvested , and stained with propidium iodide
using cycletest plus .
b , hek 293 cells were transiently transfected or not with the
indicated plasmids and sirna , and then cultured for 2 days in dmem containing
10% fetal bovine serum .
the number of viable cells was measured using the
celltiter - glo assay system based on quantification of the atp present .
a , hek 293 cells were transfected with the indicated expression
plasmids , cultured for 24 h , harvested , and stained with propidium iodide
using cycletest plus .
b , hek 293 cells were transiently transfected or not with the
indicated plasmids and sirna , and then cultured for 2 days in dmem containing
10% fetal bovine serum .
the number of viable cells was measured using the
celltiter - glo assay system based on quantification of the atp present .
socs-3 inhibits the cell cycle progression of dp-1-transfected
cells to verify the above - mentioned possibility , we used flow
cytometry to determine whether or not socs-3 could retard the
e2f / dp-1-dependent cell cycle progression .
we transfected hek 293 cells with
the appropriate expression plasmids and then analyzed the distribution of
cells in the various phases of the cell cycle , as described previously
( 27 ) .
4a , dp-1 enhanced
the proportion of hek 293 cells that had passed from g1 to s phase
( fig .
furthermore , we examined cell growth by conducting a
luminescent cell viability assay , which is a homogeneous method for
determining the number of viable cells .
as we expected , the stimulated cell
growth of dp-1-transfected cells was clearly eliminated by dp-1 sirna
( fig .
4b , lane
4 ) . when the cells were co - transfected with socs-3 and dp-1 expression
plasmids , although the dp-1-mediated cell growth was markedly inhibited by
socs-3 ( fig .
4b ,
lane 5 ) , importantly , this inhibitory action of socs-3 was blocked by
socs-3 sirna ( fig .
4b , lane 6 ) .
these results suggest that socs-3
acts as a negative regulator of the cell cycle and cell growth under e2f / dp-1
control .
dp-1 eliminates the negative regulation of socs-3 in stat
signaling finally , to confirm definitively this interaction between
socs-3 and dp-1 , in reverse , we explored whether dp-1 could eliminate the
negative regulation of socs-3 in jak - stat signaling . to explore this
, we
examined whether dp-1 could block the socs-3 inhibition of lif - stimulated
stat3 transcriptional activity by conducting a luciferase assay with a
reporter plasmid bearing the apre promoter and luciferase gene .
socs-3 ( wt )
dramatically inhibited the lif - stimulated stat3 transcriptional activity in
hek 293 cells ( fig . 5 , lane
3 ) .
this inhibition was almost completely blocked by socs-3 sirna
( fig . 5 , lane 4 ) .
importantly , dp-1 clearly eliminated the inhibitory action of socs-3 toward
lif - stimulated stat3 transcriptional activity in socs-3 ( wt)-transfected cells
( fig . 5 , lane 14 ) . in
addition , as we expected , this elimination by dp-1 was blocked by dp-1 sirna
( fig . 5 , lane 16 ) .
however , such elimination was not observed for socs-3
( 156172)-mediated inhibition of the stat3 transcriptional
activity , because socs-3 ( 156172 ) is not able to bind to dp-1
( fig . 5 , lane 18 ) .
these results strongly indicate that dp-1 was able to block the socs-3 action
as a negative regulator of jak - stat signaling .
herein , using the two - hybrid system , we identified dp-1 as a
socs-3-interacting protein . because e2f / dp-1 plays an important role in the
g1-to - s phase transition in the cell cycle
( 2224 )
,
we suspected that socs-3 may regulate cell cycle progression under e2f / dp-1
control via interaction with dp-1 .
although it is well known that
retinoblastoma tumor suppressor protein ( rb ) regulates negatively e2f function
by interacting directly with this transcriptional protein
( 2931 ,
3638 ) ,
to our knowledge , a dp-1-interacting protein that is able to regulate cell
cycle progression under e2f / dp-1 control has not previously been demonstrated .
our present study is the first one to show that socs-3 acts as a negative
regulator of the cell cycle under e2f / dp-1 control by interacting with dp-1 .
interestingly , these findings also suggest the possibility that human socs-3
may regulate tumor cell growth and cell differentiation via this novel
mechanism .
figure 5.dp-1 eliminates the inhibitory action of socs-3 toward lif - stimulated
stat3 transcriptional activity .
hek 293 cells were transiently transfected
with various combinations of flag - socs-3 ( wt ) , flag - socs-3
( 156172 ) , 6myc - dp-1 ( wt ) , and sirna in the presence of
the apre - luc and prl - tk - luc reporter plasmids .
the cells were incubated in the
presence or absence of 10 ng / ml hlif for 6 h , and then the cell extracts were
prepared .
firefly luciferase activity ( apre - luc ) from triplicate
samples was determined and normalized against renilla luciferase
( prl - tk - luc ) activity .
dp-1 eliminates the inhibitory action of socs-3 toward lif - stimulated
stat3 transcriptional activity .
hek 293 cells were transiently transfected
with various combinations of flag - socs-3 ( wt ) , flag - socs-3
( 156172 ) , 6myc - dp-1 ( wt ) , and sirna in the presence of
the apre - luc and prl - tk - luc reporter plasmids .
the cells were incubated in the
presence or absence of 10 ng / ml hlif for 6 h , and then the cell extracts were
prepared .
firefly luciferase activity ( apre - luc ) from triplicate
samples was determined and normalized against renilla luciferase
( prl - tk - luc ) activity .
we found using an immunoprecipitation assay that socs-3 interacted with
dp-1 both in cells in vitro as well as in vivo
( fig . 1 , b and
c ) .
in addition , using a series of deletion mutants of
socs-3 , we determined that the 156172 amino acid region of socs-3 was
required for interaction with dp-1 ( fig .
although the function of this region located between
sh2 and socs - box domains is not yet known , this region is considered to be a
part of the domain interacting with dp-1 .
it is well known that dp-1
transcriptional activity is regulated by interaction with p53
( 39 ) or arf
( 40 ,
41 ) and also that e2f is
controlled by interaction with prb
( 2931 ,
3638 ) .
however , because the cell cycle is a series of complicated cellular events
regulated by many kinds of signaling molecules , it was of much interest to us
to identify novel factors interacting with e2f / dp-1 and also to demonstrate
the regulatory mechanism involving e2f / dp-1 in detail .
therefore , we
investigated here the regulatory mechanism of socs-3 with respect to e2f / dp-1
control of the cell cycle .
several recent studies have shown that the
decreased expression of socs-1 , -2 , and -3 by hypermethylation of its gene
promoter is closely related to aggravation of some cancers
( 1121 ) .
although these observations suggested to us some regulatory action of socs-1
for development and progression of tumor cells , the molecular mechanism
underlying the inhibitory action of socs family proteins
we found that socs-3 inhibited the transcriptional
activity of e2f / dp-1 via its interaction with dp-1 and consequently retarded
the cell cycle and cell growth under e2f / dp-1 control ( figs .
3 and
4 ) , though socs-3 did not
completely inhibit the transcriptional activity of e2f / dp-1
( fig .
importantly , these inhibitions of socs-3 were almost completely blocked by
socs-3 sirna ( figs . 3 and
4b ) . as shown in
fig .
2 , the localization of
both dp-1 and socs-3 co - overexpressed in hek 293 cells almost was the same as
that of each overexpressed alone ; and , importantly , both proteins were
detected together in the cytoplasm . because we observed the co - localization of
dp-1 and socs-3 in the cytoplasm ( fig .
2 ,
g and k ) , we suspect that socs-3 probably may
inhibit the transcriptional activity by interacting with dp-1 located in the
cytoplasm and promote the proteolysis of dp-1 via the socs - box .
this
possibility is supported by our data from the chip assay showing that socs-3
clearly inhibited dna binding activity of dp-1/e2f-1 at the cyclin - e promoter
( fig .
figure 6.model illustrating the regulatory mechanisms between socs-3 and dp-1 for
jak - stat signaling and cell cycle progression .
several kinds of cytokines
induce socs-3 expression via the jak - stat signaling system , and then the
endogenous socs-3 inhibits the transcriptional activity of e2f / dp-1 by binding
to cytoplasmic dp-1 .
consequently socs-3 acts as a negative regulator of cell
cycle progression under e2f / dp-1 control . acting differently
, dp-1 eliminates
the inhibitory action of endogenous socs-3 toward jak - stat signaling .
model illustrating the regulatory mechanisms between socs-3 and dp-1 for
jak - stat signaling and cell cycle progression .
several kinds of cytokines
induce socs-3 expression via the jak - stat signaling system , and then the
endogenous socs-3 inhibits the transcriptional activity of e2f / dp-1 by binding
to cytoplasmic dp-1 .
consequently socs-3 acts as a negative regulator of cell
cycle progression under e2f / dp-1 control . acting differently
, dp-1 eliminates
the inhibitory action of endogenous socs-3 toward jak - stat signaling .
interestingly , because socs-1 and socs-2 also were able to interact with
dp-1 and to inhibit its transcriptional
activity,3 both socs
proteins also may act as novel negative regulator of e2f / dp-1 via direct
interaction with dp-1 .
( 26 ) identified a novel dp
subclass , dp-3 , that is able to inhibit e2f-1 transcriptional activity .
therefore , our interest was to address whether socs-3 also is able to interact
with dp-3 .
consequently , we proved that socs-3 directly is able to interact
with dp-3 ( fig .
although it is very important to explore the regulatory action of
socs-3 for dp-3 , these results suggest to us a novel mechanism of socs
protein - mediated regulation of tumor cell growth and development . on the other hand , to confirm our finding that human socs-3 was an
interacting protein of dp-1 , approaching the question from another angle , we
investigated whether dp-1 could eliminate the inhibitory action of socs-3
toward lif - stimulated stat3 transcriptional activity in jak - stat signaling .
consequently we observed that dp-1 almost completely eliminated such
inhibitory action of socs-3 in this signaling pathway
( fig .
as described above , the
cytoplasmic dp-1 may interact with endogenous socs-3 induced by cytokines or
growth hormones and act as its modulator .
these observations lead us to
speculate that socs-3 and dp-1 may alternatively regulate each other in local
sites of tissues having inflammatory reaction such as tumor and rheumatoid
arthritis ( fig .
also , interestingly , it has been shown that socs-3 is deeply involved in
both initiation and development of allergic diseases such as atopic dermatitis
and asthma ( 42 ) .
therefore ,
dp-1 may act as a potent modulator of allergic diseases(s ) regulated by
socs-3 .
importantly , it has been shown that ubiquitinated dp-1 is degraded by
the proteasome system ( 43 ) .
also , socs-3 is known to recruit ecs ( elongin b / c - cul2/cul5-socs - box protein )
e3 ligase , resulting in accelerated proteasomal degradation of target proteins
and socs-3
( 4447 ) .
therefore , to understand how each of these factors actually exhibits its
regulatory action in the cytoplasm , in further experiments , it will be very
important for us to address in detail the degradation events of both factors
in the cytoplasm . in conclusion
, we demonstrated that human socs-3 interacted with dp-1 and
regulated cell cycle progression under e2f / dp-1 control
( fig .
thus , these findings
provide us with new insights into the role of socs-3 in cell growth and cell
differentiation besides its function as a negative regulator of jak - stat
signaling .
Output:
| recent studies using socs family knock - out mice have suggested that socs
proteins have multiple biological functions in addition to their role as
negative regulators of jak - stat signaling . to explore these other functions of
this family of proteins , we used yeast two - hybrid screening to find proteins
interacting with human socs-3 .
we identified the transcriptional factor dp-1
as a socs-3-interacting protein involved in regulation of the cell cycle .
immunoprecipitation - western blot assay showed that this interaction between
these endogenous proteins occurred in cells both in vitro and in
vivo .
socs-3 interacted with the c - terminal region of dp-1 , and amino
acids 156172 of socs-3 were required for this interaction .
confocal
microscopy revealed that socs-3 and dp-1 were primarily colocalized in the
cytoplasm .
socs-3 inhibited e2f / dp-1 transcriptional activity under the
cyclin - e promoter and actually inhibited cell cycle progression and cell
growth under e2f / dp-1 control . in contrast , dp-1 almost completely eliminated
the inhibitory action of socs-3 on lif - stimulated stat-3 transcriptional
activity in jak - stat signaling .
interestingly , the alternative regulatory
action of socs-3 and dp-1 was dramatically eliminated by each sirna . taken
together ,
these findings demonstrate that socs-3 acts as a negative regulator
of the cell cycle progression under e2f / dp-1 control by interfering with
heterodimer formation between dp-1 and e2f and also that dp-1 plays an
important role in controlling jak - stat signaling . |
PubmedSumm7814 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: analgesic nephropathy is a disease resulting from the frequent use of combinations of analgesic medications over many years , leading to significant impairment of renal function .
the observation of a large number of cases of renal failure in patients abusing analgesic mixtures containing phenacetin led to the initial recognition of the nephrotoxicity from the use of analgesics .
. however , the role of a single analgesic as a sole cause of analgesic nephropathy was challenged , and a number of researchers have since attempted to determine the extent of involvement of other analgesics including nonsteroidal anti - inflammatory drugs ( nsaids ) , aspirin , and paracetamol .
we present the case of an 83-year - old woman with a history of nsaid - induced nephropathy with poor pain control and reluctance to use paracetamol .
we attempt to briefly review the evidence of paracetamol being implicated in the development of analgesic - induced nephropathy .
patients should therefore not be withheld paracetamol , an effective and commonly recommended agent , for fear of worsening renal function .
we present a case of poor pain control and reluctance to use paracetamol in an elderly patient who had a history of nonsteroidal anti - inflammatory drug ( nsaid)-induced nephropathy .
we also attempt to briefly review the evidence of paracetamol being implicated in the development of analgesic - induced nephropathy .
mrs mj ( 83 years old ) was referred for a routine home medicines review in view of her multiple medications ( table 1 ) .
home medicines review is a government - funded program in australia that allows a pharmacist to review patients medications at their homes and make recommendations to their general practitioners.1,2 mrs mj s medical history included : atrial fibrillation , analgesic nephropathy ( an ) , chronic kidney disease ( stage 3 , estimated glomerular filtration rate 60 ml / min/1.73 m ) , gastroesophageal reflux disease , vitamin b12 deficiency , hypertension , hypercholesterolemia , hyperhomocysteinemia , hypothyroidism , myocardial infarction ( two in the 1970s ) , degenerative spondylolisthesis , and transient ischemic attack . at review , mrs mj described persistent back pain , but was reluctant to take paracetamol , due to her renal disease and previously documented analgesic - induced nephropathy in 1999 .
the patient had been told by health professionals to be careful with some painkillers to avoid further kidney damage , and subsequently had chosen to avoid paracetamol .
the patient was unsure which health professional had told her to avoid paracetamol , but had decided it would be prudent to avoid all painkillers , and she could not recall a health professional telling her paracetamol was safe .
further , it was documented that the patient had previously experienced acute renal failure from the use of an nsaid
. the patient was unsure which nsaid had caused her acute kidney failure , and it was not documented in her medical history .
chronic pain is a treatable condition that at any one point in time affects 20%46% of community - dwelling older adults and 28%73% of residents in aged - care facilities.3 a number of practice guidelines and literature reviews relating to the management of chronic pain in the elderly exist , with paracetamol being the first - line management option.3,4 a daily dose of both analgesic and anti - inflammatory medications is common practice among millions of patients experiencing chronic pain.5 paracetamol is used alongside nsaids to assist in managing inflammatory conditions , such as gout or rheumatoid arthritis.6 nsaids are more effective than paracetamol for persistent inflammatory pain ; however , they are associated with gastrointestinal side effects ( eg , ulcers , bleeding ) , cardiovascular side effects ( eg , hypertension , exacerbation of heart failure ) , and worsening of chronic renal failure.3,4 nsaids are best avoided in the elderly despite their efficacy , and if they are required to use them , they should be given in the lowest possible dose for the shortest period.3 the long - term effects of other analgesics ( particularly paracetamol ) on the kidneys have been debated at length.7,8 currently , there are two recognized forms of an : nsaid - associated nephropathy and classic an .
nsaid - induced nephropathy is a widely reviewed condition.9 the nephrotoxicity of nsaids is mediated via nonspecific blocking of cyclooxygenase , subsequent inhibition of prostaglandin synthesis leading to vasoconstriction , and reversible renal impairment in volume - contracted states.9 this may lead to acute tubular necrosis and acute renal failure
. nsaids also produce interstitial nephritis and papillary necrosis , resulting in chronic renal failure.9 the observation of large numbers of cases of renal failure in patients abusing analgesic mixtures containing phenacetin ( termed phenacetin nephropathy ) led to the initial recognition of nephrotoxicity from the use of analgesics.10 however , the role of a single analgesic as a sole cause of an was challenged , leading to the redefinition of an in 1996 as a disease resulting from the frequent use of combinations of analgesic medications over many years , usually codeine or caffeine.10 phenacetin was introduced as an analgesic in 1887 , soon followed by paracetamol in 1893.11 phenacetin was popular due to its long duration of action ; however , it had weaker antipyretic effects when compared to paracetamol.11 it took scientists nearly 50 years to discover that paracetamol is the major metabolite of phenacetin , thus accounting for phenacetin s analgesic effect ( figure 1).11 in the 1970s , an as a cause of end - stage renal disease reached its peak in australia , with the condition being responsible for an estimated 20% of patients requiring renal replacement therapy.12 as a response to this , phenacetin was removed from vincents and bex ( the most frequently used analgesic products ) in 1967 and 1975 , respectively.13 in 1977 , phenacetin was legally banned from all medical preparations in australia , and all over - the - counter combination analgesic products were banned in 1979.13 phenacetin was later removed from the canadian market in 1978 , and in 1983 from the us.14,15 similarly , phenacetin was banned from the uk in 1980 , and in belgium phenacetin was removed from the two most frequently abused preparations in 1972 and 1981 , followed by a total legal ban in 1988.15,16 since this time , the exclusive role of phenacetin has been questioned in the development of nephropathy .
researchers have proposed that paracetamol , not phenacetin , accumulated in the renal papilla , and in animal experiments phenacetin appeared to be less nephrotoxic than the other analgesics.17 further , the withdrawal of phenacetin in australia in 1977 did not result in a decline of an , as illustrated in figure 2.12,18 on the contrary , a surge in the incidence of an was noted for some years before a reduction .
these differences presumably resulted from the misdiagnosis of nsaid - induced nephropathy.18 several case - control studies have reported associations between chronic renal failure and other analgesic preparations , including aspirin , antipyretics , and nsaids in combination with caffeine , codeine , and/or barbiturates.19 the research regarding the effects of paracetamol on an appear to be inconclusive .
perneger et al investigated 716 patients with renal failure , and concluded that increased paracetamol use was associated with an enhanced risk of renal failure in a dose - dependent manner.20 approximately 9% of renal failure cases were attributable to increased paracetamol use.20 however , this study failed to adjust for the potential for patients using paracetamol to be concurrently using either phenacetin or nsaids when assessing association with renal failure.20 a major review by delzell and shapiro highlighted that most of the epidemiological evidence investigating an has been unsatisfactory , and the research using animal models was inconsistent and not translatable to humans.21 another review published in 2000 found no evidence between nonphenacetin combined analgesics and nephropathy.22 a 2001 study attempted to adjust for the use of other analgesics , including phenacetin , and evaluate paracetamol and aspirin use in relation to chronic renal disease.23 this study found that the regular use of paracetamol ( at least twice a week for 2 months ) increased the risk of developing chronic renal failure ( 2.5-fold increase compared to nonusers ) . however , consumption of these analgesics for conditions that predisposed patients to renal failure may have resulted in some bias.23 mihatsch et al ( n=616 , autopsy examination of adult kidneys ) found compelling evidence demonstrating nonphenacetin analgesics are not responsible for an , citing a significant decline in the prevalence of an from ~4% in 1980 to 0.2% in 2000 ( 20 years after the removal of phenacetin from the analgesic market ) .
also , kelkar et al conducted a retrospective case - control study of medical and pharmacy claims of a sample of 4,742 cases of renal disease , comparing chronic versus acute paracetamol use and renal disease.24 this study further confirmed that there was not a significant increase in risk for an in patients exposed to accumulative dosage of at least 1 kg of paracetamol in the preindex year.24 researchers , however , were unable to assess use of over - the - counter paracetamol , which would likely have strengthened results.24 currently in australia , paracetamol is available for purchase as an unscheduled medication as 500 mg tablets in packets of 20 tablets or less.25 the sale of larger quantities and combination products , such as narcotic and decongestant preparations , are more highly regulated , and are required to be sold by pharmacies.25 in response to the lack of concrete data regarding causative analgesics , a peer - review committee was selected by the regulatory authorities of germany , switzerland , and austria to determine the relationship between nonphenacetin analgesics and an.22 the committee concluded that previously published studies to date had major flaws and failed to establish the association of analgesics other than phenacetin leading to chronic renal disease.22 in our view , patients should not be withheld an effective and commonly recommended analgesic agent for fear of worsening renal function .
chronic pain is a treatable condition that at any one point in time affects 20%46% of community - dwelling older adults and 28%73% of residents in aged - care facilities.3 a number of practice guidelines and literature reviews relating to the management of chronic pain in the elderly exist , with paracetamol being the first - line management option.3,4 a daily dose of both analgesic and anti - inflammatory medications is common practice among millions of patients experiencing chronic pain.5 paracetamol is used alongside nsaids to assist in managing inflammatory conditions , such as gout or rheumatoid arthritis.6 nsaids are more effective than paracetamol for persistent inflammatory pain ; however , they are associated with gastrointestinal side effects ( eg , ulcers , bleeding ) , cardiovascular side effects ( eg , hypertension , exacerbation of heart failure ) , and worsening of chronic renal failure.3,4 nsaids are best avoided in the elderly despite their efficacy , and if they are required to use them , they should be given in the lowest possible dose for the shortest period.3 the long - term effects of other analgesics ( particularly paracetamol ) on the kidneys have been debated at length.7,8 currently , there are two recognized forms of an : nsaid - associated nephropathy and classic an .
nsaid - induced nephropathy is a widely reviewed condition.9 the nephrotoxicity of nsaids is mediated via nonspecific blocking of cyclooxygenase , subsequent inhibition of prostaglandin synthesis leading to vasoconstriction , and reversible renal impairment in volume - contracted states.9 this may lead to acute tubular necrosis and acute renal failure
. nsaids also produce interstitial nephritis and papillary necrosis , resulting in chronic renal failure.9 the observation of large numbers of cases of renal failure in patients abusing analgesic mixtures containing phenacetin ( termed phenacetin nephropathy ) led to the initial recognition of nephrotoxicity from the use of analgesics.10 however , the role of a single analgesic as a sole cause of an was challenged , leading to the redefinition of an in 1996 as a disease resulting from the frequent use of combinations of analgesic medications over many years , usually codeine or caffeine.10 phenacetin was introduced as an analgesic in 1887 , soon followed by paracetamol in 1893.11 phenacetin was popular due to its long duration of action ; however , it had weaker antipyretic effects when compared to paracetamol.11 it took scientists nearly 50 years to discover that paracetamol is the major metabolite of phenacetin , thus accounting for phenacetin s analgesic effect ( figure 1).11 in the 1970s , an as a cause of end - stage renal disease reached its peak in australia , with the condition being responsible for an estimated 20% of patients requiring renal replacement therapy.12 as a response to this , phenacetin was removed from vincents and bex ( the most frequently used analgesic products ) in 1967 and 1975 , respectively.13 in 1977 , phenacetin was legally banned from all medical preparations in australia , and all over - the - counter combination analgesic products were banned in 1979.13 phenacetin was later removed from the canadian market in 1978 , and in 1983 from the us.14,15 similarly , phenacetin was banned from the uk in 1980 , and in belgium phenacetin was removed from the two most frequently abused preparations in 1972 and 1981 , followed by a total legal ban in 1988.15,16 since this time , the exclusive role of phenacetin has been questioned in the development of nephropathy .
researchers have proposed that paracetamol , not phenacetin , accumulated in the renal papilla , and in animal experiments phenacetin appeared to be less nephrotoxic than the other analgesics.17 further , the withdrawal of phenacetin in australia in 1977 did not result in a decline of an , as illustrated in figure 2.12,18 on the contrary , a surge in the incidence of an was noted for some years before a reduction .
these differences presumably resulted from the misdiagnosis of nsaid - induced nephropathy.18 several case - control studies have reported associations between chronic renal failure and other analgesic preparations , including aspirin , antipyretics , and nsaids in combination with caffeine , codeine , and/or barbiturates.19 the research regarding the effects of paracetamol on an appear to be inconclusive .
perneger et al investigated 716 patients with renal failure , and concluded that increased paracetamol use was associated with an enhanced risk of renal failure in a dose - dependent manner.20 approximately 9% of renal failure cases were attributable to increased paracetamol use.20 however , this study failed to adjust for the potential for patients using paracetamol to be concurrently using either phenacetin or nsaids when assessing association with renal failure.20 a major review by delzell and shapiro highlighted that most of the epidemiological evidence investigating an has been unsatisfactory , and the research using animal models was inconsistent and not translatable to humans.21 another review published in 2000 found no evidence between nonphenacetin combined analgesics and nephropathy.22 a 2001 study attempted to adjust for the use of other analgesics , including phenacetin , and evaluate paracetamol and aspirin use in relation to chronic renal disease.23 this study found that the regular use of paracetamol ( at least twice a week for 2 months ) increased the risk of developing chronic renal failure ( 2.5-fold increase compared to nonusers ) . however , consumption of these analgesics for conditions that predisposed patients to renal failure may have resulted in some bias.23 mihatsch et al ( n=616 , autopsy examination of adult kidneys ) found compelling evidence demonstrating nonphenacetin analgesics are not responsible for an , citing a significant decline in the prevalence of an from ~4% in 1980 to 0.2% in 2000 ( 20 years after the removal of phenacetin from the analgesic market ) .
also , kelkar et al conducted a retrospective case - control study of medical and pharmacy claims of a sample of 4,742 cases of renal disease , comparing chronic versus acute paracetamol use and renal disease.24 this study further confirmed that there was not a significant increase in risk for an in patients exposed to accumulative dosage of at least 1 kg of paracetamol in the preindex year.24 researchers , however , were unable to assess use of over - the - counter paracetamol , which would likely have strengthened results.24 currently in australia , paracetamol is available for purchase as an unscheduled medication as 500 mg tablets in packets of 20 tablets or less.25 the sale of larger quantities and combination products , such as narcotic and decongestant preparations , are more highly regulated , and are required to be sold by pharmacies.25 in response to the lack of concrete data regarding causative analgesics , a peer - review committee was selected by the regulatory authorities of germany , switzerland , and austria to determine the relationship between nonphenacetin analgesics and an.22 the committee concluded that previously published studies to date had major flaws and failed to establish the association of analgesics other than phenacetin leading to chronic renal disease.22 in our view , patients should not be withheld an effective and commonly recommended analgesic agent for fear of worsening renal function .
we have presented a case of a patient who was concerned about an adverse side effect of paracetamol that has not been clearly established in the literature .
the patient was reassured that paracetamol was safe . at follow - up , our patient reported recommencing paracetamol ( 665 mg three times a day ) , with improvement in back pain control without deterioration of renal function .
Output:
| introductionanalgesic nephropathy is a disease resulting from the frequent use of combinations of analgesic medications over many years , leading to significant impairment of renal function .
the observation of a large number of cases of renal failure in patients abusing analgesic mixtures containing phenacetin led to the initial recognition of the nephrotoxicity from the use of analgesics .
phenacetin was subsequently exclusively blamed for this disease
. however , the role of a single analgesic as a sole cause of analgesic nephropathy was challenged , and a number of researchers have since attempted to determine the extent of involvement of other analgesics including nonsteroidal anti - inflammatory drugs ( nsaids ) , aspirin , and paracetamol.case presentationwe present the case of an 83-year - old woman with a history of nsaid - induced nephropathy with poor pain control and reluctance to use paracetamol .
we attempt to briefly review the evidence of paracetamol being implicated in the development of analgesic - induced nephropathy.conclusionthere is a lack of concrete data regarding causative analgesics , including paracetamol .
patients should therefore not be withheld paracetamol , an effective and commonly recommended agent , for fear of worsening renal function . |
PubmedSumm7815 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: with the abundance of dna sequence information currently available , researchers are now looking to comprehensively identify and characterize the proteomic products of the genetic blueprint .
the most widespread and high - throughput methodology being used to address this goal is mass spectrometry ( ms ) . using ms to perform large - scale experiments generates substantial amounts of peptide and protein mass spectra .
the informatics issues involved in dealing with these volumes of data can be overwhelming even within an individual laboratory .
this matter , together with a lack of open standard formats , has contributed towards the general shortage of publicly available ms - based proteomic data . however , there is increasing recognition within the community , granting bodies and publishing agencies ( 1 ) that published proteomic data can , and should , be fully accessible .
open access policies such as these allow the community to review and comprehensively re - examine the data upon which experimental conclusions are based . from the researcher 's ; perspective , the long - term archiving of proteomic data at a centralized repository not only increases the data usability and visibility but also decreases the risk of data loss .
in addition , the availability of large collections of ms data can benefit the field in a wider sense , for example , by enabling informaticians to develop better algorithms or construct spectral libraries .
several databases already exist to store and disseminate proteomic data including pride ( 2 ) , peptideatlas ( 3 ) , tranche ( 4 ) , the gpm ( 5 ) , and human proteinpedia ( 6 ) .
peptidome ( 7 ) aims to complement these resources ; the major goals of the peptidome project are to :
build and maintain a robust database in which to efficiently store tandem ms data at a level of detail appropriate for both ms professionals and the wider biological community , develop simple deposit procedures that minimize the burden of submission while supporting well - annotated data deposits from the research community , exchange data with established ms repositories , offer user - friendly tools that enable users to query , locate , analyze and review the data of interest .
build and maintain a robust database in which to efficiently store tandem ms data at a level of detail appropriate for both ms professionals and the wider biological community , develop simple deposit procedures that minimize the burden of submission while supporting well - annotated data deposits from the research community , exchange data with established ms repositories , offer user - friendly tools that enable users to query , locate , analyze and review the data of interest .
the information captured in the online database is designed to represent the final results based upon the submitter 's ; interpretation of the raw ms / ms spectra .
this is intended to provide a quick overview for mass spectrometrists and accessibility for other non - specialists .
the original submitted files are the true record , and will always be available for download .
proteins and peptides. proteins contain links to their member peptides , and peptides know which proteins they are members of .
spectra through peptide identifications ( pepidents ) , thus allowing more than one interpretation of a spectrum , and providing storage for post - translational modifications and identification scores . a schematic overview of peptidome .
proteins and peptides. proteins contain links to their member peptides , and peptides know which proteins they are members of .
spectra through peptide identifications ( pepidents ) , thus allowing more than one interpretation of a spectrum , and providing storage for post - translational modifications and identification scores .
a study is a collection of related samples and provides a focal point for , and description of , the whole experiment .
a sample contains all the data related to the biological material , which may be derived from one or more ms instrument runs .
each sample record contains a list of identified proteins and a list of identified peptides .
each protein points to a sublist of peptides by which it was identified , and each peptide is linked to the protein(s ) that it is a member of .
these pepidents denote any post - translational modifications as well as any identification scores for the match between a given spectrum and a peptide .
note that this allows a spectrum to have more than one peptide associated with it .
a sample also contains descriptive information about the biological material , protocols used to generate the data , instrumentation and informatics parameters .
both studies and samples are accessioned objects ; each record is assigned a unique and stable peptidome accession number that may be cited in a manuscript describing the data .
the accession consists of a number and a letter prefix indicating whether the record is a peptidome study ( psexxx ) or peptidome sample ( psmxxxx ) .
our goal is to make data submission procedures as straightforward as possible , while encouraging a high level of experimental annotation . to minimize the burden of data submission
there are four components that are required for a complete submission :
a metadata file that describes the overall experiment , each associated biological sample , the instruments and protocols used to generate the data and the relationship of the corresponding data files .
this information is provided by completing a metadata spreadsheet ; templates and example spreadsheets are provided within the peptidome submission guidelines from a link on the petidome homepage.raw data files contain the original ms and ms / ms information from the instrument .
peptidome currently accepts any of the standard xml formats ( mzdata , mzxml or mzml ) that contain both the ms and ms / ms data from a single fraction .
in addition , text formats ( .mgf , .pkl , .sqt , .dta ) are also accepted , but not preferred .
proprietary binary data directly from the manufacturers ( e.g. .raw or .wiff ) are not accepted.output files from any peptide identification program . these files contain matches of the ms / ms scans to the peptides .
currently , peptidome supports dat files from mascot , asn.1 or xml formatted files from omssa , and any search engine output files that have been converted to pepxml format ( e.g. x!tandem or sequest ) .
if manual identification was used to interpret the spectra , or the search engine output formats are not supported by peptidome , the submitted results table must include references to spectrum files and additional information that is usually extracted from the search engine output files , e.g. charge state and identification scores.results tables that describe the submitter 's ; view of the final , processed results according to whatever criteria they use to determine acceptability .
results tables list the proteins discovered in each sample in the study . for each protein ,
the peptides should be listed , and for each peptide , the matching spectrum files should be listed .
if the matching spectrum file list is omitted , then every spectrum matched to that peptide / protein in the peptide identification output files is assumed to be correct .
similarly , if the results table contains only proteins , then all associated peptides and spectra will be gleaned from the peptide identification output files .
peptidome supports post - translational modification annotations in the unimod i d ( 8) format .
fixed modifications for given residues are listed separately and are assumed to apply to all residues of that type .
in the modified peptide strings , each residue is followed by a unimod i d in parenthesis if it is modified and fixed modifications need not be listed . a metadata file that describes the overall experiment , each associated biological sample , the instruments and protocols used to generate the data and the relationship of the corresponding data files .
this information is provided by completing a metadata spreadsheet ; templates and example spreadsheets are provided within the peptidome submission guidelines from a link on the petidome homepage .
raw data files contain the original ms and ms / ms information from the instrument .
peptidome currently accepts any of the standard xml formats ( mzdata , mzxml or mzml ) that contain both the ms and ms / ms data from a single fraction .
in addition , text formats ( .mgf , .pkl , .sqt , .dta ) are also accepted , but not preferred .
proprietary binary data directly from the manufacturers ( e.g. .raw or .wiff ) are not accepted .
currently , peptidome supports dat files from mascot , asn.1 or xml formatted files from omssa , and any search engine output files that have been converted to pepxml format ( e.g. x!tandem or sequest ) .
if manual identification was used to interpret the spectra , or the search engine output formats are not supported by peptidome , the submitted results table must include references to spectrum files and additional information that is usually extracted from the search engine output files , e.g. charge state and identification scores .
results tables that describe the submitter 's ; view of the final , processed results according to whatever criteria they use to determine acceptability .
results tables list the proteins discovered in each sample in the study . for each protein ,
the peptides should be listed , and for each peptide , the matching spectrum files should be listed .
if the matching spectrum file list is omitted , then every spectrum matched to that peptide / protein in the peptide identification output files is assumed to be correct .
similarly , if the results table contains only proteins , then all associated peptides and spectra will be gleaned from the peptide identification output files .
there are many different methods for ms quantification , with new ones being invented all the time .
therefore , for peptide and protein quantification , each quantification value with a single number per protein , peptide and/or spectrum per sample is denoted , where the units ( if applicable ) and methodology used to quantify the sample are required in the metadata annotation .
when all submission files are assembled , they can be transferred to peptidome via ftp .
a curator will collect the files and manually curate and validate them before depositing in the database .
some journals require accession numbers for ms proteomic data before acceptance of a paper for publication .
thus , ideally , data should be deposited in peptidome before a manuscript describing the data is sent to a journal for review .
a reviewer url can be generated and disclosed to journal editors ; this url grants anonymous , confidential access to private data during the manuscript review period .
all submissions undergo both syntactic validation and manual review by a curator before being uploaded to the peptidome database , thus enforcing good quality data deposits .
when any issues , such as mangled formats or missing components , are identified , a curator will work with the submitter until the problems are resolved .
early exemplar submissions in peptidome were gathered from selected data in peptideatlas ( 3 ) , with the metadata manually enriched from publications associated with those experiments .
submissions are processed using custom software to upload the metadata and results into the database .
the spectra files are not loaded into the database , instead they are converted to a custom format , based upon hdf5 ( available from http://www.hdfgroup.org/hdf5/ ) , that is both more compact and allows faster retrieval of individual spectra than the original xml format .
proteins are linked with the corresponding entries in ncbi entrez in a best effort fashion .
this flexibility allows submitters to reference novel proteins that are not yet in the mainstream databases , and to use custom protein databases .
peptidome protein links are updated in an ongoing process , in order that they remain up - to - date .
the data in peptidome may be browsed by studies or samples , and the individual samples may be examined from the identified proteins and peptides down to the individual spectra as shown in figure 2 .
figure 2.a series of screenshots showing navigation from a top level list of studies ( 1 ) , to its list of samples ( 2 ) , to the protein list for a sample ( 3 ) , to the list of peptide identifications for that protein ( 4 ) and finally to three individual spectra for different peptide identifications ( 5 ) . a series of screenshots showing navigation from a top level list of studies ( 1 ) , to its list of samples ( 2 ) , to the protein list for a sample ( 3 ) , to the list of peptide identifications for that protein ( 4 ) and finally to three individual spectra for different peptide identifications ( 5 ) .
metadata for all public studies and samples , and the associated proteins for each sample , are loaded into ncbi 's ; powerful entrez search and linking system ( 9 ) .
this facilitates cross - linkage with other ncbi resources like entrez protein , pubmed and taxonomy .
the entrez interface also allows users to search peptidome using simple free text or complex fielded queries .
additionally , all original data , including spectra files , output results and supplementary data are available for bulk download via anonymous ftp at ftp://ftp.ncbi.nih.gov / pub / peptidome/.
peptidome was recently established at ncbi with the goal to enhance proteomic research by providing a high - quality mass spectra repository .
we are now accepting submissions and invite researchers to deposit their tandem ms data sets with us so that we can disseminate them to the wider community .
currently , the peptidome team is working to expand and improve existing indexing , linking , searching , exploring and retrieving functionalities .
additional advanced data mining and visualization tools for the convenience of proteomic researchers are under design and development .
funding for open access charge : intramural research program of the national institutes of health , national library of medicine .
Output:
| peptidome is a public repository that archives and freely distributes tandem mass spectrometry peptide and protein identification data generated by the scientific community .
data from all stages of a mass spectrometry experiment are captured , including original mass spectra files , experimental metadata and conclusion - level results .
the submission process is facilitated through acceptance of data in commonly used open formats , and all submissions undergo syntactic validation and curation in an effort to uphold data integrity and quality .
peptidome is not restricted to specific organisms , instruments or experiment types ; data from any tandem mass spectrometry experiment from any species are accepted .
in addition to data storage , web - based interfaces are available to help users query , browse and explore individual peptides , proteins or entire samples and studies .
results are integrated and linked with other ncbi resources to ensure dissemination of the information beyond the mass spectroscopy proteomics community .
peptidome is freely accessible at http://www.ncbi.nlm.nih.gov/peptidome . |
PubmedSumm7816 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: an adult male was discovered unconscious at home and a ct head demonstrated diffuse subarachnoid hemorrhage , mild ventricular hemorrhage and hydrocephalus . on subsequent ct angiogram of head , a moderately wide neck 3 mm left anterior communicating artery ( acom ) aneurysm was identified .
the patient was taken to the neurointerventional suite , where the small acom aneurysm was successfully coiled ( axium , covidien corporation , plymouth , mn , usa ) .
on 6-month follow - up mr angiogram of the head , a small recurrent aneurysm was discovered , so a stage - ii embosurgery was scheduled .
the patient was pre - operatively medicated with aspirin and clopidogrel . under general anesthesia ,
a 6-french guidecatheter was placed in the left ica . using multiple microcatheters and microwires in varying combinations ,
the recurrent aneurysm was noted to be small , measuring about 2 mm , and which demonstrated a wide base that incorporated portions of the left acom and the left a2 ( fig .
given this configuration plus the associated tortuous vascularity , stent - assisted coiling was elected . a marksman catheter ( covidien corporation )
was primarily advanced over numerous microwires in an unsuccessful attempt to gain access in the left a2 distal to the aneurysm . as a result
, exchange wire technique was used : an sl-10 microcatheter ( boston scientific corporation , fremont , ca , usa ) , was successfully advanced over exchange length synchro2 microwire ( boston scientif ic corporation ) . with the wire at the left a2 - 3 junction ,
the marksman catheter was advanced as far as possible into the left a2 , that is , approximately 1 cm beyond the aneurysm ( fig .
advancing this catheter any further was prevented by a combination of the general vascular tortuosity and the relatively small caliber of the a2 .
a 2.5 15 mm nf - ez stent was brought to the field , prepped , and advanced through the marksman catheter .
though the nf - ez stent system advanced easily , the marksman catheter slightly retreated with its tip adjacent to the most proximal a3 subfrontal branch .
the nf - ez guidewire readily entered this small vessel instead of continuing around into the distal a2 . an attempt to advance the stent with the wire in this small branch
because of the added length of the nf - ez guidewire , the stent apparatus could not be positioned completely across the aneurysm orifice , and so it was withdrawn . the stent apparatus was examined and found to be free of defect or
otherwise adversely affected by the attempt to place it . but to gain sufficient intracranial purchase of the stent , the guidewire was snipped off flush using surgical scissors at the junction with the distal stent bumper ( fig .
the stent was readvanced into the marksman catheter and easily placed across the aneurysm neck . with the distal guidewire now removed , care was taken to ensure that forward motion of the stent delivery system did not advance beyond the tip of the marksman catheter . with the stent positioned across the aneurysm ,
the marksman catheter was manually withdrawn , unsheathing the stent in an acceptable position-- completely crossing the aneurysm orifice , extending from the left a2 into the left a1 ( fig .
aneurysm coiling proceeded uneventfully at that point ( deltapaq and deltaplush , codman & shurtleff inc , raynham , ma , usa ) .
final angiography demonstrated an adequately packed aneurysm with coils completely secured in the aneurysm by the stent ( fig .
the patient did well post - operatively , and remains neurologically intact , functionally independent and fully employed ( most recent follow - up at 15 months ) . because the above nf - ez modification represented a device protocol deviation ,
it was reported to both the local irb and the device 's sponsor in a timely fashion .
the nf - ez is the latest offering from the neuroform stent family . like its predecessors ,
the nf - ez stent renders mechanical and hemodynamic benefits for aneurysm repair by preventing and repairing coil protrusion into the parent artery , reducing intra - aneurysmal flow , and promoting aneurysm occlusion [ 2 - 4 ] .
the nf - ez confers several advantages over the existing third generation neuroform stent delivery system .
some of the technical difficulties described with the third generation version included the en bloc advancement or transfer to a pre - positioned alternate microcatheter , which can also be time consuming and technically challenging for a single operator .
complications can arise in conjunction with stent implantation including stent migration , maldeployment and stent herniation into the aneurysm [ 5 , 6 ] .
however , the nf - ez allows the sole surgeon to more easily place the stent without the challenges of handling a long stent transfer system . also , the addition of distal and proximal radioopaque positioning bumpers and a preshaped distal tip have , overall , facilitated precise positioning prior to , and during deployment . in regards to this unique device modification ,
the standard stent pre - deployment technique failed because of mechanical impendence from the preshaped distal tip entering a small vessel branch .
friction generated from the patient 's intra- and extracranial vascular tortuosity further limited the amount of forward pressure that could be placed upon the delivery and guide catheters without causing these catheters to retreat . a larger caliber or stiffer guide catheter might have obviated the need to modify the stent .
also , a third , intermediate catheter ( e.g. , navien , covidien corporation ) would potentially have offered a more robust tri - axial support system .
the wingspan stent ( stryker , kalamazoo , mi , usa ) was considered as a back - up option if the rigid nose - cone of this stent was likewise severed as previously reported by lesley et al . but owing to the wingspan 's stent inherently greater stiffness compared to the neuroform stent , the off - label choice of this stent was avoided .
other intracranial stents ( solitiare , covidien corporation ; and , enterprise , depuy / codman & shurtleff , inc , raynham , ma , usa ) as well as the navien catheter were not stocked in - house at the time of the procedure and were therefore not considered in this case . any perceived benefit must be weighed against the potential for patient harm when modifying any surgical device . before introducing the altered stent ,
the surgical scissors had cleanly amputated the wire from the stent , leaving no wire remnant or jagged edge .
the modified stent advanced readily to the tip of the microcatheter with no tactile sensation of resistance and no fluoroscopic evidence of unexpected device function .
because of the blunt nature of the distal stent bumper , extreme care was used in the absence of the stent guide wire to ensure that the bumper did not advance unprotected within the vessel during the microcatheter unsheathing of the stent .
however , the preshaped distal guidewire can , on occasion , impede sufficient distal placement of the stent .
Output:
| the neuroform ez stent system is a fourth generation intracranial aneurysm stent that utilizes an integrated navigation guidewire .
while designed to facilitate stent delivery , the guidewire can rarely impede proper positioning of the stent . in this technical case report , severing the guidewire from the stent delivery system with surgical scissors
was required for successful stent implantation . |
PubmedSumm7817 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: on the hypothetical dynamic s curve of biomarkers appearance for the diagnosis of alzheimer s disease ( ad ) [ 1 , 2 ] , clinical signs seem to appear late after the positivity of in vivo biomarkers reflecting the amyloid process and the tau neuronal injury .
the development of brain imaging amyloid markers , based on the amyloid cascade theory of hardy [ 3 , 4 ] , gives us anatomical information regarding the amyloid load .
the aim is to underline in vivo amyloid plaques in the brain regions of interest that reflect the ad process . in the first human study comparing pittsburgh compound - b ( pib ) retention in 16 mild ad patients versus 9 controls ,
the pib retention was increased most prominently in frontal cortex ( 1.94-fold , p = 0.0001 ) in the ad patients . if large increases were also observed in parietal , temporal , and occipital cortices , other studies validated , on visual inspection of the pib images , a greater binding in the orbitofrontal , posterior cingulate , and precuneus ( for review , see saidlitz et al . ) .
amyloid load assessed on pet scan may be also a risk marker of progression of healthy and mild cognitive impairment ( mci ) subjects to ad [ 79 ] .
literature data show that 20 to 30% of healthy elderly subjects have increased amyloid . in these subjects ,
amyloid load progresses during follow - up , as shown in a study that followed 24 non - demented subjects , mean age 79 years , for 1.5 years 6 months and found that pib retention increased by 0.9% annually .
the increase was greater in subjects who had high amyloid deposition at baseline , mainly in the prefrontal , parietal , lateral temporal , occipital , and anterior and posterior cingulate cortices . moreover , certain regions of amyloid deposits ( pre - frontal , posterior cingular , lateral temporal cortices ) appear to be more predictive of risk of progression of amnestic mci subjects toward dementia disorder . on the other hand ,
some neuropsychiatric signs like apathy or irritability seem to belong to the spectrum of prodromal ad symptoms [ 12 , 13 ] .
no study underlines the presence of frontal clinical signs at an early stage of ad .
we assume that clinical signs could help in a better and earlier diagnosis of ad and in particular specific clinical signs such as frontal release signs ( snout , palmomental , grasping \dots ) in relation with the frontal ( pre - frontal , lateral frontal ) amyloid load at an early stage [ 1416 ] . to address this hypothesis
, we explored whether neurological signs could be present at an early stage of ad in a subsample of the french three - city ( 3c ) , a prospective cohort study of non - institutionalized subjects aged 65 and over , followed during 12-years with an exhaustive and systematic clinical examination at each follow - up .
the french 3c study ( three french cities : bordeaux , montpellier , and dijon ) is a population - based study of non - institutionalized subjects aged 65 aiming to determine the relationship between vascular factors and dementia [ 17 , 18 ] .
a nested case - control study is designed based on the 2,259 participants stemming from the montpellier cohort followed every two years during a 12-year period with standardized and detailed neurological examination .
this neurological examination was carried out for all individuals by a trained practitioner at each follow - up .
each practitioner was trained by the same senior neurologist ( jt ) during all follow - ups .
a systematic procedure for the neurological exam was fulfilled by the practitioner . a particular focus on extrapyramidal signs ( akinesia , rigidity , rest tremor ) , pyramidal symptoms ( spastic rigidity , babinski sign ) , primitive reflexes ( snout , palmomental , grasp ) , and tremor ( essential ( action / postural ) , intentional , head ) classified in 0 ( absent ) or 1 ( present ) is performed . to test akinesia , as a change of the initiation and the automatic execution of the movements , the slowing down and
the rarity of the harmonious character of the gesture , we analyzed rapid alternative movements , gait impairments , and reduced facial expression ( mask - like ) . for extrapyramidal rigidity , we analyzed the sustained lead pipe resistance throughout the range of motion affecting flexor and extensor muscles equally . cog wheeling may be brought out when the examiner passively moves an elbow or wrist .
this sign is increased by reinforcement maneuvers such as having the patient use the opposite hand to trace circles in the air .
asymmetric resting tremor corresponds to regular rhythmic tremor ( frequency 46 hertz ) observed when the patient sits , hands on the knees . to detect the palmomental reflex , the skin of the patient is scratched near the thenar eminence by a key .
when present , there is a brief contraction of the ipsilateral mentalis muscle with puckering the chin .
it pertains to the abnormal oscillation around the axis when the postural manoeuver hand in tension is performed .
the intentional tremor presents characteristics of cerebellar signs , the tremor appears when patients are asked to touch their nose with their fingers , oscillations are more marked when the target is reached .
the diagnosis of dementia is established at each follow - up using a two - step procedure .
first , the evaluation of neuropsychological tests ( mini - mental state examination ( mmse ) , the isaacs set test , and the benton visual retention test ) is performed by trained psychologists and the subject is systematically examined by a neurologist .
second , an independent committee of neurologists reviewed all potential cases of dementia in order to obtain a consensus based on the diagnostic and statistical manual of mental disorders ( dsm - iv ) criteria and nincds - adrda criteria for ad diagnosis .
we excluded the 41 prevalent dementia cases for which clinical signs before diagnosis were unavailable , and the 66 incident dementia other than ad .
thus , the cases were the incident ad cases that were identified during the 12-year follow - up ( n = 106 ) .
two controls per case were randomlysampled from the set of those at risk i ) under follow - up on the date the case was diagnosed , ii ) of the same gender , age ( 2.5 years ) , and educational attainment ( 4 classes : primary , secondary , college , and university as described in table 1 ) .
we constitute a group of 208 matched controls ( 4 cases has only 1 matched - controls ) .
the study protocol was approved by the ethical committee of the institutional review board at kremlin - bictre university medical center .
first we compared cases and controls using chi2 test ( for qualitative variables ) or wilcoxon s test ( for quantitative variables ) .
multiple conditional logistic regressions were used to estimate the odds ratios with their 95% confidence intervals in matched cases - control analysis [ 21 , 22 ] .
secondary , we performed the same analysis in two groups according to age : < 80 years - old/80 years old .
analyses were performed using the sas software ( version 9.2 , sas institute inc . , cary , nc ) .
the french 3c study ( three french cities : bordeaux , montpellier , and dijon ) is a population - based study of non - institutionalized subjects aged 65 aiming to determine the relationship between vascular factors and dementia [ 17 , 18 ] .
a nested case - control study is designed based on the 2,259 participants stemming from the montpellier cohort followed every two years during a 12-year period with standardized and detailed neurological examination .
this neurological examination was carried out for all individuals by a trained practitioner at each follow - up .
each practitioner was trained by the same senior neurologist ( jt ) during all follow - ups .
a systematic procedure for the neurological exam was fulfilled by the practitioner . a particular focus on extrapyramidal signs ( akinesia , rigidity , rest tremor ) , pyramidal symptoms ( spastic rigidity , babinski sign ) , primitive reflexes ( snout , palmomental , grasp ) , and tremor ( essential ( action / postural ) , intentional , head ) classified in 0 ( absent ) or 1 ( present ) is performed . to test akinesia , as a change of the initiation and the automatic execution of the movements , the slowing down and
the rarity of the harmonious character of the gesture , we analyzed rapid alternative movements , gait impairments , and reduced facial expression ( mask - like ) . for extrapyramidal rigidity , we analyzed the sustained lead pipe resistance throughout the range of motion affecting flexor and extensor muscles equally . cog wheeling may be brought out when the examiner passively moves an elbow or wrist .
this sign is increased by reinforcement maneuvers such as having the patient use the opposite hand to trace circles in the air .
asymmetric resting tremor corresponds to regular rhythmic tremor ( frequency 46 hertz ) observed when the patient sits , hands on the knees . to detect the palmomental reflex , the skin of the patient is scratched near the thenar eminence by a key .
when present , there is a brief contraction of the ipsilateral mentalis muscle with puckering the chin .
it pertains to the abnormal oscillation around the axis when the postural manoeuver hand in tension is performed .
the intentional tremor presents characteristics of cerebellar signs , the tremor appears when patients are asked to touch their nose with their fingers , oscillations are more marked when the target is reached .
the diagnosis of dementia is established at each follow - up using a two - step procedure .
first , the evaluation of neuropsychological tests ( mini - mental state examination ( mmse ) , the isaacs set test , and the benton visual retention test ) is performed by trained psychologists and the subject is systematically examined by a neurologist .
second , an independent committee of neurologists reviewed all potential cases of dementia in order to obtain a consensus based on the diagnostic and statistical manual of mental disorders ( dsm - iv ) criteria and nincds - adrda criteria for ad diagnosis .
we excluded the 41 prevalent dementia cases for which clinical signs before diagnosis were unavailable , and the 66 incident dementia other than ad .
thus , the cases were the incident ad cases that were identified during the 12-year follow - up ( n = 106 ) .
two controls per case were randomlysampled from the set of those at risk i ) under follow - up on the date the case was diagnosed , ii ) of the same gender , age ( 2.5 years ) , and educational attainment ( 4 classes : primary , secondary , college , and university as described in table 1 ) .
we constitute a group of 208 matched controls ( 4 cases has only 1 matched - controls ) .
the study protocol was approved by the ethical committee of the institutional review board at kremlin - bictre university medical center .
clinical signs variables are evaluated as binary characteristics . first we compared cases and controls using chi2 test ( for qualitative variables ) or wilcoxon s test ( for quantitative variables ) .
multiple conditional logistic regressions were used to estimate the odds ratios with their 95% confidence intervals in matched cases - control analysis [ 21 , 22 ] .
secondary , we performed the same analysis in two groups according to age : < 80 years - old/80 years old .
analyses were performed using the sas software ( version 9.2 , sas institute inc . , cary , nc ) .
in the incident ad cases , the mean age was 82.2 ( sd = 5.9 ) , 19.8% were highly educated , the median mmse was 23 [ 1428 ] , 20.4% presented with a mmse 26 and 58.3% a mmse between 21 and 26 .
all cognitive scores were lower in the ad dementia group than in controls ( p < 0.001 ) . at baseline , no difference was observed between groups for vascular risk factors ( diabetes mellitus , blood pressure , alcohol consumption , tobacco abuse , bmi , and presence of cardiovascular diseases ) ( data not shown ) . at time of diagnosis ,
akinesia ( 30.7 versus 17.6% , or = 2.44 , p = 0.004 ) , palmomental primitive reflex ( 22.6 versus 12.1% , or = 2.30 , p = 0.02 ) , and essential tremor ( 17.3 versus 8.51% , or = 2.16 , p = 0.03 ) were more frequent in incident ad cases than in controls .
two years before , no clinical sign differed between incident ad cases and controls in the entire population .
interestingly , in younger patients ( less than 80 years old ) the palmomental reflex was more frequent in ad patients than in controls ( 25.0 versus 7.0% , p = 0.03 ) two years before .
this result persists at the time of diagnosis ( 30.3 versus 12.3% , p = 0.02 ) .
akinesia ( 43.5 versus 23.8% , p = 0.001 ) and essential tremor ( 21.1 versus 11.8% , p
= 0.035 ) were more frequent in older ad patients ( 80 years - old ) at the time of diagnosis only .
no difference was observed for grasp reflexes , babinski s sign , others types of tremor , plastic or spastic hypertonia , or others neurological clinical signs .
in the incident ad cases , the mean age was 82.2 ( sd = 5.9 ) , 19.8% were highly educated , the median mmse was 23 [ 1428 ] , 20.4% presented with a mmse 26 and 58.3% a mmse between 21 and 26 .
all cognitive scores were lower in the ad dementia group than in controls ( p < 0.001 ) . at baseline , no difference was observed between groups for vascular risk factors ( diabetes mellitus , blood pressure , alcohol consumption , tobacco abuse , bmi , and presence of cardiovascular diseases ) ( data not shown ) .
at time of diagnosis , akinesia ( 30.7 versus 17.6% , or = 2.44 , p = 0.004 ) , palmomental primitive reflex ( 22.6 versus 12.1% , or = 2.30 , p = 0.02 ) , and essential tremor ( 17.3 versus 8.51% , or = 2.16 , p = 0.03 ) were more frequent in incident ad cases than in controls .
two years before , no clinical sign differed between incident ad cases and controls in the entire population .
interestingly , in younger patients ( less than 80 years old ) the palmomental reflex was more frequent in ad patients than in controls ( 25.0 versus 7.0% , p = 0.03 ) two years before .
this result persists at the time of diagnosis ( 30.3 versus 12.3% , p = 0.02 ) .
akinesia ( 43.5 versus 23.8% , p = 0.001 ) and essential tremor ( 21.1 versus 11.8% , p = 0.035 ) were more frequent in older ad patients ( 80 years - old ) at the time of diagnosis only .
no difference was observed for grasp reflexes , babinski s sign , others types of tremor , plastic or spastic hypertonia , or others neurological clinical signs .
to the best of our knowledge , this is the first report highlighting that primitive reflexes were present and relevant for ad diagnosis at an early stage in patients younger than 80 years .
two years before diagnosis , palmomental reflex could help discriminate young ad patients from controls .
our results challenge the dogma of the normal clinical examination in ad patients at an early stage of the disease .
primitives reflexes such as palmomental , snout , and grasp reflexes are present from birth and can be associated with feeding and attachment to the mother .
the primitive reflexes are often present and the prevalence increases with age as described in the large sample of the maastricht aging study .
as the 3c study included subjects older than 65 , we took into account the effect of age by matching controls to ad cases in regards to age . for specific dementia diagnosis
, studies usually report a lack of specificity and sensibility of these reflexes particularly the palmomental .
however , the exact prevalence of such primitive reflexes is unknown because of the variability in the means of eliciting these reflexes and the interpretation of their presence . in dementia patients ,
the presence of primitive reflexes has been linked to the severity of the dementia in a prospective study of 2914 canadians over 65 , with a higher frequency in patients with severe dementia than at an earlier stage of the disease . in a systematic description of 204 cases of dementia ,
primitive reflexes appear to be more indicative of advanced age , severity of the illness , and diagnosis of lewy body disease or mixed dementia . in the present study
, we unveiled interestingly that palmomental primitive reflexes were pathologic early on in the ad process in patients younger than 80 years , a point that had never been examined in previous studies .
the reasons why these clinical signs were only pathologic in younger patients remain hypothetical but one explanation might be the high prevalence of amyloid lesions in the frontal area in normal elderly people , observed , for example , in amyloid imaging studies , contributing to decreasing the difference between ad and non - ad in older people .
another hypothetical explanation might reside in the fact that older patients present a different ad clinical phenotype with less frontal - related signs and more akinetic symptoms related to the impact of vascular mixed brain lesions .
some neuropsychological and brain imaging studies underlined that frontal areas are pathologic at a prodromal stage of the disease .
frontal - related apathy could be considered as an early biomarker of ad diagnosis [ 2830 ] . in the same way
, the amyloid pet - scan studies at a prodromal stage of ad revealed that amyloid load is predominant on frontal areas such as dorsolateral frontal areas . in this study ,
the diagnosis of ad is based on the nincds - adrda diagnosis criteria and on a consensus adjudicative committee .
as all the convertors and/or controls has not undergone brain imaging to exclude vascular changes in frontal lobes , we could not exclude that some vascular lesions are the cause of the positivity of frontal release signs .
a major strength of our work is the framework of a longitudinal follow - up and systematic neurological exam implemented in the 3c - montpellier cohort .
clinical signs were documented at each wave and can be studied two years before the diagnosis , so interpretation is not influenced by cognitive complaint or status and reflects the ad prodromal phase .
however , we can not exclude inter - operator differences in the interpretation of the presence of each clinical sign despite the fact that all physicians who examined participants have been trained to standardize the exam in the neurology unit ( jt , ag ) associated closely to the epidemiological team .
primitive reflexes can be tested easily and rapidly in clinical routine . even if the sensibility of these signs is far from perfect , their presence may alert the clinician to the possibility of brain pathology , even at an early stage . the standardized examination with primitive reflexes evaluation
should be included or re - included in the neurological bedside screening of patients with early ad degenerative process .
Output:
| background : sophisticated and expensive biomarkers are proposed for the diagnostic of alzheimer s disease ( ad ) .
the amyloid process seems to be early in ad , and brain amyloid load affects the frontal lobe.objective:to determine if certain simple clinical signs , especially frontal - related signs , could help reach an earlier and better diagnosis.methods:in the frame of the 3-city cohort , we conducted a nested case - control study comparing incident cases of ad to controls matched for age , gender , and education .
the standardized neurological exam included extrapyramidal signs ( akinesia , rigidity , rest tremor ) , pyramidal symptoms ( spastic rigidity , babinski reflex ) , primitive reflexes ( snout , palmomental reflex grasping ) , and tremor ( essential , intentional , head ) at the time of diagnosis and two years before.results:we compared 106 incident ad subjects ( mean age at diagnosis 82.2 ( sd = 5.9 ) ; median mmse at diagnosis = 23 ) to 208 matched controls . in patients younger than 80 ,
palmomental reflexes were more frequent in ad than controls , two years before diagnosis ( 25.0 versus 7.0% , p = 0.03 ) and at time of diagnosis ( 30.3 versus 12.3% , p = 0.02 ) .
no difference was observed for other signs two years before diagnosis or for patients older than 80.conclusion:before diagnosis , the clinical examination of ad patients is not strictly normal ; the primitive reflexes appear to be pathological .
it might be in connection with the frontal amyloid load at an early stage of the disease .
clinical examination can reveal simple and interesting signs that deserve consideration as well as the other more invasive and expensive biomarkers . |
PubmedSumm7818 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: when trials were first developed for use in agriculture , researchers were presumably concerned about the effect of interventions on the overall size and quality of the crop rather than on the wellbeing of any individual plant.p . m. rothwell , 2005 when trials were first developed for use in agriculture , researchers were presumably concerned about the effect of interventions on the overall size and quality of the crop rather than on the wellbeing of any individual plant .
p. m. rothwell , 2005 survival of patients with some forms of cancer ( e.g. , testicular cancer , hodgkin s disease , acute childhood leukemia ) has improved dramatically during the last decades due to advances in chemotherapeutic regimens as well as surgical and radiotherapeutic techniques .
the price of cure or long term survival are acute toxic effects ( e.g. radiation pneumonitis , acute renal failure , sepsis ) , chronic toxic effects ( e.g. pulmonary fibrosis , congestive heart failure , graft versus host disease , neurological syndromes , infertility , hypothyroidism ) and second malignancies . as cancer treatments have become more effective , it has even been suggested to tailor therapies based on late toxicities rather than survival .
a question that has received far less attention is whether present cancer treatment modalities may actually have a cancer - promoting effect .
the aim of the present review is to provide the evidence , suggesting that surgery , irradiation , chemotherapy and immunotherapy may stimulate tumor growth and / or metastatic spread and by these or other mechanisms decrease the survival of certain patient subgroups .
presently , surgery is the most effective primary modality of therapy against cancer and possible detrimental effects of primary tumor removal are rarely discussed .
nevertheless , most cancer surgeons have observed rapid tumor regrowth shortly after primary surgery [ 4 , 5 ] .
some experimental evidence has indicated that removal of a primary tumor ( and / or surgical stress ) may enhance the growth of residual tumor and the development of metastases [ 59 ] .
appearance of growth - stimulating factor in serum after primary tumor removal , abrogation of immune or nonimmunologic growth inhibiting factors , increased angiogenesis and surgical stress induced immunosuppression have been implicated as possible mechanisms for this phenomenon .
it has been show in an experimental mouse model , that presence of the primary tumor influences antitumor mechanisms against the secondary tumor , although the nature of these mechanisms is not completely understood .
thus , the presence of a primary tumor might have a protective effect against metastases .
for obvious ethical reasons , comparative clinical trials to evaluate the influence of primary tumor surgery on metastatic spread have not been performed .
evidence that surgery provokes activation of latent metastases in early breast cancer was presented by michael retsky and his colleagues .
this evidence was generated by interpretation of the results of natural history databases and clinical trials using hazard rate plots .
a patient presenting with a primary breast tumor along with distant metastases is uncommon ( 0% , 3% and 7% in stages i , ii and iii , respectively ) .
however , 18 months after diagnosis and therapy distant metastases are detected in 5% stage i and in 25% stage iii breast cancer patients .
the explanation of this fact could be that the clinical appearance of metastases is triggered or accelerated after the primary tumor has been removed .
mean survival of patients with locally advanced or metastatic breast cancer is approximately two and a half years .
however , 18% of untreated patients even with locally advanced or overt metastatic disease survived 5 years and 0.8% patients survived 15 years .
a small group of breast cancer patients with untreated localized disease could be identified with near 70% 5-year survival . on the other hand ,
radiation therapy has been in use as a cancer treatment for more than a century , with its earliest roots traced from the discovery of x - rays in 1895 by wilhelm rntgen .
two - thirds of all cancer patients will be treated with radiotherapy at some point in their life . ionizing radiation causes dna damage through induction of breaks in one or both of dna strands .
since cancer cells display deregulated cell cycle control and increased proliferation they are more vulnerable to irradiation than normal cells which usually are able to repair the dna damage or to induce cell death in those cells in which dna damage can not be repaired .
the effect of radiation on cancer cell or normal cell does not always take place immediately after treatment .
this is due to the fact that radiation damaged cells can stay alive as long as all dna is present .
radiation - induced bone cancers and soft tissue sarcomas have been observed in long - term survivors of hereditary retinoblastoma .
most deaths from these secondary malignancies occurred within 30 years after retinoblastoma diagnosis . in patients with hodgkin s lymphoma ,
causes other than primary disease contribute most to excess mortality 10 years after radiotherapy .
solid tumors , especially from the digestive and respiratory tract , contribute most to this excess mortality , followed by cardiovascular disease .
statistically significantly increased risks of solid cancers ( lung , colon , bladder , pancreas , pleura and esophagus ) are observed among long - term survivors of testicular cancer treated with radiotherapy alone . men who receive radiotherapy for localized prostate cancer have an increased risk of bladder cancer compared to patients undergoing radical prostatectomy and compared to the general population
. the risk of rectal cancer is increased in patients who receive external beam radiotherapy compared to radical prostatectomy .
second solid malignancies are rarely seen before 10 years , with increasing incidence thereafter . from this point of view
, benefits of radiotherapy clearly outweigh its potential harm and the widespread use of this form of cancer treatment seems justified . on the other hand , radiotherapy - induced second cancers illustrate the cancer - promoting effect of this treatment modality . similarly to surgical eradication of a primary tumor
, radiation therapy may also induce the explosive growth of previously dormant metastases in experimental models [ 20 , 21 ] .
this phenomenon has been explained by the decrease of the angiostatin production which is regulated by the primary tumor .
chemotherapy has provided curative treatments for some forms of cancer ( acute childhood leukemia , testicular cancer , and hodgkin s disease ) that were previously fatal . however , the role of chemotherapy in other more common cancers is quite modest , with survival improvement measuring few months or only few weeks .
one of the ironies of chemotherapeutic successes has been the recognition that many cytotoxic drugs are themselves carcinogenic .
it is worth mentioning , that death receptors , once thought to primarily induce cytotoxic signaling cascades , recently have been shown to initiate multiple signaling pathways , including regulation of cell proliferation and tumor - promoting activities .
the carcinogenic risk is especially great with alkylating agents and the epipodophyllotoxins , but carcinogenicity has also been described for antimetabolites , anthracyclines , cisplatin and others . most often ,
these chemotherapeutic agents cause the development of acute myeloid leukemia , high - grade non - hodgkin s lymphoma , and myelodysplastic syndrome .
it has been observed that if patients receive suboptimal doses of chemotherapeutic drugs , they are not cured , and their survival is shorter compared to patients who receive optimal doses ( although is not always clear what doses should be considered optimal ) [ 25 , 26 ] .
even with optimal doses , chemotherapy is not likely to be effective for all patients .
a number of molecular markers have been identified that have predictive value for the outcome of treatment with chemotherapeutic drugs of non - small cell lung cancer , pancreas , breast , colorectal cancer , diffuse large b - cell lymphoma and other cancers .
the efficacy and toxicity of current chemotherapeutic regimens may depend on genetic factors , like cytochrome p450 polymorphisms .
it has been shown that the risk of breast cancer mortality is increased in tamoxifen users with decreased cyp2d6 activity .
thus , in some patients for whom chemotherapy is not curative , detrimental or even lethal effects of chemotherapeutic agents are likely to outweigh modest antitumor effect and thereby decrease survival of a patient .
our unpublished observations in a rat model have shown that docetaxel treatment of multidrug resistant prostate cancer decreases survival time of animals [ jjlj et al . , manuscript in preparation ] .
furthermore , patients undergoing antineoplastic treatment experience various changes in the immune system , which not only render them susceptible to infections , but also might have an overall effect on the risk of relapse .
the generally held view is than a placebo group in cancer clinical trials is unethical .
experimental animal research , however , has shown that chemotherapy can even stimulate the metastatic spread of the primary tumor [ 36 , 37 ] .
in the past few decades , immunotherapy has become the fourth cancer treatment modality . presently , intravesical immunotherapy with bacillus calmette - gurin ( bcg )
is regarded as the most effective protection against recurrence and progression in high - risk bladder cancer patients .
recombinant cytokines ( interferon- and interleukin-2 ) demonstrate reproducible activity in some forms of cancer , including renal cell carcinoma and melanoma . despite complete or partial response rate with cytokines
monoclonal antibodies , vaccination therapy and adoptive cell transfer are rapidly evolving fields of cancer immunotherapy .
the immunostimulatory theory of tumor growth was proposed by prehn in the 1970s .
several investigators have demonstrated in experimental models that immunotherapy against established tumors or against residual tumor cells can produce not only inhibitory or null effects , but also can stimulate tumor growth and spread of metastases [ 4347 ] .
probably the first immunotherapy for which detrimental effects were observed was interferon-. adjuvant treatment with this cytokine decreased overall survival and/or disease - free survival compared with observation arm ( although not always statistically significantly ) in high - risk melanoma , colon cancer and small - cell lung cancer patients .
interferon- ( ifn- ) has produced only modest benefits in unselected advanced renal carcinoma patients .
meta - analysis of 42 randomized , controlled trials of ifn- , including 4,216 patients , revealed the overall survival advantage of 3.8 months for ifn- treated patients . despite this benefit of ifn- was quite modest , for considerable period of time ifn- was the de facto standard of care of metastatic renal cell carcinoma worldwide .
regulatory agencies have supported the use of ifn- as the control arm for randomized trials with new therapies .
therefore , it was impossible to perform a study including a control group of untreated renal cell carcinoma patients . obviously , a control group of untreated patients is necessary to determine the biomarkers of response or non - response . in the late nineties
, our group has studied the prognostic and predictive significance of immunologic markers in peripheral blood of renal cell carcinoma patients . during 19951999
, ifn- was just being introduced in lithuania , and no strict guidelines towards its use for treatment of metastatic renal cell carcinoma were available . due to considerable variability in approach to treatment of metastatic renal cell carcinoma patients in lithuania , we were able to select subgroups of patients treated and non - treated with ifn-. peripheral blood lymphocyte subsets were determined using flow cytometry .
thus , we had the opportunity to analyze the predictive significance of peripheral blood lymphocyte subsets in patients with advanced renal cell carcinoma .
we found remarkable differences in overall survival of advanced renal cell carcinoma patients based on peripheral blood levels of cd8highcd57 + lymphocytes . in our analysis ,
the median survival of patients with < 30% cd8highcd57 + lymphocytes in the cd8 + subset was 23.5 months ( the relatively good prognosis group ) , whereas the median survival of patients with 30% cd8highcd57 + lymphocytes in the cd8 + subset was only 6 months ( the bad prognosis group ) .
treatment with ifn- significantly increased the overall survival of the bad prognosis group renal cell carcinoma patients ( from 6 to 18.5 months ) .
in contrast , a trend towards decreased overall survival was observed in the relatively good prognosis group after treatment with ifn- ( 13.6 months of ifn--treated patients vs. 23.5 months of patients non - treated with ifn- ) ( fig . 1 ) .
although we admit the drawbacks of our study due to its retrospective nature , the remarkable differences in patient survival related to counts of cd8highcd57 + lymphocytes can not be ignored .
the utility of cd57 + expression in t lymphocytes to measure functional immune deficiency in patients with autoimmune disease , infectious diseases , and cancers has recently been reviewed .
1median survival times of advanced renal cell carcinoma patients according to treatment with ifn- and percentage of cd8highcd57 + lymphocytes in cd8 + subset ( in peripheral blood ) median survival times of advanced renal cell carcinoma patients according to treatment with ifn- and percentage of cd8highcd57 + lymphocytes in cd8 + subset ( in peripheral blood ) similarly to ifn- therapy of renal cell carcinoma , adjuvant therapy with ifn- of high - risk melanoma is only minimally effective in a nonselected patient population . in a recent systematic review and meta - analysis of 14 randomized controlled trials including a total of 8,122 patients , statistically significant improvement in overall survival of high - risk melanoma patients treated with ifn- vs. comparator regimen or observation was shown .
however , the authors of this systematic review and meta - analysis admit that this improvement can not be considered satisfying in terms of anticancer efficacy .
several reports have suggested the involvement of cd8+cd57 + t lymphocytes in control of melanoma progression [ 5557 ] . in our study of melanoma patients
treated with adjuvant ifn- , we observed remarkable differences in survival depending on pre - treatment levels of cd8highcd57 + lymphocytes in peripheral blood .
median survival time of patients with > 23% cd8highcd57 + lymphocytes in cd8 + subset was 14.2 months , whereas median survival time of patients with < 23% cd8highcd57 + lymphocytes was not reached at the time of analysis ( median follow - up 24.6 months ) .
the cut - off level of 23% in the present study was found by separating patients with increasing values of cd8highcd57 + lymphocytes during the first few months of treatment with ifn- from those with decreasing values .
this means that lower ( < 23% ) pre - treatment values of these lymphocytes tend to increase , whereas higher values ( > 23% ) tend to decrease during therapy .
thus , ifn- seems to induce opposite changes in peripheral blood cd8highcd57 + lymphocyte levels ( i.e. increase or decrease ) depending on their pre - treatment values .
the opposite action of adjuvant ifn- on immune parameters in different subgroups of patients may explain the null or minimal effect of this treatment on the whole population of unselected melanoma patients .
probably the most recent examples of detrimental effects of cancer immunotherapy include the failure of several vaccine trials .
the survival of stage iii and stage iv melanoma patients receiving the allogeneic cancer vaccine canvaxin was shorter compared with untreated patients .
the large phase iii eortc 18961 trial of adjuvant ganglioside vaccine gmk in 1,314 patients with stage ii melanoma was stopped earlier because of inferior survival in the vaccine arm .
in this paper , the data have been reviewed suggesting that current cancer treatment modalities may also have a cancer - promoting effect ( fig . 2 ) .
these data do not mean that current cancer therapies are not beneficial . in some cases , like radiotherapy of localized cancer ,
benefits of treatment clearly outweigh the risk of second cancers developing after long latent period .
in other cases , like cytokine therapy of renal cell carcinoma or melanoma the benefit / risk ratio seems much more uncertain . a cancer promoting - effect of many therapies may remain obscured due to the generally held view that an untreated group in cancer clinical trials is unethical .
2summary of data indicating cancer - promoting effects of surgery , radiotherapy , chemotherapy and immunotherapy summary of data indicating cancer - promoting effects of surgery , radiotherapy , chemotherapy and immunotherapy the evidence reviewed in this paper challenges the assumption that in cancer patients who do not respond to therapy , the course of disease is the same as without treatment .
the existing data highlight the possibility of the qualitative heterogeneity of relative treatment effect , defined as the treatment effect being in different directions in different groups of patients .
thus , a subgroup of patients may have beneficial effects from a therapy , whereas another subgroup may have detrimental effects .
this possibility has major implications for cancer clinical practice and for testing efficacy of new drugs .
the results of cancer treatment may be improved by using biomarkers that correlate with positive or negative therapeutic effect .
great numbers of biomarkers have been detected , but few of them are used in clinical practice .
the suspicion that a given therapy has a cancer - promoting effect in a subgroup of patients might provide an urgent stimulus to introduce and to use the predictive biomarkers .
therefore , the most relevant for implementation biomarkers should be selected and applied in clinical practice .
large clinical trials always may contain subgroups in which beneficial or detrimental effects are obtained . as a result
thus , small comparative trials based on groups of patients with different predictive biomarkers may be preferable for testing efficacy of new drugs [ 22 , 60 ] .
another argument in favor of small comparative trials based on predictive biomarkers is that a lower number of patients would suffer a detrimental effect of an investigative therapy , if such a detrimental effect would exist . given the possibility of a cancer - promoting effect of an anticancer intervention , a group of untreated patients might be acceptable from the ethical point of view . in conclusion , the probability of a cancer - promoting effect of current cancer treatment modalities emphasizes the importance of prediction and personalized approach in oncology .
ignoring biomarkers that correlate with positive or negative therapeutic effect may not be compatible anymore with the ethical principle
Output:
| present cancer treatment strategies are based on the assumption that a therapy may work ( response ) or not work ( no - response ) .
however , the existing evidence suggests that current cancer treatment modalities may also have a cancer - promoting effect in part of the patients . in this paper ,
some relevant data are reviewed suggesting that surgery , irradiation , chemotherapy and immunotherapy can stimulate tumor growth / metastatic spread and decrease survival of patients in certain subgroups .
thus , results of cancer treatment may be improved by detection and use of biomarkers that correlate with positive or negative therapeutic effects .
small trials based on groups with differing biomarkers rather than large phase iii trials may aid the development and efficacy testing of new anticancer drugs .
moreover , ignoring biomarkers that correlate with positive or negative therapeutic effect may not be compatible anymore with the ethical principle first do no harm . |
PubmedSumm7819 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: acute cholecystitis refers to a syndrome of right upper quadrant pain , fever and leukocytosis associated with gallbladder inflammation that is usually related to gallstone disease .
patients with acute cholecystitis typically complain of abdominal pain , most commonly in the right upper quadrant or epigastrium .
. a variety of other conditions can give rise to symptoms in the upper abdomen , which may be confused with acute cholecystitis .
these include cardiac ischemia , which can usually be differentiated by the clinical setting in which it occurs and by obtaining the appropriate diagnostic studies , such as an electrocardiography ( ecg ) and laboratory examinations .
however , acute cholecystitis has also been reported to mimic the nonspecific diffuse ecg changes associated with ischemic heart disease .
studies have shown that gallbladder distension reduces coronary blood flow , providing a mechanism for the association of gallbladder disease , myocardial ischemia and st segment ecg changes .
various sources have also reported elevated troponin levels in patients with sepsis , septic shock or systemic inflammatory response syndrome , but the mechanism by which infection causes troponin release is not yet understood .
the finding of ecg changes , associated with elevation of the specific cardiac marker troponin , alarms many physicians and leads them to initiate diagnostic cardiac investigations for early confirmation and treatment of ischemic heart disease .
awareness of the differential diagnosis is crucial to ensure appropriate diagnostic investigations and to avoid incorrect cardiac management , such as thrombolysis and even angioplasty .
we present the case of a 75-year - old woman who presented at the accident and emergency department after 2 days of epigastric and right upper quadrant pain associated with nausea but without fever .
she had been referred for nonspecific digestive difficulties within the past few months and for a similar episode 1 week earlier .
the abdomen was tender , with guarding in the right upper quadrant and positive murphy 's sign .
abdominal ultrasound revealed gallbladder distension , wall thickening and a 2.5 cm stone in the gallbladder lumen that were suggestive of acute cholecystitis ( fig .
the following laboratory findings were obtained at admission : white blood cell count 8.3 10/l , c - reactive protein ( crp ) 85 mg / l , serum total bilirubin 17.3 mol / l , alkaline phosphatase 79 iu / l , aspartate aminotransferase 23
iu / l , lipase 32 iu / l , sodium 136 mmol / l , potassium 3.8 mmol / l , blood urea 5.1 mmol / l , creatinine 82 mol / l and troponin i < 0.01 u / l . the clinical diagnosis was acute cholecystitis .
ecg showed sinus rhythm with an incomplete right branch block and negative t waves in v1v3 with no sign of ischemia ( results comparable to previous ecg ) .
the patient was initially managed with intravenous antibiotics ( cephalosporin and metronidazole ) and fluids .
hematological and biochemical investigations revealed an increased white blood cell count ( 10.2 10/l ) and a crp of 434 mg / l , with normal urea , electrolytes , liver function , amylase and bilirubin . based on the deteriorating laboratory values , we planned a surgical cholecystectomy . despite the absence of chest pain
ecg showed st segment depression in v3 in addition to the already known negative t waves in v1v3 . in view of these unexpected ecg findings
the patient was initially managed conservatively using the acute coronary syndrome protocol for anticoagulation with high - dose low - molecular - weight heparin , aspirin and -blockers in addition to the already administered angiotensin - converting enzyme inhibitors .
g / l after 12 h and to 0.30 g / l after another 8 h. cardiac ultrasound showed a mildly enlarged right ventricle , no enlargement of the left ventricle , a good ejection fraction and a right overload septal motion abnormality with pulmonary hypertension ( systolic peripheral arterial pressure 4550 mm hg ) .
an angio - ct was performed to exclude pulmonary embolism ; the findings were negative .
coronary angiography was then undertaken , showing no abnormality and normal left ventricular function . finally , abdominal ct confirmed cholecystitis and excluded empyema or abscess complications ( fig .
the clinical course was favorable , with a progressive disappearance of abdominal symptoms and a return to normal complete blood count , lipase , cardiac markers , electrolytes , bilirubin aminotransferase and crp levels .
in previous studies , gallbladder distension has been associated with nonspecific t - wave inversions or st segment depressions that are similar to those of ischemic heart disease [ 1 , 2 , 3 , 4 ] , and only five previous cases with similar ischemic ecg changes attributed to cholecystitis have been reported [ 5 , 6 , 7 , 8 , 9 ] .
several studies in animals [ 10 , 11 ] have demonstrated that gallbladder distension can reduce coronary blood flow and increase heart rate and arterial blood pressure , and may explain the association with transiently mimicked myocardial ischemia and st segment ecg changes .
increases in troponin are most commonly related to ischemic myocardial cell injury / necrosis , but nonischemic cardiac causes include prolonged tachycardia and septicemia / septic shock [ 12 , 13 ] .
only two previous reports [ 14 , 15 ] have described increased troponin levels in a patient with acute cholecystitis ; the simultaneous presentation of both pathological findings has not been reported .
the new finding in this case was the observation of ecg changes that mimicked myocardial infarction , with a raised troponin i level that did not seem to be attributable to myocardial ischemia , but was exclusively related to cholecystitis .
this case shows that cholecystitis with gallbladder distension can be the sole cause of pathological ecg changes and an increased troponin i level , which should be considered when evaluating patients with similar presentations .
Output:
| cardiac troponins are the most sensitive and specific serum markers of myocardial cell injury , but they can also arise without apparent cardiac injury .
besides , acute cholecystitis may be associated with nonspecific st - t wave changes in electrocardiography ( ecg ) .
the signs and symptoms of gallbladder and heart disease may overlap , which can make diagnosis difficult .
we describe the case of a 75-year - old woman with clinical features suggestive of acute cholecystitis associated with transient st segment elevation and elevated troponin i that , after extensive workup , did not seem to be attributable to myocardial ischemia or any other acute cardiac problem , but were exclusively related to cholecystitis .
we show that cholecystitis with gallbladder distension can be the sole cause of pathological ecg changes and an increased troponin i level ; this should be considered when evaluating patients with similar presentations . |
PubmedSumm7820 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: during 20012014 , epidemiologic data on nhp related injuries and associated rabies pep treatment were prospectively collected for patients of the marseille rabies treatment centre .
demographics , place of exposure , travel characteristics , clinical data , and rabies pep were documented .
a total of 135 cases of persons injured by nhps reported during a 14-year period were included , representing an average 10 cases / year ( range 416 cases / year ) , with a tendency to increase over time ( figure , panel a ) .
exposures were more frequently reported during july october ( figure , panel b ) .
the f / m sex ratio of patients was 1.1 , and the mean age was 30 years ( median 27 years ; range 370 years ) ; 20.7% of patients were < 15 years of age ( table 1 ) .
of the 135 patients , 2 had complete and 1 incomplete preexposure vaccination against rabies .
most exposures ( n = 120 , 88.9% ) occurred outside of france , notably in southeast asia ( n = 82 ) ; most cases occurred in thailand ( n = 48 ) and indonesia ( n = 25 ) .
most exposures in thailand were on monkey beach on koh phi phi island and in the lopburi monkey temple ; most exposures in indonesia were in the ubud monkey forest in bali ( table 2 ) .
most persons injured abroad were tourists with a mean travel duration of 21 days ( median 17 days ; range 3180 days ) .
the mean time between the first date of travel and exposure was 10 days ( median 8 days ; range 150 days ) .
number of injuries to humans by nonhuman primates requiring rabies postexposure prophylaxis , marseille rabies treatment centre , marseille , france , 20012014 .
a ) logarithmic regression was used to calculate a line of best fit of y = 2,3191ln(x ) + 5.4699 ( black line ) .
b ) cumulative occurrence by month . * vietnam ( 5 ) , india ( 4 ) cambodia ( 3 ) , myanmar ( 1 ) , sri - lanka ( 1 ) .
madagascar ( 4 ) , kenya ( 4 ) , botswana ( 1 ) , cameroon ( 1 ) , central african republic ( 1 ) .
brazil ( 2 ) , anguilla ( 1 ) , dominican republic ( 1 ) , mexico ( 1 ) , peru ( 1 ) .
persons , or their descendants , who have immigrated to marseille from another country who were exposed while visiting friends and relatives in their country of origin ( 3 ) , expatriate ( 1 ) , humanitarian worker ( 1 ) , and student ( 1 ) .
injuries most commonly occurred on the upper limbs ( 57.8% ) ; subsequent occurrences of injury were on lower limbs ( 28.9% ) , head ( 5.9% ) , trunk ( 3.7% ) , or multiple sites ( 2.2% ) .
most injuries ( 66.7% ) were severe transdermal type 3 injuries according to the who classification , resulting from severe bites ( 1 ) ; the remaining ( 33.3% ) were type 2 injuries ( minor abrasions and scratches without bleeding ) .
according to who guidelines ( 1 ) , rabies immune globulin ( rig ) was indicated for 65.2% of patients who had type 3 injuries and no previous vaccination against rabies . among patients injured abroad ,
58 ( 48.3% ) started rabies pep abroad ; the mean time between injury and treatment was 1 day ( median 0 days ; range 021 days ) .
most ( 77.6% ) underwent the essen protocol and 17.2% underwent the zagreb protocol ( 1 ) ; and 5.2% underwent the 7-dose mouse brain vaccine protocol ( local subcutaneous and intradermal protocol used in north africa : seven 1.0-ml subcutaneous injections from day 0 through day 6 , followed by 2-site 0.1-ml intradermal injections on days 10 , 14 , 29 , and 90 ) .
a total of 35 patients ( 25.9% ) had an indication for rig , of whom 8 ( 22.9% ) received the rig abroad . among the 27 remaining patients , the mean time between first injection of vaccine abroad and the first consultation in france was 12 days ( median 12 days ; range 331 days ) .
an additional 6 patients ( 17.1% ) received rig in france , and the remaining 21 patients ( 60.0% ) did not .
of those 21 patients , 20 sought follow - up medical consultation in france > 7 days after the first vaccine was provided abroad ; the initiation of rig is contraindicated if > 7 days have passed since vaccine initiation ( 5 ) .
a total of 62 patients started their treatment in france with a mean time between injury and treatment of 15 days ( median 11 days ; range 2123 days ) .
most underwent the essen protocol ( 71.0% ) , followed by the zagreb protocol ( 27.4% ) .
one patient who received complete preventive vaccination received 2 booster doses at days 0 and 3 .
of 44 patients for whom rig was indicated , 39 ( 88.6% ) received rig .
an estimated 31% of injuries requiring rabies pep among international travelers are caused by nhps , which rank second after dogs in most studies and first in studies conducted among travelers returning from southeast asia ( 2 ) . in a recent geosentinel survey involving 2,697 travelers requiring rabies pep , nhps accounted for 66% of animal bites occurring in southeast asia , and tourists made up a disproportionately large portion of the nhp exposures ( 92% ) ( 6 ) .
bites by nhps can transmit other potentially life - threatening zoonoses , such as the herpes b virus ( cercopithecine herpesvirus 1 ) .
the human herpes b virus infections that have been described have all occurred after contact with macaques in a biomedical research setting ( 7 ) .
however , samples of > 80% of macaques at the monkey forest in bali tested positive for antibodies against the herpes b virus , a naturally occurring infectious agent that is endemic among macaque monkeys from asia ( 8) .
appropriate b virus prophylaxis may be considered for travelers injured by asian macaques , although this treatment is not applicable to those injured by new world nhps ( 3,4 ) . in this study
, we observed that most exposures occurred among adult tourists to southeast asia during the summer months , which probably reflects travel volume .
furthermore , we identified 2 major tourist destinations in thailand and 1 in indonesia as locations where monkeys were most likely to bite tourists , reflecting the regional distribution of both monkey and tourist populations .
most patients were taking relatively short trips and were bitten within the first 10 days after their arrival . indeed
an estimated 6% of visitors to bali monkey temples are bitten by macaque monkeys ( 9 ) .
no detailed information is available about documented cases of rabies among monkeys at these tourist destinations ; however , confirmed cases have been reported in monkeys as well as in gibbons and langurs in thailand ( panichabhongse p. , the epidemiology of rabies in thailand [ thesis ] .
we show that most of the cases involved persons who had not received preexposure immunization and that 33% of patients for whom rig was indicated did not receive rig .
only a small proportion of travelers received rig in the country of exposure , which reflects the limited supply of this biological agent in many countries .
unvaccinated western travelers who are unaware of the risk for rabies regularly engage in contact with animals during their trips , often resulting in expensive pep . to decrease the need for rabies pep after animal bites , it is crucial that travelers to countries in which rabies is endemic be fully informed of this specific risk , which can be easily minimized by avoiding contact with animals , avoiding feeding them , avoiding smiling at them ( showing teeth is a sign of aggression ) , avoiding dropping something that a monkey has grabbed , and avoiding showing fear .
our findings indicate that tourists should be given strong warnings before travel to visit koh phi phi , lopburi , or ubud .
Output:
| most exposures of residents of marseille to nonhuman primates occurred among unvaccinated adult travelers to southeast asia within the first 10 days of their arrival at 2 major tourist locations in thailand and 1 in indonesia .
a small proportion of travelers received rabies immunoglobulin in the country of exposure . |
PubmedSumm7821 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: this study was conducted as part of epidemiologic surveillance activities of the ministry of public health of the central african republic .
data were obtained through the yellow fever surveillance system and approved by the ministry of health and who .
a suspected case of yellow fever was defined as an acute onset of fever in a patient followed by jaundice within 2 weeks ( 3 ) .
all blood samples from patients with suspected cases were tested at the institut pasteur ( bangui , central african republic ) ( ipb ) for yellow fever virus specific igm by using the elisa developed by the us centers for disease control and prevention ( 4 ) .
positive samples were sent to the regional reference laboratory at the institut pasteur in dakar , senegal , where a plaque - reduction neutralization test ( prnt ) was performed for case confirmation .
a suspected yellow fever case was ruled out if elisa or prnt results were negative . when a suspected case was not ruled out by elisa ,
health authorities were informed and an investigation was conducted so that vaccination could be implemented without delay if the case was confirmed .
each intermediate step was studied : collection ( from onset of jaundice to blood sample collection ) , field storage ( from sample collection to shipping ) , transportation ( from shipping to reception at ipb ) and testing ( from reception of sample to elisa result ) .
survival analysis was performed to determine how the following factors affected time to confirmed cases : age , sex , onset during the rainy season ( may 1october 31 ) , province of residence , history of vaccination against yellow fever , and year of onset . because the proportional hazard assumption was not verified for several variables , we used a parametric survival model and assumed a log - normal distribution of event times to estimate mutually adjusted time ratios .
data were analyzed with stata software version 11.0 ( statacorp lp , college station , tx , usa ) maps were drawn with arcgis version 10.1 ( esri , redlands , ca , usa ) . during january 2007july 2012 , a total of 3,220 suspected cases of yellow fever were reported to ipb ( technical appendix figure 1 ) .
suspected cases were reported in all provinces but mostly in bangui ( 32.7% ) and in neighboring ombella mpoko province ( 24.7% ) ( technical appendix figure 2 ) .
median age of patients with suspected cases was 21 years ( interquartile range 1030 years ) and 57.5% were men .
only 21.9% reported having been vaccinated against yellow fever virus within the previous decade ( table 1 ) .
mean delay was 9.9 days ( 95% ci 9.510.2 days ) for blood sample collection , 1.5 days ( 95% ci 1.41.6 days ) for field storage , 1.1 days ( 95% ci 1.01.1 days ) for transportation , and 4.2 days ( 95% ci 4.14.3 days ) for testing .
detection of yellow fever ( figure 1 , panel a ) and delay for blood collection ( figure 1 , panels b e ) were shortest in 2009 .
temporal pattern of mean time ( delay between date of onset of jaundice reported by the patient and date of an elisa result ) for a ) yellow fever surveillance , b ) blood sample collection , c ) field storage of samples , d ) transportation of samples , and e ) testing of samples , central african republic , 20072012 .
mean time until blood collection was shortest in bangui ( 14.8 days ) and surrounding areas and longest in mbomou ( 26.2 days ) ( figure 2 , panel a ) .
mean delay for blood sample collection was shorter in eastern and northern regions of the country and longer in central and western regions ( figure 2 , panel b ) .
east gradient and ranged from 0.1 days in bangui to 4.9 days in haut mbomou ( figure 2 , panel d ) . a longer period to blood sample testing for the eastern part of the country was related to longer times of field storage and transportation ( figure 2 , panels c , d ) .
mean time for testing remained stable at 45 days ( figure 2 , panel e ) .
spatial pattern of mean time ( delay between date of onset of jaundice reported by the patient and date of an elisa result for a ) yellow fever surveillance , b ) mean time for blood sample collection , c ) mean time for field storage of samples , d ) mean time for transportation of samples , and e ) mean time for testing of samples , by province , central african republic , 20072012 .
province of residence and year of onset were associated with a shorter period to diagnosis ( p<0.001 ) ( table 2 ) .
adjusted time ratios are from a parametric survival model assuming log - normal distribution of the event times .
timeliness was defined as the delay between the date of onset of jaundice ( reported by the patient ) and the date of elisa result .
a total of 55 yellow fever cases were confirmed and 11 case - patients died .
of the confirmed case - patients , 22 ( 40.0% ) were 1524 years of age , 35 ( 63.6% ) were male , and for 13 ( 23.6% ) date of vaccination against yellow fever virus was unknown .
age and history of vaccination differed between patients who had confirmed yellow fever cases and those who did not ( table 1 ) .
this study shows that in the central african republic , a country with limited health care and transportation facilities , confirmation of a yellow fever case takes 23 weeks .
approximately 10 days ( 60% of the delay ) are required from the onset of symptoms to blood collection . a fast time to case confirmation
was observed in 2009 , which was largely caused by a decrease in time required for blood collection , could be related to greater public awareness resulting from a yellow fever outbreak in ombella mpoko and lobaye ( 5 ) and from a large outbreak of hepatitis e. this study showed an unexpected association between younger age and more rapid time to diagnosis , which was caused mainly by a shorter delay until blood collection , suggesting that parents have their children tested earlier .
these 2 results indicate that the delay to blood collection could be reduced by better awareness of the population to the need for testing when they have symptoms compatible with yellow fever .
the 45 days of delay until testing is below the threshold of 7 days recommended by who
. however , it could be decreased by implementation of a method of yellow fever detection ( bioplex technology ; biorad laboratories , hercules , ca , usa ) , which is now in progress at ipb . the need for confirmation by prnt might delay vaccination because of time necessary for transportation of samples to dakar and testing .
the central african republic is landlocked and surrounded by countries to which yellow fever is endemic ( 6 ) .
thus , prnt for this region could be implemented at ipb , where biosafety level 3 facilities are functional .
delays in reporting cases observed in this study are consistent with time between onset of symptoms of yellow fever in index case - persons and in persons infected by them , which is estimated to be 2 weeks ( 7 ) .
a comparison of delays found in this study with those in other countries would be helpful .
Output:
| during january 2007july 2012 , a total of 3,220 suspected yellow fever cases were reported in the central african republic ; 55 were confirmed and 11 case - patients died .
mean delay between onset of jaundice and case confirmation was 16.6 days .
delay between disease onset and blood collection could be reduced by increasing awareness of the population . |
PubmedSumm7822 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: leishmaniasis caused by the intracellular protozoan leishmania is the second most important parasitic disease after malaria , affecting humans and animals in wide areas of the americas , asia , africa and europe .
domestic dogs are considered the main reservoir of leishmania infantum , and a risk factor for anthroponotic human visceral infection .
canine leishmaniasis ( canl ) is endemic and affects millions of dogs in asia , europe , north africa and south america , and is currently an emergent disease in north america .
it has been estimated that at least 2.5 million dogs are infected in southwestern europe ( moreno and alvar , 2002 , athanasiou et al . , 2012 ) .
the infection is spreading to non - endemic areas and cases of canl are reported with increasing frequency in northern european countries and in the united kingdom , even in dogs that have never visited endemic zones ( shaw et al . , 2009 ) .
the introduction and spread of the disease to regions where infections had not previously been observed may create new epidemiological scenarios , further complicating the zoonotic potential and control of the disease . in the absence of effective human and canine vaccines , the only feasible way to treat and control leishmaniasis is through the use of affordable chemotherapy .
meglumine antimoniate is one of the most common drugs used in europe to treat canl ( solano - gallego et al . , 2011 ) .
the combination of meglumine antimoniate with allopurinol is considered to be the most effective therapy and constitutes the first line protocol against canl ( mir et al .
anti - leishmania therapy can usually decrease the parasite load , although it is extremely difficult to achieve a parasitological cure in dogs .
for this reason , the majority of short - term therapeutic interventions are usually followed by a relapse within 1 year of discontinuing treatment ( baneth and shaw , 2002 , ikeda - garcia et al .
as infected dogs never achieve parasitological cure and are frequently treated several times with the same compounds , selection and transmission of antimony - resistant parasites could appear ( campino and maia , 2012 , sereno et al . , 2012 ) .
therapeutic failure and relapse in leishmaniasis is known to have a multifactorial origin , involving features related to the host ( immunity , genetic and nutritional factors , among others ) , the drug ( quality , pharmacokinetics ) and the parasite ( drug resistance , increased infectivity , coinfection with other pathogens ) ( vanaerschot et al . , 2014 ) . while the occurrence of leishmania resistance to pentavalent antimonials is well known in human medicine ( croft et al . , 2006 ,
l. infantum isolates taken from dogs which had received several treatment courses have demonstrated contradictory results , with no differences in susceptibility in isolates from treated and untreated dogs ( carri and ports , 2002 ) , or a decreased susceptibility to antimony after several therapeutic interventions ( gramiccia et al . , 1992 ) . in the present study
we investigate if a l. infantum isolate from a dog with canl relapse after a therapeutic intervention has developed drug resistance as a factor responsible of therapeutic failure , and the mechanism of resistance developed .
the singularity of this study was based on the use of leishmania isolates at the time of diagnosis and after therapeutic interventions , facilitating the comparative studies .
it is important to detect resistant parasites in dogs with therapeutic failure in order to avoid and reduce the emergence and spread of resistant parasites throughout the canine populations ; a factor that requires special consideration when dogs are treated with the same anti - leishmania drugs that are available for human visceral leishmaniasis .
trivalent antimony ( sb ) , amphotericin b ( amb ) , paromomycin , triton x-100 , paraformaldehyde , 4,6-diamidino-2-phenylindole dilactate ( dapi ) , n - dodecyl--d - maltoside ( ddm ) , 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) and phorbol 12-myristate 13-acetate ( pma ) were obtained from sigma - aldrich ( st . louis , usa ) .
a five - years - old male boxer dog was positively diagnosed for leishmaniasis through detection of anti - leishmania specific antibodies by indirect immunofluorescence ( igg titer 1280 ) and by detection of l. infantum parasites with qpcr ( 1.06 parasites/l ) using specific primers for kdna as described ( corpas - lpez et al . , 2015 ) .
the animal had many clinical signs compatible with canl , including onychogryphosis , adenopathy , skin lesions and uveitis , among others .
briefly , each symptom was assigned a value according to the severity of it ( 0 = absence ; 1 = mild ; 2 = moderate ; 3 = severe ) and the cs was the sum of the values for every symptom . the initial clinical scores ( cs = 18 ) rises after the first treatment series ( cs = 24 ) and declined to the initial cs value after the second one ( cs = 18 ) . in the follow - up period without drug pressure , the dog showed a higher cs value ( cs = 20 ) , due to the aggravation of eye symptoms ( uveitis , keratitis ) besides increased creatinine .
after the trial , the dog was returned to its owner with full information on its clinical and parasitological state , who decided to treat the animal with other drugs .
the dog was housed in the facilities of an animal shelter , with access to water and food ad libitum .
the building where the dog was housed was protected with adequate mosquito nets to prevent sandflies from entering .
animal experiments were approved by the ethics committee for animal experimentation of the university of granada ( protocol : 450 - 26113 ) and all procedures were carried out according to the international guidelines and the european union directive ( 86/609/eec ) .
the dog was treated with meglumine antimoniate ( glucantime ) at 100 mg / kg / day administered subcutaneously for two 28-day periods , separated by a 30-day interval .
the parasites were isolated from bone marrow and ganglion aspirates in evans modified tobie s medium ( emtm ) .
after their isolation , parasites were cultured at 28 c in rpmi-1640 medium supplemented with 10% heat - inactivated fetal bovine serum ( hifbs , invitrogen ) .
after 6 passages ( 2 months ) , parasite strains were labeled , mixed with dmso and stored in liquid nitrogen . to determine parasite susceptibility to sb and other anti - leishmania drugs such as amb , paromomycin and miltefosine ,
2 10 promastigotes were incubated in 96-well plates ( 100 l ) at 28 c for 72 h in the presence of increasing drug concentrations before determining cell proliferation by the mtt colorimetric assay as described previously ( gmez - prez et al . , 2015 ) .
the 50% effective concentration ( ec50 ) was defined as the drug concentration required for half maximal inhibition of cellular growth rate .
the ec50 for each line was calculated by nonlinear regression analysis using sigmaplot 2000 software for windows ( spss inc . ,
resistance index ( ri ) was calculated by dividing the ec50 obtained for the resistant line by the ec50 obtained for the parental susceptible line .
thp-1 cells were grown at 37 c and 5% co2 in rpmi-1640 supplemented with 10% hifbs , 2 mm glutamate , 100 u / ml penicillin and 100 g / ml streptomycin .
3 10 cells / well , in 96-well plates , were differentiated to macrophages with 20 ng / ml of pma treatment for 48 h followed by 24 h of culture in fresh medium ( gmez - prez et al . , 2014 ) . to determine the susceptibility of intracellular leishmania amastigotes to sb , sb in the form of meglumine antimoniate ( glucantime ) , amb , paromomycin and miltefosine ,
late stationary - phase promastigotes were used to infect macrophage differentiated - thp-1 cells at a macrophage / parasite ratio of 1:10 .
infected cell cultures were then incubated at different compound concentrations for 72 h , as described previously ( gmez - prez et al . , 2014 ) .
samples were then fixed for 30 min at 4 c with 2% paraformaldehyde in pbs , followed by permeabilization with 0.1% triton x-100 in pbs for 30 min .
the percentage of infection and the mean number of amastigotes from infected macrophages were determined in 200 macrophages / well .
promastigotes ( 1 10 per ml ) were incubated with 100 m sb for 60 min at 28 c , then centrifuged and the resultant pellet stored at 80 c until antimony accumulation was measured as described previously ( manzano et al . , 2013 ) .
to determine antimony efflux , the different isolates were incubated with compensated sb concentrations ( 50 m for line 576 - 1 and 500 m for line 576 - 3 ) in culture medium at 28 c for 1 h to allow a similar labeling in the leishmania lines .
the parasites were then washed with pbs , resuspended in culture medium at 28 c and pelleted at different times ( 0 , 30 , 60 and 120 min ) . the cell pellet was dissolved in 200 l of concentrated nitric acid at room temperature for 24 h. the sample was diluted to 3 ml with distilled water and then injected into an inductively coupled plasma mass spectrometer ( icp - ms ; perkinelmer ) for quantitation .
antimony was measured at its m / z ratios of 121 and 123 with rhodium as an internal standard .
genomic dna and total rna were extracted from the leishmania isolates using the rneasy plus mini kit ( qiagen ) and dneasy blood and tissue kit ( qiagen ) , respectively .
isolated rna was transcribed into cdna using the qscript cdna synthesis kit ( quanta biosciences , inc ) following the manufacturer s instructions .
the synthetized cdnas were diluted 1:10 and 1:50 and specific fragments amplified with sense and antisense primers ( 5-acgatggcgtccaagtacag ) and ( 5-gagtatgcgaggtgacaagtc ) for aquaglyceroporin-1 ( aqp1 ) , ( 5-gctgtacatgcagaacgtctc ) and ( 5-acgtactcgtgctccacttc ) for mrpa , ( 5-cttcaactgcatcctcttcg ) and ( 5-gcagtccatcgaatcgcagg ) for ornithine decarboxylase ( odc ) , ( 5-cctcgtgtgccgctatctag ) and ( 5-gcatgcgctgcacaaggtca ) for -glutamylcysteine synthetase ( -gcs ) , and ( 5-gaagtacacggtggaggctg ) and ( 5-cgctgatcacgaccttcttc ) for gapdh using 35 amplification cycles at an annealing temperature of 54 c .
pcr products were electrophoresed on 1% agarose gel , stained with ethidium bromide , viewed under a uv illuminator and the relative intensity against gapdh was measured as an internal control .
the full - length coding sequence of aqp1 from l. infantum ( genedb l. infantum , accession code linj.31.0030 ) was isolated from the genomic dna of the clinical isolates by pcr using sense and antisense primers ( 5-caacagcacgcgcacttc ) and ( 5-cagtcagca cgagctgtg ) .
a single - band 945 bp pcr product was obtained , cloned in the pgem - t vector system ( promega ) and sequenced .
intracellular non - protein thiol levels were measured by flow cytometry using celltracker , as described previously ( garca - hernndez et al . , 2012 ) .
promastigotes ( 1 10 per ml ) were washed twice with pbs , incubated with 2 m celltracker for 15 min at 37 c , washed again with pbs and analyzed by flow cytometry using a facscan flow cytometer ( becton - dickinson , san jose , ca ) equipped with an argon laser operating at 488 nm .
fluorescence emission between 515 and 545 nm was quantified using cell quest software . for preparation of total protein lysate , l. infantum promastigotes ( 3 10 per ml ) were harvested , washed in pbs , lysed by the addition of lysis buffer ( 2% ddm , 150 mm nacl , 50 mm tris - hcl ph 7.4 plus a protease inhibitor cocktail from sigma ) and incubated at 4 c for 1 h. the clarified lysate was mixed with 2 laemmli sample buffer and resolved by sds - polyacrylamide gel electrophoresis ( sds - page ) . the samples ( 25 g protein per lane ) were resolved by 10% sds - page and transferred to pvdf membranes .
membranes were subsequently blocked at room temperature for 1 h in 5% skimmed milk in pbs with 0.05% tween 20 ( pbs - t ) and washed three times with pbs - t .
immunodetection was performed by incubating the blocked membranes at room temperature for 1 h in the presence of antibodies against cytosolic tryparedoxin ( ctxn ) , mitochondrial tryparedoxin ( mtxn ) , cytosolic tryparedoxin peroxidase ( ctxnpx ) , mitochondrial tryparedoxin peroxidase ( m - txnpx ) , trypanothione synthetase ( trys ) and trypanothione reductase ( tr ) : anti - ctxn ( dilution 1:3000 ) ( castro et al . , 2004 ) , anti - mtxn ( 1:3000 ) ( castro et al . , 2004 ) , anti - ctxnpx ( 1:3000 ) ( castro et al . , 2002 ) , anti - mtxnpx ( 1:3000 ) ( castro et al . , 2002 ) , anti - trys ( 1:1000 ) ( sousa et al . , 2014 ) or anti - tr ( 1:1000 ) ( h. castro and a. toms , personal communication ) .
the membranes were washed and incubated with hrp anti - mouse igg ( 1:5000 ) or hrp anti - rabbit igg ( 1:5000 ) ( promega ) .
immunoreactive proteins were viewed using a chemiluminescence detection kit ( pierce ecl western blotting substrate ) according to the manufacturer s instructions .
in this study , we have analyzed parasites isolated from ganglion aspirate at the time of diagnosis ( mcan / es/2014/dp576 - 1 , abbreviated as line 576 - 1 ) and 30 days after two therapeutic interventions with glucantime ( 100 mg / kg / day , subcutaneously for 28 days ) , separated by a 30-days interval ( mcan / es/2014/dp576 - 3 , abbreviated as line 576 - 3 ) .
several factors could have contributed to the absence of a therapeutic response to glucantime in this dog , including factors related to the parasite , the drug or the host .
we evaluated whether line 576 - 3 presents modifications in drug susceptibility that could be associated with the development of resistance and , in positive case , we analyzed the mechanism of resistance . the susceptibility profile to sb of the different isolates of l. infantum
was analyzed in promastigotes and intracellular amastigotes ( table 1 ) , the ec50 values for line 576 - 3 were significantly higher than for line 576 - 1 , in both promastigotes and intracellular amastigotes ( table 1 ) .
these data suggest that parasites developed resistance to sb after the second therapeutic intervention , presenting a ri of around 6 for promastigotes and greater than 3 for intracellular amastigotes ( table 1 ) .
considering glucantime was the drug used to treat this infected dog , we analyzed the susceptibility profile to this drug in intracellular amastigotes from line 576 - 3 , obtaining an ec50 of 159.3 m , 3.3-fold higher than line 576 - 1 ( table 1 ) . our data clearly substantiate that relapse after the second therapeutic intervention was due to the acquisition of drug resistance in line 576 - 3 .
we also studied the cross - resistance profile to other anti - leishmania drugs , including amb , miltefosine and paromomycin ( table 1 ) .
the results showed that intracellular amastigotes from line 576 - 3 present a significant cross - resistance to paromomycin ( ri around 2.8 ) .
however , we did not observe any cross - resistance to amb and miltefosine in promastigotes and intracellular amastigotes .
as previously described , promastigotes of l. donovani resistant to antimony present a significant cross - resistance to paromomycin and not to amb and miltefosine ( garca - hernndez et al . ,
2012 ) ; however , other studies using antimony resistant and sensitive field l. donovani isolates shown equal susceptibility to paromomycin ( kulshrestha et al . ,
these results support the variability in the response of leishmania to drugs . additionally , drug pressure could induce genomic changes in parasites that could be responsible of the resistance to paromomycin in intracellular amastigotes . furthermore , lack of correlation between the promastigote and intracellular amastigote susceptibilities to paromomycin observed in the present study , supports the intracellular amastigote model as more appropriate approach for susceptibility studies , as has been previously reported ( vermeersch et al .
we then tried to elucidate the mechanism of antimony resistance in line 576 - 3 by analyzing antimony uptake and the expression profiles of known genes involved in transport and thiol based redox metabolism .
a decrease in drug concentration within the parasite , either by reducing drug uptake or by increasing efflux / sequestration of the drug , represents the primary mechanism of antimonial resistance in leishmania ( brochu et al . , 2003 ) .
to determine whether a reduction in sb uptake was one of the mechanisms of resistance developed in line 576 - 3 , the intracellular accumulation of this metal ion was measured by icp - ms after incubation with 100 m sb for 1 h. sb accumulation was found to be significantly lower ( 90% ) in the resistant line 576 - 3 compared to line 576 - 1 ( fig .
the lower sb accumulation in line 576 - 3 could explain the resistance to antimonials . to determine whether the reduced level of accumulation was due to an increase in antimony efflux
, both l. infantum lines were loaded under conditions that yielded similar amounts of intracellular antimony and the portion of antimony retained in the parasites was measured at different times .
the efflux of sb was found to be time - dependent and similar in both leishmania lines ( fig .
1b ) , thus confirming that the lower sb accumulation was not due to increased efflux activity , but rather a decrease in drug uptake .
in leishmania , antimony uptake is mediated by the transporter aqp1 ( gourbal et al .
previous studies indicated aqp1 rna levels were down - regulated in several leishmania promastigote species ( l. tarentolae , l. major and l. infantum ) that were experimentally resistant to antimonials ( marquis et al . , 2005 ) , as well as in different antimony - resistant leishmania donovani clinical isolates ( decuypere et al . , 2005 ,
in general , the level of aqp1 transcript correlated well with the accumulation of sb and resistance levels in leishmania parasites ( marquis et al . , 2005 ) .
aqp1 gene expression in lines 576 - 1 and 576 - 3 was analyzed by rt - pcr to ascertain whether there was a correlation between aqp1 gene expression and antimony susceptibility and accumulation .
the results showed that aqp1 expression in the resistant line 576 - 3 was around 5-fold lower than the expression in the susceptible line 576 - 1 ( fig .
gene deletion and point mutations in aqp1 have been reported in antimony - resistant leishmania parasites ( monte - neto et al . ,
the full - length coding sequence of the l. infantum aqp1 gene was cloned and sequenced from the 576 - 1 and 576 - 3 isolates .
only one of five clones sequenced presented a point mutation that lead to a premature stop codon , while the rest of the clones did not show any point mutations or deletions that could be associated with a reduction in aqp1 activity .
our data therefore support the suggestion that down regulation of aqp1 is the main resistance mechanism in l. infantum isolate from a case of canl with therapeutic failure .
abc transporter mdr - related proteins ( mrpa / pgpa ) are known to be involved in antimonial - resistance in leishmania through sequestration of the metal - thiol conjugates in an intracellular organelle located close to the flagellar pocket ( lgar et al . , 2001 ) .
the role of mrpa in conferring antimony resistance by sequestration of metal - thiol conjugates has also been reported in clinical isolates of leishmania ( mukherjee et al . , 2007 ) .
mrpa gene expression analysis in antimony susceptible and resistant l. infantum lines was determined by rt - pcr using specific primers .
the results showed that there were no differences in expression levels between susceptible and resistant lines ( fig .
1d ) , suggesting that mrpa is probably not responsible for the defect in antimonial accumulation in resistant l. infantum line 576 - 3 .
an increase in thiol levels is considered to be one detoxification mechanism described in antimony - resistant l. donovani isolates ( mandal et al .
, 2011 , rai et al . , 2013 ) . in order to study the involvement of thiols in the antimony resistant line
the results , quantified in terms of relative fluorescence units ( rfu ) , demonstrate that the resistant line 576 - 3 showed 1.5-fold higher intracellular non - protein thiol levels ( 239.17 38.43 rfu ) than the susceptible line 576 - 1 ( 152.57 23.38 rfu ) , and the difference showed statistical significance ( p < 0.005 ) .
trypanothione ( t[sh]2 ) , a conjugate of glutathione ( gsh ) and spermidine , is one of the major reduced thiols in leishmania parasites ( fairlamb and cerami , 1992 ) . increased levels of t[sh]2 are achieved through overexpression of -gcs , the rate limiting enzyme of gsh biosynthesis , and odc , an enzyme involved in spermidine biosynthesis ( grondin et al . , 1997 ,
2003 ) . mechanisms of antimony resistance based on t[sh]2 overproduction through overexpression of -gcs / odc have previously been described in both experimental leishmania antimony - resistant lines and in some clinical isolates of antimony - resistant l. donovani ( haimeur et al . , 1999 , decuypere et al . , 2005 ,
, 2006 , mukherjee et al . , 2007 , goyeneche - patino et al . , 2008 ,
this led us to probe the possible relationship between intracellular thiol content and the gene expression status of -gcs , odc and t[sh]2 synthetase ( trys ) .
the results show that odc exhibited increased rna levels ( around 2-fold ) in the antimony - resistant line 576 - 3 compared to the susceptible line 576 - 1 ( fig .
2a ) , whereas -gcs and trys expression levels were unaffected ( fig . 2 ) .
therefore , overexpression of odc may contribute to increased levels of t[sh]2 in the 576 - 3 antimony - resistant parasites .
the above results concur with previous reports that revealed an increased expression of odc in antimony - resistant isolates of l. donovani ( mukherjee et al . , 2007 ) . in trypanosomatids
tr is a flavoenzyme that catalyzes the nadph - dependent reduction of trypanothione disulfide ( ts2 ) to t[sh]2 .
previous reports have described the amplification of the tr gene in antimony - resistant l. donovani field isolates ( mittal et al . , 2007 ) .
using western blot analysis we observed a 4-fold increase in the levels of tr protein in the resistant line versus the susceptible one ( fig .
2b ) . increased levels of tr will help to maintain increased levels of t[sh]2 , which is required for conjugation with antimony and to overcome the inhibitory effect of sb . in leishmania the tryparedoxin / tryparedoxin peroxidase ( txn / txnpx ) system
is crucial to defend parasites against the oxidative stress that can be found in different compartments ( floh et al . , 1999 ) . increased levels of both proteins
have been detected in antimony - resistant l. donovani field isolates ( wyllie et al . , 2010 ) .
leishmania have two txnpx , one localized in the cytoplasm ( ctxnpx ) and the other in the mitochondrion ( mtxnpx ) , which protect the cell from peroxide - induced damage ( castro et al . , 2002 ) .
proteomic analysis of experimental antimony - resistant lines from l. braziliensis and l. infantum showed an overexpression of ctxnpx ( matrangolo et al .
additionally , overexpression of ctxnpx confers resistance to antimony in l. braziliensis and l. donovani ; however , overexpression of ctxnpx in l. infantum does not seem to be directly associated with resistance to sb ( lyer et al .
therefore , we studied whether txn / txnpx proteins were upregulated in the antimony - resistant line 576 - 3 .
the results showed an overexpression of mtxn ( by around 12-fold ) and mtxnpx ( around 4-fold ) , while no differences were observed in the expression of ctxn and ctxnpx ( fig .
the overexpression of the mitochondrial pathway could induce an increase in t[sh]2 levels which forms a complex with sb , thus inactivating the toxic effects of antimony and enhancing the parasite s antioxidant defense .
the present study has characterized the mechanisms of antimony resistance for the first time in a clinical isolate of l. infantum from a dog with naturally acquired canl .
we confirmed that l. infantum line 576 - 3 confers resistance against sb by significantly decreasing expression of the aqp1 transporter which leads to a reduction in intracellular accumulation of sb .
other factors including an increase in thiols levels and overexpression of enzymes involved in thiol metabolism could also contribute to the sb detoxification mechanism .
a major contribution of this study in a canine l. infantum isolate is to find an antimony - resistant mechanism similar to that previously described in other human clinical isolates .
therefore , more studies are required in l. infantum isolates from dogs that relapse after treatment to better understand the therapeutic failure in canl .
the use of naturally infected dogs and a controlled therapeutic intervention represent an excellent experimental strategy to study therapeutic failure / resistance and search for more effective therapeutic strategies following relapse , to avoid the spread of drug - resistant lines in endemic areas in attempts to control the disease . however , the use of naturally infected dogs has limitations mainly due to the economic costs and the requirements and controls to prevent new reinfections and follow - up analyses for drug efficacy .
Output:
| visceral leishmaniasis ( vl ) caused by the protozoan parasite leishmania infantum , is one of the most important zoonotic diseases affecting dogs and humans in the mediterranean area .
the presence of infected dogs as the main reservoir host of l. infantum is regarded as the most significant risk for potential human infection .
we have studied the susceptibility profile to antimony and other anti - leishmania drugs ( amphotericin b , miltefosine , paromomycin ) in leishmania infantum isolates extracted from a dog before and after two therapeutic interventions with meglumine antimoniate ( subcutaneous glucantime , 100 mg / kg / day for 28 days ) . after the therapeutic intervention , these parasites were significantly less susceptible to antimony than pretreatment isolate , presenting a resistance index of 6-fold to sbiii for promastigotes and > 3-fold to sbiii and 3-fold to sbv for intracellular amastigotes .
the susceptibility profile of this resistant l. infantum line is related to a decreased antimony uptake due to lower aquaglyceroporin-1 expression levels .
additionally , other mechanisms including an increase in thiols and overexpression of enzymes involved in thiol metabolism , such as ornithine decarboxylase , trypanothione reductase , mitochondrial tryparedoxin and mitochondrial tryparedoxin peroxidase , could contribute to the resistance as antimony detoxification mechanisms .
a major contribution of this study in a canine l. infantum isolate is to find an antimony - resistant mechanism similar to that previously described in other human clinical isolates . |
PubmedSumm7823 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: halogen bonding ( xb )
refers to the attractive noncovalent interaction arising between the
electron - deficient -hole of a polarized halogen atom , such
as bromine or iodine , and an electron - rich lewis base .
while xb has been well - developed in the context of solid - state crystal
engineering and in the design of functional materials , the utilization of xb in solution is relatively underexploited
with seminal applications in the areas of reactivity , catalysis , self - assembly , transport , and medicinal chemistry
only recently being reported .
anion supramolecular
chemistry has experienced rapid growth over the past few decades stimulated
by the crucial roles that anions play in many chemical , biological ,
and environmental processes . while supramolecular interactions such as hydrogen bonding ( hb )
have dominated the field of anion coordination , recognition , and transport , halogen bonding ( xb )
has only recently begun to emerge as a powerful
alternative interaction capable of coordinating anions in competitive
solvent media .
the strength of xb in solution has been demonstrated to be comparable
to hb , while the stringent linear directionality
of xb and ph - independence is advantageous for the design of selective
receptors for anions with particular geometries .
it is noteworthy
that the relatively few examples of acyclic and macrocyclic xb anion
receptors reported to date all display significantly contrasting anion
recognition behavior compared to hb analogues .
furthermore , rotaxane
interlocked host structural frameworks containing convergent xb triazolium
donor groups have been demonstrated to selectively recognize and sense
halide anions in highly competitive aqueous media .
herein we report a bis - iodotriazole - pyridinium
motif , incorporated within both an acyclic and a novel catenane - based
receptor , capable of binding anions via two convergent r ix halogen bonds .
the catenane host structural framework ,
prepared via chloride anion templation , is demonstrated to bind halide
anions with impressive selectivity in competitive organic
in addition , we report for the first time
cl and br k - edge xas analysis of the interactions observed in these
receptors with anions , revealing significant charge transfer from
the halides to the iodotriazole xb donors , and the first measure of
covalency in these systems .
these data allow for the first quantitative
evaluation of the degree of covalency in halogen - bonded species .
pre - edge
features in the xas spectra are modeled and supplemented with dft
calculations and tddft simulations of the xas data which reproduce
the experimentally observed pre - edge features .
the synthesis of the acyclic bis - triazole - pyridinium
receptors is shown in scheme 1 .
3,5-diethynylpyridine 1 was prepared by deprotecting 3,5-bis(trimethylsilylethynyl )
pyridine with koh in methanol , while azides 2a c were prepared via a modification of
a literature procedure .
the bidentate bis - triazole - pyridinium acyclic
precursor , 3a , was prepared via a cuaac click
reaction between 1 and 2.2 equiv of hexylazide , prepared in situ from the corresponding bromide .
the bidentate bis - iodotriazole - pyridinium acyclic receptor
precursors , 3b and 3c , were prepared using
a modification of a cuaac click
ci which were characterized by high - resolution
esi mass spectrometry , h , c nmr , and f as well as p nmr spectroscopy where appropriate .
acyclic receptors 4a and , for solubility reasons , 4b were anion exchanged to their corresponding noncoordinating
hexafluorophosphate salts in preparation for anion titration experiments ,
while 4cx was used in x - ray crystallographic structure
analysis ( x = cl ) and x - ray absorption spectroscopic
analysis ( x = cl , br , pf6 ) .
reagents
and conditions : ( i ) x = h : cuso45h2o ,
ascorbic acid , na2co3 , nan3 , hexyl - bromide , 3a : 79% ; x = i : nai , cu(clo4)26h2o , tbta , dbu , thf , 3b : 76% , 3c : 79% ; ( ii ) ch3i , dcm , 4ai : 81% , 4ci : 80% ; ( iii ) nh4pf6(aq ) , 4apf6 : 89% , 4bpf6 : 53% .
the anion recognition properties
of acyclic receptors 4apf6 and 4bpf6 were investigated using h nmr anion titration experiments by adding aliquots of anions as
their tetrabutylammonium salts to solutions of the receptor .
initial
titrations with tbacl in acetone - d6 determined 1:1 stoichiometric association constants of > 10 m for both receptors .
consequently , titrations
were repeated in the more competitive cd3cn affording the
data in table 1 for hb receptor 4apf6 ; however , association constants for xb receptor 4bpf6 were still > 10 m. as a result , titrations for 4bpf6 were performed in the even more competitive solvent dmso - d6 indicating the superior anion - binding capability
of the xb receptor .
addition of anions typically caused downfield
perturbations of 4apf6 triazole proton d , directly involved in anion coordination , and the 4bpf6 pyridinium proton c incumbent on anion binding ( figure 1 ) .
wineqnmr2 analysis of the titration data determined the
1:1 stoichiometric association constants shown in table 1 .
anion binding titrations with 4bpf6 following proton c in dmso - d6 : experimental titration data ( circles ) with fitted binding
isotherms indicated as lines ( 298 k ) .
calculated using wineqnmr2 monitoring the chemical shift data of 4apf6 proton d and 4bpf6 proton c ; estimated standard errors given
in parentheses ( 298 k ) .
the anion binding selectivity of prototriazole receptor 4apf6 follows anion basicity trends , as would be expected
for an anion receptor in an aprotic solvent , with the larger halides
complexed more weakly than chloride .
similarly , for the xb acyclic
receptor 4bpf6 , selectivity follows
anion basicity trends for the halides , with oac being the most strongly associated anion ; the association constant , ka , is 2.5 times larger in magnitude than chloride .
interestingly ,
no binding was observed for h2po4 and no3 , while
so4 was bound at > 10 m , presumably due to the greater negative charge .
to the best of our knowledge ,
this is only the second example of an
xb oxoanion - selective anion receptor .
crystals suitable for x - ray diffraction structural analysis were
obtained from the chloride salt of the octyl - appended acyclic receptor 4ccl .
iodotriazole
heterocyclic motif , despite the large size of the iodine substituents
( figure 2 ) .
the chelating xbs vary
in length from 3.121(2 ) to 3.195(2 ) corresponding to 8486%
of the sum of the van der waals halide radii , which is indicative
of strong xb interactions to the anion .
perspective
( left ) and space - filling representation ( right ) views of the crystal
structure of 4ccl .
gray = carbon , blue = nitrogen , purple = iodine , green = chlorine . as a result of the enhanced
anion recognition properties of the acyclic xb receptor 4bpf6 , in comparison to the hb analogue , 4apf6 ,
the bis - iodotriazole - pyridinium motif was integrated
into a catenane host structural framework . to this end
, macrocycle
precursor 6 was prepared initially , by reaction of 1 with 2.2 equiv of vinyl - appended azide 5 , via the same modified cuaac methodology ( scheme 2 ) .
methylation was achieved using ch3i , and thereafter , the vinyl - appended bis - iodotriazole - pyridinium - containing
macrocycle precursor was anion exchanged to the corresponding chloride
salt by repeated washing with nh4cl(aq ) to afford 7cl .
reagents and conditions : ( i ) nai ,
cu(clo4)26h2o , tbta , dbu , thf ,
56% ; ( ii ) ch3i , dcm , 99% ; ( iii ) nh4cl(aq ) , 66% .
synthesis of catenane 9cl was accomplished using chloride templation via a ring - closing
metathesis strategy .
an initial interpenetrated assembly was prepared
by mixing equimolar amounts of macrocycle 8(71 ) with 7cl in dry ch2cl2 .
addition of grubbs ii ring - closing metathesis
catalyst afforded the catenane in 41% yield following purification
by preparative thin layer chromatography .
catenane 9cl was characterized by h , c and 2d
cosy nmr experiments and high - resolution mass spectrometry .
notable
shifts in the pyridinium and isophthalamide protons c and 3 , respectively , were observed in addition to the splitting
and upfield perturbation of the hydroquinone protons 5 and 6 consistent
with inter - ring donor acceptor interactions between the electron - rich
hydroquinone groups and the electron - deficient pyridinium group , which
confirms the interlocked nature of the catenane ( figure 3 ) .
further evidence for the interlocking of the two macrocyclic
components was obtained by 2d roesy nmr which revealed through - space
interactions including those between hydroquinone and pyridinium protons
of the two macrocycles ( see supporting information ( si ) ) . truncated h nmr spectra of 7cl ( top ) , 9cl
( middle ) , and 8 ( bottom ) ( 300 mhz ,
293 k , solvent : cdcl3 ) .
the chloride anion template was removed by repeated washing
with nh4pf6(aq ) to afford 9pf6 for anion recognition studies and was similarly fully characterized
( scheme 3 ) .
reagents and conditions :
( i ) grubbs ii ( 10 wt % ) , dcm , 41% ; ( ii ) nh4pf6(aq ) , 86% .
association constants for the formation
of 1:1 stoichiometric host / guest complexes of catenane 9pf6 with various anions were determined using h nmr titration experiments , monitoring shifts in the internal
isophthalamide proton 3 upon addition of aliquots of anions added
as their tetrabutylammonium salts ( figure 4 ) .
a preliminary titration of 9pf6 with tbacl in 1:1 cdcl3/cd3od resulted in an association constant ka > 10 m , much greater
than the value obtained for the previously reported analogous prototriazole - containing
hb catenane ( table 2 ) .
consequently , all subsequent titrations were conducted in the aqueous
solvent mixture 10:45:45 d2o / cdcl3/cd3od , which is more competitive .
the association constants shown in
table 2 were determined by wineqnmr2 analysis of the titration data .
d2o / cdcl3/cd3od : experimental
titration data ( circles ) with calculated fit indicated as the line
( 298 k ) . calculated using wineqnmr2 monitoring the internal pyridinium proton ; estimated standard errors
given in parentheses ( 293 k , solvent : 10:45:45 d2o / cdcl / cd3od ) .
1:1 cdcl3/cd3od , 298 k. nb : no
binding : < 0.07 ppm . very strong binding of the halides
indeed ,
association constants determined for br and i are both > 10 m which
highlights the fact that binding is dramatically enhanced in the xb
catenane when compared to the hb catenane analogue . furthermore , in contrast , the xb host demonstrates a preference
for the larger halides despite the voluminous iodine xb donors .
indeed ,
a reversal in selectivity for the halides is observed for 9pf6 in comparison to the acyclic receptor 4bpf6 due the interlocked host s unique
three - dimensional binding cavity . despite the oac selectivity observed for the acyclic xb receptor 4bpf6 , no evidence for oxoanion binding was discerned
for oac or h2po4 for the xb catenane 9pf6 .
this may
be attributed to the oxoanions large size and unfavorable
geometry to bind and be encapsulated by the unique interlocked catenane
host cavity ( vide infra ) .
crystals suitable for x - ray diffraction structural analysis were
obtained for catenane 9 with chloride , bromide ,
iodide , dihydrogen phosphate , and sulfate counteranions .
all structures
crystallize in p1 with 1:1 complexes obtained
for chloride ( figure 5 ) , bromide , and iodide ,
which are isomorphous , and 2:1 complexes were obtained for dihydrogen
phosphate and sulfate , which in turn are isomorphous . while both hydrogen
and halogen bonds are observed between the host 9 and the anionic guest , the catenane curiously adopts an open
conformation in the solid state rather than completely encapsulating
the anion ; presumably this is due to the large iodo - substituted triazole
and the most energetically favorable conformation for crystallization .
while a varying degree of disorder for the polyether ends of the macrocycles
is observed in each complex , it does not affect the anion - binding
cavity of the catenane and is omitted for clarity here .
perspective
( left ) and space - filling representation ( right ) views of the crystal
structure of 9cl .
triazole icl halogen bonds ( 3.110(2)3.300(3 ) ) are
indicated as red dashed lines .
gray = carbon , blue = nitrogen , red = oxygen , purple
= iodine , green = chlorine , white = hydrogen . for further information
regarding the isomorphous 9br and 9i structures , see si .
examining the halide anion structures , strong halogen
bonds are observed indicated by bond lengths significantly shorter
than the sum of the van der waals radii and are summarized in table 3 . calculated errors
given in parentheses .
the
structure of ( 9)2so4 ( figure 6 ) clearly shows the so4 anion situated between two hosts rather
than being encapsulated in the cavity , as it is too large to penetrate
the interlocked binding pocket .
furthermore , the anion is on the inversion
center in the asymmetric unit allowing it to adopt one of two symmetry - related
orientations ( see supporting information ) .
halogen
bonds are formed rather than bifurcated halogen bonds from one o to
each of the iodine xb donors . the dihydrogen phosphate structure ( see supporting information ) , while of lower quality ,
shows a very similar structure ; i.e. , the large oxoanion binds outside
of the cavity .
crystal structure of ( 9)2so4 showing a 2:1 catenane / anion
complex with the anion ( so4 ) positioned
between the two catenane hosts rather than penetrating the binding
cavity .
gray = carbon , blue = nitrogen ,
red = oxygen , purple = iodine , white = hydrogen , orange = phosphorus ,
yellow = sulfur .
to establish the nature of the interactions
between the halide ( cl / br ) donor
and the iodine acceptor , we have exploited cl and br k - edge x - ray
absorption spectroscopy ( xas ) .
it has been clearly established that
cl k - edge xas can be used to evaluate the degree of delocalization
in chloro - metal bonds . in such cases ,
a pre - edge feature is observed in
the spectrum that formally corresponds to excitation of a cl1s electron to empty valence d - orbitals
on the transition metal acceptor .
the intensity of such transitions
is directly proportional to the amount of cl3p character mixed into these empty metal acceptor orbitals ,
providing a convenient method of obtaining a quantitative measure
of the degree of mixing between the chloro donor and the metal acceptor .
this methodology is equally applicable in cases where nonmetal acceptors
are under investigation , although to our knowledge it has not been
applied to other types of donor acceptor systems . within
the context of this work
, one would expect a halide ion ( cl and/or br ) to exhibit simple k - edge xanes spectra
with no pre - edge features .
electric - dipole allowed cl3p cl1s ( or br4p br1s ) transitions would not be observed since these valence p - states are filled ( nsnp ) .
covalent delocalization of the filled cl3p orbital with an empty acceptor orbital ( e.g. , via
hydrogen or halogen bonding ) would result in the possibility of a
new allowed transition corresponding to charge transfer from the chloride
to its bonding partner ( axcl * cl1s ) .
given that the intensity of such transitions is directly proportional
to the amount of cl3p in the final state
wave function , axcl * , the intensity of any observable
pre - edge feature provides us a direct measure of the degree of covalency
in the halogen bond .
chlorine k - edge xas data were obtained
for a series of donor acceptor complexes at beamline 4 - 3 at
the stanford synchrotron radiation lightsource .
the near - edge spectra
for 4cl and 9cl ( see figure 7 ) each exhibit an intense pre - edge feature that
is not present in ionic chloride salts .
the presence of this intense
feature can only result from charge transfer between the chloro donor
and its partners .
fitting of the pre - edge and edge
features allows experimental quantification of the degree of charge
donation in each of these species ( table 4 ) .
these results clearly demonstrate charge transfer from the donor
via halogen bonding in 4cl , and a combination of
xb and hb interactions in 9cl . for comparison ,
data were also collected on the h - bonding analogue of 4cl ( 10cl ) as well as a simple x - bonded adduct
5-iodo-3-methyl-1,4-dioctyl-1h-1,2,3-triazol-3-ium
chloride ( 11cl ) ( figure 7 ; see si for the synthesis of 10cl and 11cl ) .
these data provide a measure
of the total donation from the chloride anion to all of its bonding
partners , and thus the number of interactions must be considered when
interpreting these results .
normalized and background subtracted : ( a ) cl
k- and ( b ) br k - edge xas data for 11cl / br , 4cl / br , 10cl / br , and 9cl / br .
calculated errors
( parentheses ) are obtained from statistical distribution of fit results
for > 50 fits for each data set .
total donation is calculated in comparison with cl k - edge xas data
on a cucl4 reference , errors include
an estimate of the error in charge transfer of this reference compound .
it is apparent that , with a
chloride donor , x - bonding interactions are significantly more covalent
in character than comparable h - bonding interactions .
these data are
consistent with previous reports that charge transfer is an important
factor in xb bonds .
these xas data , however ,
allow us to quantify the degree of covalency in the xb bond and thus
compare the degree of charge transfer in different systems , which
to our knowledge is unprecedented . in 11cl , where
only a single halogen bonding interaction is possible , we find that
the degree of donation is consistent with 6% charge transfer
to the iodinated triazole acceptor .
the magnitude of charge donation / covalent
character in the xb bond is notable in that it is a similar magnitude
to that which is commonly observed in transition metal complexes ,
where covalent contributions are considered to be of great importance
in defining chemical properties .
for example , in simple divalent metal
chlorides ( [ mcl4 ] , where m = cu , ni ,
co , fe ) , bond covalencies have been determined to range from 6% to
9% . in the bis - triazole 4cl , the total charge donation from the halide ion almost doubles
to 11% , which implies that each of the halogen bonds are independent
from each other and additive . by contrast
, replacement of the iodine
acceptors for protons in the bis - triazole ( 10cl )
leads to an almost complete loss of intensity in the cl k - edge xas
pre - edge feature , reflecting very poor charge donation through h - bonding
in this system .
data for the catenane 9cl ,
where both h- and x - bonds are present , indicate that charge donation
from the chloride anion decreases substantially ( as compared to 4cl ) .
this presumably reflects weakened halogen bonding
due to competition with amide h - bond interactions .
qualitatively
similar data were obtained for the bromide donor complexes 11br , 4br , 10br , and 9br ( see figure 7 ) .
unfortunately ,
lifetime broadening at the higher energy br k - edge , as well as smaller
energy separation between features , leads to poorer resolution of
the pre - edge features of interest .
the data indicate the presence
of a low - energy shoulder , indicating a pre - edge feature to that observed
in the cl k - edge data .
we note that the pre - edge shoulder is larger
for the x - bonded systems as compared to the h - bonded system ( 10br ) .
however , quantitative comparisons between the
different x - bonded systems are inconclusive due to large errors in
the associated fits ( see section s6 ) . to further explore the details of the covalent
nature of x - bonding in these systems , we performed a series of density
functional calculations , and tddft simulations of the xas data .
i in 4cl
are calculated to be 3.18(3 ) , which compare favorably with
that observed crystallographically ( 3.120(2)3.195(2 ) ) .
tddft simulations of the cl k- and br k - edge xas data reproduce the
low energy pre - edge feature assigned to the axx *
x1s transition in each case .
the relevant
axx * orbitals for 11cl and 4cl are shown in figure 8 . in
each case , these antibonding acceptor orbitals reflect the covalent
nature of the x i bond(s ) .
two relevant
acceptor orbitals are present in 4cl since two
x i interactions are possible ; the splitting
of these two orbitals in 4cl is small ( 0.3
ev ) , and thus the resulting transitions can not be resolved experimentally .
all calculated values are for fully optimized structures at the b3lyp / def2-tzvp+zora
level of theory .
visual representation
of the important axx * kohn sham acceptor orbitals
for 11 , 4 , and 9 .
tddft - based simulations of the
cl k- and br k - edge xas data are in good qualitative agreement with
the experimental data ( figure 9 ) .
as anticipated ,
the intensities of the axx * x1s pre - edge transitions correlate with the degree of
charge transfer from the halide to the acceptor .
the trends observed
in the tddft - calculated intensities of the transitions are in reasonable
agreement with those observed in the experimental data .
however , the
calculated pre - edge intensities ( and calculated xb charge donation )
are in good agreement with those obtained from the cl k - edge xas data .
trends observed in pre - edge transition energies are also reproduced
in the dft results . a small shift to higher energy ( 0.4 ev )
on going from a single xb acceptor ( 11cl ) to two
acceptors ( in 4cl ) is consistent with a similar
shift observed in the experimental data ( see table 4 ) .
this shift correlates with decreased electron density on
the chloride , which leads to stabilization of the cl1s donor orbital .
tddft simulated cl k - edge ( left ) and br
k - edge ( right ) xas spectra for selected xb adducts .
a constant linear
shift was applied to the calculated energies
to better match experimental k - edge energies .
the bromide adducts show similar trends as those observed
in the chlorides ; the tddft simulations are also in reasonable agreement
with the br k - edge experimental data .
the calculated degree of charge
donation is very similar between the two halides , suggesting that
the degree of covalent mixing is similar in both cases .
investigations
are currently underway to further evaluate the specific factors that
affect the covalency of these xb interactions and the resultant binding
affinities in the catenanes .
in
conclusion , the xb bis - iodotriazole - pyridinium motif is shown to be
a potent anion - coordinating motif in competitive aqueous media , especially
when incorporated into a catenane host structural framework .
the
acyclic xb receptor displays a marked enhancement in anion recognition
over the hb analogue and the first instance of acetate selectivity .
moreover , the xb catenane notably exhibits further augmentation
of anion recognition ability over its hb analogue , selectively binding
halides very strongly in competitive aqueous media with no binding
of oxoanions which is the reverse acetate selectivity trend of the
acyclic xb receptor .
this suggests the xb catenane s unique
interlocked host binding cavity is of complementary size and shape
for halides , whereas the oxoanions are too large and are of the wrong
geometry for encapsulation .
single crystal x - ray structural
analysis provided solid - state evidence for the association of anions
with the catenane host framework where halide anions are able to
penetrate the cavity of the catenane . by contrast oxoanions ( h2po4 and so4 ) are found outside the three - dimensional binding pocket in support
of the solution - state anion recognition binding observations .
cl and br k - edge xas revealed the presence of intense pre - edge features
characteristic of charge transfer between the halide donor and the
xb acceptor .
quantitative fitting of these pre - edge features provided
a direct measure of the degree of covalency in the halogen bonding
interaction , which is comparable to that observed in transition metal
complexes .
furthermore , we confirm that perpendicular xb interactions
are independent and additive , but that the degree of xb covalency
can be mitigated through the presence of hb donors .
these conclusions
are well supported and substantiated by tddft simulations of the xas
data , which indicate that the degree of covalency is essentially the
same for both cl and br donors .
most importantly , these results offer the first evidence of this
kind for covalency in halogen bonds of
anion receptors with halide anions .
furthermore , the presence of both
xb and hb donors in the catenane host framework provides interesting
insight into the interplay between these two competing interactions
in a single anion receptor system .
Output:
| the synthesis and anion binding properties
of novel halogen - bonding ( xb ) bis - iodotriazole - pyridinium - containing
acyclic and [ 2]catenane anion host systems are described .
the xb acyclic
receptor displays selectivity for acetate over halides with enhanced
anion recognition properties compared to the analogous hydrogen - bonding
( hb ) acyclic receptor .
a reversal in halide selectivity is observed
in the xb [ 2]catenane , in comparison to the acyclic xb receptor , due
to the interlocked host s unique three - dimensional binding
cavity , and no binding is observed for oxoanions .
notable halide anion
association constant values determined for the [ 2]catenane in competitive
organic aqueous solvent mixtures demonstrate considerable enhancement
of anion recognition as compared to the hb catenane analogue .
x - ray
crystallographic analysis of a series of halide catenane complexes
reveal strong xb interactions in the solid state .
these interactions
were studied using cl and br k - edge x - ray absorption spectroscopy
( xas ) indicating intense pre - edge features characteristic of charge
transfer from the halide to its bonding partner ( axx * x1s ) , and providing a direct measure
of the degree of covalency in the halogen bond(s ) .
the data reveal
that the degree of covalency is similar to that which is observed
in transition metal coordinate covalent bonds .
these results are supported
by dft results , which correlate well with the experimental data . |
PubmedSumm7824 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: adequate treatment planning is one of the most important factors in successful conventional implant prosthesis , requiring clear communication between the prosthetic dentist and surgeon .
it becomes more critical when the patient has unfavorable conditions such as a severely resorbed alveolar ridge .
treatment planning must be based on a thorough dental diagnosis and a prognosis assessment for the remaining dentition .
improper planning may result in a range of prosthetic complications and a poor prognosis due to unfavorable mechanical stress and poor oral hygiene .
partial edentulism can be restored with implants by several methods.1 in considering implant placement , the numbers and position of implants should always contribute to the convenience and longevity of a definitive prosthesis fulfilling esthetic and functional demands .
implants in partial edentulous patients involve either fixed type implant prosthesis or removable type implant prosthesis .
there are several reports that removable partial dentures with posteriorly - placed implants showed a favorable outcome and counted as an adequate treatment option.2,3 this clinical report concerns the rescuing procedure for inadequately planned prosthodontic case for a partially edentulous patient with severely resorbed alveolar ridge .
predetermined impractical fixed type prosthesis to restore posterior teeth was properly re - evaluated and restored with a removable partial denture with milled bars and magnetic attachments .
a 26-year - old male patient presented to the department of prosthodontics at yonsei university dental hospital to restore the posterior edentulous area .
radiographic examination showed that implants were placed in the area of teeth number # 17 , 16 , 22 , 25 and 27 and clinical examination revealed 3 degree of hypermobility on teeth number # 15 and # 24 ( fig .
1 ) . teeth # 15 and 24 were diagnosed as hopeless and were extracted .
impressions were made with alginate and casts were poured and mounted in centric relation for prosthodontic evaluation .
a provisional denture was fabricated on the articulator and placed in the patient 's mouth .
an impression was made with implant level impression coping and casts were mounted for prosthetic treatment planning .
it was determined that implant supported fixed partial denture was not indicated due to severe bone resorption resulting in a poor crown - to - root ratio and buccal placement of implants .
so , the treatment option of removable partial denture was presented to the patient which involved fabrication of a milled bar with a magnetic attachment . a customized abutment and
a crown for tooth number # 22 were fabricated on the articulator and delivered to the patient .
the milled bar was fabricated accounting available interocclusal space , as measured from the vinyl index on mounted casts of provisional denture .
a two - degree tapered milled bar wax pattern was fabricated on the master cast and magnet keepers were embedded in the pattern , which was then invested and casted ( figs
the fit of the milled bar and framework were checked in patient 's mouth , and the fit between them was adjusted with a tungsten carbide bur ( bredent medical , senden , germany ) , and the maxillomandibular relationship was recorded for denture fabrication using an occlusal rim .
the prosthesis was remounted on the articulator after polymerization and the occlusion was adjusted on the articulator .
the prosthesis was inserted ; phonetics , esthetics , function , and comfort were clinically verified .
the magnet was embedded in the denture with gc pattern resin at 2 weeks after initial placement of the final prosthesis .
postoperative instructions were given to the patient , and no complications have arisen since insertion of the prosthesis five years ago .
as number of implants and their position depend on prosthesis type , making presurgical prosthetic treatment planning critical for the success of the prosthesis . in our case , implant surgery had been performed without proper evaluation of remaining teeth or adequate prosthodontic treatment planning . as a result , two hopeless teeth had to be extracted at six months after initial implant surgery . because of additional extraction followed implant surgery , supplementary implants were necessary for the fixed - type prosthesis especially due to poor crown to root ratio . however , the patient rejected additional implants placement but accepted a removable prosthesis to reduce treatment time and cost .
removable prosthesis is more advantageous as restore prosthesis with a poor crown - to - root ratio caused by severe resorption of the alveolar ridge .
though guidelines for the crown - to - root ratio in natural teeth are not applicable to implants4 , the ratio is still a prognostic indicator . when treating partial edentulism with implants , an implant - supported , fixed - type prosthesis is usually the first option .
it is reported that implant supported removable partial denture is suitable and has advantages to restore kennedy class i posterior edentulous patients.5 those advantages include enhancing retentive or supportive elements of removable partial dentures.6 - 7 strategically - placed dental implants in conjunction with the remaining natural teeth can also establish a favorable removable partial denture design by significantly reducing the effect of the reciprocal arm and improving the fulcrum line position.7 in this case two milled bars with magnet attachments connected to upper posterior implants were used to provide enhanced support for the denture .
this report illustrates how improper planning may prolong treatment and give rise to complicated treatment procedure with poor prognosis .
countermeasures in this case consisted of correcting to an implant supported removable partial denture in conjunction with careful evaluation of the oral condition during treatment .
dental treatment should be based on an adequate treatment plan , and procedures must be guided by proper planning achieved by cooperation between implant surgeon and restorative dentist .
implant - supported removable - type prosthesis with milled bar and attachment is a viable and useful treatment option in patients with improperly placed implants .
Output:
| presurgical prosthetic treatment planning is critical for the success of the implant prosthesis .
inadequate treatment plan , due to insufficient discussion between prosthodontist , and surgeon , may result in poor prognosis .
a 26-year - old male patient was referred for prosthodontic treatment after implant was placed in the area of teeth # 17 , 16 , 22 , 25 and 27 , without adequate discussion nor the treatment planning between oral surgeon and prosthodontist .
it was found that the patient had two hopeless teeth , and a severely resorbed alveolar ridge .
additional tooth extraction was needed and the type of definitive prosthesis was shifted from fixed type to removable one .
proper pre - surgical treatment planning is essential for the good prognosis .
implant - supported removable prosthesis on milled bars may be a useful treatment option in patients with incorrect angled placement on severely resorbed alveolar ridge . |
PubmedSumm7825 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in the last few years , macular diseases have been studied better , thanks to the widespread use of instruments that can simultaneously combine spectral domain optical coherence tomography ( sd - oct ) and fluorescein angiography ( fa ) .
the spectralis system ( heidelberg engineering , heidelberg , germany ) uses a solid - state laser diode to produce light at multiple wavelengths such as 830 nm near - infrared ( nir ) and 488 nm blue autofluorescence ( af ) .
digital retinal imaging can be obtained by direct reflectance or by emitted autofluorescence through different barrier filters .
the active eye tracking and confocal imaging system in the platform permits focused , clearly defined , high - contrast fa and tomography with 40,000 a - scans per second , resulting in higher resolution .
multimodal approach is now widely employed in highly specialized centers , especially to examine the retina when difficulties arise in diagnosis or for study purposes.1 among macular pathologies , pathologic myopia ( pm ) is one of the main causes of vision loss in developed countries,2 with a prevalence of 0.9%3.1% , and it has been recently reported that 5.2%11.3% of myopic individuals develop myopic choroidal neovascularization ( mcnv).3 it is therefore extremely important to diagnose the condition as early as possible , considering , too , that these lesions respond very well to anti - vegf therapy.4 the details of mcnv have been studied from the tomographic viewpoint , but little has been done using af5,6 and nothing at all with nir . moreover ,
the sensitivity of each of these methods is still debated , with reports of cases for fa varying from 60%7 up to 84.5%.8 the main aim of this study was to investigate and correlate the tomographic and angiographic findings in mcnv , and their nir and af features , in a retrospective series of patients .
a secondary aim was to evaluate the specific contribution of each modality to the diagnosis .
in this retrospective consecutive study , two authors ( pm and am ) , senior retina specialists , reviewed the charts and images of patients seen in our hospital ( istituto auxologico italiano ) between 2010 and 2014 .
the authors advise that in italy there is no need for ethical approval for retrospective study using imaging data or charts . in accordance with italian law
every patient signs a personal consent to allow the health institution they enter to manage their private medical information , and this type of consent was obtained by every patient included in the present study .
the inclusion criteria were as follows : recent ( 30 days ) vision deterioration with metamorphopsia and/or scotoma at the amsler grid test , pm , refractive error 6 diopters , staphyloma at sd - oct , documentation or suspicion ( based on the clinical history ) of mcnv , or macular exudative pathologies on fa and sd - oct .
exclusion criteria were previous vitreoretinal surgery , diabetes or signs of age - related macular degeneration ( amd ) , such as drusen , or typical geographic atrophy . similarly , we excluded patients with images of unsatisfactory quality or presenting with vitreoretinal interface - related pathologies such as macular hole , epiretinal membrane ( erm ) , or retinal detachment without mcnv .
the two investigators ( pm and am ) considered only good - quality images , at first presentation , and stored them in the data base of the spectralis multimodal imaging system which combines confocal scanning laser angiography , simultaneous sd - oct , and multiple imaging using a solid - state laser diode that can produce excitation light at different wavelengths : nir ( excitation =830 nm ) , af and fa after intravenous injection of 5 ml of fluorescein ( excitation =488 nm , emission 500 nm ) . to increase the signal - to - noise ratio , the device is equipped with an eye tracker that averages multiple frames . only eyes for which the following images were evaluable were recruited :
nir and af imaging of the macular area with the 30 module lens setfa documentation of initial ( 045 seconds ) , middle ( 12 minutes ) , and late ( at least 3 minutes ) phases of the macular area after intravenous injection of 2.5 ml of fluoresceinmultiple horizontal tomographic linear scans , with the scanner positioned on the center of the macula in the volume mode and , additionally , in the center of the suspected lesion in the single linear mode , horizontal and vertical .
the software has an automatic real - time ( art ) function to reduce noise and improve image quality . with art activated ,
multiple nine or 100 b - scan frames of the same scanning location were taken when using the volume or the single linear acquisition module , respectively .
nir and af imaging of the macular area with the 30 module lens set fa documentation of initial ( 045 seconds ) , middle ( 12 minutes ) , and late ( at least 3 minutes ) phases of the macular area after intravenous injection of 2.5 ml of fluorescein multiple horizontal tomographic linear scans , with the scanner positioned on the center of the macula in the volume mode and , additionally , in the center of the suspected lesion in the single linear mode , horizontal and vertical .
( art ) function to reduce noise and improve image quality . with art activated ,
multiple nine or 100 b - scan frames of the same scanning location were taken when using the volume or the single linear acquisition module , respectively .
the presence of mcnv was confirmed on the basis of the following features of the suspected lesion : initial dye uptake with hyperfluorescence and possibly late leakage on fa and the presence of a hyper - reflective lesion at sd - oct .
the fa patterns of mcnv of each patient were rated as follows : hyperfluorescence
( when there was only mild hyperfluorescence , possibly clearly circumscribed , without any leakage ) or mild leakage / leakage ( if there were typical signs of neovascular activity , ie , initial fluorescein uptake by the mcnv network and extension of dye beyond the boundaries delineated in the early fluorescein transit ) . leakage was recorded as indistinguishable if the lesion could not be outlined clearly in the surrounding tissue .
the assessable neovascular complex inside the lesion in every volume and linear scan was also studied .
the two investigators ( pm and am ) had to establish the presence or absence of the following conditions :
intraretinal edema ( possibly with cystoid macular edema , intraretinal small and isolated cysts , and serous neuroretinal detachment)retinal thickening anterior to the mcnverm in correspondence ( anterior and/or immediately adjacent ) or not in correspondence with the lesion ( ie , in other areas of the macular region)vitreomacular adhesion ( defined as focal adhesion and/or traction of the posterior vitreous face within the macular region , as a sign of incomplete posterior vitreous detachment)hyper - reflective foci ( hf ) .
intraretinal edema ( possibly with cystoid macular edema , intraretinal small and isolated cysts , and serous neuroretinal detachment ) retinal thickening anterior to the mcnv erm in correspondence ( anterior and/or immediately adjacent ) or not in correspondence with the lesion ( ie , in other areas of the macular region ) vitreomacular adhesion ( defined as focal adhesion and/or traction of the posterior vitreous face within the macular region , as a sign of incomplete posterior vitreous detachment ) hyper - reflective foci ( hf ) .
the mcnv area was measured manually using the spectralis software ( heidelberg eye explorer , version 1.9.10.0 ; heidelberg engineering , heidelberg , germany ) , which circumscribes the lesion and calculates the area in square mm .
the boundaries were identified in the early phase of fa , and then overlaid with the mouse .
the mcnv was considered foveal - juxtafoveal if positioned 1199 m from the foveal depression , identified in the sd - oct scan , or extrafoveal if positioned 200 m or more from the center .
focal or diffuse peripapillary areas of chorioretinal atrophy , contiguity of the lesion to an atrophic area ( macular or papillary ) , and hemorrhage were noted .
a shadowing effect toward the choroid was considered when sd - oct showed the typical cone of shadow , easily recognized when tomographic details on the outer part of the lesion are less evident than those around it due to the high reflectivity of the lesion . in our opinion ,
the nir appearance of the mcnv is not easy to describe because of the typical tessellated appearance of the macular region in pm and frequent association with chorioretinal atrophy .
the lesion was defined as pale / white if it appeared mainly lighter than the adjacent retinal tissue , and grayish or even black if it was mostly darker .
similarly , when possible , we assessed the hyper- or hypoautofluorescence , checking for any rings , and rated the lesion indeterminable if undistinguishable .
figure 1 shows an example of the characteristics investigated . to establish the specific contribution of each of the four methods nir , af , fa , and sd - oct to the diagnosis , the two investigators ( pm and am ) showed the images of the selected patients to two other retina experts ( sm and ms ) on the monitor , who were then asked to what extent it was possible to identify mcnv on the basis of each of the single examinations , rating the diagnosis as positive , negative , or doubtful .
we performed a descriptive analysis of the characteristics through the estimates of either the mean value or the percentage of occurrence of a specific nominal value and their 95% confidence interval ( ci ) .
we used correlation analysis to first investigate the spearman s pairwise correlations among the characteristics and then between the characteristics and the diagnosis with the four methods ( fa , sd - oct , nir , and af ) .
the value of p may range between 1 , indicating a perfect correlation , and 1 , indicating a perfect inverse ( negative ) correlation .
then , we performed a multivariate canonical correlation and a factorial analysis in order to highlight possible relationships among the characteristics .
we used wilcoxon test to compare the average behavior of every variable ( eg , presence / absence of hf ) between the two subgroups ( eg , presence / absence of hemorrhage ) .
the proportion of agreement for pairs was assessed using the cohen s kappa ( ) statistic and the overall agreement using the m statistic ( k<0 [ poor agreement ] ; k=00.20 [ slight agreement ] , 0.210.40 [ fair ] , 0.410.60 [ moderate ] , 0.610.8 [ substantial ] ; and k>0.81 [ almost perfect agreement ] ) .
all analyses were done with sas software version 9.2 ( sas institute inc . , cary , nc , usa ) .
we performed a descriptive analysis of the characteristics through the estimates of either the mean value or the percentage of occurrence of a specific nominal value and their 95% confidence interval ( ci ) .
we used correlation analysis to first investigate the spearman s pairwise correlations among the characteristics and then between the characteristics and the diagnosis with the four methods ( fa , sd - oct , nir , and af ) .
the value of p may range between 1 , indicating a perfect correlation , and 1 , indicating a perfect inverse ( negative ) correlation .
then , we performed a multivariate canonical correlation and a factorial analysis in order to highlight possible relationships among the characteristics .
we used wilcoxon test to compare the average behavior of every variable ( eg , presence / absence of hf ) between the two subgroups ( eg , presence / absence of hemorrhage ) .
the proportion of agreement for pairs was assessed using the cohen s kappa ( ) statistic and the overall agreement using the m statistic ( k<0 [ poor agreement ] ; k=00.20 [ slight agreement ] , 0.210.40 [ fair ] , 0.410.60 [ moderate ] , 0.610.8 [ substantial ] ; and k>0.81 [ almost perfect agreement ] ) .
all analyses were done with sas software version 9.2 ( sas institute inc . , cary , nc , usa ) .
sixty - five eyes of 62 patients ( 44 females and 21 males ) , all caucasians , met the criteria for inclusion in the study .
mean age was 66.72 years ( 95% ci 6370 ) , range 18 to 89 .
mean refraction was 9.72 diopters , range 6 to 22 ( 95% ci 8.74 to 10.70 ) .
most of the mcnv cases were foveal - juxtafoveal ( 60/65 , 92.3% ) ; small ( mean area 1.51 mm ) ; and presented with hemorrhage ( 40/65 , 61.6% ) , thickening of the corresponding retina ( 62/65 , 95.3% ) at oct , and leakage ( 44/65 , 67.6% ) on fa . in 32 eyes ( 49.2% ) , no retinal fluid of any type was detectable .
papillary chorioretinal atrophy was evident in 58 ( 89.2% ) and erm in 38 ( 58.4 ) eyes .
neovascularization developed on the edge of a chorioretinal atrophic lesion ( macular or papillary ) in 18/65 eyes ( 27.6% ) and in one eye presented with two distinct but contiguous areas of leakage .
the appearance on nir and af varied widely and was indeterminable in 19 ( 29.2% ) and 27 cases ( 41.5% ) , respectively .
it was predominantly black or grayish on nir ( 34/65 , 52.3% ) and hypo - hyperautofluorescent on af ( patchy , 25/65 , 38.4% ) .
the lesion was surrounded by a ring either on nir or on af in 37 cases ( 28.4% ) ( table 2 ) . in eyes with edema or hemorrhage ,
the prevalence of hf was more frequent than in eyes without ( 64.2% vs 25.4% , p<0.05 and 72.0% vs 32.5% , p<0.05 ) .
if macular chorioretinal atrophy was present , hemorrhages were much less frequent ( p<0.05 ) ; mcnv often developed adjacent to it or to an area of peripapillary atrophy ( =0.6 , p<0.0001 ) and was more frequently hyperfluorescent on fa rather than with leakage ( p<0.0001 ) .
doubtful diagnosis on fa was significantly related to a higher percentage of eyes with macular choroidal atrophy ( p<0.001 ) , with mcnv close to choroidal atrophy ( p<0.001 ) and with hyperfluorescent mcnv ( p<0.001 ) . in the group with doubtful diagnosis at sd - oct
, there was a higher percentage of eyes without any kind of retinal fluid ( p<0.05 ) and a smaller percentage of eyes with hf ( p<0.05 ) , hemorrhage ( p<0.05 ) , erm ( p<0.05 ) , and leakage ( p<0.01 ) .
we also observed a higher percentage of lesions close to the region of choroidal atrophy ( p<0.01 ) .
diagnostic difficulties of sd - oct and fa were associated ( =0.47 , p<0.0001 ) as were positive cases diagnosed by nir and af ( =0.77 , p<0.0001 ) , which also resulted in discrete correlation with the presence of hemorrhage , hf , and larger mcnv ( r>0.4 , p>0.4 ) .
in fact , af and nir were of some diagnostic utility ( [0.4 , 0.53 ] p<0.0001 ) only in eyes with hemorrhage , cystoid macular edema , or edema .
fa and sd - oct offered similar diagnostic sensitivity ( k=0.5 ) , as mcnv was properly detected in 49 ( 75.3% ) and 48 ( 73.8% ) eyes , respectively , on the basis of single modality ( table 4 ) .
there was no significant difference in the dimension of the lesion with respect to age and refraction .
leakage on fa was more prominent in patients younger than 66 years ( p<0.05 ) and did not differ statistically between the eyes with or without edema ( p=0.35 ) .
hyperfluorescence on fa , erm , and the shadowing effect seemed to be more frequent in older patients ( p<0.05 ) .
numerous papers have been published on the multimodal description of retinal lesions , but not on mcnv , especially in caucasians .
the present study , though only covering a fairly small series of patients , shows up many important features of mcnv , some known and others unknown , such as the frequent presence of erm ( 38/65 , 58.4% ) , especially in larger lesions and in older patients . in 6/65 ( 9.2% ) cases ,
erm was present only at the site of mcnv , in 19 ( 29.2% ) it involved the entire macular area , and in 13 ( 19.9% ) it was outside the mcnv area .
similar to the nonmyopic population , the findings in myopic eyes also vary widely : from 23% in chinese9 to 11%40% in caucasians.10,11 the relationship between erm and cnv has not been widely investigated , but many authors found lower rates of posterior vitreous detachment in eyes with exudative amd than in eyes with dry amd or no disease.1214 since statistically relevant association was also observed between cnv and vma ( located just anterior to the cnv area ) in 19%28% of patients with exudative amd,15,16 it has been suggested that persistent attachment of the posterior vitreous cortex to the macula may be a risk factor for the development of cnv .
the early vitreous fluidification and detachment , which typically occur prematurely in high myopia,17 and the relative older mean age of patients may also explain the larger proportion of erm in our study .
another interesting finding is the occurrence of very high frequency of peripapillary chorioretinal atrophy ( 89.2% ) , slightly more prevalent than reported in myopic patients without mcnv ( 81.2%).18 this finding is very common in pm and was recently reported to be negatively related to visual acuity improvement after intravitreal injection19 and to be the only relevant factor associated with the need for retreatment.20 peripapillary atrophy may be secondary to the degree of choroidal ischemia in pm , as choroidal circulatory disturbances may contribute to crescent development and enlargement over the years21 and to mcnv onset .
as was found in other studies , macular chorioretinal atrophy in our series was also less prevalent than papillary atrophy , and this was probably because of differences in circulation .
overall , it is not surprising that 47/65 mcnvs developed on the edge of an area of chorioretinal atrophy , macular or papillary , presumably in response to an ischemic cause .
increased thinning of the retina in the border of areas of chorioretinal atrophy may account for higher prevalence of hyperfluorescence than leakage on fa and to fewer hemorrhages ( p<0.05 ) .
we have no explanations for the low prevalence of serous neuroretinal fluid at sd - oct ( 27% compared to 60% in cnv secondary to amd22 ) , although we can speculate that it might be secondary to the lower activity of mcnv .
the hf observed in the neovascular complex have also been found to be commonly associated with cnv in amd , with retinal vein occlusion and diabetic macular edema .
hf are thought to be migrating retinal pigment epithelium ( rpe ) cells or leucocytes , or very initial intraretinal lipoprotein exudates , and therefore their presence is a sign of lesion activity.23,24 in our study , hf appeared to be clearly related to the presence of retinal edema , serous neuroretinal detachment , and hemorrhage ( p<0.05 , table 3 ) , thus confirming the association with exudative retinal changes .
the shadowing effect toward the choroid is intuitively due to the hyper - reflectivity of the thickened retina mcnv complex , and its results
the nir features of macular neovascular lesions and af characteristics of mcnv have been investigated but not as thoroughly.5,6,2527 using nir and af imaging , we were unable to define the mcnv features in 29.2% and 41.5% of cases , respectively
differences in the patterns may be caused by the typical rpe thinning and/or by the rpe cells
nir mainly correlates with melanin inside the rpe27 and , similar to the findings reported in a small sample with amd,26 nearly half of the lesions ( 49.2% ) presented a gray or black appearance , surrounded by a whitish or black - grayish ring in 13 and seven cases , respectively .
the presence of a reactive , hyperautofluorescent ring is partially confirmed by af imaging , where the main finding , unlike to a recent report by parodi et al,28 was a hypo - hyperautofluorescent ( patchy ) rather than a hyperautofluorescent lesion .
autofluorescence is related to the presence of lipofuscin in the rpe , and is probably due to the displacement of macular pigments and subsequent increased exposure of lipofuscin . in 15/65 ( 23% ) eyes ,
previously , it has been considered secondary to fibrin accumulation,26 but we believe that a sort of rpe reactive hyperplasia develops secondary to mcnv formation , as confirmed by some studies.29,30 the type of nir reflectance or af by the ring or even by the lesion itself may be indicative of the different stages of rpe hyperplasia or the portion and shape of the neovascular membrane complex . angiographic visualization of the mcnv has improved greatly since the scanning laser system came into clinical practice . despite avila s findings in 1984,31 it is now clear that most of the lesions commonly present with at least mild leakage .
this was seen in 76% of the eyes in our series , especially in patients younger than 66 years , whereas in the others we detected only some hyperfluorescence and no leakage , making diagnosis impossible on the basis of fa alone in eleven of these cases .
in contrast with previous findings7 and with nir and af , fa and sd - oct , when used separately , offered overall similar , discrete good diagnostic sensitivity , although 16 ( 24.6% ) and 17 ( 26.1% ) patients , respectively , would not have been diagnosed correctly and consequently not properly treated . in all these cases
, it was direct comparison of the two imaging modalities that permitted a correct diagnosis .
the presence of macular chorioretinal atrophy in 12/16 and 11/17 cases was significantly related to a doubtful evaluation either on fa or on sd - oct . intuitively , the absence of any kind of retinal fluid , hemorrhage , and hf also resulted in diagnostic difficulties on sd - oct ( p<0.05 ) .
this study has some limitations , such as the small number of patients and the lack of masked evaluation of the images by several examiners .
interpretation of the nir and af images was problematic , highly variable , and subjective .
we must also consider that it may take several weeks for some older patients to become aware of their visual loss .
another limitation is that the tomographic evaluation may be influenced by the number of sections in the macular volume module .
however , this is only the first paper to describe multimodal imaging features in mcnv .
this study reported a description and correlation of the mcnv characteristics on fa , sd - oct , nir , and af . the angiographic and tomographic diagnostic sensitivity appear to be similar , but the combination of both modalities is recommendable to achieve the diagnosis in all the cases .
Output:
| purposeto investigate myopic choroidal neovascularization ( mcnv ) by fluorescein angiography ( fa ) , spectral - domain optical coherence tomography ( sd - oct ) , near - infrared ( nir ) reflectance , and autofluorescence ( af).methodsthis retrospective study included 65 eyes of 62 caucasian patients with a mean age of 66.72 years ( 95% confidence interval [ ci ] 6370 years ) and a mean refraction of 9.72 diopters ( 95% ci 8.74 to 10.70 diopters).resultsmost of the mcnv cases were foveal - juxtafoveal ( 60/65 , 92.3% ) , with thickening of the corresponding retina ( 62/65 , 95.3% ) and leakage on fa ( 44/65 , 67.6% ) .
no retinal fluid was detectable in 32 ( 49.2% ) eyes and there was no hemorrhage in 25 ( 38.4% ) eyes .
papillary chorioretinal atrophy was evident in 58 ( 89.2% ) , a shadowing effect in 48 ( 73.8% ) , and an epiretinal membrane in 38 ( 58.4% ) eyes .
if an area of macular chorioretinal atrophy was present , mcnv frequently developed adjacent to it and was hyperfluorescent rather than with leakage ( p0.001 ) . in eyes with edema or hemorrhage , hyper - reflective foci were more frequent ( p0.005 ) .
nir and af features were indeterminable in 19 ( 29.2% ) and 27 ( 41.5% ) eyes , respectively .
the predominant feature was black or grayish on nir ( 34/65 , 52.3% ) and patchy ( hypo- and hyperfluorescence was observed ) on af ( 25/65 , 38.4% ) .
fa and sd - oct correctly detected mcnv in 49 ( 75.3% ) and 48 ( 73.8% ) eyes , respectively , whereas nir and af exhibited limited diagnostic sensitivity .
doubtful diagnosis was associated with hyperfluorescent mcnv ( p0.001 ) , absence of retinal fluid and epiretinal membrane ( p0.05 ) , and presence of macular chorioretinal atrophy ( p0.01).conclusiontomographic , angiographic , af , and nir features of mcnv are described in this study .
combination of sd - oct and fa is recommendable for diagnosis . |
PubmedSumm7826 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| bovine spongiform encephalopathy ( bse ) could be an autoimmune disease produced following exposure of cattle to feedstuffs containing bacteria showing molecular mimicry between bacterial components and bovine tissue .
analysis of molecular sequence databases ( genbank and swissprot ) shows that three bacteria ( acinetobacter calcoaceticus , ruminococcus albus , and agrobacter tumefaciens ) share sequences with the encephalitogenic peptide of bovine myelin , while three molecules in escherichia coli show molecular mimicry with host - encoded prion protein .
immune responses against these bacteria at both t and b cell levels may cause neurological tissue injury resembling bse .
the role of these bacteria in bse , if any , merits further investigation.imagesfigure 1.figure 2 . |
PubmedSumm7827 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the menisci are critical components of a healthy knee joint and play a crucial role in load bearing , load transmission , shock absorption , as well as lubrication and nutrition of articular cartilage.12345 ahmed et al .
showed that menisci can transmit 50% to 70% tibiofemoral compressive load in extension knee and up to 85% to 90 in flexed knee.6 meniscal injury is the most common knee injury , the overall rate being 0.7 per 1000 people per year.7 the national center of health statistics8 reported more than 450,000 arthroscopic meniscectomies performed each year in united states .
complete or partial loss of a meniscus can decrease tibiofemoral contact area , increase contact stress on the articular cartilage and reduce its shock - absorbing capabilities , leading to serious long term sequelae.910 the clinical and biomechanical data on relationship between pcl injuries and menisci are scanty.111213 pearsall et al . showed that meniscal strain increased with complete pcl injury and returned to normal after pcl reconstruction.14 little
is known about the biomechanical disorder in partial pcl transection cases and its impact on different parts of meniscal strain under various loading conditions . based on this background
, we hypothesized that the resultant force on medial meniscus was significantly elevated in incomplete pcl transection .
we employed a biomechanical testing system to measure the strain on the different parts of medial meniscus ( anterior , posterior horn and body of meniscus ) with intact pcl ( pcl - i ) , anterolateral bundle transection ( alb - t ) , posteromedial bundle transection ( pmb - t ) and pcl complete transection ( pcl - t ) under different axial compressive tibial loads ( 200 - 800 n ) at 0 , 30 , 60 and 90 of knee flexion , respectively .
twelve fresh frozen male cadaveric knee specimens ( six left and six right specimens ) were used in this study , with an average age of 32.7 years ( range 26 - 39 years ) .
all the specimens underwent macroscopic inspection and the posterior drawer test to rule out gross anomalies like degenerative changes , fracture , tumor and pcl damage . prior to experiments ,
the femur and tibia were cut to approximately 30 cm from the joint line ; the proximal portion of fibula was retained and secured to tibia at its anatomic position using a cortical screw .
each specimen was dissected to the joint capsule withcare taken to maintain the meniscocapsular attachments to tibia .
twelve specimens were fixed in cylindrical clamps of universal testing machine ( css-88100 , chang chun , china ) which was capable of applying a specific load or positioning the knee at a predetermined flexion angle with the femur on lower and tibia on the upper fixture [ figure 1a ] . the strain transducer gauge ( bx120 - 1aa , hy corp . , zhejiang , china )
was used that converts tissue strain into voltage change that could be recorded by a computer equipped with an analog - to - digital converter.151617 in our experiment , 5 5 mm tissue in the anterior horn , body and posterior horn of medial meniscus were exposed and burnished with abrasive paper , followed by degreasing . when dried , a strain gauge was fixed vertically with -cyanoacrylate in a direction consistent with the load [ figure 1b ] .
the joint capsule was closed and strain foil inside was connected to the output of static strain indicator ( dh-3818 , dh corp . ,
photographs showing ( a ) biomechanical test instrumentation setup and ( b ) transducer strain gauges fixed in different parts of medial meniscus the specimens were divided into four groups : pcl - i as control , alb - t , pmb - t and pcl - t groups .
stage ii : 12 specimens were randomly divided in alb - t and pmb - t groups .
state iii : 12 specimens with pcl - t . in each stage , the specimens were positioned at 0 , 30 , 60 and 90 of knee flexion in sequence . at the beginning , we loaded the specimens 20 times at 200 n with a speed of 0.5 mm / s to eliminate the influence of innate viscosity .
after that , the static strain measuring device was calibrated in balance and then continuous axial load ( 0 - 800 n ) was loaded at a speed of 0.5 mm / s .
data at 200 , 400 , 600 and 800 n from every channel of the device were documented ( e , microstrain ) . the same procedure was repeated when it came to 30 , 60 and 90 of flexion , with an interval of 10 min to allow restoration of elasticity .
finishing the aforementioned tests , we separated the 12 specimens randomly and equally into alb - t and pmb - t groups , followed by same test as mentioned earlier .
next , the pcl of all 12 specimens was severed completely , modeling complete pcl transection . then , the same biochemical test was performed on the newly treated specimens again . during the whole test ,
the specimens were kept at a humidity of 60 - 80% and a temperature of 25c .
data analysis was performed with spss version 17.0 ( chicago , il , usa ) .
data were expressed as mean sd . differences were considered statistically significant when p < 0.05 . a one - way analysis of variance ( anova ) was performed to determine whether there were statistically significant differences among the experimental groups . when the populations from which the samples were normally or approximate normal distribution and the variances of the populations were equal , the student 's t - test was employed to compare the means of two independent groups .
while the variances of the strain value in anterior horn and body of meniscus under loads of 200 and 400 n at 0 of flexion were not equal among the groups , comparisons between groups were made using mann
twelve fresh frozen male cadaveric knee specimens ( six left and six right specimens ) were used in this study , with an average age of 32.7 years ( range 26 - 39 years ) .
all the specimens underwent macroscopic inspection and the posterior drawer test to rule out gross anomalies like degenerative changes , fracture , tumor and pcl damage . prior to experiments ,
the femur and tibia were cut to approximately 30 cm from the joint line ; the proximal portion of fibula was retained and secured to tibia at its anatomic position using a cortical screw .
each specimen was dissected to the joint capsule withcare taken to maintain the meniscocapsular attachments to tibia .
twelve specimens were fixed in cylindrical clamps of universal testing machine ( css-88100 , chang chun , china ) which was capable of applying a specific load or positioning the knee at a predetermined flexion angle with the femur on lower and tibia on the upper fixture [ figure 1a ] . the strain transducer gauge ( bx120 - 1aa , hy corp . , zhejiang , china )
was used that converts tissue strain into voltage change that could be recorded by a computer equipped with an analog - to - digital converter.151617 in our experiment , 5 5 mm tissue in the anterior horn , body and posterior horn of medial meniscus were exposed and burnished with abrasive paper , followed by degreasing . when dried , a strain gauge was fixed vertically with -cyanoacrylate in a direction consistent with the load [ figure 1b ] .
the joint capsule was closed and strain foil inside was connected to the output of static strain indicator ( dh-3818 , dh corp . ,
photographs showing ( a ) biomechanical test instrumentation setup and ( b ) transducer strain gauges fixed in different parts of medial meniscus
the specimens were divided into four groups : pcl - i as control , alb - t , pmb - t and pcl - t groups .
stage ii : 12 specimens were randomly divided in alb - t and pmb - t groups .
state iii : 12 specimens with pcl - t . in each stage , the specimens were positioned at 0 , 30 , 60 and 90 of knee flexion in sequence . at the beginning , we loaded the specimens 20 times at 200 n with a speed of 0.5 mm / s to eliminate the influence of innate viscosity .
after that , the static strain measuring device was calibrated in balance and then continuous axial load ( 0 - 800 n ) was loaded at a speed of 0.5 mm / s .
data at 200 , 400 , 600 and 800 n from every channel of the device were documented ( e , microstrain ) . the same procedure was repeated when it came to 30 , 60 and 90 of flexion , with an interval of 10 min to allow restoration of elasticity .
finishing the aforementioned tests , we separated the 12 specimens randomly and equally into alb - t and pmb - t groups , followed by same test as mentioned earlier .
next , the pcl of all 12 specimens was severed completely , modeling complete pcl transection .
then , the same biochemical test was performed on the newly treated specimens again . during the whole test ,
the specimens were kept at a humidity of 60 - 80% and a temperature of 25c .
data analysis was performed with spss version 17.0 ( chicago , il , usa ) .
data were expressed as mean sd . differences were considered statistically significant when p < 0.05 . a one - way analysis of variance ( anova ) was performed to determine whether there were statistically significant differences among the experimental groups .
when the populations from which the samples were normally or approximate normal distribution and the variances of the populations were equal , the student 's t - test was employed to compare the means of two independent groups .
while the variances of the strain value in anterior horn and body of meniscus under loads of 200 and 400 n at 0 of flexion were not equal among the groups , comparisons between groups were made using mann
at 0 flexion , the strain value in whole medial meniscus was negative in response to axial load , indicating that the strain in this position was a compressive strain [ figure 2 ] . under 200 n load , the strain on whole medial meniscus in alb - t , pmb - t and pcl - t groups were not statistically different from those in the pcl - i group ( p > 0.05 ) . under 400 and 600 n loads , the strain on whole medial meniscus in alb - t group was not statistically different from those in the pcl - i group ( p > 0.05 )
however , the strain on whole medial meniscus in the pmb - t and pcl - t groups were markedly greater than those in the pcl intact group ( p < 0.05 ) . under 800 n load , the alb - t
, pmb - t and pcl - t groups had significantly increased strain values ( p < 0.05 ) in comparison to the pcl - i group . a bar diagram showing strain value on medial meniscus at 0 of flexion ( , microstrain ; * p<0.05 compared to pcl - i ) at 30 of flexion
, compression strain was found in body of meniscus in all groups , in anterior horn of meniscus in alb - t and pcl - t groups and in posterior horn of meniscus in pcl - i and pmb - t groups .
the strain value in anterior horn of meniscus in pcl - i and pmb - t groups and in posterior horn of meniscus in alb - t and pcl - t groups was positive in response to axial load , indicating that the strain was a tension strain .
alb - t and pcl - t groups had higher strain than pcl - i in all parts of medial meniscus under all 4 loading conditions . compared with the pcl - i group ,
pmb - t group did not have significantly increased strain values under loads of 200 , 400 and 600 n ( p > 0.05 ) , whereas under 800 n load the strain values were markedly increased ( p < 0.05 ) [ figure 3 ] . a bar diagram showing strain value on medial meniscus at 30 of flexion ( , microstrain ; * p<0.05 compared to pcl - i )
the trends with respect to strain state were similar between 60 of flexion and 30 of flexion [ figure 4 ] . compared to the control ,
strain value increased significantly on whole meniscus in alb - t and pcl - t groups under all four loading conditions and in pmb - t group under 800 n load ( p < 0.05 ) . a bar diagram showing strain value on medial meniscus at 60 of flexion ( , microstrain ; * p<0.05 compared to pcl - i )
strain state in whole medial meniscus at 90 of flexion was similar to that at 30 of flexion [ figure 5 ] .
significant higher strain value on whole meniscus was observed in alb - t , pmb - t and pcl - t groups compared with the pcl - i group all four loading conditions ( p < 0.05 ) . a bar diagram showing strain value on medial meniscus at 90 of flexion ( , microstrain ; * p<0.05 compared to pcl - i )
at 0 flexion , the strain value in whole medial meniscus was negative in response to axial load , indicating that the strain in this position was a compressive strain [ figure 2 ] . under 200 n load , the strain on whole medial meniscus in alb - t , pmb - t and pcl - t groups were not statistically different from those in the pcl - i group ( p > 0.05 ) . under 400 and 600 n loads , the strain on whole medial meniscus in alb - t group was not statistically different from those in the pcl - i group ( p > 0.05 )
however , the strain on whole medial meniscus in the pmb - t and pcl - t groups were markedly greater than those in the pcl intact group ( p < 0.05 ) . under 800 n load , the alb - t
, pmb - t and pcl - t groups had significantly increased strain values ( p < 0.05 ) in comparison to the pcl - i group . a bar diagram showing strain value on medial meniscus at 0 of flexion ( , microstrain ; * p<0.05 compared to pcl - i )
at 30 of flexion , compression strain was found in body of meniscus in all groups , in anterior horn of meniscus in alb - t and pcl - t groups and in posterior horn of meniscus in pcl - i and pmb - t groups . the strain value in anterior horn of meniscus in pcl - i and pmb - t groups and in posterior horn of meniscus in alb - t and pcl - t groups was positive in response to axial load , indicating that the strain was a tension strain .
alb - t and pcl - t groups had higher strain than pcl - i in all parts of medial meniscus under all 4 loading conditions . compared with the pcl - i group ,
pmb - t group did not have significantly increased strain values under loads of 200 , 400 and 600 n ( p > 0.05 ) , whereas under 800 n load the strain values were markedly increased ( p < 0.05 ) [ figure 3 ] . a bar diagram showing strain value on medial meniscus at 30 of flexion ( , microstrain ; * p<0.05 compared to pcl - i )
the trends with respect to strain state were similar between 60 of flexion and 30 of flexion [ figure 4 ] . compared to the control ,
strain value increased significantly on whole meniscus in alb - t and pcl - t groups under all four loading conditions and in pmb - t group under 800 n load ( p < 0.05 ) . a bar diagram showing strain value on medial meniscus at 60 of flexion ( , microstrain ; * p<0.05 compared to pcl - i )
strain state in whole medial meniscus at 90 of flexion was similar to that at 30 of flexion [ figure 5 ] .
significant higher strain value on whole meniscus was observed in alb - t , pmb - t and pcl - t groups compared with the pcl - i group all four loading conditions ( p < 0.05 ) . a bar diagram showing strain value on medial meniscus at 90 of flexion ( , microstrain ; * p<0.05 compared to pcl - i )
pcl is considered to be the primary restraint to posterior knee translation and a secondary restraint to varus , valgus and external rotation of knee joint.181920 although an isolated pcl injury is often regarded as less disabling than an isolated injury to the acl , many authors have reported clinical sequela associated with pcl injury.212223 boynton et al .
reported that eight ( 21% ) patients had meniscal injury after pcl injuries.24 biomechanical studies have shown increased contact pressures in the patellofemoral and medial compartments following pcl loss.25 normally , the medial meniscus carries 50% of the medial compartment load with knee fully extended .
the interrelationship between the loss of the load - bearing role of the meniscus after meniscectomy and the development of osteoarthritis is well documented.2627 therefore , secondary damage of the medial meniscus may be considered as a reason of the development of medial compartment osteoarthritis , followed by pcl deficiency .
the results in our study showed that partial and complete pcl transaction did not increase medial meniscus strain under 200 n load at 0 flexion .
reported.14 that pcl injury minimally changes posterior tibial translation at 0 under 200 n load , thereby having a minimal effect on meniscal strain
. however , pmb and pcl transection increased medial meniscus strain under 400 , 600 and 800n loads .
this may be due to pmb becoming tight and the alb slack when the knee is at 0 of flexion.28 pmb transection can cause posterior tibial translocation in extension increasing the strain on medial meniscus .
the present study showed that alb and pcl transection increased medial meniscus strain at 30 , 60 and 90 of flexion under all loading conditions . in higher flexion ,
the alb is tight , whereas the pmb is slack.28 therefore , alb transection can increase posterior tibial translocation in flexion , which results in increased strain on the medial meniscus . while under 800 n load , both partial and complete pcl transaction increased medial meniscus strain .
the posterior tibial translation increased gradually with increasing knee loads after pcl transaction , which can lead to increased meniscal strain . at 90 of flexion ,
castle et al.29 assessed static squatting with pcl deficiency resulting in a mean increase in posterior translation of 7.4 mm for high angle squats ( 70 - 90 flexion ) compared to 2.1 mm for low flexion squats ( 32 - 50 flexion ) .
increase in posterior tibial translation in pcl deficient knee at higher flexion angle may explain increased medial meniscal strain .
the current data also demonstrate that the effect of pcl state on meniscal strain was more pronounced under higher loading conditions at higher flexion angles .
it has been reported that alb get strained in the process of flexion28 and the pmb rupture , strained medial meniscus at 0 under 400 , 600 and 800 n loads , which suggested that pmb played significant role in anterior movement constraint in full extension.28 in view of this , we can easily recognize that the two bundles of pcl contribute to the stabilization of knee joint in a complementary manner and medial meniscus strain may remarkably elevate no matter which part of pcl is transected .
this study also showed that in physiological status , the knee joint harbored the biggest strain at 0 and 30 of flexion on body part of medial meniscus in pcl intact group .
physiologically , weight bearing area of medial meniscus locates on its body carries the maximum load between 0 - 30 flexion.17 thus , abnormal strains generated from anterior / posterior translation and internal / external rotation of medial femoral condyle at the 0 - 30 flexion resulted in body tear of medial meniscus more easily.30 when flexed at an angle more than 60 , as the motion center of medial femoral condyle shifted , strain onthe body decreased so that the posterior horn instead of the body became the major weight bearing area .
at this situation , posterior horn played the major part of knee joint stability maintenance and constrained the anterior translation of tibia.31 therefore , the tear of posterior horn of the meniscus occurs more commonly at an angle more than 60 after pcl transection .
first , the dissection of soft tissue surrounding the knee joint could have some influence on the exact value in different loading conditions .
secondly , the weight - bearing lunge was scanned at each flexion angle in the current study and did not measure dynamic motion of the joint .
thirdly , it is a cadaveric study and so can not simulate the complex loading conditions in the normal knee such as tibial rotation and mediolateral forces .
subject to these limitations , the current study demonstrates that similar to complete pcl transection , partial pcl transection triggers strain concentration on medial meniscus and the effect is more pronounced with higher loading conditions at higher flexion angles .
Output:
| background : the relationship between medial meniscus tear and posterior cruciate ligament ( pcl ) injury has not been exactly explained .
we studied to investigate the biomechanical effect of partial and complete pcl transection on different parts of medial meniscus at different flexion angles under static loading conditions.materials and methods : twelve fresh human cadaveric knee specimens were divided into four groups : pcl intact ( pcl - i ) , anterolateral bundle transection ( alb - t ) , posteromedial bundle transection ( pmb - t ) and pcl complete transection ( pcl - t ) group .
strain on the anterior horn , body part and posterior horn of medial meniscus were measured under different axial compressive tibial loads ( 200 - 800 n ) at 0 , 30 , 60 and 90 knee flexion in each groups respectively.results:compared with the pcl - i group , the pcl - t group had a higher strain on whole medial meniscus at 30 , 60 and 90 flexion in all loading conditions and at 0 flexion with 400 , 600 and 800 n loads . in alb - t group ,
strain on whole meniscus increased at 30 , 60 and 90 flexion under all loading conditions and at 0 flexion with 800 n only .
pmb - t exihibited higher strain at 0 flexion with 400 n , 600 n and 800 n , while at 30 and 60 flexion with 800 n and at 90 flexion under all loading conditions.conclusions:partial pcl transection triggers strain concentration on medial meniscus and the effect is more pronounced with higher loading conditions at higher flexion angles . |
PubmedSumm7828 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in developing countries , human immunodeficiency virus ( hiv ) infection and neonatal tetanus ( nt ) are among the leading causes of childhood morbidity and mortality .
understanding the interaction between hiv and nt is important since it may have a major implication for nt elimination program .
newborns are protected from nt by maternal anti - tetanus antibody ( mta ) of the igg class which is actively transferred across the placental barrier from third trimester of gestation following tetanus toxoid ( tt ) vaccination in pregnant women .
strengthening of immunisation for pregnant women with tt vaccine is reported to be the single most effective strategy independent of other interventions in eliminating neonatal tetanus .
its efficacy and effectiveness has been convincingly demonstrated in many field trials and in hospital - based studies [ 26 ] .
however , there are conflicting reports of the influence of maternal hiv infection on anti - tetanus antibody production by the mothers as well as its transfer through the placenta to their unborn babies .
whereas lower anti - tetanus antibody levels in hiv infected women were reported from senegal , brazil , and the gambia , no such relationship was found in malawi .
similarly , cumberland et al . in kenya reported a decrease in cord - maternal ratio ( cmr ) with 50% reduction in cord blood tetanus antibody concentration in babies born by hiv infected mothers .
similar conclusions were arrived at by bonetti et al . in brazil . to the best of our knowledge ,
no such study was carried out in nigeria which happens to be one of the 46 remaining countries yet to eliminate neonatal tetanus as at 2008 and among the 24 countries responsible for 90% of the global burden of the disease .
moreover , chama et al . in 2010 reported a high prevalence of hiv infection of 12.7% among women attending antenatal clinic of the university of maiduguri teaching hospital ( umth ) , maiduguri , northeastern nigeria , where this study was carried out .
we thus aim to assess the effect of maternal hiv infection on the serum levels of anti - tetanus antibodies in mother - infant pairs and hence transplacental transfer of antibody .
the umth is a tertiary - based care centre located in northeastern nigeria and a centre of excellence for infectious diseases and immunology .
it also serves as a referral site for the six northeastern states of nigeria and the neighboring countries of chad , cameroon , and niger .
the study was a hospital - based descriptive and cross - sectional study of mother - newborn pairs recruited from the labour ward of the umth .
the study protocol was reviewed and approved by the medical research and ethics committee of umth .
the minimum sample size was determined using cochran 's sample size formula for categorical data at alpha level of 0.05 and power of 95% .
proportion of newborns with protective level of tetanus igg antibody ( seropositives ) , value of p , was taken from a previous study in jos by adabara et al . to be 88% . therefore , the sample size for the study was one hundred and sixty - two mother - newborn pairs .
mother - newborn pairs were enrolled in this study using the systematic random sampling method , in which the first of every three mother - newborn pairs was picked at the labour ward from the first day of data collection after fulfilling the eligibility criteria .
exclusion criteria were failure to give consent ( 0.05% ) , stillbirth and history of antitetanus serum ( ats ) , or blood transfusion during pregnancy .
mothers with diabetes mellitus , hypertension , eclampsia , or preeclampsia were also excluded . upon enrolment , a questionnaire detailing sociodemographic variables was completed for each mother - newborn pair .
this included biodata , pregnancy history and antenatal history , and gestational age as well as indicators of socioeconomic status like occupation and educational levels of both parents .
history of tt vaccination during current pregnancy , verifiable from the patients ' antenatal clinic records , where possible , was obtained , including how many doses and their interval as well as tt received before the index pregnancy ( both during and outside pregnancy ) .
gestational age ( ga ) at delivery was determined by date using the last menstrual period or by first - trimester ultrasound scan , where available .
dubowitz score was used to access the ga of the newborn infants at birth , and their birth weight ( bw ) was measured using a digital weighing scale that has a sensitivity of 0.01 kg .
newborn infants with ga less than 37 completed weeks were classified as preterm , those from 37 completed to less than 42 completed weeks were term , and those with 42 completed weeks or more were postterm .
newborns weighing > 3.99 kilograms were classified as macrosomia , those weighing 2.53.99 kilograms were classified as normal , and those < 2.5 kilograms were termed low bw .
socioeconomic status was assigned using oyedeji 's model . maternal venous blood ( 2 ml )
two millilitres of cord blood from the placental end of the cord , after early clamping of the cord , was also collected and stored in a properly labelled sterile plain bottle .
sera were separated after centrifuging these blood samples at 5000 rpm for five minutes .
all mother - newborn pairs sera were assayed for tetanus igg antibodies by enzyme linked immunosorbent assay ( elisa ) technique .
the optical density at 450 nm ( od450 ) was measured in an elisa microplate reader .
standard curves were drawn for each plate and optical densities of the test serum dilutions falling within the linear part of the curve were extrapolated .
world health organization ( who ) guidelines proposed a cut - off of 0.10.2 iu / ml for a protective antibody concentration .
for this study , antibody level of 0.1 iu / ml was used as the cut - off , below which individuals were classified as being seronegative .
maternal hiv status was defined by presence of serum hiv antibodies determined by two different elisa tests , as recommended by who .
analysis was done using spss version 16.0 ( spss , chicago , illinois , usa ) .
frequencies of tetanus antibody serostatus ( seropositives and seronegatives ) were compared using fisher exact test . a p value of < 0.05 was considered significant .
the mean standard deviation ( sd ) age of the mothers was 27.2 6.0 years .
most of them were multipara ( 121 [ 74.7% ] ) and belonged to the low socioeconomic class ( 132 [ 81.5% ] ) .
one hundred and thirty - eight ( 85.2% ) mothers had at least 2 tetanus toxoid ( tt ) vaccinations during the current pregnancy .
ten ( 6.2% ) mothers were hiv infected and were on antiretroviral treatment ( table 1 ) .
nine ( 90% ) of the hiv positive mothers had at least 2 doses of tt vaccination ; the remaining woman had only a single dose .
there was no significant variation in doses of tt vaccination between the hiv positive and hiv negative mothers ( p = 1.000 ) . among the 162 babies enrolled in the study , 84 ( 51.9% ) were males and 78 ( 48.1% ) were females with a male to female ratio ( m : f ) of 1.08 : 1 .
most of them , 149 ( 92% ) , were term and the remaining 13 ( 8% ) were preterm .
low birth weight was observed in 9 ( 5.6% ) babies while the remaining 153 ( 94.4% ) were of normal birth weight .
one hundred and twenty - four mothers ( 76.5% ) and 121 ( 74.4% ) babies were seropositive for tetanus antibodies ( titre of 0.1 iu / ml ) .
the remaining were seronegative ( titre < 0.1 iu / ml ) , out of whom 8 of the mothers were hiv positive and 9 of the babies were delivered by hiv positive mothers .
the mean ( sd ) tetanus antibody titres of the studied mothers and their babies were 0.160 ( 0.122 ) and 0.230 ( 0.170 ) iu / ml , respectively .
there was a significant strong positive correlation between maternal and cord blood levels of tetanus antibodies ( r = + 0.668 , r = 0.445 , p < 0.001 ) with a shared variance of 44.6% ( figure 1 ) .
one hundred and six pairs ( 65.4% ) had cord - maternal ratios ( cmr ) of 1 with a mean ( sd ) of 1.499 ( 0.729 ) , while the remaining 56 ( 34.6% ) had ratios of < 1 with a mean ( sd ) of 0.553 ( 0.232 ) .
the overall mean ( sd ) of the cord - maternal ratios was 1.062 ( 0.767 ) .
there was a significant but weak negative correlation between maternal tetanus antibody levels and cord - maternal ratios ( r = 0.158 , p = 0.045 ) with a shared variance of only 2% ( figure 2 ) .
on the effects of the various maternal and neonatal factors on the anti - tetanus antibody serostatus and cmr , only maternal tt vaccination and hiv status showed statistically significant association with maternal anti - tetanus antibody serostatus ( p 0.001 ) for both .
similarly , hiv exposure and gestational age at birth were the only factors with statistically significant association with cord anti - tetanus antibody serostatus ( p 0.001 and 0.004 ) , respectively . in both cases ,
these factors were still found to have a significant predictive value even after controlling for all the other variables using logistic regression analysis ( tables 2 and 3 ) for maternal serostatus and cord serostatus , respectively . maternal hiv infection and neonatal gestational age at birth were the only factors with statistically significant association with cmr ( p = 0.001 and 0.033 ) for maternal hiv and gestational age , respectively .
hiv infected mothers were 16.27 times more likely to have seronegative levels of tetanus antibody than hiv negative mothers .
similarly , hiv exposed babies were 33.75 times more likely to have seronegative cord blood than those delivered by hiv negative mothers .
again , hiv positive mother - newborn pairs were 4.91 times more likely to have a poorly efficient transplacental transfer of tetanus antibodies with cmr of < 1.0 compared to hiv negative pairs ( table 4 ) .
the observed hiv prevalence of 6.2% among the mothers in this study is quite above the national average of 3.7% this higher prevalence may be due to several factors .
the umth antenatal clinic serves as a referral centre for hiv positive pregnant women from lower cadre health facilities for the purpose of enrolment into the pmtct program .
this will undoubtedly lead to concentration of hiv positive pregnant women in this hospital and hence the observed higher prevalence .
secondly , the child bearing age also corresponds to the age of maximal sexual activity and has been found to have the highest incidence of hiv infection .
this prevalence is , however , about half of 12.7% reported by chama et al . in 2010 among women attending antenatal
the lower prevalence observed in this study , compared to the one by chama et al .
4 years earlier , could be a reflection of the general decline in hiv prevalence being experienced in the country .
while the study by chama et al . considered all women attending anc in umth over a 2-year period , this study enrolled 1 of every 3 women that delivered in umth over a period of 6 months until the required sample size was attained .
the observed overall protective levels of tetanus antibodies ( mean 0.1 iu / ml ) for both mothers and infants are similar to the report of cumberland et al . in kenya in 2007 .
they found that the geometric mean titres of both the mothers and their babies were within the protective range .
similarly , hood et al . found the geometric mean concentration of tetanus antibodies in nigerian mothers and their infants to be within the protective range .
the high proportion of tetanus antibody seropositivity among both the mothers and their babies in this study is similar to the findings in earlier studies from kenya , jos , and ibadan .
at the jos university teaching hospital , nigeria , in 2010 also reported a highly significant positive correlation between the maternal tetanus antibody levels and those of the babies similar to our finding .
these findings , however , are probably overestimates of the mean tetanus antibody titre and proportion of seropositivity in the general population , because women who deliver in hospital are more likely to have received tt vaccination than women who deliver at home , hence further underscoring the import of tt vaccination in attainment of anti - tetanus antibody seropositivity .
the mean cord - maternal ratio found in this study was higher than most previous studies reported from kenya ; ibadan , nigeria ; libreville , gabon , as well as thailand and india . while it was found to be > 1.0 in this study signifying efficient placental transfer
, the others reported < 1.0 , pointing to the earlier held view of poor placental transfer of tetanus antibodies in african mothers .
however , besides the small sample size in the ibadan study , most of the studies used in vitro technique to determine tetanus antibody levels which measures both igg and igm antibodies resulting in misleadingly high maternal titres and therefore low cord - maternal ratios , compared with standard elisa ( in - vivo ) used in this study which measures only igg .
the effect of maternal hiv infection on maternal serum and cord tetanus antibody levels as well as transplacental transfer of this antibody in this study is consistent with the findings of lower tetanus antibody levels in hiv infected women in senegal , brazil , and the gambia .
it is also in agreement with data from kenya , in the largest study of the association between maternal hiv infection and tetanus antibody levels by cumberland et al . , where they found lower levels of tetanus antibody among hiv infected women , reduced transplacental transfer of tetanus antibody , and ~50% lower antibody levels in cord serum .
in contrast , de moraes - pinto et al . from malawi found that maternal hiv infection had no effect on maternal serum and cord anti - tetanus igg levels as well as transplacental transfer of this antibody .
the reason for this contrasting finding is not clear but may be due to the fact that the authors did not adjust for tt vaccination status which has been demonstrated in this study and others [ 26 ] to be an important determinant of serum tetanus antibody status .
maternal hiv infection was associated with significantly impaired maternofoetal transfer of tetanus antibody and seronegativity ( unprotective ) levels in both mother - newborn pairs at birth despite being on antiretroviral therapy for hiv .
there is need to review and restrategize neonatal tetanus elimination program among this vulnerable population .
such strategies may include passive immunisation in addition to other elements of prevention among high risk groups .
Output:
| background .
tetanus toxoid immunisation of pregnant mother has remained the most effective strategy in eliminating neonatal tetanus .
impaired production and/or transplacental transfer of antibodies may affect the effectiveness of this strategy .
we studied the effect of maternal hiv infection on serum levels and transplacental transfer of anti - tetanus antibodies . methods .
a total of 162 mother - baby paired serum samples were taken and analysed for anti - tetanus antibody levels using elisa .
maternal hiv status was also determined by double elisa technique .
maternal tt vaccination status was also documented .
results .
thirty - eight ( 23.5% ) mothers and 41 ( 25.3% ) babies were seronegative , out of whom 8 mothers were hiv positive and 9 babies were hiv exposed .
hiv infected mothers and hiv exposed infants were , respectively , 16.27 times ( or = 16.27 , 95% ci = 3.28 to 80.61 ) and 33.75 times ( or = 33.75 , 95% ci = 4.12 to 276.40 ) more likely to be seronegative for anti - tetanus antibody .
similarly , hiv positive mother - newborn pairs were 7.46 times more likely to have a poor transplacental transfer of tetanus antibodies ( or = 7.46 , 95% ci = 1.96 to 28.41 ) . conclusions .
maternal hiv infection is associated with impaired maternofoetal transfer of anti - tetanus antibodies and seronegativity among mothers and their newborns .
hence , this may hinder efforts to eliminate neonatal tetanus . |
PubmedSumm7829 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the capacity of mature mammalian skeletal muscles to repair and maintain mass is due to the presence of undifferentiated mononuclear myogenic precursor cells , that is , the satellite cells , located at the periphery of myofiber , between the sarcolemma and the surrounding basal lamina .
satellite cells remain quiescent until appropriate stimuli ( e.g. , muscle injury ) trigger their re - entry into the cell cycle ; they then undergo activation and proliferation , and the daughter cells fuse to form muscle fibers which increase muscle mass . the availability and responsiveness of satellite cells are therefore necessary for efficient muscle regeneration . during aging ,
a progressive loss of skeletal muscle mass and a parallel decrease in muscle strength and endurance take place .
this condition , termed sarcopenia , has important health - care and socioeconomic implications for humans , since it contributes to frailty , functional loss , dependence , disability , high health care costs , and premature death ( the recent review in ) .
the mechanisms leading to sarcopenia are probably manifold and they still remain to be completely elucidated ( review in [ 2 , 3 ] ) .
one of the possible causes could be the remarkable decline in the efficiency of muscle regeneration ; this has been associated with decreasing amounts of satellite cells ( e.g. , [ 48 ] ) , possibly due to apoptotic cell death [ 9 , 10 ] , although this is controversial [ 1113 ] .
it has also been suggested that activation , proliferation , and/or differentiation of satellite cells and their progeny may be altered in sarcopenia [ 14 , 15 ] .
it is known that aging involves alterations in the pathways of gene expression , which are not necessarily associated with mutations but can imply impairments in pre - mrna transcription and/or splicing ( review in ) . in particular
, it has been shown that aging affects intranuclear rna pathways by altering the organization , composition , and location of the ribonucleoprotein-(rnp- ) containing structures [ 1721 ] .
these structures are part of the transcription and splicing machinery : perichromatin fibrils ( pfs ) are the morphological equivalent of hnrna transcription and cotranscriptional splicing , perichromatin granules ( pg ) , which form by pf coiling , are involved in the storage and the nucleus - to - cytoplasm transport of mrna , while interchromatin granules ( ig ) represent the storage , assembly , and recycling site for snrnp and non - snrnp splicing factors [ 2224 ] . in a recent study ,
we have analyzed the fine structure of myonuclei as well as the distribution and amount of rna processing factors in myofibers of biceps brachii and quadriceps femoris from adult and old rats .
we thus showed that in myonuclei of aged fibers a decrease in the transcription , processing , and transport rate of pre - mrna takes place .
both muscles contain a high proportion ( about 90% ) of type ii fibers and are therefore largely affected by sarcopenia [ 2628 ] . in the present study
whether the rna pathways also undergo alterations in the satellite cells of aging muscles , we combined morphometry and immunocytochemistry at light and electron microscopy and investigated the distribution and content of nuclear rnp structural constituents involved in different steps of mrna formation .
two adult ( 9 months of age ) and two old ( 28 months of age ) male wistar rats were used .
all animals were bred under controlled environmental conditions with a 12-hour light / dark cycle and fed ad libitum with a standard commercial chow .
the experimental protocols comply with the guidelines of the italian ministry of health as well as with internationally recognized guidelines .
the rats were deeply anesthetized with pentobarbital ( 50 mg / kg i.p . ) and then perfused via the ascending aorta with a brief prewash of 0.09% nacl solution followed by 300 ml of a fixative solution containing 4% ( v / v ) paraformaldehyde in 0.1 m phosphate buffer , ph 7.4 at 4c .
biceps brachii and quadriceps femoris muscles were quickly removed and placed in the same fixation solution for 2 hours at 4c .
seven-m - thick muscle samples were cross - sectioned then submitted to immunohistochemical procedures for identification of satellite cells by using a mouse monoclonal antibody directed against the membrane - bound neural cell adhesion molecule ( n - cam / cd56/leu-19 ) , which has been demonstrated on satellite cells in normal adult skeletal muscle and represents an established marker ( bd biosciences , san jose , ca ) .
the primary antibody was then revealed with an alexa 488 conjugated antibody against mouse igg ( molecular probes , invitrogen , milan , italy ) .
the sections were finally counterstained for dna with 0.1 g / ml hoechst 33258 to label the cell nuclei and to detect the occurrence of apoptosis based on chromatin morphology .
observations were made with an olympus bx51 microscope equipped with a 100 w mercury lamp under the following conditions : 330- to 385-nm excitation filter ( excf ) , 400-nm dichroic mirror ( dm ) , and 420-nm barrier filter ( bf ) , for hoechst 33258 ; 450- to 480-nm excf , 500-nm dm , and 515 nm bf for alexa 488 .
micrographs were recorded with an olympus camedia c-5050 digital camera and stored on a pc by the olympus software for processing and printing .
morphometrical evaluations were performed by using the software image j ( nih , usa ) . to estimate the possible decrease in the amount of satellite cells in the muscles ,
the number of satellite cells was determined over areas of cross - sectioned muscles containing only myofibers and endomysium ; using a 40 objective lens , a total of 880,000 m were considered per each muscle , and the density of satellite cells was expressed as satellite cells/1000 m of muscle area .
the percentage of apoptotic nuclei was also evaluated on myofibres , on a total of 25 microscope fields , using an 20 objective lens ( at least 2000 myonuclei per muscle sample were counted ) .
after fixation , muscle samples were washed in srensen buffer and subsequently in phosphate buffered saline ( pbs ) , kept in 0.5 m nh4cl in pbs for 45 minutes to block free aldehydes , dehydrated with ethanol , and embedded in lr white resin polymerized under u.v .
this fixation procedure is optimal to allow antigen detection at electron microscopy , although the ultrastructural morphology of especially the cellular membranes can not be perfectly preserved .
ultrathin sections were collected on formvar - carbon coated nickel grids and used for morphometrical and immunocytochemical analyses .
morphometrical evaluations ( x11,000 ) were made on twelve satellite cell nuclei per muscle by using a computerized image analysis system ( analysis image processing , soft imaging system gmbh , muenster , germany ) .
the following parameters were considered : area of nuclei and nucleoli , percentage of nuclear area occupied by condensed chromatin and pg density ( pg/m of interchromatin space , i.e. , the nucleoplasmic region devoid of condensed chromatin ) , area of the fibrillar centers , and percentage of the nucleolar area occupied by the dense fibrillar component and by the granular component . to investigate the fine distribution of some rna transcription and processing factors ,
thin muscle sections were treated with one of the following probes : mouse monoclonal antibodies directed against the activated , phosphorylated form of rna polymerase ii ( research diagnostic inc . , flanders , nj ) or against the snrnp ( small nuclear rnp ) sm core proteins ( abcam , cambridge , ma ) ; rabbit polyclonal antibodies were used against dna / rna hybrid molecules specifically occurring in the transcription sites [ 25 , 31 ] , and the cleavage stimulation factors cstf .
sections were floated for 3 minutes on normal goat serum ( ngs ) diluted 1 : 100 in pbs and then incubated overnight at 4c with the primary antibodies diluted with pbs containing 0.1% ( w / v ) bovine serum albumin ( fluka , buchs , switzerland ) and 0.05% ( v / v ) tween 20 . after rinsing ,
sections were floated on ngs , and then allowed to react for 20 minutes at room temperature with the secondary 12 nm or 18 nm - gold - conjugated antibody ( jackson immunoresearch laboratories inc . , west grove , pa ) diluted 1 : 10 in pbs . finally , the sections were rinsed and air - dried . as controls ,
some grids were incubated without the primary antibody and then processed as described above . to reduce chromatin contrast and selectively reveal nuclear rnp constituents , the sections were bleached by the edta method , observed in a philips morgagni tem operating at 80 kv , and equipped with a megaview ii camera for digital image acquisition
. quantitative assessment of the immunolabeling was carried out by estimating the gold grain density over selected cellular compartments on sections treated in the same run .
the surface area of the interchromatin space and ig was measured on fifteen satellite cell nuclei ( x22,000 ) from each muscle by using a computerized image analysis system ( analysis image processing ) . for background evaluation samples treated in the absence of primary antibody
the gold grains over each selected compartment were counted , and the labeling density was expressed as the number of gold grains/m . for each analyzed variable , the kolmogorov - smirnov two - sample test was performed in order to verify the hypothesis of identical distribution among animals of each experimental group ( i.e. , adult and old rats ) .
the data were then pooled according to the experimental groups and the means standard error of the mean ( se ) values were calculated .
statistical comparisons were performed by the mann whitney u - test ( significance was set at p 0.05 ) .
as previously reported , a dramatic mass reduction was observed in both the biceps and quadriceps muscles of old rats in comparison to adult animals .
satellite cells were specifically labeled by the anti - n - cam antibody ( figure 1(a ) ) ; their density ( number of satellite cells/1000 m of muscle area ) was significantly higher in adult than in old rats , in both the biceps and quadriceps muscle .
morphologically recognizable apoptotic nuclei in satellite cells of both muscles from adult rats were quite scarce ; in muscles of old animals the percentage of apoptotic nuclei increased although not significantly ( figure 1(b ) ) .
it is , however , worth underlying that the absolute number of satellite apoptotic cells counted was very low , in both animal groups .
morphologically recognizable apoptotic nuclei in the myofibres were quite scarce and their percentage was similar in adult and old animals in both biceps ( 0.16 0.06% versus 0.22 0.09 , resp . ) and quadriceps ( 0.15 0.06% versus 0.18 0.07 , resp . )
muscles . in spite of the nonoptimal ultrastructural preservation due to the fixation procedure necessary for immunocytochemistry ,
in all the muscle samples satellite cells were morphologically recognizable as small cells with scanty cytoplasm and located between the sarcolemma and the surrounding basal lamina of the muscle fibers ( figure 2(a ) ) .
satellite cell nuclei generally were ovoid in shape with finely irregular border and contained abundant condensed chromatin distributed both at the nuclear and nucleolar periphery , and one roundish compact nucleolus with prominent granular component , scarce dense fibrillar component , and rare small fibrillar centers ( figure 2(b ) ) . in the nucleoplasm , all the usual rnp structural constituents involved in pre - mrna transcription and processing were evident ; few pf and pg were mainly distributed at the periphery of the condensed chromatin and small ig clusters occurred in the interchromatin space . in satellite cell nuclei of old muscles ,
pf sometimes occurred as clusters ( figures 2(d ) and 2(h ) ) . at electron microscopy ,
the satellite cell nuclei were structurally similar in adult and old rats , and morphological evidence of apoptosis was never found in any of the muscle samples examined . in both biceps and quadriceps muscles , we did not observe significant differences between the satellite cells from adult and old rats as for the nuclear or nucleolar area , the percentage of condensed chromatin , the pg density , and the percentage of the dense fibrillar and the granular components of nucleoli ( figure 3 ) .
the area of the rare fibrillar centers observed ranged from 0.001 to 0.003 m , without difference between muscles or age groups .
the immunocytochemical labeling for polymerase ii , the dna / rna hybrid molecules , snrnps , and the cleavage factor cstf were similar in the nucleoplasm of satellite cells from adult and old rats . in both animal groups ,
polymerase ii and dna / rna hybrid molecules were exclusively associated with pf ( figures 2(c ) and 2(d ) ; snrnps were restricted to pf and ig ( figures 2(e ) and 2(f ) ) ; cstf was located essentially on pf and on rnp tails rising from pg ( figures 2(g ) and 2(h ) ) .
the quantitative evaluation of the immunolabeling ( figure 4 ) revealed similar densities of polymerase ii and dna / rna hybrid molecules in both biceps and quadriceps muscles of adult and old rats ; conversely , snrnps and cstf were more abundant in the interchromatin space of old rats compared to adult rats .
in addition , snrnps were found to be more abundant in the ig of old rats ( biceps brachii : 16.12 2.86 gold grains/m in adult versus 33.76 5.25 in old rats , p = 0.047 ; quadriceps femoris : 15.56 3.88 gold grains/m in adult versus 34.97 5.94 in old rats , p = 0.042 ) ; conversely , in all the samples the labeling for polymerase ii , the dna / rna hybrid molecules and cstf were almost absent on ig ( figures 2(c ) , 2(d ) , 2(g ) , and 2(h ) ) .
the biceps brachii and the quadriceps femoris of the old rats were severely affected by sarcopenia , as demonstrated by the remarkable muscle mass reduction and the drastic decrease in the size of type ii myofiber .
the density of satellite cells was also significantly decreased in old rats compared to adult rats , consistent with the impaired regenerative capacity of muscles in sarcopenia .
a smaller amount of satellite cells has already been reported in different aging muscles ( e.g. , [ 48 ] ) , although some authors did not observe these quantitative changes [ 1113 ] .
this discrepancy could be due to the differences in muscle , myofiber , and atrophy types that were investigated ( for a recent review , see ) ; in particular , it has been reported that satellite cell content is specifically reduced in type ii skeletal muscle fibers in the elderly , thus making muscles , which are mainly composed of this fiber type ( like the biceps brachii and the quadriceps femoris ) , especially prone to satellite cell loss .
the scarce presence of morphologically recognizable apoptotic nuclei in satellite cells ( at both light and electron microscopy ) suggests that cell death via apoptosis might rarely occur in aging skeletal muscles .
however , it should be also considered that our data have been collected in old animals where the sarcopenic process had already come to an advanced stage ; this implies that a substantial role of apoptosis in earlier phases can not be excluded . in any case , in both muscles of old rats the percentage of apoptotic satellite cell nuclei was increased ( thought not significantly ) ; whereas apoptotic nuclei were rare in myofibers , without differences between adult and old animals [ 25 , 35 ] ; these findings support the hypothesis that the apoptotic signals in old muscles may mostly originate from satellite cells .
the satellite cells bordering the myofibers of old muscles are morphologically similar to those found in adult muscles ; in particular , the structural features of their nuclei are typical of quiescent cells .
they contain abundant clumps of condensed chromatin , few pf and pg , compact nucleoli with abundant granular components , and scarce dense fibrillar components , which are all markers of low nuclear activity .
accordingly , the quantitative evaluation of the fine structural features of satellite cell nuclei gave similar values in adult and old rats ; however , the in situ analysis of pre - mrna processing factors revealed significant differences in the amount and intranuclear distribution of snrnps and cstf . in detail , the snrnps ( involved in the cotranscriptional splicing of pre - mrna ) were found to increase in satellite cell nuclei of old muscles ; however , analysis of their intranuclear distribution reveals that snrnps accumulate in the ig , known to represent the site of storage , transit and recycling of many nuclear factors [ 24 , 39 ] , but not on pf , which represent the in situ form of nascent transcripts , as well as of their splicing and 3 end processing ( reviews in [ 22 , 23 ] ) .
therefore , the increase in snrnps is not associated with an increase in the transcriptional rate , according to the results obtained for polymerase ii and the dna / rna hybrid molecules .
a similar accumulation of nuclear factors in ig has been previously described in hepatocytes and neurons of old rodents [ 1921 ] , suggesting that the rna pathways impairment may represent a common event during aging , independently on the cell type .
the cleavage factor cstf also increases in satellite cell nuclei of old muscles in comparison to the adult ones ; however , this factor was always and exclusively located on pf .
a similar accumulation of cstf has been previously observed in myonuclei of old muscles as well as in aging hepatocyte nuclei .
consistent with the data on snrnps , the accumulation of cstf suggests that the processing and/or the intranuclear transport of transcripts are impaired .
the presence of clustered pf as well as the increase in pg density observed in satellite cell nuclei of old muscles ( although below the level of statistical significance ) supports the hypothesis of altered pre - mrna cotranscriptional activities and reduced cytoplasmic export .
in fact , pf ( which represent sensitive markers for the pre - mrna processing impairment ) have been already observed to accumulate in aging hepatocytes [ 17 , 21 ] ; moreover , pg ( which represent storage and/or transport sites for spliced ( pre-)mrna ) generally increase in number as a consequence of altered pre - mrna processing as well as of impaired intranuclear or nucleus - to - cytoplasm transport of mrnas ( e.g. , [ 40 , 41 ] ) .
consistent with this hypothesis , a decrease in the nucleus - to - cytoplasm transport factors has been reported during aging , when the degradation systems also undergo alterations leading to the accumulation of cross - linked , insoluble , and often oxidized proteins , which may damage the intracellular transport mechanisms [ 44 , 45 ] .
accordingly , several proteins have been found to accumulate in satellite cell nuclei of old skeletal muscles . in this view
, the intranuclear accumulation of some nuclear factors in aging cell nuclei could be also related to the reduced efficacy of their degradation machinery .
it is worth noting that the abnormal accumulation of reactive oxygen species in skeletal myofibers and satellite cells [ 47 , 48 ] as well as dysfunctions in the proteolytic and autophagic pathways [ 49 , 50 ] is thought to be involved in sarcopenia .
interestingly , when the results obtained for satellite cells are compared to those recently reported for myonuclei of the same muscles , it appears that satellite cell nuclei are less affected by aging : myonuclei show alterations in their fine structural and molecular features indicating that the entire mrna production chain , from the synthesis to the cytoplasmic export , becomes less efficient ; whereas in satellite cell nuclei the pre - mrna processing / transport only is affected .
this could be due to the relatively low nuclear activity of satellite cells , compared to myonuclei , which could in turn results in the slowing down of the progressive age - related deterioration of the whole cell function , including the rna production .
the changes in the mrna production machinery revealed in this study , however , suggest that satellite cell nuclei of aged individuals might be less responsive to the activating stimuli that those in adults , thus compromising the regenerative capacity of old skeletal muscles .
there is growing evidence in the literature that aging affects cell nuclear function by impairing the transcriptional / cotranscriptional mechanisms in a wide variety of cell types in different organs , including muscles ; this leads to a number of metabolic consequences , which finally result in the impairment of the specific physiological role(s ) of each cell type .
recently , it has been demonstrated that defects in the rna pathways are paralleled by altered intranuclear distribution of pre - mrnas processing factors in some diseases characterized by muscle atrophy / dystrophy [ 5153 ] .
it is likely that the age - related nuclear dysfunctions of satellite cells could hamper their capability to become activated and to proliferate in response to muscle damage .
thus nuclear dysfunction of both muscle fibers and satellite cells seems to play a pivotal role in the sarcopenia of aged individuals , and this should be taken into account in the perspective to prevent and treat this ever - increasing health - risk factor .
Output:
| satellite cells are responsible for the capacity of mature mammalian skeletal muscles to repair and maintain mass . during aging , skeletal muscle mass as well as the muscle strength and endurance progressively decrease , leading to a condition termed sarcopenia .
the causes of sarcopenia are manifold and remain to be completely elucidated .
one of them could be the remarkable decline in the efficiency of muscle regeneration ; this has been associated with decreasing amounts of satellite cells , but also to alterations in their activation , proliferation , and/or differentiation . in this study , we investigated the satellite cell nuclei of biceps and quadriceps muscles from adult and old rats ; morphometry and immunocytochemistry at light and electron microscopy have been combined to assess the organization of the nuclear rnp structural constituents involved in different steps of mrna formation .
we demonstrated that in satellite cells the rna pathways undergo alterations during aging , possibly hampering their responsiveness to muscle damage . |
PubmedSumm7830 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: this was a prospective study at three large swiss hospitals assessing the impact of strategies to improve postprandial glucose by optimizing the combination of oral antidiabetes drugs and/or insulin according to a prespecified scheme ( 5 ) .
included patients had type 2 diabetes 6 months with a1c between 7.0 and 12.0% . patients with renal insufficiency or proteinuria were excluded .
written consent was obtained , and the study was approved by the local ethics committees .
patients regularly monitored their blood glucose levels before and 2 h after main meals ( glucotrend premium ; roche diagnostics , mannheim , germany ) , and 1,5-ag was measured at each time point in a central laboratory ( lana 1.5 auto liquid reagent ; interbiotech , tokyo , japan ; automated on a hitachi 917 analyzer , coefficient of variation 5.2% ) .
postprandial glucose values were included in the analysis if measured between 110 and 130 min after the corresponding preprandial measurement .
the models were adjusted for age , sex , treatment modalities , time in study , and time of day .
1,5-ag measurements were examined for correlations with postprandial glucose values taken over the following prespecified preceding time periods : 3 days , 1 week , then weekly up to 12 weeks .
all analyses were performed using stata 10.0 ( stata , college station , tx ) .
all 55 patients ( 19 women and 36 men ) contributed to the present analysis .
the average number of self - measurements of blood glucose per patient and year were 405 224 ( fasting / preprandial ) and 230 122 ( postprandial ) .
mean fasting / preprandial glucose was 155 48 mg / dl at the beginning and 133 46 mg / dl at the end of the study , and corresponding values for postprandial glucose were 172 55 and 162 53 mg / dl .
mean a1c was 8.7 1.3% at baseline and 7.7 1.0% at study end .
mean 1,5-ag was 4.2 3.5 g / ml at baseline and 6.4 3.5 g / ml at study end .
a1c and 1,5-ag were negatively correlated ( r = 0.42 , p < 0.001 ) . the correlation coefficient of postprandial glucose values with 1,5-ag varied across the prespecified time periods preceding the measurement of 1,5-ag ( fig .
1 ) : 0.34 ( p < 0.05 ) for 3 days , 0.38 ( p <
0.001 ) for 1 week , and 0.40 ( p < 0.001 ) for 2 weeks . afterward , the strength of the correlation decreased ( p < 0.001 for all remaining correlations ) .
the association of fasting / preprandial glucose and 1,5-ag was lower ( 0.19 to 0.23 , p < 0.001 for all correlations ) and did not reveal a time dependency ( fig .
1 ) . adjusting analyses for age , sex , treatment modalities , time in study , and time of day did not change the observed time dependency ( data not shown ) .
time - specific correlation coefficients were 0.260.28 for a1c with fasting / preprandial and 0.220.30 for a1c with postprandial glucose , without evidence of a time dependency .
the present study is the first to longitudinally assess the association of 1,5-ag with 2-h postprandial glucose values in diabetic patients followed over 12 months in an outpatient setting . although correlations were moderate ( < 0.5 in magnitude ) , 1,5-ag best reflected 2-h postprandial glucose values in the 2 preceding weeks .
correlations were weaker for a1c with fasting / preprandial as well as with postprandial glucose . a comparable
albeit slightly stronger correlation of 1,5-ag with postprandial glucose in a population of type 1 and 2 diabetic patients was recently reported . of note ,
dungan et al . ( 1 ) used a continuous glucose monitoring system to measure the area under the curve for glucose levels exceeding 180 mg / dl , while the present study was based on self - measured glucose values .
the lower number of postprandial compared with preprandial values reflects the difficulty to motivate patients for additional measurements and substantiates the role of 1,5-ag as a substitute for postprandial glucose measurements , complementing the widely used a1c and fructosamine measurements .
a recent cross - sectional study in prediabetic japanese patients found a higher correlation with 2-h postprandial glucose ( 3 ) .
it is noteworthy that 1,5-ag is subject to urinary excretion followed by almost complete reabsorption , which is competitively inhibited by glucose if the renal threshold for glucosuria is exceeded ( 6 ) .
while glucosuria in prediabetic individuals mainly occurs in the context of carbohydrate loading , diabetic patients may reveal increased glucose values independently of meals .
moreover , differences in absolute levels of 1,5-ag between asian and caucasian individuals have been previously reported ( 7 ) . in conclusion
, this longitudinal study in an outpatient setting shows that 1,5-ag best reflects 2-h postprandial glucose values in the 2 preceding weeks .
Output:
| objective to assess the association of 1,5-anhydroglucitol ( 1,5-ag ) with 2-h postprandial glucose values in type 2 diabetic patients followed over 12 months in an outpatient setting.research design and methods in 55 patients , we examined self - measured postprandial blood glucose values for correlations with 1,5-ag values over prespecified preceding time periods ( 3 days , 1 week , and weekly up to 12 weeks).results the correlation coefficients for postprandial glucose values were 0.34 ( p < 0.05 ) for 3 days , 0.38 ( p <
0.001 ) for 1 week , and 0.40 ( p <
0.001 ) for 2 weeks preceding the measurement of 1,5-ag .
correlations declined for time periods > 2 weeks before measurement of 1,5-ag .
the correlation was lower with fasting / preprandial plasma glucose levels .
there was no time dependency for the correlation between a1c and fasting or postprandial glucose.conclusions1,5-ag best reflected the 2-h postprandial glucose values of the 2 previous weeks . |
PubmedSumm7831 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: more than 26% of older americans have impaired glucose tolerance ( igt ) ( 1 ) , increasing their risk for developing type 2 diabetes .
a sedentary lifestyle may further increase this risk through changes in skeletal muscle morphology and insulin signaling that worsen insulin resistance .
we ( 2,3 ) and others ( 4,5 ) report low skeletal muscle capillarization in sedentary , insulin - resistant subjects that is inversely associated with the degree of glucose tolerance ( 2 ) and directly associated with insulin sensitivity ( 4,5 ) in cross - sectional studies .
as the major interface between the circulation and skeletal muscle , the microvasculature affects a number of physiological processes , including insulin resistance .
transcapillary transport of insulin is an important determinant of glucose uptake in skeletal muscle ( 6 ) and is a rate - limiting step for insulin action ( 7,8 ) .
the reduced capillary surface area in igt and type 2 diabetes is associated with lower glucose uptake during insulin infusion ( 9 ) ; therefore , low skeletal muscle capillarization , along with defects in insulin signaling , can contribute to insulin resistance in igt and type 2 diabetes by decreasing the available surface area for diffusion of insulin and glucose ( 10,11 ) .
lifestyle interventions including aerobic exercise and weight loss ( aex+wl ) are a cornerstone of the treatment of insulin resistance and can prevent progression from igt to type 2 diabetes in older people ( 12,13 ) .
aex training increases skeletal muscle capillarization in healthy adults ( 1418 ) , but less is known about its effects on skeletal muscle capillarization in insulin - resistant subjects .
one study showed that aex training increases skeletal muscle capillarization in subjects with igt ( 19 ) and such an increase in capillarization after aex+wl may represent a mechanism for enhancing insulin and glucose delivery to skeletal muscle to improve insulin sensitivity .
we hypothesized that a 6-month aex+wl program would increase skeletal muscle capillarization in older adults with igt , and that the increase in capillarization would translate to improvements in insulin sensitivity and glucose tolerance . to test this hypothesis , we examined skeletal muscle capillarization , glucose tolerance , and insulin sensitivity during hyperinsulinemic - euglycemic clamps before and after 6 months of aex+wl in overweight - obese , older adults with igt .
men and postmenopausal women 5080 years of age , who were nonsmokers and had no previous diagnosis of diabetes or cardiovascular disease , were recruited from the baltimore , md , regional area to participate in studies examining metabolic responses to aex+wl .
data from eight men and eight women ( mean age 63 2 years ) with igt and skeletal muscle samples for assessment of capillarization are reported herein ; subject characteristics and certain metabolic data from a larger sample of the subjects were previously reported ( 20,21 ) .
subjects were all weight stable ( < 2.0 kg weight change in past year ) , sedentary ( < 20 min of aerobic exercise two times per week ) , and screened by medical history questionnaire , physical examination , and fasting blood profile .
subjects were screened for igt by oral glucose tolerance tests ( ogtts ) according to american diabetes association criteria ( 22 ) .
all subjects were nonsmokers and showed no evidence of cancer ; liver , renal , or hematological disease ; or other medical disorders .
subjects taking medications for hypertension or dyslipidemia were included if medically stable and if medications were not known to affect glucose metabolism .
the research protocols were approved by the institutional review board at the university of maryland school of medicine .
prior to metabolic testing , subjects received 68 weeks of instruction on the therapeutic lifestyle changes diet ( 23 ) in order to minimize potential confounding by changes in dietary composition during the intervention .
subjects followed the dietary guidelines and were weight stable for at least 2 weeks prior to baseline testing .
after baseline testing , subjects were instructed to maintain the diet , and all subjects attended weekly weight loss classes for 6 months led by a registered dietitian .
individuals were counseled to restrict their caloric intake by 300500 kcal / day to achieve > 5% weight loss during the intervention .
compliance was monitored by 7-day food records using the american diabetes association exchange list system .
in addition , all subjects underwent 6 months of supervised aex training on treadmills at the baltimore veterans affairs medical center geriatric research , education , and clinical center exercise facility .
exercise intensity was prescribed by target heart rate range calculated using the karvonen formula ( 24 ) ; heart rates were monitored during exercise with chest - strap heart rate monitors ( polar electro inc . , lake success , ny ) .
aex training began at a volume of three sessions per week of 20 min at 50% of heart rate reserve , and gradually increased to three sessions per week of 45 min at 85% of heart rate reserve , a level maintained for > 4 months .
fat mass , fat - free mass , and percent body fat were measured with dual - energy x - ray absorptiometry ( prodigy ; lunar radiation corp .
intra - abdominal ( iaf ) and subcutaneous abdominal ( saf ) fat areas were determined by a computed tomography scan at l4-l5 region using a siemens somatom sensation 64 scanner ( fairfield , ct ) and medical image processing , analysis and visualization software ( mipav v.7.0.0 ; nih , bethesda , md ) . maximal oxygen consumption ( vo2max )
was measured by indirect calorimetry during a graded treadmill exercise test on a motorized treadmill .
subjects walked at a constant velocity throughout the protocol ; grade was initially set to 0% and increased every 2 min thereafter to maximal effort .
vo2max was defined as the highest oxygen consumption value obtained for a full 30-s increment .
attainment of vo2max was verified by standard physiological criteria ( respiratory exchange ratio > 1.10 or a plateau in vo2 with an increase in workload ) .
a catheter was placed in an antecubital vein and blood samples were drawn before and 30 , 60 , 90 , and 120 min after the ingestion of a 75-g glucose solution .
plasma glucose levels were analyzed with a glucose analyzer ( 2300 stat plus ; ysi , yellow springs , oh ) .
plasma insulin levels were determined by radioimmunoassay ( millipore , st . charles , mo ) .
glucose ( gauc ) and insulin ( iauc ) areas under the curve during the ogtt were calculated using the trapezoidal method .
the homeostatic model assessment for insulin resistance was calculated as described by matthews et al .
insulin - stimulated glucose uptake ( m ) was measured as an index of insulin sensitivity .
subjects were provided with all meals for the 2 days preceding the clamp to control nutrient intake . after a 12-h overnight fast , subjects underwent the hyperinsulinemic - euglycemic glucose clamp ( 26,27 ) as performed in our laboratory ( 20 ) .
insulin was infused at a rate of 555 pmol / m / min , and m is reported in micromoles of glucose infused per kilogram of fat - free mass per minute ( mol / kg ffm / min ) .
clamp data were not available for one subject after aex+wl due to a technical problem .
plasma glucose levels were analyzed at 5-min intervals using the glucose oxidase method ( beckman instruments , fullerton , ca ) .
plasma insulin levels were determined by radioimmunoassay ( millipore , st . charles , mo ) . mean insulin and glucose levels during the clamp were 1,131 32
mmol / l , respectively , and did not differ before and after aex+wl ( p > 0.4 ) .
percutaneous needle biopsies were obtained from the vastus lateralis , 1213 cm above the patella on the anterolateral aspect of the right thigh using a bergstrom needle ( stille , solna , sweden ) as previously described ( 28 ) .
muscle samples were rapidly embedded in optimal cutting temperature - tragacanth gum mixture , frozen , and stored at 80c for histochemical analyses .
muscle was sectioned to a thickness of 14 m on a cryostat and capillaries were identified using a modified double - stain technique ( 29 ) . in brief ,
sections were then incubated with primary antibodies ( ulex europaeus agglutinin i for endothelial cells and mouse anticollagen iv for muscle fiber perimeters ) and secondary antibodies ( rabbit anti - ulex europaeus , goat anti - rabbit , and goat anti - mouse ) .
sections were then reacted with avidin - biotinylated alkaline phosphatase ( abc / ap ; dako , carpinteria , ca ) and the new fuchsin substrate system ( dako , carpinteria , ca ) .
immunostained muscle sections were viewed under a light microscope and digital images were obtained ( eclipse ti ; nikon instruments inc . ,
quantification of capillarization was performed on at least 50 fibers for each sample ( mean = 69 4 fibers / sample ) ; sampling a larger number of fibers does not improve the estimation of capillarization in human muscle ( 30 ) .
the following four indices of capillarization were measured : 1 ) capillary contacts ( the number of capillaries in contact with each muscle fiber ) , 2 ) individual capillary - to - fiber ratio ( the number of whole capillary equivalents in contact with each muscle fiber ) , 3 ) capillary density ( cd ; the number of capillaries per mm of muscle cross - sectional area ) , and 4 ) capillary - to - fiber perimeter exchange index ( the number of capillaries per mm of muscle fiber perimeter ) . for each vastus
lateralis sample , a serial section was obtained and fiber type was determined using a myosin atpase technique . after an initial 5-min incubation in an acid solution ( 0.4% sodium acetate , 0.6% sodium barbital , and 0.04 n hydrochloric acid ) , the samples
were incubated for 45 min in an atp reaction solution ( 0.6% glycine , 0.6% calcium chloride , 0.4% sodium chloride , 0.3% sodium hydroxide , and 0.17% atp ) .
this was followed by a 3-min incubation in 1% calcium chloride , a 3-min incubation in 2% cobalt chloride , and a 1-min incubation in 0.2% ammonium sulfide .
stained sections viewed under a light microscope and digital images were obtained ( eclipse ti ) .
the primary study outcomes were skeletal muscle capillarization , m , fasting plasma glucose , plasma glucose response to an ogtt , and vo2max .
secondary variables included fasting plasma insulin , plasma insulin response to an ogtt , and body composition .
statistical analyses were performed using spss v12.0 ( ibm , armonk , ny ) . repeated - measures anova was used to test for differences in outcome variables after aex+wl , with sex used as a covariate in all analyses .
regression analyses were used to test for associations between capillarization variables and other primary and secondary variables ; multivariable regression accounting for age , sex , and/or baseline levels of primary outcome variables was conducted where indicated . a type i error rate of = 0.05 was selected , and two - tailed probabilities are reported for all analyses .
men and postmenopausal women 5080 years of age , who were nonsmokers and had no previous diagnosis of diabetes or cardiovascular disease , were recruited from the baltimore , md , regional area to participate in studies examining metabolic responses to aex+wl .
data from eight men and eight women ( mean age 63 2 years ) with igt and skeletal muscle samples for assessment of capillarization are reported herein ; subject characteristics and certain metabolic data from a larger sample of the subjects were previously reported ( 20,21 ) .
subjects were all weight stable ( < 2.0 kg weight change in past year ) , sedentary ( < 20 min of aerobic exercise two times per week ) , and screened by medical history questionnaire , physical examination , and fasting blood profile .
subjects were screened for igt by oral glucose tolerance tests ( ogtts ) according to american diabetes association criteria ( 22 ) .
all subjects were nonsmokers and showed no evidence of cancer ; liver , renal , or hematological disease ; or other medical disorders .
subjects taking medications for hypertension or dyslipidemia were included if medically stable and if medications were not known to affect glucose metabolism .
the research protocols were approved by the institutional review board at the university of maryland school of medicine .
prior to metabolic testing , subjects received 68 weeks of instruction on the therapeutic lifestyle changes diet ( 23 ) in order to minimize potential confounding by changes in dietary composition during the intervention .
subjects followed the dietary guidelines and were weight stable for at least 2 weeks prior to baseline testing .
after baseline testing , subjects were instructed to maintain the diet , and all subjects attended weekly weight loss classes for 6 months led by a registered dietitian .
individuals were counseled to restrict their caloric intake by 300500 kcal / day to achieve > 5% weight loss during the intervention .
compliance was monitored by 7-day food records using the american diabetes association exchange list system .
in addition , all subjects underwent 6 months of supervised aex training on treadmills at the baltimore veterans affairs medical center geriatric research , education , and clinical center exercise facility .
exercise intensity was prescribed by target heart rate range calculated using the karvonen formula ( 24 ) ; heart rates were monitored during exercise with chest - strap heart rate monitors ( polar electro inc . , lake success , ny ) .
aex training began at a volume of three sessions per week of 20 min at 50% of heart rate reserve , and gradually increased to three sessions per week of 45 min at 85% of heart rate reserve , a level maintained for > 4 months .
fat mass , fat - free mass , and percent body fat were measured with dual - energy x - ray absorptiometry ( prodigy ; lunar radiation corp . ,
intra - abdominal ( iaf ) and subcutaneous abdominal ( saf ) fat areas were determined by a computed tomography scan at l4-l5 region using a siemens somatom sensation 64 scanner ( fairfield , ct ) and medical image processing , analysis and visualization software ( mipav v.7.0.0 ; nih , bethesda , md ) .
maximal oxygen consumption ( vo2max ) was measured by indirect calorimetry during a graded treadmill exercise test on a motorized treadmill .
subjects walked at a constant velocity throughout the protocol ; grade was initially set to 0% and increased every 2 min thereafter to maximal effort .
vo2max was defined as the highest oxygen consumption value obtained for a full 30-s increment .
attainment of vo2max was verified by standard physiological criteria ( respiratory exchange ratio > 1.10 or a plateau in vo2 with an increase in workload ) .
a catheter was placed in an antecubital vein and blood samples were drawn before and 30 , 60 , 90 , and 120 min after the ingestion of a 75-g glucose solution .
plasma glucose levels were analyzed with a glucose analyzer ( 2300 stat plus ; ysi , yellow springs , oh ) .
plasma insulin levels were determined by radioimmunoassay ( millipore , st . charles , mo ) .
glucose ( gauc ) and insulin ( iauc ) areas under the curve during the ogtt were calculated using the trapezoidal method .
the homeostatic model assessment for insulin resistance was calculated as described by matthews et al .
insulin - stimulated glucose uptake ( m ) was measured as an index of insulin sensitivity .
subjects were provided with all meals for the 2 days preceding the clamp to control nutrient intake . after a 12-h overnight fast , subjects underwent the hyperinsulinemic - euglycemic glucose clamp ( 26,27 ) as performed in our laboratory ( 20 ) .
insulin was infused at a rate of 555 pmol / m / min , and m is reported in micromoles of glucose infused per kilogram of fat - free mass per minute ( mol / kg ffm / min ) .
clamp data were not available for one subject after aex+wl due to a technical problem .
plasma glucose levels were analyzed at 5-min intervals using the glucose oxidase method ( beckman instruments , fullerton , ca ) .
pmol / l and 5.1 0.1 mmol / l , respectively , and did not differ before and after aex+wl ( p > 0.4 ) .
percutaneous needle biopsies were obtained from the vastus lateralis , 1213 cm above the patella on the anterolateral aspect of the right thigh using a bergstrom needle ( stille , solna , sweden ) as previously described ( 28 ) .
muscle samples were rapidly embedded in optimal cutting temperature - tragacanth gum mixture , frozen , and stored at 80c for histochemical analyses .
muscle was sectioned to a thickness of 14 m on a cryostat and capillaries were identified using a modified double - stain technique ( 29 ) . in brief ,
sections were then incubated with primary antibodies ( ulex europaeus agglutinin i for endothelial cells and mouse anticollagen iv for muscle fiber perimeters ) and secondary antibodies ( rabbit anti - ulex europaeus , goat anti - rabbit , and goat anti - mouse ) .
sections were then reacted with avidin - biotinylated alkaline phosphatase ( abc / ap ; dako , carpinteria , ca ) and the new fuchsin substrate system ( dako , carpinteria , ca ) . immunostained muscle sections were viewed under a light microscope and digital images were obtained ( eclipse ti ; nikon instruments inc . , melville , ny ) .
quantification of capillarization was performed on at least 50 fibers for each sample ( mean = 69 4 fibers / sample ) ; sampling a larger number of fibers does not improve the estimation of capillarization in human muscle ( 30 ) .
the following four indices of capillarization were measured : 1 ) capillary contacts ( the number of capillaries in contact with each muscle fiber ) , 2 ) individual capillary - to - fiber ratio ( the number of whole capillary equivalents in contact with each muscle fiber ) , 3 ) capillary density ( cd ; the number of capillaries per mm of muscle cross - sectional area ) , and 4 ) capillary - to - fiber perimeter exchange index ( the number of capillaries per mm of muscle fiber perimeter ) .
for each vastus lateralis sample , a serial section was obtained and fiber type was determined using a myosin atpase technique . after an initial 5-min incubation in an acid solution ( 0.4% sodium acetate , 0.6% sodium barbital , and 0.04 n hydrochloric acid ) , the samples were incubated for 45 min in an atp reaction solution ( 0.6% glycine , 0.6% calcium chloride , 0.4% sodium chloride , 0.3% sodium hydroxide , and 0.17% atp ) .
this was followed by a 3-min incubation in 1% calcium chloride , a 3-min incubation in 2% cobalt chloride , and a 1-min incubation in 0.2% ammonium sulfide .
stained sections viewed under a light microscope and digital images were obtained ( eclipse ti ) .
the primary study outcomes were skeletal muscle capillarization , m , fasting plasma glucose , plasma glucose response to an ogtt , and vo2max .
secondary variables included fasting plasma insulin , plasma insulin response to an ogtt , and body composition .
repeated - measures anova was used to test for differences in outcome variables after aex+wl , with sex used as a covariate in all analyses .
regression analyses were used to test for associations between capillarization variables and other primary and secondary variables ; multivariable regression accounting for age , sex , and/or baseline levels of primary outcome variables was conducted where indicated .
a type i error rate of = 0.05 was selected , and two - tailed probabilities are reported for all analyses .
subject characteristics , body composition , and cardiorespiratory fitness levels before and after 6-month aex+wl are presented in table 1 . in response to the aex+wl intervention
, subjects reduced their body weight and fat mass by 8% and their bmi by 7% ( p
the subjects did not have a statistically significant reduction in iaf , but did reduce saf by 9% ( p = 0.007 ) .
the subjects significantly increased vo2max ( l / min ) by 18% ( p = 0.02 ) .
subject characteristics and responses to 6-month aex+wl aex+wl significantly increased skeletal muscle capillarization ( table 2 ) , with a 15% increase in cd ( p = 0.01 ) , a 14% increase in capillary - to - fiber perimeter exchange index ( p = 0.004 ) , and a greater number of capillaries in contact with each skeletal muscle fiber ( capillary contacts and capillary - to - fiber ratio , p < 0.05 ) . the proportion of type i or ii muscle fibers did not change after aex+wl ( 65 4 vs. 67 5% type i fibers , p = 0.75 ) nor did skeletal muscle fiber area and perimeter ( 2% difference , p > 0.68 ) .
these results indicate that the increase in cd was due to an increase in the number of capillaries , not a reduction in muscle fiber size .
skeletal muscle capillarization , glucose tolerance , and insulin sensitivity before and after 6-month aex+wl data from glucose tolerance tests and hyperinsulinemic - euglycemic clamps are presented in table 2 .
fasting plasma glucose and insulin concentrations were numerically lower after aex+wl , but the differences were not statistically significant .
aex+wl reduced 120-min postprandial glucose concentrations ( g120 ) by 16% ( p = 0.008 ) , reduced 120-min postprandial insulin concentrations by 31% ( p = 0.04 ) , and reduced gauc by 10% ( p = 0.03 ) .
likewise , aex+wl increased m ( mol / kg ffm / min ) by 21% ( p = 0.04 ) . at baseline , m ( mol / kg ffm / min ) directly correlated with cd ( r = 0.62 , p = 0.01 ) and tended to inversely correlate with iaf ( r = 0.49 , p = 0.07 ) in bivariate analyses .
m was not associated with the proportion of type i or ii muscle fibers ( r = 0.00.27 , p > 0.33 for all ) .
baseline g120 correlated only with cd ( r = 0.68 , p = 0.004 ) .
in multivariable regression analyses accounting for age , sex , and body weight in the model , baseline cd was the only variable independently associated with m ( partial r = 0.58 , p = 0.04 ) ( fig .
1a ) and g120 ( partial r = 0.60 , p = 0.03 ) ( fig .
inclusion of iaf as an independent variable slightly reduced the overall r values in the regression models but did not affect the independent relationships ( partial r values ) between cd and m or g120 in the models .
scatterplots depicting the relationships between skeletal muscle cd and insulin sensitivity ( m ) ( a ) and 120-min postprandial glucose ( g120 ) ( b ) at baseline in overweight - obese , older adults with igt .
bivariate correlation coefficients are shown in the figures ; partial correlation coefficients from regression models are r = 0.58 and r = 0.60 , respectively .
after aex+wl , the change in m ( mol / kg ffm / min ) directly correlated with the change in cd ( r = 0.53 , p = 0.04 ) but not with the changes in vo2max , body weight , body fat , iaf , or saf ( r = 0.19 to 0.29 , p > 0.33 ) in bivariate analyses .
likewise , the change in g120 inversely correlated with the change in cd ( r = 0.51 , p = 0.04 ) . in multivariable regression analyses accounting for age , sex , and the change in body weight , the aex+wl - induced increase in cd independently correlated with the increase in m ( partial r = 0.74 , p = 0.006 ) ( fig
. 2a ) and the decrease in g120 ( partial r = 0.55 , p = 0.04 ) ( fig .
2b ) . scatterplots depicting the relationships between the aex+wl - induced change in skeletal muscle cd and insulin sensitivity ( m ) ( a ) and 120-min postprandial glucose ( g120 ) ( b ) in overweight - obese older adults with igt .
bivariate correlation coefficients are shown in the figures ; partial correlation coefficients from regression models are r = 0.74 , p = 0.006 and r = 0.55 , p = 0.04 , respectively .
subject characteristics , body composition , and cardiorespiratory fitness levels before and after 6-month aex+wl are presented in table 1 . in response to the aex+wl intervention
, subjects reduced their body weight and fat mass by 8% and their bmi by 7% ( p
the subjects did not have a statistically significant reduction in iaf , but did reduce saf by 9% ( p = 0.007 ) .
the subjects significantly increased vo2max ( l / min ) by 18% ( p = 0.02 ) .
subject characteristics and responses to 6-month aex+wl aex+wl significantly increased skeletal muscle capillarization ( table 2 ) , with a 15% increase in cd ( p = 0.01 ) , a 14% increase in capillary - to - fiber perimeter exchange index ( p = 0.004 ) , and a greater number of capillaries in contact with each skeletal muscle fiber ( capillary contacts and capillary - to - fiber ratio , p < 0.05 ) . the proportion of type i or ii muscle fibers did not change after aex+wl ( 65 4 vs. 67 5% type i fibers , p = 0.75 ) nor did skeletal muscle fiber area and perimeter ( 2% difference , p > 0.68 ) .
these results indicate that the increase in cd was due to an increase in the number of capillaries , not a reduction in muscle fiber size .
skeletal muscle capillarization , glucose tolerance , and insulin sensitivity before and after 6-month aex+wl data from glucose tolerance tests and hyperinsulinemic - euglycemic clamps are presented in table 2 .
fasting plasma glucose and insulin concentrations were numerically lower after aex+wl , but the differences were not statistically significant .
aex+wl reduced 120-min postprandial glucose concentrations ( g120 ) by 16% ( p = 0.008 ) , reduced 120-min postprandial insulin concentrations by 31% ( p = 0.04 ) , and reduced gauc by 10% ( p = 0.03 ) .
likewise , aex+wl increased m ( mol / kg ffm / min ) by 21% ( p = 0.04 ) .
at baseline , m ( mol / kg ffm / min ) directly correlated with cd ( r = 0.62 , p = 0.01 ) and tended to inversely correlate with iaf ( r = 0.49 , p = 0.07 ) in bivariate analyses .
m was not associated with the proportion of type i or ii muscle fibers ( r = 0.00.27 , p > 0.33 for all ) .
baseline g120 correlated only with cd ( r = 0.68 , p = 0.004 ) .
in multivariable regression analyses accounting for age , sex , and body weight in the model , baseline cd was the only variable independently associated with m ( partial r = 0.58 , p = 0.04 ) ( fig .
1a ) and g120 ( partial r = 0.60 , p = 0.03 ) ( fig .
inclusion of iaf as an independent variable slightly reduced the overall r values in the regression models but did not affect the independent relationships ( partial r values ) between cd and m or g120 in the models .
scatterplots depicting the relationships between skeletal muscle cd and insulin sensitivity ( m ) ( a ) and 120-min postprandial glucose ( g120 ) ( b ) at baseline in overweight - obese , older adults with igt .
bivariate correlation coefficients are shown in the figures ; partial correlation coefficients from regression models are r = 0.58 and r = 0.60 , respectively .
after aex+wl , the change in m ( mol / kg ffm / min ) directly correlated with the change in cd ( r = 0.53 , p = 0.04 ) but not with the changes in vo2max , body weight , body fat , iaf , or saf ( r = 0.19 to 0.29 , p > 0.33 ) in bivariate analyses .
likewise , the change in g120 inversely correlated with the change in cd ( r = 0.51 , p = 0.04 ) . in multivariable regression analyses accounting for age , sex , and the change in body weight , the aex+wl - induced increase in cd independently correlated with the increase in m ( partial r = 0.74 , p = 0.006 ) ( fig .
2a ) and the decrease in g120 ( partial r = 0.55 , p = 0.04 ) ( fig .
scatterplots depicting the relationships between the aex+wl - induced change in skeletal muscle cd and insulin sensitivity ( m ) ( a ) and 120-min postprandial glucose ( g120 ) ( b ) in overweight - obese older adults with igt .
bivariate correlation coefficients are shown in the figures ; partial correlation coefficients from regression models are r = 0.74 , p = 0.006 and r = 0.55 , p = 0.04 , respectively .
insulin resistance and diabetes are health problems that affect more than one - third of older adults .
although lifestyle interventions including exercise and weight loss can improve glucose tolerance and reduce risk for type 2 diabetes ( 12,13 ) , many of the underlying mechanisms remain elusive .
the current study shows that despite the capillary rarefaction found in the skeletal muscle of sedentary , older adults with igt , aex+wl significantly increases skeletal muscle capillarization .
furthermore , this is the first study to show that increases in capillarization are directly associated with improvements in glucose tolerance and insulin sensitivity measured during a hyperinsulinemic - euglycemic clamp to our knowledge .
therefore , despite impaired angiogenesis and capillary rarefaction in sedentary people with insulin resistance and igt , the ability to increase capillarization in skeletal muscle is maintained and likely contributes to aex+wl - induced improvements in insulin sensitivity in older adults at risk for type 2 diabetes .
skeletal muscle capillarization increases after aex training in healthy young ( 14,18 ) and older ( 15,17 ) subjects ; however , few studies have examined the effects of aex training with or without wl on capillarization in subjects with igt or type 2 diabetes to date . in one study ,
aex training increased capillarization by 10% in a small group of men with igt ( 19 ) .
our results are concordant with these findings , indicating that skeletal muscle capillarization does increase with aex+wl in both men and women with igt .
another study using a combined aex and strength training intervention showed an increase in the number of capillaries per fiber and in muscle fiber size , but no change in cd in subjects with type 2 diabetes ( 31 ) .
the maintenance of cd with increases in fiber size in that study suggests that angiogenesis occurred in skeletal muscle and that diabetes - associated capillary rarefaction may be reversible . as there were no changes in fiber size after aex+wl in our study , increases in capillarization were consistent across the measurements we report .
weight loss independent of aex may not be associated with an increase in skeletal muscle capillarization ( 32 ) ; however , one study showed increases in cd with large amounts ( > 20% ) of weight loss ( 33 ) . additional study is required to distinguish the independent effects of aex and wl on skeletal muscle capillarization in older subjects with igt .
previous cross - sectional studies from our group and others demonstrate relationships between skeletal muscle capillarization and insulin sensitivity or glucose tolerance ( 25 ) .
the longitudinal study design in the present report allowed us to test the effects of an aex+wl intervention that targets skeletal muscle , and to examine its effects on skeletal muscle capillarization and changes in glucose metabolism .
concordant with previous studies ( 25 ) , we find a direct relationship between capillarization and insulin sensitivity at baseline .
furthermore , our results show a strong relationship between aex+wl - induced changes in capillarization and insulin sensitivity in people at high risk for type 2 diabetes .
although these data do not demonstrate true causality , data from animal models do demonstrate a direct role of capillarization in determining insulin sensitivity .
for example , vollus et al . ( 34 ) show that a graded occlusion of capillaries in a rodent model reduces insulin action and causes a stepwise reduction in insulin - stimulated glucose uptake in skeletal muscle ranging from 9 to 60% .
impairments in the recruitment and perfusion of capillaries by insulin also contribute to insulin resistance in humans and animals ( see reference 35 for review ) ; thus , it stands to reason that by having more capillaries in skeletal muscle , there is a larger capillary surface area that can be recruited and perfused in response to insulin .
aex training also improves endothelial vasoreactivity in subjects with igt , which may play a role in improving insulin sensitivity through increased blood flow ( 36 ) ; however , the effects of capillarization and capillary recruitment appear to be independent of blood flow ( 11 ) .
collectively , these findings support the conclusion that aex+wl - induced increases in capillarization contribute to improvements in insulin sensitivity in older subjects with igt . in this study , subjects with igt improved insulin sensitivity by > 20% and improved glucose tolerance to near - normal levels ( g120 = 7.85 mmol / l ) , with 9 of the 16 subjects reverting to normal glucose tolerance after 6 months of aex+wl . apart from skeletal muscle capillarization , other mechanisms including improvements in insulin signaling , gene and protein expression , glut4 content and translocation ( see reference 37 for review ) , and body composition ( 3840 )
we did not find a significant relationship between changes in insulin sensitivity and body weight or body composition in the current study , but our group previously showed that aex+wl - induced increases in glycogen synthase activity are directly associated with improvements in insulin sensitivity ( 20 ) .
we did not assess these intramuscular mechanisms in the current study ; thus , it is likely that increases in skeletal muscle capillarization work in tandem with these mechanisms to increase insulin action and improve insulin sensitivity in people with igt .
studies are in progress to determine the relative contribution of capillarization and intramuscular mechanisms to aex- and wl - induced improvements in insulin sensitivity . in summary , these results show that skeletal muscle capillarization significantly increases after a 6-month aex+wl intervention in previously sedentary older adults with igt , and that there is a direct relationship between the increase in capillarization and the improvements in glucose tolerance and insulin sensitivity .
these findings add further support to the concept that lifestyle interventions including aex+wl will improve insulin sensitivity and reduce risk for type 2 diabetes , and indicate that increased skeletal muscle capillarization is one mechanism by which these metabolic improvements occur in overweight - obese , older adults with igt .
Output:
| objectivetranscapillary transport of insulin is one determinant of glucose uptake by skeletal muscle ; thus , a reduction in capillary density ( cd ) may worsen insulin sensitivity .
skeletal muscle cd is lower in older adults with impaired glucose tolerance ( igt ) compared with those with normal glucose tolerance and may be modifiable through aerobic exercise training and weight loss ( aex+wl ) .
we tested the hypothesis that 6-month aex+wl would increase cd to improve insulin sensitivity and glucose tolerance in older adults with igt.research design and methodssixteen sedentary , overweight - obese ( bmi 2735 kg / m2 ) , older ( 63 2 years ) men and women with igt underwent hyperinsulinemic - euglycemic clamps to measure insulin sensitivity , oral glucose tolerance tests , exercise and body composition testing , and vastus lateralis muscle biopsies to determine cd before and after 6-month aex+wl.resultsinsulin sensitivity ( m ) and 120-min postprandial glucose ( g120 ) correlated with cd at baseline ( r = 0.58 and r = 0.60 , respectively , p < 0.05 ) .
aex+wl increased maximal oxygen consumption ( vo2max ) 18% ( p = 0.02 ) and reduced weight and fat mass 8% ( p < 0.02 ) .
cd increased 15% ( 264 11 vs. 304 14 capillaries / mm2 , p = 0.01 ) , m increased 21% ( 42.4 4.0 vs. 51.4 4.3 mol / kg ffm / min , p < 0.05 ) , and g120 decreased 16% ( 9.35
0.5 vs. 7.85 0.5 mmol / l , p = 0.008 ) after aex+wl .
regression analyses showed that the aex+wl - induced increase in cd independently predicted the increase in m ( r = 0.74 , p < 0.01 ) as well as the decrease in g120 ( r = 0.55 , p < 0.05).conclusionssix - month aex+wl increases skeletal muscle cd in older adults with igt .
this represents one mechanism by which aex+wl improves insulin sensitivity in older adults with igt . |
PubmedSumm7832 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: imatinib has radically changed prognosis in chronic - phase chronic myeloid leukemia ( cml ) , with 90% overall survival rate at 8 yrs , and 4070% of patients achieving a stable mmr .
even better results have been reported in terms of cytogenetic and molecular responses and the rate of progression to accelerated / blast phase using second - generation tyrosine - kinase inhibitors ( tki ) first - line .
physicians are no longer familiar with resistant chronic - phase cml and are particularly frustrated when facing primary resistance to tkis , as it is quite uncommon and related to still poorly understood mechanisms .
point mutations within the bcr - abl kinase domain account for 5060% of cases of secondary resistance to imatinib and to a lesser extent to secondary resistance to second - generation tkis .
however , abl mutations are less frequently detected in primary resistant patients and mutational analysis is not required by european leukemianet ( eln ) recommendations at diagnosis .
we report a cml patient who showed resistance to multiple tkis because of different emerging abl mutations , but who showed an admirable and incredible perseverance in the pursuit of her personal aims .
our patient ( a 24-year - old woman ) arrived in italy from eastern europe in march 2013 as an illegal immigrant .
her blood counts were as follows : leukocytes 410.710/l , platelets 39110/l , hb 11 g / dl , with immature myeloid cells at differential count .
cytogenetic analysis on the bone marrow aspirate revealed t(9;22)(q34;q11 ) in 20/20 metaphases without additional abnormalities , and a bcr - abl rearrangement ( e14a2 ) was detected by qualitative rt - pcr .
two leukapheresis procedures were performed and cytarabine ( 800 mg for two doses ) was administered .
twenty days after admission imatinib therapy was started at the dose of 400 mg od . at this time
the blood counts were : leukocytes 37.410/l , platelets 55110/l and hb 12 g / dl .
an abl mutational analysis was performed , although it was not required according to eln recommendations in chronic phase at diagnosis , and an f317l mutation was detected by sanger sequencing .
this mutation is resistant to dasatinib and sensitive to imatinib albeit with higher ic50 than wild type abl .
accordingly , the imatinib dose was increased to 400 mg bid , but two months later hematologic response was still inadequate .
considering the low age and the poor response we applied for nilotinb availability to treat our patient , although she was living in italy without regular assistance from the national health system .
nilotinib therapy was authorized by local regulatory agency and was started in september 2013 at the dose of 400 mg bid .
a complete hematologic response was achieved , but after three months of therapy the bcr - abl transcript level was still high ( bcr - abl / abl 23% is ) without any cytogenetic response .
the mutational analysis was repeated and two further mutations ( f359v , e255v ) both resistant to nilotinib were discovered . a switch to ponatinib therapy
was planned ( according to an individual use program ) but at the end of january 2014 the patient communicated to be pregnant , despite repeated and clear discouragement to conceive .
nilotinib was immediately discontinued ( 6 weeks gestation ) and elective abortion was suggested , because of risk of fetal abnormalities and refractory disease requiring treatment .
the patient initially agreed ; however , just prior to undergo the procedure she decided to continue with her pregnancy , due to her own religious beliefs and desire of motherhood . in the meanwhile ,
a spontaneous and unexpected lowering of leukocyte count was observed that allowed the patient to remain without treatment until may 2014 .
then , ifn treatment was refused by our patient and hydroxyurea therapy was started to control the disease ( 22 weeks gestation ) .
a follow - up with ultrasound scan during the course of the pregnancy was unremarkable .
pregnancy was uneventful and at 36 weeks gestation a healthy male infant was born after induction of delivery ( weight : 2.4 kg ) .
lactation was inhibited and ponatinib was started ( 45 mg od ) . at this time
, cytogenetic analysis showed 8/8 ph - positive metaphases ; bcr - abl transcript level was 63% is and a double bcr - abl rearrangement was detected by fish analysis .
the patient is still on ponatinib at the dose of 15 mg od due to recurrent grade iii cytopenia and the transcript level was 4.28% is at the last check - up .
the patient has two younger sisters ( 17-year old twins ) and one brother who are not allowed to move to italy and could therefore not be tested for the hla compatibility .
a full - matched hla identical unrelated donor has been identified , but the patient decided to postpone the allogeneic transplant as she is not able to manage the predictable issues related to the procedure in the absence of an adequate familial support . in this case
we had to face two serious concurrent problems : refractory cml and conception under second - line tki .
abl mutations selected in sequence by the tki in use were apparently responsible for resistance to multiple tki , but in addition genetic instability typical of a more advanced phase might be hypothesized in a patient who had most likely ignored her disease for months .
ponatinib has been proven to be effective in heavily pretreated cml patients independent of the presence of abl mutations .
allogeneic stem cell transplantation seems to be the only meaningful option in this case , but we do not know if our patient will ever undergo the procedure .
whereas some reassuring data exists on unplanned conception under imatinib treatment , very little information is available about the safety of conception under nilotinib , and female patients in reproductive age are strongly advised to use effective methods of contraception while receiving tkis .
the management of the pregnancy posed challenges to both the patient and the physicians , as our patient became pregnant on nilotinib while strictly requiring treatment to control her disease .
moreover , it required delicate attention to important ethical and psychosocial issues , including as well as cultural sensibilities .
so far , the patient has been confident in the good outcome of the whole clinical course , often reassuring her increasingly worried physicians with a smile and pictures of her son .
this case reminds us that ( i ) cml is still a life - threatening disease and we should not to lower our guard , despite excellent results in the majority of patients and multiple tkis available ; ( ii ) patients ' personal social contexts and wishes have to be respected , even if they contrast with rational adherence to the treatment guidelines ; and ( iii ) a patient 's perseverance and optimism are invaluable in the fight against leukemia .
were responsible for the clinical management of the patient , acquisition of data , drafting the manuscript .
Output:
| primary resistance to tyrosine - kinase inhibitors ( tkis ) is quite uncommon in chronic - phase chronic myeloid leukemia ( cml ) and related to still poorly understood mechanisms , as abl mutations are rarely detected in primary resistant patients .
we report the challenging case of a cml patient who was resistant to multiple tkis because of different emerging abl mutations and became pregnant while on nilotinib therapy despite repeated and clear discouragement to conceive .
she decided to continue with her pregnancy , showing an admirable and incredible perseverance in the pursuit of her personal aims . |
PubmedSumm7833 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: there is a long history of reconstructing ocular function with biomaterials , particularly in the outer segment of the eye where various lens materials have been employed as contact and intraocular lenses .
the discovery of the possible use of biomaterials in the eye started after the discovery of windshield plexiglass materials lodged in the cornea of a world war ii fighter pilot without major side effects .
since then , a number of synthetic materials have been explored as biomaterials for the eye . while millions of intraocular lenses , contact lenses or various devices have been utilized on patients around the world , development of a synthetic corneal substitute has had little success . in the meantime , the field of tissue engineering and regenerative medicine developed as a major force in creating tissue substitutes .
the general approach of tissue engineering is to employ biomaterials as temporary scaffolds to support and direct cells to form new tissue .
biological cues , in the form of growth factors , small molecules or even gene therapy can also play important roles in directing cell behavior and tissue development and repair .
while tissue engineering has reached clinical testing and even commercialization for applications , including skin , bone and cartilage , it has been slow to reach ophthalmology and corneal reconstruction . here
, we will present a number of strategies by which a regenerative medicine approach can be introduced to provide biological repair and reconstruction of the cornea .
there are a number of degrees and levels of complexity in which smart biomaterials and tissue engineering can be introduced for treating tissue repair and loss in the cornea [ figure 1 ] .
regenerative technologies can be simple and stimulate local tissue repair , such as the case in small injuries or incisions . for example
, a biological adhesive can be designed with properties that allow it to glue tissue together while simultaneously stimulating tissue growth . at the next level
, regenerative strategies can be employed to replace corneal layers , such as the epithelium or endothelium .
finally , a number of strategies are being employed to create biological substitutes for the complete cornea .
while corneal transplantation has an excellent record of success , there remain challenges in cases of rejection or graft failure , along with inadequate donor supply in the developing world .
ultimately , using biomaterials to direct cell function and new tissue development in the cornea and other ocular tissues represents a paradigm shift in clinical treatment that will allow patients to rebuild physiologically normal tissues instead of relying on synthetic materials that can not mirror native structure or function . finally , by taking a materials engineering perspective in characterizing the complex structure of the cornea , we can better understand the matrix properties of the tissue during disease and , ultimately , design more efficient therapeutic interventions .
application of biomaterials for biological reconstruction of the cornea cells , in particular , stem cells , are critical components required to reconstruct and rebuild tissues .
there are significant , ongoing research efforts by a number of groups to elucidate the identity and function of stem cells in practically all tissues of the body , including the many tissue compartments of the eye .
these cells can be isolated from small biopsies , expanded in culture and delivered to a site of injury , oftentimes using a biomaterial carrier . in another , more subtle use of stem cells , biomaterials can be designed to attract and concentrate stem cells directly in tissues , frequently in conjunction with biological signals . in this way ,
this strategy of modulating endogenous stem cell behavior is simple and more practical for widespread clinical application ; however , aged patients or those with severe disease may need the addition of exogenous stem cells for adequate repair .
the recognition that stem cells possess the ability to both self renew and differentiate , is leading to the generation of adequate numbers of cells for delivery to patients . in the eye ,
limbal stem cells ( lscs ) were identified as the source of cells that continually generate the corneal epithelial layer .
more recently , corneal stromal stem cells , which can differentiate to keratocytes , were discovered .
finally , progenitor cells of the endothelium and trabeculum ( pcet ) , which seem to differentiate into endothelial cells , were also identified . as in organ transplantation ,
although use of lifelong or long - term immunosuppressive medication is possible , the best way to prevent rejection is to use the patient s own cells , which may be possible in unilateral eye disease or trauma .
the classic corneal epithelial cell transplantation procedure employs grafting of a healthy limbal biopsy , either from a healthy contra lateral eye or from a donor , onto the damaged cornea .
the technique was developed in the late 1980s and early 1990s and proved useful in severe surface diseases ( now narrowed to limbal stem cell deficiencies , ) .
the need for a greater number of cells for transplantation was soon evident , and efforts began to culture epithelial and limbal cells in vitro .
the goal of in vitro culture procedures was to obtain a layer of cells that could be used as a replacement for the native corneal epithelium .
denuded amniotic membrane is currently employed to improve culture conditions and facilitate culture and transplantation . in a recent review of the literature , baylis et al .
they also found that results differ according to disease etiology , with inflammatory conditions having the best outcomes ( 86% ) and congenital ones producing the worst ( 60% ) .
some of the most common complications reported for cell transplantation include infections , conjunctivalization and corneal perforations .
clear biomaterials capable of fighting bacterial or cellular invasions through drug release or surface modifications , could be manufactured to improve on current results .
furthermore , as discussed later , we are developing new biological membranes with complex fibrillar architecture to enhance cell proliferation while remaining transparent . the quest for alternative ,
autologous cell sources for regeneration has led to the use of different cell types for corneal epithelial reconstruction .
dental pulp - derived stem cells share some markers with lscs , and were effective for cornea reconstruction in a rabbit model of moderate and severe chemical burns .
another recently proposed source of stem cells for cornea epithelium is the hair follicle , cells from which were induced to express cytokeratin 12 in a mouse model of cornea regeneration .
mesenchymal stem cells ( mscs ) from bone marrow and umbilical cord were used to regenerate damaged corneas in animal models , with overall promising results .
mscs also were used in animal models of acute cornea surface damage to reduce inflammation and promote wound healing .
direct incorporation of these autologous stem cell sources on surface biomaterial implants may eventually become commonplace , especially for elderly or bilaterally affected patients , but further research is necessary and clinical practicality must be considered .
the most widespread alternative cell type that was tried clinically for corneal regeneration , however , is not a stem cell .
cultivated oral mucosal epithelial transplantation ( comet ) was successfully used to treat lsc deficiency in japan . in recent long - term results of comet , at 36 months , 42% of patients had at least a two - line improvement in best corrected visual acuity ( bcva ) and 53% had at least a one - line improvement .
another report shows a stable cornea surface in 53% of patients at three - year follow up , with failure - free survival of the surface in approximately 78% of patients .
these results are remarkable because , unlike stem cells , these cells are not expected to differentiate into corneal epithelial cells .
however , these cells provided adequate functionality to be clinically relevant , but are not regenerative per se . utilizing cells from tissues other than the cornea , however , is not free from complications and concerns .
there is an increased risk of peripheral cornea neo - vascularization and there are doubts as to the long - term survival of the cells .
a recent report has proven survival of the oral mucosal cells for at least one year after the procedure , but with only four patients reported and a very short follow up time . while comet will continue to be a viable clinical alternative for now
, there will be development of new sources of more efficient and effective cells or stem cells and means of delivery .
in contrast to corneal epithelial cells , endothelial cells can not be renewed or replaced during a lifetime .
this means that , as far as we know , there are no adult stem or progenitor cells routinely repopulating the endothelial layer . if damaged , it was generally believed that endothelial cells migrate , grow in size and cover the space left open , but do not proliferate .
there is the possibility of a dormant stem cell population on the schwalbe s ring region ( the transition between endothelium and the anterior portion of the trabecular meshwork ) capable of producing both endothelial and trabecular cells .
the existence of these putative stem cells does not change that the corneal endothelial cell layer does not regenerate in vivo , but it provides hope for the existence of a cell population that can be leveraged to generate a native endothelial cell layer for transplantation in the near future .
the traditional treatment for endothelial disorders is a full - thickness penetrating keratoplasty ( full cornea transplant ) .
more recently , deep lamellar endothelial keratoplasty ( transplant of the endothelium with descemet s membrane and a thin layer of stroma ) and even descemet membrane endothelial keratoplasty have been adopted .
there have been many different protocols and media compositions used to expand endothelial cells in vitro , with equally varying results .
so far , expansion seems dependent on the presence of serum in the media , which limits the clinical potential of any cells cultured .
different cell carriers have been tested in animal models , but problems remain regarding biomaterial transparency , structural strength and integration with native tissues . taken together , all these factors have prevented the development of clinically relevant cell therapies for reconstructing the corneal endothelial layer , but researchers continually search for solutions . corneal disease affects more than 10 million people worldwide and , after cataracts , is the second leading cause of blindness .
corneal transplantation is currently the standard treatment for restoring vision in the most severe cases .
the success rate is high . with the notable exception of north america , however , in most of the world the demand for high - quality donors exceeds the supply .
the future for maintaining the current high quantity and high quality of donors is uncertain because of aging populations , the increase in corneal refractive surgeries and infectious diseases .
such devices must fulfill the natural functions of the cornea : maintain transparency ; have an adequate refractive index ; protect the inner ocular structures from external hazards , including pathogens and ultraviolet ( uv ) light ; have proper mechanical properties to tolerate the intraocular pressure and allow diffusion of oxygen and nutrients .
in addition , as biomaterials , they must be biocompatible , nontoxic , neither immunogenic nor mutagenic and integrate well with the recipients surrounding tissues and cells .
there are two main substitute categories : synthetic keratoprostheses and , our main interest , tissue engineered corneal substitutes .
they consist of two main parts : the transparent optical center and the surrounding skirt designed to support the implant . depending on the type of kpro , additional supporting components may be found .
the optical region is commonly made of plastic polymers , including poly ( methyl methacrylate ) ( pmma ) , poly(2-hydroxyethyl methacrylate ) ( phema ) and polydimethylsiloxane ( pdms ) , which do not integrate well with the native tissue .
the major complications derive from integration problems and include device extrusion , stromal melting , epithelial thinning and persistent epithelial defects .
the boston kpro ( dohlman - doane keratoprosthesis ) is fda approved and is considered the gold standard in synthetic corneal substitutes .
type 1 consists of a central pmma optical region , a porous back plate and a titanium locking ring that locks on native corneal tissue .
the type 2 kpro was designed for patients suffering from severe diseases of the ocular surface , such as stevens
johnson syndrome ( sjs ) and ocular cicatricial pemphigoid ( ocp ) , who are unable to maintain eyelid function . except for the additional anterior protruding rod in the central area ,
recent reports indicate high retention rates ( 84% at 17 months ) , good visual prognosis ( 75% better than 20/200 at one year ) and no endophthalmitis , excluding sjs and ocp patients . however , there are still relatively high complication rates in the sjs groups , presenting as retroprosthetic membrane formation and persistent epithelial defects . the osteo - odonto keratoprosthesis ( ookp ) , like the boston type 2 kpro , is primarily used for patients with severe dry eye .
the concept of the ookp derives from research showing that integration is maximized while immune reactions are minimized through the use of the patient s own tissue , including cartilage , and tibial bone .
the ookp uses a canine tooth , its alveolar bone and ligament as a skirt to support the central optic component . a retrospective study of the ookp shows high retention rates ( 85% ) over 19 years , including in sjs and ocp patients , with low complication rates .
even with the additional complex and invasive surgical procedures and the risk of resorption of the tissue , the ookp is the most successful and well known kpro in use today .
the alphacor kpro is manufactured by altering the water contents in phema during the polymerization of the optical center and the skirt .
unlike other kpros , the design of the alphacor utilizes the interpenetrating polymer network to permanently connect the two regions .
the porous phema allows for the vigorous invasion of keratocytes , resulting in a better integration with host tissue .
because of this stromal skirt repopulation , the retention rate is relatively high ( 87% , 58% and 42% at 1 , 2 and 3 years post - implantation , respectively ) .
unfortunately , even though there are promising short - term results , the fixation failures caused by stromal melting and intraoptic deposits still limit the usefulness of the alphacore kpro in the long term .
tissue engineering corneal substitutes promise to overcome the many challenges and deficiencies of synthetic materials .
tissue - engineered corneal substitutes are constructed by naturally generating an extracellular matrix ( ecm ) component with or without corneal cells .
it is well established that the ecm directs the fate of cells , therefore , the fabrication of the correct ecm components could produce an ideal corneal substitute , able to mimic the native corneal function . since the components of the ecm are natural ( biological ) polymers , there is higher biocompatibility and integration with host tissues when compared to synthetic polymeric materials , such as those in the different kpros .
in addition , these substitutes can be used to generate a targeted corneal layer , such as the endothelium for descemet s stripping endothelial keratoplasty ( dsek ) .
cosmetically , the tissue - engineered cornea is more similar to native cornea than the kpros and has the potential to provide a long - term or even permanent tissue replacement , indistinguishable from the original tissue .
they are highly versatile materials that allow for the diffusion of oxygen and nutrients , have adjustable mechanical properties , can be designed to contain large volumes of water and are relatively biocompatible . the corneal stroma comprises roughly 85% of the corneal thickness and consists of keratocytes and ecm . since collagen type i is the predominant component of the corneal stromal ecm ( approximately 70% of dry weight ) , it has been considered as the natural component to reconstruct it . as such
, a corneal substitute was developed using highly cross- linked collagen hydrogels using n-(3-dimethylaminopropyl)-n-ethylcarbodiimide ( edc ) and n - hydroxysuccinimide ( nhs ) technology .
it was successfully transplanted into several animal models , including guinea pig , dog and pig , either as a deep lamellar or full thickness keratoplasty .
recently , these collagen - based corneal substitutes were transplanted into 10 patients in a phase i clinical trial .
after 24 months , there were no severe adverse effects and the implants allowed for epithelial and keratocyte migration in all patients , as well as slow nerve invasion in the younger patients .
eight of the patients , however , developed focal hazing , which may critically reduce vision quality .
a long - term clinical study , with a large number of patients and further development of the material , will be needed if the material is to be used in clinical practice .
non - cross - linked collagen hydrogels are generally composed of loosely packed collagen fibers , strongly contrasting with the highly condensed and well organized collagen fibers found in the stromal layer of the cornea . recently , takezawa et al . , developed a type i collagen hydrogel membrane using a novel processing method , called vitrification , that we have been optimizing for ocular applications .
the collagen hydrogel membrane was named vitrigel , and is made from a type i collagen solution prepared through a three - stage sequence : gelation , vitrification and rehydration .
the vitrification step is unique in that it allows the collagen hydrogel to dry slowly so the collagen fibers can be reorganized and develop new hydrogen bonding interactions with each other . more importantly , unlike the opaque and comparably weak non - cross - linked collagen hydrogels , vitrigels are clear and possess greatly enhanced mechanical properties that are critical for ocular applications .
most important , with this method we begin to approach the more complex structure of the native cornea matrix with collagen fibers that are critical for both physical and biological function of the tissue [ figure 2c ] .
keratocytes cultured on vitrigels maintain a native dendritic morphology in serum - free [ a ] and 10% serum media [ b ] tem images of collagen vitrigel highlighting the fibrillar nanostructure of the matrix [ c ] bar = 500 nm using vitrigel , we evaluated the reconstruction of the three different corneal layers : epithelium , stroma and endothelium .
human lscs were cultured successfully on the vitrigel , demonstrating maintenance and upregulated expression of the putative stem cell markers abcg2 and p63 , respectively , thus indicating that vitrigels can preserve the lsc phenotype . in vivo , keratocytes exhibit a characteristic dendritic morphology with extensive intercellular contacts . however , when the corneal stroma is wounded , the cells transform either to wound - healing fibroblasts or to scar - forming myofibroblasts , which form a disorganized and opaque ecm .
therefore , it is desirable to promote the fibroblast phenotype and proliferative activity of keratocyte wound healing .
we found that keratocytes cultured on vitrigels exhibit enhanced dendritic branch density and length , compared to tissue culture plate control [ figure 2a - b ] .
an enhanced expression of aldehyde dehydrogenase ( aldh ) and keratocan ( important markers of keratocyte phenotype and function ) was also observed .
these results suggest that the use of vitrigel materials may benefit corneal stromal regeneration , as well as promote better integration and cellular function in vivo .
finally , promising results were obtained for endothelial culture on the vitrigels . in short ,
vitrigels demonstrate unique advantages over other materials ; these include optical transparency , mechanical strength and handling convenience .
these properties make vitrigels novel and very promising options for corneal tissue engineering and regeneration .
furthermore , as we analyze the collagen fibrillar structure of the vitrigels , we are gaining important insight into how fibers form .
we can apply this to understanding stroma structure - function properties in normal and diseased states . engineering a new cornea or subset of the cornea
however , we can also look to other strategies , including animal sources , to provide surgeons with a corneal substitute that has a structure similar to native tissue .
in particular , we can apply materials science and engineering strategies to process and create an implant from animal sources .
xenotransplantation can be employed to obtain corneal substitutes , particularly in developing countries that suffer from low donor rates because of regional , cultural and other institutional issues .
although rejection is the greatest obstacle to widespread use of xenotransplantation , fully decellularized components of the animal tissue may be clinically applied without immune rejection .
decellularization can be applied , not only to xenogeneic , but also to allogeneic cornea tissues for transplantation .
this could , in theory , improve the clinical outcome and reduce the complications associated with allogeneic cornea transplants .
a decellularized tissue provides a three - dimensional ecm structure for corneal reconstruction that fully mimics the native tissue and can be applied with or without the addition of a cellular component .
corneal decellularization has been performed on porcine corneas using various methods : sodium dodecyl sulfate ( sds ) , triton - x , hypertonic nacl solution , and high hydrostatic pressure .
these methods have been used by several groups in asia,[4651 ] and on bovine corneas by our group .
there are mixed results in the literature , however , with some reports failing to provide proper quantitative data on the presence of cell debris , which may cause immune reactions and affect transparency .
the relevance of cell debris can be seen in a recent article reporting that both untreated corneas as well as corneas in which cell debris was not removed experienced immune rejection in a primate model .
recently , our group successfully engineered decellularized corneas from both porcine and bovine tissue with a novel method , combining chemical and enzymatic treatments to remove the cellular components , but also incorporating vitrification and cross - linking steps to improve the optical and structural properties of the device . with this novel procedure , we were able to create acellular porcine and bovine corneas containing almost no cellular debris , while maintaining impressive light transmission rates and biocompatibility .
moreover , the curvature can be manipulated in this novel , engineered decellularized cornea , allowing for control of the refractive index , which is essential to corneal function .
a recent study reported the results of 150 patients who received anterior lamellar keratoplasty with this product .
they showed high levels of epithelialization within a few days and no postoperative infection or rejection in all but four cases , all of which occurred in patients with preexisting corneal melting .
finally , instead of utilizing a biomaterials approach , researchers have also harnessed the capacity of cells to self - assemble to form biological corneal substitutes .
keratocyte - derived fibroblasts produce stromal ecm , and epithelial cells produce basement membrane . using this concept ,
a translucent ecm from corneal fibroblasts has been produced and coated with epithelial cells . even though the thickness of the ecm is
far from that of the native cornea , the model was able to mimic the microstructure and wound healing processes of the corneal surface . with further development
traumatic defects or even cataract incisions would benefit greatly from a repair strategy that includes both physical apposition ( i.e. tissue bonding ) and biological stimulation to promote new tissue development .
such technologies for local corneal repair includes tissue adhesive ( ta ) biomaterials that can form chemical , biological or physical bonds with the molecular residues from local tissue . before the development of tas for the eye ,
nylon sutures were the standard method to close corneal wounds caused by cataract incision , corneal ulcer , trauma or transplant .
these new materials offer to improve on the past regenerative results of sutures for surgical and non - surgical wounds by reducing operation time , minimizing scar formation . and providing a vehicle for delivery of biological signals that can stimulate tissue development .
numerous additional corneal adhesives have been developed over the past 10 years to address the unique requirements for sealing different types of wounds .
the material is prepared by processing plasma from autologous blood or from plasma pools of volunteer donations . in corneal surgery ,
fibrin glue has been employed to seal corneal perforations and it melts along with adhering amniotic membrane to the ocular surface ( alone and with lscs).the adhesive can also be applied in different kinds of keratoplasty and even to temporarily stabilize keratoprosthetics .
however , as a blood product , it carries the risk of disease transmission and its low tensile strength and fast degradation are significant drawbacks .
thus , there is a significant need for an ocular adhesive that has the biological benefits and compatibility of a biological adhesive but has the increased mechanical strength and durability specifically needed for ocular applications .
synthetic adhesives provide faster polymerization ( i.e. cure rate ) and higher tensile strength , making them good candidates for corneal wound closure devices . among all of the synthetic adhesives for corneal wound healing , polymeric hydrogels
for example , a dendritic linear copolymer based on poly ( ethylene glycol ) ( peg ) , glycerol and succinic acid was shown to be effective in closing linear , full - thickness corneal incisions .
after photocross linking using uv light , the adhesive produced a firm seal , matching the strength of sutures .
another version of the material that does not require light has been applied clinically in europe .
while these materials have the strength and durability required clinically , they have little biological activity to stimulate new tissue growth . to create an ocular adhesive that combines the benefits of both synthetic and biological materials
the first generation adhesive we developed was composed of a modified chondroitin sulfate ( cs ) , cs - aldehyde that , when combined with polyvinyl alcohol co - vinylamine ( pva - a ) , cross - linked together and with the surrounding tissue .
the aldehyde - amine reaction provided the basis for this adhesive ; however , the biocompatibility was not good .
therefore , we created a second generation material that combines cs and peg . in this case
, the cs is modified with succinimide groups and is chemically cross - linked with peg - amine molecules through a michael addition .
in addition to being more biocompatible , the cs - peg adhesive formed tight seals on corneal incisions to maintain a normal intraocular pressure . ultimately , the combination of the biological benefits of the cs , which includes reducing scar formation and inflammation , with the physical benefits of the synthetic peg , which provides durability , allows the creation of an optimal ocular tissue adhesive .
drugs , such as antibiotics or anti - inflammatory molecules , can also be incorporated into the adhesives based on clinical need . in hydrogel adhesives , biological factors
could either be encapsulated in the material or covalently bonded to the macromolecule , and dual or multiple delivery systems could also be developed .
our approach to developing new strategies for ocular reconstruction and regeneration is based on understanding the physical structure of a tissue or biomaterial and the resulting impact on biological function .
this structure - function principle is key , not only to developing new therapies , but also for understanding disease processes and designing more efficient therapies .
even the most advanced biological products today do not take into account the microscopic and molecular structure of the cornea , providing natural corneal cells with unnatural , cross - linked substrates .
if successful corneal regeneration will ever be accomplished , we must pay close attention to the natural structure and function of the native tissue .
there is a delicate balance in the relationship of cornea cells and their local micro- and nano - environments that allow the corneal tissue to maintain function throughout a lifetime . at the same time
, the loss of this homeostatic balance gives rise to different disease states , some of which can be addressed by taking a new , engineering design approach .
for example , given the fibrillar nature of the cornea stroma , the transparency of the tissue is a remarkable engineering feat .
understanding the matrix design , we are engineering biomimetic materials for the cornea with geometrically oriented biological nanofibers .
such reinforced materials could be used as stromal fillers or to treat conditions of stromal weakness , such as keratoconus .
future collagen materials for cornea reconstruction will likely be composed of recombinant human molecules containing the telopeptides to maximize the proteoglycan effect and fibril control .
if truly mimetic materials can be made , they will offer an option for patients who currently are unable to undergo refractive surgery because of a thin stroma .
furthermore , the importance of proteoglycans and their relationship to collagen fibril formation is evident in diseases such as keratoconus , where an increase in their stromal contents is accompanied by thinning and disarray of the fibers . ultimately , harnessing the biological cues that direct cell function during tissue repair will lead to improvements in repair and regeneration therapies targeted for the cornea .
the future of regeneration in the eye is , indeed , very promising . in the future
, we aim to control cell migration and remodeling of biomimetic materials to promote the restoration of a natural corneal structure , fully functional and useful for a lifetime .
furthermore , these strategies will be extended to engineering and replacing conjunctiva , lacrimal glands and other ocular and periocular tissue .
the recognition that stem cells possess the ability to both self renew and differentiate , is leading to the generation of adequate numbers of cells for delivery to patients . in the eye , limbal stem cells ( lscs ) were identified as the source of cells that continually generate the corneal epithelial layer .
more recently , corneal stromal stem cells , which can differentiate to keratocytes , were discovered .
finally , progenitor cells of the endothelium and trabeculum ( pcet ) , which seem to differentiate into endothelial cells , were also identified . as in organ transplantation ,
although use of lifelong or long - term immunosuppressive medication is possible , the best way to prevent rejection is to use the patient s own cells , which may be possible in unilateral eye disease or trauma .
the classic corneal epithelial cell transplantation procedure employs grafting of a healthy limbal biopsy , either from a healthy contra lateral eye or from a donor , onto the damaged cornea .
the technique was developed in the late 1980s and early 1990s and proved useful in severe surface diseases ( now narrowed to limbal stem cell deficiencies , ) .
the need for a greater number of cells for transplantation was soon evident , and efforts began to culture epithelial and limbal cells in vitro .
the goal of in vitro culture procedures was to obtain a layer of cells that could be used as a replacement for the native corneal epithelium .
denuded amniotic membrane is currently employed to improve culture conditions and facilitate culture and transplantation . in a recent review of the literature , baylis et al .
they also found that results differ according to disease etiology , with inflammatory conditions having the best outcomes ( 86% ) and congenital ones producing the worst ( 60% ) .
some of the most common complications reported for cell transplantation include infections , conjunctivalization and corneal perforations .
clear biomaterials capable of fighting bacterial or cellular invasions through drug release or surface modifications , could be manufactured to improve on current results .
furthermore , as discussed later , we are developing new biological membranes with complex fibrillar architecture to enhance cell proliferation while remaining transparent . the quest for alternative ,
autologous cell sources for regeneration has led to the use of different cell types for corneal epithelial reconstruction .
dental pulp - derived stem cells share some markers with lscs , and were effective for cornea reconstruction in a rabbit model of moderate and severe chemical burns .
another recently proposed source of stem cells for cornea epithelium is the hair follicle , cells from which were induced to express cytokeratin 12 in a mouse model of cornea regeneration .
mesenchymal stem cells ( mscs ) from bone marrow and umbilical cord were used to regenerate damaged corneas in animal models , with overall promising results .
mscs also were used in animal models of acute cornea surface damage to reduce inflammation and promote wound healing .
direct incorporation of these autologous stem cell sources on surface biomaterial implants may eventually become commonplace , especially for elderly or bilaterally affected patients , but further research is necessary and clinical practicality must be considered .
the most widespread alternative cell type that was tried clinically for corneal regeneration , however , is not a stem cell .
cultivated oral mucosal epithelial transplantation ( comet ) was successfully used to treat lsc deficiency in japan . in recent long - term results of comet , at 36 months , 42% of patients had at least a two - line improvement in best corrected visual acuity ( bcva ) and 53% had at least a one - line improvement .
another report shows a stable cornea surface in 53% of patients at three - year follow up , with failure - free survival of the surface in approximately 78% of patients .
these results are remarkable because , unlike stem cells , these cells are not expected to differentiate into corneal epithelial cells .
however , these cells provided adequate functionality to be clinically relevant , but are not regenerative per se . utilizing cells from tissues other than the cornea , however , is not free from complications and concerns .
there is an increased risk of peripheral cornea neo - vascularization and there are doubts as to the long - term survival of the cells .
a recent report has proven survival of the oral mucosal cells for at least one year after the procedure , but with only four patients reported and a very short follow up time . while comet will continue to be a viable clinical alternative for now
, there will be development of new sources of more efficient and effective cells or stem cells and means of delivery .
in contrast to corneal epithelial cells , endothelial cells can not be renewed or replaced during a lifetime .
this means that , as far as we know , there are no adult stem or progenitor cells routinely repopulating the endothelial layer .
if damaged , it was generally believed that endothelial cells migrate , grow in size and cover the space left open , but do not proliferate .
there is the possibility of a dormant stem cell population on the schwalbe s ring region ( the transition between endothelium and the anterior portion of the trabecular meshwork ) capable of producing both endothelial and trabecular cells .
the existence of these putative stem cells does not change that the corneal endothelial cell layer does not regenerate in vivo , but it provides hope for the existence of a cell population that can be leveraged to generate a native endothelial cell layer for transplantation in the near future .
the traditional treatment for endothelial disorders is a full - thickness penetrating keratoplasty ( full cornea transplant ) .
more recently , deep lamellar endothelial keratoplasty ( transplant of the endothelium with descemet s membrane and a thin layer of stroma ) and even descemet membrane endothelial keratoplasty have been adopted .
there have been many different protocols and media compositions used to expand endothelial cells in vitro , with equally varying results .
so far , expansion seems dependent on the presence of serum in the media , which limits the clinical potential of any cells cultured .
different cell carriers have been tested in animal models , but problems remain regarding biomaterial transparency , structural strength and integration with native tissues . taken together , all these factors have prevented the development of clinically relevant cell therapies for reconstructing the corneal endothelial layer , but researchers continually search for solutions .
corneal disease affects more than 10 million people worldwide and , after cataracts , is the second leading cause of blindness .
corneal transplantation is currently the standard treatment for restoring vision in the most severe cases .
the success rate is high . with the notable exception of north america , however , in most of the world the demand for high - quality donors exceeds the supply .
the future for maintaining the current high quantity and high quality of donors is uncertain because of aging populations , the increase in corneal refractive surgeries and infectious diseases .
such devices must fulfill the natural functions of the cornea : maintain transparency ; have an adequate refractive index ; protect the inner ocular structures from external hazards , including pathogens and ultraviolet ( uv ) light ; have proper mechanical properties to tolerate the intraocular pressure and allow diffusion of oxygen and nutrients .
in addition , as biomaterials , they must be biocompatible , nontoxic , neither immunogenic nor mutagenic and integrate well with the recipients surrounding tissues and cells .
there are two main substitute categories : synthetic keratoprostheses and , our main interest , tissue engineered corneal substitutes .
they consist of two main parts : the transparent optical center and the surrounding skirt designed to support the implant . depending on the type of kpro
the optical region is commonly made of plastic polymers , including poly ( methyl methacrylate ) ( pmma ) , poly(2-hydroxyethyl methacrylate ) ( phema ) and polydimethylsiloxane ( pdms ) , which do not integrate well with the native tissue .
the major complications derive from integration problems and include device extrusion , stromal melting , epithelial thinning and persistent epithelial defects .
the boston kpro ( dohlman - doane keratoprosthesis ) is fda approved and is considered the gold standard in synthetic corneal substitutes .
type 1 consists of a central pmma optical region , a porous back plate and a titanium locking ring that locks on native corneal tissue .
the type 2 kpro was designed for patients suffering from severe diseases of the ocular surface , such as stevens
johnson syndrome ( sjs ) and ocular cicatricial pemphigoid ( ocp ) , who are unable to maintain eyelid function . except for the additional anterior protruding rod in the central area ,
recent reports indicate high retention rates ( 84% at 17 months ) , good visual prognosis ( 75% better than 20/200 at one year ) and no endophthalmitis , excluding sjs and ocp patients . however , there are still relatively high complication rates in the sjs groups , presenting as retroprosthetic membrane formation and persistent epithelial defects . the osteo - odonto keratoprosthesis ( ookp ) , like the boston type 2 kpro , is primarily used for patients with severe dry eye .
the concept of the ookp derives from research showing that integration is maximized while immune reactions are minimized through the use of the patient s own tissue , including cartilage , and tibial bone .
the ookp uses a canine tooth , its alveolar bone and ligament as a skirt to support the central optic component .
a retrospective study of the ookp shows high retention rates ( 85% ) over 19 years , including in sjs and ocp patients , with low complication rates .
even with the additional complex and invasive surgical procedures and the risk of resorption of the tissue , the ookp is the most successful and well known kpro in use today .
the alphacor kpro is manufactured by altering the water contents in phema during the polymerization of the optical center and the skirt .
unlike other kpros , the design of the alphacor utilizes the interpenetrating polymer network to permanently connect the two regions .
the porous phema allows for the vigorous invasion of keratocytes , resulting in a better integration with host tissue .
because of this stromal skirt repopulation , the retention rate is relatively high ( 87% , 58% and 42% at 1 , 2 and 3 years post - implantation , respectively ) .
unfortunately , even though there are promising short - term results , the fixation failures caused by stromal melting and intraoptic deposits still limit the usefulness of the alphacore kpro in the long term . tissue engineering corneal substitutes promise to overcome the many challenges and deficiencies of synthetic materials .
tissue - engineered corneal substitutes are constructed by naturally generating an extracellular matrix ( ecm ) component with or without corneal cells .
it is well established that the ecm directs the fate of cells , therefore , the fabrication of the correct ecm components could produce an ideal corneal substitute , able to mimic the native corneal function . since the components of the ecm are natural ( biological ) polymers , there is higher biocompatibility and integration with host tissues when compared to synthetic polymeric materials , such as those in the different kpros .
in addition , these substitutes can be used to generate a targeted corneal layer , such as the endothelium for descemet s stripping endothelial keratoplasty ( dsek ) .
cosmetically , the tissue - engineered cornea is more similar to native cornea than the kpros and has the potential to provide a long - term or even permanent tissue replacement , indistinguishable from the original tissue .
they are highly versatile materials that allow for the diffusion of oxygen and nutrients , have adjustable mechanical properties , can be designed to contain large volumes of water and are relatively biocompatible .
the corneal stroma comprises roughly 85% of the corneal thickness and consists of keratocytes and ecm .
since collagen type i is the predominant component of the corneal stromal ecm ( approximately 70% of dry weight ) , it has been considered as the natural component to reconstruct it . as such
, a corneal substitute was developed using highly cross- linked collagen hydrogels using n-(3-dimethylaminopropyl)-n-ethylcarbodiimide ( edc ) and n - hydroxysuccinimide ( nhs ) technology .
it was successfully transplanted into several animal models , including guinea pig , dog and pig , either as a deep lamellar or full thickness keratoplasty .
recently , these collagen - based corneal substitutes were transplanted into 10 patients in a phase i clinical trial .
after 24 months , there were no severe adverse effects and the implants allowed for epithelial and keratocyte migration in all patients , as well as slow nerve invasion in the younger patients .
eight of the patients , however , developed focal hazing , which may critically reduce vision quality .
a long - term clinical study , with a large number of patients and further development of the material , will be needed if the material is to be used in clinical practice .
non - cross - linked collagen hydrogels are generally composed of loosely packed collagen fibers , strongly contrasting with the highly condensed and well organized collagen fibers found in the stromal layer of the cornea . recently , takezawa et al . , developed a type i collagen hydrogel membrane using a novel processing method , called vitrification , that we have been optimizing for ocular applications .
the collagen hydrogel membrane was named vitrigel , and is made from a type i collagen solution prepared through a three - stage sequence : gelation , vitrification and rehydration .
the vitrification step is unique in that it allows the collagen hydrogel to dry slowly so the collagen fibers can be reorganized and develop new hydrogen bonding interactions with each other . more importantly , unlike the opaque and comparably weak non - cross - linked collagen hydrogels
, vitrigels are clear and possess greatly enhanced mechanical properties that are critical for ocular applications .
most important , with this method we begin to approach the more complex structure of the native cornea matrix with collagen fibers that are critical for both physical and biological function of the tissue [ figure 2c ] .
keratocytes cultured on vitrigels maintain a native dendritic morphology in serum - free [ a ] and 10% serum media [ b ] tem images of collagen vitrigel highlighting the fibrillar nanostructure of the matrix [ c ] bar = 500 nm using vitrigel , we evaluated the reconstruction of the three different corneal layers : epithelium , stroma and endothelium .
human lscs were cultured successfully on the vitrigel , demonstrating maintenance and upregulated expression of the putative stem cell markers abcg2 and p63 , respectively , thus indicating that vitrigels can preserve the lsc phenotype . in vivo , keratocytes exhibit a characteristic dendritic morphology with extensive intercellular contacts . however , when the corneal stroma is wounded , the cells transform either to wound - healing fibroblasts or to scar - forming myofibroblasts , which form a disorganized and opaque ecm .
therefore , it is desirable to promote the fibroblast phenotype and proliferative activity of keratocyte wound healing .
we found that keratocytes cultured on vitrigels exhibit enhanced dendritic branch density and length , compared to tissue culture plate control [ figure 2a - b ] .
an enhanced expression of aldehyde dehydrogenase ( aldh ) and keratocan ( important markers of keratocyte phenotype and function ) was also observed .
these results suggest that the use of vitrigel materials may benefit corneal stromal regeneration , as well as promote better integration and cellular function in vivo .
finally , promising results were obtained for endothelial culture on the vitrigels . in short ,
vitrigels demonstrate unique advantages over other materials ; these include optical transparency , mechanical strength and handling convenience .
these properties make vitrigels novel and very promising options for corneal tissue engineering and regeneration .
furthermore , as we analyze the collagen fibrillar structure of the vitrigels , we are gaining important insight into how fibers form .
we can apply this to understanding stroma structure - function properties in normal and diseased states . engineering a new cornea or subset of the cornea
however , we can also look to other strategies , including animal sources , to provide surgeons with a corneal substitute that has a structure similar to native tissue .
in particular , we can apply materials science and engineering strategies to process and create an implant from animal sources .
xenotransplantation can be employed to obtain corneal substitutes , particularly in developing countries that suffer from low donor rates because of regional , cultural and other institutional issues .
although rejection is the greatest obstacle to widespread use of xenotransplantation , fully decellularized components of the animal tissue may be clinically applied without immune rejection .
decellularization can be applied , not only to xenogeneic , but also to allogeneic cornea tissues for transplantation .
this could , in theory , improve the clinical outcome and reduce the complications associated with allogeneic cornea transplants .
a decellularized tissue provides a three - dimensional ecm structure for corneal reconstruction that fully mimics the native tissue and can be applied with or without the addition of a cellular component .
corneal decellularization has been performed on porcine corneas using various methods : sodium dodecyl sulfate ( sds ) , triton - x , hypertonic nacl solution , and high hydrostatic pressure .
these methods have been used by several groups in asia,[4651 ] and on bovine corneas by our group .
there are mixed results in the literature , however , with some reports failing to provide proper quantitative data on the presence of cell debris , which may cause immune reactions and affect transparency .
the relevance of cell debris can be seen in a recent article reporting that both untreated corneas as well as corneas in which cell debris was not removed experienced immune rejection in a primate model .
recently , our group successfully engineered decellularized corneas from both porcine and bovine tissue with a novel method , combining chemical and enzymatic treatments to remove the cellular components , but also incorporating vitrification and cross - linking steps to improve the optical and structural properties of the device . with this novel procedure , we were able to create acellular porcine and bovine corneas containing almost no cellular debris , while maintaining impressive light transmission rates and biocompatibility .
moreover , the curvature can be manipulated in this novel , engineered decellularized cornea , allowing for control of the refractive index , which is essential to corneal function .
a recent study reported the results of 150 patients who received anterior lamellar keratoplasty with this product .
they showed high levels of epithelialization within a few days and no postoperative infection or rejection in all but four cases , all of which occurred in patients with preexisting corneal melting .
finally , instead of utilizing a biomaterials approach , researchers have also harnessed the capacity of cells to self - assemble to form biological corneal substitutes .
keratocyte - derived fibroblasts produce stromal ecm , and epithelial cells produce basement membrane . using this concept ,
a translucent ecm from corneal fibroblasts has been produced and coated with epithelial cells . even though the thickness of the ecm is
far from that of the native cornea , the model was able to mimic the microstructure and wound healing processes of the corneal surface . with further development , this approach may be used to engineer a full - thickness corneal substitute .
traumatic defects or even cataract incisions would benefit greatly from a repair strategy that includes both physical apposition ( i.e. tissue bonding ) and biological stimulation to promote new tissue development .
such technologies for local corneal repair includes tissue adhesive ( ta ) biomaterials that can form chemical , biological or physical bonds with the molecular residues from local tissue . before the development of tas for the eye ,
nylon sutures were the standard method to close corneal wounds caused by cataract incision , corneal ulcer , trauma or transplant .
these new materials offer to improve on the past regenerative results of sutures for surgical and non - surgical wounds by reducing operation time , minimizing scar formation . and providing a vehicle for delivery of biological signals that can stimulate tissue development .
numerous additional corneal adhesives have been developed over the past 10 years to address the unique requirements for sealing different types of wounds .
the material is prepared by processing plasma from autologous blood or from plasma pools of volunteer donations . in corneal surgery ,
fibrin glue has been employed to seal corneal perforations and it melts along with adhering amniotic membrane to the ocular surface ( alone and with lscs).the adhesive can also be applied in different kinds of keratoplasty and even to temporarily stabilize keratoprosthetics .
however , as a blood product , it carries the risk of disease transmission and its low tensile strength and fast degradation are significant drawbacks .
thus , there is a significant need for an ocular adhesive that has the biological benefits and compatibility of a biological adhesive but has the increased mechanical strength and durability specifically needed for ocular applications .
synthetic adhesives provide faster polymerization ( i.e. cure rate ) and higher tensile strength , making them good candidates for corneal wound closure devices . among all of the synthetic adhesives for corneal wound healing , polymeric hydrogels
for example , a dendritic linear copolymer based on poly ( ethylene glycol ) ( peg ) , glycerol and succinic acid was shown to be effective in closing linear , full - thickness corneal incisions .
after photocross linking using uv light , the adhesive produced a firm seal , matching the strength of sutures .
another version of the material that does not require light has been applied clinically in europe .
while these materials have the strength and durability required clinically , they have little biological activity to stimulate new tissue growth .
to create an ocular adhesive that combines the benefits of both synthetic and biological materials , we engineered a biosynthetic ocular adhesive .
the first generation adhesive we developed was composed of a modified chondroitin sulfate ( cs ) , cs - aldehyde that , when combined with polyvinyl alcohol co - vinylamine ( pva - a ) , cross - linked together and with the surrounding tissue .
the aldehyde - amine reaction provided the basis for this adhesive ; however , the biocompatibility was not good .
therefore , we created a second generation material that combines cs and peg . in this case
, the cs is modified with succinimide groups and is chemically cross - linked with peg - amine molecules through a michael addition .
in addition to being more biocompatible , the cs - peg adhesive formed tight seals on corneal incisions to maintain a normal intraocular pressure .
ultimately , the combination of the biological benefits of the cs , which includes reducing scar formation and inflammation , with the physical benefits of the synthetic peg , which provides durability , allows the creation of an optimal ocular tissue adhesive .
drugs , such as antibiotics or anti - inflammatory molecules , can also be incorporated into the adhesives based on clinical need . in hydrogel adhesives , biological factors
could either be encapsulated in the material or covalently bonded to the macromolecule , and dual or multiple delivery systems could also be developed .
our approach to developing new strategies for ocular reconstruction and regeneration is based on understanding the physical structure of a tissue or biomaterial and the resulting impact on biological function .
this structure - function principle is key , not only to developing new therapies , but also for understanding disease processes and designing more efficient therapies .
even the most advanced biological products today do not take into account the microscopic and molecular structure of the cornea , providing natural corneal cells with unnatural , cross - linked substrates .
if successful corneal regeneration will ever be accomplished , we must pay close attention to the natural structure and function of the native tissue .
there is a delicate balance in the relationship of cornea cells and their local micro- and nano - environments that allow the corneal tissue to maintain function throughout a lifetime . at the same time
, the loss of this homeostatic balance gives rise to different disease states , some of which can be addressed by taking a new , engineering design approach .
for example , given the fibrillar nature of the cornea stroma , the transparency of the tissue is a remarkable engineering feat .
understanding the matrix design , we are engineering biomimetic materials for the cornea with geometrically oriented biological nanofibers .
such reinforced materials could be used as stromal fillers or to treat conditions of stromal weakness , such as keratoconus .
future collagen materials for cornea reconstruction will likely be composed of recombinant human molecules containing the telopeptides to maximize the proteoglycan effect and fibril control .
if truly mimetic materials can be made , they will offer an option for patients who currently are unable to undergo refractive surgery because of a thin stroma .
furthermore , the importance of proteoglycans and their relationship to collagen fibril formation is evident in diseases such as keratoconus , where an increase in their stromal contents is accompanied by thinning and disarray of the fibers . ultimately , harnessing the biological cues that direct cell function during tissue repair will lead to improvements in repair and regeneration therapies targeted for the cornea .
the future of regeneration in the eye is , indeed , very promising . in the future
, we aim to control cell migration and remodeling of biomimetic materials to promote the restoration of a natural corneal structure , fully functional and useful for a lifetime .
furthermore , these strategies will be extended to engineering and replacing conjunctiva , lacrimal glands and other ocular and periocular tissue .
Output:
| repair and reconstruction of the cornea has historically relied on synthetic materials or tissue transplantation .
however , the future holds promise for treatments using smart biomaterials and stem cells that direct tissue repair and regeneration to ultimately create new ocular structures that are indistinguishable from the original native tissue . the cornea is a remarkable engineering structure . by understanding the physical structure of the tissue and the resulting impact of the structure on biological function , we can design novel materials for a number of ophthalmic clinical applications .
furthermore , by extending this structure - function approach to characterizing corneal disease processes , new therapies can be engineered . |
PubmedSumm7834 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: this problem poses an enormous burden on health care systems and has lowered the quality of life of affected individuals substantially .
world health organization 's latest projections indicate that by 2015 approximately 2.3 billion adults will be overweight and 700 million will be obese .
postmenopausal ( pm ) status is associated with higher prevalence of obesity , as 44% of postmenopausal women ( pmw ) are overweight , among whom 23% are obese .
it is as yet unclear whether the menopausal transition itself leads to weight gain , but is known that the physiological withdrawal of estrogen brings about changes in fat distribution , together with physical inactivity , are probably the major causes of this phenomenon .
women with abdominal obesity compared with other women have , high vasomotor scores , personal life dissatisfaction , nervousness , memory loss , depression , flatulence , muscle and joint pains , sleeping disorders lack of energy .
a sustained weight loss in obese patients has been shown to confer marked health benefits ( metabolic and vascular ) by various studies existing from western population .
there is irrefutable evidence of the effectiveness of life - style management by regular physical activity and dietary management , in the primary and secondary prevention of several chronic diseases ( e.g. , cardiovascular disease [ cvs ] , diabetes , cancer , hypertension , depression and osteoporosis ) and premature death .
sibutramine and rimonabant were withdrawn from the market recently . moreover , no convincing data exist recommending the use orlistat in pm obesity as such . hence , presently life - style modification at the transition and during of menopause will go a long way in preventing weight gain and related complications during this metabolically vulnerable period .
there are only few studies available from the western countries but no study is available from india to the best of our knowledge confirming the benefits of life - style management on weight reduction among pm indian women .
this study was conducted in the postgraduate department of pharmacology and therapeutics , in a tertiary care teaching medical college of india over a period of 1 year .
the study was approved by institutional ethics board . written informed consent was obtained from all the patients after explaining them the nature and purpose of the study .
out of 96 patients , a total of 60 meeting the inclusion criteria were randomized into two groups equally .
thirty patients in group i and 24 patients in group ii completed the study .
age : > 45 yearssex : pm femalesoverweight : body mass index ( bmi ) : 25 - 29.9 kg / mobese : bmi > 30
overweight : body mass index ( bmi ) : 25 - 29.9 kg / m
hypertension.cerebrovascular disease.cvs diseases such as ischemic heart disease and arrhythmias.renal and hepatic disease.type 1 and type 2 diabetes mellitus.psychosis.thyroid disorder.dyslipidemia.use of medications known to affect body weight , e.g. , drugs acting on central nervous system , cathartics , thyroid supplements , diuretics and selective serotonin reuptake inhibitors.a weight loss of 5 kg or more in preceding 6 months.psychosocial contraindications such as bulimia nervosa , anorexia nervosa , substance abuse , clinically significant depression or under current psychiatric care .
cerebrovascular disease .
use of medications known to affect body weight , e.g. , drugs acting on central nervous system , cathartics , thyroid supplements , diuretics and selective serotonin reuptake inhibitors . a weight loss of 5 kg or more in preceding 6 months . psychosocial contraindications such as bulimia nervosa , anorexia nervosa , substance abuse , clinically significant depression or under current psychiatric care .
clinical evaluation with complete medical history , complete general physical examination and complete systemic examination was done .
the following laboratory investigations were carried out at the time of screening :
hemoglobin , total leucocyte count , differential leucocyte count , erythrocyte sedimentation rate.liver function tests.renal function tests.serum electrolytes ( na , k ) .electrocardiography , x - ray , urine routine examination .
hemoglobin , total leucocyte count , differential leucocyte count , erythrocyte sedimentation rate . liver function tests .
weight , height , bmi , waist circumference ( wc).blood sugar ( f ) , lipid profile ( triglyceride , low - density lipoprotein - cholesterol and high - density lipoprotein - cholesterol ) , serum uric acid .
blood sugar ( f ) , lipid profile ( triglyceride , low - density lipoprotein - cholesterol and high - density lipoprotein - cholesterol ) , serum uric acid . after screening all the patients
two groups were formed group i was designated as the intervention group and group ii served as control .
both groups attended follow - up visits at 4 , 8 , 16 and 24 weeks of study .
group i was advised life - style modification as follows : caloric restriction , consisting of 1300 kcal / day ( 25% total fat , 7% saturated fat , 100 mg of dietary cholesterol ) , eating calcium , flavonoid and antioxidant rich diet .
they were encouraged intake of fiber , spinach , kale , cabbage , broccoli , tomatoes , beans , lentils , citrus fruits and a diet rich in phytoestrogens .
all women were asked to avoid of fatty diet , sugars , salt , ghee , excess rice , potato and even honey .
major recommendation was to exercise regularly , for at least 30 - 60 min on at least 5 days of the week or increased their physical activity expenditure ( 1000 - 1500 kcal / week ) .
controlled yoga and mind full exercises like meditation for 1 h on at least 5 days a week was compulsory .
any of the strength , resistance and stretching exercise training , aerobic such as walking , jogging , swimming , cycling , dancing , step ups and downs , brisk walking , lawn mowing were recommended to all .
the highly motivated known women regularly visiting to yoga center of medical college , premises , after two brief educative awareness sessions were included in the interventional group .
group ii was treated as control and was allowed to undertake their routine activity and diet of their own choice .
weight in kilograms was measured nearest to 0.1 kg ( 100 g ) on insulin sensitivity index marked weighing machine with the subject ideally fasting , empty bladder , wearing only light clothing and without shoes .
bmi has been traditionally used to identify individuals who are most likely to be overweight and obese .
it is calculated by dividing weight ( in kg ) by height ( in m ) squared : body fatness in terms of bmi is classified as per consensus statement for diagnosis of obesity and metabolic syndrome for asian indian .
wc is considered to be a better assessor of metabolic risk than bmi because it is more directly proportional to total body fat and amount of metabolically active visceral fat .
normal wc measurements for men and women are 94 cm and 80 cm respectively . metabolic risk is increased substantially if wc is 102 cm and 88 cm for males and females respectively .
similarly , wc was classified as per consensus statement for diagnosis of obesity and metabolic syndrome for asian indian . for men : 90 cm and for women
: 80 cm respectively to define obesity . wc in inches was measured midway between the lower rib margin and iliac crest with a horizontal tape at the end of gentle expiration .
, weight , wc , bmi , was done by applying unpaired t - test for evaluation of intergroup significance and the intragroup significance was assessed using paired t - test
age : > 45 yearssex : pm femalesoverweight : body mass index ( bmi ) : 25 - 29.9 kg / mobese : bmi > 30 kg / m .
hypertension.cerebrovascular disease.cvs diseases such as ischemic heart disease and arrhythmias.renal and hepatic disease.type 1 and type 2 diabetes mellitus.psychosis.thyroid disorder.dyslipidemia.use of medications known to affect body weight , e.g. , drugs acting on central nervous system , cathartics , thyroid supplements , diuretics and selective serotonin reuptake inhibitors.a weight loss of 5 kg or more in preceding 6 months.psychosocial contraindications such as bulimia nervosa , anorexia nervosa , substance abuse , clinically significant depression or under current psychiatric care .
use of medications known to affect body weight , e.g. , drugs acting on central nervous system , cathartics , thyroid supplements , diuretics and selective serotonin reuptake inhibitors . a weight loss of 5 kg or more in preceding 6 months . psychosocial contraindications such as bulimia nervosa , anorexia nervosa , substance abuse , clinically significant depression or under current psychiatric care .
clinical evaluation with complete medical history , complete general physical examination and complete systemic examination was done .
the following laboratory investigations were carried out at the time of screening :
hemoglobin , total leucocyte count , differential leucocyte count , erythrocyte sedimentation rate.liver function tests.renal function tests.serum electrolytes ( na , k ) .electrocardiography , x - ray , urine routine examination .
hemoglobin , total leucocyte count , differential leucocyte count , erythrocyte sedimentation rate . liver function tests .
weight , height , bmi , waist circumference ( wc).blood sugar ( f ) , lipid profile ( triglyceride , low - density lipoprotein - cholesterol and high - density lipoprotein - cholesterol ) , serum uric acid .
blood sugar ( f ) , lipid profile ( triglyceride , low - density lipoprotein - cholesterol and high - density lipoprotein - cholesterol ) , serum uric acid . after screening all the patients
two groups were formed group i was designated as the intervention group and group ii served as control .
both groups attended follow - up visits at 4 , 8 , 16 and 24 weeks of study .
group i was advised life - style modification as follows : caloric restriction , consisting of 1300 kcal / day ( 25% total fat , 7% saturated fat , 100 mg of dietary cholesterol ) , eating calcium , flavonoid and antioxidant rich diet .
they were encouraged intake of fiber , spinach , kale , cabbage , broccoli , tomatoes , beans , lentils , citrus fruits and a diet rich in phytoestrogens .
all women were asked to avoid of fatty diet , sugars , salt , ghee , excess rice , potato and even honey .
major recommendation was to exercise regularly , for at least 30 - 60 min on at least 5 days of the week or increased their physical activity expenditure ( 1000 - 1500 kcal / week ) .
controlled yoga and mind full exercises like meditation for 1 h on at least 5 days a week was compulsory .
any of the strength , resistance and stretching exercise training , aerobic such as walking , jogging , swimming , cycling , dancing , step ups and downs , brisk walking , lawn mowing were recommended to all .
the highly motivated known women regularly visiting to yoga center of medical college , premises , after two brief educative awareness sessions were included in the interventional group .
caloric restriction , consisting of 1300 kcal / day ( 25% total fat , 7% saturated fat , 100 mg of dietary cholesterol ) , eating calcium , flavonoid and antioxidant rich diet .
they were encouraged intake of fiber , spinach , kale , cabbage , broccoli , tomatoes , beans , lentils , citrus fruits and a diet rich in phytoestrogens .
all women were asked to avoid of fatty diet , sugars , salt , ghee , excess rice , potato and even honey .
major recommendation was to exercise regularly , for at least 30 - 60 min on at least 5 days of the week or increased their physical activity expenditure ( 1000 - 1500 kcal / week ) .
controlled yoga and mind full exercises like meditation for 1 h on at least 5 days a week was compulsory .
any of the strength , resistance and stretching exercise training , aerobic such as walking , jogging , swimming , cycling , dancing , step ups and downs , brisk walking , lawn mowing were recommended to all .
the highly motivated known women regularly visiting to yoga center of medical college , premises , after two brief educative awareness sessions were included in the interventional group .
group ii was treated as control and was allowed to undertake their routine activity and diet of their own choice .
weight in kilograms was measured nearest to 0.1 kg ( 100 g ) on insulin sensitivity index marked weighing machine with the subject ideally fasting , empty bladder , wearing only light clothing and without shoes .
bmi has been traditionally used to identify individuals who are most likely to be overweight and obese .
it is calculated by dividing weight ( in kg ) by height ( in m ) squared : body fatness in terms of bmi is classified as per consensus statement for diagnosis of obesity and metabolic syndrome for asian indian .
wc is considered to be a better assessor of metabolic risk than bmi because it is more directly proportional to total body fat and amount of metabolically active visceral fat .
normal wc measurements for men and women are 94 cm and 80 cm respectively . metabolic risk is increased substantially if wc is 102 cm and 88 cm for males and females respectively .
similarly , wc was classified as per consensus statement for diagnosis of obesity and metabolic syndrome for asian indian . for men : 90 cm and for women
wc in inches was measured midway between the lower rib margin and iliac crest with a horizontal tape at the end of gentle expiration .
weight in kilograms was measured nearest to 0.1 kg ( 100 g ) on insulin sensitivity index marked weighing machine with the subject ideally fasting , empty bladder , wearing only light clothing and without shoes .
bmi has been traditionally used to identify individuals who are most likely to be overweight and obese .
it is calculated by dividing weight ( in kg ) by height ( in m ) squared : body fatness in terms of bmi is classified as per consensus statement for diagnosis of obesity and metabolic syndrome for asian indian .
wc is considered to be a better assessor of metabolic risk than bmi because it is more directly proportional to total body fat and amount of metabolically active visceral fat .
normal wc measurements for men and women are 94 cm and 80 cm respectively . metabolic risk is increased substantially if wc is 102 cm and 88 cm for males and females respectively .
similarly , wc was classified as per consensus statement for diagnosis of obesity and metabolic syndrome for asian indian . for men : 90 cm and for women : 80 cm respectively to define obesity .
wc in inches was measured midway between the lower rib margin and iliac crest with a horizontal tape at the end of gentle expiration .
, weight , wc , bmi , was done by applying unpaired t - test for evaluation of intergroup significance and the intragroup significance was assessed using paired t - test
the results obtained after evaluating the effects of both groups on various parameters are as under : baseline characteristics of women group i observed , reduced mean weight from 83.1 7.64 kg at baseline to 80.2 7.4 ( -2.9 kg at 4 weeks , 73.2 7.5 ( -9.9 kg ) at 8 weeks , 71.6 6.46 ( -11.5 kg ) at 16 weeks and 71.2 6.52 ( -11.9 kg ) at 24 weeks .
the effect was found to be statistically significant at 4 , 8 , 16 and 24 weeks ( p 0.001 ) when compared with baseline [ table 2 ] .
effect of life - style management on weight , wc and bmi ( mean sd ) in over weight and obese women ( n = 30 ) similarly in group i , a significant decrease in wc from 4 week onwards .
there was a decrease from baseline score of 38.6 2.33 inches to 37.3 2.17 ( -1.3 inches ) with ( p 0.001 ) at 4 weeks , 34.9 2.02 ( -3.7 inch ) at 8 weeks ( p 0.001 ) , 34.56 2.40 ( 4.04 inch ) at 16 weeks and 34.02fnx08 2.62 ( -4.58 ) ( p 0.001 ) at 24 weeks .
intervention group i showed a significant decrease in bmi from 4 week . the decrease was observed from a mean baseline score of 30.6 2.7 kg / m to 29.5 2.62 ( -1.1 inch ) at 4 weeks ( p 0.001 ) , 26.8 2.5 ( -3.8 ) at 8 weeks ( p 0.001 ) 0 , 26.3 2.26 ( -4 ) at 16 weeks ( p 0.001 ) and 26.1 2.61 ( -4.5 ) at 24 weeks ( p 0.001 ) .
peak decrease was seen at 24 weeks [ table 2 ] . in the control arm , group
ii mean weight reduced from baseline score of 80.6 8.83 kg to 78.6 9.06 ( -2 kg ) , at 4 weeks , 77.2 8.94 ( -3.4 kg ) , 75.62 8.87 ( -4.98 kg ) and 75.22 6.88 ( -5.38 kg ) , at the end of 4 , 8 , 16 and 24 weeks respectively [ table 3 ] .
there was a decrease in wc to 37.7 2.64 ( -0.9 inches ) at 4 weeks , 36.3 3.45 ( -2.3 inches ) at 8 weeks , 35.91 2.92 ( -2.69 inches ) at 16 weeks 35.24 2.41 ( -.3.36 inches ) at the end of 24 weeks ( p 0.001 ) [ table 3 ] . in the control arm bmi decreased from a mean 31.7 3.25 kg / m at baseline to 31.4 3.69 ( -0.3 ) , 30.8 3.3 ( -1.09 ) , 29.82 3.206 ( -1.88 ) and 29.58 3.23 ( -2.12 ) at 4 , 8 , 16 and 24 weeks [ table 3 ] .
effect of control on weight , wc and bmi ( mean sd ) in overweight and obese women ( n = 24 ) when the effect of group i ( intervention group ) and control on weight was compared at 4 , 8 , 16 and 24 weeks , there was no significant difference between them up to 8 week . at 8 weeks group i caused a significant decrease in weight ( p 0.05 ) when compared with the placebo arm and this significant difference in weight reduction continued throughout the study period ( p < 0.05 ) at both 16 and 24 weeks .
on comparing the effect of group i and control wc at 4 , 8 , 16 and 24 weeks , the group i in a similar manner produced a significant reduction in wc from 8 week onwards up to 24 weeks ( p 0.05 ) .
on comparing the effect on bmi , fall in bmi was statistically significant in group i and the effect started at 4 week ( p 0.05 ) and the differences in bmi reduction were highly significant at 16 and 24 week ( p 0.001 ) [ table 4 ] .
comparative analysis of group i ( n = 30 ) and group ii ( n = 24 ) on weight , wc and bmi in overweight and obese women
group i observed , reduced mean weight from 83.1 7.64 kg at baseline to 80.2 7.4 ( -2.9 kg at 4 weeks , 73.2 7.5 ( -9.9 kg ) at 8 weeks , 71.6 6.46 ( -11.5 kg ) at 16 weeks and 71.2 6.52 ( -11.9 kg ) at 24 weeks . the effect was found to be statistically significant at 4 , 8 , 16 and 24 weeks ( p 0.001 ) when compared with baseline [ table 2 ] .
effect of life - style management on weight , wc and bmi ( mean sd ) in over weight and obese women ( n = 30 ) similarly in group i , a significant decrease in wc from 4 week onwards .
there was a decrease from baseline score of 38.6 2.33 inches to 37.3 2.17 ( -1.3 inches ) with ( p 0.001 ) at 4 weeks , 34.9 2.02 ( -3.7 inch ) at 8 weeks ( p 0.001 ) , 34.56 2.40 ( 4.04 inch ) at 16 weeks and 34.02fnx08 2.62 ( -4.58 ) ( p 0.001 ) at 24 weeks .
intervention group i showed a significant decrease in bmi from 4 week . the decrease was observed from a mean baseline score of 30.6 2.7 kg / m to 29.5 2.62 ( -1.1 inch ) at 4 weeks ( p 0.001 ) , 26.8 2.5 ( -3.8 ) at 8 weeks ( p 0.001 ) 0 , 26.3 2.26 ( -4 ) at 16 weeks ( p 0.001 ) and 26.1 2.61 ( -4.5 ) at 24 weeks ( p 0.001 ) .
peak decrease was seen at 24 weeks [ table 2 ] . in the control arm , group
ii mean weight reduced from baseline score of 80.6 8.83 kg to 78.6 9.06 ( -2 kg ) , at 4 weeks , 77.2 8.94 ( -3.4 kg ) , 75.62 8.87 ( -4.98 kg ) and 75.22 6.88 ( -5.38 kg ) , at the end of 4 , 8 , 16 and 24 weeks respectively [ table 3 ] .
there was a decrease in wc to 37.7 2.64 ( -0.9 inches ) at 4 weeks , 36.3 3.45 ( -2.3 inches ) at 8 weeks , 35.91 2.92 ( -2.69 inches ) at 16 weeks 35.24 2.41 ( -.3.36 inches ) at the end of 24 weeks ( p 0.001 ) [ table 3 ] . in
the control arm bmi decreased from a mean 31.7 3.25 kg / m at baseline to 31.4 3.69 ( -0.3 ) , 30.8 3.3 ( -1.09 ) , 29.82 3.206 ( -1.88 ) and
29.58 3.23 ( -2.12 ) at 4 , 8 , 16 and 24 weeks [ table 3 ] .
effect of control on weight , wc and bmi ( mean sd ) in overweight and obese women ( n = 24 ) when the effect of group i ( intervention group ) and control on weight was compared at 4 , 8 , 16 and 24 weeks , there was no significant difference between them up to 8 week . at 8 weeks group i caused a significant decrease in weight ( p 0.05 ) when compared with the placebo arm and this significant difference in weight reduction continued throughout the study period ( p < 0.05 ) at both 16 and 24 weeks . the maximum effect was seen at 24 weeks [ table 4 ] . on comparing the effect of group i and control wc at 4 , 8 , 16 and 24 weeks , the group i in a similar manner produced a significant reduction in wc from 8 week onwards up to 24 weeks ( p 0.05 ) .
on comparing the effect on bmi , fall in bmi was statistically significant in group i and the effect started at 4 week ( p 0.05 ) and the differences in bmi reduction were highly significant at 16 and 24 week ( p 0.001 ) [ table 4 ] .
i ( n = 30 ) and group ii ( n = 24 ) on weight , wc and bmi in overweight and obese women
weight gain per se does not appear to be affected by the hormonal changes of the menopause .
other factors that may contribute to obesity in women include a low level of activity , parity , lower level of education , a family history of obesity , use of psychotropic drugs and chemotherapy .
in addition to the adverse physical consequences of obesity , weight excess is a major risk factor for psychological distress , low self - esteem , depression and sexual dysfunction .
the result of the current study is in full accordance with these recommendations . as on comparison life - style modification
reductions in weight , bmi and abdominal circumference have been associated with a reduction in vasomotor symptoms in overweight and obese women .
the combination of dietary modification and exercise also has positive effects on health - related quality of life ( hrqol ) and psychological health , which may be greater than that from exercise or diet alone .
improvements in weight , aerobic fitness and psychosocial factors may mediate some of the effects of these interventions on hrqol . weight loss in overweight and obese women improves psychological well - being , hrqol , self - esteem and health practices .
in addition , dietary weight loss and exercise exert a positive effect over insulin resistance in pmw , which together with a decrease in menopausal symptoms may potentially decrease cardiovascular risk .
the results of these studies are in accordance with our study as per beneficial effects of life- style modification is concerned on weight management of pmw , however the current study did not study the beneficial effects on various other parameters such as quality of life , symptom score and cardiovascular parameters . some of the recent studies are also in accordance with the current study . dietary weight loss and
exercise has been shown to improve body measures and biomarkers of glucose metabolism and inflammation independent of antidepressant use in overweight or obese , pmw in a 12-month randomized controlled trial .
similarly , caloric restriction , weight loss diet with or without exercise has been shown to reduce biomarkers of inflammation in pmw , with potential clinical significance for cancer risk reduction .
positive changes in depression , stress and social support have been shown to independently associated with increased hrqol , after adjusting for changes in weight and aerobic fitness exercise group among overweight / obese pmw .
dietary weight loss , with or without exercise , significantly improved insulin resistance and older women have been shown to derive as much benefit as did the younger pmw in one of the recent study .
the results of the present study are in accordance to our study , however our study was only planned to see the benefits on weight , bmi and wc among pm obese / overweight indian women .
thus , physical exercise and dietary changes are absolutely essential in the treatment of obesity particularly when existing literature fails to recommends the use of drugs for the effective and safe management of pm obesity .
first , it is a short - term study with less number of patients and effect of small sample size can not be ruled out on results of the study as power of the study was not calculated before resuming the current study .
thus , the highly encouraging results noticed in the current study need to be validated in larger indian population .
no biochemical markers , effects on menopausal symptoms , cvs parameters and impact on quality of life as a result of weight reduction were studied .
furthermore , highly motivated population included in the study retained these effects on long - term or not remains to be seen .
the results of the present study strongly recommend the life - style management to be incorporated in daily routine of pmw under the supervision and motivation / adherence to life - style management shall go a long way to avoid dual menace of obesity and its related complications .
Output:
| aim : the aim of the following study is to evaluate the effect of life - style modification on postmenopausal ( pm ) overweight and obese indian women in a randomized controlled 24 week study.materials and methods : two groups were formed group i ( n = 30 ) was designated as intervention ( dietary and exercise group ) and group ii ( n = 24 ) served as control .
comparison of weight , waist circumference ( wc ) and body mass index ( bmi ) were made and compared among two groups at 4 , 8 , 16 and 24 weeks.results:mean age at menopause was 48.35 years versus 49.65 years ; mean number of menopausal symptoms were 5.70 1.76 versus 5.10 1.56 and mean duration since menopause was 2.70 versus 2.90 years in groups i and ii respectively .
when the effect of group i and control on weight was compared at 4 , 8 , 16 and 24 weeks , there was no significant difference between them up to 8 week . at 8 weeks group
i caused a significant decrease in weight ( p 0.05 ) when compared with control arm and which continued throughout the study period ( p < 0.05 ) at both 16 and 24 weeks .
group i produced a significant reduction in wc from 8 weeks onwards up to 24 weeks ( p 0.05 ) .
bmi was statistically significant in group i and the effect started at 4th week ( p 0.05 ) and the differences in bmi reduction were highly significant at 16th and 24th weeks ( p 0.001).conclusion : the results of the present study strongly recommend the life - style management to be incorporated in daily style of postmenopausal women under controlled supervision . |
PubmedSumm7835 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: partial cholecystectomy , whether open ( 1,2 ) or laparoscopic ( 3 ) , has been described as a safe and effective operation .
it is indicated in cases of severe acute cholecystitis , gangrenous cholecystitis or necrotizing cholecystitis , where the degree of inflammation precludes safe visualization of biliary structures .
partial cholecystectomy removes the majority of the gallbladder , leaving a portion of the neck , and occasionally the posterior wall of the gallbladder , in place .
( 4 ) it is reportedly tolerated well , with few minor postoperative complications , however the issues that do occur include recurrent symptoms , choledocholithiasis and persistent biliary fistula . ( 5 ) historical accounts have documented partial cholecystectomy performed in the 1950s with washout and removal of gallbladder contents with placement of a drain in the orifice of the cystic duct when dissection of the hilar structures would be too dangerous , or the gallbladder was densely adherent to the liver bed .
( 6 ) it should be noted that even though technically possible , partial cholecystectomy is less than the ideal procedure , which is a complete cholecystectomy , with total removal of the gallbladder and closure of the cystic duct remnant .
partial cholecystectomy may not provide a cure in all patients because leaving a portion of the gallbladder in situ in connection to the common bile duct may contribute not only to the formation of new stones , but also leaves a path intact for continued biliary colic and obstruction .
we review a case in which partial cholecystectomy was performed due to severe inflammation in a young otherwise healthy patient .
a 22 year - old male presented with a history of several months of nausea , vomiting , right upper quadrant abdominal pain and in the last two weeks , jaundice .
seven months prior , he had undergone a partial cholecystectomy at an outside institution for severe acute cholecystitis .
the case was attempted laparoscopically , however due to lack of visualization , it was converted to an open approach .
the gallbladder was dissected from the fundus in a retrograde fashion , but extended far posteriorly , and was noted to be beyond surgical reach , secondary to the acute inflammation .
a partial cholecystectomy was done with a surgical ta stapler across the infundibulum leaving approximately 25% of the gallbladder , including the entire cystic duct .
mrcp shows the residual gallbladder ( x ) , and the dilated common bile duct with stones ( white arrows ) over seven months , he had continued frequent recurrent attacks of acute cholecystitis , and choledocholithiasis .
his symptoms included frequent nausea , vomiting , persistent sharp right upper quadrant pain , fever , and jaundice , which precipitated multiple emergency department visits to multiple institutions .
the patient presented to our institution with an outside ultrasound that demonstrated multiple residual stones , a sonographic murphy s sign , and dilated common bile duct of 9 mm .
. 1 ) and gallstones were visualized in the remaining portion of the gallbladder by ct , ( fig .
preoperatively , an ercp with sphincterotomy was performed to extract the remaining common bile duct stones ( fig .
ct of the abdomen demonstrates the residual portion of the gallbladder , marked by an
the staple line , indicated by a black arrow , is seen best on the coronal imaging at operation , the previous transverse right upper quadrant incision was reentered , and dissection continued down to the liver .
the previously stapled remnant of gallbladder was identified as partially intrahepatic , and located at the most inferior portion of the liver .
the cystic duct and artery were then each ligated and a completion cholecystectomy was performed . due to the still severe inflammation , the estimated blood loss was 1800 cc . on pathology ,
the patient tolerated the surgery well and was discharged home the following day , and made a full recovery with no further symptoms .
ercp shows a residual cystic duct ( black arrow ) , and choledocholithiasis ( white arrows )
in patients with acute cholecystitis , partial cholecystectomy can be performed , when the severity of inflammation precludes safe dissection of the hilar structures .
depending on the extent of the resection and the structures left in situ , there is a definite risk of recurrence of symptoms , including recurrent acute cholecystitis ( 7 ) , gallstone pancreatitis ( 8) and choledocholithiasis .
the morbidity of recurrent gallbladder issues will require further endoscopic and/or surgical interventions in at least some patients , as the underlying pathophysiologic process responsible for the acute cholecystitis has not been definitively managed .
all efforts should be made to remove remaining gallstones from the remaining portion of the gallbladder ; as this was not done in our patient it explains the lack of recovery from the partial cholecystectomy .
analogous to a cholecystostomy tube placement , partial cholecystectomy should therefore be considered another option for temporizing the patient experiencing severe acute cholecystitis .
however , there needs to be an awareness that the patient will need to be considered for definitive surgical management with a completion cholecystectomy . in our case , this was done via an open approach due to the adhesions and the posterior position of the remnant gallbladder , but in more favorable cases it has been performed laparoscopically .
Output:
| partial cholecystectomy has been documented in the literature as a safe alternative in the management of patients with acute cholecystitis when the degree of inflammation prevents a safe dissection to identify the biliary structures for complete removal of the gallbladder .
partial cholecystectomy however is not without risk of recurrence , and the need for further surgical or endoscopic intervention in management of complications .
we review a case in which partial cholecystectomy was performed without any relief of symptoms , to review the possible postoperative complications , and caution that these patients will need to be considered for a completion cholecystectomy . |
PubmedSumm7836 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: brackets used were first premolar brackets of the 022 028 roth prescription , made of five different materials .
they were divided into the following six groups which include a control group which did not have any brackets : group i : stainless steel brackets ( victory 3 m , unitek , monrovia , ca , usa ) group ii : composite brackets ( brilliant , forestadent , pforzehim , germany ) group iii : ceramic brackets ( clarity , 3 m , monrovia , ca , usa ) .
group iv : titanium brackets ( orthos , ormco , glendora , ca , usa ) group v : gold brackets ( magnum , orthodontic design and production , inc . , vista , ca , usa ) group vi : control , without brackets . in each group , 24 samples for culture were taken as follows : 8 containing s. mutans , 8 containing c. albicans , and 8 containing a combination of s. mutans and c. albicans .
the microorganisms used were a wild strain of s. mutans provided by microbiologics , inc , minnesota , usa , an atcc 35668 strain of s. mutans , an oral stain of c. albicans isolated from the sri ramachandra university microbiology laboratory , and an atcc 10231 strain .
s. mutans was seeded in brain heart infusion agar under microanaerobiosis at 37c for 24 h. c. albicans was seeded in sabouraud dextrose agar and incubated under aerobic condition at 37c for 18 h. microbial suspensions were prepared with each species on reaching the exponential growth .
eight samples from each of the five experimental groups were cultured with one of the microorganism groups .
the procedure was performed as suggested by brusca et al . with flat - bottomed vials .
the brackets were then transferred to the respective medium with 20% of sucrose added to it .
sucrose was used because s. mutans produces glucans from sucrose , which allows the adherence to the glass surface of the vials .
these eight vials of each group were inoculated with 1 ml of microbial solution in a concentration of 1 10 and 1 10 colony - forming units ( cfus ) of mutans streptococci and c. albicans , respectively .
this was achieved by matching the culture media with the organism to the control with the help of turbidity meter , dade behering , microscan , dade behring microscan inc west sacramento , ca according to macfarlane standard .
then , the brackets were placed in the glass vials with the help of straight point tweezers .
the control group consisted of three vials , one with s. mutans , one with c. albicans , and the third tube with both s. mutans and c. albicans .
the procedure was performed close to a culture oven and the vials were placed in a crate made ad hoc to secure them in a fixed position .
the samples were incubated at 37c for 48 h. the brackets were removed using straight point tweezers .
the supernatant in the vials was removed , the vials were turned upside down to perform the macroscopic examination of the cells adhered to the glass , and specially designed score grid was placed on the bottom of the vials .
after the bracket removal , each of the experimental vials was compared with the control vials to evaluate the adherence to the brackets .
the brackets were then processed for electron microscopy , during which they were dehydrated in alcohol , dried , and fixed in 10% formaldehyde and treated with gold palladium using hitachi e-1010 ion sputter .
the brackets were then observed using hitachi s - 3400 scanning microscope with 50 to 2500 magnifications .
the biological controls included commercial strip with bacterial spores containing 1.6 10
bacillus stearothermophilus and 2.3 10
bacillus subtilisvarniger .
the viability of the spore in the strips was tested prior to the study using staining techniques that allow for morphological evaluation .
the results were expressed as the number of cfus per milliliter ( cfu / ml ) .
statistical analysis was done with spss software version 15 and the results were expressed as mean values .
one - way analysis of variance ( anova ) and scheff post hoc test were used for multiple comparisons .
brackets used were first premolar brackets of the 022 028 roth prescription , made of five different materials .
they were divided into the following six groups which include a control group which did not have any brackets : group i : stainless steel brackets ( victory 3 m , unitek , monrovia , ca , usa ) group ii : composite brackets ( brilliant , forestadent , pforzehim , germany ) group iii : ceramic brackets ( clarity , 3 m , monrovia , ca , usa ) .
group iv : titanium brackets ( orthos , ormco , glendora , ca , usa ) group v : gold brackets ( magnum , orthodontic design and production , inc . , vista , ca , usa ) group vi : control , without brackets . in each group , 24 samples for culture were taken as follows : 8 containing s. mutans , 8 containing c. albicans , and 8 containing a combination of s. mutans and c. albicans .
the microorganisms used were a wild strain of s. mutans provided by microbiologics , inc , minnesota , usa , an atcc 35668 strain of s. mutans , an oral stain of c. albicans isolated from the sri ramachandra university microbiology laboratory , and an atcc 10231 strain .
s. mutans was seeded in brain heart infusion agar under microanaerobiosis at 37c for 24 h. c. albicans was seeded in sabouraud dextrose agar and incubated under aerobic condition at 37c for 18 h. microbial suspensions were prepared with each species on reaching the exponential growth .
eight samples from each of the five experimental groups were cultured with one of the microorganism groups .
the procedure was performed as suggested by brusca et al . with flat - bottomed vials .
the brackets were then transferred to the respective medium with 20% of sucrose added to it .
sucrose was used because s. mutans produces glucans from sucrose , which allows the adherence to the glass surface of the vials .
these eight vials of each group were inoculated with 1 ml of microbial solution in a concentration of 1 10 and 1 10 colony - forming units ( cfus ) of mutans streptococci and c. albicans , respectively .
this was achieved by matching the culture media with the organism to the control with the help of turbidity meter , dade behering , microscan , dade behring microscan inc west sacramento , ca according to macfarlane standard .
then , the brackets were placed in the glass vials with the help of straight point tweezers .
the control group consisted of three vials , one with s. mutans , one with c. albicans , and the third tube with both s. mutans and c. albicans .
the procedure was performed close to a culture oven and the vials were placed in a crate made ad hoc to secure them in a fixed position .
the samples were incubated at 37c for 48 h. the brackets were removed using straight point tweezers .
the supernatant in the vials was removed , the vials were turned upside down to perform the macroscopic examination of the cells adhered to the glass , and specially designed score grid was placed on the bottom of the vials .
after the bracket removal , each of the experimental vials was compared with the control vials to evaluate the adherence to the brackets .
the brackets were then processed for electron microscopy , during which they were dehydrated in alcohol , dried , and fixed in 10% formaldehyde and treated with gold palladium using hitachi e-1010 ion sputter .
the brackets were then observed using hitachi s - 3400 scanning microscope with 50 to 2500 magnifications .
the biological controls included commercial strip with bacterial spores containing 1.6 10
bacillus stearothermophilus and 2.3 10
bacillus subtilisvarniger .
the viability of the spore in the strips was tested prior to the study using staining techniques that allow for morphological evaluation .
the results were expressed as the number of cfus per milliliter ( cfu / ml ) .
statistical analysis was done with spss software version 15 and the results were expressed as mean values .
one - way analysis of variance ( anova ) and scheff post hoc test were used for multiple comparisons .
the results obtained under these experimental conditions showed that the capacity of each of the studied microorganisms to adhere to glass and brackets was determined . table 1 shows the number of cfus adhering to the glass surface of the flat - bottomed vials without brackets .
both species added together resulted in a significant decrease in cfu / ml , compared with s. mutans alone ( p<0.001 ) [ table 1 ] .
one of the common problems that should be avoided in orthodontic treatment is the development of dental plaque which is initiated by the adhesion of s. mutans to the tooth surface or orthodontic devices .
ervedi stated that most orthodontic patients are not able to perform effective plaque control , and therefore develop mild to moderate gingivitis during treatment with fixed appliances .
it is accepted that the presence of foas greatly inhibits oral hygiene and creates new retentive areas for plaque and debris , which in turn predisposes to increased carriage of microbes and subsequent infection .
discussed a link between an increased level of dental plaque in individuals treated with foas and the subsequent development of gingivitis .
ogaard has indicated an increasing incidence of incipient carious lesion on the facial and lingual aspects of the teeth , while rosenbloom and tinanoff reported increased gram - positive bacterial counts in saliva during treatment with foas .
plaque accumulating around orthodontic brackets often results in enamel white spot formation adjacent to brackets .
this plaque is composed of various microorganisms of which s. mutans is the most cariogenic .
these insoluble glucans also attach to the tooth surface , providing ideal sites for oral bacteria to inhabit .
the resulting complex of glucan and various bacteria then creates an oral biofilm which is the mature stage of dental plaque .
as plaque accumulates , acidic compounds such as fructose and other fatty acids degrade the enamel surface of the teeth through a process known as dental caries .
discussed the high oral colonization by the fungal pathogen c. albicans in individuals wearing either full or partial removable denture .
candida species have also been isolated from dental plaque and caries and the subgingival flora .
as yet , there have been limited studies examining the colonization trends of candida species in well - defined populations using foas .
evaluating s. mutans alone revealed that there was a greater number of cfus on stainless steel brackets than on plastic and ceramic brackets .
but not in agreement with the reports of papaioannou et al . , fournier et al . , and brusca et al . , who found no obvious difference in the adhesion of s. mutans to stainless steel , plastic , and ceramic brackets
when c. albicans was evaluated alone , the results revealed a greater adherence to plastic and ceramic brackets than to stainless steel brackets , and this finding is in accordance with the report of brusca et al .
gold brackets had the least number of cfus and were similar to the control group [ figure 1 ] .
titanium brackets had the greatest number of cfus and this could be because of the rough surface characteristics of this bracket .
shows quantitatively that the number of cfus of s. mutans was modified in the presence of different bracket types .
the mean cfus / ml of s. mutans for stainless steel brackets was found to be the highest , followed by gold , ceramic , plastic , and titanium in descending order when s. mutans and c. albicans were evaluated in combination , which is more reflective of the clinical situation , rather than individual examination of the microorganisms , there was a decrease in cfus of both s. mutans and c. albicans , revealing an antagonistic relationship at least in the initial growth .
this finding is in accordance with the brusca et al . who also reported that once the microorganisms are established in the plaque , they do not inhibit each other , but rather seem to exert a synergistic effect .
there was a greater number of cfus for plastic and ceramic brackets when compared to the metal brackets , with stainless steel having the least number of cfus .
examining the brackets showed that titanium had the least number of cfus with s. mutans alone , while it had the greatest number of cfus with c. albicans alone but was similar to stainless steel brackets when the organisms were evaluated together [ figure 2 ] .
this could suggest some antibacterial property of titanium to s. mutans , which was not effective against the fungi , thus mirroring bundy 's observation of titanium being an inhibitor , but this property not being consistent .
it can be seen that the number of cfus differs according to the bracket composition .
the adherence of c. albicans was similar in the case of titanium and plastic brackets , with titanium having the highest count .
the gold brackets were similar to the controls in case of s. mutans and c. albicans since the fungi grow by hyphae formation , the rough surface characteristics of titanium brackets could have facilitated the increased levels of c. albicans when it was studied alone .
gold brackets showed a decreased number of cfus when s. mutans and c. albicans were analyzed alone or in combination .
plastic and ceramic brackets showed a decreased number of cfus when s. mutans was evaluated alone and the levels were increased when c. albicans was studied alone and when the organisms were evaluated together .
stainless steel brackets showed increased levels when s. mutans was evaluated separately , but decreased levels with c. albicans and when the organisms were evaluated in combination [ figure 3 ] .
shows the cfus / ml when s. mutans and c. albicans were added together . a decrease in cfus / ml
was observed in the presence of metallic brackets . and to the contrary , the ceramic brackets triggered an increase in cfu / ml .
the titanium brackets were similar to the control in the number of cfu / ml the variation between brackets when s. mutans was analyzed alone could be explained on the basis of surface free energy and tension .
van dijk has shown that more microorganisms adhered to substrata with an initially high surface free energy than to substrata with an initially low surface free energy .
eliades has shown that stainless steel had the highest critical surface tension , indicating an increased potential for microorganism attachment on metallic brackets .
accordingly , a material with high surface free energy will attract more bacteria to its surface than a material with low surface free energy [ figures 413 ] .
eliades et al . have suggested that metal brackets increase the level of bacterial adhesion because of the greater surface energy compared with ceramic brackets .
show the electron microscopy images of the different brackets ( stainless steel , composite , ceramic , titanium , and gold ) removed from the vials containing s. mutans and c. albicans together .
it can be seen that the adherence of microorganisms to the brackets was great on the slot zone and varied according to bracket composition .
it was higher on the ceramic and lower on the metallic brackets evaluation under sem showed that the yeasts exhibited numerous cell elongations in the presence of composite , which could be interpreted as potential intercellular bridges involved in the adhesion mechanism that allows the formation of pseudohyphae .
the formation of pseudohyphae is noteworthy although the culture medium does not induce filamentation of c. albicans .
hyphae formation has been considered a virulence factor associated with greater invasive capacity , tissue invasion , and greater resistance to phagocytes .
the present study is to evaluate in vitro the affinity of two important oral microorganisms , s. mutans and c. albicans , to various bracket materials which are used for a significant period of time during orthodontic treatment .
however , various factors which could affect the microorganism colonization , like the presence of saliva , elastomers , metal ligatures , nickel , titanium , or steel arches , adhesives , etc .
, which are present in the oral cavity , warrant further in vivo studies to conclude the effects of microorganisms on appliance components .
when s. mutans and c. albicans were evaluated together , plastic and ceramic brackets showed greater number of cfus than stainless steel , titanium , and gold .
when s. mutans was evaluated alone , stainless steel showed the greatest number of cfus than any of the other bracket materials studied .
when c. albicans was evaluated alone , stainless steel showed the greatest number of cfus than any of the other bracket materials studied . when s. mutans and c. albicans were evaluated together , there was a decrease in cfus , thereby indicating an antagonistic relation .
Output:
| objective : to quantify the adherence of streptococcus mutans and candida albicans on brackets made of stainless steel , plastic , ceramic , titanium , and gold , and to evaluate the various sites of adherence of these microorganisms with scanning electron microscopy ( sem).materials and methods : brackets made of stainless steel , plastic , ceramic , titanium , and gold were used .
the adherence of s. mutans and c. albicans were studied .
the brackets were placed in flat - bottomed vials containing basal medium with 20% sucrose added ; the flasks were inoculated with each of the microbial suspensions .
the samples were incubated at 37c for 48 h , after which the brackets were removed .
the cells adhering to the glass were counted and the brackets were studied with sem.results:when evaluated together , the adherence of s. mutans and c. albicans was increased in the ceramic bracket group . when evaluated separately ,
metallic brackets had increased number of colony - forming units ( cfus ) of s. mutans and the use of titanium brackets increased the cfus of c. albicans .
sem demonstrated that the adherence of s. mutans and c. albicans together varied according to the bracket materials , with ceramic having the greatest and stainless steel having the least adherence.conclusions:oral hygiene may be of greater concern with esthetic brackets since this study shows that microbial adhesion is greater with these brackets . |
PubmedSumm7837 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: debate on quality and its management and improvement initially began in 1950s , which has served as an important criterion for evaluating the performance of most organizations services , including health care organizations ( hcos ) ( 13 ) .
different models and systems , such as tqm ( total quality management ) , iso ( international standards organization ) and efqm have been developed or adapted over time to assess and improve the quality in health care .
bohigas and heaton ( 4 ) place these programs in four main categories including certification by iso , business excellence awards [ e.g. mbnqa malcolm baldrige national quality award ] , efqm , professional peer reviews [ e.g. visitation , vasitatie in dutch ] and accreditation .
this study seeks to compare the evaluation results of two external assessment programs in iran ; trying to verify the performance assessment results of inphe through the application of efqm .
the inphe was established by iranian ministry of health and medical education ( mohme ) in 1997 at its new structure aiming to assess and improve the quality and safety of services delivered by all hospital nationwide ( 6 ) .
this program is of a national standard setting and local ( decentralized ) monitoring status ( 7 ) .
the highest evaluation grade granted to the hospitals by inphe , as braithwaite et al .
( 8) put it , is deemed as a valid indicator of high organizational performance and central to the safety and quality in hcos .
the evaluation process of inphe normally starts from the emergency department ( ed ) of hospitals .
the ed evaluation is conducted entirely independent of the rest of the hospitals and has important implications for their assessment .
that is , if a hospital does not obtain acceptable scores for its ed , its evaluation will be suspended until the ed gains a satisfactory score .
in other words , the overall grade of the hospital can never exceed the grade of its ed ( 9 ) .
this emphasis on the eds , given the nature ( i.e. vitality ) of the activities in this department , is understandable ( 10 ) .
however , it might also force the hospitals to unwittingly neglect their main activities at the expense of obtaining higher grades for their eds evaluation .
table 1 shows the scoring system of inphe for the eds as opposed to that of efqm model .
it is clear from the table that the inphe is stricter than efqm as it requires hcos to obtain 90% of the scores in order to gain the excellent position .
along with this program , mohme has been urging the hcos to apply other quality improvement such as efqm to promote the quality and prepare for the inphe evaluation in recent years .
it has mandated the all universities of medical sciences ( umss ) to apply the efqm at least in one of their hospitals ( there are presently 40 umss in the country , which are responsible both for health services delivery and medical education ) . at present
, approximately 48 hospitals have applied this quality system in the country ( 12 ) .
briefly , the efqm model is an internationally recognized model for assessing the quality of organizations , which can serve as a diagnostic tool for self - assessment , where organizations can grade themselves against a set of detailed criteria grouped into enablers and results ( 13 ) .
iranian national quality award ( inqa ) was designed based on the efqm model in 2003 , following some modifications in the criteria , sub - criteria and the weight of original model .
therefore , the mohme recommended the application of the original efqm-2010 to the hospitals later on , considering no alteration in the nine criteria and sub - criteria and weights , except for in its guidance notes ( 15 ) .
an important reason behind the interest of iranian health system in efqm is to lay the groundwork for an effective presence in the medical services market of middle east , in line with the country s 20-year vision plan ( 16 ) .
such a ground for application of efqm is also echoed by lee ( 17 ) .
several studies in the health sector have used the efqm model ( 2023 ) ; for example , as in line with the aim of current study , vallejo and colleagues ( 21 ) concluded that the efqm model could be a suitable model for self - assessment at departmental level in hospitals and to identify the areas of improvement .
numerous iranian studies have also used the efqm-2003 model to assess quality in hcos ( 2430 ) . despite various studies on both efqm and iranian evaluation program ,
there are some justifications behind current study : first , all these studies have simply relied on one model to assess the quality of hcos performance . as to the comparison of the two quality assessment models ,
nevertheless , the most have compared the coverage rate of the inphe and the jci s standards without considering their results in practice ( 31 , 32 ) .
similarly , delgoshai and tofighi ( 33 ) have compared the coverage of the iso and the inphe s standards .
all these studies point to the deficient coverage of the inphe s standards as compared to those of the jci and iso . at international literature
, the existing studies have mainly investigated the differences and similarities of various models and none has undertaken a comparison based on their assessment results ( 3437 ) .
second , unlike previous research , our study has a departmental approach , that is , rather than covering all activities of a hospital , it only concentrates on one department , which is emergency department ( ed ) ( i.e. a more focused study ) .
in addition , the ed is an overly vital part of any hospital , which is not studied independently before .
the importance of the ed is also recognized in a way it is evaluated by the inphe ( more explanation came formerly ) .
in fact , current study aims to contribute to this extant area of literature through scrutinizing and validating the results of inphe relying on the evaluation results of an internationally - known quality management system ( qms ) ( i.e. efqm ) .
since the country has also started to review and replace current evaluation system , the results could serve as invaluable practical implication for such a purpose .
third , previous studies in the country applied the efqm-2003 ; we instead used efqm-2010 , which was the latest version at that time .
the inphe was established by iranian ministry of health and medical education ( mohme ) in 1997 at its new structure aiming to assess and improve the quality and safety of services delivered by all hospital nationwide ( 6 ) .
this program is of a national standard setting and local ( decentralized ) monitoring status ( 7 ) .
the highest evaluation grade granted to the hospitals by inphe , as braithwaite et al .
( 8) put it , is deemed as a valid indicator of high organizational performance and central to the safety and quality in hcos .
the evaluation process of inphe normally starts from the emergency department ( ed ) of hospitals .
the ed evaluation is conducted entirely independent of the rest of the hospitals and has important implications for their assessment .
that is , if a hospital does not obtain acceptable scores for its ed , its evaluation will be suspended until the ed gains a satisfactory score . in other words , the overall grade of the hospital
this emphasis on the eds , given the nature ( i.e. vitality ) of the activities in this department , is understandable ( 10 ) .
however , it might also force the hospitals to unwittingly neglect their main activities at the expense of obtaining higher grades for their eds evaluation .
table 1 shows the scoring system of inphe for the eds as opposed to that of efqm model .
it is clear from the table that the inphe is stricter than efqm as it requires hcos to obtain 90% of the scores in order to gain the excellent position .
along with this program , mohme has been urging the hcos to apply other quality improvement such as efqm to promote the quality and prepare for the inphe evaluation in recent years .
it has mandated the all universities of medical sciences ( umss ) to apply the efqm at least in one of their hospitals ( there are presently 40 umss in the country , which are responsible both for health services delivery and medical education ) . at present , approximately 48 hospitals have applied this quality system in the country ( 12 ) .
briefly , the efqm model is an internationally recognized model for assessing the quality of organizations , which can serve as a diagnostic tool for self - assessment , where organizations can grade themselves against a set of detailed criteria grouped into enablers and results ( 13 ) .
iranian national quality award ( inqa ) was designed based on the efqm model in 2003 , following some modifications in the criteria , sub - criteria and the weight of original model .
therefore , the mohme recommended the application of the original efqm-2010 to the hospitals later on , considering no alteration in the nine criteria and sub - criteria and weights , except for in its guidance notes ( 15 ) . an important reason behind the interest of iranian health system in efqm is to lay the groundwork for an effective presence in the medical services market of middle east , in line with the country s 20-year vision plan ( 16 ) .
such a ground for application of efqm is also echoed by lee ( 17 ) .
several studies in the health sector have used the efqm model ( 2023 ) ; for example , as in line with the aim of current study , vallejo and colleagues ( 21 ) concluded that the efqm model could be a suitable model for self - assessment at departmental level in hospitals and to identify the areas of improvement .
numerous iranian studies have also used the efqm-2003 model to assess quality in hcos ( 2430 ) . despite various studies on both efqm and iranian evaluation program ,
there are some justifications behind current study : first , all these studies have simply relied on one model to assess the quality of hcos performance . as to the comparison of the two quality assessment models ,
nevertheless , the most have compared the coverage rate of the inphe and the jci s standards without considering their results in practice ( 31 , 32 ) .
similarly , delgoshai and tofighi ( 33 ) have compared the coverage of the iso and the inphe s standards .
all these studies point to the deficient coverage of the inphe s standards as compared to those of the jci and iso . at international literature ,
the existing studies have mainly investigated the differences and similarities of various models and none has undertaken a comparison based on their assessment results ( 3437 ) .
second , unlike previous research , our study has a departmental approach , that is , rather than covering all activities of a hospital , it only concentrates on one department , which is emergency department ( ed ) ( i.e. a more focused study ) .
in addition , the ed is an overly vital part of any hospital , which is not studied independently before .
the importance of the ed is also recognized in a way it is evaluated by the inphe ( more explanation came formerly ) .
in fact , current study aims to contribute to this extant area of literature through scrutinizing and validating the results of inphe relying on the evaluation results of an internationally - known quality management system ( qms ) ( i.e. efqm ) .
since the country has also started to review and replace current evaluation system , the results could serve as invaluable practical implication for such a purpose .
third , previous studies in the country applied the efqm-2003 ; we instead used efqm-2010 , which was the latest version at that time .
conducted in the second half of 2012 , the study investigated all eds located in the hospitals with more than 300 beds affiliated with tums , as they had a well - developed ed .
they were chosen because in these hospitals , more than 30 emergency beds existed . in accord with the mohme s guidelines , less
the latter is the subject of this study , as the researchers thought the performance of departments were under their own control and valid to measure .
the data collection team included five members most of them experienced in both efqm assessment and inphe .
they all had an efqm assessor certificate with two members of the team further having more than five years of inphe experience .
as with the inphe , since it is a state - run program the researchers could only access to the final evaluation results of the selected hospitals eds .
the evaluation process of inphe comprises a pre - arranged ( announced ) site visit by a multidisciplinary team of surveyors .
the evaluation usually takes no more than one week depending on the size of hospitals and the number of in - patient beds . during the evaluation process ,
the surveyors based on their own specialties investigate different aspects of hospitals activities including medical equipment , and clinical and paramedical spaces ; they interview medical staff ( mainly nurses ) and sometimes patients , and finally review the related documents . at the end of the site visit , the surveyors are expected to hold a meeting with managers of the hospital to discuss the problems and to brief them on existing non - compliances with pre - announced standards .
the result of the assessment is usually sent to the hospitals within a month of the visit and , if any ed is non - compliant , namely achieving grade 4 , it is given six months to improve its deficiencies and solve its identified problems .
by contrast , higher grades of eds and hospitals allow for an increase in the tariffs of hospitals hotel - type services ( 9 ) .
the researchers conducted the data collection using the efqm-2010 standardized questionnaire ( 39 ) , following its conversion into farsi and back - translation into english and
the team members completed their questionnaires for each department through observation , interview and review of related documents .
radar logic was used to score the eds in each sub - criterion . to put simply using efqm language
, the team assessed that whether the appropriate and integrated approaches deployed systematically in all sections of the eds existed and that these approaches and their deployment were constantly measured , reviewed and improved in each enabler sub - criterion . as such in the result - related sub - criteria , the specific and fulfilled objectives , improving trends compared to the past and other eds and the established relationship between the results and the approaches as well as the scope of reported results were assessed and included in the questionnaire .
drawing on the efqm consensus process , for each criterion one consensus meeting , thus overall nine meetings were held among assessment team members .
consensus is efqm ascendancy , which is also used in the inphe score setting process .
however , there is a difference . in the efqm if the variance of the all team members scores is less than 25% , the average score is considered , otherwise , discussion on the justifications of the members must close the scoring gap and a revisit to the site and re - check of the existing evidence might be the last option to this end . in the inphe ,
recheck of the evidence and revisit is not conducted and there is no 25% variation condition for averaging the members scores .
as to the performance differentiation of two programs , besides checking the structure and process of inphe against efqm ( table 2 ) , the researchers mainly compared the overall results of these quality assessment systems in order for evaluating their performance , as their similarities were more recognizable . the highest score attainable for eds according to inphe and efqm model were 1672 and 1000 , respectively ( 18 , 40 ) .
the researchers calculated the score of each ed , based on the models , as percentage in proportion to the total score and compared subsequently ( fig .
1 ) . in addition , we standardized the scores of the inphe according to the efqm score ( see figure 1 : sinphe ) , to make them more comparable and the variations more recognizable .
that is , we considered the highest inphe score achieved by eds as equal to the highest efqm score and adjusted the other inphe scores for the rest of eds proportionally .
ms excel was used to display the results . from the research ethic perspective , the proposal of this study was approved by the research ethics committee of tums and the name of the hospitals was anonymized for the sake of confidentiality .
the total scores of the eds , based on the efqm , were 43.3 , 40 , 26.9 , 22.8 , 21.8 percent and 90.9 , 90.9 , 84.2 , 83.2 , 83 percent based on inphe ( fig .
it was understood that out of five hospitals selected , two have already implemented external qmss such as iso and efqm .
the findings revealed that the score of the departments with at least three years of experience in qmss was higher than other departments .
figure 2 shows the percentage score for five eds separately for the enablers and results .
the mean of enablers criteria was higher than that of the results in all eds .
the mean percentages of the eds scores in the nine criteria of the efqm ( i.e. leadership ; strategy ; people ; partnership and resources ; processes , products and services ; customer results ; people results ; society results ; and key results ) were 30.6 , 25.6 , 33.8 , 40.6 , 38.4 , 31.6 , 29.6 , 20.4 and 29.6 , respectively ( fig .
the highest score pertains to the partnerships and resources and the lowest to the society results .
although inphe have ten domains ( human resources , religious and ethical aspects , physical structure and establishment , medical equipment and medication , safety issues , patient satisfaction , management , hospital committees , sanitation and cleanliness , information system and medical records ) for assessing quality of eds , they are not of a logical base as with the components of efqm model .
figure 4 shows the quality web of the eds in nine criteria of efqm model . as clear ,
the area inside each web represents the quality level and its symmetry implies the balance in the implementation of quality management .
therefore , it could be said that the ed3 overall covered the largest area and owned the most symmetry .
the mean percentages of the eds scores in the nine criteria of the efqm ( i.e. leadership ; strategy ; people ; partnership and resources ; processes , products and services ; customer results ; people results ; society results ; and key results ) were 30.6 , 25.6 , 33.8 , 40.6 , 38.4 , 31.6 , 29.6 , 20.4 and 29.6 , respectively .
the highest score pertains to the partnerships and resources and the lowest to the society results .
as the inphe is not of an organized and clear criterion - based structure , we could not draw such figures for this model .
figure 1 illustrates the comparative percentage scores of the departments based on the efqm and inphe with the standardized inphe ( sinphe ) curve ( the standardization of the inphe is based on efqm scores . ) .
the mean percentage score of the eds was 31% based on the efqm and 86.4% on inphe implying a relatively large difference ( i.e. 55% ) in the scores of two programs .
the overall results of the eds with previous implementation of the any qms were higher than rest .
the mean score of the former was 416.75 as compared to 238.33 for those without any system of quality improvement .
as such , the departments with a qms could score almost two times more in leadership , strategies , processes , products and services , customer and society results criteria .
a raft of models has nowadays emerged for assessing and improving the quality in organizations ( 34 ) .
this abundance has as such made the choice of an appropriate model difficult for most of hcos .
comparison of various qmss , as in the current study , could render a performance assessment of the qmss ( 41 ) and explore the strengths and weaknesses of these models making the selection to some extent easier for the organizations .
the most substantial finding of this study comes from the comparison of two programs scores .
as noted earlier , only the final percentage scores were considered for this purpose ( fig .
first , a huge gap existed between the score ranges of inphe and efqm alluding to the poor level of inphe standards compared to those of efqm unlike the fact that at the first glance the inphe s standards seemed to be stricter ( table 1 ) .
it might be argued that the difference could partly result from the dissimilar attitudes of two programs surveyors .
however , to alleviate this effect , the researchers included some of the inphe surveyors ( with efqm certificate ) into the efqm assessment team beforehand .
another reason for this difference might be related to the organizational learning curve ( 42 , 43 ) in that as the eds have been evaluated by the inphe checklists for many years , they might have mastered them and could score high in comparison with the efqm which is fairly new .
the figure also demonstrates that the gap is not equal among the efqm and inphe scores of the five eds .
considering the fact that the mohme is both the owner and assessor of these eds ( through inphe ) and the hospitals with higher evaluation grade could charge higher tariffs and encounter less deficits , this debate could arise that due to its conflict of interest the mohme might show more leniency to avoid its hospitals facing with financial problems .
therefore , the scores are kept high even those of the eds whose efqm score is at the lowest level . to address this issue , according to the fifth plan of economic , social and cultural development ( 20092014 ) , the parliament mandated the delegation of responsibility evaluation to an independent body ( 44 ) which has not been put in action thus far .
the mohme has also moved towards developing an accreditation program of hospitals to be implemented in late 2012 .
second point from the figure 1 is the variation among the scores of eds based on two programs .
as the figure exhibits , the fluctuation is approximately three times more in efqm scores ( range= 22% ) than inphe ( range=7% ) .
this differentiation is more noticeable when the score of those eds with ( eds 1 and 2 ) and without ( eds 35 ) prior record in using qmss is considered .
it means that efqm is of a higher differentiation power , so apparently a more valid assessment tool .
the higher enablers score implied that the eds are potentially competent to render better results in terms of the quality of the services .
the scores allocated to the different dimensions of the eds by the inphe somehow confirm this finding , that is , more than 60% of the scores are allocated to the structural and human - related aspects ( enablers ) of the eds ( 42 ) .
in fact , this overemphasis , we could argue , has drawn the hospitals towards concentrating more on the enablers ( capabilities ) than the results .
2 shows wherever the score of each enabler is high their corresponding results are also high confirming the logic behind efqm model .
the different score of the eds with and without any history in application of qmss , in terms of radar logic , was because the eds with no qms presented either oral or little evidence in approaches .
they have not gathered and analyzed the required data for assessing approaches and deployment or used them for refining approaches and deployment .
these departments could not also present enough evidence in results criteria about trends , goals , comparisons and causes .
furthermore , further investigation into the findings revealed that the score of the departments with at least three years of experience in qmss was 1.7 times more than other departments confirming the results of those studies published after the implementation of the efqm model ( 2123 ) .
although the casual relationship based on longitudinal or cross - sectional descriptive studies has serious limitations , the repetition of same results in different times and places might strengthen the hypothesis of causality . the distribution pattern of scores between enablers and results found in this study was similar to the results of more domestic and foreign studies .
consistent with most similar studies ( internal and external ) on efqm , the eds obtained the highest score in people , partnerships and resources and processes criteria ( fig .
improvement was also found to be more substantial in people , partnerships and resources and processes criteria over several years ( 22 , 23 ) .
this finding arguably implies that designing and implementing quality improvement projects in terms of enabler criteria is easier as they could be readily prepared .
further , the outcomes are seemingly more tangible and quickly achieved in enablers . the lowest score of society and strategy is also echoed by all studies conducted inside the country and slightly different from studies abroad in which the society and people results are of the lowest score ( fig .
the reason the society results scored low in our study was found owing to the lack of society - oriented attitudes among the managers as seen in the hospitals policies and strategies . as to the strategy score , since , it is mostly relevant for whole organization , at departmental level ( e.g. an ed ) the score might not be achieved , as similarly debated by valejo ( 21 ) .
the average efqm score of eds ( i.e. 31% ) was lower than the mean scores of domestic ( 53.4% ) and foreign studies ( 37.4% ) conducted on the hospitals .
this difference might be because they had mostly used self - assessment with questionnaire or scoring workshop , while this study relied only on external assessment .
current study despite its limitations is one of the very few studies in the literature , which have compared two external evaluation programs .
the results comparison ( or verification ) of an internal hco evaluation program ( i.e. inphe ) with those of an internationally recognized quality assessment ( i.e. efqm ) was intended to , in a way , deliver a performance assessment of the former and prove the feasibility of the efqm application at a departmental level .
the results revealed that the inphe assessments were not confirmed by those of efqm model ( eds average score based on efqm= 31% and inphe= 86.4% ) .
the 55% score difference and 15% variation range in line with two models could allude to the higher efqm differentiation power in assessing the performance as opposed to inphe and consequently necessitates the scrutiny of the structure , processes and scoring system of the inphe .
moreover , the efqm-2010 was found to be a suitable model for assessing the quality of hospital services at the departmental level .
such advantages of efqm as having conceptual , criterion - based framework , self - assessment process , scoring logic ( i.e. radar ) and applicability de facto could be invoked in the design and implementation of local models for hcos evaluation .
the cross - sectional design of the study and its small sample size could be the main limitations of the study .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .
Output:
| backgroundeuropean foundation for quality management ( efqm ) model is a widely used quality management system ( qms ) worldwide , including iran .
current study aims to verify the quality assessment results of iranian national program for hospital evaluation ( inphe ) based on those of efqm.methods:this cross - sectional study was conducted in 2012 on a sample of emergency departments ( eds ) affiliated with tehran university of medical sciences ( tums ) , iran . the standard questionnaire of efqm ( v-2010 )
was used to gather appropriate data .
the results were compared with those of inphe .
ms excel was used to classify and display the findings.results:the average assessment score of the eds based on the inphe and efqm model were largely different ( i.e. 86.4% and 31% , respectively ) .
in addition , the variation range among five eds scores according to each model was also considerable ( 22% for efqm against 7% of inphe ) , especially in the eds with and without prior record of applying qmss.conclusion:the inphe s assessment results were not confirmed by efqm model .
moreover , the higher variation range among eds scores using efqm model could allude to its more differentiation power in assessing the performance comparing with inphe .
therefore , a need for improvement in the latter drawing on other qmss ( such as efqm ) strengths , given the results emanated from its comparison with efqm seems indispensable . |
PubmedSumm7838 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| we report on the
synergy between catalytic propulsion and mesoporous
silica nanoparticles ( msnps ) for the design of janus nanomotors as
active cargo delivery systems with sizes < 100 nm ( 40 , 65 , and 90
nm ) .
the janus asymmetry of the nanomotors is given by electron beam
( e - beam ) deposition of a very thin platinum ( 2 nm ) layer on msnps .
the chemically powered janus nanomotors present active diffusion at
low h2o2 fuel concentration ( i.e. , <3 wt
% ) .
their apparent diffusion coefficient is enhanced up to 100% compared
to their brownian motion . due to their mesoporous architecture and
small dimensions
, they can load cargo molecules in large quantity
and serve as active nanocarriers for directed cargo delivery on a
chip . |
PubmedSumm7839 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: one in four people in the world is affected by mental or neurological disorders at some point in their live .
about 450 million people currently suffer from such conditions , placing mental disorders among the leading causes of ill - health and disability worldwide .
according to the world health organization ( who ) , the vast majority of countries allocate less than 2% of their health budgets to mental health , leading to a treatment gap of more than 75% in many low and middle income countries .
the poor often bear the greater burden of mental disorders , both in terms of the risk in having a mental disorder and the lack of access to treatment .
constant exposure to severely stressful events , dangerous living conditions , exploitation , and poor health in general contribute to the greater vulnerability of the population .
the lack of access to affordable treatment makes the course of the illness more severe and debilitating , leading to a vicious circle of poverty and mental health disorders that is rarely broken
. often referred to as the common cold of mental disorders , both anxiety and depression are debilitating conditions that greatly impair psychological , social , and emotional well - being .
more than 20% of the adult population suffer from these conditions at sometime during their life .
anxiety disorders are common mental diseases of the central nervous system ( cns ) that include heterogeneous phenomena such as panic disorder , phobias , obsessive - convulsive disorders , generalized anxiety disorders , and posttraumatic stress disorders while depressive disorders are illnesses that involve the body , mood , and thought .
anxiety and depressive disorders have many causes : on one hand those related to environment , mode of life , modernization of habits , industrialization , worries , stressing professional situations , and economical and financial crisis . on the other hand
, we have intrinsic causes that can be genetic , some diseases like cardiac and respiratory insufficiencies and malfunctioning of the thyroid gland . for many years , anxiety and depression
were considered as two different mental diseases , with the benzodiazepines used as drugs of choice for acute anxiety states and the amine uptake inhibitors to treat depression .
meanwhile the clinicians seem to have become less sure of the original mutually exclusive classification of the two diseases , with margin between anxiety and depression becoming blurred [ 4 , 6 , 7 ] . in the treatment of anxiety disorders , the benzodiazepines are now slowly replaced by antidepressants , which are not only efficacious in depression but also in acute and long - term treatment for major anxiety disorders .
the different drugs used act on gaba receptors ( gabaa ) as agonist at the receptors , increasing calcium influx . in a general manner , gaba acts to reduce the firing of the dopaminergic neurons .
however almost all pharmacological treatments used to diminish these disorders have adverse side effects including sedation , sleep disturbance , and sexual dysfunctioning and are not accessible to all due to poverty .
there is a great interest in fundamental and clinical research to explore new therapeutic targets and new molecules acting on the central nervous system . at the same time , there is a growing interest of people across the country to the use of alternative medicine , particularly in the acute phase of neurological disorders .
however , the evidence to recommend the use of herbal medicines in the treatment of these illnesses is still insufficient .
there are reports about the popular use of tapinanthus dodoneifolius ( dc ) danser ( loranthaceae ) also called agelanthus dodoneifolius ( polh and wiens ) in treating hypertension and malaria . in the far north region of cameroon
, it is used in the treatment of diabetes and cancer . during an ethnobotanical survey in this region we also found that the stem bark of t. dodoneifolius was systematically used by more than two thirds of traditional healers in the treatment of epilepsy .
these observations indicate that this plant may certainly have some therapeutic effects on the cns . nevertheless , there is no scientific evidence about potential effects of tapinanthus dodoneifolius on the neurological disorders .
the main objective of the present study was then to evaluate the neuroprotective effects and memory improvement properties of tae on animal models of anxiety and depression .
animals were adult albino swiss male mice ( 12 weeks , 27 2 g ) . they were purchased from lanavet ( laboratoire national vtrinaire , garoua ) and housed in groups of 5 in polypropylene cages with wood shavings as bedding , under a natural 12 h/12 h light / dark cycle ( lights on at 7:00 a.m. ) and controlled temperature ( 23 2c ) .
the animals had free access to water and food , with the exception of 1 h before and during the experiments .
the animals were not specifically handled prior to the experiments , with the exception of handling during necessary animal care ( cleaning the cages ) and drug administration ( weighing , tail marking , and drug administration ) .
the stem bark of tapinanthus dodoneifolius used in our experiments was collected in october 2012 , from mokon in the far north region of cameroon and identified by mrs .
hamawa youkouda , agroforestrist , and froumsia moksia , botanists , at the department of agriculture , livestock and by - products of the higher institute of sahel ( iss ) of the university of maroua .
this was later authenticated at the national school of fauna , garoua , where the voucher specimen already existed under the number hefgn 7406 .
the stem bark of the plant was chopped into small pieces and shade dried in the laboratory at room temperature for three weeks until all the water evaporate .
one hundred gram of dried , ground material was extracted in 1000 ml of boiled distilled water and allowed to infuse for 60 minutes .
the extract was later filtered using a whatman gf / c ( 90 mm ) paper and evaporated to dryness in an oven ( 50c ) . the yield of the extract was 3.6 w% .
tae ( 25 , 50 , and 100 mg / kg ) , diazepam ( 2 mg / kg ; roche , france ) , and imipramine ( 10 mg / kg , sigma , italy ) as well as vehicle ( 10 ml / kg ) were administered intraperitoneally ( i.p . ) .
tae dose was set based on a preliminary ethnopharmacological survey , as administered to human being .
preliminary phytochemical screening was carried out according to classic laboratory methods as described by harborne . in this study ,
the mice were assigned to independent groups ( 5 in each group ) , except in the y - maze test where there were 6 animals per group .
the procedures used in the present study were in accordance with the guide for the care and use of laboratory animals eighth edition ( copyright 2011 by the national academy of sciences ) .
the experiments were performed in the morning ( 812 h ) , and the illumination level was 200 lux in the experimental room .
the elevated plus - maze apparatus consists of four arms ( 25 5 cm ) elevated 40 cm above the floor , with each arm positioned at 90 relative to the adjacent arms .
open and closed arms were connected via a central area ( 5 5 cm ) to form a plus sign .
mice were randomly assigned to experimental groups : negative control ( normal saline 10 ml / kg , i.p . ) , positive control ( diazepam 2.0 mg / kg , i.p . ) , and tae ( 25 , 50 , and 100 mg / kg , i.p . ) .
testing commenced 30 minutes after administration of drug by placing a mouse on the central platform of the maze , facing an open arm .
the number of entries into and the time spent on each of the two types of arms were recorded during 5 minutes [ 14 , 15 ] .
we also recorded in the apparatus behavioral parameters such as head - dips ( dipping the head below the open arm of the epm , with all four paws on an open arm ) , stretch attend postures ( frequency with which the animal demonstrated forward elongation of the head and shoulders followed by retraction to the original position ) , numbers of grooming ( duration of time the animal spent licking or scratching itself while stationary ) and rearing ( frequency with which the mice stood on their hind legs in the maze ) , and time in the central platform . the plus - maze was thoroughly cleaned with 70% ethanol between tests .
the open field arena was made of white polywood ( 72 cm 72 cm 36 cm ) and divided into twelve squares of equal areas .
mice were carried to the test room in their home cages and were handled by the base of their tails at all times .
the five groups of animals received the various treatments as described above 30 minutes prior to the test .
each animal was placed into the center of the open field and allowed to explore the apparatus for 5 minutes .
after the 5 minutes test , mice were returned in their home cages and the open field cleaned with 70% ethanol and permitted to dry between tests .
the observed parameters were ambulations ( the number of squares crossed with all four paws ) , numbers of grooming and rearing , and time spent at the center and at the border if the arena .
the apparatus consisted of a transparent glass cylinder ( 30 cm high 20 cm diameter ) filled to a 20 cm depth with water maintained at 25 2c . in the pretest
, mice were placed in the cylinder for 15 min , 24 h prior to the 5-min swimming test .
animals were distributed 30 minutes prior to the swimming test as in the epm test , but diazepam was replaced by imipramine at 10 mg / kg . for the 6-minutes swimming test ,
the following behavioral responses were recorded by a trained observer during the last four minutes : swimming time , defined as movement time throughout the swim chamber , which included crossing into another quadrant , and immobility time considered when the mouse made no further attempts to escape except the movements necessary to keep its head above the water .
increases in active responses , such as climbing or swimming , and reduction in immobility , were considered as behavioral profiles consistent with an antidepressant - like action .
y - maze test is widely used to assess exploratory behaviors , learning , and memory function in rodents [ 19 , 20 ] .
the y - maze apparatus consisted of three identical arms ( 33 11 12 cm each ) in which the arms are symmetrically separated at 120. animals were randomly divided into five groups of 5 or 6 animals : negative control ( 10 ml / kg of normal saline ) ; tae ( 25 , 50 , and 100 mg / kg ) ; and positive control ( diazepam 2.0 mg / kg ) . because we were interested in the cognitive and not in the neuroendocrine
changes induced by running - wheel activity , we tried to design our experiment in such a way that stress levels are not minimized .
y - maze learning can also be stressful to the mice because of the new environment .
no habituation session was undertaken , and by so doing , stress was associated with this task due to the fact that the mice were not allowed to voluntarily enter the apparatus but were placed by the experimenter on an arm of the apparatus .
nonhabituated mice were gently placed at the end of one arm and were allowed to freely explore the y - maze during 8 min .
the number of arm visits ; sequence of arm visits ; rearing frequency ; grooming frequency ; and the number of lines crossed were recorded for each mouse by a trained observer .
the number of maximum spontaneous alternation behaviors was then calculated by subtracting two units from the total number of arms entry , and the percent of spontaneous alternation was calculated as ( actual alternations / maximum alternations ) 100 [ 21 , 22 ] .
spontaneous alternation behavior is considered to reflect spatial working memory , which is a form of short - term memory while the total number of arm entries was considered to reflect spontaneous locomotor activity .
one way anova followed by newman - keuls multiple comparison test was performed using graphpad prism version 5.00 for windows , graphpad software , san diego california usa , http://www.graphpad.com/. a probability level of 0.05 or less was accepted as significant .
pearson 's correlation coefficient and regression analysis were used to evaluate the connection between the working memory errors and some parameters like locomotion , grooming and rearing in the y - maze test .
the phytochemical screening revealed that tae contains proteins , alkaloids , glycosides , saponins , tannins , phenols , and flavonoids . in the epm , tae at the doses used significantly ( f(3.28 ) = 5.30 , p <
0.010 ) reduced the number of entries in closed arms in a dose - dependent manner , as compared to the control , with the higher activity at the higher dose , that is , 100 mg / kg ( 3.50 2.06 versus 9.80 2.92 for the control group ) .
we also observe that diazepam brought about a highly significant ( f(5.31 ) = 30.67 , p < 0.0006 ) decrease in the number of entries in closed arms and an increase in the open arms ( figure 1 ) .
figure 2 shows that in the epm animals of the control group spent more time in the closed arm .
when treated with the plant extract at the doses of 25 and 50 mg / kg , no remarkable changes were noticed .
the highest dose of tae ( 100 mg / kg ) significantly increased ( f ( 5.31 ) = 7.30 , p < 0.030 ) the time spent by the animals in the open arm compared to the control , with a concomitant decrease of the time spent at the closed arm . this was an index of the anxiolytic effect of the extract at this dose .
diazepam as the reference drug also exhibited this pharmacological activity with a more important effect .
as shown in figure 3 , the rearing , grooming , and head dipping behaviors were high in control animals in the epm .
but when the animals were pretreated with the different doses of tae , the number of grooming significantly ( f(3.28 ) = 4.62 , p < 0.02 ) decreased in a dose - dependent manner with the highest effect obtained at the dose of 100 mg / kg .
interestingly , the inhibitory activity of the extract on the grooming behavior was more pronounced than that of diazepam ( 2 mg / kg ) , the reference drug . similarly , the rearing which is a form of vertical locomotor activity also significantly ( f(3.28 ) = 5.70 , p < 0.009 ) decreased with the maximum effect at the dose of 50 mg / kg . the head dipping behavior in the elevated plus maze test was also significantly ( f(3.28 ) = 8.39 , p < 0.002 ) inhibited by the pretreatment of the animal with the extract ( figure 3 ) .
when placed in the open field arena , the control animals exhibited ambulatory activities marked by the number of lines crossed ( 94.40 17.35 ) . with the tae pretreatment , the number of lines crossed
severely dropped to 24 3.4 and 23 9.7 , respectively , at the doses of 50 and 100 mg / kg ( figure 4 ) . however , the inhibitory effect of diazepam on the locomotion was more pronounced than that of the plant extract .
the saline - treated animals passed all the time at the border of the field , spending about 4 min and 66 s of the 5 min test session at that zone . with the tae treatment , a nonsignificant decrease in the time spent at the border of
the maze was noticed ( results not shown ) . the results of this test revealed that the swimming time of the animals treated with tae increased in a dose - dependant manner .
however , the significant response was obtained only at the highest dose ( 100 mg / kg , ( f(5.31 ) = 10.63 , p <
the immobility time increased with the dose of 25 mg / kg and drops with doses of 50 mg / kg and 100 mg / kg .
the standard drug in this test , imipramine , also decreased significantly the immobility time ( figure 5 ) .
after a single administration of tae , there was an increase in the percentage of spontaneous alternation in animals treated with the intermediate dose ( 66.71% 9.51 ; 50
mg / kg ) of the plant extract , when compared to control group ( 49.80% 8.42 ) , suggesting effects on short - term memory .
this increase in the percentage of spontaneous alternations was significant ( f(2.92 ) = 1.93 , p < 0.05 ) ( figure 6 ) .
the number of lines crossed in the treated animals decreased in a dose - dependent manner as compared to the saline treated animal ( control ) .
the effect obtained at a dose of 50 mg / kg was comparable to that of the standard drug diazepam ( 2 mg / kg ) .
tae also significantly reduced the grooming ( f(3.23 ) = 12.73 , p < 0.0002 ) and the rearing ( f(3.23 ) = 9.69 , p < 0.0007 ) behaviors of animals in this task . when linear regression was determined , negative correlation between spontaneous alternation versus number of entries in the maze ( n = 5 , r = 0.745 , p = 0.2678 ) ( figure 8(a ) ) , between spontaneous alternation versus grooming time ( n = 5 , r = 0.716 , p = 0.358 ) ( figure 8(b ) )
however a positive but very low and therefore not significant correlation between spontaneous alternation versus number of rearing in the maze ( n = 7 , r = 0.237 , p = 0.2678 ) was noted ( figure 8(c ) ) .
in the present study , the anxiolytic , and antidepressant - like effects of the acute administration of tae were studied in different animal models of anxiety and depression .
the effect of this extract on memory improvement was later investigated using y - maze paradigm .
the plant extract was first studied using the elevated plus maze which is considered to be an etiologically valid animal model of anxiety because it makes use of natural stimuli .
anxiety - like behavior may be represented by an avoidance of the open arm and immobility of an animal placed in the elevated plus maze . in accordance with previously published reports , anxiolytic substances like diazepam increased the percentage of open arm entries and the time spent by animals in the open arms [ 2426 ] . in this work ,
treatment of mice with tae lead to a dose - dependent and significant ( p < 0.01 ) decrease in the number of entries in closed arms .
the time spent in open arms increased but was significant only at 100 mg / kg ( p < 0.05 ) .
diazepam , a benzodiazepine anxiolytic drug used as standard drug , also significantly ( p < 0.001 ) increased the open arm exploration .
it is quite important to notice that in the epm , some stress parameters like rearing , grooming , and head dipping were significantly reduced when the animals were pretreated with the extract ( p < 0.05 ) or with diazepam ( p < 0.01 ) , when compared to control mice .
the increase in time spent in the open arms in the epm is an indicator of reduction of anxiety in rodents . however , in this study , the reduction of the time spent in the close arm was not systematically followed by an increase of the time in the open arm .
the anxiolytic effects of benzodiazepine drugs are usually accompanied by decreased ambulatory activity and sedation . taken together , these results highly suggested that the action of tae may be more sedative than anxiolytic .
the oft was also used for the investigation of the anxiolytic state of the mice .
general activity in the oft measures various behavioral parameters , among those related to emotional , exploratory , and motor behaviors .
the first exposure of the animal to the open field has a more marked emotional component than the remaining aspects of exposure .
the results obtained with this animal model showed that diazepam ( 2 mg / kg ) , tae at all the doses used , significantly decreased the number of lines crossed by mice ( ambulatory activity ) . moreover , the time spent at the center was also slightly increased .
this may indicate that the plant possesses substances that may have sedative or anxiolytic properties . on the other hand ,
the reduced locomotion pattern of the mice in the oft confirmed the result obtained with the epm and strongly suggested that this plant may produce sedative effects .
it is well known that benzodiazepines have sedative and ataxic side effects [ 25 , 30 , 31 ] .
this was entirely confirmed in our study , using 2 mg / kg of diazepam .
however , it is noteworthy that a reduction in spontaneous activity can be due to a variety of causes other than sedation , such as motor impairment or muscle relaxation .
therefore , other behavioral evaluation , such as prolongation of pentobarbital - induced sleep are needed to confirm the sedative effect of tae .
moreover since in the forced swimming test the result of the extract was an increase in swimming time , we tend to exclude the muscle relaxation amongst the causes of the reduction of spontaneous locomotion of mice .
these findings raised the possibility that the anxiolytic or sedative and other central depressant effects of the extract may be exerted by different phytoconstituents possibly acting through different receptor subtypes or having different affinity for the relevant receptors .
nevertheless , the reduction of anxiety in the two animal models used in our study may either be related to the action of the tae on benzodiazepine sites of gabaa receptor complex .
the tae may bind to the gamma subunit of gaba - a receptor , increasing the gaba activity in the brain , through an increase in chloride ion conductance and inhibition of the action potential .
this proposed mechanism may explain the powerful sedation and the anxiolytic effect of the extract as it is well known that benzodiazepines have this pharmacological profile .
however an antagonist on 5-ht13 receptors can also be hypothesis [ 32 , 33 ] .
flavonoids with anxiolytic activity have been described in many plant species used in folk medicine such as passiflora caerulea .
the tlc phytochemistry of t. dodoneifolius carried out by wahab et al . revealed the presence of terpenoids and terpenoid - related compounds .
these substances have proven their efficiency in animal models of anxiety , pain , depression , and epilepsy .
the forced swimming test is a well - known behavioral test in rodents that predicts the clinical efficacy of many types of antidepressants and investigates the mechanism underlying their action .
various antidepressant medications including serotonin reuptake inhibitors ( ssri ) , tricyclic antidepressants , or nmda receptor antagonists reverse the immobility posture and promote the occurrence of escape - related behavior .
the immobility displayed by rodents when subjected to unavoidable stress such as forced swimming is thought to reflect a state of despair or lowered mood , which are thought to reflect depressive disorders in humans .
rodents when forced to swim in a cylinder from which they can not escape will , after an initial period of vigorous activity , display a characteristic immobile posture which can be readily identified and is said to reflect a state of despair .
moreover , it has some drawbacks represented by the possibility of obtaining some false positive or negative responses .
drugs that enhance motor activity may give a false positive effect in the forced swimming test .
therefore , this test would not be as a good test for antidepressants such as nomifensine , amineptine , and any plant extract exhibiting myostimulant activities , since these agents increase motor activity . in this study ,
the single administration of 100 mg / kg of tae provoked significant reduction of the immobility time of mice subjected to forced swimming as compared to the control group .
the result was quite comparable to that of imipramine , the tricyclic antidepressant drug used as standard at the same dose of 10 mg / kg , indicating that the extract possesses antidepressant activity on the central nervous system . to discount the possibility of false positive response
as shown in the elevated plus maze and in the open field tests , the extract did not increase spontaneous motor activity in mice but had a significant inhibition on the locomotory activity . putting these results together
, we can strongly suggest that the antidepressant activity of the tae has no link with any skeletal muscle stimulation .
depression is commonly accepted to be a disorder due to disturbances in neurotransmitters function , particularly serotonin , noradrenalin , and dopamine .
reduction in brain serotonin has been reported to be one of the most important etiological factors for genesis of depression , and the most widely used antidepressants namely ssris , increase extracellular availability of serotonin [ 18 , 41 , 42 ] .
thus tae may exert its antidepressant effect through one or some of these central nervous neurotransmitters acting on glutaminergic receptors , gabaergic receptor , or serotonergic pathways . at this level
, it is not possible to give the exact mechanism of action by which t. dodoneifolius acts .
however we can hypothesize according to our results that the antidepressant effect of tae appears to be related to enhancement of central noradrenergic and/or serotonergic neurotransmissions .
this type of maze tests has been used to assess the spatial learning behavior of mice by many scientists [ 44 , 45 ] .
it is also used to determine the effect of different drugs on learning and memory process .
it is known worldwide that rodents particularly have exploratory behavior in the maze and this ability comes from their evolutionary history .
in fact rodents are small burrowing animals that have spent millennia digging and finding their way around underground tunnels . in this behavioral paradigm ,
the spontaneous alternation behavior recorded is considered to reflect spatial working memory , which in turn is a form of short - term memory . in the present study ,
animals treated with a single dose ( 50 and 100 mg / kg ) of tae showed an improvement of the memory compared to control group .
however , this improvement was significant only at the dose of 50 mg / kg . it is important to note that the process of memory is really very complex and in our study , the plant extract was acutely given once .
it will thus be important and maybe interesting to know the pattern of the results of this test if the extract is given chronically for one or two weeks . in summary
, the current work demonstrated that acute administration of the tae produced anxiolytic and antidepressant effects with a sedative side effect on mice and it slightly improves short - term memory .
we speculated that the antidepressant effect of tae observed is not due to the inhibition of the locomotory activity .
although the action mechanisms of this extract still to be studied , our results bring the pharmacological evidence of the traditional use of this plant for the treatment of some neurological disorders .
Output:
| we evaluated the anxiolytic and antidepressant effects of the aqueous extract of the bark of tapinanthus dodoneifolius ( tae ) ( danser ) ( 25 , 50 , and 100 mg / kg ) , using open field , elevated plus maze , and forced swimming tests .
effect of tae was compared to standard drugs diazepam ( 2 mg / kg ) and imipramine ( 10 mg / kg ) .
additionally , the same doses of tae were evaluated on rat 's memory using y - maze task .
results showed a significant ( p < 0.05 ; 100 mg / kg ) increase in the percentage of open arm entry and the time spent in the open arms in the elevated plus maze , suggesting an anxiolytic activity of the extract . in a dose - dependant manner , tae at 25 mg / kg significantly ( p < 0.05 ) decreased the number of lines crossed and the rearing behavior in the open field test , suggesting its possible sedative activity . in the forced swimming test ,
the immobility time of the animal was significantly reduced ( p < 0.05 ) by tae ( 100 mg / kg ) , compared to control , and this effect was quite comparable to that of imipramine . in the y - maze paradigm ,
tae at 50 mg / kg caused a significant increase in the spontaneous alternations but with a significant decrease in exploratory behavioral pattern .
taking these results together , tae improved the spatial memory and showed anxiolytic , antidepressant , and sedative activities .
the present results support the anxiolytic and antidepressant activities of tae and , to our knowledge , for the first time , demonstrate its enhancing effect on memory . |
PubmedSumm7840 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the anti - mili monoclonal antibody 17.8 was generated by immunizing mice with recombinant gst - mili .
other antibodies used were anti - flag ( sigma ) , anti - sdma ( sym11 ; millipore ) , anti - adma ( asym24 ; millipore ) , anti - tmg ( santa cruz biotech ) , anti--tubulin ( developmental studies hybridoma bank ) ; anti - hnrnpc ( 4f4 ) , anti - smn ( 2b1 ) , anti - gemin3 ( 12h12 ) , anti - gemin5 ( 10g11 ) , y12 were gifts from g. dreyfuss and antibodies against drosophila ago1 , aub , piwi and ago3 were gifts from mc .
csul flies ( csul : w;csul / cyo ) , were a gift from j. anne and a deletion that uncovers csul ( w n ; df(2r)jp7 , was obtained from bloomington drosophila stock center ( indiana university ) .
directional ligation of adapters and cdna generation was performed using the small rna sample prep kit ( illumina ) .
recombinant flag - miwi and flag - mili and gst - mili were produced in baculovirus infected sf9 cells .
the cdnas for flag - miwi and flag - mili production and flag - miwi truncations mutants ( bc for 68 - 862aa of miwi and np for 1 - 212aa ) were gifts from s. kuramochi - miyagawa and t. nakano .
arginine residues were changed to lysine ( wt : 10a - r - g - r - g - r - g - r - k18 changed to mutant : 10a - k - g - k - g - k - g - k - k18 ) , by site - directed mutagenesis ( quickchange xl , stratagene ) using the following primers ; forward : 5-caccaaaccctgtaattgctaaaggaaaaggtaaaggaaaaaagcccaataatgtagaggc-3 and reverse : 5-gcctctacattattgggcttttttcctttaccttttcctttagcaattacagggtttggtg-3. wild - type and mutant prh - flag - aub expression vectors were co - transfected with pcoblast ( invitrogen ) at a ratio of 5:1 using cellfectin at 27 c .
twenty - four hours post - transfection , cells were grown in complete schneider cell medium containing 15 g / ml blasticidin .
recombinant aub expression was induced by growing s2 cells seeded at 2 10 cells / ml in complete schneider cell medium containing 500 m cuso4 for 48 hours , and the protein was purified by immunoprecipitation using anti - flag m2 agarose ( sigma ) .
defolliculated oocytes were fixed with 10% neutral buffered formalin , paraffin embedded and sectioned at 5m ; in situ hybridization was performed with a locked nucleic acid ( lna)-modified probe against xl - pir-3 ( 5- uaaguagaagagcaccaaugucaugucc ) , an abundant pirna sequenced from x. laevis oocytes .
the sequence of the lna probe was : 5- ggacatgacattggtgctcttctactta -3-dig ( capital letters : lna - modified nucleotides ; dig : digoxigenin ) . for northern
blotting , total rna was isolated from x. laevis mixed stage oocytes and from liver and probed with 5-end radiolabeled dna probes antisense to xl - pir-3 ( probe : 5- ggacatgacattggtgctcttctactta ) and antisense to mir-16 ( probe : 5- caccaatatttacgtgctgcta ) .
a synthetic pirna containing a photo - reactive residue , 4-thio - uridine ( su ) , at position 1 ( 5-(su)gacaugaacacaggugcucagauagcuuu-3 ) was 5-end labeled using [ -p ] atp and t4 polynucleotide kinase ( t4 pnk , new england biolabs ) .
the p - labeled rnas ( 20,000 cpm ) were incubated with wild - type or mutant flag - aub beads at 28 c for 60 min in a buffer containing 20 mm tris - hcl ph 7.5 , 200 mm nacl , 2.5 mm mgcl2 , 0.05 % np-40 and complete edta - free protease inhibitors ( roche ) .
crosslinking was performed on ice by irradiation for 30 min with a 365 nm hand - held lamp ( el series uv lamp , uvp ) .
cross - linked proteins were separated by nupage and detected by storage - phosphor autoradiography .
data and analysis for x. laevis pirnas are found in the supplement and in : http://cbcsrv.watson.ibm.com / piwi_modification/.
the anti - mili monoclonal antibody 17.8 was generated by immunizing mice with recombinant gst - mili .
other antibodies used were anti - flag ( sigma ) , anti - sdma ( sym11 ; millipore ) , anti - adma ( asym24 ; millipore ) , anti - tmg ( santa cruz biotech ) , anti--tubulin ( developmental studies hybridoma bank ) ; anti - hnrnpc ( 4f4 ) , anti - smn ( 2b1 ) , anti - gemin3 ( 12h12 ) , anti - gemin5 ( 10g11 ) , y12 were gifts from g. dreyfuss and antibodies against drosophila ago1 , aub , piwi and ago3 were gifts from mc .
csul flies ( csul : w;csul / cyo ) , were a gift from j. anne and a deletion that uncovers csul ( w n ; df(2r)jp7 , was obtained from bloomington drosophila stock center ( indiana university ) .
testis and liver tissues were procured from euthanized animals . y12-immunopurified x. laevis pirnas from testis and oocytes were 5-end labeled and gel purified .
directional ligation of adapters and cdna generation was performed using the small rna sample prep kit ( illumina ) .
recombinant flag - miwi and flag - mili and gst - mili were produced in baculovirus infected sf9 cells .
the cdnas for flag - miwi and flag - mili production and flag - miwi truncations mutants ( bc for 68 - 862aa of miwi and np for 1 - 212aa ) were gifts from s. kuramochi - miyagawa and t. nakano .
were changed to lysine ( wt : 10a - r - g - r - g - r - g - r - k18 changed to mutant : 10a - k - g - k - g - k - g - k - k18 ) , by site - directed mutagenesis ( quickchange xl , stratagene ) using the following primers ; forward : 5-caccaaaccctgtaattgctaaaggaaaaggtaaaggaaaaaagcccaataatgtagaggc-3 and reverse : 5-gcctctacattattgggcttttttcctttaccttttcctttagcaattacagggtttggtg-3. wild - type and mutant prh - flag - aub expression vectors were co - transfected with pcoblast ( invitrogen ) at a ratio of 5:1 using cellfectin at 27 c .
twenty - four hours post - transfection , cells were grown in complete schneider cell medium containing 15 g / ml blasticidin .
recombinant aub expression was induced by growing s2 cells seeded at 2 10 cells / ml in complete schneider cell medium containing 500 m cuso4 for 48 hours , and the protein was purified by immunoprecipitation using anti - flag m2 agarose ( sigma ) .
defolliculated oocytes were fixed with 10% neutral buffered formalin , paraffin embedded and sectioned at 5m ; in situ hybridization was performed with a locked nucleic acid ( lna)-modified probe against xl - pir-3 ( 5- uaaguagaagagcaccaaugucaugucc ) , an abundant pirna sequenced from x. laevis oocytes .
the sequence of the lna probe was : 5- ggacatgacattggtgctcttctactta -3-dig ( capital letters : lna - modified nucleotides ; dig : digoxigenin ) . for northern
blotting , total rna was isolated from x. laevis mixed stage oocytes and from liver and probed with 5-end radiolabeled dna probes antisense to xl - pir-3 ( probe : 5- ggacatgacattggtgctcttctactta ) and antisense to mir-16 ( probe : 5- caccaatatttacgtgctgcta ) .
a synthetic pirna containing a photo - reactive residue , 4-thio - uridine ( su ) , at position 1 ( 5-(su)gacaugaacacaggugcucagauagcuuu-3 ) was 5-end labeled using [ -p ] atp and t4 polynucleotide kinase ( t4 pnk , new england biolabs ) . the p - labeled rnas ( 20,000 cpm ) were incubated with wild - type or mutant flag - aub beads at 28 c for 60 min in a buffer containing 20 mm tris - hcl ph 7.5 , 200 mm nacl , 2.5 mm mgcl2 , 0.05 % np-40 and complete edta - free protease inhibitors ( roche ) .
crosslinking was performed on ice by irradiation for 30 min with a 365 nm hand - held lamp ( el series uv lamp , uvp ) .
cross - linked proteins were separated by nupage and detected by storage - phosphor autoradiography .
data and analysis for x. laevis pirnas are found in the supplement and in : http://cbcsrv.watson.ibm.com / piwi_modification/.
Output:
| piwi family proteins are essential for germline development and bind piwi - interacting rnas ( pirnas 1
2
3 ) .
the grandchildless gene aub of drosophila melanogaster encodes the pirna - binding protein aub that is essential for formation of primordial germ cells ( pgcs ) 4 . here
we report that mouse , xenopus laevis and drosophila melanogaster piwi family proteins contain symmetrical dimethylarginines ( sdmas ) .
we find that piwi proteins are expressed in x. laevis oocytes and we identify numerous x. laevis pirnas .
we report that the drosophila homolog of protein methyltransferase 5 ( dprmt5 , csul / dart5 ) , which is also the product of a grandchildless gene 5 , 6 , is required for arginine methylation of drosophila piwi , ago3 and aub proteins , in vivo .
loss of dprmt5 activity leads to reduction of pirnas and in particular of ago3 and aub protein levels and accumulation of retrotransposons in the drosophila ovary .
our studies explain the relationship between aub and dprmt5 ( csul / dart5 ) genes by demonstrating that dprmt5 is the enzyme that methylates aub .
our findings underscore the significance of sdma modification of piwi proteins in the germline and suggest an interacting pathway of genes that are required for pirna function and pgc specification . |
PubmedSumm7841 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
life depends on the ability of an organism to correctly assess its environment and respond accordingly . to illustrate , migratory animals such as birds utilize environmental cues , including temperature and sunlight , to inform them when it is time to relocate .
failure to identify and/or respond to these cues appropriately would ultimately result in death due to cold exposure and hunger .
emerging research demonstrates that the sensory system does not simply report the status of the environment .
rather , the cues themselves can have significant effects on organismal health and longevity . in the worm caenorhabditis elegans , functional manipulation of discrete sensory neurons caused differential effects on lifespan .
subsequent studies performed using the fruit fly drosophila melanogaster not only established that the effects of manipulating the sensory system on lifespan were evolutionarily conserved but also identified a repertoire of sensory cues that have a direct impact on aging .
food cues , such as sweet ( via the receptor gr5a ) or bitter ( via the receptor gr66a ) tastes , had opposite , yet significant effects on lifespan .
ablation of water sensing via the water receptor ppk28 caused significant increases in both fat levels and lifespan .
loss of the ability to sense danger cues via the co2 receptor , gr63a , also resulted in significantly increased fat levels and in extended lifespan .
conversely , pheromonal cues , sensed in male flies via the receptor ppk23 , caused significant decreases in fat levels and longevity . while we are beginning to understand the types of environmental cues that significantly impact health and longevity , the mechanisms by which a few specific sensory neurons affect the lifespan of cells and tissues throughout the animal remain poorly understood .
neurotransmitter release is likely involved in this process since these molecules are responsible for direct communication between neighboring neurons , propagating sensory information from the initial site of sensory stimulation to deeper regions of the nervous system .
an understanding of which neurotransmitters are important in transmitting longevity signals from sensory neurons may provide clues about the types of neural circuits that are critical for controlling lifespan .
overexpression of bas-1 ( a dopa decarboxylase responsible for the synthesis of both serotonin and dopamine ) in serotonergic neurons caused improved behavioral performance with age as well as increased overall lifespan of the worms .
a separate study demonstrated that lifespan can be extended in c. elegans by pharmacologically altering adrenoceptor , histamine , serotonin , dopamine , or octopamine signaling .
dopamine has also been implicated in mammalian longevity ; mice fed the drug levodopa ( l - dopa ) , which is expected to potentiate dopamine levels , had significantly longer lives ( up to 50% longer ) , whereas dopamine receptor 4 ( drd4 ) mutants show reduced lifespan when the animals were kept in an enriched environment .
longevity signals may help identify target molecules for the development of therapies that maximize the benefits of sensory perception .
in addition to neurotransmitters , which are responsible for short distance communication between neurons , it is of interest to identify the molecules that are responsible for propagating sensory information through broader neuronal and cellular networks that affect the aging process .
one candidate neuropeptide that appears to fulfill this role is neuropeptide f ( npf ) . when male flies were exposed to female pheromones , levels of npf mrna and protein
furthermore , silencing of npf - expressing neurons rendered male flies insensitive to the effects of female pheromones .
together these data suggest that npf may be a key molecule in transmitting one or more sensory cues to different neuronal populations within the nervous system or even to other target tissues , such as the gut . of note
, the npf homolog in mammals , called neuropeptide y ( npy ) , also has significant effector roles in a variety of physiological outcomes such as feeding , metabolism , reproduction , and stress .
a second neuropeptide involved in communicating sensory information across tissues is the glucagon - like adipokinetic hormone ( akh ) .
ablation of the water - sensing receptor ppk28 increased akh levels in d. melanogaster while mutation of the akh receptor abrogated ppk28-mediated lifespan extension , implicating a role for akh in water sensing and establishing a potential link between this peptide hormone and aging .
importantly , foxo , a transcription factor in the insulin - signaling pathway that is known to influence lifespan across species , is also required for ppk28 loss of function to extend lifespan .
while the specific cues and/or the neuronal circuitry of one species may not be directly translatable to another species , the ways in which the sensory system orchestrates significant physiological changes in complex outcomes , such as aging , are likely conserved across species .
new evidence supports this view ; sensory perturbations in mice , similar to what have been demonstrated in worms and flies , significantly increased their lifespan and promoted more
brains isolated from adult male flies exposed to either ( a ) control males or ( b ) males genetically engineered to express female pheromones were immunostained against npf ( yellow ) and the nc82 neuronal cell marker ( blue ) .
the total npf immunostaining normalized to nc82 area ( n = 7 for male adult brain samples exposed to male flies ; n = 6 for male adult brain samples exposed to feminized males ; p = 0.058 as measured by student 's t - test ) . the npf antibody used in this experiment
brains isolated from adult male flies exposed to either ( a ) control males or ( b ) males genetically engineered to express female pheromones were immunostained against npf ( yellow ) and the nc82 neuronal cell marker ( blue ) .
the total npf immunostaining normalized to nc82 area ( n = 7 for male adult brain samples exposed to male flies ; n = 6 for male adult brain samples exposed to feminized males ; p = 0.058 as measured by student 's t - test ) .
what are the implications that can be made from our current understanding of the effect of sensory systems on organismal physiology ?
firstly , and perhaps the most obvious , sensory experiences may have more significant effects on human health than are currently realized .
this can be inferred from the fact that sensory manipulations in species separated in evolutionary time by millions of years of have equally dramatic effects on health and lifespan , reaffirming that the effects of sensory perception on organismal physiology is evolutionary conserved .
just which specific sensory cues are relevant to us , how they are integrated , and in what ways they impact our health and lifespan remain to be addressed .
secondly , data from our laboratory indicate that the perception of one sense leads to the drastic down - regulation in the expression of genes involved in sensing other , seemingly dissimilar environmental cues .
this observation suggests the hypothesis that organisms have evolved mechanisms to modulate their sensitivity to a certain amount of environmental input(s ) in response to the perception of others .
it will therefore be of interest to test whether exposing an organism to one type of environmental cue modifies its ability to either detect or enact an appropriate physiological response to other types of environmental cues , as would be predicted from our rna sequencing data .
thirdly , the effects of pheromone perception may directly impact evolutionary dynamics . while our recent work demonstrates that pheromone perception of the opposite gender significantly shortened fly lifespan
, we also observed that mating after pheromone exposure partially rescued the pheromone - induced lifespan effects .
thus , weaker males that sense females but are not allowed to mate are more likely to die earlier than stronger males that successfully mate .
perhaps this is a mechanism through which females manipulate males to increase the probability of mating with those that are more robust , thereby ensuring that the strongest genes are incorporated in future generations .
lastly , our laboratory has shown that pathways important for modulating aging in an organism , such as insulin and target of rapamycin signaling , can also affect pheromone production and its overall attractiveness .
it is therefore plausible that the sensory system may be a conduit through which the genome of one individual can impact the health and lifespan of another .
Output:
| while the traditional importance of the sensory system lies in its ability to perceive external information about the world , emerging discoveries suggest that sensory perception has a greater impact on health and longevity than was previously appreciated .
these effects are conserved across species . in this mini - review
, we discuss the specific sensory cues that have been identified to significantly impact organismal physiology and lifespan .
ongoing work in the aging field has begun to identify the downstream molecules that mediate the broad effects of sensory signals .
candidates include foxo , neuropeptide f ( npf ) , adipokinetic hormone ( akh ) , dopamine , serotonin , and octopamine .
we then discuss the many implications that arise from our current understanding of the effects of sensory perception on health and longevity . |
PubmedSumm7842 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: salmonella typhimurium , a facultative anaerobe , has been shown to accumulate at tumor sites when injected intravenously into mouse tumor models
attenuated s. typhimurium were engineered to express fas ligand ( fasl ) to deliver this toxic , antitumor cytokine to tumor sites and to thereby enhance therapeutic potential .
s. typhimurium expressing fasl dramatically inhibited the growth of d2f2 murine breast carcinoma and ct-26 murine colon carcinoma tumors , as well as the growth of d2f2 pulmonary metastases in mice .
these experiments involved murine tumor models , and the effects of fasl - expressing s. typhimurium on human tumor models are not yet known .
salmonella typhimurium , a facultative anaerobe , has been shown to accumulate at tumor sites when injected intravenously into mouse tumor models
attenuated s. typhimurium were engineered to express fas ligand ( fasl ) to deliver this toxic , antitumor cytokine to tumor sites and to thereby enhance therapeutic potential .
s. typhimurium expressing fasl dramatically inhibited the growth of d2f2 murine breast carcinoma and ct-26 murine colon carcinoma tumors , as well as the growth of d2f2 pulmonary metastases in mice .
these experiments involved murine tumor models , and the effects of fasl - expressing s. typhimurium on human tumor models are not yet known .
nih - ca69381 ; austrian program for advanced research and technology ( austrian academy of sciences ) .
Output:
| intravenous administration of bacteria leads to their accumulation in tumors and to sporadic tumor regression .
we therefore explored the hypothesis that salmonella typhimurium engineered to express the proapoptotic cytokine fas ligand ( fasl ) would exhibit enhanced antitumor activity .
immunocompetent mice carrying tumors derived from syngeneic murine d2f2 breast carcinoma or ct-26 colon carcinoma cells were treated intravenously with fasl - expressing s. typhimurium or with phosphate - buffered saline ( pbs ; control ) .
treatment with fasl - expressing s. typhimurium inhibited growth of primary tumors by an average of 59% for d2f2 tumors and 82% for ct-26 tumors
( eg , at 25 days after initial treatment , mean volume of pbs - treated ct-26 colon carcinomas = 1385 mm3 and of s. typhimurium fasl - treated ct-26 tumors = 243 mm3 , difference = 1142 mm3 , 95% confidence interval = 800 mm3 to 1484 mm3 , p < .001 ) . pulmonary d2f2 metastases ( as measured by lung weight ) were reduced by 34% in s. typhimurium fasl - treated mice compared with pbs - treated mice .
fasl - expressing s. typhimurium had similar effects on growth of murine b16 melanoma tumors in wild - type mice but not in lpr / lpr mice , which lack fas , or in mice with disrupted host inflammatory responses .
antitumor activity was achieved without overt toxicity .
these preclinical results raise the possibility that using attenuated s. typhimurium to deliver fasl to tumors may be an effective and well - tolerated therapeutic strategy for some cancers . |
PubmedSumm7843 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: cytotoxic t lymphocytes ( ctls ) play a significant role controlling viral replication in hiv and simian immunodeficiency virus ( siv ) infections as exemplified by diverse facts such as the association of gag - specific ctl activity and viremia or progression to aids [ 1 , 2 ] , the viral escape consequence of immune selection [ 3 , 4 ] or by enhanced ctl function in elite controllers ( ec ) [ 58 ] . in macaque models ,
this association has been reinforced by depletion studies [ 911 ] or by studying the mechanisms of protection in live , attenuated siv vaccine models [ 12 , 13 ] . yet ,
not all aids vaccines that have shown induction of strong specific t - cell responses are protective or assure effective control of hiv / siv [ 14 , 15 ] .
factors , both intrinsic and extrinsic to ctls , may be critical for determining the ability of cd8 t cells to effectively control hiv / siv replication .
several intrinsic parameters inherent to the ctl response have been shown to correlate with control of viremia and/or disease progression ( tcr repertoire and public clonotypes , avidity , polyfunctionality , killing capacity , etc . )
extrinsic factors affecting the ctl response such as the inflammatory and regulatory environment also determine the quality and persistence of cd8 t cells .
these external factors affect the ratio between target cells and effector cells or influence the phenotype and functionality of cd8 effector cells [ 17 , 20 ] , all contributing to viral control . from animal model studies
, we are learning that the generation and maintenance of a ctl response that is located at the mucosal site of viral transmission is beneficial against mucosal challenge with pathogenic sivmac [ 12 , 21 ] .
cd8 t lymphocytes interact with virus - infected cells by recognizing viral peptides presented on the cell surface by major histocompatibility complex class i molecules .
once this cognate interaction occurs , there is induction of numerous genes involved in cell cycle , proliferation , apoptosis , and cytokine secretion .
if this interaction induces killing of the virus - infected target cell , this can occur through two main pathways [ 7 , 22 ] .
ctls can bind to receptors of the tumor necrosis factor superfamily ( e.g. , fas - mediated killing ) on the surface of the target cells or deliver the contents of cytotoxic granules to these target cells , both cases ultimately inducing cell death . not only is the granule - independent pathway involving fas / fasl interaction a less frequent mode of target cell killing , but also during hiv and siv infections this pathway is highly activated and contributes to reduced cellular immunity and disease progression by activation - induced cell death of bystander cells .
the second pathway is mediated by perforin , which promotes granzyme delivery to the target cell cytosol , substrate cleavage , and cell death induction .
lately several papers have reported enhanced cytotoxic function in hiv - specific cd8 t cells from ec [ 7 , 22 ] , including a superior ability to express perforin and granzyme b , with no detectable difference in the levels of granzyme a or granulysin , and the transcription factor t bet is the enhancer of this effector activity .
degranulating capacity at mucosal level , measured by cd107 expression , has also been associated with protection against vaginal challenge with siv , where at early timepoints after challenge there was significantly less degranulation capacity in the vaginal cd8 t cells of control animals than in the immunized macaques .
moreover , cd8 t cells from mucosal tissues may be more efficient at suppressing viral replication ex vivo than cells from blood .
interestingly , compared to prime - boost regimens , vaccination with live , attenuated siv resulted in a faster kinetics of cytolysis by siv - specific ctls , with rapid and robust degranulation and granzyme b release from tetramer - positive cd8 t cells .
all these findings suggest that mucosal ctl mechanisms are contributing to the success of live , attenuated vaccines . yet , we need to determine if all the specific molecules involved in these cytotoxic mechanisms are expressed at sufficient levels in the genital mucosa .
this is important because ctls from the gastrointestinal ( gi ) mucosa express low perforin , and measurement of cd107 could be overestimating ctl function if lacking other components .
cd107 is expressed on the ctl surface when the lytic granules are discharged during target - cell lysis , thus cd107 staining quantifies the recent killing history of ctls .
but the ability of cd8 t cells to induce target cell death is dependent on granule protein content rather than on the act of degranulation itself .
still previous studies have shown that the presence of cd107 t cells correlated well with cytotoxic activity and , although ctls from the gi tract contain low perforin , an increase in the levels of perforin in gut accompanies the appearance of the siv - specific cd8 t - cell response during acute siv infection .
the qualitative aspects of the t - cell response and specifically the capacity of revealing multiple functions upon antigen stimulation is currently seen as one of the best correlates of t - cell immunity measurable directly ex vivo , since preservation of polyfunctional hiv - specific cd8 t cells is associated with control of viremia in infected people and with protection from uncontrolled viral replication in vaccinated rhesus monkeys after siv infection .
polyfunctional cd8 t cells degranulate and produce multiple functional molecules , such as interleukin-2 , interferon- , and tumor necrosis factor .
importantly , this correlation is also reported in mucosal tissues , where polyfunctional gag - specific cd8 t cells are significantly more abundant in rectal mucosa from controllers as compared to noncontrollers and patients under antiretroviral therapy or in the genital tract of the immunized macaques in live , attenuated vaccine models .
further , the most polyfunctional cells produce higher levels of cytokine on a per - cell basis .
yet , there is no consensus on which cytokines and molecules are critical to control viral replication and , thus , should be measured by these polychromatic flow cytometry assays .
all these features are related to the specific ligand - receptor recognition , among other intrinsic parameters , which are ultimately limited by the t - cell receptor ( tcr ) expressed by a particular ctl clone .
studies in this area have recognized the importance of the tcr repertoire mobilized against infection and the beneficial effect on vaccine efficacy of the public composition against viral conserved regions of these recruited clonotypes .
the repertoire engaged will impact on the breadth of the ctl response ( number of epitopes targeted ) and the balance between immunodominant and subdominant responses , both affecting viral load .
interestingly , significant overlap in the clonality and immunodominance hierarchy of the cd8 t cells isolated from blood and gi mucosa has been demonstrated .
possibly even more crucial , and independent of the specific clonotype may be the intensity of the tcr - mediated signal , which is directly linked to cd8 t - cell polyfunctionality and hiv - suppressive activity . cd8 t cells with high avidity can recognize low densities of cognate antigen on the target cell surface , resulting in effective target cell clearance ; which may correspond to a superior capacity to suppress hiv replication .
the importance of these high - avidity ctls on viral dissemination and infection clearance in animal models , especially of those induced at mucosal level , has also been established .
further , two recent studies associate the effectiveness of a ctl response and their high avidity with a narrow , public clonotypic repertoire [ 18 , 36 ] .
while recruiting high - avidity clones may be desirable to promote vaccine efficacy , viral escape is not impaired . yet , limiting initial virus replication at the mucosal level may impair the capacity of escape mutants to emerge stochastically .
there is doubt on the importance of the phenotype of the cd8 t - cell response in relation to the protective efficacy in vivo , and little difference in the functional capacity when comparing cells across a wide range of phenotypes has been shown [ 17 , 31 ] .
still , several aspects related to extrinsic factors surrounding the specific response influence antigen sensitivity and the functional profile . this way
, viral load and immune activation may induce transient hyporesponsiveness or cell exhaustion , ultimately generating less functional ctls .
in fact , antigen load and viral sequence diversification determine the functional profile of hiv-1-specific cd8 t cells . exhausted t cells express increased amounts of multiple inhibitory receptors , such as programmed death-1 ( pd-1 ) among others [ 37 , 38 ] .
pd-1 regulates t - cell activation and tolerance through mechanisms such as anergy and development of induced regulatory t cells .
the implication of pd-1 on the functional capacity of the cd8 t - cell response in chronic viral infections has been widely reported and sustained antigen - specific tcr stimulation may be key to persistent expression of this regulatory molecule .
a recent paper demonstrates that pd-1 can cause t - cell exhaustion by upregulating a gene that inhibits t - cell function , where enforced expression of basic leucine transcription factor atf - like ( batf ) was sufficient to impair t - cell proliferation and cytokine secretion .
furthermore , cd8 t cells in lymph nodes and gl mucosa of infected macaques express high levels of pd-1 while significant reduction in plasma viral load and improved functionality of these siv - specific cd8 t cells was reached by blocking pd-1 .
expression of the killer cell lectin - like receptor g1 ( klrg1 ) on t cells has recently been shown to have a functional role on human cd8 t cells inhibiting the proliferative capacity of highly differentiated cd8 t cells .
similarly , cd57 is a human natural killer-1 ( hnk-1 ) glycoprotein found on many nk cells and a subset of cd8 t cells , where it has been reported to identify terminally differentiated t cells with reduced proliferative capacity .
both these markers have been suggested to identify replicative senescent cells , but the functional capacity and the correlation of cells expressing these markers with viral load in the context of hiv / siv is unknown .
it has been shown that due to chronic t - cell activation hiv - specific cd8 t cells may become replicative senescent , express cd57 , and become prone to activation - induced apoptosis .
this may be reflective of normal t - cell development during chronic stimulation and thus not necessarily a defect within the hiv - specific cd8 t cells , since they maintain effective cytotoxic potential [ 44 , 45 ] .
moreover , the damage to gut epithelium may trigger ligation of the inhibitory receptor klrg-1 by e - cadherin , which inhibits the effector functions of klrg1-expressing hiv-1-specific cd8 t cells systemically .
it has also been shown that the majority of hiv - specific cd8 t cells are found to express cd57 , with or without pd-1 , and that cd57 pd-1 have higher survival potential ( more resistant to apoptosis ) than cd57 pd-1 .
in fact , pd-1 has been shown to be a preapoptotic factor for cd8 t cells in hiv infection [ 47 , 48 ] . in a live ,
attenuated siv vaccine experiment the increased survival potential of the gag - specific cd8 t cells was associated to control of viremia at set - point , a feature observed in these macaques during acute infection and restricted to the genital tissue .
the induction of protective prosurvival molecules ( members of the bcl-2 family ) occurs initially through tcr - mediated specific activation of t cells , but , as differentiation proceeds , this is followed by a decline in bcl-2 expression and an increase in cell death signals ( i.e. , caspases ) .
however , the strength of the stimulation determines the level and duration of bcl-2 expression . defining the expression of these molecules in antiviral t cells may be critical for understanding the nature of the protective t - cell response .
although a phenotypic definition of a protective anti - siv / hiv t - cell response is still lacking , specific phenotypes have been associated with certain functional attributes . in this sense ,
hiv - specific cd8 t cells in hiv controllers have a unique hla - dr cd38 phenotype and the cells of these patients effectively suppress hiv-1 infection in vitro .
further , development of hla - dr cd38 cd8 t cells during hiv infection was associated with subsequent stable cd4 t - cell levels and good prognosis .
cd8 t cells from normal uninfected humans express little cd38 or hla - dr ; however , during hiv seroconversion there is an increase in the subset of cells expressing both markers , and this activated population probably includes the ctl that develop during acute hiv infection .
the frequency of t cells expressing cd38 in uninfected rhesus macaques is higher than in humans and the frequency of hla - dr t cells is lower in macaques compared to humans .
however , once infected the dynamics of expression on t cell in humans and macaques and the prognostic value of both these markers are similar .
interestingly , degranulating siv - specific cd8 t cells ( cd107 ) have more hla - dr expression than the total cd8 t - cell population in siv infected macaques ( unpublished data ) . these findings are consistent with the hypothesis that hla - dr expression on anti - siv cd8 t cells indicates cells with enhanced cytolytic capacity , as proposed in ec .
similarly , a human vaccine experiment identified cd38 , hla - dr , ki-67 , and bcl-2 low in cd8 t cells as effector t - cell responses after immunization or infection . by monitoring the expression of these markers in the blood , they confirmed the increasing population of effector cd8 t cells , which correlated with tetramer and interferon gamma secreting specific cd8 t cells after immunization with live , attenuated yellow fever-17d vaccine .
hiv is transmitted primarily by sexual contact , and the female genital tract , male genital tract , and rectum are the anatomic sites of virus transmission .
recent studies have conclusively demonstrated that immediately after mucosal transmission most systemic hiv and siv infections are established by a very limited number of viral envelope variants . before virus dissemination occurs , few days after infection , it may be possible to contain and eliminate these initial founder viral populations at the site by vaccine - induced effector t cells .
importantly , localized mucosal memory t - cell populations provide superior control of viral infection compared with circulating memory t cells . yet , since intravaginal or rectal immunization is not a viable option , we have to think of other ways to establish this memory mucosal response . central memory ( cm ) t lymphocytes have limited effector function , but they have the capacity to home and reside in lymphoid organs and , upon secondary exposure to their cognate antigen , they rapidly proliferate to become effector t cells . in contrast , effector memory ( em ) t lymphocytes home to peripheral tissues and , following antigenic stimulation , have limited proliferative capacity but have the ability to degranulate and rapidly produce effector cytokines [ 27 , 58 ] .
it is reasonable to think that em - specific cd8 t cells will be more effective at eliminating virus - infected cells while generating less proinflammatory cytokines , thus attenuating activation and inflammatory events .
in fact , a successful model of live , attenuated vaccine increases the total number of circulating cd8 t cells and , specifically , the em cd8 t - cell phenotype ( unpublished observations ) while it blunts proliferation , activation , and apoptotic cell death . simultaneously , polyfunctional cd8 t cells with high cytotoxic capacity are present in the vagina of these immunized animals on the day of siv challenge and these effector t cells mediate protection in this model . other successful live ,
attenuated vaccines elicit mucosal ctl responses that are more effective at suppressing viral replication than cd8 t cells from blood .
similarly to these models , an immunization strategy using a replication competent cytomegalovirus ( cmv ) vector expressing multiple siv antigens establishes persistent siv - specific em t - cell responses at potential sites of siv replication conferring protection from mucosal challenge in 50% of the immunized animals [ 21 , 59 ] .
the success of these cmv - vector siv vaccines and of live , attenuated vaccines indicates that , so far , only replicating vaccine virus that disseminates throughout the body and produces antigen continuously , albeit at a low level , in the mucosal tissues may be capable of providing protective immunity [ 12 , 13 , 21 ] .
while many of the other systemically administered vaccine strategies may decrease viral replication after immunized animals become infected , none can block infection ( reviewed in ) .
several features of these persistent vaccines that differ from other vaccine strategies could explain the effectiveness of cd8 t - cell responses in these models [ 12 , 13 , 21 ] .
out of these , chronic low - level of antigenic stimulation from residual vaccine replication in tissues , including the mucosa affected , up to the time of challenge and the consequent generation and maintenance of a resident effective antiviral immune response at the portal of virus entry may be the key points to understand protection ( figure 1 ) .
this effective antiviral immune response is characterized by em cd8 t cells , which will help maintain a more homeostatic environment [ 27 , 58 ] .
then , it is not surprising that these replicating vaccines , in contrast to other more conventional vaccine strategies ( figure 1(a ) ) occurred without anamnestic t - cell responses [ 12 , 21 ] .
the concept that a persistent , attenuated viral vaccine that maintains a pool of cd8 effector t cells capable of controlling but not eliminating the pathogen is necessary for protection against persisting pathogens like hiv or siv was first proposed by zinkernagel .
similarly , in models of tuberculosis , promising mucosal vaccine systems that use antigen persistence to generate protective cd8 t cells maintained independently of peripheral supply have been described .
although the cmv vector vaccine increased resistance to rectal siv challenge , virus replication in immunized animals that became infected was not altered .
the immunologic basis for the all or none protection phenomena seen in this study remains to be defined but the results are similar to the all or none protection seen in both recently completed human aids vaccine efficacy trials [ 6365 ] .
in contrast , live , attenuated vaccines induce control of viremia when the infection is productive [ 66 , 67 ] .
this difference could be related to some of the requirements of live , attenuated vaccines to be protective , like the necessity of vigorous viral replication for the generation of an effective anti - siv immune response .
as proposed by zinkernagel , protection by immunity represents an equilibrium between optimal resistance against the various cytopathic infections and avoidance of excessive immunologically mediated tissue damage .
this is particularly crucial in hiv / siv infection , since the initial viral insult initiates an inflammatory cascade and immune activation that , if not resolved soon enough , will contribute to virus dissemination and infection amplification ( reviewed in ) . in the case of the natural host ,
immune activation appears to be detrimental for control of viral replication and disease progression while ec maintain high levels of hiv - specific immune responses with low levels of immune activation . in this sense , a live , attenuated vaccine model has shown that the relative number of siv target cells compared to the number of siv vaccine - induced antiviral t cells in the vagina determines the outcome of vaginal siv challenge in immunized animals , since cd8 t cell - depleted , vaccinated animals had the highest levels of siv replication in the genital tract and genital lymph nodes [ 22 , 67 ] .
in fact , the viral rna levels in these tissues exceeded those found in the gi tract of control animals .
this very high level of viral replication in the vagina and genital lymph nodes is unprecedented and suggests that in the absence of antiviral cd8 t cells , siv replication in the genital tract was enhanced by prior shiv immunization .
since shiv - immunized animals have numerous siv - specific cd4 t cells in the vaginal mucosa on the day of challenge , it seems likely that they provide more cellular targets compared to the nave animals , which leads to enhanced local viral replication .
this result demonstrates that viral replication after challenge results from a balance between siv replication in abundant target cells and efficient killing of those infected target cells by antiviral cd8 t cells .
in this sense , recent studies highlight the importance of the number of effector ctls in relation to the number of target cells ( e : t ratios ) to significantly reduce viral load in the female reproductive tract . of note
, the induction of effector - memory - like cd4 t cells in mucosal tissues might contribute to the protection in live , attenuated siv vaccine models and in hiv controllers .
although the role of cd4 t cells in viral infection is commonly attributed to helper functions generating and supporting memory cd8 t cell - responses , antiviral cytokine production , and lytic functions have been described in herpes simplex virus type 1 , friend leukemia virus , and hiv infection for hiv - specific cd4 t cells .
thus , the same mediators that initiate immune activation leading to antiviral immune responses also activate and recruit cd4 t cells to tissues that serve as the primary target cells for viral infection .
cytokines and chemokines regulate cell migration and activation , and these molecules will also determine antiviral t - cell fate [ 76 , 77 ] . moreover , the inflammatory milieu is a critical factor controlling the differentiation of primary antiviral cd8 t cells into terminally effector cells or long - lived memory t cells .
prolonged inflammation or stimulation by the t - cell transcription factor , t - bet , results in a predominantly short - lived , effector cd8 t - cell population rather than a long - lived memory population with proliferative potential .
thus , the cd8 t - cell response that is observed in the shiv - vaccinated monkeys that are protected from pathogenic sivmac challenge is consistent with an effector t - cell population driven by continuous antigen production rather than a large memory t - cell pool associated with anamnestic proliferation ( figure 1(b ) ) .
yet , the presence of central - memory t cells in the draining lymph node and a balance between these cells and effector cd8 t cells in the mucosa may be required to maintain an effective anti - siv t cell response .
finally , another way to control the number of target cells and avoid excessive immune activation and inflammation could be through the induction of regulatory t cells [ 79 , 80 ] .
however , the role of these regulatory t cells remains controversial , since they could both reduce immune activation and limit development of specific adaptive responses . in this sense
, elevated frequencies of regulatory cells associated to low levels of immune activation may contribute to the ability of some individuals to avoid hiv infection .
further , after siv challenge , a quiescent tissue environment is actively maintained by a t - regulatory cell response that rapidly expands to suppress immune activation preventing the generation of more activated target cells to support siv replication (; manuscript in preparation ) .
active immunoregulatory mechanisms , rather than intrinsically attenuated innate immune responses , efficiently downregulate the robust innate immune responses that also occurs soon after siv infection of the natural host , the african green monkey , in which persistent siv infection is relatively nonpathogenic .
thus , it seems that the persistent , low - level replication of shiv infection modulates the immunological response to pathogenic siv challenge such that the response resembles that of natural host nonhuman primates , where low levels of t - cell activation , proliferation , and apoptosis are also observed after siv infection [ 8284 ] .
from a vaccine development viewpoint , defining the specific subset of cd8 t cells that are responsible for control of viral replication could inform hiv vaccine design and the search for an immune correlate of protection . there is compelling evidence from live , attenuated siv vaccine models and from the recent cmv - vector vaccine experiments that the critical t cell is an effector cd8 t cell that does not undergo anamnestic proliferation as detected in the blood .
yet , the challenge exists on evaluating these responses at mucosal level , where the picture seems to be completely different than the snapshot we can get from peripheral blood . although studying mucosal immunity is technically challenging due to difficulty in obtaining samples of sufficient quality and quantity for analysis , the need to improve the relatively low efficacy of the systemic aids vaccines currently in development demands a focus on eliciting mucosal immune responses through vaccination .
further , a careful design of standardized protocols for collecting and analyzing mucosal specimens in preclinical and clinical trials is critical for assessing immunogenicity in hiv vaccine candidates .
although conventional vaccines attempt to elicit strong anamnestic cd8 t - cell responses after hiv exposure , caution may be needed in that pursuit .
lessons learnt from successful persistent vaccines indicate that protection against mucosal hiv transmission requires induction of resident mucosa effector cd8 t cells but little systemic t - cell proliferation [ 12 , 13 , 21 ] .
a complex immune environment allows memory effector cd8 t cells in the vagina on the day of challenge to effectively kill infected cells by not providing additional substrate for virus replication whilst unique control against rectal challenge is conferred by high - frequency siv - specific t cells induced through persistent cmv vectors [ 12 , 21 ] .
both systems maintain a resident effector response indefinitely that can protect without anamnestic expansion [ 12 , 21 ] .
development of alternative strategies to replicating vaccines to induce mucosa immunity in the reproductive tract using adjuvants is warranted .
other routes of virus transmission like blood transfusions and mother - to - child may require different vaccination strategies .
considering the outcome of recent clinical trials , refined animal models may help to define the type of complex immunological response an hiv / siv vaccine candidate may need to elicit to be effective .
Output:
| a vaccine inducing protective immunity in mucosal tissues and secretions may stop or limit hiv infection .
although cytotoxic t lymphocytes ( ctls ) are clearly associated with control of viral replication in hiv and simian immunodeficiency virus ( siv ) infections , there are examples of uncontrolled viral replication in the face of strong cd8 + t - cell responses .
the number of functions , breadth , avidity , and magnitude of ctl response are likely to be important factors in the effectiveness of anti - hiv t - cell response , but the location and persistence of effector cd8 + t cells are also critical factors . although the only hiv vaccine clinical trial targeting cellular immunity to prevent hiv infection failed , vaccine strategies using persistent agents against pathogenic mucosal challenge in macaque models are showing unique success .
thus , the key to control the initial focus of viral replication at the portal of entry may rely on the continuous generation of effector ctl responses at mucosal level . |
PubmedSumm7844 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: rocuronium is a non - depolarizing neuromuscular blocking agent ( ndnmba ) , employed in the clinic as an adjunct to general anesthesia , to facilitate rapid sequence tracheal intubation and to provide skeletal muscle relaxation during surgery .
resistance to the neuromuscular effects of ndnmbas has been reported following burns , immobilization , denervation , and infectious diseases .
this resistance can be manifested either as a delayed onset of the effect , an incomplete neuromuscular block despite an effective dose , or a rapid recovery from paralysis .
we report an unusual case of complete resistance to rocuronium in a 20-year - old patient undergoing renal biopsy , wherein , a neuromuscular block has been achieved by subsequent administration of cisatracurium . to our knowledge
, this is the first case of complete resistance to a double dose of an aminosteroid nondepolarizing muscle relaxant , but not to benzylisoquinolinium .
a 20-year - old man , with height - 177 cm , weight - 78.4 kg , and body mass index ( bmi ) - 24.9 , was scheduled for renal biopsy as part of a diagnostic protocol for undefined glomerulonephritis , with a nephrotic syndrome .
the patient took oral prednisone therapy ( 30 mg / day ) , which lasted 140 days , and received the last dose ( 5 mg ) two months before the scheduled surgery .
preoperative laboratory testing showed low hemoglobin levels ( 8.6 g / dl ) and a low serum protein concentration ( 4.3 g / dl ) with hypoalbuminemia ( 2.7 g / dl ) . after receiving desensitizing therapy ( betamethasone 4 mg twice a day ) and ciprofloxacin ( 200 mg ) intravenous ( iv ) for one day
, the patient was admitted to the operating room and was premedicated with iv of midazolam ( 1 mg ) , fentanyl ( 0.05 mg ) , and atropine ( 0.7 mg ) .
intraoperative monitoring included an electrocardiogram ( ecg ) , noninvasive blood pressure , pulse oximetry , end - tidal co2 , and neuromuscular blockade monitoring .
the intravenous catheter and arterial blood pressure monitor were placed on the contralateral arm for neuromuscular monitoring .
neuromuscular monitoring was performed by acceleromyography ( m - nmt 's transducer ; mechanosensor ; datex - ohmeda ) .
after three minutes of preoxygenation , anesthesia was induced with propofol ( 200 mg ) and continuous remifentanil ( 0.11 mcg / kg / minute ) . just before the administration of rocuronium ( 0.6 mg / kg ) , the calibration of train - of - four ( tof ) twitch height was performed .
three minutes later any depression of twitch height was observed ( tof - r > 0.9 ) and the patient seemed to be partially awake without clinical signs of muscle relaxation .
additional doses of propofol ( 200 mg ) and rocuronium ( 50 mg ) from different batches were injected over ten minutes , but no depression in the twitch response was noted over the next seven minutes . an oral airway was inserted and the patient was ventilated by mask with sevoflurane ( end - tidal concentration 2% ) in oxygen ( fio20.5 ) .
option to awake the patient was discussed because tof stimulation continued to evoke four equal twitches without fade ( tof - r > 0.9 ) during the subsequent ten minutes .
finally , it was decided to attempt neuromuscular relaxation with a benzylisoquinolinium non - depolarizer compound , and cisatracurium ( 0.2 mg / kg ) was injected .
train - of - four responses disappeared quickly ( 120 seconds ) and completely and orotracheal intubation was easily performed . during general anesthesia ( sevorane and remifentanil )
the operation took approximately half an hour and was uneventful . at a tof - r
> 0.9 the patient 's trachea was safely extubated , without any airway complications , using pharmacological reversal with neostigmine ( 2 mg ) , atropine ( 1 mg ) , and sugammadex ( 2 mg / kg ) .
we report the first case , to our knowledge , of complete resistance to a double dose of aminosteroid nondepolarizing muscle relaxant , but not to benzylisoquinolinium .
all possible causes that could account for such unusual failure of effect of an aminosteroid muscle relaxant , such as , outdated rocuronium and/or improper storage conditions were carefully assessed before being excluded as the likely causes .
we used the same batch of rocuronium for a variety of other procedures with normal therapeutic effects .
we placed the iv catheter and arterial blood pressure monitor on the contralateral arm for neuromuscular monitoring , to minimize any interference between these monitorings .
we checked the correct placement of the stimulating electrodes along the ulnar nerve at the wrist during the procedure .
many cases of resistance to neuromuscular blocking agents ( nmbas ) have been anecdotally reported .
there are specific pathological states , such as , upper motor neuron lesions , severe thermal injuries , liver disease , and disuse atrophy , all of which show an increased resistance to the effects of nondepolarizing muscle relaxants . also concurrent drug therapy can change the efficacy of nmbas . it is known that the possible interaction between nmbas and other common drugs used in anesthesia can lead to a variability of their effect .
the interaction can take place at various levels involving the transmission of an action potential in the motor nerve , the synthesis and release of acetylcholine , and the integrity of post synaptic receptors . focusing on our patient 's clinical and pharmacological history
, we hypothesize that resistance to rocuronium may be on account of the patient 's corticosteroid therapy . as we have just reported , the patient received two doses of betamethasone before the surgery and ended the prednisone long term therapy two months before .
data from the literature report that glucocorticoids are able to interact with neuromuscular transmission in different ways .
additionally , glucocorticoids act :
presynaptically , stimulating synthesis , spontaneous release , as well as stimulated the release of acetylcholinepostsynaptically , with upregulation of the nicotinic acetylcholine receptor ( nachrs ) with a genomic effect , in long - term treatments .
presynaptically , stimulating synthesis , spontaneous release , as well as stimulated the release of acetylcholine postsynaptically , with upregulation of the nicotinic acetylcholine receptor ( nachrs ) with a genomic effect , in long - term treatments .
resistance to aminosteroid nmbas given in association with steroid therapy has been reported in several cases . in all of these cases ,
the occurrence of resistance has been reported in terms of delayed onset time , incomplete neuromuscular block despite an effective dose or a rapid recovery from paralysis , however , no one has described the complete absence of curarization after administration , within the clinical range of therapy .
have reported that the administration of dexamethasone immediately before induction of anesthesia does not attenuate the rocuronium effect , but even if administrated at a lower dose ( 0.3 mg / kg ) , two or three hours before induction , it can reduce the duration of the neuromuscular block .
a presynaptic cholinergic receptor binding interaction between steroids and neuromuscular blocking agents that have steroid derived molecular structures is one possible factor that may have brought about complete resistance . on the other hand
, it has been suggested that rocuronium , as any other aminosteroid nmba , acts predominantly at presynaptic receptor sites , whereas , cisatracurium , similar to other benzylisoquinoliniums , primarily a postjunctional receptor blockade , has a synergic effect when used in combination .
moreover , the patient 's chronic glucocorticoid therapy , according to maestrone and colleagues , induces an upregulation of native muscle nachr in cultured human muscle , with a genomic effect .
as reported elsewhere , upregulation of nachrs in the skeletal muscle is associated with the development of resistance to nmba .
the same phenomenon occurs further to glucocorticoid exposure , both in vivo and in patients . to the best of our knowledge
, we can only suppose that this upregulation was still present in our patient , although the therapy ended two months before the observed resistance , and it also occurred in patients with burns . even in those patients there is an upregulation of nachrs and it has been reported that recovery of neuromuscular function to preburn levels may take several months or even years after the burn injury .
therefore , our case of complete resistance to the rocuronium effect could be on account of a double sided interference : presynaptic and postsynaptic .
rocuronium action was reduced at the presynaptic junction ( by betamethasone administered before the surgery ) , and despite its dose being doubled , it was not enough to determinate a significant effect on the postsynaptic increased receptors , with complete absence of clinical effects revealed , with any sort of twitch depression on acceleromyography .
it has been found that in normal subjects 75% receptor occupancy by the antagonist is necessary before any effect can be seen , and at least 95% receptor occupancy is necessary for complete suppression of the twitch .
we can not exclude that the normal effect observed after cisatracurium administration was because of the synergic effect between rocuronium and cisatracurium . it would be interesting to know what would have happened if we had used the benzylisoquinolinium compound as a first choice .
it has also been reported in a retrospective clinical review performed by parr and colleagues , that patients receiving long term pretreatment with betamethasone required , on an average , 75% more vecuronium ; conversely , in our case it was doubled ( 100% more ) .
an additional factor that may contribute to the resistance is decreased acetylcholinesterase activity ( ache ) . here , breakdown of acetylcholine ( ach ) would be diminished increasing the levels of ach at the neuromuscular joint .
examined the effects of dexamethasone on the ache activity and they found no significant influences .
moreover , liu and dilger reported that mutations in both the - and -subunits of nachr affected the inhibitory potency of rocuronium in the in vitro experiment , and we can not exclude a similar condition in our case . at the end of the procedure conventional reversal agents were used .
as two kinds of nmbas were administered in sequence , and one of these in a double dose , the postoperative residual curarization risk can not be predicted .
to the best of our knowledge , this is the first case of complete resistance to a doubled dose of an aminosteroid nondepolarizing muscle relaxant , but not to benzylisoquinoliniumin , in a patient who received corticosteroid therapy before surgery .
therefore , the case described is an example of drug therapeutic failure ( dtf ) by pharmacodynamic interaction .
the dtf is , to date , included within the wider definition of an adverse drug event given by the world health organization ( who ) and it is proposed as a peculiar type of adverse drug reaction designated as
failure. for this reason pharmacovigilance post - marketing studies are key elements to monitor the safety and effectiveness of approved drugs . therefore , pharmacovigilance post - marketing could also be a valid instrument to identify the reactions by interaction , such as those described , and to promote appropriate studies that may help to understand the underlying mechanisms .
Output:
| rocuronium is a non - depolarizing neuromuscular blocking agent ( ndnmba ) , employed in the clinic as an adjunct to general anesthesia to facilitate tracheal intubation rapid sequence , and to provide skeletal muscle relaxation during surgery .
many cases of resistance to neuromuscular blocking agents ( nmbas ) have been anecdotally reported .
there are specific pathologic states , such as upper motor neuron lesions , severe thermal injuries , liver disease , renal failure , disuse atrophy , all of which show an increased resistance to the effects of nondepolarizing muscle relaxants . also concurrent drug therapy can alter the efficacy of nmbas such as some classes of antibiotics , furosemide , receptor agonists , phosphodiesterase inhibitors , calcium antagonists , respiratory stimulants but also ketamine , propofol and barbiturates at high concentrations . in this scenario
we describe an unusual case of 20-years - old man who showed a complete resistance to rocuronium maybe due to a glucocorticoids concomitant therapy . |
PubmedSumm7845 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: vaporization enthalpies are used frequently in adjusting enthalpies of formation of liquids to the standard state and in evaluating environmental transport properties .
accurate thermodynamic correlations are required to enhance the reliability of such simulations . of the thermodynamic properties ,
heat of vaporization is one of the most important parameters for a multi - component multistage vapor
liquid equilibrium process as it is the one which controls the temperature as well as liquid and vapor profiles in a column .
moreover , this property is sometimes used in the prediction or correlation of other thermodynamic properties .
there is thus engineering and theoretical interest in the measurement and correlation of values of this property [ 212 ] .
the normal boiling enthalpy can be calculated using either equations of state applied to the liquid and vapor phases or more simply by means of empirical correlations that allow calculating the enthalpy of vaporization of pure fluids [ 622 ] .
some of them are general analytical expressions that only require as input parameters certain properties of the fluid , such as the critical temperature , critical pressure , normal boiling point temperature , and molecular weight . in this study ,
an accurate empirical correlation was presented by incorporating the normal boiling temperature and critical points of the pure substances .
this equation can predict the heat of vaporizations for pure substances over the entire range of normal boiling point temperatures of practical interest .
in this research , we considered some of well known analytical models that do not require specific adjustable coefficients for each substance , but rather are based on a knowledge of some properties of the liquid vapor equilibrium ( critical properties mainly ) or on molecular properties
. in particular , we selected seven specific expressions that are valid only for the calculation of the vaporization enthalpy .
( zny ) , the simplest method defined as trouton rule , two models presented by vetere and a more recent proposal of liu .
riedel model
( 1)hb=1.093rtblnpc-1.0130.93-tb / tcwhere hvb is vaporization enthalpy ( j mol ) , r is universal gas constant ( 8.3145 j mol k ) , tb is normal boiling point ( k ) , tc is critical temperature ( k ) , and pc is critical pressure ( bar ) .
chen model
( 2)hb = rtb3.978(tb / tc)-3.958 + 1.555lnpc1.07-tb / tc trouton rule
( 3)hb=88tbjmol-1 zhao et al . model ( zny )
( 4)hb = tb(36.6 + 8.314lntb ) vetere model ( v-79 )
( 5)hb = rtb(1-tb / tc)0.38[ln(pc-0.513 + 0.5066tc2/(pctb2)]1-tb / tc+[1-(1-tb / tc)0.38]ln(tb / tc ) vetere model ( v-95 )
for hydrocarbons:(6)hb=4.1868tb9.08 + 4.36log10tb+0.0068tbm+0.0009tb2 m for alcohols:(7)hb=4.1868tb18.82 + 3.34log10tb-6.37tbm+0.036tb2m-5.210 - 5tb3mwhere m is molecular weight ( kg / kmol ) .
liu
( 8)hb = rtbtb2200.0627(1-tb / tc)0.38ln(pc / pa)1-tb / tc+0.38(tb / tc)ln(tb / tc ) where pa is atmospheric pressure in bar . in this study , we tried to find a more accurate and rapid model to calculate vaporization enthalpies of pure substances based on experimental data [ 14,2426 ] .
thermophysical properties of compounds are obtained from the literatures . by investigation of more than 452 data points vaporization enthalpy of pure substances and using 352 points of them in multiple regression analysis , a new empirical correlation is suggested to accurately prediction of vaporization enthalpy with the wide ranges of normal boiling temperatures ( 20.3722 k ) .
the new presented model has three dependent variables ( pc , tc , and tb ) and 10 independent variables as follows:(9)hb = rtb(a+btbr+ctbr2+dtbr3)(10)b = b1+b2pc+b3ln(pc)(11)c = c1+c2pc+c3ln(pc)(12)d = d1+d2pc+d3ln(pc)in this equation , hvb is vaporization enthalpy ( kj mol ) , r is universal gas constant and equals to 8.3145 j mol k , tb ( k ) is normal boiling temperature , tc ( k ) is critical temperature , tbr is reduced temperature defined as tb / tc , and pc ( bar ) is critical pressure . also , tuned coefficients that have been determined by minimizing the sum of square errors of the model are presented in table 1
in this study , we tried to find a more accurate and rapid model to calculate vaporization enthalpies of pure substances based on experimental data [ 14,2426 ] .
thermophysical properties of compounds are obtained from the literatures . by investigation of more than 452 data points vaporization enthalpy of pure substances and using 352 points of them in multiple regression analysis , a new empirical correlation is suggested to accurately prediction of vaporization enthalpy with the wide ranges of normal boiling temperatures ( 20.3722 k ) .
the new presented model has three dependent variables ( pc , tc , and tb ) and 10 independent variables as follows:(9)hb = rtb(a+btbr+ctbr2+dtbr3)(10)b = b1+b2pc+b3ln(pc)(11)c = c1+c2pc+c3ln(pc)(12)d = d1+d2pc+d3ln(pc)in this equation , hvb is vaporization enthalpy ( kj mol ) , r is universal gas constant and equals to 8.3145 j mol k , tb ( k ) is normal boiling temperature , tc ( k ) is critical temperature , tbr is reduced temperature defined as tb / tc , and pc ( bar ) is critical pressure . also , tuned coefficients that have been determined by minimizing the sum of square errors of the model are presented in table 1
we carried out regression analysis for 352 pure substances and also for 100 other substances which are not participate in fitting procedure .
the values of the critical pressure , critical temperature , normal boiling temperature , and molecular weight ( for comparison with other models ) were taken from the literatures [ 14,2426 ] . to compare the accuracy of presented empirical model , calculated enthalpies of vaporizations for 352 pure substances versus experimental measured enthalpies
1 . in table 2 , the aard% of enthalpies calculated from proposed and other models for each substance include one or more isomers with respect to the values given by experimental measurements were presented .
it showed that presented model was more accurate than other empirical correlations for all types of compounds considered in this study .
data points with aard of more than 40% were not participated in statistical parameters calculations .
table 3 presents the statistical parameters including average absolute relative deviation percentage ( aard% ) , average relative deviation , ( ard% ) , and root mean square deviation ( rmsd ) of the considered models and new proposed correlation .
2 also shows the accuracy of different empirical methods in prediction of vaporization enthalpies of 352 pure substances . as shown in fig .
2 , the new proposed model is more accurate than the seven commonly used correlations .
the new method has successfully predicted 75% of the all measurements with aard less than 3% and 84% of the data with aard less than 4% .
only 2% of the enthalpy measurements were predicted with aard of more than 10% by the new method .
liu model , that is the second accurate empirical method , predicted 65% of the enthalpies measurements with aard less than 3% and 75% of the measurements with aard less than 4% . for real comparison and
estimate the applicability of presented method to calculate vaporization enthalpy of pure substances , some independent data for more than 100 pure substances which are not employed in regression analysis of new proposed correlation were studied [ 2426 ] .
finally , aard of the new method and other mentioned models for these substances are presented in table 4 .
table 5 presents the statistical parameters including average absolute percentage relative deviation percentage ( aard% ) , average relative deviation , ( ard% ) , and root mean square deviation ( rmsd ) of the considered models and new proposed correlation for 100 new data points .
3 shows calculated enthalpies of vaporizations versus experimental measured enthalpies and fig . 4 indicates cumulative frequency of different empirical correlations versus average absolute relative deviations for new 100 substances . as shown in fig .
4 , the new presented model estimated 85% of all 100 measurements with aard less than 4 , while riedel model , that is the second accurate empirical method in this comparison , predicts 77% of 100 measurements with aard less than 4% . hence , the superiority of this new empirical method over the other empirical methods has been verified for all experimental data .
but our presented correlation was fitted with more experimental data for more constant parameters than other models which can helps to generalize the equation to calculate fitting data and other independent data which are not employed in regression analysis with lower deviations .
the new correlation has a potential validation for calculation of vaporization enthalpy for acetates , alcohols , aldehyds , alkans , alkenes , alkyl and multi - alkyl benzene , alkynes , amines , anhydrides , anilines , carboxylic acids , cetones , cyclo alkanes , dimethyl alkanes , esters , halo alkanes , halo alkenes , halo benzene , methyl alkans , naphthalenes , nitriles , nitro alkanes , pyridynes , sulfid and sulfoxids , xylene , and some other hydrocarbons .
in this study , the new empirical method was presented to estimate the vaporization enthalpy of pure substances at their normal boiling temperature . to estimate accuracy of this correlation
, the comparisons were done for presented model and seven commonly used empirical methods include vetere ( v-95 ) , vetere ( v-79 ) , riedel , chen , zhao et al .
results indicate the superiority of the new presented correlation over all other methods used to calculate vaporization enthalpies with average absolute relative deviation percent ( aard% ) of 2.28 . also to estimate the applicability of the new method ,
some data for more than 100 pure substances which are not participate in regression analysis are examined , and the results showed again the superiority of presented correlation with lower deviation .
Output:
| the heat of vaporization of a pure substance at its normal boiling temperature is a very important property in many chemical processes . in this work
, a new empirical method was developed to predict vaporization enthalpy of pure substances .
this equation is a function of normal boiling temperature , critical temperature , and critical pressure .
the presented model is simple to use and provides an improvement over the existing equations for 452 pure substances in wide boiling range .
the results showed that the proposed correlation is more accurate than the literature methods for pure substances in a wide boiling range ( 20.3722 k ) . |
PubmedSumm7846 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: trained research assistants obtained consent and enrolled participants as part of an ongoing prospective study measuring quality of care for hospitalized general medicine patients at the university of chicago medicine and mercy hospital and medical center ( meltzer et al . ,
the university of chicago medicine and mercy hospital and medical center institutional review boards approved the protocol .
research assistants administered the bvsq , which consisted of the questions , how confident are you filling out medical forms by yourself ? , how often do you have someone help you read hospital materials ? , and how often do you have problems learning about your medical condition because of difficulty understanding written information ? , scored on a likert scale from 0 to 4 .
participants had low health literacy if they had a score of 2 or less on at least one question ( chew et al . , 2004 ; chew et al . , 2008 ) .
the realm - revised ( realm - r ) was administered to participants with at least 20/50 acuity in at least one eye ( snellen eye chart ) .
the realm - r ( bass et al . , 2003 ) is a list of eight medical terms and was used as the comparator to the bvsq due to its brevity and feasibility for implementation .
descriptive statistics were calculated to summarize data using means , standard deviations , and proportions .
mcnemar 's test was utilized for matched pair testing to compare the health literacy tools . a two - tailed p value of less than .05 defined statistical significance .
areas under the receiver operating characteristic curve ( auroc ) allowed comparison between the bvsq items , in individual and composite form , and the realm - r tool .
the auroc , sensitivity , and specificity were therefore calculated for each individual question and as a composite to review tradeoffs with respect to improving sensitivity versus specificity ( chew et al .
, 2008 ; morris , maclean , chew , & littenberg , 2006 ; wallace et al . , 2006 ) .
research assistants administered the bvsq , which consisted of the questions , how confident are you filling out medical forms by yourself ? , how often do you have someone help you read hospital materials ? , and how often do you have problems learning about your medical condition because of difficulty understanding written information ? ,
participants had low health literacy if they had a score of 2 or less on at least one question ( chew et al . , 2004 ; chew et al . , 2008 ) .
the realm - revised ( realm - r ) was administered to participants with at least 20/50 acuity in at least one eye ( snellen eye chart ) .
the realm - r ( bass et al . , 2003 ) is a list of eight medical terms and was used as the comparator to the bvsq due to its brevity and feasibility for implementation .
descriptive statistics were calculated to summarize data using means , standard deviations , and proportions .
mcnemar 's test was utilized for matched pair testing to compare the health literacy tools . a two - tailed p value of less than .05 defined statistical significance .
areas under the receiver operating characteristic curve ( auroc ) allowed comparison between the bvsq items , in individual and composite form , and the realm - r tool .
the auroc , sensitivity , and specificity were therefore calculated for each individual question and as a composite to review tradeoffs with respect to improving sensitivity versus specificity ( chew et al .
, 2008 ; morris , maclean , chew , & littenberg , 2006 ; wallace et al . ,
from june 20 , 2011 , through august 20 , 2012 , 2,776 patients were screened ; 1,061 were discharged before approach , 19 did not complete the bvsq , 63 did not provide consent for participating in the vision screen and/or realm - r , 35 were repeat participants , 4 required a proxy , and 701 did not complete vision testing .
more than three fourths of participants ( 680/893 ) had sufficient vision , and 12 participants did not complete the realm - r for other reasons , including refusing to complete the realm - r or being discharged or otherwise unavailable ( e.g. , taken away for a test ) ; 668 participants completed both the bvsq and the realm - r .
of the 893 participants , 79% were african american , 57% were female , and 29% were age 65 years or older . of those reporting , 20% ( 173/874 ) had less than a high school education , 33% ( 221/678 ) did not have insurance or had medicaid , and 51% ( 163/319 ) had an annual household income less than $ 25,000 .
when comparing participants with poor vision ( completed bvsq only , n = 213 ) to those with sufficient vision ( completed both bvsq and realm - r , n = 668 ) , significant differences emerged between the groups with respect to race ( 91% vs. 81% non - white race , p = .001 ) , income ( 68% vs. 46% low income , p = .003 ) , educational level ( 30% vs. 16% without high school diploma , p < .001 ) , and age ( 40% vs. 26% age 65 years or older , p <
.001 ) , but not with gender ( 59% vs. 56% female , p = .44 ) or insurance type ( 26% vs. 34% without insurance or on medicaid , p = .11 ; see table 1 ) .
bsvq = brief verbal screening questions ; realm - r = rapid estimate of adult learning in medicine revised .
data were missing for 1 participant in the sufficient vision group ( completed both bvsq and realm - r ) ; 375 of 667 participants in the sufficient vision group were female ( 56% ) , 292 of 667 participants were male ( 44% ) .
data were missing for one participant in the insufficient vision group ( completed bvsq only ) ; 125 of 212 participants in the insufficient vision group ( completed bvsq only ) were female ( 59% ) , 87 of 212 participants were male ( 41% ) .
data were missing for nine participants in the sufficient vision group ( completed both bvsq and realm - r ) .
race was dichotomized into white and non - white ; 124 of 659 participants in the sufficient vision group ( 19% ) were white , and all other responses were defined as non - white .
african americans made up the majority of the non - white category with 506 of 659 participants ( 77% ) , 6 of 659 participants ( 0.9% ) were american indian / alaskan native , 2 of 659 participants ( 0.3% ) were asian / pacific islander , and 21 of 659 participants ( 3% ) chose the other category .
data were missing for one participant in the insufficient vision group ( completed bvsq only ) .
race was dichotomized into white and non - white ; 20 of 212 participants in the insufficient vision group ( 9% ) were white , and all other responses were defined as non - white .
african americans made up the majority of the non - white category with 186 of 212 participants ( 88% ) , 3 of 212 participants ( 1% ) were american indian / alaskan native , 0 of 212 participants ( 0% ) were asian / pacific islander , and 3 of 212 participants ( 1% ) chose the other category .
data were missing for 16 participants in the sufficient vision group ( completed both bvsq and realm - r ) ; education categories for this group include junior high school or less ( 17/652 , 3% ) , some high school ( 90/652 , 14% ) , high school graduate ( 188/652 , 29% ) , some college / junior college ( 219/652 , 34% ) , college graduate ( 87/652 , 13% ) , and postgraduate ( 51/652 , 8% ) .
data were missing for four participants in the insufficient vision group ( completed bvsq only ) ; education categories for this group include junior high school or less ( 16/209 , 8% ) , some high school ( 46/209 , 22% ) , high school graduate ( 64/209 , 31% ) , some college / junior college ( 54/209 , 26% ) , college graduate ( 16/209 , 8% ) , and postgraduate ( 13/209 , 6% ) .
data were missing for 102 participants in the sufficient vision group ( completed both bvsq and realm - r ) ; insurance categories for this group include medicare ( 230/566 , 41% ) , medicaid ( 169/566 , 30% ) , private ( 145/566 , 26% ) , no payer ( 21/566 , 4% ) , and grants ( 1/566 , 0.2% ) .
data were missing for 112 participants in the insufficient vision group ( completed bvsq only ) ; insurance categories for this group include medicare ( 63/101 , 62% ) , medicaid ( 20/101 , 20% ) , no payer ( 6/101 , 6% ) , and private ( 12/101 , 12% ) .
data were missing for 411 participants in the sufficient vision group ( completed both bvsq and realm - r ) ; income categories for this group include $ 2,500 or less ( 26/257 , 10% ) , $ 2,501 to $ 5,000 ( 10/257 , 4% ) , $ 5,001 to $ 10,000 ( 26/257 , 10% ) , $ 10,001 to $ 15,000 ( 31/257 , 12% ) , $ 15,001 to $ 25,000 ( 26/257 , 10% ) , $ 25,001 to $ 35,000 ( 33/257 , 13% ) , $ 35,001 to $ 50,000 ( 29/257 , 11% ) , $ 50,001 to $ 100,000 ( 52/257 , 19% ) , $ 100,001 to $ 200,000 ( 18/257 , 4% ) , and over $ 200,000 ( 6/257 , 2% ) .
data were missing for 156 participants in the insufficient vision group ( completed bvsq only ) ; income categories for this group include $ 2,500 or less ( 6/57 , 11% ) , $ 2,501 to $ 5,000 ( 4/57 , 7% ) , $ 5,001 to $ 10,000 ( 7/57 , 12% ) , $ 10,001 to $ 15,000 ( 8/57 , 14% ) , $ 15,001 to $ 25,000 ( 14/57 , 25% ) , $ 25,001 to $ 35,000 ( 7/57 , 12% ) , $ 35,001 to $ 50,000 ( 4/57 , 7% ) , $ 50,001 to $ 100,000 ( 3/57 , 5% ) , $ 100,001 to $ 200,000 ( 3/57 , 5% ) , and over $ 200,000 ( 1/57 , 2% ) . among participants completing the bvsq , 43% ( 384/893 )
of participants completing the realm - r , 47% ( 311/668 ) had low health literacy . among participants who completed both tools ,
the prevalence of low health literacy was greater with the realm - r ( 311/668 , 47% ) than with the bvsq ( 251/668 , 38% ; p = .0001 ) .
the sensitivity of each bvsq item ( 24%34% ) was less than the sensitivity of the combination of all three items ( 51% ) .
the auroc for the combination of the three items was 0.65 ( see table 2 ) .
performance of health literacy screening questions for detecting inadequate health literacy ( n = 668 ) note .
questions adapted from the brief questions to identify patients with inadequate health literacy , by chew , bradley , and boyko ( 2004 ) . confident with forms = how confident are you filling out medical forms by yourself ? help read = how often do you have someone help you read hospital materials ? problems learning = how often do you have problems learning about your medical condition because of difficulty understanding written information ? nearly one fourth of participants had insufficient vision ( 213/893 ) .
approximately one third of the cases of inadequate vision were due to each of the following : participants not having corrective lenses ( 35% ) , participants having inadequate corrective lenses ( 33% ) , or participants not having their lenses with them in the hospital ( 32% ) .
among participants with low health literacy on the bvsq ( n = 213 ) , those with insufficient vision were at greater risk of low health literacy ( 126/213 , 59% ) than those with sufficient vision ( 258/680 , 38% ; p < .001 ) .
of the 893 participants , 79% were african american , 57% were female , and 29% were age 65 years or older . of those reporting , 20% ( 173/874 ) had less than a high school education , 33% ( 221/678 ) did not have insurance or had medicaid , and 51% ( 163/319 ) had an annual household income less than $ 25,000 .
when comparing participants with poor vision ( completed bvsq only , n = 213 ) to those with sufficient vision ( completed both bvsq and realm - r , n = 668 ) , significant differences emerged between the groups with respect to race ( 91% vs. 81% non - white race , p = .001 ) , income ( 68% vs. 46% low income , p = .003 ) , educational level ( 30% vs. 16% without high school diploma , p < .001 ) , and age ( 40% vs. 26% age 65 years or older , p < .001 ) , but not with gender ( 59% vs. 56% female , p = .44 ) or insurance type
( 26% vs. 34% without insurance or on medicaid , p = .11 ; see table 1 ) . characteristics of study population note .
bsvq = brief verbal screening questions ; realm - r = rapid estimate of adult learning in medicine revised .
data were missing for 1 participant in the sufficient vision group ( completed both bvsq and realm - r ) ; 375 of 667 participants in the sufficient vision group were female ( 56% ) , 292 of 667 participants were male ( 44% ) .
data were missing for one participant in the insufficient vision group ( completed bvsq only ) ; 125 of 212 participants in the insufficient vision group ( completed bvsq only ) were female ( 59% ) , 87 of 212 participants were male ( 41% ) .
data were missing for nine participants in the sufficient vision group ( completed both bvsq and realm - r ) .
race was dichotomized into white and non - white ; 124 of 659 participants in the sufficient vision group ( 19% ) were white , and all other responses were defined as non - white .
african americans made up the majority of the non - white category with 506 of 659 participants ( 77% ) , 6 of 659 participants ( 0.9% ) were american indian / alaskan native , 2 of 659 participants ( 0.3% ) were asian / pacific islander , and 21 of 659 participants ( 3% ) chose the other category .
data were missing for one participant in the insufficient vision group ( completed bvsq only ) .
race was dichotomized into white and non - white ; 20 of 212 participants in the insufficient vision group ( 9% ) were white , and all other responses were defined as non - white .
african americans made up the majority of the non - white category with 186 of 212 participants ( 88% ) , 3 of 212 participants ( 1% ) were american indian / alaskan native , 0 of 212 participants ( 0% ) were asian / pacific islander , and 3 of 212 participants ( 1% ) chose the other category .
data were missing for 16 participants in the sufficient vision group ( completed both bvsq and realm - r ) ; education categories for this group include junior high school or less ( 17/652 , 3% ) , some high school ( 90/652 , 14% ) , high school graduate ( 188/652 , 29% ) , some college / junior college ( 219/652 , 34% ) , college graduate ( 87/652 , 13% ) , and postgraduate ( 51/652 , 8% ) .
data were missing for four participants in the insufficient vision group ( completed bvsq only ) ; education categories for this group include junior high school or less ( 16/209 , 8% ) , some high school ( 46/209 , 22% ) , high school graduate ( 64/209 , 31% ) , some college / junior college ( 54/209 , 26% ) , college graduate ( 16/209 , 8% ) , and postgraduate ( 13/209 , 6% ) .
data were missing for 102 participants in the sufficient vision group ( completed both bvsq and realm - r ) ; insurance categories for this group include medicare ( 230/566 , 41% ) , medicaid ( 169/566 , 30% ) , private ( 145/566 , 26% ) , no payer ( 21/566 , 4% ) , and grants ( 1/566 , 0.2% ) .
data were missing for 112 participants in the insufficient vision group ( completed bvsq only ) ; insurance categories for this group include medicare ( 63/101 , 62% ) , medicaid ( 20/101 , 20% ) , no payer ( 6/101 , 6% ) , and private ( 12/101 , 12% ) .
data were missing for 411 participants in the sufficient vision group ( completed both bvsq and realm - r ) ; income categories for this group include $ 2,500 or less ( 26/257 , 10% ) , $ 2,501 to $ 5,000 ( 10/257 , 4% ) , $ 5,001 to $ 10,000 ( 26/257 , 10% ) , $ 10,001 to $ 15,000 ( 31/257 , 12% ) , $ 15,001 to $ 25,000 ( 26/257 , 10% ) , $ 25,001 to $ 35,000 ( 33/257 , 13% ) , $ 35,001 to $ 50,000 ( 29/257 , 11% ) , $ 50,001 to $ 100,000 ( 52/257 , 19% ) , $ 100,001 to $ 200,000 ( 18/257 , 4% ) , and over $ 200,000 ( 6/257 , 2% ) .
data were missing for 156 participants in the insufficient vision group ( completed bvsq only ) ; income categories for this group include $ 2,500 or less ( 6/57 , 11% ) , $ 2,501 to $ 5,000 ( 4/57 , 7% ) , $ 5,001 to $ 10,000 ( 7/57 , 12% ) , $ 10,001 to $ 15,000 ( 8/57 , 14% ) , $ 15,001 to $ 25,000 ( 14/57 , 25% ) , $ 25,001 to $ 35,000 ( 7/57 , 12% ) , $ 35,001 to $ 50,000 ( 4/57 , 7% ) , $ 50,001 to $ 100,000 ( 3/57 , 5% ) , $ 100,001 to $ 200,000 ( 3/57 , 5% ) , and over $ 200,000 ( 1/57 , 2% ) .
. of participants completing the realm - r , 47% ( 311/668 ) had low health literacy . among participants who completed both tools , the prevalence of low health literacy was greater with the realm - r ( 311/668 , 47% ) than with the bvsq ( 251/668 , 38% ; p = .0001 ) .
the sensitivity of each bvsq item ( 24%34% ) was less than the sensitivity of the combination of all three items ( 51% ) .
the auroc for the combination of the three items was 0.65 ( see table 2 ) .
performance of health literacy screening questions for detecting inadequate health literacy ( n = 668 ) note .
questions adapted from the brief questions to identify patients with inadequate health literacy , by chew , bradley , and boyko ( 2004 ) .
confident with forms = how confident are you filling out medical forms by yourself ?
help read = how often do you have someone help you read hospital materials ? problems learning = how often do you have problems learning about your medical condition because of difficulty understanding written information ?
approximately one third of the cases of inadequate vision were due to each of the following : participants not having corrective lenses ( 35% ) , participants having inadequate corrective lenses ( 33% ) , or participants not having their lenses with them in the hospital ( 32% ) . among participants with low health literacy on the bvsq ( n = 213 ) , those with insufficient vision were at greater risk of low health literacy ( 126/213 , 59% ) than those with sufficient vision ( 258/680 , 38% ; p < .001 ) .
we found that within the same population , the realm - r identified a greater proportion of patients with low health literacy than the bvsq .
further , a nontrivial proportion of participants failed a vision screen , which may explain some of the divergent results .
our study demonstrates less concordance , compared to previous studies , between the bvsq and frequently used tools to measure health literacy .
responses to the bvsq self - report items may differ because our inpatient population differs substantially from prior study populations of generally healthier ambulatory patients ( chew et al .
health literacy can also be context specific , varying by the setting or the problem being treated ( baker , parker , williams , & clark , 1998 ; koh et al .
, 2013 ; morris , grant , repp , maclean , & littenberg , 2011 ; six - means et al . , 2012 ) .
for example , inpatients may be facing new challenges based on their current sick state , which may influence how much help they need navigating the health care system compared to their usual well state . although the bvsq may have less utility among inpatients , the tool does not rely on patients ' vision level .
our findings highlight that participants may have a dual risk of low health literacy and poor vision ; those with vision limitations were more likely to have low health literacy .
participants with poor vision were more likely to be african american , older , and have lower income .
our findings have implications for interventions and practice by addressing barriers related to poor vision . because one third of the study population did not have their corrective lenses available , hospital - based interventions to increase access to corrective lenses
similarly , inpatient vision screening may identify access barriers that could prompt vision care referrals following discharge .
one limitation of this study is the generalizability of the findings because the majority of this inpatient population was african american .
although it is important to begin to obtain data on the utility of the bvsq tool for this largely understudied population ( shea et al . , 2004 ) , future multicenter studies can build on this work to further evaluate the utility of the bvsq among diverse hospitalized patients .
the bvsq should be tested against other research tools such as the short - tofhla or the full realm for robust validation ( chew et al . , 2004 ; chew et al . , 2008 ;
haun et al . , 2012 ; powers , trinh , & bosworth , 2010 ) .
lastly , vision may play a role in delirium , falls , or other inpatient hazards ( inouye , 1998 ) .
future research should explicitly evaluate the extent to which poor vision is a proxy for low health literacy versus a unique risk factor that may have implications for self - care .
the implications of poor vision on assessing health literacy and self - care also warrant further study .
Output:
| patient - centered care includes involving patients and their families in self - management of chronic diseases . identifying and addressing barriers to self - management , including those related to health literacy and vision limitations , may enhance one 's ability to self - manage .
a set of brief verbal screening questions ( bv sq ) that does not rely on sufficient vision to assess health literacy was developed by chew and colleagues in the outpatient setting .
the authors aimed to evaluate the usefulness of this tool for hospitalized patients and to determine the prevalence of poor vision among inpatients . in a prospective study , the bvsq and the rapid estimate of adult learning in medicine - revised ( realm - r ; among participants with sufficient vision , 20/50 snellen ) were administered to general medicine inpatients . of 893 participants ,
79% were african american , and 57% were female ; the mean age was 53 years . among 668 participants who completed both tools , the proportion with low health literacy was 38% with the bvsq versus 47% with the realm - r
( p = .0001 ) .
almost one fourth of participants had insufficient vision ; participants with insufficient vision were more likely to be identified as having low health literacy by the bvsq , compared with those with sufficient vision ( 59% vs. 38% , p < .001 ) . |
PubmedSumm7847 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: nonsteroidal anti - inflammatory drugs ( nsaids ) like ibuprofen are effective for the relief of pain , and their use is widespread [ 13 ] .
ibuprofen , which contains equal quantities of ( + ) ibuprofen and ( ) ibuprofen , has been used as an anti - inflammatory and analgesic agent for over 30 years .
( + ) ibuprofen , or dexibuprofen , is the pharmacologically effective enantiomer of + ibuprofen [ 13 ] .
the present uv and hplc methods are relatively simple , rapid , and highly sensitive in the determination of dexibuprofen .
the aim of the present work was to develop and validate a simple , fast , and reliable isocratic rp - hplc and uv method for the determination of di in pharmaceutical dosage forms .
the important features and novelty of the proposed method included simple sample treatment with sonication of small amount of powder sample at ambient temperature , centrifugation , and dilution ; short elution time with internal standard eluted prior to di ; good precision ( r.s.d .
confirmation of the applicability of the developed method was validated according to the international conference on harmonisation ( ich ) , to determination of di in pharmaceutical dosage forms .
dexibuprofen standard and ibuprofen ( internal standard ) were provided by noven life sciences private limited , hyderabad , india .
hplc chromatographic separation was performed on a shimadzu liquid chromatographic system equipped with a lc-10at - vp solvent delivery system ( pump ) , spd m-10avp photo diode array detector , and rheodyne 7725i injector with 50 l loop volume .
class - vp 6.01 data station was applied for data collecting and processing ( shimadzu , japan ) .
the hplc was carried out at a flow rate of 1.0 ml min using a mobile that is phase constituted of acetonitrile50 mm potassium dihydrogen orthophosphate ( ph 7.5 adjusted with orthophosphoric acid ( 45 : 55 , v / v ) ) , and detection was made at 222.0 nm .
the mobile phase was prepared daily , filtered through a 0.45 m membrane filter ( millipore ) and sonicated before use . a princeton spher c18 column ( 25 cm 4.6 mm i.d .
uv method was performed on a uv - visible spectrophotometer , uv-160 ( shimadzu ) with the at 222.0 nm and using 1.0 cm quartz cell . for the calibration curve , accurately weighed 100.0 mg of di was transferred to a 100 ml volumetric flask and dissolved in a mixture of water and methanol of the ratio 1 : 1 v / v . from this solution ,
other solutions with concentrations of 10.0 , 20.0 , 30.0 , 40.0 , 50.0 , and 60.0 g ml were obtained by diluting adequate amounts in triplicate . for the calibration curve , accurately weighed 100.0 mg of di was transferred to a 100 ml volumetric flask and dissolved in a mixture of water and methanol of the ratio 1 : 1 v / v . from this solution , other solutions with concentrations of 2.0 , 4.0 , 6.0 , 8.0 , 10.0 , and 12.0
twenty tablets , each containing 200.0 , 300.0 , and 400.0 mg of di were weighed and finely powdered ; a quantity of powder equivalent to 20.0 , 30.0 and 40.0 mg of di was weighed and transferred to a sintered glass crucible . to this 5.0 ml of 1.0
mg ml solution of ibuprofen was added and the drugs were extracted with three quantities , each of 20 ml of mixture of methanol and water ( 1 : 1 v / v ) .
the combined extracts were made up to 100 ml with mobile phase , and further dilutions were made to get a concentration of 20.0 , 30.0 , and 40.0 g / ml of dexibuprofen , 50.0 g / ml of ibuprofen as internal standard , and this solution was used for the estimation . accurately weighed amount of powder equivalent to 20.0 , 30.0 , and 40.0 mg of di was transferred to 100 ml volumetric flask and dissolved in the mobile phase to obtain a concentration of 20.0 , 30.0 , and 40.0 g ml .
an aliquot of this solution was diluted in mobile phase to obtain a solution with final concentration of 4.0 g ml . the objective of method validation is to demonstrate that the method is suitable for its intended purpose as it is stated in ich guidelines .
the method was validated for linearity , precision ( repeatability and intermediate precision ) , accuracy specificity , short - term stability , and system suitability .
standard plots were constructed with six concentrations in the range of 1060 g ml prepared in triplicates to test linearity .
the ratio of peak area signal of di to that of is was plotted against the corresponding concentration to obtain the calibration graph .
the linearity was evaluated by linear regression analysis that was calculated by the least square regression method .
the precision of the assay was studied with respect to both repeatability and intermediate precision .
repeatability was calculated from six replicate injections of freshly prepared di solution in the same equipment at a concentration 50 g ml of the intended test concentration value on the same day .
the experiment was repeated by assaying freshly prepared solution at the same concentration additionally on two consecutive days to determine intermediate precision .
peak area ratio of di to that of is was determined and precision was reported as % r.s.d .
of individual measurements ) by analysing samples of di at three different levels in pure solutions using three preparations for each level .
specificity was assessed by comparing the chromatograms obtained from sample of pharmaceutical preparation and standard solution with those obtained from excipients which take part in the commercial tablets and verifying the absence of interferences .
sample solution short - term stability was tested at ambient temperature ( 20 1c ) for three days . in order to confirm the stability of both standard solutions at 100% level and tablets sample solutions ,
both solutions protected from light were reinjected after 24 and 48 h at ambient temperature and compared with freshly prepared solutions .
a system suitability test was performed by six replicate injections of the standard solution at a concentration of 50 g ml verifying is / di resolution > 2 , % r.s.d . of peak area ratios of di to that of is 2% , % r.s.d . of each peak retention time 2% .
six point calibration graphs were constructed covering a concentration range of 1060 mg ml .
linear relationships between the ratio of the peak area signal of di to that of is versus the corresponding drug concentration were observed , as shown by the results presented in table 1 .
the carried out repeatability study ( n = 6 ) showed a r.s.d . of 0.858% for the peak area ratios of di to that of is obtained , thus showing that the equipment used for the study worked correctly for the developed analytical method and is highly repetitive . for the intermediate precision , a study carried out by the same analyst working on two consecutive days ( n = 3 ) indicated a r.s.d . of 0.744% .
both values were far below 5% , the limit percentage set for the precision , and indicated a good method precision .
the data for accuracy were expressed in terms of percentage recoveries of di in the real samples .
the mean recovery data of di in real sample were within the range of 100.01 and 102.28% , and mean % r.s.d .
the hplc chromatogram recorded for the mixture of the drug excipients revealed no peak within a retention time range of 5 min .
the results showed that the developed method was specific as none of the excipients interfered with the analytes of interest ( figure 1 ) .
the stability of di in standard and sample solutions containing is was determined by storing the solutions at ambient temperature ( 20 1c ) protected from light .
the solutions were checked in triplicate after three successive days of storage , and the data were compared with freshly prepared samples . in each case , it could be noticed that solutions were stable for 72 h , as during this time the results did not decrease below 97% .
this denotes that di is stable in standard and sample solutions for at least 3 days at ambient temperature , protected from light , and is compatible with is .
the resolution factor between is and di , in the developed method , was above 2 .
the % r.s.d . of peak area ratio of di to that of is and retention times for both drug and is were within 2% indicating the suitability of the system ( table 3 ) .
these results indicate the applicability of this method to routine with no problems , with its suitability being proved .
the statistical evaluation of the proposed method revealed its good linearity , reproducibility , and its validation for different parameters and led us to the conclusion that it could be used for the rapid and reliable determination of di in pharmaceutical forms .
the validated method was applied for the assay of commercial tablets containing 200 mg , 300 mg , and 400 mg of di ( dexifen ) ; each sample was analysed in triplicate after extracting the drug as mentioned in the assay sample preparation of section 2 and injections were carried out in triplicate .
a validated isocratic hplc and uv methods has been developed for the determination of di in dosage forms .
its chromatographic run time of 10.5 min allows the analysis of a large number of samples in a short period of time .
therefore , it is suitable for the routine analysis of di in pharmaceutical dosage forms .
the simplicity of the method allows for application in laboratories that lack sophisticated analytical instruments such as lc - ms / ms or gc - ms / ms that are complicated , costly , and time consuming rather than a simple hplc - uv method .
considering the possible worldwide development of counterfeit dexifen , the proposed method could be useful for the national quality control laboratories in developing countries .
Output:
| a high - performance liquid chromatographic ( hplc ) and a ultraviolet ( uv ) methods were developed and validated for the quantitative determination of dexibuprofen ( di ) in pharmaceutical dosage form .
hplc was carried out by reversed phase technique on a rp-18 column with a mobile phase composed of acetonitrile and 0.5% triethylamine ( ph 7.5 adjusted with orthophosphoric acid ( 30 : 70 , v / v ) ) .
uv method was performed with the max at 222.0 nm .
both the methods showed good linearity , reproducibility and precision .
no spectral or chromatographic interferences from the tablet excipients were found in uv and hplc .
the method was successfully applied to commercial dexifen tablets .
validation parameters such as linearity , precision , accuracy , and specificity were determined .
the proposed method could be applicable for routine analysis of di and monitoring of the quality of marketed drugs . |
PubmedSumm7848 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: essential thrombocythemia ( et ) is a philadelphia chromosome ( ph)-negative myeloproliferative neoplasm ( mpn ) .
it is characterized by thrombocytosis and megakaryocytic hyperplasia of the bone marrow with jak2v617f mutation in 50 - 60% of patients .
et transforms into myelofibrosis in a minority of cases , while evolution to acute leukemia is uncommon and increases with the use of certain therapies .
it is mainly characterized by iron deficiency anemia that is not responding to oral iron intake , but partially responding to parenteral iron therapy .
recently , it is shown that irida has stemmed from mutations in the gene tmprss6 , which encodes a transmembrane serine protease ( matriptase-2 ) expressed by the liver .
irida patients indicate inappropriately increased levels of hepcidin which is a hormone delivered by the liver inhibiting iron absorption from the intestine and iron release from macrophage stores .
according to recent studies , tmprss6 down - regulates hepcidin expression by cleaving hemojuvelin , a membrane - bound protein which triggers hepcidin signaling in hepatocytes .
rcc , as the most common solid lesion in the kidney , represents approximately 90% of all kidney malignancies .
many renal masses are asymptomatic and non - palpable till the late phases of the disease .
currently , more than half of the rccs are identified incidentally through imaging while investigating some non - specific symptom complexes .
the classic triad of flank pain , gross hematuria and palpable abdominal mass is uncommon ( 6 - 10% ) .
a few symptomatic patients present with symptoms due to metastatic disease , such as bone pain or persistent cough .
ten to forty percent of patients with rcc experience paraneoplastic phenomena over the span of the disease .
the symptom that may result in erythrocytosis is the most well - known paraneoplastic hematological event .
modest granulocytosis and thrombocytosis appears in approximately 20% of the patients and is seen as part of a systemic inflammatory reaction as it is typically interrelated with anemia , fever , weight loss , and increased serum levels of crp and interleukin-6 . here , we report a patient who presents with coexistence of rcc and thrombocytosis , which hasnt been caused by hormonal factors that are produced in tumor cells .
we could not find similar cases previously reported and this may be the first documentation of such a case in literature .
his blood counts were : white blood cells : 950010/l ; hemoglobin : 6.9 g / dl ; mean corpuscular volume 58 fl . ; platelets count : 1.423.000/mm ; c - reactive protein : 0.9 mg / l ; serum iron : 5 mol / l ( normal range : 15 - 30
mol / l ) ; total iron - binding capacity : 505 g / dl ( normal range : 110 - 350 g / dl ) ; transferrin saturation : 1% ( normal range : 20 - 45% ) ; ferritin : 3.1 ng / ml ( normal range : 20 - 330 ng / ml ) ; sedimentation rate 23 ( normal range : 0 - 20 ) .
the peripheral blood smear showed hypochromic and microcytic cells , anisopoikilocytosis and thrombocytosis while his liver and kidney tests were normal .
endoscopy and colonoscopy was applied to the patient in order to determine the etiology of iron deficiency anemia and no pathological signs were found . according to the etiology of thrombocytosis , jak2v617f mutation was found as positive and ph chromosome was negative in our patient .
bone marrow biopsy showed megakaryocytic hyperproliferation , in which megakaryocytes are increased in size with mature hyperlobulated with abundant cytoplasm and grouped .
standard cytogenetic studies showed a normal male karyotype ( 46 xy ) and fish ( fluorescence in situ hybridization ) analysis for deletion 5q [ del ( 5q ) ] was negative .
abdominal computed tomography was applied to the patient to investigate the presence of other malignancies and a 3532 mm .
the biopsy of this mass showed clear cell rcc ( crcc ) . during the examination of patient ,
the hemoglobin concentration , serum iron level and ferritin level did nt increase enough after four weeks .
this failure is usually due to poor compliance , misdiagnosis , continued blood loss , or malabsorption but none of these reasons were present in our patient .
starch block electrophoresis of the hemoglobin was applied to him to investigate the underlying thalassemia , and the hemoglobin electrophoretic pattern was found normal .
we suspected that the patient may have irida , because all of its typical features as microcytic anemia with low serum iron , no response to oral iron , and only a partial response to intravenous iron therapy were present in our patient ; however , we could nt identify mutations of the tmprss6 gene and high plasma levels of hepcidin due to technical difficulties .
as a result of all these investigations , the patient was found to have coexistence of rcc , et and irida .
radical nephrectomy operation was planned for the patient by urologists . before the operation cytoreductive therapy with hydroxyurea
was administered to the patient until his platelet count is reduced below 400 000/mm and parenteral ( intravenously ) iron treatment was applied to the patient until the hemoglobin level increased at least above 10 g / dl .
platelet count can increase in a variety of conditions , such as anemia , reduced iron stores , inflammation , the absence of a spleen , and primary proliferative disorders .
of all these conditions , malignant neoplasms are one of the most frequent causes of thrombocytosis .
here we report a patient who presented with coexistence of rcc and thrombocytosis , but it hasnt been caused by hormonal factors that are produced in tumor cells .
we aimed to show that coexistence of malignant neoplasms and thrombocytosis may not only arise from the production of humoral factors produced by the tumor , but concomitant mpn must be also considered .
Output:
| essential thrombocythemia ( et ) is a philadelphia chromosome ( ph)-negative myeloproliferative neoplasm .
it is characterized by thrombocytosis and megakaryocytic hyperplasia of the bone marrow with jak2v617f mutation .
iron - refractory iron deficiency anemia ( irida ) is an autosomal recessive disorder , which is mainly characterized by iron deficiency anemia not responding to oral iron intake , but partially responding to parenteral iron therapy .
recently , it has been shown that irida has stemmed from mutations in the gene tmprss6 , which encodes a transmembrane serine protease ( matriptase-2 ) expressed by the liver .
renal cell carcinoma ( rcc ) accounts for 2 - 3% of all cancers . as the most common solid lesion in the kidneys , it represents approximately 90% of all renal malignancies .
approximately 30% of patients with symptomatic rccs seem to display paraneoplastic syndromes .
the symptom that may result from erythrocytosis is the most well - known paraneoplastic hematological event . here , we report a patient who presents with coexistence of rcc and thrombocytosis , which hasnt been caused by hormonal factors that are produced in tumor cells .
this patient has been therefore diagnosed with et .
the patient who was expected to display rcc with polycythemia , conversely present with irida . |
PubmedSumm7849 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: indirect restorations play an important role in clinical dentistry . whilst clinicians often spend considerable time choosing materials or type of restorations , the cementation process is often considered less important and manufacturer 's instructions modified or ignored .
luting materials are necessary to retain such restorations on teeth and to prevent leakage at their margins .
one such material is zinc phosphate cement which is used routinely by almost one - third of uk practitioners .
clinically , the cement is presented as powder and liquid components which must be mixed together prior to application to the restoration or the tooth . often the proportions of the two elements used are measured by eye or with operator - dependent measuring systems .
they are then mixed together in varying environments ( temperature and humidity ) under differing mixing conditions time and manipulation technique . while low - grade mixing errors ( < 1020% ) may not have serious implications regarding the integrity of traditional luting agents , there is concern regarding high - grade errors .
such errors are likely to occur with less experienced operators , such as undergraduate dental students and inexperienced dental nurses . as a measure of mechanical integrity of the set cement ,
compressive strength has been found to increase with the amount of powder mixed with a constant amount of liquid [ 48 ] .
in addition , diametral tensile strength ( dts ) is a well - established and reproducible measure of mechanical integrity in very brittle materials such as zinc phosphate cement and has been extensively used in the testing of appropriate dentally related materials [ 911 ] .
the aim of this study was to ( a ) investigate whether high - grade powder - liquid proportioning errors might occur in a cohort of inexperienced dental undergraduate students mixing zinc phosphate cement and ( b ) determine the effect of any such variability on the diametral tensile strength of the set material .
the null hypotheses were that ( a ) the powder - liquid mixing ratios observed would not differ from the manufacturer 's recommended ratio and ( b ) dts of the set cement samples using the extreme powder / liquid ratios observed would not differ from those made using the manufacturer 's recommended ratio .
the entire third year undergraduate dentistry class from a dental school in ireland was invited to participate in the study .
thirty four students contributed to the experiment , none of whom had previous experience of working with zinc phosphate cement but had experience of mixing other dental materials including glass ionomer cement in the clinical environment .
each student received verbal and written directions in measuring powder and liquid components according to the manufacturer 's instructions ( fleck 's cement , mizzy , cherry hill , nj , usa ) . the instructions stated that 0.8 g of powder should equate with 2 fillings to the shoulder of the powder cap dome and 0.3 ml liquid should equate with 12 drops of liquid
the students measured the powder and liquid using the powder cap and liquid dropper onto a preweighed plastic container and the mass of each was recorded ( mettler ae 100 balance , mettler instruments ag , greifensee , zurich ) .
a calibrated pipette was used to determine the density of the cement liquid yielding the mass equivalent of the manufacturer 's recommended volume of 0.3 mls and a powder / liquid ratio ( m / m ) of 1.718 .
the observed maximum ( 2.386 ) and minimum ( 1.018 ) powder / liquid ratios , together with the manufacturer 's recommended ratio ( m / m ) , were used subsequently by a single experienced dental clinician to prepare cylindrical samples ( n = 3 34 ) , of nominal dimensions 6 mm 3 mm , using a stainless steel split mould .
the samples were hand mixed on a chilled glass slab and the mix transferred and packed into the split mould .
the samples were left to initially mature ( 60 mins ) before being removed from the mould .
the specimens were further matured in deionised water ( 37 2)c for 48 hours . before testing , each specimen was dried gently on all sides using soft tissue paper and the diameter and height measured using a micrometer gauge .
compression across a diameter was carried out using a universal testing machine , h10ks ( tinius olsen ) , at a constant crosshead speed of 0.75 mm / min .
failure load data were converted to dts using the expression = 2p/dl ( = diametral tensile strength , p = load at failure , d = diameter of cylinder , and l = height of cylinder ) .
the null hypotheses were that ( a ) the powder - liquid mixing ratios observed would not differ from the manufacturer 's recommended ratio and ( b ) dts of the set cement samples would not differ from those made using the manufacturer 's recommended ratio .
statistical analyses ( = 0.05 ) were by student 's t - test in the case of powder / liquid ratio and one - way anova and tukey hsd for for pair - wise comparisons of mean dts ( r version 2.8.0r foundation for statistical computing ) .
the extreme powder / liquid mixing ratios ( m / m ) observed from the student cohort , together with the manufacturer 's recommending ratio , and corresponding data regarding dts are presented in table 1 .
the mean powder / liquid ratio obtained for the student cohort was not significantly different from the manufacturer 's recommended value ( p = 0.189 ) .
the mean dts values recorded for the maximum and minimum ratios for the student cohort were significantly different from that obtained from the manufacturer 's recommended powder / liquid ratio ( p < 0.001 ) and from each other ( p < 0.001 ) .
it is clear that high - grade powder - liquid proportioning errors were observed in this cohort of dental undergraduate students in the sense that the extreme powder - liquid ratios resulted in significant impacts on dts .
these proportioning errors have occurred notwithstanding explicit verbal and written instructions given immediately before the mixing process . while it is attractive to attribute this effect to inexperience , as might be relevant to undergraduate dental students and inexperienced dental nursing staff , more substantial and quantifiable concerns must address the mixing methodology . ideally , the mixing process should be fail safe in that it should only be possible to mix material correctly , or not at all . in this regard , a number of opportunities for error present .
the volume of powder delivered using volume dispensation is very operator dependent and variations can be common due to the differences in cement powder packing densities when filling the scoop [ 12 , 13 ] . for dispensing the liquid the opportunity for inaccuracy is potentially even greater .
the amount of liquid expressed is dependent on the manner in which the bottle is held and the force exerted on it .
excessive force can cause a stream of liquid to be expressed rather than a series of drops and air bubbles can further complicate measurement .
operators often tend to mix cements and other restorative materials by experience , adding extra powder or liquid to gain the consistency or properties they desire . a report quoted relatively good intraoperator consistency in mixing zinc phosphate cement ( single commercial product ) among a cohort of 40 qualified dental nurses in the uk but little intra - operator consistency .
clearly , such a report is not conducive to the expectation of acceptable performance among inexperienced operators and begs the overall question of whether an alternative approach should be used in the manner of a standard operating protocol per product .
a plausible solution to addressing variability in powder / liquid ratio ( and presenting the possibility of consistent mixing ) is the encapsulation of cement components ( single - use capsules ) which certain manufacturers have done with zinc phosphate and other luting cements such as glass ionomer . encapsulation would also remove the problem of solvent evaporation from the cement liquid with possible phosphate deposition yielding the liquid unusable .
it is , however , unclear what parameters the manufacturer 's recommended powder / liquid address .
presumably , the resultant mixture is required to be sufficiently thin to wet the adherend but with the ability to yield acceptable strength on setting . a report on the effect of powder / liquid ratio on the clinical performance of resin - modified glass ionomer
cement indicates that higher powder / liquid ratios compromise surface wetting with an increased incidence of subsequent retention failures when used as a tooth restorative . the reported mean value for dts , mixed according to the manufacturer 's ratio , was generally consistent with previously reported values for other brands of zinc phosphate cement relating to similar specimen dimensions and storage [ 18 , 19 ]
this would suggest that the observed low value obtained from the minimum powder / liquid ratio may be generalised as inappropriate proportioning .
the value was less than 38% of the strength associated with the manufacturer 's mixing ratio and must raise concerns regarding mechanical adequacy of the set material .
apart from concerns regarding compromised mechanical properties , there are likely clinical consequences to the use of an inappropriate powder to liquid ratio .
for example , incorporation of too much powder into the luting cement may result in a thick mix of cement which could make complete seating an indirect restoration difficult .
this could result in open margins and/or a high restoration which could cause patient discomfort in the short term and the failure of the restoration in the long term .
while the use of encapsulated products might appear attractive to obviate arbitrary mixing ratios with attendant problems , a reported comparison of an encapsulated zinc phosphate cement with a hand - mixed analogue highlighted certain deficiencies in the encapsulated material [ 21 , 22 ] no significant advantages in terms of reliability or strength were observed in the encapsulated product .
in addition , the latter was observed to be more porous than the hand - mixed material , most likely due to the entrapment of air during the relatively vigorous mechanical trituration .
high - grade proportioning errors relating to fleck 's cement , for a luting consistency , were observed among a cohort of dental undergraduate students .
these errors resulted in significant differences between the dts values of the set cement and those which relate to the manufacturer 's recommended ratio .
apart from compromised mechanical performance resulting from inappropriate proportioning , incorporation of too much powder into the luting cement may result in a thick mix of cement which could make complete seating an indirect restoration difficult .
routine encapsulation of zinc phosphate cement components , in the form of single - use disposable capsules , is suggested as a method of addressing variability in proportioning powder - liquid cements especially amongst inexperienced operators .
Output:
| aim . to investigate ( a ) variability in powder / liquid proportioning and ( b ) effect of variability on diametral tensile strength ( dts ) , in a zinc phosphate cement .
statistical analyses ( = 0.05 ) were by student 's t - test in the case of powder / liquid ratio and one - way anova and tukey hsd for pair - wise comparisons of mean dts .
the null hypotheses were that ( a ) the powder - liquid mixing ratios would not differ from the manufacturer 's recommended ratio ( b ) dts of the set cement samples using the extreme powder / liquid ratios would not differ from those made using the recommended ratio .
methodology .
34 dental students dispensed the components according to the manufacturer 's instructions .
the maximum and minimum powder / liquid ratios , together with the manufacturer 's recommended ratio , were used to prepare samples for dts testing .
results . powder / liquid ratios ranged from 2.386 to 1.018 .
the mean ratio ( 1.644 ) was not significantly different from the recommended value of 1.718 ( p = 0.189 ) .
dts values for the maximum and minimum ratios were both significantly different from each other ( p < 0.001 ) and from the mean value obtained from the recommended ratio ( p < 0.001 ) .
conclusions .
variability exists in powder / liquid ratio for hand dispensed zinc phosphate cement
. this variability can affect the dts of the set material . |
PubmedSumm7850 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: idiopathic parkinson 's disease ( pd ) can be difficult to distinguish from atypical parkinsonian syndromes such as progressive supranuclear palsy ( psp ) and corticobasal degeneration ( cbd ) , especially in the early stages of disease .
a simple test that is easy to administer , differentiates between parkinsonian disorders and identifies decline over time would be a welcome addition to the clinical and research armoury . for clinicians
such a test could reduce the high rate of uncertainty , diagnostic delay and misdiagnosis , which are especially common for psp . in research ,
the urgent need for new disease measures and better diagnostic differentiation is highlighted by current progress toward neuroprotective and disease - modifying therapies : early diagnosis and the ability to monitor progression will be increasingly important with disease - specific treatments.1 a perfect single test may not exist , but a combination of clinical , cognitive and biological tests , as biomarkers of disease , would provide a significant step forward.2 in this study , we consider the potential role of cognitive tests for these purposes .
pd , psp and cbd are all movement disorders with varying patterns of cognitive impairment .
pd is characterised by asymmetric bradykinesia , with tremor , rigidity and/or postural instability . while frontostriatal executive impairments are common in pd , an early dementia is uncommon and tends to be heralded by deficits in posterior cortically based cognitive functions.3 psp typically presents with symmetrical akinesia and rigidity , early falls and a supranuclear gaze palsy .
it is associated with a frontal dysexecutive syndrome , impaired fluency , disinhibition and cognitive inflexibility , together with impairments in language , motivation , emotional and social cognition.46 cbd is highly variable , but includes the alien limb syndrome , asymmetric dystonia , apraxia , myoclonus , non - fluent aphasia and visuospatial impairment.7 cognitive involvement in cbd ranges from near normal cognition to severe dementia , although language syndromes such as non - fluent aphasia are common.6
8 despite characterisation of individual cognitive profiles , the difference between diseases has been less well studied .
cognitive tests have been suggested to differentiate between pd and atypical parkinsonism.9
10 a small study using a battery of executive tests , including verbal fluency , correctly identified 15 of 16 patients with psp from those with pd or multiple system atrophy , but with wide cis .
the revised addenbrooke 's cognitive examination ( ace - r ) and verbal fluency have been found to distinguish between atypical parkinsonian disorders and alzheimer 's disease.11 however , this is rarely a clinical conundrum ; the more common clinical dilemma is one of differentiating pd from other parkinsonian disorders .
typical signs such as the humming bird and mickey mouse signs may occur in psp while formal quantification of structural mri changes using voxel - based morphometry have suggested patterns of atrophy that may help distinguish between pd and psp12 with a specificity of 84% and sensitivity of 79% based on atrophy in the cerebellar peduncles and midbrain.13 contrasting atrophy patterns are also seen between cbd and psp ; presence of midbrain atrophy has a specificity of 96.2% and sensitivity of 93.8% to distinguish psp from cbd , and from asymmetrical cortical atrophy a specificity of 87.5% and sensitivity of 100%.14 a more quantitative approach was less successful , achieving a positive predictive value ( ppv ) of 66.7% for psp and 71.4% for cbd by measuring changes in the midbrain , pontine tegementum and left frontal eye field.15 given the cost and limited success of brain imaging to distinguish pd from other parkinsonian syndromes , attention has turned to simpler neuropsychological measures .
the ace - r is a comprehensive and easily administered pen and paper test of cognition which has been used in a number of neurodegenerative diseases , including pd , alzheimer 's disease16 and frontotemporal dementia.17 it consists of a 100-point test divided into five cognitive subdomains ( table 1 ) .
the ace - r test multiple cognitive domains , summed to a score of 100 points the mmse is extracted as a 30-point score from elements of the ace - r .
ace - r , addenbrooke 's cognitive examination revised ; mmse , mini - mental state examination . based on the differing published descriptions of cognitive profiles between diseases , we set out to assess whether the ace - r , the ace - r subscores or the widely used mini mental state examination ( mmse ) might be useful in two distinct ways .
first , whether these cognitive tests distinguish between pd , psp and cbd , at a group average level and in terms of receiver operator characteristic ( roc ) curves .
second , whether these tests have the potential to monitor disease progression over time in these disorders .
we recruited patients with pd ( n=86 ) , psp ( n=30 ) and cbd ( n=19 ) .
patients with pd were newly diagnosed and recruited as part of a community - based incidence study of pd in cambridgeshire ( picnics study ) .
all picnics study participants who had returned for a follow - up assessment at the time of data analysis were included in this study , representing 37% of the overall picnics study population .
patients were recruited from primary and secondary care and assessed using a battery of cognitive and neurological tests , in addition to a semi - structured interview . all patients fulfilled queen square brain bank criteria for pd .
patients with psp and cbd were recruited from a regional tertiary referral specialist clinic at the cambridge university hospitals nhs trust ( addenbrookes ) , uk .
this clinic encourages regional referral of all cases of psp and cbd , from movement disorders specialists and memory clinics .
standard diagnostic criteria were applied for psp18 and cbd.8 of nine psp patients who proceeded to post mortem , all had neuropathological confirmation of psp .
all patients gave written , informed consent and ethical approval was obtained from the cambridge 2 research ethics committee , cambridge , uk .
cognitive assessment using the ace - r and mmse was performed on two separate occasions , at a baseline visit and again at a follow - up visit . for patients with pd , a planned visit at
approximately 18 months was arranged as part of the picnics study . for patients with psp and cbd ,
assessment was carried out in a quiet room by investigators familiar with the ace - r .
collection of data in patients with psp and cbd began before widespread use of the movement disorder society unified parkinson 's disease rating scale ( mds - updrs ) ; therefore motor function was assessed using the original updrs iii , whereas patients with pd were evaluated with the mds - updrs iii .
between - group differences at baseline were investigated using a one - way analysis of variance ( anova ) .
group difference for change in scores between visits was assessed using a multiple measures anova with fixed and random effects .
if appropriate ( as indicated in the results section ) , significance values were bonferroni corrected for multiple comparisons .
roc curves and associated statistics were generated using the proc package.19 an optimal threshold for each cognitive test per pairwise comparison was identified using a
closest top - left algorithm : cis were obtained for the area under the curve ( auc ) , sensitivity and specificity by a stratified bootstrap analysis with 5000 permutations .
sensitivity was defined as the ratio between true positives and all those who carried a diagnosis of interest ( condition positive ) for a given threshold .
specificity was defined as the proportion of false negatives among all those who did not carry the diagnosis of interest ( condition negative ) for a given threshold .
ppv was defined as the ratio between the number of true positive subjects and the total number of positive results ( false positive and true positives ) for each diagnosis at a given threshold ; negative predictive value ( npv ) was defined as the ratio between the number of true negative results and the total number of negative results for each diagnosis at a given threshold .
we recruited patients with pd ( n=86 ) , psp ( n=30 ) and cbd ( n=19 ) .
patients with pd were newly diagnosed and recruited as part of a community - based incidence study of pd in cambridgeshire ( picnics study ) .
all picnics study participants who had returned for a follow - up assessment at the time of data analysis were included in this study , representing 37% of the overall picnics study population .
patients were recruited from primary and secondary care and assessed using a battery of cognitive and neurological tests , in addition to a semi - structured interview . all patients fulfilled queen square brain bank criteria for pd .
patients with psp and cbd were recruited from a regional tertiary referral specialist clinic at the cambridge university hospitals nhs trust ( addenbrookes ) , uk .
this clinic encourages regional referral of all cases of psp and cbd , from movement disorders specialists and memory clinics .
standard diagnostic criteria were applied for psp18 and cbd.8 of nine psp patients who proceeded to post mortem , all had neuropathological confirmation of psp .
all patients gave written , informed consent and ethical approval was obtained from the cambridge 2 research ethics committee , cambridge , uk .
cognitive assessment using the ace - r and mmse was performed on two separate occasions , at a baseline visit and again at a follow - up visit . for patients with pd , a planned visit at approximately 18 months
was arranged as part of the picnics study . for patients with psp and cbd ,
assessment was carried out in a quiet room by investigators familiar with the ace - r .
collection of data in patients with psp and cbd began before widespread use of the movement disorder society unified parkinson 's disease rating scale ( mds - updrs ) ; therefore motor function was assessed using the original updrs iii , whereas patients with pd were evaluated with the mds - updrs iii .
between - group differences at baseline were investigated using a one - way analysis of variance ( anova ) .
group difference for change in scores between visits was assessed using a multiple measures anova with fixed and random effects . if appropriate ( as indicated in the results section ) , significance values were bonferroni corrected for multiple comparisons .
roc curves and associated statistics were generated using the proc package.19 an optimal threshold for each cognitive test per pairwise comparison was identified using a
closest top - left algorithm : cis were obtained for the area under the curve ( auc ) , sensitivity and specificity by a stratified bootstrap analysis with 5000 permutations .
sensitivity was defined as the ratio between true positives and all those who carried a diagnosis of interest ( condition positive ) for a given threshold .
specificity was defined as the proportion of false negatives among all those who did not carry the diagnosis of interest ( condition negative ) for a given threshold .
ppv was defined as the ratio between the number of true positive subjects and the total number of positive results ( false positive and true positives ) for each diagnosis at a given threshold ; negative predictive value ( npv ) was defined as the ratio between the number of true negative results and the total number of negative results for each diagnosis at a given threshold .
patients with cbd were younger than those with pd ( p=0.004 ) and those with psp ( p=0.001 ) .
the duration of symptoms reported by the patient or carer at the first clinical assessment was shorter for patients with pd compared with those with psp ( p=0.003 ) and cbd ( p<0.001 ) .
there were no significant differences between groups in terms of baseline education , handedness or gender .
there was a trend toward more patients with pd taking levodopa than the other two groups , although those that did took a similar dose .
patients with pd were seen for follow - up on average at 19.0 months , slightly later than psp ( 16.1 months , p=0.007 ) or cbd ( 14.3 months , p=<0.001 ) .
the selection of patients with pd matched the demographics of the whole picnics study population in terms of age , gender , handedness , years of education , mds - updrs iii , levodopa equivalent dose and ace - r score ( p>0.1 in all cases ) .
demographics for the study population recorded at the baseline visit p values based on f tests in one - way analysis of variance , or , as appropriate .
cbd , corticobasal degeneration ; pd , parkinson 's disease ; psp , progressive supranuclear palsy . ace - r scores and subscores at baseline and follow - up visits for patients with pd , psp and cbd .
ace - r , addenbrooke 's cognitive examination revised ; cbd , corticobasal degeneration ; mmse , mini mental state examination ; pd , parkinson 's disease ; psp , progressive supranuclear palsy . at the baseline visit ,
a between - group comparison showed a significant effect of diagnosis on the ace - r score for attention and concentration , fluency , language and visuospatial subscores , but not for memory subscores ( table 3 ) . between group differences at baseline visit for ace - r score and subscores , and combined raw verbal fluency ( combined letter and category fluencies ) post hoc t tests are shown wherever analysis of variance showed a significant group difference . *
ace - r , addenbrooke 's cognitive examination revised ; cbd , corticobasal degeneration ; mmse , mini mental state examination ; pd , parkinson 's disease ; psp , progressive supranuclear palsy . to investigate the effect of disease duration and delayed diagnosis between groups
, we took advantage of a feature in our data , that the time from first reported symptom in the pd group at follow - up ( 3.3 years ) was not significantly different from the baseline symptom duration in the psp ( 3.2 years ) and cbd ( 3.1 years ) groups .
hence , baseline psp and cbd scores and follow - up pd scores were at similar symptom duration , and could be compared directly .
anova results for this comparison showed a similar pattern of significance in group differences , except that pairwise comparison of visuospatial scores were non - significant between pd and psp ( p=0.1 ) , and between pd and cbd ( p=0.2 ) . to investigate the predictive accuracy of each score for individual subjects , we performed roc curve analysis ( figure 2 ) .
detailed results are shown in table 3 for all ace - r scores and subscores where the auc exceeded 0.85 , and for the mmse as a comparison .
best differentiation was seen between pd and psp subjects , in particular the verbal fluency subscore .
subdividing the fluency score into letter and category components showed a diagnostic differentiation between pd and psp similar to the combined scaled score using letter fluency alone ( threshold 7 words per minute , auc 0.93 , specificity 0.85 , sensitivity 0.83 , ppv 0.81 , npv 0.93 ) , and slightly poorer differentiation using category fluency ( threshold 13.5 words per minute , auc 0.89 , specificity 0.81 , sensitivity 0.83 , ppv 0.63 , npv 0.93 ) .
receiver operating characteristics curves distinguishing between diagnostic groups using baseline ace - r scores and subscores .
ace - r , addenbrooke 's cognitive examination revised ; auc , area under the curve ; cbd , corticobasal degeneration ; mmse , mini mental state examination ; pd , parkinson 's disease ; psp , progressive supranuclear palsy . an interaction between diagnosis and change in score between visits was seen in the ace - r total score , visuospatial subscore , attention and concentration subscore , and mmse ( table 4 ) .
post hoc t tests showed that ace - r total scores declined significantly in pd and cbd ( see table 5 ) .
there was greatest decline in visuospatial subscores in the cbd group , although the pd and psp groups also showed a significant fall .
analysis of follow - up scores without normalisation for interval to follow - up showed an almost identical pattern of significance , the only difference being a marginally significant difference for ace - r score between visits in the psp group ( p=0.04 ) .
ace - r , addenbrooke 's cognitive examination revised ; cbd , corticobasal degeneration ; mmse , mini mental state examination ; npv , negative predictive value ; pd , parkinson 's disease ; ppv , positive predictive value ; psp , progressive supranuclear palsy ; roc , receiver operating characteristics .
group differences for the change in ace - r and subscores between baseline and follow - up visit scores , normalised to a rate of change over 18 months * significant bonferroni correct p value < 0.05 .
ace - r , addenbrooke 's cognitive examination revised ; cbd , corticobasal degeneration ; mds - updrs iii , movement disorder society unified parkinson 's disease rating scale iii ; mmse , mini mental state examination ; pd , parkinson 's disease ; psp , progressive supranuclear palsy .
patients with cbd were younger than those with pd ( p=0.004 ) and those with psp ( p=0.001 ) .
the duration of symptoms reported by the patient or carer at the first clinical assessment was shorter for patients with pd compared with those with psp ( p=0.003 ) and cbd ( p<0.001 ) .
there were no significant differences between groups in terms of baseline education , handedness or gender .
there was a trend toward more patients with pd taking levodopa than the other two groups , although those that did took a similar dose .
patients with pd were seen for follow - up on average at 19.0 months , slightly later than psp ( 16.1 months , p=0.007 ) or cbd ( 14.3 months , p=<0.001 ) .
the selection of patients with pd matched the demographics of the whole picnics study population in terms of age , gender , handedness , years of education , mds - updrs iii , levodopa equivalent dose and ace - r score ( p>0.1 in all cases ) .
demographics for the study population recorded at the baseline visit p values based on f tests in one - way analysis of variance , or , as appropriate .
cbd , corticobasal degeneration ; pd , parkinson 's disease ; psp , progressive supranuclear palsy . ace - r scores and subscores at baseline and follow - up visits for patients with pd , psp and cbd .
ace - r , addenbrooke 's cognitive examination revised ; cbd , corticobasal degeneration ; mmse , mini mental state examination ; pd , parkinson 's disease ; psp , progressive supranuclear palsy .
at the baseline visit , a between - group comparison showed a significant effect of diagnosis on the ace - r score for attention and concentration , fluency , language and visuospatial subscores , but not for memory subscores ( table 3 ) . between group differences at baseline visit for ace - r score and subscores , and
combined raw verbal fluency ( combined letter and category fluencies ) post hoc t tests are shown wherever analysis of variance showed a significant group difference .
ace - r , addenbrooke 's cognitive examination revised ; cbd , corticobasal degeneration ; mmse , mini mental state examination ; pd , parkinson 's disease ; psp , progressive supranuclear palsy . to investigate the effect of disease duration and delayed diagnosis between groups , we took advantage of a feature in our data , that the time from first reported symptom in the pd group at follow - up ( 3.3 years ) was not significantly different from the baseline symptom duration in the psp ( 3.2 years ) and cbd ( 3.1 years ) groups .
hence , baseline psp and cbd scores and follow - up pd scores were at similar symptom duration , and could be compared directly .
anova results for this comparison showed a similar pattern of significance in group differences , except that pairwise comparison of visuospatial scores were non - significant between pd and psp ( p=0.1 ) , and between pd and cbd ( p=0.2 ) . to investigate the predictive accuracy of each score for individual subjects , we performed roc curve analysis ( figure 2 ) .
detailed results are shown in table 3 for all ace - r scores and subscores where the auc exceeded 0.85 , and for the mmse as a comparison .
best differentiation was seen between pd and psp subjects , in particular the verbal fluency subscore .
subdividing the fluency score into letter and category components showed a diagnostic differentiation between pd and psp similar to the combined scaled score using letter fluency alone ( threshold 7 words per minute , auc 0.93 , specificity 0.85 , sensitivity 0.83 , ppv 0.81 , npv 0.93 ) , and slightly poorer differentiation using category fluency ( threshold 13.5 words per minute , auc 0.89 , specificity 0.81 , sensitivity 0.83 , ppv 0.63 , npv 0.93 ) .
receiver operating characteristics curves distinguishing between diagnostic groups using baseline ace - r scores and subscores .
ace - r , addenbrooke 's cognitive examination revised ; auc , area under the curve ; cbd , corticobasal degeneration ; mmse , mini mental state examination ; pd , parkinson 's disease ; psp , progressive supranuclear palsy .
an interaction between diagnosis and change in score between visits was seen in the ace - r total score , visuospatial subscore , attention and concentration subscore , and mmse ( table 4 ) .
post hoc t tests showed that ace - r total scores declined significantly in pd and cbd ( see table 5 ) .
there was greatest decline in visuospatial subscores in the cbd group , although the pd and psp groups also showed a significant fall .
analysis of follow - up scores without normalisation for interval to follow - up showed an almost identical pattern of significance , the only difference being a marginally significant difference for ace - r score between visits in the psp group ( p=0.04 ) .
ace - r , addenbrooke 's cognitive examination revised ; cbd , corticobasal degeneration ; mmse , mini mental state examination ; npv , negative predictive value ; pd , parkinson 's disease ; ppv , positive predictive value ; psp , progressive supranuclear palsy ; roc , receiver operating characteristics .
group differences for the change in ace - r and subscores between baseline and follow - up visit scores , normalised to a rate of change over 18 months * significant bonferroni correct p value < 0.05 .
ace - r , addenbrooke 's cognitive examination revised ; cbd , corticobasal degeneration ; mds - updrs iii , movement disorder society unified parkinson 's disease rating scale iii ; mmse , mini mental state examination ; pd , parkinson 's disease ; psp , progressive supranuclear palsy .
our data show that the ace - r , and in particular its total score , verbal fluency and visuospatial subscores , distinguish between pd and psp , and to a lesser extent between pd and cbd .
the differentiation between pd and psp using verbal fluency alone ( specificity 0.92 , sensitivity 0.87 ) outperforms previous reports of diagnostic differentiation achieved using imaging methods alone.12
13 in addition , our data suggest that the ace - r may be helpful for tracking disease progression over time , particularly in cbd .
these findings suggest that in the appropriate clinical context , the ace - r may provide useful information in the diagnosis and tracking of parkinsonian disorders .
the good ppvs and npvs , low cost and simplicity of these cognitive biomarkers makes them especially useful when the cost and expertise required for routine clinical mri or positron emission tomography is prohibitive .
this includes many regions of the world where imaging is not available.20 cognitive tests have the potential of being safe , inexpensive and low - tech additions to the diagnostic armoury that can be used in a range of clinical settings primary , secondary or tertiary care and research studies .
the ace - r has even been validated in a number of languages , although our findings would require replication in different populations to properly assess generalisation.17
21
22 different parts of the cognitive assessment had different value in the differentiation of pd , psp and cbd .
we focused on the ace - r rather than the mmse , as it was superior in differentiating disorders ( see roc curves , figure 2 ) and was more sensitive to decline over time .
fluency deficits have been described in pd,23 psp5
24 and cbd.25 the decline in fluency is not entirely due to bradykinesia , as fluency requires very little motor function .
interestingly , patients with psp or cbd may generate a small number of low - frequency words ( eg ,
peramubulator ) rather than high - frequency words ( eg , put , people ) .
this is supported by evidence from functional imaging suggesting that verbal fluency is associated with activation of a diffuse cortical network26 but with an emphasis on brodmann area 45 for lexical retrieval and brodmann area 46 in phonological processing during word generation.27 patients with brain lesions in the left dorsolateral frontal lobe were found to have impaired verbal fluency if there were additional or solitary striatal lesions.28 neuropathology studies confirm that both of these sites are affected in psp and cbd.29
30 verbal fluency impairment has previously been reported in the early stages of pd,3 and is consistent with the braak staging hypothesis that predicts frontal lobe cortical pathology.31 changes in higher visual processing are present in all three disorders , but take different forms in each .
patients with pd may experience hallucinations or misperceptions usually later in the disease process that may be related to medication side effects or impaired attentional processing.32 patients with cbd and , to a lesser extent , those with psp perform poorly on visuospatial tasks .
object decision tasks , thought to be related to impairment in the ventral stream of visuospatial processing , whereas patients with cbd are typically worse on spatial location tasks , thought to relate to the parietal atrophy disrupting the dorsal stream of visuospatial processing.33 these previous findings are in broad agreement with our results .
the ace - r visuospatial tests rely more on spatial abilities than object recognition and is therefore likely to be more sensitive to the changes seen in cbd and psp , but is less likely to detect the misperceptions more commonly experienced in pd .
statistically significant group differences in test scores do not necessarily indicate clinically meaningful differences in test scores , especially in large studies .
for many of our results , we suggest that the differences between groups and over time are both statistically significant and clinically meaningful .
mmse scores declined by 2.7 points in the cbd group , which is close to the sd of 2.8 found in a large dementia population,34 suggesting this change is clinically significant .
large absolute differences were seen in psp and cbd groups for total ace - r score ( psp 6.0 , cbd 10.9 , of maximum score 100 ) and visuospatial subscores ( psp 2.5 , cbd 3.8 , of maximum 16 points ) .
although we do not have functional rating scales or measures of activities of daily living , we suggest that the magnitudes of these changes are likely to be clinically significant .
in contrast , the pd group showed much smaller changes in total ace - r score ( 1.9 points ) and the visuospatial subscore ( 0.5 points ) , which lie within the range of test variation ( inter - rater variance and test retest ) and are less likely to be clinically meaningful . in the context of pd , it has recently been demonstrated that the ace - r reflects functional changes ; the authors could identify the difference between cognitively well patients with pd and those with pd and mild cognitive impairment using a cut - off of 89 ( specificity of 84% , sensitivity 69%).35 our findings would support the use of cognitive measures in diagnostic criteria , although neuropathological correlation would be required to confirm this . in comparing groups in this study , we are reliant on clinical diagnostic criteria , which may not always reflect underlying pathology .
clinical diagnostic criteria for psp18 tend to be specific , with a diagnostic accuracy of 92% in patients meeting criteria.36 they may be insensitive to psp pathology in patients with a pd - like syndrome37 or no clinical disease.38 in our cohorts , many patients with psp had consented to brain donation in a regional brain bank , providing neuropathological confirmation in nine out of nine cases , in keeping with the high clinicopathological correlations in other centres .
there are several current clinical diagnostic criteria for cbd , recently reviewed by mathew et al.8 they applied clinical criteria in early cbd , finding sensitivities of 23.567.5% , increasing to 87.592.5% in later stage disease depending on the criteria applied .
diagnostic uncertainty is further reflected in the ante - mortem misclassification of cbd from post - mortem studies.39
40 our findings therefore support the use of cognitive measures in diagnostic criteria for pd , psp and cbd , although further neuropathological correlation would be helpful to investigate the link between cognition and histological disease changes in more detail , and evaluating cognitive differentiation of atypical or intermediate syndromes which combine features of pd , psp and cbd . in principle , one could apply more detailed neuropsychological tests .
however , an advantage of the ace - r is ease of use , requiring short training for those administering it . usually a full test will take around 10 min in cognitively well participants without akinesia , although it can be up to half an hour in severely affected patients with psp and cbd .
verbal fluency is an even briefer test , taking just 2 min of testing time .
the ace - r and verbal fluency could be assessed routinely in a general neurology or movement disorders clinic and its utility has been shown in this study .
furthermore , the duration of symptoms was shorter in the pd group , although correcting for this by comparing baseline psp and cbd scores with follow - up pd scores led to the same pattern of results . delayed diagnosis in psp and cbd is common , with patients often receiving an alternative diagnosis for 12 years , therefore recruiting patients with psp and cbd at an earlier stage is challenging .
we can not exclude the possibility that cognitive profiles would be different and between - group differences smaller at an earlier stage in the disease processes .
post - mortem confirmation of diagnosis was not available in all patients and so it is possible that for a small number of patients the diagnosis may be inaccurate .
patients with pd were seen for follow - up slightly later than the other two groups . however , correcting for this difference would augment rather than diminish our findings given the largest differences over time were seen in the cbd group who had the shortest mean follow - up .
for example , it is possible that apraxia or other features of a movement disorder impaired task performance differentially between groups , particularly on visuospatial drawing tasks and in patients with cbd .
however , the majority of subjects were relatively early in the disease course , able to hold a pencil and draw sufficiently to reveal the cognitive elements of the test .
there are also caveats to our use of the updrs iii motor subscale to measure motor severity .
this scale does not capture all signs in the cbd phenotype , omitting apraxia , alien limb phenomena , dysarthrophonia and mirror movements .
although the principal axial and appendicular motor signs of psp are included in the updrs iii , it should be borne in mind that the test was developed for use in pd and that it may not be adequately balanced to sensitively grade the progressive severity of psp or cbd .
the use of the updrs should therefore be seen as descriptive and not diagnostic of our study populations .
we propose that the ace - r score and verbal fluency are useful in supporting the differential diagnosis of parkinsonian disorders , including the sometimes difficult differentiation between pd and psp . by the time of diagnosis ( approximately 3 years from symptom onset for psp ) , patients with psp had lower ace - r scores and severely reduced verbal fluency .
the ace - r may additionally be useful for measuring disease progression , especially in cbd , both in the clinical setting and in clinical trials of new therapies .
we propose that the ace - r score and verbal fluency are useful in supporting the differential diagnosis of parkinsonian disorders , including the sometimes difficult differentiation between pd and psp . by the time of diagnosis ( approximately 3 years from symptom onset for psp ) , patients with psp had lower ace - r scores and severely reduced verbal fluency .
the ace - r may additionally be useful for measuring disease progression , especially in cbd , both in the clinical setting and in clinical trials of new therapies .
Output:
| objectivedifferentiating idiopathic parkinson 's disease from atypical parkinsonian syndromes is challenging , especially in the early stages .
we assessed whether the revised addenbrooke 's cognitive examination ( ace - r ) could differentiate between parkinsonian syndromes and reflect longitudinal changes in cognition in these disorders.methodsthe ace - r was administered at baseline and after approximately 18 months to 135 patients with parkinsonian disorders : 86 with idiopathic parkinson 's disease ( pd ) , 30 with progressive supranuclear palsy ( psp ) , 19 with corticobasal degeneration ( cbd ) .
we assessed differences between groups for ace - r , ace - r subscores and mini mental state examination ( mmse ) scores at baseline ( analyses of variance , receiver operating characteristics curves ) , and the interaction between diagnosis and change in ace - r scores between visits ( analyses of variance).resultsthe ace - r verbal fluency subscore distinguished between psp and pd with a high sensitivity ( 0.92 ) and specificity ( 0.87 ) ; total ace - r score and the visuospatial subscore were less specific ( 0.87 and 0.84 respectively ) and sensitive ( 0.70 and 0.73 ) .
significant group level differences were found between pd and psp for mmse and ace - r ( total score and subscores for attention and concentration , fluency , language , and visuospatial function ) , and between pd and cbd for the ace - r visuospatial subscore .
performance worsened between visits for ace - r score in pd ( p=0.001 ) and cbd ( p=0.001 ) ; visuospatial subscore in pd ( p=0.003 ) , psp ( p=0.022 ) and cbd ( p=0.0002 ) ; and mmse in cbd ( p=0.004).conclusionswe propose the ace - r , particularly the verbal fluency subscore , as a valuable contributor to the differential diagnosis of parkinsonian syndromes in the correct clinical context .
the ace - r may reflect disease progression in pd and cbd . |
PubmedSumm7851 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the formation of a tooth occurs inside a development sac known as the dental follicle or dental sac , which surrounds the papilla of the tooth and the enamel organ 1 .
damante 2 characterized the follicle as being the remnant of the tissues that participated in the odontogenesis and remained circumjacent to the crown of a tooth whose normal eruption has not occurred , the wall of connective tissue and the odontogenic epithelial remnants distributed in this tissue being its main constituents .
4 report that the follicle becomes part of the connective tissue of the free marginal gum and cahill and marks 5 have demonstrated its importance in the process of eruption .
consolaro 6 states that the potential transformation of unerupted teeth into cystic or neoplastic ones is related to the constituent structures of the follicle , in particular , the enamel reduced epithelium and remnants of dental lamina located in its connective tissue wall .
histologically , the follicular tissues may be confused with pathosis , correlations of the clinical , radiographic and histopathological findings being required to establish a diagnosis 3 .
radiographically , the pericoronal follicles present as slight semicircular radiolucencies around unerupted teeth ; however , enlargements or asymmetries can occur , which may be misinterpreted 3 . for santamaria and artegoitia 7 , pericoronal
radiolucency is one of the most important factors to be borne in mind in the decision on whether to retain or remove an impacted tooth , and the presence of radiolucency may be the only indication for this procedure . despite the importance of the radiographic findings , miller and bean 8 state that disease conditions may be found in minute follicular spaces and in enlarged radiolucent areas
there may be histologically normal tissues , so a biopsy is imperative . taking into consideration that the radiograph is in most cases the only instrument available to the oral and maxillofacial surgeon for deciding between removing or following up an asymptomatic unerupted tooth and that a number of studies show the possibility of cystic degeneration and/or neoplastic transformation of the follicles , the present study evaluated the correlation between radiographic and morphologic features of pericoronal follicles of unerupted third molars with incomplete rhizogenesis , with the aim of acquiring insights that might aid a surgeon faced with such teeth
the sample consisted of 56 patients , of whom 17 ( 30% ) were males and 39 ( 70% ) were females , with a total of 105 follicles of unerupted third molars with incomplete rhizogenesis .
ages ranged from 13 to 24 years , with a mean of 18.3 years ( standard deviation = 2.7 years ) and a median of 18 years .
this is a cross - sectional study in which the sample was established within a specific time frame .
the study was approved by the ethics in research committee of the state university of pernambuco .
the type of radiograph used was the panoramic one , only teeth between nolla 's 9 stages 6 ( complete crown ) and 9 ( almost complete root , open apex ) of rhizogenesis being included in the study .
the width of the pericoronal space was determined from the half of the mesial , distal and occlusal surfaces , the largest width being selected .
the harvesting of the follicle was performed by separation at the level of the cementoenamel junction , with the follicle being conditioned in 10% formol .
the specimens were submitted to the routine histotechnical procedures , semi - serial cross - sections with a thickness of 5 m , being selected and stained with hematoxylin - eosin ( he ) .
the odontogenic lining epithelium was classified according to cell activity as inactive , hyperplastic and absent .
it was considered inactive when it presented fewer than 20 layers of epithelial cells and when there were no epithelial projections into the connective tissue .
regarding type , it was classified as enamel reduced epithelium and stratified squamous epithelium 2,6 .
the remaining epithelium in the connective tissue was classified as inactive , proliferative or absent .
it was inactive when exhibiting a typical island or string formation and proliferative when forming sheets or layers of cells 10 .
in the evaluation of the connective tissue an analysis was made of the type to verify whether it was dense or loose and whether inflammation was present , the latter being classified as acute , chronic or absent .
the pearson chi - square test with a significance level of 5% was employed to assess the correlation between the radiographic and morphological features .
in the correlation between the type of lining epithelium and the stage of rhizogenesis ( table 1 ) , it was found that the enamel reduced epithelium ( figure 1 ) was the most commonly found type at all stages of rhizogenesis ; however , at stages 8 and 9 there was a marked increase in follicles with stratified squamous epithelium ( figure 2 ) , probably owing to a greater maturation of this follicle , such a transformation being expected . at stage 7 of rhizogenesis , proportionally , the occurrence of stratified squamous epithelium ( 2.7% ) was less than expected and that of enamel reduced epithelium ( 78.4% ) greater than what was to be expected , namely 14.3% and 62.9% , respectively . at stage 9
the presence of squamous epithelium ( 28.1% ) was more frequent than expected and that of reduced epithelium ( 40.6% ) less frequent than expected .
these data prove that the transformation of the reduced epithelium into squamous epithelium with maturation of the follicle and consequently with increasing age was statistically significant ( p = 0.017 ) .
these findings corroborate those of daley and wysocki 11 , who state that the normal follicle may be lined by squamous epithelium and that a dentigerous cyst probably develops when the reduced epithelium is still present , which is at variance with glosser and campbell 12 and curran et al .
13 , who argue that any follicle with squamous epithelium should be regarded as a dentigerous cyst .
according to slater 14 , the presence of squamous epithelium can not be diagnosed as a dentigerous cyst , but rather as follicular tissue with squamous differentiation . on the basis of these criteria ,
the use of immunohistochemistry in the study of follicles has led to greater discussion of this controversial question , since adelsperger et al .
15 demonstrated an association between squamous differentiation and proliferative activity in the majority of cases .
the authors disagree with the view that squamous metaplasia is a normal change that takes place during the maturation of the follicle and state that it represents an early pathosis , a stance supported by the proliferating cell nuclear antigen ( pcna ) . in the correlation between the type of lining epithelium and the width of the radiographic pericoronal space
, there was no statistically significant difference ( p = 0.353 ) ; it was , however , noted that the pericoronal space was observed even in most of the follicles with no epithelium .
the predominant widths were 0 to 1 mm ( 20.7% ) and 3 to 4 mm ( 77.8% ) in the stratified squamous epithelium and reduced epithelium , respectively .
these results were totally different to those of damante and fleury 16 , who found a statistically significant association between the presence of stratified squamous epithelium and an enlarged pericoronal space . in the correlation between the cellular activity of the lining epithelium and the stage of rhizogenesis
, there was no statistical significance ( p = 0.702 ) ; at stage 9 , however , proportionally , there was a tendency for cellular activity to be absent ( 31.3% ) , compared with what was expected ( 22.9% ) , which may be due to the maturation of the follicles . in the correlation between cellular activity of the epithelium and width of the pericoronal space
, there was no statistical significance ( p = 0.825 ) , but there was a tendency for the width to be less than 3 mm in the hyperplastic epithelium ( figures 3 , 4 ) , a result at variance with what had been expected . in the correlation between the type of connective tissue and the stage of rhizogenesis , there was no statistical significance ( p = 0.212 ) ; at stage 8 , however , dense connective tissue ( 57.7% ) tended to occur less frequently and loose tissue ( 42.3% ) more frequently than expected , namely 72.4% and 27.6% , respectively . at stage 7 , dense connective tissue ( 81.1% ) occurred more frequently and loose tissue ( 18.9% ) less frequently , differently from the results expected . in the correlation between the type of connective tissue and the width of the pericoronal space , there was no statistical significance ( p = 0.364 ) . in the correlation between inflammation in the connective tissue and stage of rhizogenesis
there was no statistical difference ( p = 0.104 ) , but no follicle exhibited inflammation at stage 6 . at stage 9
, there was a greater occurrence of chronic inflammation ( 31.3% ) and the absence of inflammation ( 68.8% ) was less frequent than expected , namely 20.0% and 80.0% , respectively , showing clearly that the earlier the rhizogenesis and the more intra - osseous the tooth , the less the inflammation .
the presence of inflammation increased with the progression of the rhizogenesis , and this may be due to the physiology of eruption or proximity to the oral environment 16 . in the correlation between inflammation of the connective tissue and width of the pericoronal space , there was no statistical significance ( p = 0.439 ) , but there was a tendency for the absence of inflammation up to 1.0 mm , the presence of chronic inflammation from 1.5 mm to 2.5 mm and the absence of inflammation between 3.0 mm and 4.0 mm .
these results are at variance with those of damante and fleury 16 , who found an association between inflammation and an enlargement of the pericoronal space despite the lack of statistical significance .
it was also observed that in 4.8% of the follicles the following changes occurred that deviated from the pattern of normality : proliferative sheets and layers of epithelium ; islands of epithelium in the connective tissue with squamous metaplasia ; islands of epithelium with squamous metaplasia and an area suggestive of cystic degeneration ; islands with an ameloblastomatoid feature ; and an island suggestive of cystic degeneration .
costa filho 17 identified remnants of epithelium in the connective tissue in 98% of the specimens evaluated , only 2% of which had proliferative cellular activity .
kim and ellis 3 found traces of epithelium in the connective tissue in 79% of the cases studied and foci of squamous metaplasia in the remnants of epithelium in 4% of the sample .
the presence of islands with an ameloblastomatoid feature was reported in dentigerous cysts by garrocho et al .
patients with such changes should be followed up radiographically , hence the importance of the histopathology examination of the pericoronal follicles .
in addition to the evaluation of statistical data , clinical experience is of fundamental importance in the management of asymptomatic unerupted third molars in relation to whether or not they need to be removed .
even though , statistically , most studies suggest that the possibility of pathological changes is only a small one , it does exist .
assael 19 reported his personal analysis of the elective removal of impacted teeth based on the articles of curran et al .
the study by curran et al . served to show that the early removal of impacted teeth is usually desirable and that their preservation requires long - term follow - up . with regard to the studies of kugelberg and kugelberg et al . , assael concluded that , owing to the risk of bone loss and slower healing , in patients over the age of 25 years impacted teeth should be removed only if they exhibit clinical or radiographic signs of a pathosis .
evaluating the work of rood ; shehab , he observed that teeth with completely formed roots have a greater potential for causing an injury to the inferior alveolar nerve and should be removed prior to the closure of the apex .
he concluded that an indication for the prophylactic removal of impacted teeth is based in part on the significant risk of destructive pathoses associated with the follicular tissues .
as yet it does not seem possible to confidently determine which unerupted third molars , whether radiographically normal or not , but with histological evidence of cyst formation or another pathosis , may turn into clinically detectable lesions .
further studies are thus required with a view to calculating the risks involved when a decision is taken not to remove an asymptomatic unerupted third molar . on the basis of the results obtained and the methodology employed ,
it is concluded that there was an association between the progression of rhizogenesis and the transformation of the enamel reduced epithelium into stratified squamous epithelium , which was regarded as a normal finding .
there were no clinically significant association between the radiographic and morphological findings ; accordingly , all asymptomatic unerupted third molars should be submitted to radiographic follow - up and any follicle obtained from such teeth should be sent for a histopathology investigation .
Output:
| the objective of this study was to determine the correlation of the radiographic and morphological features of the dental follicle of unerupted third molars with incomplete root formation .
a cross - sectional study was carried out with 56 patients ( 105 teeth ) aged 13 to 24 years .
panoramic radiography was used to determine the stage of root formation to locate and measure pericoronal radiolucency .
the width of the dental follicle ranged from 0.0 to 4.0 mm , the distal face being the one most frequently involved , and stage 7 of root formation showing the highest incidence .
an inactive enamel reduced epithelium and inactive epithelium remnant also showed a high incidence .
dense connective tissue showed a high incidence , chronic inflammation was infrequent and calcification was a common finding .
there was a significant association between the progression of the rhizogenesis and the transformation of the enamel reduced epithelium into a stratified squamous epithelium .
no significant association was found between rhizogenesis and the other morphological findings or between the latter and the width of the pericoronal space .
it was concluded that there was no clinically significant correlation between the radiographic and morphological features .
every asymptomatic unerupted third molar should be followed up and the follicular tissue analyzed . |
PubmedSumm7852 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: selecting new targets for developing antidiabetic drugs for type 2 diabetes mellitus ( t2 dm ) is best guided by considerations of established physiological chemistry of glucose homeostasis and of prevailing views about t2 dm pathophysiology because the disease genetics that could serve as another guiding principle remain prohibitively perplexing .
the glucose - phosphorylating enzyme glucokinase ( gk ) ( also called hexokinase iv or d ) was identified as an outstanding drug target for developing antidiabetic medicines because it has an exceptionally high impact on glucose homeostasis , serving as a glucose sensor of the pancreatic beta cell and as a rate - controlling enzyme for hepatic glucose clearance and glycogen synthesis , both processes that are impaired in t2 dm . in the mid-1990s ,
high - throughput screening of 120,000 small molecules of the roche ( basel , switzerland ) compound library , using a screening assay based on measuring the effect on recombinant gk inhibited by gk regulatory protein ( gkrp ) , identified a lead molecule that stimulated gk directly but also blocked gkrp inhibition of the enzyme .
the optimization effort of this newly discovered gk activator ( gka ) molecule resulted in the discovery of more potent , preclinically effective , and apparently safe compounds and culminated in the development of piragliatin ( figure 1 ) , which was advanced to phase ii human trials but then shelved for undisclosed reasons [ 2 - 6 ] .
the first 2003 report in science on the development and successful preclinical use of gkas was soon followed by the issuance of more than 100 patents for gkas of different chemical structure , demonstrating the keen interest of the pharmaceutical industry in this new class of antidiabetics [ 7 - 10 ] .
the report led to the publication of a flood of studies in animal models and the first human trials , contributing significantly to the proof of principle for gka use as a novel treatment for this disease [ 1,3,7 - 10 ] .
chemical structures of glucokinase activators used in extensive preclinical studies using ( a ) ro-0274375 - 000 ( cpd a ) or ( b ) ro-0281675 - 000 ( cpd r ) and short - term phase ii trials in type 2 diabetes mellitus with ( c ) ro-4389620 - 000 ( piragliatin ) [ 1 - 6,8 - 10 ] .
to comprehend the mechanism of action of gkas and the rationale of using them for treating diabetics , the role of gk at the molecular , cellular , organ , and whole - body levels has to be understood .
its glucose s0.5 ( i.e. , the half - saturation concentration ) is about 7.0 mm , and the co - substrate mgatp saturates physiologically ( km = 0.4 mm ) .
the enzyme shows sigmoidal glucose dependency ( has a hill number of 1.7 ) and thus is most sensitive to glucose change in the 4.0-mm range .
the crystal structure of gk has been solved , both as a ligand - free apoenzyme in a super - open conformation and as a ternary complex with one d - glucose and a gka bound in a
there is strong evidence that the transition between super - open and closed forms is slow compared with the rate of the catalytic cycle , and this evidence is used to explain the physiologically important cooperativity with regard to glucose .
cellular expression of gk is governed by a single gene with two promoters , one of these operating constitutively in gk - containing glucose - sensing endocrine cells ( most importantly , in the pancreatic beta cell ) and in neurons , and the other controlling hepatic gk expression tightly regulated by insulin .
gk thus governs the beta - cell threshold for glucose - stimulated insulin release ( gsir ) .
it accomplishes this by operating in tandem with the adenine nucleotide - sensitive k - channel / sur1 ( sulfonylurea receptor-1 ) complex and l - type ca - channels .
alterations of any one of the three beta - cell components influence the threshold for gsir profoundly .
the rate of glucose metabolism as determined by blood glucose levels and the beta - cell gk content is coupled to the two channels : directly by the atp / adp ratio to the k - channels and indirectly by the membrane potential to the ca - channels .
high glucose increases gk expression in beta - cells as much as 5- to 10-fold , in a concentration - dependent manner , and thus sensitizes them to glucose stimulation of insulin biosynthesis and release . in excess of 99% of the bodies gk protein
resides in the liver , explaining its critical role postprandially in the high - capacity clearance of glucose from the blood stream coupled with enhanced glycogen synthesis and glucose catabolism . in hepatocytes ,
gk is subtly regulated by gkrp , a 68-kda primarily nuclear protein that inactivates and facilitates the sequestration of gk in the nucleus when glucose levels are low .
high glucose and fructose-1-p ( a metabolite of dietary fructose ) dissociate the gk / gkrp complex , which results in reactivation and relocation of gk to the cytosol .
hepatic gk regulates glycogen metabolism , glycolysis , the pentose - p shunt , glucose oxidation , and associated oxidative phosphorylation and atp production .
the predominant role of this core control system based on beta - cell and hepatic gk is probably complemented in ways to be explored by the function of other gk - containing cells in the hypothalamus , the brain stem , the portal vein , entero - endocrine k and l cells , pancreatic islet alpha cells as well as gonadotropes and thyrotropes ( figure 3 ) . a critical cutout of the gk structure is presented to show the conformational change induced by glucose allowing gka to bind .
note the marked rearrangement of known contact amino acids in the drug receptor region of the enzyme .
expression of gk in the pancreatic islet alpha and beta cells , other endocrine cells ( including pituitary cells ) , and cells in the portal vascular tree and central nervous system ( including the hypothalamus and brain stem ) makes up about 0.1% of the body s total gk complement .
the pancreatic islet cells and the liver constitute the basic gk - dependent regulatory system maintaining glucose homeostasis .
ans , autonomic nervous system ; gka , glucokinase activator . modified from matschinsky , nat rev drug discov 2009 .
a drug receptor is therapeutically useful only if it is not significantly impaired or deleted by the disease to be treated .
the evidence is strong that beta - cell gk is functional in t2 dm , although total gk is probably diminished because beta - cell mass and function are reduced as the disease progresses .
the known right shift and the blunting of the dose - dependency curve of gsir in t2 dm are probably the result of multiple yet - to - be - defined defects of the signaling chains controlling gsir and insulin biosynthesis , including perhaps the cellular content or activity of gk ( or both ) .
hepatic gk expression is insulin - controlled and may be greatly reduced in severe forms of t2 dm as demonstrated in human and animal models of the disease with severe insulin deficiency .
still , whatever gk remains available or is newly induced by gka - stimulated insulin release is probably responsive to activation by gkas .
nothing is known about the status of gk in other cells expressing the enzyme but it is speculated that constitutive expression of gk might be unaltered by the disease . on theoretical grounds , pharmacological activation of gk
is expected to have a high potential for the treatment of t2 dm and perhaps also t1 dm .
gkas are , in general , small molecules with a considerable variety of chemical structures ( selected examples in figure 1 ) that mostly adhere to a common pharmacophore model with related structural motifs [ 1,3,7 - 10,12 ] .
the model consists of a center of a carbon or an aromatic ring with three attachments to it .
two of these are hydrophobic , and at least one of the two is aromatic .
the third attachment is a 2-aminoheterocycle or n - acyl urea moiety that provides the basis of forming an electron donor / acceptor interaction with r63 of gk .
at least a dozen other amino acids have been shown to be involved in gka binding : v62 , r63 , s64 , t65 , g68 , s69 , g72 , v91 , w99 , m210 , i211 , y214 , y215 , m235 , v452 , v455 , and k459 .
it is noteworthy that mutations of many of these lead to activation of gk and cause hyperinsulinemic hypoglycemia .
gkas increase the affinity of recombinant gk for glucose by as much as 10-fold and may also augment the vmax ( maximum velocity ) moderately , perhaps as much as twofold .
the affinity for mgatp is increased when tested at glucose levels below the glucose s0.5 .
some gkas lower the hill coefficient such that they render the enzyme more hexokinase - like .
the potency of known gkas varies considerably , with dissociation constant values ranging from low nanomolars to low micromolars .
little is known about gka effects on the known interaction of gk with cellular organelles ( e.g. , mitochondria or insulin granules ) or other macromolecules besides gkrp ( e.g. , the pro - apoptotic bad [ bcl-2-associated death promoter ] protein or the bifunctional enzyme that generates and hydrolyzes fructose-2,6-bisphospate ) .
impaired formation of a gk / bad complex proposed to associate with mitochondria and to enhance glucose oxidation may be significant for the molecular pathogenesis of the functional beta - cell defect and apoptotic beta - cell loss known to cause t2 dm .
it is tempting to hypothesize that gkas might remedy this defect . indeed , as reported at the 2009 international diabetes federation meeting in montreal ( matschinsky et al .
, unpublished data ) , studies from our laboratory have demonstrated a marked reduction of glucose - induced respiration in islets isolated from t2 dm organ donors and showed that this metabolic defect was partially or fully remedied in acute studies using the hoffmann - la roche gka piragliatin .
therefore , it is not unreasonable to explore whether gkas are anti - apoptotic in gk - containing cells . as we showed in these studies with islets of langerhans isolated from the pancreas of rodents or of normal and diabetic human tissue donors , gkas potentiate glucose stimulation of insulin release and enhance the permissive action of glucose for other physiological stimuli , including amino acids , fatty acids , acetylcholine , and glp-1 ( glucagon - like peptide-1 ) .
studies with isolated rat hepatocytes demonstrated that gkas stimulate glycolysis and glycogen synthesis and effectively dissociate the nuclear gk / gkrp complex , thus activating glucose phosphorylation .
in intact control animals and a wide variety of animal models of t2 dm , gkas uniformly lowered blood glucose and stimulated insulin release [ 1 - 3,7 - 10 ] .
they also curbed hepatic glucose production in normal and diabetic rats . in a long - term study with c57black6j mice ,
gkas prevented the development of diet - induced diabetes with little effect on the weight gain of the animals .
results of human trials with normal or diabetic patients showed that gkas reduced blood glucose dose - dependently and increased insulin secretion .
the blood glucose - lowering potential of gkas in t2 dm is compellingly illustrated by results of trials with piragliatin from roche in a 5.5-day multiple ascending dose study and a 1-day single ascending dose study with arry403 from array biopharma ( boulder , co , usa ) .
to comprehend the mechanism of action of gkas and the rationale of using them for treating diabetics , the role of gk at the molecular , cellular , organ , and whole - body levels has to be understood .
its glucose s0.5 ( i.e. , the half - saturation concentration ) is about 7.0 mm , and the co - substrate mgatp saturates physiologically ( km = 0.4 mm ) .
the enzyme shows sigmoidal glucose dependency ( has a hill number of 1.7 ) and thus is most sensitive to glucose change in the 4.0-mm range .
the crystal structure of gk has been solved , both as a ligand - free apoenzyme in a super - open conformation and as a ternary complex with one d - glucose and a gka bound in a
there is strong evidence that the transition between super - open and closed forms is slow compared with the rate of the catalytic cycle , and this evidence is used to explain the physiologically important cooperativity with regard to glucose .
cellular expression of gk is governed by a single gene with two promoters , one of these operating constitutively in gk - containing glucose - sensing endocrine cells ( most importantly , in the pancreatic beta cell ) and in neurons , and the other controlling hepatic gk expression tightly regulated by insulin .
gk thus governs the beta - cell threshold for glucose - stimulated insulin release ( gsir ) .
it accomplishes this by operating in tandem with the adenine nucleotide - sensitive k - channel / sur1 ( sulfonylurea receptor-1 ) complex and l - type ca - channels .
alterations of any one of the three beta - cell components influence the threshold for gsir profoundly .
the rate of glucose metabolism as determined by blood glucose levels and the beta - cell gk content is coupled to the two channels : directly by the atp / adp ratio to the k - channels and indirectly by the membrane potential to the ca - channels .
high glucose increases gk expression in beta - cells as much as 5- to 10-fold , in a concentration - dependent manner , and thus sensitizes them to glucose stimulation of insulin biosynthesis and release . in excess of 99% of the bodies gk protein
resides in the liver , explaining its critical role postprandially in the high - capacity clearance of glucose from the blood stream coupled with enhanced glycogen synthesis and glucose catabolism . in hepatocytes ,
gk is subtly regulated by gkrp , a 68-kda primarily nuclear protein that inactivates and facilitates the sequestration of gk in the nucleus when glucose levels are low .
high glucose and fructose-1-p ( a metabolite of dietary fructose ) dissociate the gk / gkrp complex , which results in reactivation and relocation of gk to the cytosol .
hepatic gk regulates glycogen metabolism , glycolysis , the pentose - p shunt , glucose oxidation , and associated oxidative phosphorylation and atp production .
the predominant role of this core control system based on beta - cell and hepatic gk is probably complemented in ways to be explored by the function of other gk - containing cells in the hypothalamus , the brain stem , the portal vein , entero - endocrine k and l cells , pancreatic islet alpha cells as well as gonadotropes and thyrotropes ( figure 3 ) . a critical cutout of the gk structure is presented to show the conformational change induced by glucose allowing gka to bind .
note the marked rearrangement of known contact amino acids in the drug receptor region of the enzyme .
expression of gk in the pancreatic islet alpha and beta cells , other endocrine cells ( including pituitary cells ) , and cells in the portal vascular tree and central nervous system ( including the hypothalamus and brain stem ) makes up about 0.1% of the body s total gk complement .
the pancreatic islet cells and the liver constitute the basic gk - dependent regulatory system maintaining glucose homeostasis .
a drug receptor is therapeutically useful only if it is not significantly impaired or deleted by the disease to be treated .
the evidence is strong that beta - cell gk is functional in t2 dm , although total gk is probably diminished because beta - cell mass and function are reduced as the disease progresses .
the known right shift and the blunting of the dose - dependency curve of gsir in t2 dm are probably the result of multiple yet - to - be - defined defects of the signaling chains controlling gsir and insulin biosynthesis , including perhaps the cellular content or activity of gk ( or both ) .
hepatic gk expression is insulin - controlled and may be greatly reduced in severe forms of t2 dm as demonstrated in human and animal models of the disease with severe insulin deficiency .
still , whatever gk remains available or is newly induced by gka - stimulated insulin release is probably responsive to activation by gkas .
nothing is known about the status of gk in other cells expressing the enzyme but it is speculated that constitutive expression of gk might be unaltered by the disease .
on theoretical grounds , pharmacological activation of gk is expected to have a high potential for the treatment of t2 dm and perhaps also t1 dm .
gkas are , in general , small molecules with a considerable variety of chemical structures ( selected examples in figure 1 ) that mostly adhere to a common pharmacophore model with related structural motifs [ 1,3,7 - 10,12 ] .
the model consists of a center of a carbon or an aromatic ring with three attachments to it .
two of these are hydrophobic , and at least one of the two is aromatic .
the third attachment is a 2-aminoheterocycle or n - acyl urea moiety that provides the basis of forming an electron donor / acceptor interaction with r63 of gk .
at least a dozen other amino acids have been shown to be involved in gka binding : v62 , r63 , s64 , t65 , g68 , s69 , g72 , v91 , w99 , m210 , i211 , y214 , y215 , m235 , v452 , v455 , and k459 .
it is noteworthy that mutations of many of these lead to activation of gk and cause hyperinsulinemic hypoglycemia .
gkas increase the affinity of recombinant gk for glucose by as much as 10-fold and may also augment the vmax ( maximum velocity ) moderately , perhaps as much as twofold .
the affinity for mgatp is increased when tested at glucose levels below the glucose s0.5 .
some gkas lower the hill coefficient such that they render the enzyme more hexokinase - like .
the potency of known gkas varies considerably , with dissociation constant values ranging from low nanomolars to low micromolars .
little is known about gka effects on the known interaction of gk with cellular organelles ( e.g. , mitochondria or insulin granules ) or other macromolecules besides gkrp ( e.g. , the pro - apoptotic bad [ bcl-2-associated death promoter ] protein or the bifunctional enzyme that generates and hydrolyzes fructose-2,6-bisphospate ) .
impaired formation of a gk / bad complex proposed to associate with mitochondria and to enhance glucose oxidation may be significant for the molecular pathogenesis of the functional beta - cell defect and apoptotic beta - cell loss known to cause t2 dm .
it is tempting to hypothesize that gkas might remedy this defect . indeed , as reported at the 2009 international diabetes federation meeting in montreal ( matschinsky et al .
, unpublished data ) , studies from our laboratory have demonstrated a marked reduction of glucose - induced respiration in islets isolated from t2 dm organ donors and showed that this metabolic defect was partially or fully remedied in acute studies using the hoffmann - la roche gka piragliatin .
therefore , it is not unreasonable to explore whether gkas are anti - apoptotic in gk - containing cells . as we showed in these studies with islets of langerhans isolated from the pancreas of rodents or of normal and diabetic human tissue donors , gkas potentiate glucose stimulation of insulin release and
enhance the permissive action of glucose for other physiological stimuli , including amino acids , fatty acids , acetylcholine , and glp-1 ( glucagon - like peptide-1 ) .
studies with isolated rat hepatocytes demonstrated that gkas stimulate glycolysis and glycogen synthesis and effectively dissociate the nuclear gk / gkrp complex , thus activating glucose phosphorylation . in intact control animals and a wide variety of animal models of t2 dm , gkas uniformly lowered blood glucose and stimulated insulin release [ 1 - 3,7 - 10 ] .
they also curbed hepatic glucose production in normal and diabetic rats . in a long - term study with c57black6j mice ,
gkas prevented the development of diet - induced diabetes with little effect on the weight gain of the animals .
results of human trials with normal or diabetic patients showed that gkas reduced blood glucose dose - dependently and increased insulin secretion .
the blood glucose - lowering potential of gkas in t2 dm is compellingly illustrated by results of trials with piragliatin from roche in a 5.5-day multiple ascending dose study and a 1-day single ascending dose study with arry403 from array biopharma ( boulder , co , usa ) .
the published results of treating t2 dm patients with gkas for periods of up to 1 week demonstrate that these agents lower blood glucose effectively in a dose - dependent manner without medically significant side actions except ( not surprisingly ) moderate hypoglycemia at the higher doses .
thus , intensive research and development have produced a class of powerful antidiabetic drugs with a new mechanism of action , contrasting it to all other available pharmacotherapies , including insulin .
it remains to be seen whether this novel class of drug withstands the test of time and secures for itself a significant place among approved antidiabetic medicines .
the massive current effort of at least 15 pharmaceutical companies to develop gkas shows that expectations for success in this endeavor are high . of remaining concern are the dangers of hypoglycemia , fatty liver , and hyperlipidemia .
available results of preclinical and clinical studies are , however , reassuring in this regard and it is reasonable to argue that such potential side effects can be managed by designing gkas , which are less potent than the currently known prototypes , or by judicious dose regimens .
all indications are that several gkas now in development will be advanced to phase ii and iii trials [ 1 - 10 ] . beyond their potential medical significance , gkas will also prove highly useful as an experimental tool in studies of the gk molecule and of glucose homeostasis in health and disease ( figure 3 ) .
Output:
| the glucose - phosphorylating enzyme glucokinase , a promising target for developing new antidiabetic agents , was identified through the combined efforts of basic research and human biochemical genetics .
allosteric glucokinase activators ( gkas ) were discovered by high - throughput screening of a large compound library and first reported in 2003 .
gkas stimulate insulin release and glucose metabolism in the liver thereby lowering blood sugar , and promising trials in humans demonstrate that they are highly effective in patients with type 2 diabetes mellitus .
many companies are now attempting to develop effective and safe gkas for treating diabetics . |
PubmedSumm7853 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the quest of humans to conquer pain by investigating the underlying cause is a challenging and ongoing process . according to the international association for the study of pain , the definition of pain as an unpleasant sensory and emotional experience associated with actual or potential tissue damage , or described in terms of such damage indicates the subjective nature of pain.1 it is the most common complaint for which patients seek medical attention , lose productivity , and incur health care costs.2 the epidemic status of pain across the globe is highlighted by a recent study which showed that nearly 37.3% and 41.1% of the adult population in the developed and developing countries , respectively , experience chronic pain due to diseases or disorders or injuries.3 pain is characterized by both physical and psychological symptoms .
based on clinical characteristics , pain can be classified as nociceptive , neuropathic , or psychogenic / idiopathic.2,46 the mechanical , chemical , or thermal stimulation of peripheral sensory nerves due to surgery or trauma in a well localized area is described as nociceptive pain , whereas neuropathic pain is defined as an abnormal signaling resulting from injury or dysfunction of the peripheral or central nervous system ( cns ) leading to pain .
in addition , the latter is less localized and can persist in the absence of visible injury or inflammation.711 pain perception / assessment in patients with personality disorders , mood disorders , or substance abuse indicates the influence of psychiatric disorders on pain etiology.12,13 traditional pain - management therapies involve analgesics such as acetaminophen and aspirin , nonsteroidal anti - inflammatory drugs ( nsaids ) such as ibuprofen and indomethacin , and narcotics such as morphine.14,15 however , there is a growing concern on the risks of overdose , abuse , and addiction potential of these agents .
for example , in the united states alone , about 30,000 hospitalizations are attributed to acetaminophen overdose , whereas nsaid therapy is associated with fatal gastrointestinal bleeding and potential cardiovascular risks.1618 in addition , narcotic analgesic abuse and addiction is a serious concern.19 these facts mandate the need to look beyond traditional pain targets such as cyclooxygenases and opioid receptors .
the complexity in understanding the pain mechanisms listed in figure 1 will go a long way in developing new therapies .
current research efforts are ongoing to discover agents with superior efficacy and safety profiles that target novel pathological routes as pain therapeutics ( figure 1 ) .
emerging pain targets include cannabinoid ( cb ) receptors , fatty acid amide hydrolase ( faah ) , voltage- and ligand - gated ion channels ( sodium channels , t - type calcium channels , n - type calcium channels , p2 receptors , transient receptor potential [ trp ] channels ) , peptide receptor antagonists , nerve growth factor ( ngf ) , and glial cell modulators .
this review describes recent developments in the discovery of cb2 agonists , trp vanilloid-1 ( trpv1 ) channel antagonists , p2 receptor antagonists , and agents that target activated glia .
the cb receptors are part of the endocannabinoid system and are g - protein coupled receptors .
their role in the modulation of pain and inflammation is well documented.2022 mammalian tissues express two types of cb receptors : cb1 and cb2 respectively .
cb1 receptors are primarily expressed in the cns , whereas cb2 receptors are primarily located in the periphery such as immune cells , spleen , and tonsils.23 in this regard , a number of cb receptor agonists were reported .
the classic cbs , tetrahydrocannabinol ( -thc , marinol , solvay pharmaceuticals , ixelles , brussels , belgium ) ( figure 2 , compound ( 1 ) ) and dimethylheptyl tetrahydrocannabinol ( hu-210 ) ( figure 2 , compound ( 2 ) ) based on a tricyclic terpenoid template are nonselective cb agonists with hu-210 exhibiting a greater degree of binding affinity toward cb receptors ( figure 2 ) .
the major drawback of classical cb therapy in pain management is the impairment of cognitive / motor function and altered psychological state.24,25 compound cp-55,940 ( figure 2 , compound ( 3 ) ) , a nonclassical cb was developed based on the chemical structure of -thc and played a major role in the discovery of the cb1 receptor.26 consequently , the development of an aminoalkyl indole - based small molecule such as win55212 ( figure 2 , compound ( 4 ) ) provided some degree of cb2 selectivity.27 eicosanoids such as anandamide22,28 represent endogenous cbs that exhibit greater affinity toward cb1 than cb2 . since centrally acting cb1 receptor agonists
are known to produce cns side effects such as dizziness and cognitive impairment , current focus is to develop cb2 receptor agonists that could produce minimal cns side effects and to target cb1 receptors at the periphery.22,29,30 a number of small - molecule cb2 receptor agonists have been developed in the past decade as potential agents to treat nociceptive , inflammatory , and neuropathic pain .
some studies suggest that cb2 agonists could act on immune cells and prevent the associated inflammatory response .
a recent investigation by hsieh and coworkers shows that the dorsal root ganglia and spinal cord regions are the potential sites of cb2-receptor - mediated analgesia.31 in this regard , one of the early cb2-receptor agonists hu-308 ( figure 3 , compound ( 5 ) , a bicyclic derivative ) exhibited high cb2 selectivity ( cb2 inhibition constant [ ki ] = 23 nm ) and significant pain relief in the formalin model.32 a wide range of small molecules with diverse ring templates have been developed as cb2-selective agonists ( figures 3 , 4 , and 5 ) . in this regard , several aminoalkyl indole - based derivatives exhibit superior cb2 receptor binding and selectivity.3336 for example , am1241 ( figure 3 , compound ( 6 ) ) is a highly selective cb2-agonist ( cb2 ki = 3.4 nm ; cb1 ki = 280 nm ) that exhibits in vivo peripheral analgesia in inflammatory and neuropathic pain models without exhibiting cns side effects .
furthermore , the aminoalkyl indole ( figure 3 , compound ( 7 ) ) was a highly selective cb2 receptor agonist ( cb2 ki = 1.9 nm ; cb1 ki > 10,000 nm ; cb1/cb2 selectivity > 5263 ) . in another study , cheng and
coworkers developed a novel series of n - arylamide oxadiazoles where they identified an amide - linked quinolone derivative ( figure 4 , compound ( 8) ) as a potent and selective cb2 agonist ( cb2 half - maximal effective concentration [ ec50 ] = 2.2 nm ) with excellent oral bioavailability profile in rats.37 in an elegant study , a research team from glaxosmithkline discovered compound gw842166x ( figure 4 , compound ( 9 ) ) based on a pyrimidinecarboxamide template as a clinical candidate to treat inflammatory pain .
compound gw842166x was a selective cb2 receptor agonist ( cb2 ec50 = 63 nm ; cb1ec50 > 30 m ) and exhibited potent oral activity ( ed50 [ half - maximal effective dose ] = 0.1 mg / kg ) in animal models of inflammatory pain .
further lead optimization provided the 5-azaindole ( figure 4 , compound ( 10 ) ) with superior cb2 binding affinity ( cb2ec50 = 5 nm ) and efficacy in both acute and chronic pain models.38,39 another study showed that 4-oxo-1,4-dihydropyridines could serve as useful templates to develop selective cb2 receptor ligands .
the phenyl - substituted dihydropyridine ( figure 4 , compound ( 11 ) ) exhibited excellent cb2-binding affinity and was an inverse agonist ( cb2 ki = 4.0 nm ; cb1 ki = 592 nm).40 rapid progress has been made in the development of cb2-selective ligands based on a wide variety of ring templates , and a detailed discussion is beyond the scope of this review.30 the evidence acquired to date , clearly supports targeting cb2 , cb1/cb2 , or cb1 receptors and to develop peripherally restricted
cb ( cb2 selective , dual cb1/cb2 ) agonists that exhibit reduced cns side effects as novel agents in the pharmacotherapy of pain disorders .
the trp channel family belongs to ligand - gated and voltage - dependent ion channels / nociceptors that respond to chemical , mechanical , or thermal noxious stimuli at the periphery .
many are located in the central and peripheral sensory neurons and are potential targets to treat neuropathic pain.4143 the trpv1 channels have been studied extensively and are known to play a critical role in peripheral sensitization of nociceptors and reduce pain threshold when activated by noxious stimuli .
the active ingredient of chili peppers , capsaicin ( figure 5 , compound ( 12 ) ) is a known activator of trpv1 and is effective as a topical agent to treat pain states .
although opioids are used to treat chronic pain , they exhibit serious side effects such as dizziness , sedation , loss of cognitive function , dependency , respiratory depression , development of tolerance , and constipation .
these shortcomings support the need to target novel pathways of pain . in this regard ,
the role of trpv1 in peripheral sensitization contributing to acute and chronic pain dictates the need to develop trpv1 antagonists as potential agents to treat inflammatory and neuropathic pain.4447 one of the early trpv1 antagonists to enter the clinical trial was sb-705498 ( figure 5 , compound ( 13 ) ) based on a pyrrolidine urea that exhibited excellent oral activity in animal models.48 furthermore , amgen reported the discovery of a clinical candidate amg517 ( figure 5 , compound ( 14 ) ) based on a oxopyrimidine ring template .
compound amg517 exhibited excellent trpv1 inhibition ( half - maximal inhibitory concentration [ ic50 ] = 0.9 nm ) ; however , it had a long half - life and low aqueous solubility .
further lead optimization provided compound amg628 ( figure , compound ( 15 ) ) , the piperazinylpyrimidine derivative that exhibited good trpv1 inhibition , in vivo half - life , and aqueous solubility and was considered as a clinical candidate.49,50 recently , abbott laboratories reported the discovery of an orally active clinical candidate ( r)-1-(5-tert - butyl-2,3-dihydro-1-h - inden-1-yl)-3-(1h - indazol-4-yl ) urea ( abt102 , figure 5 , compound ( 16 ) ) to treat chronic pain .
this small molecule exhibited potent trpv1 binding ( trpv1 ic50 = 4 nm ) and was effective in various in vivo pain models such as carrageenan induced postoperative and cancer pain .
in addition , this agent did not exhibit side effects such as sedation and constipation commonly seen with opiate therapy , highlighting the fact that selective targeting of trpv1 should provide agents that lack the adverse side effects of opiates.5153 accordingly , several small - molecule candidates are being developed by the pharmaceutical companies.41,47,54 the representative examples discussed here indicate the enormous potential of targeting trpv1 receptors to treat both acute and chronic pain .
compared with peripherally restricted cb agonists , trpv1 receptor modulators reduce pain by acting on both central and peripheral pain pathways , suggesting their potential to cause cns side effects .
the challenges include recognizing trpv1 gene polymorphism in patients to predict desired therapeutic responses and identify potential side effects such as hyperthermia.46
the neurotransmitter atp ( adenosine-5-triphosphate ) is known to produce pain through activating the purinergic receptors p1 and p2 .
the p1 receptors are known as adenosine receptors , whereas p2 receptors are further divided into p2y ( g - protein coupled receptors ) and p2x ( ligand - gated channels ) .
the p2x receptors are subdivided into seven receptor subtypes ( p2x1 , p2x2 , p2x3 , p2x4 , p2x5 , p2x6 , and p2x7 respectively ) and have attracted widespread attention as potential targets to develop novel pain therapeutics.5558 among the p2x family , p2x7 is known to be present in immune cells such as monocytes , macrophages , mast cells , lymphocytes , and microglia , indicating their role in disorders such as pain , neurodegeneration , and inflammatory conditions.59,60 in this regard , novel p2x7 receptor antagonists are being developed as clinical candidates to treat acute and chronic pain.61 scientists at abbott laboratories reported the development of some distinct small molecules as p2x7 receptor antagonists . in this regard ,
the 1-benzyl-5-phenyltetrazoles ( figure 6 , compound ( 17 ) ) exhibited potent p2x7 inhibition and were effective in a neuropathic pain model .
in another study , a series of n-acyl hydrazides was reported as a novel series of p2x7 receptor antagonists with in vivo activity .
compound ( 18 ) shown in figure 6 was identified as a potent p2x7 receptor antagonist .
further studies led to the development of a novel series of cyanoguanidines with potent p2x7 inhibition , and compound ( 19 ) ( figure 6 ) was effective in a neuropathic pain model.6264 in addition , researchers from astrazeneca reported the development of adamantine - based small molecules ( eg , compound ( 20 ) shown in figure 6 ) as p2x7 receptor antagonists with ability to prevent the formation of the pro - inflammatory cytokine interleukin-1.65 a detailed description of several small - molecule p2x receptor modulators has been reviewed elsewhere.61,66
recent studies have focused on the role of non - neuronal cells such as astrocytes and glia or glial cells in pain pathophysiology . under pathological conditions ,
glial cells get activated and are known to release pro - inflammatory cytokines , chemokines , and other signaling molecules that contribute to neuropathic pain.6769 some strategies include blocking glial cell activation , prevent the biosynthesis of pro - inflammatory cytokines , block the action of pro - inflammatory cytokines , and disrupt their signaling . in this regard , the tetra - cycline antibiotic minocycline ( figure 7 , compound ( 21 ) ) is known to selectively target microglia and could suppress the release of pro - inflammatory cytokines , whereas the xanthine derivative pentoxyfylline ( trental , aventis , strasbourg , france ) ( figure 7 , compound ( 22 ) ) currently used to treat chronic occlusive arterial disease and av411 ( ketas , senju pharmaceutical co , osaka , japan ) are known to inhibit pro - inflammatory cytokine biosynthesis .
these small molecules are able to cross the blood brain barrier , indicating their potential to target neuropathic pain .
in contrast , biological molecules such as etanercept ( enbrel , amgen , thousand oaks , ca ) and the interleukin-1 antagonist anakinra ( kineret , amgen ) are known to exhibit efficacy in neuropathic animal models , suggesting their ability to block glial cell mediated cytokine signaling.68 however , these agents are injectables that exhibit poor cns penetration . in the last decade ,
glial cells have emerged as attractive targets to prevent chronic pain.70,71 in this regard , the neuroprotective nature of glial cells during tissue injury suggests a careful approach toward developing novel glial cell modulators .
the molecular mechanisms of glial cell activation and its consequences is still a work in progress .
the last decade has seen an unprecedented surge in understanding the complexity of pain pathology .
the identification of novel pain targets such as cb receptors , faah , voltage- and ligand - gated ion channels ( sodium channels , t - type calcium channels , p2x receptors , trp channels ) , peptide receptor antagonists , ngf and glial cell modulators to treat nociceptive , inflammatory , and neuropathic pain is highly promising .
preclinical data shows that one can develop peripherally restricted agents such as cb receptor modulators and faah inhibitors that do not exhibit psychotropic effects indicating their superior side - effect profile compared with traditional pain therapies .
the challenge is to prove the efficacy seen in preclinical data of novel agents with clinical evidence
. the benefit - to - risk ratios of novel pain therapies will come under careful scrutiny of regulatory agencies . despite the challenges ahead ,
it is clear that understanding the molecular mechanisms of novel pain targets will go a long way in developing selective or
site specific agents that exhibit efficacy and superior side - effect profile as pain therapeutics .
Output:
| the myriad pain pathophysiology has intrigued and challenged humanity for centuries . in this regard ,
the traditional pain therapies such as opioids and nonsteroidal anti - inflammatory drugs have been highly successful in treating acute and chronic pain .
however , their drawback includes adverse events such as psychotropic effects , addiction potential , and gastrointestinal toxicities , to mention a few .
these factors combined with the likelihood of an increase in chronic pain conditions due to an aging population calls for the development of novel mechanism - based or
site - specific agents to target novel pain pathways . in this regard , rapid progress has been made in understanding the molecular mechanisms of novel pain targets such as cannabinoid receptors , fatty acid hydrolase , voltage - gated and ligand - gated ion channels such as p2 receptors , transient receptor potential channels and glial cell modulators .
accordingly , preclinical studies indicate that the site - specific / selective agents exhibit sufficient efficacy and reduced side effects such as lack of psychotropic effects indicating their clinical potential . this review provides a brief summary of some at - site
pain targets and their role in the pain pathophysiology , and describes the efforts in developing some small molecules as novel pain therapeutics . |
PubmedSumm7854 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the system response to surgical trauma includes activation of the sympathetic nervous system , the endocrine
stress response , and immunological and hematological changes .various kinds of stress cause an increase in the secretion of acth from the adenohypophysis , and ( within a few minutes ) an increase in secretion of cortisol from the adrenal cortex .
many different , non - specific stimuli can cause a noticeable increase in secretion of cortisol from the adrenal cortex ( e.g. , trauma , surgery , infection , strong heat or cold , and almost any debilitating disease ) . generally , the level and duration of increase in intra - and postoperative concentrations of cortisol are in proportion with the degree of surgical trauma .
the etiology of hyperglycemia in stress is multi - factorial , but is thought primarily to be the result of activation of the sympathoadrenal system , with contributions from the hypothalamus and adenohypophysis .
the stress response triggers an increase in levels of plasma catecholamines and glucocorticoids , which in turn lead to hyperglycemia .
cortisol also has a huge impact on the glucose metabolism in stress , because by increasing glycogenolysis and glucogenesis it can lead to hyperglycemia .
clinical implications of stress response involve hypertension , tachycardia , arrhythmia , myocardial ischemia , protein catabolism , suppression of the immune response , and loss of the excretory renal function with retention of electrolytes and water .
stress response is a significant risk factor for an unsatisfactory outcome in patients with cardiovascular disease , in patients with known endocrine , metabolic and immune disorders , as well as in patients with infection and immunosuppression .
thus , the reduction and modulation of stress response during the operation can significantly reduce the incidence of post - operative complications and morbidity .
the choice of anesthesia technique depends on the surgical disease , the general condition of the patient , the level and extent of the surgical operation , as well as the availability of resources required for anesthesia .
many surgical procedures can be done under spinal anesthesia , which has been used in clinical practice for more than a hundred years .
the advantages of regional anesthesia over general anesthesia are documented in many studies ( e.g. , inhibition of metabolic and hormonal responses to stress , reducing the incidence of post - operative pain , speeding peristalsis after abdominal operations , reducing the incidence of deep vein thrombosis , and shorter hospital stay ) .
the potential lack of regional anesthesia is that its limited duration has an impact on the management of surgery .
the advantages of general anesthesia are its simple and easy method of application , rapid sedation of the patient , and increased comfort of surgeons and anesthesiologists when the surgery has to last longer .
the disadvantages of general anesthesia are poor control of anesthetics ( depends on the individual ability of the organism to degrade and eliminate them ) and postoperative adverse effects ( e.g. , sickness , nausea , vomiting , and pain ) .
the aim of the study was to determine the significance of spinal anesthesia in suppressing the metabolic , hormonal , and hemodynamic response to surgical stress during and after elective operations in abdominal , urological , and orthopedics surgery compared with the technique of general anesthesia . to monitor the metabolic and hormonal responses to stress , we measured the serum cortisol levels and glycemia , which are most easily detectable and are closely correlated with the intensity of stress .
the secondary objective was to investigate the suppression of the adrenergic response by monitoring hemodynamic parameters : systolic and diastolic arterial pressure ( ap ) and heart rate ( hr ) .
the research was conducted at the kosovska mitrovica health center from september 2013 to march 2014 .
the patients were divided into 2 groups , depending on the anesthetic technique . in the spinal anesthesia group
there were 38 patients and in the general anesthesia group were 37 patients undergoing the same surgical procedure .
depending on the performed surgical procedure , patients were classified into several subgroups : general surgery ( herniotomy and thrombosaphenectomy ) , orthopedics ( osteosynthesis ) , and urology ( prostatectomy ) .
the choice of anesthesia technique was made by the anesthesiologist , based on preanesthetic parameters ( clinical examination of the patient , laboratory analysis ) , the type of surgery , and on the patient s preference . to assess the operational risk
, we used a classification adopted by the american society of anesthesiologists ( asa ) .
the study included patients of asa 1 ( patients with no organic pathology or patients in whom the pathological process is localized and does not cause any systemic disturbance or abnormality ; excludes very young and very old patients ) and asa 2 ( patients with no functional limitations , with well - controlled disease of 1 body system )
. the study did not include patients with severe and extreme systemic disorders ( asa 36 ) .
serum cortisol levels were measured using the eleksys 2010 chemiluminescence apparatus and glycemia was measured on the hitachi 902 biochemical analyzer in the laboratory of the kosovska mitrovica health center .
hemodynamic parameters systolic and diastolic ap , heart rate ( hr ) , arterial oxygen saturation ( spo2 ) were monitored in all patients .
serum cortisol levels , glycemia and hemodynamic parameters were measured at the following time points : before induction on anesthesia ( t1 ) , 30 min after the surgical incisions ( t2 ) , 1 h postoperatively ( t3 ) , and 24 h after surgery ( t4 ) .
30 min prior to surgery . in the general anesthesia group , for the induction of anesthesia we used propofol ( 2.5 mg / kg b.w . ) and for endotracheal intubation we used succinyl - choline ( 1.5 mg / kg b.w . ) . to maintain anesthesia , we used propofol boluses with a 2 : 1 nitrous oxide : oxygen ( n2o - to - o2 ) ratio .
analgesia was achieved with fentanyl ( 0.05 mg / kg b.w . ) and muscle relaxation with rocuronium bromide ( 0.6 mg / kg b.w . ) . for the reversal of neuromuscular blockade
, we used 1.5 mg prostigmin and 0.5 mg atropine . in the spinal anesthesia group , we used a 2226 g spinal needle , local anesthetic ( bupivacaine 15 mg 0.5% ) , and opioids ( fentanyl 0.05 mcg ) . for
the analysis of primary data , descriptive statistical methods and hypothesis testing methods were used .
we used the following descriptive statistical methods : measures of central tendency ( arithmetic mean ) , measures of variability ( standard deviation ) , and relative numbers . to test hypotheses about the difference in frequency
the t - test was used for testing hypothesis about difference of arithmetic means between the 2 groups .
anova for repeated measures was used to identify differences between groups in which the data were parametric and normally distributed . to assess correlations between continuous variables ,
there was no statistically significant difference between the spinal and the general anesthesia groups regarding age , duration of surgery , asa categories , and type of surgery .
for comorbidity and the type of surgery , the frequency is shown by category ( table 1 ) .
intraoperatively ( t2 ) , serum cortisol level ( 694.7140.8 vs. 478.791.9 ) increases in both groups , but significantly more in the general anesthesia group .
serum cortisol levels in the general anesthesia group at 1 h after surgery ( t3 ) and 24 h postoperatively ( t4 ) were significantly higher than in the spinal anesthesia group ( figure 1 ) .
glycemia values were statistically significantly increases 30 min after surgical incision ( t2 ) in both groups , but at t3 and t4 glycemia decreased ( figure 2 ) .
there was a statistically significant , positive correlation between serum cortisol levels and glycemia at all times observed . at time
t1 , there was a statistically significant , weak negative correlation between serum cortisol level and systolic ap , and between serum cortisol level and diastolic ap . during the same period
, there was a statistically significant , positive correlation between serum cortisol level and hr . at time t4 there was a statistically significant , weak positive correlation between serum cortisol levels and spo2 ( table 2 ) .
systolic and diastolic ap did not differ significantly between the groups . in the observed period , systolic and diastolic ap
were significantly different , with a significant linear trend of decreasing ap values , but there was no significant difference in the fluctuations at the points of measurement , of the values for systolic and diastolic ap ( figure 3 ) .
the hr was significantly higher in the general anesthesia group compared to the spinal anesthesia group ( p<0.01 ) ( figure 4 ) .
measurements of the parameters at t3 determined that there was no statistically significant correlation between the duration of surgery and serum cortisol levels or between the duration of surgery and glycemia .
measurements of the parameters at t4 determined that there was no statistically significant correlation between the duration of surgery and serum cortisol levels or between the duration of surgery and glycemia ( table 3 ) .
serum cortisol levels are correlated with the intensity , duration , and type of stress that caused them ; therefore , plasma cortisol concentration is the most commonly used marker for perioperative examination of stress induced by surgical trauma .
many studies have examined the effect of different anesthesia techniques on the concentration of serum cortisol levels . in general , the results of previous studies have shown that the choice of anesthesia technique affects intraoperative stress response , and thus significantly affects the outcome and morbidity of surgical patients and the reduction of postoperative pain .
attenuation of the endocrine metabolic response may reduce the frequency of postoperative complications . in our study ,
basal serum cortisol levels , which we measured before the start of surgery , were in the range of reference values .
thirty minutes after surgical incision , there was a significant rise in serum cortisol levels in both groups of patients , but significantly higher in the general anesthesia group .
perioperative serum cortisol levels in the spinal anesthesia group were significantly lower compared to those in the general anesthesia group .
postoperative serum cortisol levels were also significantly lower in the spinal anesthesia group , as previously described .
this difference can be attributed to spinal anesthesia blocking the sensory afferent nerve impulses originating from the surgical trauma .
it is known that blocking the efferent and afferent pathways of the sympathetic and somatic nervous system inhibits activation of the neuroendocrine axis during surgical procedures . in our study , we researched the following procedures : prostatectomy , osteosynthesis , herniotomy , and thrombosaphenectomy .
these types of surgeries are procedures of intermediate severity and can potentially cause an increase in cortisol secretion in response to surgical stimulation . increased levels of stress hormones are considered undesirable because they lead to intraoperative and postoperative metabolic catabolism and to hemodynamic instability .
clinical evidence has shown that spinal anesthesia has an effect in modification of stress response by means of modulation or inhibition of the nociceptive afferent signals from the area of surgical trauma .
the changes include alterations in metabolic , hormonal , inflammatory , and immune systems , which can be collectively termed the stress response .
integral to stress responses are the effects of nociceptive afferent stimuli on systemic and pulmonary vascular resistance , heart rate , and blood pressure , which are a combination of efferent autonomic response and catecholamine release via adrenal medulla .
the magnitude of the response is broadly related to the site of injury ( greater in regions with visceral pain afferents , such as the abdomen and thorax ) and extent of the trauma .
conducted a comparative study in which they compared the effects of general and spinal anesthesia on serum cortisol levels in anorectal surgery .
the results showed that serum cortisol levels were significantly lower in the spinal anesthesia group compared to the general anesthesia group .
davis et al . concluded that unilateral spinal anesthesia more effectively suppresses the metabolic stress response in orthopedic patients undergoing total hip arthroplasty compared with general anesthesia . in our study , we found a suppression of the hyperglycemic response in both groups .
lower glycemia were observed in the spinal anesthesia group at 1 h and 24 h postoperatively .
there was a statistically significant positive correlation between serum cortisol levels and glycemia at all points of measurement , which means that an increase in serum cortisol levels has a direct impact on the increase of glycemia .
surgery - related metabolic and endocrine derangements lead to adverse effects , including increased oxygen consumption , hypertension , tachycardia , arrhythmia , myocardial ischemia , hemodynamic instability , catabolism , and impaired immune function .
these derangements have been associated with poor postoperative course and clinical outcome [ 2224 ] .
anesthesia is performed adequately if the ap and hr do not exceed 20% of the values before induction . in our study
, hemodynamic parameters showed that the suppression of the adrenergic response was adequate in both investigated groups . in the general anesthesia group ,
systolic ap was significantly higher 30 min after the surgical incision , 1 h postoperatively , and 24 h after surgery , but with no substantial oscillation of the values .
the diastolic ap was significantly lower in the spinal anesthesia group 30 min after the surgical incision and 1 h postoperatively , but there were no differences in their dynamics .
the values of hr were significantly higher in the general anesthesia group , but without significant fluctuations at the different points of measurement , which indicates a satisfactory depth of anesthesia .
wolf reported that the sympathetic block induced by regional anesthesia resulted in a profound suppression of hemodynamic and stress response to pediatric surgery .
the systolic and diastolic ap was significantly higher in the general anesthesia group intraoperatively and immediately postoperatively .
however , we noted no significant fluctuations in the dynamics of changes in the studied groups . due to the reduced sensitivity to norepinephrine in patients under stress , despite its elevated levels in plasma , there were no significant changes in ap .
changes in hr during the period did not differ significantly between the groups , although significantly higher values of hr were recorded in the general anesthesia group .
attari et al . conducted a study in which they compared the effects of spinal and general anesthesia on the hemodynamic stability of patients and the need for postoperative analgesia in elective surgery of the lumbar spine .
they concluded that spinal anesthesia is superior in terms of hemodynamic stability and postoperative analgesia compared with general anesthesia .
concluded that the vast majority of patients who have undergone both general and local anesthesia for dacryocystorhinostomy would choose local anesthesia again .
our findings are in agreement with other reports in the literature suggesting that regional anesthesia could produce an attenuation of the stress response to surgical trauma . in our study
, the number of patients is too small to reach conclusion regarding different types of surgery .
another limitation is that stress response to surgical trauma measured by serum cortisol levels and glycemia could be due to other factors besides type of anesthesia , such as type of surgery , magnitude of surgical injury , duration of operation , and degree of postoperative pain .
different techniques of anesthesia have not been shown to affect clinical outcome , so studies with more sensitive methods should be carried out to further investigate this issue .
spinal anesthesia showed better efficacy in suppressing cortisol response as compared to the technique of general anesthesia . in the suppression of the hyperglycemic response , both types of anesthesia proved equally effective , although slightly lower glycemia were recorded in patients who underwent spinal anesthesia .
hemodynamic parameters showed that the suppression of the adrenergic response was adequate in both groups , but hemodynamic stability was better in the spinal anesthesia group . based on metabolic , hormonal , and hemodynamic responses ,
spinal anesthesia proved more effective than general anesthesia in suppressing stress response during elective procedures in abdominal , urological , and orthopedic surgery .
Output:
| backgroundthe aim of the study was to determine the significance of spinal anesthesia in the suppression of the metabolic , hormonal , and hemodynamic response to surgical stress in elective surgical patients compared to general anesthesia.material/methodsthe study was clinical , prospective , and controlled and it involved 2 groups of patients ( the spinal and the general anesthesia group ) who underwent the same surgery .
we monitored the metabolic and hormonal response to perioperative stress based on serum cortisol level and glycemia .
we also examined how the different techniques of anesthesia affect these hemodynamic parameters : systolic arterial pressure ( ap ) , diastolic ap , heart rate ( hr ) , and arterial oxygen saturation ( spo2 ) .
these parameters were measured before induction on anesthesia ( t1 ) , 30 min after the surgical incisions ( t2 ) , 1 h postoperatively ( t3 ) and 24 h after surgery ( t4).resultsserum cortisol levels were significantly higher in the general anesthesia group compared to the spinal anesthesia group ( p<0.01 ) .
glycemia was significantly higher in the general anesthesia group ( p<0.05 ) .
there was a statistically significant , positive correlation between serum cortisol levels and glycemia at all times observed ( p<0.01 ) .
systolic and diastolic ap did not differ significantly between the groups ( p=0.191 , p=0.101 ) .
the hr was significantly higher in the general anesthesia group ( p<0.01 ) .
spo2 values did not differ significantly between the groups ( p=0.081).conclusionsbased on metabolic , hormonal , and hemodynamic responses , spinal anesthesia proved more effective than general anesthesia in suppressing stress response in elective surgical patients . |
PubmedSumm7855 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| under carbonylative conditions , neutral
rh(i)-systems modified
with weak donor ligands ( asph3 or 1,4-oxathiane ) undergo
n - cbz , n - benzoyl , or n - ts directed insertion into the proximal c c
bond of aminomethylcyclopropanes to generate rhodacyclopentanone
intermediates .
these are trapped by n - tethered alkenes to provide
complex perhydroisoindoles . |
PubmedSumm7856 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: experiments were performed in accordance with the guiding principles for the care and use of experimental
animals in the field of physiological sciences ( physiological society of japan ) and were approved by the
committee on animal experiments of the school of veterinary medicine , yamaguchi university . in silico mining of the bovine genome database
these genes were predicted by automated computational
analysis , best - placed refseq gnomon ver 5.1 , against the bovine genome database ( bioproject number was
prjna33843 ) in ddbj / genbanktm / ebi data bank .
table 1table 1.gene numbers in this study ( numbered from the top of the molecular dendrogram ) , gene name from cow
sequence , accession number and details of pcr primers#gene nameaccession numberprimernucleotidesequence ( 5to 3)1v1r407xm_002695263.3up2749tggagaacgttgggttttagttadown306326tgaaatccaccggagaacaga2vn1r4lxm_002695264.3up425445cactgagacctgacggcatgt(loc100337475)down684704cgaacgtacgggaaaaatctg3vnt1r4lxm_005195507.1up1634ctggccatgttgccttgtg(loc100847477)down213235tagaggatcctgaatgggaacac4v1r413xm_002695269.2up391413agtgtcttccaggtcatcaccatdown671690agagccactggccaagattg5v1r410xm_002695266.2up1338tatgaagtattggtacgtggagaatgdown288312cagaaccaagatgttacctacgatc6v1r406xm_002695262.2up3352caggtgtccggctgaagagadown218242agtagcaggtcaacaaaaatccaat7vnt1r4lxm_005195506.1up411430actccaggtgggcagagctt(loc101908711)down689710ggactctctgcttgcacctgta8v1r411xm_001789862.3up549571gttgatgtccttccctgatgtgtdown829848gggctgatagttgggaagca9v1r416xm_002695271.1up323ggccagcattgatttgacaatdown283302aggcagatgctaccgatgga10v1r414xm_001254649.3up2644ccaggctcgtggatttgtgdown214235ggtgtgtgctgtatgcatcatg11v1r415xm_001254634.2up90113tatcgtccttcacatcatgggttadown368389ggaacggtgtacttgggagcta12vn1r2xm_002695278.2up4262ggaagcccgagtgaagaacagdown321341gaaaggagggccaagatgttg13v1r418xm_001789884.1up774793gagtccagagccacccaaagdown965990gtacagaaagcagagactggatatga14v1r420xm_001254581.1up6889accttgaatgacaccacagctcdown369386aagaggcaggttgtgcca15v1r421xm_001789887.1up329gtcacaaatttatatgagccattctatdown269386actcaagaggcaggtggtactg16v1r417xm_001789881.3up2746cctttttcctgcgtccagaadown205226agccaactttccttgtgtgctt17v1r419xm_001254591.2up257277tctcaaaagggctccctcagadown537556tgcgccatttgtcagaaaca18vn1r1xm_005219819.1up446464gcgccctctaggcactgatdown726745cccgtggctactctgtggaa19vnt1r4lxm_005215403.1up2444gcgttttgcacaccagttacc(loc100847223)down304323tgtccccttggagacgagaa20v1r427xm_002695464.1up191213tgattattttctcccctgggattdown469490taccctgtggaccagtgactgt21vn1r4lxm_002695460.3up355373acccccaggagagcgaagt(loc100295682)down637654caccctctggcggtgtct22v1r433xm_002695465.1up182202tgatggcagcttttgtgtcaadown459481acttgccttgggcatcagtatag23v1r426xm_002695403.2up118atgtctctaaggggccacdown318338gtgctgagagccatcctctgt24vnt1r1lxm_003585332.1up3756tgcatcaactccctgcagaa(loc100851211)down245256aatgtggcagaaccatctgtgt25v1r425xm_001788382.2up88111gtcaatgtcatccttttcttccaadown366387tctgagcaatgacctcccttct26v1r432xm_002695457.2up359380ctgggagagaagggaggtcactdown589608gaccagaccatgaggccaat27vn1r1lxm_002695462.2up564582gtggtccacctcggatgct(loc100295623)down844863aagggagaaacggtgggaaa28v1r428xm_002695463.2up316336tttcacaaagacgccctgagadown598615ggtgctgcgagccatttt29v1r431xm_002695458.3up329348atggctgtggccaatctcttdown606628tttgagaggaacacggatgtaca30v1r424xm_002695400.2up253276tccagtcttgggtgtaagtttgtgdown534552gcctgtggcagcacctgta31v1r430xm_002695461.3up1738atgccctgagaaccataatccadown273296gccaccctctgtacataaaacaca32v1r437xm_601821.1up6483attgggatcttggccaacacdown345363tgccagacgggagtttctg33v1r403xm_002695191.2up309329gagtgcctaccaagccatcacdown589608agactggaccacgccatgag34v1r404xm_002695192.2up349369aagtgggcgtggcttagatctdown629648ctggactctctggcggtgtt shows the gene names and ncbi reference sequences of the 34 v1r homologs .
drawing a molecular dendrogram : the bovine v1r gene sequences were utilized to draw a
molecular dendrogram using the two - parameter model and neighbor - joining method [ 24 , 36 ] with molecular evolutionary genetyx analysis ver.6.0.5
( mega6 ) .
the evolutionary distances were computed using the maximum
composite likelihood method . here , the 34 genes are numbered from
the top of molecular dendrogram . collecting vos and oe from bulls and steers : we collected vos and oe from healthy , intact
japanese black bulls ( n=5 , 46 6 months old , 838 11 kg ) and japanese black steers ( n=5 , 28 1 months old ,
698 12 kg ) in a local slaughterhouse according to a previous anatomical study .
italian ryegrass hay , rice
straw and concentrate were provided according to the japanese feeding standard .
it is generally difficult to obtain sufficient number of bull samples in any
country .
the bulls were used for sumo wrestling in western japan and were very healthy they were being
sacrificed after losing wrestling rank , not for health reasons .
presence or absence of testis was confirmed in
each bull or steer at the slaughterhouse .
vos and oe
were obtained within 15 min of slaughter using a disk grinder with a diamond blade , hammer , straight gouge and
scissors .
the tissues surrounding the vos and oe were carefully removed and washed with phosphate - buffered
saline ( pbs ) . the vos and oe were frozen in liquid nitrogen and preserved at 80c until use for rna
extraction . collecting vos and oe from heifers : we collected vos and oe from japanese black heifers in
estrus ( n=7 , 30 1 months old , 506 10 kg ) or early luteal phase ( n=6 , 30 1 months old , 505 10 kg ) .
all heifers had received two intramuscular
injections of 20 mg dinoprost ( pronalgon f , pfizer , tokyo , japan ) given 11 days apart to synchronize the estrous
cycle .
estrous behavior and ovulation were monitored at the farm ; ovarian and uterine morphology were confirmed
at the slaughterhouse .
rna extraction , cdna synthesis and semi - quantitative pcr : total rna was extracted from frozen
vo and oe samples with rnaiso plus ( takara bio inc . ,
the rna
solution was extracted a second time with rnaiso plus , because single extraction yielded a brown product that
inhibited rt - pcr that could only be removed by a second extraction ( preliminary study , data not shown ) .
we could
not use a column method for rna extraction due to the mucus and brown powder in the vo and oe samples .
total rna
samples were digested with dnase i ( promega , madison , wi , u.s.a . ) to remove contaminating genomic dna .
rna
concentration and purity were evaluated by using a nanodrop nd-1000 spectrophotometer ( nanodrop technologies ,
wilmington , de , u.s.a . ) to ensure the a260/a280 nm ratio was in the acceptable range of 1.82.1 .
electrophoresis
of total rna followed by staining with ethidium bromide was performed to verify mrna quality ; the 28s:18s ratios
were 2:1 .
we synthesized cdna from 2 g rna in 20-l reactions with random
hexamer primers and the precise high - capacity cdna reverse transcription kit ( applied biosystems , foster city ,
ca , u.s.a . ) .
pcr conditions were optimized by conventional pcr with tks gflex dna polymerase ( takara bio ) , 20
ng dnase - treated reverse - transcribed rna , a veriti thermal cycler ( applied biosystems ) and
primers .
experiments included a no - template control and a no reverse transcription control . in preliminary
experiments ,
the optimum cycle number was determined for each target , so that signals were always in the
exponential portion of the amplification curve .
typical cycling conditions were as follows : 94c for 1 min ,
followed by 35 cycles of 98c for 10 sec , 60c for 15 sec and 68c for 30 sec .
primers were designed with primer express software v3.0 ( applied biosystems ) and reference sequences .
amplicons for most targets were 300 bp
with the following exceptions : gene 2 ( 280 bp ) , gene 3 ( 220 bp ) , gene 6 ( 210 bp ) , gene 10 ( 210 bp ) , gene 13 ( 217
bp ) , gene 14 ( 320 bp ) , gene 15 ( 383 bp ) , gene 16 ( 200 bp ) , gene 23 ( 338 bp ) , gene 24 ( 220 bp ) and gene 26 ( 250
bp ) .
the presence of a single product was confirmed by 2% ( w / v ) agarose gel electrophoresis ( sigma - aldrich ,
saint louis , mo , u.s.a . ) .
molecular weight markers ranging from 0.1 to 20 kbp ( gene ladder wide 1 ; nippon gene ,
tokyo , japan ) were used to identify the bands .
pcr products were visualized with a highly sensitive fluorescent
stain ( gelstar , lonza , allendale , nj , u.s.a . ) and a charge - coupled device ( ccd ) imaging system ( geldoc ; bio - rad ,
hercules , ca , u.s.a . ) , and the sensitivity of this system against double - strand dna was 20 pg .
pcr product concentrations were calculated by comparing the band strength of the unknown samples to the
molecular weight markers using alphaview software ( proteinsimple , santa clara , ca , u.s.a . ) .
v1r gene expression
was normalized to the geometric means of two housekeeping genes , chromosome 2 open reading frame 29 ( c2orf29 ;
xm_002691150.2 ) and suppressor of zeste 12 ( suz12 ; nm_001205587.1 ) ; values for each gene were divided by the
geometric mean of c2orf29 and suz12 in each sample .
all pcr - amplified products were purified with the nucleospin gel and pcr clean - up kit ( takara bio ) and
exosap - it ( affymetrix , santa clara , ca , u.s.a . ) , and then sequenced the dye terminator v3.1 cycle sequencing kit
on an abi3130 ( applied biosystems ) .
the obtained sequences were used as query terms for homology searches in the
ddbj / genbanktm / ebi data bank using the basic nucleotide local alignment search tool ( blast ) optimized for highly
similar sequences ( available on the ncbi website ) . statistical analysis : data were analyzed using statview version 5.0 for windows ( sas
institute , inc . ,
two - factor analysis of variance ( anova ) was used to evaluate the effect of
organ ( vo or oe ) , group ( bulls , steers , estrous heifers or early luteal - phase heifers ) and interaction between
the effects of organ and group on v1r gene expression followed by post - hoc comparisons with fisher s protected
least significant difference ( plsd ) test .
the statistical significance of differences among groups was assessed
by one - factor anovas followed by post - hoc comparisons with fisher s plsd test using a model consisting of
variance from the effect of group and the residual .
1.the evolutionary history of the 34 bovine homologs of v1r was inferred using the neighbor - joining method .
the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test is
shown next to the branches .
the tree is drawn to scale , with branch lengths in the same units as those of
the evolutionary distances used to infer the phylogenetic tree .
the evolutionary distances were computed
using the maximum composite likelihood method , and units represent the number of base substitutions per
site . shows the molecular dendrogram of 34 bovine v1r homologs .
there were four clusters : gene 1 to gene 8 ; gene 9 to gene 11 ; gene 13 to gene 17 ; and gene 20 to gene
31 .
there was six independent branches for genes 12 , 18 , 19 , 32 , 33 and 34 .
the evolutionary history of the 34 bovine homologs of v1r was inferred using the neighbor - joining method .
the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test is
shown next to the branches .
the tree is drawn to scale , with branch lengths in the same units as those of
the evolutionary distances used to infer the phylogenetic tree .
the evolutionary distances were computed
using the maximum composite likelihood method , and units represent the number of base substitutions per
site .
general information of gene expression of bovine v1r homologs : housekeeping genes c2orf29 and
suz12 were amplified from all cdna samples .
no amplified products were obtained from the no - template controls
and no reverse transcription controls .
no amplified products were obtained from primers specific for genes 3 , 6 , 16 and 23 .
it was impossible to
design better primers for these genes , which were thus excluded from further analysis .
2.the expression of bovine v1r homologs genes 1 to 11 in the vo and oe of bulls ( b ; black bar ) , steers ( s ;
dark gray bars ) , estrous heifers ( e ; dotted bars ) and early luteal - phase heifers ( l ; white bars ) . v1r
gene
expressions were normalized to the geometric means of two housekeeping genes , c2orf29 and
suz12 ; values for each gene were divided by the geometric mean of
c2orf29 and suz12 in each sample .
the header in the upper right corner
of each graph represents the results of two - factor anova followed by fisher s plsd test , including the
effect of organ ( vo or oe ) , effect of group ( bulls , steers , estrous heifers or anestrous heifers ) and
interaction between the effects of organ and group .
letters ( a , b or c ) above the left - side bars indicate
significant between - group differences in expression in vos ; greek letters ( or ) above the right - side
bars indicate significant between - group differences in expression in oes ( one - factor anova followed by
fisher s plsd test).fig .
3.the expression of bovine v1r homologs genes 12 to 21 in the vo and oe of bulls ( b ; black bar ) , steers ( s ;
dark gray bars ) , estrous heifers ( e ; dotted bars ) and early luteal - phase heifers ( l ; white bars ) .
v1r gene
expressions were normalized to the geometric means of two housekeeping genes , c2orf29 and
suz12 ; values for each gene were divided by the geometric mean of
c2orf29 and suz12 in each sample .
the header in the upper right corner
of each graph represents the results of two - factor anova followed by fisher s plsd test , including the
effect of organ ( vo or oe ) , effect of group ( bulls , steers , estrous heifers or anestrous heifers ) and
interaction between the effects of organ and group .
letters ( a , b or c ) above the left - side bars indicate
significant between - group differences in expression in vos ; greek letters ( or ) above the right - side
bars indicate significant between - group differences in expression in oes ( one - factor anova followed by
fisher s plsd test).fig .
4.the expression of bovine v1r homologs genes 22 to 34 in the vo and oe of bulls ( b ; black bar ) , steers ( s ;
dark gray bars ) , estrous heifers ( e ; dotted bars ) and early luteal - phase heifers ( l ; white bars ) .
v1r gene
expressions were normalized to the geometric means of two housekeeping genes , c2orf29 and
suz12 ; values for each gene were divided by the geometric mean of
c2orf29 and suz12 in each sample .
the header in the upper right corner
of each graph represents the results of two - factor anova followed by fisher s plsd test , including the
effect of organ ( vo or oe ) , effect of group ( bulls , steers , estrous heifers or anestrous heifers ) and
interaction between the effects of organ and group .
letters ( a , b or c ) above the left - side bars indicate
significant between - group differences in expression in vos ; greek letters ( or ) above the right - side
bars indicate significant between - group differences in expression in oes ( one - factor anova followed by
fisher s plsd test ) .
show v1r mrna expression in the oe and vo of bulls , steers , estrous heifers and early luteal - phase
heifers , and outcomes of anova .
the organ effect ( oe or vo ) was significant for 22 genes ( genes 2 , 4 , 5 , 7 , 8 ,
9 , 10 , 12 , 13 , 14 , 15 , 17 , 18 , 20 , 21 , 25 , 26 , 28 , 30 , 31 , 33 and 34 ) , all of which were more highly expressed
in vos than in the oe .
the effect of group ( bulls , steers , estrous heifers or early luteal - phase heifers ) was
significant for ten genes ( genes 2 , 12 , 15 , 17 , 18 , 22 , 24 , 26 , 28 and 34 ) .
the interaction between the effects
of organ and group was significant for five genes ( genes 2 , 12 , 15 , 17 and 20 ) .
the expression of bovine v1r homologs genes 1 to 11 in the vo and oe of bulls ( b ; black bar ) , steers ( s ;
dark gray bars ) , estrous heifers ( e ; dotted bars ) and early luteal - phase heifers ( l ; white bars ) . v1r
gene
expressions were normalized to the geometric means of two housekeeping genes , c2orf29 and
suz12 ; values for each gene were divided by the geometric mean of
c2orf29 and suz12 in each sample .
the header in the upper right corner
of each graph represents the results of two - factor anova followed by fisher s plsd test , including the
effect of organ ( vo or oe ) , effect of group ( bulls , steers , estrous heifers or anestrous heifers ) and
interaction between the effects of organ and group .
letters ( a , b or c ) above the left - side bars indicate
significant between - group differences in expression in vos ; greek letters ( or ) above the right - side
bars indicate significant between - group differences in expression in oes ( one - factor anova followed by
fisher s plsd test ) .
the expression of bovine v1r homologs genes 12 to 21 in the vo and oe of bulls ( b ; black bar ) , steers ( s ;
dark gray bars ) , estrous heifers ( e ; dotted bars ) and early luteal - phase heifers ( l ; white bars ) . v1r
gene
expressions were normalized to the geometric means of two housekeeping genes , c2orf29 and
suz12 ; values for each gene were divided by the geometric mean of
c2orf29 and suz12 in each sample .
the header in the upper right corner
of each graph represents the results of two - factor anova followed by fisher s plsd test , including the
effect of organ ( vo or oe ) , effect of group ( bulls , steers , estrous heifers or anestrous heifers ) and
interaction between the effects of organ and group .
letters ( a , b or c ) above the left - side bars indicate
significant between - group differences in expression in vos ; greek letters ( or ) above the right - side
bars indicate significant between - group differences in expression in oes ( one - factor anova followed by
fisher s plsd test ) .
the expression of bovine v1r homologs genes 22 to 34 in the vo and oe of bulls ( b ; black bar ) , steers ( s ;
dark gray bars ) , estrous heifers ( e ; dotted bars ) and early luteal - phase heifers ( l ; white bars ) . v1r
gene
expressions were normalized to the geometric means of two housekeeping genes , c2orf29 and
suz12 ; values for each gene were divided by the geometric mean of
c2orf29 and suz12 in each sample .
the header in the upper right corner
of each graph represents the results of two - factor anova followed by fisher s plsd test , including the
effect of organ ( vo or oe ) , effect of group ( bulls , steers , estrous heifers or anestrous heifers ) and
interaction between the effects of organ and group . letters ( a , b or c ) above the left - side bars indicate
significant between - group differences in expression in vos ; greek letters ( or ) above the right - side
bars indicate significant between - group differences in expression in oes ( one - factor anova followed by
fisher s plsd test )
. bulls vs. steers : gene 1 expression in the oe was higher in the bull than in the steer .
gene 7
expression in vos was higher in the bull than in the steer .
estrous heifers vs. early luteal - phase heifers : gene 9 showed higher expression in the oe of
estrous heifers than in the oe of early luteal - phase heifers .
gene 15 showed higher expression in the vos of
estrous heifers than in the vos of early luteal - phase heifers .
eight genes ( genes 5 , 12 , 17 , 20 , 22 , 28 , 33 and
34 ) showed higher expression in vos of early luteal - phase heifers than in those of estrous heifers .
furthermore ,
no genes showed higher expression in the oe of early luteal - phase heifers than in the oe of estrous heifers .
bulls vs. estrous or early luteal - phase heifers : the expression of gene 1 in the oes was
higher in bulls than in both estrous and early luteal - phase heifers . the expressions of three genes ( 12 , 17 and
33 ) were higher in the vos of bulls than of estrous heifers , but not of early luteal - phase heifers .
the
expression of gene 15 in the vos was higher in bulls than in early luteal - phase heifers , but not in estrous
heifers .
the expression of gene 26 in the vos was higher in estrous heifer than in bulls , but not in early
luteal - phase heifers .
further , the expressions of six genes ( 2 , 12 , 18 , 20 , 22 and 28 ) were higher in the vos of
early luteal - phase heifers than of bulls .
this study clarified sexual polymorphisms of v1r gene expression in bovine vos and oe . although intraspecies
chemosignals and receptors in this species are poorly understood , the expression polymorphisms discovered herein
suggest the presence of multiple intraspecies chemosignals in females and males .
the genomes of mice , bovines
and humans contain 530 , 34 and 4 v1r family genes [ 16 , 21 ] ; thus , bovines represent a mid - point in the loss of v1r genes through
evolution .
therefore , the results of this study may give an insight into the evolution of such receptor genes in
mammals and their involvement in sex - specific behavior .
it is well known that there are sex differences in intraspecies chemosignal detection , although the mechanisms for these sex differences were unknown in mammals prior to this
study .
our study
results show higher gene expression in bulls than in estrous heifers ( genes 1 , 12 , 17 and 33 ) .
in addition , we
also show higher gene expression in estrous heifers than in bulls ( gene 26 ) .
therefore , we believe that these
genes may be important causes of sex differences in intraspecies chemosignal detection
. our results also suggest
that different receptor clusters may have different roles and effects on the central nervous system . however , we
believe that other mechanisms for sex differences in intraspecies chemosignal detection may exist in cattle .
indeed , a recent study , which was published after we completed our study , showed that progesterone can silence
sensory neurons detecting urinary protein pheromones in female mice .
the estrous heifers showed higher expression of gene 9 in oe and gene 15 in vos in comparison to early
luteal - phase heifers .
the vos of early luteal - phase heifers showed higher expression of eight genes than those
of estrous heifers .
blood estradiol is higher
in estrous heifers than in early luteal - phase heifers .
this and the
findings of doty and cameron suggest estradiol may be one
controlling factor .
interestingly , mouse vo synthesizes estrogen , and the vo neuronal response to putative urine
pheromones is reduced by estradiol .
we found no previous reports on the effect
of sex steroids on v1r gene expression ; however , the ability to detect putative human pheromone , androstenone ,
is more likely to diminish in boys than in girls after puberty [ 10 , 13 , 27 ] .
further studies are required
to test the hypothesis that estradiol and testosterone control sex - associated polymorphisms in v1r gene
expression .
ohara
et al . reported that all of the 24 identified v1r
genes are expressed in the vo and oe of a goat , the genome of which has not been fully sequenced .
however , the
authors did not report on the characteristics of the goat ( age , sex and intact or gonadectomized ) , and they used
nested pcr ( both first and second pcrs were 35 cycles ) to evaluate gene expression .
therefore , it is impossible
to compare our data with theirs . sniffing is the behavioral response for pheromone binding to the oe receptors ,
and flehmen is the behavioral response for pheromone binding to the vo receptors . in general ,
therefore , the smaller number
of ligand - receptor binding sites on the oe may be enough to induce the flehmen response , and a higher number of
ligand - receptor binding sites on the vos may be interpreted ( or treated ) by the accessory olfactory bulb and
lead to various neurological and behavioral effects in cattle .
sexual pheromones induce male and female effects
to activate reproductive functions in the opposite sex in small ruminants [ 11 , 17 , 37 ] .
however , an
intraspecies chemosignal was reported in dorsett ewes , which utilize their vo for neonatal offspring recognition
.
rats have the ability to communicate affective states , such as
stress , alarm , fear , anxiety or sexual interest , by releasing intraspecies chemosignals [ 25 , 26 ] .
therefore , some of the 20 v1rs may have
important roles in the detection of intraspecies chemosignals for non - sexual purposes .
we compared the expression of each of 30 v1rs in the vo and oe among the 4 different groups .
individual gene
expression patterns did not show uniformity . because all 30 v1rs are orphan receptors , it is impossible to
explain the precise characteristics of each receptor and explain the relationship with each physiological change
or gene expression requirement .
however , generally , physiological responses and decisions of animals are in
response to situations in their living environment and for survival and species conservation .
intraspecies
chemosignals have sexual and non - sexual purposes [ 3 , 6 , 18 ] .
rodents can discriminate among conspecific
animals based on various sensory cues , including dietary history ,
illness - associated state and major histocompatibility complex .
therefore , expression patterns of v1rs may have important roles in
complex intraspecific chemical communication .
tks gflex dna polymerase possesses high fidelity and excellent extension activity , because it contains a
specific priming accelerator that suppresses non - specific binding , takara bio s original strong elongation
factor and reaction buffer elements that sequester pcr inhibitors .
thus , the polymerase can amplify templates
from over a wide range of nucleic acid concentrations , even from targets containing gc- or at - rich sequences . in
our preliminary trials ,
pcr amplification failed , likely because of inhibiting contaminants , and we subsequently
evaluated several cdna reverse transcription kits and enzymes and concluded that the high - capacity cdna reverse
transcription kit and tks gflex provided the best pcr results .
ibarra - soria et al . used rnaseq to quantify whole
transcriptomes of the mouse vo and oe ; however , they measured only one vir gene among the 530 annotated v1r
genes by using real - time pcr with a commercial primer and probe set .
the amplicon size was 59 bp for the
commercial primer and probe set ; however , the sequences of primers and probe in the set were not specified .
thus , it was impossible to compare the homology of the 59-bp amplified products with that of the other 529
genes . in this study , we did not include any real - time pcr analysis data , because first , we did not obtain a
product by using tks gflex , which could be because of the high risk of failure to amplify due to the presence of
inhibiting contaminants .
second , it is difficult to ensure specificity , because of the high level of sequence
similarity within the v1r family .
third , for precise real - time pcr
analysis results , the amplicon size must be less than 150 bp ( and more than 50 bp ) .
however , such small amplicon size is insufficient to obtain sequence data for blast
search to identify the gene .
fourth , the manufacturer of the dye terminator cycle sequencing kit , namely ,
applied biosystems , advised us that the excitation and emission wavelengths of the fluorescent dyes used in
real - time pcr kits are almost similar to those of the fluorescent dyes used in the dye terminator cycle
sequencing kit .
therefore , the manufacturer was unable to guarantee the quality of the sequence data of the
amplified products obtained by real - time pcr .
therefore , we used semi - quantitative rt - pcr followed by sequencing
for identification of the expressed gene in the present study ; however , we must be cautious , because
quantification by using semi - quantitative rt - pcrs may not always be accurate .
in addition , the number of receptors
on the cell surface is not solely controlled by their mrna expressions .
therefore , specific antibodies to
extra - cellular regions of each receptor must be developed to clarify the role and importance of each v1r . in conclusion , in this study , we discovered sexual polymorphisms of v1r expressions among bulls , steers , and
estrous and early luteal - phase heifers .
this is the first report of sexual polymorphisms of v1r expression in
ruminant species and the first reported estrous stage - dependent difference of v1r expression in any mammalian
species .
Output:
| vomeronasal 1 receptors ( v1r ) are a family of receptors for intraspecies chemosignals , including pheromones ,
and are expressed in the olfactory epithelium ( oe ) and vomeronasal organ ( vo ) . even in the well - studied
rodents ,
it is unclear which members of the v1r family cause sexual polymorphisms , as there are numerous genes
and it is difficult to quantify their expressions individually .
bovine species carry only 34 v1r homologs , and
the oe and vos are large enough to sample . here
, v1r expression was quantified in the oe and vos of individual
bovines .
based on the 34 gene sequences , we obtained a molecular dendrogram consisting of four clusters and
six independent branches .
semi - quantitative rt - pcr was used to obtain gene expression profiles in the vos and
oe of 5 japanese black bulls , 5 steers , 7 estrous heifers and 6 early luteal - phase heifers .
ten genes showed
significant between - group differences , and 22 showed high expression in vos than in oe .
the bulls showed
higher expression of one gene more in oe and another in vos ( both p<0.05 ) than did steers ;
both genes belonged to the first cluster .
no genes were expressed more abundantly in steers than in bulls .
the
estrous heifers showed higher expression of a gene of the second cluster in oe , and a gene of the third
cluster in vos ( both p<0.05 ) than did early luteal - phase heifers .
these results suggest
v1r expression exhibits sexual polymorphisms in cattle . |
PubmedSumm7857 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: breast conservation therapy ( bct ) , which involves lumpectomy followed by adjuvant radiation therapy , has now become the standard of care in women with early stage breast cancer .
however , historically , the majority of patients with early stage breast cancer have been treated with whole breast irradiation ( wbi ) .
whole breast irradiation can require a long treatment time ranging anywhere from three to six weeks depending on the fractionation , which can be prohibitive for many patients .
additionally , wbi covers areas of the breast , which are not necessarily at the highest risk of relapse .
accelerated partial breast irradiation ( apbi ) utilizing single - entry multi - lumen or multi - catheter devices such as contura ( hologic inc , bedford , ma , usa ) or savi ( cianna medical , aliso viejo , ca , usa ) , can treat a smaller volume at the highest risk of recurrence around the lumpectomy cavity in regimens typically lasting only five days .
additionally , patients treated with apbi report higher cosmetic satisfaction compared to a similar wbi cohort . due to these advantages , apbi has been gaining in popularity over the past decade , now being utilized in as many as 11% of patients older than 50 who undergo bct . in the american society of breast surgeons ( asbs ) mammosite ( hologic inc , bedford , ma , usa ) registry trial , device - to - skin spacing > 7 mm was associated with better cosmetic outcome . thus , close skin spacing ( 7 mm ) has been since then feared to cause worse toxicity and produce inferior cosmetic outcomes . given the increasing use of apbi , multiple consensus guidelines and patient selection criteria have been developed to allow for the selection of the most appropriate patients [ 5 , 6 , 7 , 8 , 9 ] .
however , none of these guidelines include any selection factors or dose tolerance limits in regards to device - to - skin spacing or maximum skin dose when multi - lumen or catheter devices are utilized .
had shown that patients are at risk of developing telangiectasia if their device to skin spacing was between 7 to 12 mm but they did not include any patients with spacing of < 7 mm on their phase ii trial . patients with close skin - spacing
have previously published their results regarding acute toxicity and early cosmetic outcomes in patients treated with multi - lumen devices . however , besides the aforementioned data , there are no other clinical and toxicity outcomes for patients treated with close skin spacing using apbi .
the purpose of this study is to examine our apbi cohort and report their outcomes to add to this growing body of evidence regarding its safety efficacy and cosmesis in patients with close skin spacing .
medical records of all the patients treated with apbi using either contura or savi between 2007 to 2013 were reviewed .
patients with device - to - skin spacing of less than or equal to 7 mm and follow - up longer than six months were selected .
all patients had undergone lumpectomy along with sentinel lymph node biopsy for invasive carcinoma prior to their treatment .
all the contura or savi devices were placed by the surgeon via a closed cavity approach .
the appropriate device was selected by the surgeon based on the lumpectomy cavity size and vendor guidelines .
ultrasound guidance was used to detect the seroma and align the route of insertion along the longest axis diameter of the cavity .
planning computed tomography ( ct ) simulation was performed 48 - 72 hours following device placement in our department ( brilliance big bore , philips healthcare , andover , ma , usa ) .
all patients were simulated with the arm on the affected side raised above their head in the supine position .
a small amount of contrast ( 0.5 cc ) was added to the saline mixture filling the balloon for contura patients to improve visualization of the balloon on ct .
brachyvision treatment planning system ( varian , palo alto , ca , usa ) was used for all of our treatment planning . the planning target volume for evaluation ( ptv_eval ) consisted of 1 cm of tissue surrounding the device but limited to 5 mm from the skin for the contura patients and 3 mm for the savi patients if possible . during treatment planning
, all attempts were made to limit the maximum dose to the skin to less than 125% and no more than 145% of the prescribed dose for the contura patients , and less than 100% and no more than 110% in the savi patients .
other planning parameters included maximum rib dose of < 145% in contura patients and < 100% in savi patients , v90 ( volume of ptv_eval receiving 90% of prescribed dose ) > 100% , v95 > 95% , and v100 >
we also attempted to minimize the v150 of normal breast tissue to < 50 cc and v200 < 10 cc .
all lesions were treated to 34 gy in 10 twice - daily treatments , six hours apart , and over five days .
acute and late toxicities were graded based on the radiation oncology therapy group ( rtog ) criteria .
toxicities up to 90 days post - treatment were considered acute and the remainder were graded as late toxicities .
even though the near majority of toxicities measured were as related to skin or subcutaneous tissue , toxicities in all rtog criteria were considered and the highest grade was assigned to the patient for further analysis .
the final cosmetic outcome was determined by either the treating radiation oncologist or the breast surgeon and was graded based on the harvard breast cosmesis scale .
the test was used to assess any significant correlation between skin spacing and outcomes .
in total forty - three patients were identified with device to skin distance of 7 mm .
the sixth patient was excluded since she was converted to whole breast irradiation after 3 fractions , due to personal preference .
overall , 37 patients and 38 lesions ( one patient had bilateral treatment ) were identified as meeting our selection criteria and were analyzed .
three patients received neoadjuvant hormonal therapy prior to surgery , and 68% received adjuvant hormonal therapy .
represented histologies were mixed between ductal carcinoma in situ ( 34% ) , invasive ( 55% ) , or mixed subtypes ( 11% ) .
all our patients were staged as either tis or t1 , and all lesions with invasive subtypes underwent sentinel lymph node biopsy with no nodal involvement .
summary of baseline patient characteristics dcis ductal carcinoma in situ , idc invasive ductal carcinoma , ilc invasive lobular carcinoma treatment - related parameters are summarized in table 2 .
the median maximum skin dose amongst our savi patients was 101.15% and 118% in our contura patients , meeting skin constraints in all our patients .
the average dose non - uniformity ratio and dose homogeneity index in our cohort were 0.33 and 0.67 , respectively .
v95 , v100 , v150 , v200 the percentage of the prostate volume receiving 90% , 95% , 100% , 150% , 200% of the prescribed dose or more representative axial sections showing the isodose distributions around the device in relation to the skin .
the outer yellow lines represent the ptv_eval volume after a median follow - up of 47.5 months , one patient experienced an ipsilateral breast recurrence and is currently undergoing work - up for a planned mastectomy . of note
, she had been unable to tolerate adjuvant hormonal therapy after completion of her apbi .
a second patient experienced axillary recurrence , which was treated with hormonal therapy , due to her not being a surgical candidate .
none of the recurrences were within the treated ptv volume . per the rtog acute radiation morbidity criteria ,
seven ( 18% ) lesions had no skin or subcutaneous tissue reactions , 22 ( 58% ) lesions were reported to have grade 1 reactions , and 9 ( 24% ) treated lesions experienced grade 2 reactions .
fifteen ( 40% ) patients experienced no late skin or subcutaneous tissue side effects per the rtog criteria , 21 ( 55% ) experienced grade 1 toxicities , and two ( 5% ) patients did not have their late toxicities recorded .
one patient with 6 mm skin spacing had to undergo mastectomy nearly 54 months after completion of treatment due to mastitis .
cosmetic outcomes as measured per the harvard cosmesis scale were graded as excellent in 24 ( 63% ) , good in 11 ( 29% ) , and not reported in 3 ( 8% ) cases .
summary of toxicities and long - term cosmetic outcome reported in 38 treated lesions we attempted to determine if there was any correlation between the device to skin distance and the late toxicities and cosmesis .
there was no correlation between skin spacing and acute toxicities ( p = 0.213 ) or late toxicities ( p = 0.28 ) but trended towards significance when examining the cosmetic outcome ( p = 0.0926 ) .
however , all patients with skin spacing of 3 mm or less experienced acute ( figure 2a ) , late toxicities ( figure 2b ) , and worse cosmesis ( figure 2c ) .
representative images of patients immediately after treatment and outcomes at later time points are displayed in figure 3 .
a ) the device to skin distance ( mm ) graphed against acute skin or subcutaneous tissue toxicity per rtog criteria .
b ) the device to skin distance ( mm ) graphed against late skin or subcutaneous tissue toxicity per rtog criteria .
c ) the device to skin distance ( mm ) graphed against the harvard cosmesis scale ( 1 excellent , 2 good ) follow - up images from representative patients .
the last pictured follow - up date does not necessarily represent the last follow - up date in clinic
in total forty - three patients were identified with device to skin distance of 7 mm .
the sixth patient was excluded since she was converted to whole breast irradiation after 3 fractions , due to personal preference .
overall , 37 patients and 38 lesions ( one patient had bilateral treatment ) were identified as meeting our selection criteria and were analyzed .
three patients received neoadjuvant hormonal therapy prior to surgery , and 68% received adjuvant hormonal therapy .
represented histologies were mixed between ductal carcinoma in situ ( 34% ) , invasive ( 55% ) , or mixed subtypes ( 11% ) .
all our patients were staged as either tis or t1 , and all lesions with invasive subtypes underwent sentinel lymph node biopsy with no nodal involvement .
summary of baseline patient characteristics dcis ductal carcinoma in situ , idc invasive ductal carcinoma , ilc invasive lobular carcinoma
the median maximum skin dose amongst our savi patients was 101.15% and 118% in our contura patients , meeting skin constraints in all our patients .
the majority of our other constraints were also met during the treatment planning process . the average dose non - uniformity ratio and dose homogeneity index in our cohort were 0.33 and 0.67 , respectively .
v95 , v100 , v150 , v200 the percentage of the prostate volume receiving 90% , 95% , 100% , 150% , 200% of the prescribed dose or more representative axial sections showing the isodose distributions around the device in relation to the skin .
the outer yellow lines represent the ptv_eval volume after a median follow - up of 47.5 months , one patient experienced an ipsilateral breast recurrence and is currently undergoing work - up for a planned mastectomy . of note
, she had been unable to tolerate adjuvant hormonal therapy after completion of her apbi .
a second patient experienced axillary recurrence , which was treated with hormonal therapy , due to her not being a surgical candidate .
per the rtog acute radiation morbidity criteria , seven ( 18% ) lesions had no skin or subcutaneous tissue reactions , 22 ( 58% ) lesions were reported to have grade 1 reactions , and 9 ( 24% ) treated lesions experienced grade 2 reactions .
fifteen ( 40% ) patients experienced no late skin or subcutaneous tissue side effects per the rtog criteria , 21 ( 55% ) experienced grade 1 toxicities , and two ( 5% ) patients did not have their late toxicities recorded .
one patient with 6 mm skin spacing had to undergo mastectomy nearly 54 months after completion of treatment due to mastitis .
cosmetic outcomes as measured per the harvard cosmesis scale were graded as excellent in 24 ( 63% ) , good in 11 ( 29% ) , and not reported in 3 ( 8% ) cases .
summary of toxicities and long - term cosmetic outcome reported in 38 treated lesions we attempted to determine if there was any correlation between the device to skin distance and the late toxicities and cosmesis .
there was no correlation between skin spacing and acute toxicities ( p = 0.213 ) or late toxicities ( p = 0.28 ) but trended towards significance when examining the cosmetic outcome ( p = 0.0926 ) .
however , all patients with skin spacing of 3 mm or less experienced acute ( figure 2a ) , late toxicities ( figure 2b ) , and worse cosmesis ( figure 2c ) .
representative images of patients immediately after treatment and outcomes at later time points are displayed in figure 3 .
a ) the device to skin distance ( mm ) graphed against acute skin or subcutaneous tissue toxicity per rtog criteria .
b ) the device to skin distance ( mm ) graphed against late skin or subcutaneous tissue toxicity per rtog criteria .
c ) the device to skin distance ( mm ) graphed against the harvard cosmesis scale ( 1 excellent , 2 good ) follow - up images from representative patients .
the last pictured follow - up date does not necessarily represent the last follow - up date in clinic
although brachytherapy apbi is only appropriate for a selected population of women with early stage breast cancer [ 5 , 6 , 7 , 8 ] , it represents a valuable alternative in terms of reducing the treatment time , cost , and volume of irradiated normal tissue .
however , since in one of the earliest apbi registries report skin spacing of < 7 mm was one of the factors associated with a worse cosmetic outcome , radiation oncologists have been hesitant to treat patients with close skin spacing using apbi .
several advances have been made since including the arrival of multi - lumen applicators in the form of contura and multi - catheter applicators in the form of savi .
these newer devices allow some flexibility in dose distribution , therefore , theoretically allowing patients with close skin spacing to undergo treatment with acceptable outcomes as long as the skin dose constraints are met .
two studies since have evaluated patients with close skin spacing who have undergone treatment with savi or contura . in the initial savi experience , yashar and
their population included some patients with skin spacing of less than 7 mm with a median maximum skin dose of 80% of the prescribed dose .
however , they did not report the number of patients with close skin spacing , nor did they report clinical outcomes specifically for those with close skin spacing . in a separate report , lee et al . examined short - term outcomes in 26 patients treated with multi - lumen balloon brachytherapy .
after a median follow - up of 9 months , they reported excellent or good cosmetic outcomes in 92.3% of their patients .
their median maximum skin dose was 118.2% but the majority of their patients ( 62% ) had skin spacing between 5 to 7 mm .
we have now reported the longest follow - up and the largest cohort of patients with close skin spacing treated with multi - lumen or multi - catheter applicators .
most of our patients had excellent or good cosmesis ( 92% ) after a median follow - up of 47.5 months .
three of our patients had been treated with neoadjuvant hormonal therapy prior to treatment but this did not result in a change in the size of their tumor or their eventual treatment .
the rates of both acute and late toxicities were acceptable with only 24% of patients experiencing acute grade 2 toxicities and no late grade 2 toxicities .
we were also able to keep our maximum skin dose within our pre - specified goal ( median , 117.5% ) without compromising other dosimetric constraints .
the median maximum skin dose in the savi cohort was lower at 101.15% ; although , it is difficult to draw any definitive conclusions since only 8% of our patients were treated with savi .
there was no statistically significant correlation between the device to skin distance and the occurrence of acute or late toxicities but there was a trend towards significance in terms of the cosmetic outcome .
however , if we examined the patients with 3 mm or less skin spacing , all experienced some acute and late toxicity , and all except one had good cosmetic outcome as opposed to excellent . with the updated guidelines regarding which
patients can safely and appropriately be treated with apbi , it is important to consider each patient s specific disease and treatment related characteristics before deciding on the specific apbi delivery mode . in the interim analysis of the rapid trial , apbi using external beam radiation therapy
was shown to have worse cosmetic outcome compared to whole breast irradiation , and should ideally be avoided in patients who highly value their cosmetic outcome .
accelerated partial breast irradiation using interstitial needle placement is still an acceptable option with long - term data supporting great clinical and cosmetic outcomes but is limited to only centers with ongoing experience given the technical expertise needed for needle placement .
to our knowledge , there is no current data of examining cosmetic outcomes using this technique in relation to the skin to needle spacing .
intraoperative radiation therapy is also considered appropriate treatment for a few patients with early stage breast cancer who meet certain criteria . although patients in the targit trial were shown to have better cosmetic outcome compared to their whole breast cohort ; no cosmetic results have been reported to - date for the eliot trial .
additionally , there are no data regarding the safety and cosmesis of iort in patients with lesions in proximity to their skin .
therefore , it is important to consider a tumor s proximity to skin when planning on a potential apbi treatment post - lumpectomy , so that the correct modality for delivering apbi can be selected .
based on our results , it appears that patients with close skin spacing of 7 mm or less can potentially be treated safely with multi - lumen or multi - catheter applicators with good preliminary clinical and cosmetic outcome . nevertheless , given the limited number of patients in our study and the retrospective nature of our investigation , caution should be utilized in selecting the optimal patients and minimizing risk of toxicity by limiting dose to the skin .
a maximum skin dose constraint of 125% of prescribed dose for contura devices and 110% for savi devices is a reasonable target based on our data and lee and colleague s report .
the patients with 3 mm or less skin spacing are at higher risk of acute and late toxicities , and should be advised accordingly before their planned treatment but they can still safely be treated with good outcomes . therefore , close skin spacing should no longer be considered an automatic exclusion criterion for patients who are set to undergo apbi with multi - channel applicators .
Output:
| purposeaccelerated partial breast irradiation ( apbi ) using a single - lumen device is associated with better cosmetic outcomes if the spacing between the applicator and skin is > 7 mm . however , there are no reports addressing the late toxicity and clinical outcomes in patients treated with single - entry multi - lumen / catheter applicators who had close skin spacing ( 7 mm or less ) .
we undertook this study to report clinical outcome , acute and late toxicity as well as cosmesis of early stage breast cancer patients with close skin spacing treated with apbi using multi - lumen or multi - catheter devices.material and methodsthis is a retrospective study of all breast cancer patients who had undergone apbi using single - entry multi - lumen / catheter devices in a single institution between 2008 to 2012 .
the study was limited to those with 7 mm spacing between the device and skin.resultswe identified 37 patients and 38 lesions with skin spacing of 7 mm .
seven lesions ( 18% ) had spacing of 3 mm .
median follow - up was 47.5 months .
there was one case of ipsilateral breast recurrence and one ipsilateral axillary recurrence . based on rtog criteria ,
22 treated lesions experienced grade 1 and 9 lesions experienced grade 2 toxicity .
twenty - one lesions experienced late grade 1 toxicity .
one patient had to undergo mastectomy due to mastitis .
twenty - four treated breasts showed excellent and 11 had good cosmetic outcome .
overall cosmesis trended towards a significant correlation with skin spacing .
however , all patients with 3 mm skin spacing experienced acute and late toxicities.conclusionsaccelerated partial breast irradiation can be safely performed in patients with skin spacing of 7 mm using single - entry multi - lumen / catheter applicators with excellent cosmetic outcomes and an acceptable toxicity profile .
however , skin spacing of 3 mm is associated with acute and late toxicity and should be avoided if possible . |
PubmedSumm7858 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: methyl - directed mismatch repair ( mmr ) is the primary pathway for correcting replication errors and errant recombination events in escherichia coli ( 18 ) making a functional mmr pathway essential for ensuring the informational integrity of the chromosome , genomic stability and an acceptable cellular mutation rate .
functionally homologous repair systems , directed towards the repair of base pair mismatches as well as small insertions and deletions , also exist in eukaryotic organisms [ for reviews see ( 4,5,8,9 ) ] .
importantly , homologues of the bacterial muts and mutl proteins have been identified in every cellular organism studied to date , including yeast and humans , suggesting that the basic strategy used to repair base pair mismatches and insertion / deletion loops is highly conserved .
although the in vivo signal for strand discrimination and the mechanism of damage - containing strand excision are uncertain in eukaryotes , mismatch recognition and repair involving the muts and mutl homologues appears to be very similar to the bacterial system .
the fundamental importance of a functional mismatch repair pathway is underscored by the fact that , in humans , defects in mismatch repair result in genomic instability that can lead to certain types of cancer , especially hereditary colon cancer ( 1015 ) .
the primary components of the bacterial mmr pathway have been uncovered in a series of elegant biochemical and genetic studies , and include the mutator proteins ( mutl , muts , muth and uvrd / mutu ) , several exonucleases , including exoi , exovii , recj and exox , dna polymerase iii , single - stranded dna ( ssdna ) binding protein , dna ligase and the dam methylase ( 1623 ) .
these proteins act in concert , after passage of the replication fork , to correct base pair mismatches and small insertion
the complete mismatch repair pathway has been reconstituted in vitro ( 24 ) and the sequence of events in the mismatch repair process has been well described using this in vitro system [ for reviews see ( 4,7,25 ) ] . nonetheless , mechanistic issues , particularly those surrounding the role of atp binding / hydrolysis and the role of various protein protein interactions , remain unresolved . a current model of mmr in e.coli ( 4,7,2527 ) in posits a set of carefully orchestrated steps ( figure 1 ) .
mismatch recognition is accomplished by muts , which recognizes and binds to the base pair mismatch ( 23,28 ) in a process that requires atp .
the bacterial muts protein has been crystallized in a complex with a mismatch ( 28 ) and shown to interact asymmetrically with the dna .
one subunit in the homodimer interacts with the mismatch [ or looped out base(s ) ] while the other interacts non - specifically with the dna .
this is followed by the binding of mutl to the muts dna complex to form a ternary complex containing both proteins and dna ( 2931 ) .
both mutl and muts are functional as homodimers [ heterodimers in eukaryotic cells ( 8) ] and both proteins are capable of binding and hydrolyzing atp ( 26,27,32,33 ) .
the rate of atp hydrolysis catalyzed by muts is faster than that of mutl and the molecular role of atp binding and hydrolysis by these two proteins is under investigation .
the muts mutl complex then communicates with muth bound at a transiently hemi - methylated d(gatc ) site .
there are currently three models for which there is some experimental support . in one model the muts mutl complex is proposed to loop out the dna , actively searching for the nearest d(gatc ) methylation site either 5 or 3 of the mismatch ( 18,34 ) . in the second model muts
binds the mismatch in an adp bound state which provokes an adp atp exchange .
this produces a conformational change that induces muts to act as a sliding clamp capable of leaving the mismatch by diffusion .
this process occurs iteratively and the muts mutl complexes interact with and activate the muth endonuclease ( 35 ) .
the third model proposes that muts remains bound at or near the mismatch with communication with muth bound at the hemi - methylated site involving dna bending ( 36 ) .
while details regarding the nature of this communication are still unresolved , it is clear that once the nearest hemi - methylated d(gatc ) site is found , the muts mutl complex activates the latent endonuclease activity associated with muth to generate a nick in the dna on the unmethylated ( nascent ) dna strand ( 19,21 ) .
this provides discrimination of the parental strand from the daughter strand and directs the subsequent repair event to the nascent dna strand .
activation of the latent endonuclease activity of muth is presumably accomplished by mutl , since mutl has been shown to be capable of stimulating this reaction in the absence of muts ( 37 ) . once the nascent dna strand has been nicked , dna helicase ii ( uvrd ) unwinds the dna beginning at the nick and moving toward the mismatch ( 38 ) and one of several ssdna exonucleases ( exoi , exovii , exox and recj ) , with an appropriate polarity , degrades the nascent dna strand as it is being unwound ( 16,38 ) .
resection of the damaged dna continues to a point that is , on average , about 100 bp past the mismatch ( 18 ) and ssdna binding protein binds and stabilizes the ssdna template until dna polymerase iii is recruited to fill the gap .
the resulting nick is sealed by dna ligase , completing the repair process and restoring the integrity of the dna ( 24 ) .
the use of the nearest hemi - methylated d(gatc ) as the site of muth - directed incision provides mmr with a bidirectional capability since this site could be located on either the 5 side or the 3 side of the mismatch ( 17,18 ) . however , uvrd unwinds dna with a specific 3 to 5 polarity ( 39,40 ) . therefore , uvrd must be loaded on the appropriate dna strand in order to unwind toward the mismatch .
it is also important to note that the d(gatc ) site nearest the base pair mismatch may be 12 kb away from the mismatch ( 21,41 ) although , repair efficiency decreases as a function of increasing distance between the d(gatc ) initiation site and the mismatch .
this fact has important consequences for understanding the unwinding event catalyzed by the modestly processive uvrd helicase .
the signal indicating sufficient dna has been unwound / degraded to complete the repair process is not known .
the role of mutl protein , characterized as the master regulator of mismatch repair , remains to be completely defined on a mechanistic level .
the protein was originally purified , using a biochemical complementation assay , as an essential component for partially reconstituted mismatch repair in cell extracts lacking mutl ( 31 ) .
subsequent experiments demonstrated its interaction with muts at a mismatch ( 30,31,42 ) , and the solved crystal structure of the n - terminal domain of mutl ( 43,44 ) demonstrated an atp binding / hydrolysis fold common to the ghkl group ( gyrase / hsp90/histidine - kinase / mutl ) of atp hydrolyzing enzymes ( 45 ) .
purified mutl catalyzes a very slow atp hydrolysis reaction that is stimulated by the presence of ssdna and is essential for mmr ( 43,44,46 ) .
in addition , mutl has been shown to interact with muth and activate the hemi - methylated d(gatc)-directed nicking reaction catalyzed by muth ( 19,37 ) , as well as stimulating unwinding catalyzed by uvrd ( 38,47,48 ) .
thus , mutl is capable of interacting with and modulating the activity of many of the key protein players in mismatch repair .
the stimulation of mutl - catalyzed atp hydrolysis by the addition of dna has prompted an investigation of the dna binding properties of mutl .
several groups have demonstrated that mutl binds to both ssdna and double - stranded dna ( dsdna ) ( 30,4851 ) , while others report that mutl does not bind dna ( 52 ) or suggest that binding to dna may be irrelevant to its function ( 35 ) .
of particular interest is the fact that mutl specifically stimulates the duplex dna unwinding reaction catalyzed by uvrd ( 38,47,48 ) .
the unwinding activity of rep protein ( 37% identical to uvrd ) is also enhanced by mutl , but to a significantly lower extent ( 47 ) .
in addition , on a nicked , circular heteroduplex dna substrate , mutl and muts together activated uvrd - catalyzed unwinding while there was no detectable enhancement of unwinding by rep helicase ( 38 ) .
since the stimulation of unwinding by mutl is specific to uvrd it is likely that the mechanism of stimulation by mutl is through a direct protein
moreover , the interaction between mutl and uvrd is likely to be critical for the repair process .
uvrd exhibits modest processivity as a dna helicase ( 4050 bp ) ( 5355 ) making this protein an interesting choice for the helicase responsible for the unwinding event in mmr .
uvrd is also the helicase responsible for the unwinding event associated with excision repair ( 5659 ) , which requires unwinding of a short 1213 base long oligonucleotide well within the limits of the processivity of uvrd .
mmr , on the other hand , can require the unwinding of up to 12 kb of dna , which is substantially in excess of the reported processivity of uvrd .
in some manner , not fully understood , mutl is able to modulate the unwinding reaction catalyzed by uvrd to allow the unwinding of long duplex regions in the context of mmr .
little is known about the mechanism by which the uvrd - catalyzed unwinding reaction is enhanced by mutl .
this issue has received some attention recently ( 26,48,51 ) and some important details of the reaction have been described .
for example , on a nicked , circular molecule containing a mismatch , muts , mutl and uvrd initiate unwinding at the nick site and begin helix opening in the direction toward the mismatch .
this reaction requires all three protein components and the presence of a mismatch ( 38 ) .
moreover , while mutl dramatically stimulates the unwinding reaction catalyzed by uvrd , mutl does not increase its rate of atp hydrolysis ( 60 ) .
thus , uvrd becomes a more efficient helicase in the presence of mutl unwinding more base pairs of dna per atp hydrolysis event than in the absence of mutl .
experiments with model substrates support a mechanism in which mutl directs the productive loading of uvrd onto a dna substrate .
we have proposed that the loading of uvrd is an iterative process such that multiple molecules of uvrd accumulate on the substrate to increase the rate of progressive unwinding and to facilitate the unwinding of long duplex regions using a helicase with modest processivity .
this model suggests that ( i ) an interaction between mutl and uvrd is required for mmr , ( ii ) the atp binding / hydrolysis activity of mutl , which is known to be essential for mmr ( 46 ) , is likely to play some role in modulating the interaction between mutl and uvrd and ( iii ) dna binding by mutl is essential for stimulation of uvrd - catalyzed unwinding and , therefore , mmr .
each of these questions will be addressed , in turn , in the following discussion of the modulation of the activity of uvrd by mutl .
an interaction between mutl and uvrd was demonstrated several years ago using the yeast two - hybrid system and confirmed in biochemical studies ( 37 ) .
the yeast two - hybrid analysis revealed a direct interaction between uvrd and mutl , and deletion analysis indicated that critical residues for the interaction with uvrd were located between amino acids 397 and 438 and after amino acid 559 of the 615 amino acid mutl protein .
it was not possible to localize the region on uvrd responsible for binding to mutl using this approach since removal of either the n- or c - terminal ends of uvrd eliminated the two - hybrid interaction .
the recent solution of the structure for the c - terminal domain of mutl ( 29 ) has allowed a prediction of the interaction site between uvrd and mutl .
( 60 ) and the folding of c - terminal domain of mutl , it is likely that uvrd interacts with a region on mutl involving a portion of the disordered linker between the n- and c - terminal domains of mutl that lies nearest the c - terminal domain and the mutl c - terminus .
consistent with this assignment is the fact that the n - terminal domain of mutl , which does not include the disordered linker region , fails to stimulate the unwinding reaction catalyzed by uvrd ( 29 ) . however , the n - terminal domain has been suggested to interact with uvrd - based on crosslinking studies ( 29 ) .
the amount of crosslinked protein observed in this study was extremely low and may not reflect a significant interaction .
we have shown that deletion of the last 20 amino acids of mutl significantly reduces the mutl
however , an alternate interpretation of the structural data for the c - terminal domain ( 61 ) suggests that the c - terminal end is directly involved in dimer formation and that a truncation lacking the c - terminal 20 amino acids should be a monomer instead of a dimer .
our recent experiments with this truncation mutant indicate that the protein is , in fact , a dimer as originally suggested ( 29 ) .
this conclusion was arrived at using gel exclusion chromatography at an ionic strength that is nearly physiological ( 200 mm ) and analytical ultracentrifugation .
we suggest that uvrd is likely to directly interact with the linker region and the c - terminal end of mutl .
these two regions are located near one another in the 3d model of mutl ( 29 ) .
importantly , the mutlc20 deletion mutant maintains 60% of the atpase activity associated with mutl , binds dna , interacts with muts and stimulates muth - directed nicking in a reaction that is dependent on both muts and the presence of a mismatch base pair ( s.r .
thus , the protein is properly folded and capable of making all the required protein protein interactions necessary for mismatch repair
. however , mutlc20 fails to stimulate uvrd in helicase activity assays and does not complement a mutl deletion in genetic complementation studies .
thus , the c - terminus of mutl is essential for mmr in vivo as recently reported ( 61 ) and the interaction between mutl and uvrd is essential for loading uvrd onto the repair substrate and is essential for full functionality of the mmr pathway .
we and others have shown that mutl dramatically stimulates the unwinding activity of uvrd ( 38,47,48 ) .
previously , we proposed that mutl loads uvrd productively onto the dna for unwinding but does not clamp uvrd on the dna during the unwinding reaction ( 48 ) .
these experiments , performed using model dna substrates and in the absence of other mismatch repair proteins , also suggested that loading of uvrd by mutl was likely to be an iterative process .
the unwinding reaction catalyzed by uvrd demonstrates a limited processivity of 4050 bp ( 54 ) yet dna repair tracts can be up to 1 kb in length .
however , the processivity of uvrd as a translocase is significantly higher ( 2400 600 nt ) ( 62 ) .
thus , the iterative loading of uvrd by mutl may address the issue of how to produce long repair tracts using a helicase with limited processivity .
the first indication that mutl acted to load uvrd onto dna came from dna binding studies showing that the addition of mutl increased the affinity of uvrd for dna .
electrophoretic gel mobility shift experiments revealed that uvrd , in the presence of amp - pnp , formed a weak complex with ssdna that dissociated during the course of electrophoresis and was difficult to detect . in the presence of mutl , a supershifted mutl
ssdna complex indicating that mutl + uvrd formed a specific complex with a greater affinity for ssdna than uvrd alone ( 48 ) . based on these results
two possibilities were considered ; ( i ) mutl increased the rate of uvrd association with the dna or ( ii ) mutl decreased rate of dissociation of uvrd from ssdna .
an increased rate of association of uvrd with ssdna would be reflected as increased loading of uvrd onto model helicase substrates . in single
turn - over experiments with a 20 bp partial duplex substrate , preincubation of uvrd and mutl with the dna resulted in a stimulation of the amount of product produced reflecting an increase in the amount of productively loaded uvrd .
the concentration at which mutl was half saturating for the burst phase amplitude of uvrd - catalyzed dna unwinding ( 40.2 9.7 nm ) was similar to the kd of mutl for binding partial duplex dna ( 24.3 0.7 nm ) .
this result was interpreted to indicate that binding of mutl to dna was important for its role in stimulating the unwinding reaction catalyzed by uvrd and that mutl was stimulating the loading of uvrd onto the dna substrate . if mutl decreased the uvrd dissociation rate one could envision mutl functioning as a clamp , keeping uvrd tethered to ssdna and effectively increasing its processivity .
first , unwinding assays with a 148 bp blunt duplex substrate , well in excess of the measured processivity of uvrd , failed to detect increased unwinding in the presence of mutl after the addition of a ssdna trap .
second , single turn - over assays with a 92 bp partial duplex dna compared with a 20 bp partial duplex dna also indicated that mutl was not acting to alter the processivity of uvrd . under identical conditions ,
a smaller fraction of 92 bp partial duplex molecules were unwound in comparison to 20 bp molecules .
if mutl were acting to increase the processivity of uvrd then the same fraction of substrate should have been unwound in each case . moreover ,
the degree of stimulation was similar on both substrates suggesting that stimulation was independent of substrate length and , therefore , likely a loading phenomenon .
increased loading of uvrd by mutl was also investigated using long dna substrates to model the lengths of dna substrates likely to be encountered in vivo .
data from multiple turn - over helicase reactions with a 750 bp blunt duplex substrate and an 851 bp partial duplex substrate support the notion that mutl loads uvrd onto dna , and further suggest that loading by mutl is likely to be an iterative process .
unwinding of the two long substrates was generally described by a burst phase followed by a steady - state phase .
the burst phase for these reactions reflects unwinding by those uvrd molecules that were pre - loaded onto the dna substrate .
comparison of the unwinding kinetics exhibited by uvrd on the 750 bp blunt duplex dna in the presence or absence of mutl clearly showed that in the absence of mutl there was no burst phase .
this reflects an inability of uvrd alone to efficiently pre - load on blunt duplex substrates as shown previously ( 54 ) . in the experiments using the 750 bp blunt duplex and 851 bp partial duplex substrates
the increased productive loading of uvrd is likely to be continuous over the entire course of the unwinding reaction .
considering the reported processivity for uvrd ( 4050 bp ) , completion of unwinding of these longer substrates and detection of the significant burst phase in the unwinding assay with the 750 bp blunt duplex dna requires multiple binding events by uvrd . based on these results
a model was proposed to explain the stimulation of uvrd - catalyzed dna unwinding by mutl ( figure 2 ) .
the first step is the loading of uvrd onto the dna . in the presence of mutl
after it is loaded uvrd begins to unwind the duplex . in the presence of mutl additional molecules of uvrd
are loaded behind the leading molecule of uvrd and the high concentration of uvrd may increase the overall rate of uvrd - catalyzed unwinding .
eventually , the leading molecule of uvrd will dissociate from the duplex since uvrd translocates through duplex dna an average of ten steps ( 4050 bp ) before dissociating ( 54 ) . in the case of uvrd alone ,
when the leading molecule dissociates the partially unwound duplex can reanneal and the whole process must start over . on the other hand , in the presence of mutl multiple uvrd molecules have been loaded onto the duplex and the dna does not reanneal ; the additional uvrd molecules translocate along the ssdna template and continue unwinding .
this is consistent with the observation that uvrd is considerably more processive as a translocase moving along ssdna ( 62 ) than as a dna helicase .
as noted above , mutl - catalyzed atp hydrolysis is required for mmr ( 46,51 ) . however , the rate of mutl - catalyzed atp hydrolysis is slow and it seems unlikely this fuels active translocation along the dna lattice suggesting that atp hydrolysis may play another role ( 30,35 ) .
perhaps stimulation of the uvrd - catalyzed unwinding reaction requires the hydrolysis of atp by mutl .
if this were the case , then the mutl - catalyzed atp hydrolysis requirement in mmr might be explained by the requirement for atp hydrolysis in loading uvrd to begin resection of the damaged dna strand .
such a requirement would be consistent with the previous characterization of mutl as a molecular matchmaker ( 63 ) . using a mutl point mutant , mutl - e29a , that binds but does not hydrolyze atp , robertson et al .
( 64 ) have demonstrated that mutl - catalyzed atp hydrolysis is not required for mutl - dependent stimulation of the uvrd unwinding reaction .
in fact , the unwinding reaction catalyzed by uvrd on both a partial duplex substrate and a blunt end duplex substrate was significantly more efficient in the presence of mutl - e29a ; maximal stimulation of the unwinding reaction occurred at much lower concentrations of mutl - e29a than observed with the wild - type protein .
this was not the result of higher affinity binding of mutl - e29a to the dna substrate since binding to both a partial duplex ligand and a ssdna ligand by mutl - e29a was similar to that of the wild - type protein .
importantly , it is the atp - bound form of mutl that is specifically responsible for stimulating uvrd ( 64 ) . a second mutl point
mutant , mutl - d58a , which does not bind atp does not stimulate the unwinding reaction catalyzed by uvrd .
thus , the atp - bound form of mutl stimulates uvrd - catalyzed unwinding while the atp free form of mutl does not stimulate uvrd - catalyzed unwinding .
ban and yang ( 44 ) have shown that binding of atp causes the n - terminal domain of mutl to dimerize and perhaps this causes the protein to clamp onto the dna substrate . in the context of mmr
this may provide a loading platform for uvrd from which helicase molecules could be continuously loaded onto the dna substrate as long as mutl remained clamped on the dna . in the absence of atp hydrolysis ( i.e. with mutl - e29a )
mutl remains bound and loads multiple molecules of uvrd resulting in a very dramatic stimulation of uvrd - catalyzed unwinding at low concentrations of mutl .
if this is the case then mutl - catalyzed atp hydrolysis acts to regulate the loading of uvrd onto the mmr intermediate .
first , it serves to further refine our understanding of the role of atp binding and hydrolysis catalyzed by mutl in mmr .
it has been established previously that atp binding but not hydrolysis by mutl is required for interaction with muts ( 42 ) and it has been demonstrated that the atp - bound form of mutl stimulates the latent endonuclease reaction associated with muth ( 37 ) . thus , mutl - catalyzed atp hydrolysis is required after strand incision and the beginning stage of strand resection .
second , these results suggest the possibility that mutl - catalyzed atp hydrolysis regulates the amount of uvrd loaded onto the dna substrate . in the absence of mutl - catalyzed atp hydrolysis
the unwinding step ( catalyzed by uvrd ) may be uncoupled from the rescission step ( catalyzed by an exonuclease ) such that the exonuclease responsible for removing the unwound damage - containing nascent strand is unable to keep up with the advancing helicase .
if this were the case then repair events might not be properly completed due to this uncoupling and there would be an increase in mutation rate as was observed when mutl - e29a was substituted for mutl ( 51,64 ) .
the biological advantage of using mutl as an auxiliary factor that increases the initiation rate and progressive unwinding rate by uvrd in mismatch repair is clear .
the mismatch repair pathway requires , in some instances , the unwinding of long tracts of dna ( 22 ) . in the absence of mutl
the low processivity of uvrd seems inconsistent with the long repair patch lengths in light of the observed efficiency of mismatch repair .
therefore , the iterative loading of uvrd by mutl would increase both the rate and the efficiency of the reaction , and enable uvrd to unwind the long tracts required in this pathway despite its relatively low intrinsic processivity .
in addition , it is known that uvrd unwinds a nicked dna molecule poorly presumably due to poor binding of this substrate ( 65,66 ) .
the use of mutl as a specific loading factor at the nick created by muth overcomes this limitation and ensures the loading of uvrd on the biological substrate .
loading of uvrd by mutl would also explain the ability of uvrd to unwind toward the mismatch .
the mismatch repair reaction has bidirectional capability since the hemi - methylated d(gatc ) site may be located on either side of the mismatch [ see figure 1 ; ( 17,18 ) ] .
therefore , in order for uvrd to unwind toward the mismatch it must be loaded onto the appropriate strand to unwind with its known polarity . if mutl functions to load uvrd on the dna , this provides a mechanism to load uvrd exclusively on the appropriate strand
. this would prevent uvrd from unwinding non - specifically in both directions as was observed for uvrd - catalyzed unwinding on nicked substrates in the absence of mismatch repair proteins ( 65,66 ) .
the model for mutl - stimulated unwinding of dna by uvrd presented above predicts that the dna binding activity of mutl is essential .
the role of dna binding by mutl in the process of mismatch repair has been debated in the literature for the last 14 years . while there is considerable evidence suggesting that mutl binds dna ( 44,48,50 )
, there is also evidence to the contrary ( 52 ) , and recent experiments have suggested that dna binding may be an artifact of in vitro experiments ( 35 ) .
here we summarize new data obtained using biochemical and genetic assays to characterize a mutl point mutant ( mutl - r266e ) in an effort to evaluate the biological importance of dna binding by mutl .
taken together , the in vivo and in vitro results strongly suggest that mutl must bind dna as part of the mmr process ( 49 ) . mutl - r266e has been described as having reduced dna binding affinity ( 42,44 ) .
the crystal structure of dimeric mutl ( 43 ) positions arginine 266 facing inward and a previous report ( 29 ) has suggested that it could interact with the negatively - charged backbone of dna .
thus , arginine 266 may be a primary amino acid involved in recognizing the dna through electrostatic interactions .
purified mutl - r266e retains the biochemical properties of wild - type mutl that do not involve dna binding .
these properties include : ( i ) basal atp hydrolysis , ( ii ) an ability to interact with muth , muts , and uvrd and ( iii ) the ability to dimerize .
these results demonstrate that the mutant protein retains both its tertiary structure and its dimeric form .
however , the properties dependent upon dna binding are severely compromised in this mutant ( 49 ) .
the basal atpase activity exhibited by the mutant protein was not stimulated by the addition of ssdna , whereas the basal atpase of wild - type mutl was significantly stimulated by the addition of ssdna .
the mutant protein was also significantly reduced in its ability to stimulate the unwinding reaction catalyzed by uvrd , although at high concentrations , it was able to stimulate uvrd on a partial duplex dna substrate . with these characteristics in mind , it is not unexpected that the mutl - r266e exhibits a strong mutator phenotype .
we conclude , based on both genetic and biochemical data , that dna binding by mutl is critical for mmr consistent with the model for mutl - stimulated unwinding catalyzed by uvrd proposed above .
we note there is significant support for this conclusion in studies involving mmr in eukaryotes . in yeast
, it has been demonstrated that mutl homologues must bind dna in order for mmr to occur ( 68 ) .
point mutations in the yeast homologues ( pms1-k328e and mlh1-r273e , r274e ) , similar to the point mutation analyzed here , increase the mutation frequencies and rates in vivo .
an interaction between mutl and uvrd was demonstrated several years ago using the yeast two - hybrid system and confirmed in biochemical studies ( 37 ) .
the yeast two - hybrid analysis revealed a direct interaction between uvrd and mutl , and deletion analysis indicated that critical residues for the interaction with uvrd were located between amino acids 397 and 438 and after amino acid 559 of the 615 amino acid mutl protein .
it was not possible to localize the region on uvrd responsible for binding to mutl using this approach since removal of either the n- or c - terminal ends of uvrd eliminated the two - hybrid interaction .
the recent solution of the structure for the c - terminal domain of mutl ( 29 ) has allowed a prediction of the interaction site between uvrd and mutl .
( 60 ) and the folding of c - terminal domain of mutl , it is likely that uvrd interacts with a region on mutl involving a portion of the disordered linker between the n- and c - terminal domains of mutl that lies nearest the c - terminal domain and the mutl c - terminus .
consistent with this assignment is the fact that the n - terminal domain of mutl , which does not include the disordered linker region , fails to stimulate the unwinding reaction catalyzed by uvrd ( 29 ) . however , the n - terminal domain has been suggested to interact with uvrd - based on crosslinking studies ( 29 ) .
the amount of crosslinked protein observed in this study was extremely low and may not reflect a significant interaction .
we have shown that deletion of the last 20 amino acids of mutl significantly reduces the mutl uvrd interaction in both physical and functional assays ( s.r .
however , an alternate interpretation of the structural data for the c - terminal domain ( 61 ) suggests that the c - terminal end is directly involved in dimer formation and that a truncation lacking the c - terminal 20 amino acids should be a monomer instead of a dimer .
our recent experiments with this truncation mutant indicate that the protein is , in fact , a dimer as originally suggested ( 29 ) .
this conclusion was arrived at using gel exclusion chromatography at an ionic strength that is nearly physiological ( 200 mm ) and analytical ultracentrifugation .
we suggest that uvrd is likely to directly interact with the linker region and the c - terminal end of mutl .
these two regions are located near one another in the 3d model of mutl ( 29 ) .
importantly , the mutlc20 deletion mutant maintains 60% of the atpase activity associated with mutl , binds dna , interacts with muts and stimulates muth - directed nicking in a reaction that is dependent on both muts and the presence of a mismatch base pair ( s.r .
thus , the protein is properly folded and capable of making all the required protein protein interactions necessary for mismatch repair .
however , mutlc20 fails to stimulate uvrd in helicase activity assays and does not complement a mutl deletion in genetic complementation studies .
thus , the c - terminus of mutl is essential for mmr in vivo as recently reported ( 61 ) and the interaction between mutl and uvrd is essential for loading uvrd onto the repair substrate and is essential for full functionality of the mmr pathway .
we and others have shown that mutl dramatically stimulates the unwinding activity of uvrd ( 38,47,48 ) .
previously , we proposed that mutl loads uvrd productively onto the dna for unwinding but does not clamp uvrd on the dna during the unwinding reaction ( 48 ) . these experiments ,
performed using model dna substrates and in the absence of other mismatch repair proteins , also suggested that loading of uvrd by mutl was likely to be an iterative process .
the unwinding reaction catalyzed by uvrd demonstrates a limited processivity of 4050 bp ( 54 ) yet dna repair tracts can be up to 1 kb in length .
however , the processivity of uvrd as a translocase is significantly higher ( 2400 600 nt ) ( 62 )
. thus , the iterative loading of uvrd by mutl may address the issue of how to produce long repair tracts using a helicase with limited processivity . the first indication that mutl acted to load uvrd onto dna came from dna binding studies showing that the addition of mutl increased the affinity of uvrd for dna .
electrophoretic gel mobility shift experiments revealed that uvrd , in the presence of amp - pnp , formed a weak complex with ssdna that dissociated during the course of electrophoresis and was difficult to detect . in the presence of mutl , a supershifted mutl
ssdna complex indicating that mutl + uvrd formed a specific complex with a greater affinity for ssdna than uvrd alone ( 48 ) . based on these results
two possibilities were considered ; ( i ) mutl increased the rate of uvrd association with the dna or ( ii ) mutl decreased rate of dissociation of uvrd from ssdna .
an increased rate of association of uvrd with ssdna would be reflected as increased loading of uvrd onto model helicase substrates . in single turn - over experiments with a 20 bp partial duplex substrate , preincubation of uvrd and mutl with the dna resulted in a stimulation of the amount of product produced reflecting an increase in the amount of productively loaded uvrd .
the concentration at which mutl was half saturating for the burst phase amplitude of uvrd - catalyzed dna unwinding ( 40.2 9.7 nm ) was similar to the kd of mutl for binding partial duplex dna ( 24.3 0.7 nm ) .
this result was interpreted to indicate that binding of mutl to dna was important for its role in stimulating the unwinding reaction catalyzed by uvrd and that mutl was stimulating the loading of uvrd onto the dna substrate . if mutl decreased the uvrd dissociation rate one could envision mutl functioning as a clamp , keeping uvrd tethered to ssdna and effectively increasing its processivity .
first , unwinding assays with a 148 bp blunt duplex substrate , well in excess of the measured processivity of uvrd , failed to detect increased unwinding in the presence of mutl after the addition of a ssdna trap .
second , single turn - over assays with a 92 bp partial duplex dna compared with a 20 bp partial duplex dna also indicated that mutl was not acting to alter the processivity of uvrd .
under identical conditions , a smaller fraction of 92 bp partial duplex molecules were unwound in comparison to 20 bp molecules .
if mutl were acting to increase the processivity of uvrd then the same fraction of substrate should have been unwound in each case . moreover ,
the degree of stimulation was similar on both substrates suggesting that stimulation was independent of substrate length and , therefore , likely a loading phenomenon .
increased loading of uvrd by mutl was also investigated using long dna substrates to model the lengths of dna substrates likely to be encountered in vivo .
data from multiple turn - over helicase reactions with a 750 bp blunt duplex substrate and an 851 bp partial duplex substrate support the notion that mutl loads uvrd onto dna , and further suggest that loading by mutl is likely to be an iterative process .
unwinding of the two long substrates was generally described by a burst phase followed by a steady - state phase .
the burst phase for these reactions reflects unwinding by those uvrd molecules that were pre - loaded onto the dna substrate .
comparison of the unwinding kinetics exhibited by uvrd on the 750 bp blunt duplex dna in the presence or absence of mutl clearly showed that in the absence of mutl there was no burst phase .
this reflects an inability of uvrd alone to efficiently pre - load on blunt duplex substrates as shown previously ( 54 ) . in the experiments using the 750 bp blunt duplex and 851 bp partial duplex substrates
the increased productive loading of uvrd is likely to be continuous over the entire course of the unwinding reaction . considering the reported processivity for uvrd ( 4050 bp ) , completion of unwinding of these longer substrates and detection of the significant burst phase in the unwinding assay with the 750 bp blunt duplex dna requires multiple binding events by uvrd .
based on these results a model was proposed to explain the stimulation of uvrd - catalyzed dna unwinding by mutl ( figure 2 ) .
the first step is the loading of uvrd onto the dna . in the presence of mutl
after it is loaded uvrd begins to unwind the duplex . in the presence of mutl additional molecules of uvrd
are loaded behind the leading molecule of uvrd and the high concentration of uvrd may increase the overall rate of uvrd - catalyzed unwinding .
eventually , the leading molecule of uvrd will dissociate from the duplex since uvrd translocates through duplex dna an average of ten steps ( 4050 bp ) before dissociating ( 54 ) . in the case of uvrd alone ,
when the leading molecule dissociates the partially unwound duplex can reanneal and the whole process must start over . on the other hand , in the presence of mutl multiple uvrd molecules have been loaded onto the duplex and the dna does not reanneal ; the additional uvrd molecules translocate along the ssdna template and continue unwinding .
this is consistent with the observation that uvrd is considerably more processive as a translocase moving along ssdna ( 62 ) than as a dna helicase .
as noted above , mutl - catalyzed atp hydrolysis is required for mmr ( 46,51 ) . however , the rate of mutl - catalyzed atp hydrolysis is slow and it seems unlikely this fuels active translocation along the dna lattice suggesting that atp hydrolysis may play another role ( 30,35 ) .
perhaps stimulation of the uvrd - catalyzed unwinding reaction requires the hydrolysis of atp by mutl .
if this were the case , then the mutl - catalyzed atp hydrolysis requirement in mmr might be explained by the requirement for atp hydrolysis in loading uvrd to begin resection of the damaged dna strand .
such a requirement would be consistent with the previous characterization of mutl as a molecular matchmaker ( 63 ) .
using a mutl point mutant , mutl - e29a , that binds but does not hydrolyze atp , robertson et al .
( 64 ) have demonstrated that mutl - catalyzed atp hydrolysis is not required for mutl - dependent stimulation of the uvrd unwinding reaction .
in fact , the unwinding reaction catalyzed by uvrd on both a partial duplex substrate and a blunt end duplex substrate was significantly more efficient in the presence of mutl - e29a ; maximal stimulation of the unwinding reaction occurred at much lower concentrations of mutl - e29a than observed with the wild - type protein .
this was not the result of higher affinity binding of mutl - e29a to the dna substrate since binding to both a partial duplex ligand and a ssdna ligand by mutl - e29a was similar to that of the wild - type protein .
importantly , it is the atp - bound form of mutl that is specifically responsible for stimulating uvrd ( 64 ) . a second mutl point
mutant , mutl - d58a , which does not bind atp does not stimulate the unwinding reaction catalyzed by uvrd .
thus , the atp - bound form of mutl stimulates uvrd - catalyzed unwinding while the atp free form of mutl does not stimulate uvrd - catalyzed unwinding .
ban and yang ( 44 ) have shown that binding of atp causes the n - terminal domain of mutl to dimerize and perhaps this causes the protein to clamp onto the dna substrate . in the context of mmr
this may provide a loading platform for uvrd from which helicase molecules could be continuously loaded onto the dna substrate as long as mutl remained clamped on the dna . in the absence of atp hydrolysis ( i.e. with mutl - e29a )
mutl remains bound and loads multiple molecules of uvrd resulting in a very dramatic stimulation of uvrd - catalyzed unwinding at low concentrations of mutl .
if this is the case then mutl - catalyzed atp hydrolysis acts to regulate the loading of uvrd onto the mmr intermediate .
first , it serves to further refine our understanding of the role of atp binding and hydrolysis catalyzed by mutl in mmr .
it has been established previously that atp binding but not hydrolysis by mutl is required for interaction with muts ( 42 ) and it has been demonstrated that the atp - bound form of mutl stimulates the latent endonuclease reaction associated with muth ( 37 ) .
thus , mutl - catalyzed atp hydrolysis is required after strand incision and the beginning stage of strand resection .
second , these results suggest the possibility that mutl - catalyzed atp hydrolysis regulates the amount of uvrd loaded onto the dna substrate . in the absence of mutl - catalyzed atp hydrolysis
the unwinding step ( catalyzed by uvrd ) may be uncoupled from the rescission step ( catalyzed by an exonuclease ) such that the exonuclease responsible for removing the unwound damage - containing nascent strand is unable to keep up with the advancing helicase .
if this were the case then repair events might not be properly completed due to this uncoupling and there would be an increase in mutation rate as was observed when mutl - e29a was substituted for mutl ( 51,64 ) .
the biological advantage of using mutl as an auxiliary factor that increases the initiation rate and progressive unwinding rate by uvrd in mismatch repair is clear .
the mismatch repair pathway requires , in some instances , the unwinding of long tracts of dna ( 22 ) . in the absence of mutl
the low processivity of uvrd seems inconsistent with the long repair patch lengths in light of the observed efficiency of mismatch repair .
therefore , the iterative loading of uvrd by mutl would increase both the rate and the efficiency of the reaction , and enable uvrd to unwind the long tracts required in this pathway despite its relatively low intrinsic processivity .
in addition , it is known that uvrd unwinds a nicked dna molecule poorly presumably due to poor binding of this substrate ( 65,66 ) .
the use of mutl as a specific loading factor at the nick created by muth overcomes this limitation and ensures the loading of uvrd on the biological substrate .
loading of uvrd by mutl would also explain the ability of uvrd to unwind toward the mismatch .
the mismatch repair reaction has bidirectional capability since the hemi - methylated d(gatc ) site may be located on either side of the mismatch [ see figure 1 ; ( 17,18 ) ]
therefore , in order for uvrd to unwind toward the mismatch it must be loaded onto the appropriate strand to unwind with its known polarity . if mutl functions to load uvrd on the dna , this provides a mechanism to load uvrd exclusively on the appropriate strand .
this would prevent uvrd from unwinding non - specifically in both directions as was observed for uvrd - catalyzed unwinding on nicked substrates in the absence of mismatch repair proteins ( 65,66 ) .
the model for mutl - stimulated unwinding of dna by uvrd presented above predicts that the dna binding activity of mutl is essential .
the role of dna binding by mutl in the process of mismatch repair has been debated in the literature for the last 14 years . while there is considerable evidence suggesting that mutl binds dna ( 44,48,50 )
, there is also evidence to the contrary ( 52 ) , and recent experiments have suggested that dna binding may be an artifact of in vitro experiments ( 35 ) .
here we summarize new data obtained using biochemical and genetic assays to characterize a mutl point mutant ( mutl - r266e ) in an effort to evaluate the biological importance of dna binding by mutl .
taken together , the in vivo and in vitro results strongly suggest that mutl must bind dna as part of the mmr process ( 49 ) .
mutl - r266e has been described as having reduced dna binding affinity ( 42,44 ) .
the crystal structure of dimeric mutl ( 43 ) positions arginine 266 facing inward and a previous report ( 29 ) has suggested that it could interact with the negatively - charged backbone of dna .
thus , arginine 266 may be a primary amino acid involved in recognizing the dna through electrostatic interactions .
purified mutl - r266e retains the biochemical properties of wild - type mutl that do not involve dna binding .
these properties include : ( i ) basal atp hydrolysis , ( ii ) an ability to interact with muth , muts , and uvrd and ( iii ) the ability to dimerize .
these results demonstrate that the mutant protein retains both its tertiary structure and its dimeric form .
however , the properties dependent upon dna binding are severely compromised in this mutant ( 49 ) .
the basal atpase activity exhibited by the mutant protein was not stimulated by the addition of ssdna , whereas the basal atpase of wild - type mutl was significantly stimulated by the addition of ssdna .
the mutant protein was also significantly reduced in its ability to stimulate the unwinding reaction catalyzed by uvrd , although at high concentrations , it was able to stimulate uvrd on a partial duplex dna substrate . with these characteristics in mind , it is not unexpected that the mutl - r266e exhibits a strong mutator phenotype .
we conclude , based on both genetic and biochemical data , that dna binding by mutl is critical for mmr consistent with the model for mutl - stimulated unwinding catalyzed by uvrd proposed above .
we note there is significant support for this conclusion in studies involving mmr in eukaryotes . in yeast
, it has been demonstrated that mutl homologues must bind dna in order for mmr to occur ( 68 ) .
point mutations in the yeast homologues ( pms1-k328e and mlh1-r273e , r274e ) , similar to the point mutation analyzed here , increase the mutation frequencies and rates in vivo .
a model for the role of mutl in e.coli mismatch repair , based on the data reviewed above , can be summarized as follows . in the first step , a mismatch generated during replication is recognized by the muts dimer and a muts mutl interaction mediates communication with muth bound at the nearest hemi - methylated d(gatc ) site .
precisely how mutl facilitates the communication between the mismatched base pair and muth bound at the hemi - methylated d(gatc ) site is still uncertain .
after nicking on the nascent strand by muth , uvrd is loaded by mutl and initiates unwinding at the nick toward the mismatch .
the mismatch repair system displays bidirectional capability and correction of a mismatched base can be directed by a hemi - methylated d(gatc ) sequence on either the 5 or 3 side of the error ( 17,18 )
. however , uvrd unwinds exclusively in a 3 to 5 direction with respect to the bound dna strand ( 39,40 ) . therefore
, the capacity for bidirectional unwinding from a nick necessitates the ability of uvrd to load onto either one of the dna strands .
we and others ( 29,38,48 ) have suggested that one role for the interaction between mutl and uvrd is to orient the helicase , by loading it onto the appropriate dna strand at the nicked d(gatc ) site , so that it unwinds in the proper direction for mismatch excision .
this would explain the in vitro observations of modrich and colleagues ( 18,38 ) that uvrd preferentially unwinds toward the error in the context of the mismatch repair system and is consistent with the fact that mutl directly interacts with uvrd .
studies using model dna substrates indicate that the atp - bound form of mutl stimulates uvrd - catalyzed unwinding presumably by loading uvrd onto the dna substrate .
we hypothesize that mutl remains bound to the dna , continuously loading molecules of uvrd , until one or both of the bound atp molecules are hydrolyzed to adp and pi .
after an atp hydrolysis fueled conformational change , mutl is released from the dna and stops loading uvrd .
if this is the case , then one role of the mutl atpase is to act as a molecular switch to facilitate initiation of the excision event which involves activating the muth endonuclease and loading uvrd onto the dna .
the processivity of uvrd - catalyzed unwinding of duplex dna has been estimated at 4050 bp in one study ( 54 ) and 250 bp in another study ( 55 ) . however , repair tracts in vivo can be up to 1 kb in length ( 21,41 ) , and we have demonstrated significant unwinding of duplex dna substrates in excess of 850 bp in the presence of mutl . in a recent study by fischer et al . (
62 ) the processivity of uvrd was determined to be 2400 + 600 bases as the protein translocates along ssdna .
we suggest that the multiple uvrd molecules loaded onto the dna by mutl are able to unwind 12 kb of duplex dna in the following way : as one molecule of uvrd dissociates from the dna ( due to its intrinsic processivity as a helicase ) , a second molecule of uvrd takes its place , and so on , allowing unwinding to continue uninterrupted .
this helps to ensure that , no matter what the distance between the initiating nick and the mismatch , adequate dna is unwound by uvrd to complete repair of the mismatch .
given its multiple roles in mmr , mutl is likely to be the master coordinator in the mismatch repair reaction .
the interaction of mutl with the three mismatch repair proteins muts , muth and uvrd and with dna is critical for the proper 3d arrangement of these proteins , as well as for the appropriate sequential timing for each event in the repair reaction .
however , the results reviewed here begin to explain the mechanism by which mutl stimulates uvrd - catalyzed dna unwinding , demonstrate the importance of mutl binding to dna and indicate that atp hydrolysis by mutl is not required for the loading of uvrd .
in addition , they serve to better position the site of mutl - catalyzed atp hydrolysis within the mismatch repair pathway .
it is now clear that mutl - catalyzed atp hydrolysis is required after strand excision has begun .
it is becoming more important to identify those regions of mutl responsible for the interaction with the other components of the mismatch repair pathway to understand how mutl functions in all of its roles .
the base base mismatch is recognized by the muts homodimer and a ternary complex containing dna , mutl and muts is formed in a reaction requiring atp .
this complex communicates with the nearest hemi - methylated d(gatc ) sequence in some manner that is not yet fully understood and stimulates nicking on the unmethylated ( nascent ) dna strand by muth to provide strand discrimination .
the nearest hemi - methylated d(gatc ) site may be located on either side of the mismatch providing mmr with bidirectional capability .
uvrd is loaded by mutl and unwinds the duplex dna beginning at the nick and extending toward the mismatch .
the damaged dna strand is degraded by one of several ssdna exonucleases involved in mismatch repair depending on the polarity of the required strand resection .
the ssdna gap is stabilized by the binding of ssdna binding protein and the gap is filled by dna polymerase iii .
the resulting nick is sealed by dna ligase to restore the integrity of the dna stand and the d(gatc ) is fully methylated by dam methylase .
model for the mechanism of mutl - stimulated unwinding catalyzed by uvrd . a model for unwinding by uvrd ( a ) or uvrd + mutl ( b ) on a nicked dna substrate is shown .
step 1 is preloading ; step 2 is with one molecule of uvrd loaded ; step 3 is unwinding and step 4 is after dissociation of a molecule of uvrd .
this figure is reproduced from ( 48 ) . a model depicting the loading of uvrd by mutl in mmr .
the nick is introduced by muth on the unmethylated dna strand at a hemi - methylated d(gatc ) site .
a dimer of mutl , in the atp - bound form , is shown loading uvrd onto the nicked dna .
the uvrd loading event ensures that the helicase is loaded onto the correct strand to translocate in the 3 to 5 direction toward the mismatch .
mutl loads multiple molecules of uvrd to ensure the unwinding of repair tracks that may be in excess of 1 kb in length .
we hypothesize that atp hydrolysis by mutl releases the protein from the dna and stops the loading of uvrd .
Output:
| uvrd is a superfamily i dna helicase with well documented roles in excision repair and methyl - directed mismatch repair ( mmr ) in addition to poorly understood roles in replication and recombination .
the mutl protein is a homodimeric dna - stimulated atpase that plays a central role in mmr in escherichia coli .
this protein has been characterized as the master regulator of mismatch repair since it interacts with and modulates the activity of several other proteins involved in the mismatch repair pathway including muts , muth and uvrd . here
we present a brief summary of recent studies directed toward arriving at a better understanding of the interaction between mutl and uvrd , and the impact of this interaction on the activity of uvrd and its role in mismatch repair . |
PubmedSumm7859 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: anyone who has ever suffered jet lag knows firsthand that our bodies are persistent in how they keep track of time .
this timekeeping system structures the different physiological processes to work together over the course of the day in synchrony with the physical world .
the master network coordinating this timing system is based in the suprachiasmatic nucleus ( scn ) of the hypothalamus , where neurons exhibit circadian ( lit . about a day ) rhythms in their electrical activity and are driven by cell - autonomous molecular feedback loops.1 these neural activity rhythms are critical for circadian output and are reciprocally required for the sustained generation of their own internal molecular oscillations .
output from this scn clock regulates oscillatory sleep and arousal control centers , leading downstream to the organization of our daily sleep
wake behavior ( figure 1 ) . during jet lag , a rapid shift in the sleep
wake cycle transiently disrupts this coordinated regulation , and ( 1 ) the clock network loses synchrony with the external environment and ( 2 ) the many oscillators within our bodies become desynchronized with each other .
temporary circadian desynchronization has many effects , but the most obvious are impaired sleep at night and excessive daytime sleepiness during the day , which bring patients to the attention of the sleep clinician .
this article provides a framework for understanding the biological basis of jet lag and for recommending management strategies .
understanding jet lag can help us address the broader problem of circadian misalignment , which has increasingly been associated with increased risk for cancer , metabolic disease , cardiovascular dysfunction , mood disorders , and cognitive decline.24
although there have been a number of attempts to model the processes that regulate the sleep
wake cycle , the two - process model of sleep regulation has had the most widespread acceptance across the chronobiological community ( figure 2 ) . in the simplest terms
, this model proposes that sleep propensity is governed by two predominant , sometimes competing processes : one being a homeostatic load accumulated of sleep need based on time since last sleep episode , termed
process s , and another being a circadian - controlled rhythm in wakefulness or sleep , termed process c.57 the two major processes governing basal sleep organization keep track of time but can be thought of very differently : the circadian component , process c , is an oscillator that runs indefinitely and consistently to dictate the time at which events occur , whereas the process regulating homeostatic sleep ( process s ) operates like an hourglass which tells intervals of time .
sleep and wake behaviors are the sum result of several oscillatory and hourglass processes acting together in concert with external signals that regulate their precise initiation , termination , and duration , but for the sake of modeling , their regulatory components have been simplified and reduced to process s and process c.8,9
although sleep itself is a behavior , in humans and some animal models , we can quantify different properties of sleep by measuring cortical activity with the electroencephalogram ( eeg ) .
eeg recordings have been useful in parsing levels of arousal and sleep , such as rapid eye movement ( rem ) and nonrapid eye movement ( nrem ) , and also in relating certain electrophysiological correlates with other parameters related to sleep and wake states .
evidence suggests that delta power or slow - wave activity ( swa ) during nrem sleep can be used to estimate process s , as delta power increases logarithmically as waking is prolonged.5,6 conversely , core body temperature is often used as a measure of process c , as it is relatively free from masking by movement artifacts and itself is a robust rhythm .
sleep propensity is greatest during the falling limb of the circadian body temperature rhythm and decreases on the rising limb.10 there have been different hypotheses presented as to how specifically the circadian pacemaker dictates sleep wake behavior at a physiological level.1113 although there is no definitive consensus , data support a model by which process c actively promotes different aspects of each behavioral state rather than passively gating state transitions.14 at an additional level of temporal regulation , kleitman15 proposed that humans followed a basic rest activity cycle ( brac ) that exhibits an ultradian rhythm .
rem sleep cycles through the course of the night , and ultradian rhythms in alertness during the course of the day with a similar period
wake rhythm could be a series of thresholds set by ultradian variations coupled to circadian variations .
thus during certain times of the day , the circadian system promotes cycling levels of arousal , whereas during other times , it promotes cycling through different stages of sleep .
interestingly , there are certain aspects of sleep that appear to be strongly regulated by the circadian system that incorporate this organization .
both human and animal studies have shown that there are circadian rhythms regulating arousal and rem sleep , but nrem sleep appears to be more strongly under the control of a sleep homeostatic drive.9,14 in understanding how the circadian system influences sleep and wake , it is important to remember that process c is one of many oscillatory processes , distinguishable from other oscillatory processes in the circadian system , but sharing a common point of origin .
jet lag and other disruptions in process c may be the result of perturbations in the circadian input pathway , the master oscillatory network in the scn of the hypothalamus that organizes the body s clocks , or in the specific outputs along the sleep
in mammals , the part of the nervous system responsible for the organization of circadian behavior lies in a paired structure in the hypothalamus known as the scn .
although other cells in the body show oscillatory properties , the clock within the scn is considered the master oscillator that coordinates daily rhythms.1 the scn is a bilaterally paired nucleus made up of tightly compacted , small - diameter neurons just lateral to the third ventricle atop the optic chiasm .
subcortical light information is transmitted directly to the scn via the retinohypothalamic tract ( figure 1 ) , whereas thalamic and midbrain inputs modulate light information and transmit nonphotic signals.16 the scn integrates this environmental information and modifies the oscillatory activity of its neurons to create coherent , robust , neural , and humoral signals to the rest of the brain and periphery.17 the neural outputs of the scn largely travel to other hypothalamic regions including the subparaventricular zone and the dorsomedial nucleus.1820 these hypothalamic relay nuclei send projections throughout the central nervous system and endocrine system , providing multiple pathways by which the scn can convey temporal information to a diffuse network of sleep and arousal - promoting centers.21,22 interestingly , this communication appears to be bidirectional , as sleep state information is communicated back to the scn as well.23 the expression of behavioral rhythms involves a far more complex route than a linear pathway from a single scn neuron to sleep wake activity .
animal studies have indicated that part of the scn is primarily involved in spontaneous rhythm generation , whereas the other part is primarily involved in conveying environmental resetting signals back to the rhythm generating neurons.24 downstream of the scn , structures receiving temporal cues from the scn have to incorporate this temporal information among a vast network of other inputs . to make matters more complex , other neurons and cells throughout the body show endogenous oscillations themselves in transcriptional activity of clock genes.4 thus , the scn exerts its actions on other clock - like systems throughout the body rather than just by amplifying its own timekeeping signal as the body s only rhythm . in sleep ,
the scn signal is integrated across sleep and wake - control centers , and activity specific to this pathway generates the rhythms observed in process c. under certain experimental conditions , process c can be uncoupled from other oscillations that utilize separate neural pathways.18,25 scn lesion studies in animals have primarily been used to model sleep wake regulation in the absence of process c. in addition to exhibiting arrhythmicity in the timing of the sleep
wake cycle , some studies show that scn - lesioned animals will sleep the same amount over a 24-hour period , but this will be expressed in a fragmented ultradian rhythm over the course of the day.26,27 there are studies to suggest that total sleep time also increases after lesioning , but this might be a species - specific phenomenon.12,13 although rebound in response to sleep deprivation is relatively similar in the absence of the scn,26 the appropriate timing of this rebound is disrupted .
animal studies have also shown that rem sleep appears to be highly regulated by the circadian system.25 studies of lesioned rats showed that transitions into rem sleep are facilitated by the scn during the rest phase , but the amount of rem sleep , once initiated , is determined primarily by homeostatic mechanisms.28 there are distinctly robust contributions of process c to arousal , rem sleep , and sleep consolidation.14 the role of process c in both arousal and rem sleep may be explained by the previously described brac model in which there is a strong circadian regulation of the similar cortical activity accompanying wakefulness and rem sleep .
there is a very short and specific window , related in phase to the endogenous body temperature rhythm ( as it approaches its daily minimum ) , in which one may fall asleep and maintain this state throughout the night.14 one explanation for this is that the circadian sleep wake signal might be suppressing a drive toward arousal during the second half of a sleep period.10,14 in insomnia , this drive might be insufficient , ultimately leading to inappropriately timed wakefulness.29 the misalignment of the core body temperature minimum with the light - dark cycle is a major target for the treatment of jet lag - like desynchrony .
circadian rhythms of both nocturnal and diurnal mammals are most sensitive to light resetting during the night .
although there are other , nonphotic means to resetting the clock , light has been shown to be the most robust.30 a low intensity pulse of 180 lux light ( typical office lighting ) that is appropriately timed is sufficient to significantly reset circadian rhythms in humans.31 the direction and magnitude of light resetting depend on the endogenous phase of the clock , and this relationship is summarized in the form of a phase response curve ( prc ) . although light - based prcs have been extensively researched and documented,32,33 they all suggest the same basic pattern : in the first part of the night , light delays circadian rhythms .
in contrast , light exposure during the later part of the night or early morning advances rhythms to an earlier phase , resulting in earlier bedtime and waking up earlier in the morning .
the point at which a light cue switches its effects on the clock from delaying to advancing is around the core body temperature minimum , a time during which feelings of subjective sleepiness are strongest.32 in the middle of the subjective day , when one is normally exposed to high levels of ambient light , there is little to no shifting effect of light on circadian rhythms .
it is difficult to examine light effects on sleep independently of circadian rhythms as light has arousing effects that can mask rhythms in activity without resetting the circadian clock.34 light affects sleep both through process c and concurrently through other mechanisms , namely midbrain arousal circuits and hormonal signaling , which , like circadian rhythms , are directly connected to the non - image - forming visual system.35,36 light reaches the scn directly via a projection of intrinsically photosensitive retinal ganglion cell axons that contain the recently discovered photopigment melanopsin ( figure 1).36,37 this pigment is most sensitive to light in the blue wavelength range38 and is necessary for normal resetting of behavioral rhythms in animals following alterations in their light - dark cycle.3941 human circadian rhythms are most sensitive to resetting at light wavelengths around 460 nm , which coincides with the photoresponsive range of melanopsin.42 interestingly , melanopsin - containing neurons not only project to the scn , but also to the pretectum,36 where light acts independently of the circadian system to acutely induce sleep in nocturnal mammals during their active phase.43 melanopsin knockout mice fail to sleep during a nighttime light pulse and show less total sleep time and swa following sleep deprivation.44 thus this photoreceptive pathway affects sleep both dependent and independent of process c through multiple targets .
many scn efferents are routed through the paraventricular hypothalamus , which signals to the autonomic intermediolateral cell column of the spinal cord , and eventually to the pineal gland to produce the nocturnal hormone melatonin.45 melatonin is carried throughout the body with targets in both the brain and periphery , it exhibits a robust circadian rhythm , and it is synthesized in the pineal gland in the absence of light.46 melatonin receptors are strongly expressed in the scn , and melatonin is thought to feedback to the scn to modulate its rhythmic profile.46 interestingly , the scn has been shown to be important for both the circadian rhythm in melatonin synthesis as well as the light - induced suppression of melatonin.47 although the scn is implicated in both pathways , different subregions have been mapped out for each effect on melatonin ( circadian vs acute).48 this would suggest that at least some environmental information that resets the clock does so downstream of the master oscillator in the scn .
although in mammals melatonin is not necessary for the expression of behavioral rhythmicity , it is necessary in birds and reptiles.49 in humans , increases in melatonin at the appropriate circadian phase are associated with inducing sleepiness.50 exogenous melatonin at higher doses also has this hypnotic effect , and the mechanism by which melatonin induces sleepiness may be explained by vasodilatory effects . in warm - blooded animals , melatonin is thought to adjust the setpoint at which core body temperature is regulated , thereby allowing higher blood flow to distal areas of the body and heat loss from the body s core.51 thermosensitive neurons in the distal body communicate temperature information back to the preoptic anterior hypothalamus , which contains sleep - active neurons that send inhibitory projections to arousal - promoting circuits in the brain.52 although this pathway does not by itself account for all sleep wake regulation , it does offer one viable explanation as to the association between sleepiness and the daily core body temperature minimum .
when circadian rhythm disruptions occur , desynchrony between clock systems within an individual as well as desynchrony with the environment follows . even at the level of the scn , different subregions shift at different rates.53 in general ,
a phase shift within the scn is relatively rapid , but in other parts of the brain and also in the periphery , it can take many days to reset rhythms .
outputs from the circadian clock regulate key components in physiological pathways to drive rhythms in these systems , but the molecular components of the clock in each cell can also comprise cellular pathways with additional functions , including regulating metabolism and the cycle of cell division.4 it is , therefore , important to understand the mechanisms behind desynchrony , as these disruptions not only affect temporal organization of networks , but also of the basic functions for cell survival . although symptoms of jet lag are generally temporary , they can be disruptive and include difficulty sleeping , excessive daytime sleepiness , general malaise , impaired performance , and gastrointestinal ( gi ) upset.54 the severity of jet lag symptoms and the ability to adapt to the new time zone are typically influenced by the direction of travel ( slower adaptation when traveling east ) and the number of time zones crossed.32,33 not all travelers crossing time zones suffer from jet lag to the same degree , and these differences probably result from individual variation , similar to those reported for adaptation to shift work.32 although experimentally it has been shown that circadian rhythms can be shifted by light independent of shifts in the sleep
it has been demonstrated , for instance , that sleep deprivation can damp the effects of a light - based phase shift,56 and that bright light , conversely , can counteract some of the eeg changes that normally accompany sleep deprivation.57 studies following transatlantic airline passengers show that there are specific , sleep quality changes altered as a result of jet lag . after an eastward journey , when the sleep wake cycle is shifted ahead , travelers show increased difficulty in initiating sleep by the second night that continues for the next few days in the new time zone.58 this difference is not observed on the first night , suggesting that immediately following eastward travel , process s can induce sleep despite a misaligned process c , possibly due to sleep deprivation or fatigue associated with travel .
when simulating eastbound travel in the lab through advancing the time of sleep onset , there is an increase in time spent awake in the earlier part of the evening during the night of the shift.59 the results from these 2 paradigms suggest that the act of traveling itself helps promote sleep on the first night in the new environment .
this travel - induced increase in sleep pressure independent of process c is supported by marked increases in stage 2 sleep on only the first night in the new time zone.58 there is interestingly a compensatory increase in rem sleep several nights later.58 changes in sleep quality after a phase delaying westward fight , in contrast , last fewer days when crossing the same number of time zones.32,58 westward bound travelers show increased swa on the first night in the new time zone , suggesting an increase in sleep pressure following travel ( much like in eastward travelers ) . simulating westbound fight in the lab , modeled by delayed sleep onset , results in an increased ( albeit nonsignificant ) trend in transitions to terminal wakefulness during the first night of the new sleep schedule as well . in both experimental paradigms
however , there is also an increase in sleep pressure that is due to an extended time since last sleep episode ( ie , an increase in process s ) . in this way
, westward travel is going to consistently involve an additional factor that increases sleep pressure for at least the first night following travel , as compared with eastbound travel.59 in summary , there are patterns in the changes of sleep quality following transmeridian travel that may present in the clinic . for the first day following travel , travelers are likely to fall asleep with less difficulty due to an increased sleep pressure that arises because of sleep deprivation and fatigue from traveling . if eastbound , after the first night , individuals will likely have more difficulty in initiating sleep from a few days to around a week following travel . in westward travel , there may be more difficulty in maintaining sleep later into the night , but this ( mis)alignment is often restored and sleep symptoms are greatly reduced within only a few days post travel.58 in the laboratory , timed bright light exposure in the early evening , which mimics the light resetting effects on the clock of traveling westward , results in increased time to fall asleep for 2 nights following light exposure when the timing of the sleep wake cycle is kept constant.60 the above experimental paradigm models what might occur upon returning home after traveling westward for a short - term trip .
the changes in sleep could be explained by the evening light delaying the rhythm in core body temperature , wherein the descent toward the temperature minimum is delayed and the associated sleep - related effects of this fall are also delayed .
if traveling from the opposite direction , there is a significant rise in late - night wakefulness observed following a morning light pulse ( ie , traveling eastward ) , which has phase advancing effects on the sleep wake cycle,61,62 but these effects are not significant in all studies.60 together , these data suggest that there are specific jet lag effects also experienced from short - term travel , and these can best be treated by keeping to one s home schedule and avoiding light during the times when their circadian clocks could be reset ( ie , during the subjective night , based on schedules before travel ) .
bright light alters subjective alertness during the day.63 these effects are likely independent of shifting the circadian clock , as they occur during the day s dead zone in which light has minimal effects on the circadian clock . during the night ,
when light would also affect process c , blue light reduces swa earlier in the nrem - rem ultradian cycle and increases swa later , at the expense of less rem sleep.63 there are more power density changes following blue rather than green light pulses , suggesting that the melanopsin pathway might be mediating these effects , which are specific but small .
similar specific effects are seen with polychromatic light.64 rem sleep shows some particular alterations to jet lag . in rats , there is an immediate increase in rem the night following an 8-hour advancement in the light - dark cycle ( simulating travel from los angeles to paris).65 this could be due to a rebound from rem loss during the initial schedule shift , or it could result from a shift of rem timing to earlier in the evening . in humans , melatonin taken in the early evening , which has clock - shifting effects similar to light exposure in the early morning ( eastward travel ) , rem duration increases independently of changes in nrem sleep.66 when traveling in the opposite direction and the clock is delayed , there is an increase in rem sleep latency.67 this effect could be due to an increase in swa and other components of nrem sleep that are associated with rebound to sleep deprivation , and rem might later show a compensatory rebound on subsequent nights .
an alternative explanation is that rem sleep has also been delayed to appear later in the evening because of a delay in the clock itself.58 there are also examples of other neurological effects of jet lag .
for instance , jet lag has been associated with more frequent sleep paralysis ( lack of muscle control after arousal from sleep ) episodes.68 the physiological prerequisite for sleep paralysis is sleep onset rem , and sleep onset rem results from elevated rem sleep pressure ( a homeostatic process involved in rem regulation).69 these trends support a model where jet lag induces an initial increase in nrem sleep immediately following travel independently of shifting process c. this increase in nrem sleep suppresses rem sleep initially , but eventually it triggers a compensatory rem sleep rebound.58 during this rebound , rem pressure is increased , as is the associated frequency of sleep paralysis .
in contrast to sleep paralysis , seizures are known to be more prevalent during the night , predominantly during nrem sleep.70 the incidence of seizures has also been shown to increase following transmeridian travel.71 this again could be accounted for by an increase in nrem sleep from the sleep deprivation accompanying jet lag .
there are a number of pathophysiological conditions associated with arousal state and sleep quality , and there is evidence to support the effective clinical application of circadian and sleep - based therapies in such cases .
for example , in alzheimer disease , patients in a hospital setting where light levels are often out phase or continuously inconsistent with normal ambient lighting experience a phenomenon called sundowning , in which they exhibit periods of confusion and mania during the subjective rest phase.72 there is also evidence linking different forms of depression to phase misalignments of the sleep
wake cycle , and sleep deprivation has been shown to be effective in short - term amelioration of some depressive symptoms.73 furthermore , restoring disrupted behavioral circadian rhythms by hypnotic drugs reduces some of the symptoms of cognitive decline found in an animal model of huntington disease.74 these studies and trends suggest that circadian synchrony of the sleep
a growing body of evidence suggests that the circadian system is an important therapeutic target , and this idea is starting to gain acceptance outside of the academic chronobiological community.75 treatment for jet lag focuses on aligning the circadian system to the appropriate environment .
when three or less time zones have been crossed , the symptoms of jet lag will persist only a short time , and the treatment strategy is better suited for fatigue associated with travel , which does not involve any major shifts in the clock itself.33 also , treating an individual to resynchronize to a new environment for only 12 days requires a number of phase shifts that will only be undone when traveling again , and so in cases of the short term , it is best to assume a temporal schedule in the new environment as close as possible to one s home schedule . since light is the major signal that shifts the sleep
if sleep is needed for a short - term trip , mild doses of prescription hypnotics can be helpful .
zolpidem ( 10 mg ) given for 3 consecutive nights starting with the first night sleep after travel has been shown to improve sleep in some seasoned travelers.76 the wake - promoting agent armodafinil ( the longer acting r - isomer of modafinil ) is also being considered for use in the treatment of jet lag sleep disorder .
strictly treating the symptoms of jet lag ( ie , treating only insomnia and/or sleepiness ) does not necessarily treat jet lag itself .
in fact , one must take care not to further shift the clock in the wrong direction when treating the symptoms of jet lag .
for instance , while a traveler may have caffeine for its arousal - promoting effects , the use of caffeine close to the time of sleep onset will result in difficulty falling or maintaining sleep.77 this often leads to exposure to light during the subjective night , which will further shift the clock out of phase with the new ambient light - dark cycle , resulting in further desynchrony . in order to avoid such a scenario ,
this involves utilizing the prc to time one s exposure and avoidance of light and other resetting cues . in treating jet lag , re - entraining the sleep
wake cycle involves shifting the core body temperature minimum back to nighttime in the new environment through appropriately timed cues.32 the most effective time to begin treatment is prior to travel . shifting without major insomnia or sleepiness is best achieved gradually , and so timed exposure to bright light a couple of hours later than normal along with a progressively later bedtime will help phase delay the clock beginning a couple of days before taking a large westbound journey.32 the opposite is true for an eastbound journey , with an emphasis placed on exposure to light earlier in the morning when waking up to shift the clock forward.32 in general , it takes more time to adjust to a phase advance than delay ( or traveling eastward compared with westward ) .
when phase advances are sufficiently large ( > 8 hours ) , it might be easier and faster to delay the clock until synchronized with the new environment .
mammalian photoreception and phase shifting to light are optimized for environmental lighting conditions , which are generally much stronger than that of room lighting .
light boxes have been effective in providing strong enough light directly to the eye to induce phase shifts , but this is not the case for all room lighting , especially when they are dimly lit .
therefore , the best source of phase shifting light is sunlight , followed by light from a light box .
light should contain wavelengths in the blue range , as this is where the photosensitive circadian system is responsive.78 during times when light should be avoided ( morning for a delay , evening for an advance ) , minimizing light exposure by drawing curtains , wearing sunglasses , using low - intensity room lighting , etc .
if a number of time zones are crossed during travel , light exposure schedules on the fight should be timed to maintain that the core body temperature minimum coincides with nighttime in the new environment.33 in presentation to the patient , one usually describes such strategies of light exposure in terms of going to bed earlier or later , rather than shifting rhythms .
however , it is important to understand that the act of going to sleep itself contributes to a phase shift mostly by altering activity levels and avoiding light rather than by resetting the clock .
there is data to suggest that sleep does have small phase shifting effects independent of light,79 but these are minor in comparison to those achieved by light alone .
this is not to imply that treating sleep disturbance is ineffective , but in the case of jet lag , sleep disturbance is a secondary target .
one can recover sleep loss in just 12 nights , whereas the effects of jet lag can last much longer.32 the use of hypnotic agents , which are widely used for any sleep - related disturbance , including jet lag , may only mask the symptoms of jet lag .
the phase shifting effects of most currently prescribed hypnotics are unknown , and even if hypnotics are used , light exposure times should be concurrently regulated .
melatonin is the primary pharmacological agent used in the treatment of jet lag , and it is widely available in nonperscription form in the united states .
there are also newly developed receptor specific subtype agonists that are available for prescription use , and these are thought to directly act on the scn with higher specificity .
like in the case of light , there is a prc for melatonin that is necessary to utilize for its effective use in treating jet lag .
only appropriately timed melatonin has phase shifting effects , even though larger doses of melatonin can have sleep - inducing effects independently of changes in the clock.80 in a simplified view , the prc for melatonin appears to be almost 180 out of phase with that of light : melatonin during the early evening phase advances the clock , whereas melatonin during the morning delays it .
the dead zone for exogenous melatonin efficacy in phase shifts is during the period just prior to bedtime , when melatonin levels normally increase under low lighting conditions.33 this endogenous rise is thought to contribute to feelings of sleepiness via a mechanism that involves increased vasodilation and lowering core body temperature.51 under normally entrained conditions , endogenous melatonin synthesis is inhibited by light , and so its phase shifting effects during the early evening and morning hours are diminished .
different doses of melatonin have slightly different prcs , and only higher doses ( 3 mg vs 0.5 mg ) have been reported to have direct hypnotic effects.32 there are also higher magnitude shifts reported for the higher dose of melatonin.32 if taking melatonin during the day when sleepiness is ideally avoided and cognitive function needs to be optimal , it is best to take a lower dose .
melatonin by itself can be a potent chronobiotic , but the strongest phase shifting effects will be achieved when taken in concert with appropriately timed light exposure .
for instance , in a phase delaying example , the traveler can take a low dose of melatonin and avoid light in the morning of the new time zone , and for phase advancing , melatonin should be taken in the early evening again with the avoidance of subsequent light .
for instance , as discussed earlier , sleep is regulated by a circadian process along with a homeostatic process and can be modulated by different environmental conditions .
feeding behavior , as another example , is also regulated by a circadian process , but feeding is also regulated by food availability , social cues , appetite , etc .
although all of these rhythms become desynchronized to differing extents during jet lag , most treatment strategies focus only on resetting of the central pacemaker in the scn .
this is because inherent in most study designs , the phase of the clock is determined by core body temperature and melatonin onset , two events tightly regulated by the master clock itself .
there is only a limited understanding of how other cues locally affect the resetting of tissues and organ systems .
this is an important area of future research , as rhythms are now understood to be the result of multidirectional communicating networks .
two other areas in which phase shifting might be important for synchronization of events downstream of the master clock are exercise and timed feeding .
animal studies suggest that appropriately timed exercise contributes to recovery from jet lag . in humans ,
the data are much less consistent , but this could be due to the fact that the effects of exercise on phase shifting might exist primarily outside of the scn . furthermore , the appropriate intensity and timing of this exercise has yet to be determined in something like a consensus prc .
from what is known , however , the appropriate timing of moderate exercise appears similar to that of exogenous melatonin : exercise in the morning phase delays , and exercise in the evening phase advances.81 there is one major exception , though , involving a study showing that exercise at night in humans induces phase delays.82 it could be that in all cases , exercise promotes fatigue , napping , or some other altered form of time in bed . the phase shifting effects of exercise on the master clock are relatively low in magnitude , but in concert with other phase shifting paradigms , the effects can be additive .
it is still unknown whether or not exercise accelerates phase shifts in other brain areas or other clock networks in the body . for treatment purposes , drastically changing an exercise routine for treatment of jet lag is best avoided while the literature sorts itself out .
another area where individuals can behaviorally accelerate realignment to the environment is through appropriately timed feeding .
there has been a recent explosion of research in the field of food - entrainable oscillations , which are important for proper metabolism and also in synchronizing rest and activity rhythms.83 clock genes cycle robustly throughout the liver and the entire gi tract , and there is a normal circadian variation in gut motility that needs to be tightly regulated to maintain the sequential contraction of smooth muscle to push food and nutrients through the gut.84,85 peripheral clocks also show a hierarchical control in the circadian system , suggesting that there is some plasticity in control of synchronization at different levels of the body.86 data from animals also suggest that the scn and peripheral organs adjust to new environmental cycles at different rates , as peripheral organs appear to take longer to reset than the scn.87 this further contributes to the desynchrony within the body that accounts for the symptoms of jet lag .
there is a noticeable lack of data on how feeding schedules can be used to re - entrain following a phase shift in humans .
ironically , one of the major complaints following jet lag is bowel movement irregularity.88 one study on jet lag had suggested that a diet of high protein early in the day and high in carbohydrates later in the day accelerated a phase shift with military personnel , but this data has not been confirmed on a large scale , nor is the treatment necessarily feasible for everyone.89 regardless , a common sense approach to appropriately timed feeding is to gradually adjust meals to the new time schedule and avoid things like coffee and alcohol as they will interfere with quality of sleep and thus complicate the re - entrainment process .
jet lag is a relatively common form of circadian disruption occurring when the core circadian system is out of synchrony with the environment due to the rapid shift of the light - dark cycle . during jet lag ,
the various oscillatory components of the circadian system are likely out of phase with the central clock in the scn and consequently with each other .
this disorganization of the circadian system leads to a cluster of symptoms including sleep disturbances and suboptimal cognitive performance . for short trips
, we would recommend accommodating to this biological challenge by appropriate scheduling , ie , avoid early light exposure after newly arriving after an eastward fight or avoid nighttime light exposure after westward travel .
in addition , proper sleep hygiene , including appropriate use of hypnotics , can be useful . for longer trips , synchronization to the new time zone can be aided by a variety of manipulations including timed light - exposure , melatonin , exercise , and timed meals .
importantly , the goal of shifting one s clock should not be complicated by treating only sleep disturbances .
prcs should be used when available , but generally travelers can appropriately time light and melatonin if they expose themselves to light in the early morning and take melatonin in the late afternoon when traveling eastward , and by exposing themselves to light in the early evening and taking melatonin in the morning when traveling westward . as we have come to understand that an observable rhythm results from the interactions of many endogenously generated rhythms and environmental factors , treatment for jet lag - like sleep disorders should be multifaceted .
these widely accepted clinical treatment strategies involving light , melatonin , and other nonphotic cues have been shown effective when appropriately timed , and future research with an improved understanding of circadian misalignment will undoubtedly be beneficial in continuing to link the appropriate timing of sleep and wake cycles to improved health and well being .
Output:
| the circadian system regulates the cyclical occurrence of wakefulness and sleep through a series of oscillatory networks that comprise two different theoretical processes .
the suprachiasmatic nucleus ( scn ) of the hypothalamus contains the master oscillatory network necessary for coordinating these daily rhythms , and in addition to its ability to robustly generate rhythms , it can also synchronize to environmental light cues . during jet lag , abrupt shifts in the environmental light dark cycle temporarily desynchronize the scn and downstream oscillatory networks from each other , resulting in increased sleepiness and impaired daytime functioning .
polysomnographic data show that not only does jet lag result in changes of sleep wake timing , but also in different aspects of sleep architecture .
this type of circadian misalignment can further lead to a cluster of symptoms including major metabolic , cardiovascular , psychiatric , and neurological impairments .
there are a number of treatment options for jet lag involving bright light exposure , melatonin , and use of hypnotics , but their efficacy greatly depends on their time of use , the length of time in the new time zone , and the specific circadian disturbance involved .
the aim of this review is to provide mechanistic links between the fields of sleep and circadian rhythms to understand the biological basis of jet lag and to apply this information to clinical management strategies . |
PubmedSumm7860 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in the western cultural tradition the mind tends to be viewed as separated from the body and , in accordance with this tradition , the sciences of the mind try to understand the mind with no reference to the body . in the last few decades , however , this has changed .
the cumulative and fast advances of the sciences of the body ( neurosciences , evolutionary biology , genetics , the biological sciences more generally ) make all attempts at studying the mind while ignoring the body less and less plausible .
in fact , the idea that the mind is embodied and that to understand the mind it is necessary to take the body into consideration is being accepted by an increasing number of researchers and constitutes the premise of many important current investigations ( barsalou , 1999 , 2008 ; robbins and aydede , 2009 ) .
the embodied view of the mind has led to a recognition of the importance of the actions with which the organism responds to the stimuli in determining how the world is represented in the organism 's mind , in contrast to the traditional emphasis on mental representations as either entirely abstract or derived only from sensory input .
this action - based view of the mind underlies a number of important ideas such as the grounding of symbols in the interactions of the organism with the physical environment ( harnad , 1990 ) , the mental ( neural )
simulation of actions as a crucial component of all sorts of understanding ( gallese et al . , 1996 ; rizzolatti and craighero , 2004 ) , the mental representation of objects in terms not of their sensory properties but of the actions that the objects make possible ( affordances ; gibson , 1977 ) , the action - based nature of categories ( borghi et al . , 2002 ; di ferdinando and parisi , 2004 )
. the embodied view of the mind is also reflected in computational models which reproduce the part of the body more directly linked to the mind , i.e. , the brain ( artificial neural networks ) and , more recently , the entire body of the organism ( robotics ) , and which have abandoned the disembodied view of the mind which is at the basis of artificial intelligence and of conceptions of the mind as symbol manipulation .
however , although the study of the mind can greatly benefit from an embodied conception of the mind , it still has to free itself from another tradition of western culture which constitutes an obstacle to a complete understanding of the mind : the mind tends to be identified with cognition , that is , with knowing , reasoning , deciding , and acting .
the other half of the mind is its emotional half and , although the two halves of the mind continuously interact and behavior is a result of both halves , no satisfactory account of the mind can be provided if the science of the mind is only cognitive science .
grounded cognition , and the mental representation of objects in terms of the actions with which organisms respond to them .
but organisms , including humans , do not only have knowledge , goals , and the capacity to act .
they also have motivations and emotional states which play a crucial role in their behavior .
current embodied views of the mind tend to be concerned with the cognitive half of the mind but an embodied account of the mind must be extended to the other half of the mind , its emotional half and , in fact , some psychologists and neuroscientists are trying to extend the embodied conception of the mind to emotions ( see , for example , gallese , 2008 ; freina et al .
even if one assumes that the mind generally does not contain anything which is unrelated to sensory input and motor output ( which is what embodied theories assume ) , the cognitive and the emotional halves of the mind may not function in the same way .
input to the brain can be input from the environment but also input from inside the body , and output from the brain can be external motor output but also changes in the internal organs and systems of the body , and these different sensory inputs and motor outputs may have different characteristics and consequences .
this is why we need models that capture both the cognitive half and the emotional half of the mind and their interactions .
these models should explicitly indicate both similarities and differences between embodied cognition and embodied emotion .
this also applies to the study of the mind through the construction of computational models or robots .
robots are the most appropriate tools for exploring embodied theories of the mind because , although in a very simplified form , they reproduce the body of organisms and the physical organ that controls the organisms behavior ( neuro - robots ) , and this is true for both physically realized robots and for robots which are simulated in a computer .
however , current robots mostly try to reproduce the cognitive half of the mind but they ignore its emotional half .
the robots displace themselves in the environment , move their arms and reach for objects , turn their eyes and their face , but they do not have emotions .
some current robots produce postures and movements of their bodies ( mostly , the face ) that in humans express emotions and they can recognize the expressed emotions of humans as a purely perceptual task , but they can not be said to really have emotions and to really understand the emotions of others ( picard , 2000 , 2003 ; breazeal , 2002 ; adolphs , 2005 ; canamero , 2005 ; dautenhahn et al . , 2009 ; robinson and el kaliouby , 2009 ; cf .
( for an attempt at understanding the functional role of emotions in behavior , see ziemke , 2008 . ) .
the cognitive half of the mind is the result of the interactions of the brain with the external environment or of processes self - generated inside the organism 's brain ( mental life ) .
current robots have artificial brains which interact with the external environment and , in some cases , can even self - generate inputs and respond to these self - generated inputs ( mirolli and parisi , 2006 , 2009 ; parisi , 2007 ) . but current robotics is an external robotics : robots reproduce the external morphology of an organism 's body , the organism 's sensory and motor organs , and the interactions of the organism 's brain with the external environment . in contrast , the emotional half of the mind is the result of the interactions of the organism 's brain with the organism 's body and with the organs and systems that are inside the body .
if we want to construct robots that can be said to really have emotions , what is needed is an internal robotics , that is , robots that have internal organs and systems with which the robot 's brain can interact ( parisi , 2004 ) .
only an internal robotics can help us to better understand the emotional half of the mind and to construct a complete embodied theory of the mind .
. theories in psychology tend to be expressed verbally but verbally expressed theories have limitations because words often have different meanings for different people and because verbally expressed theories may be unable to generate specific , detailed , and non - controversial predictions .
the theory is used to construct a robot and therefore , in a sense , it can be directly observed and it can contain no ambiguity because otherwise the robot can not be constructed . furthermore , the theory generates many specific , detailed , and uncontroversial predictions which are the behaviors exhibited by the robot .
these predictions can be empirically validated by comparing them with all sorts of empirical facts : the results of behavioral experiments , data on the ecology and past evolutionary history of the organism , and data on the organism 's body and brain .
as we have said , robotic models are especially appropriate for formulating embodied theories of the mind because , by definition , a robot has a body and the robot 's behavior clearly depends on its having a body . furthermore
, since the brain is part of the body , to be consistent robots should be neuro - robots , that is , robots whose behavior is controlled by a system that resembles the structure and functioning of the brain , i.e. , an artificial neural network .
this has the advantage that it becomes possible to examine the internal representations contained in the robot 's brain ( the patterns of activation and successions of patterns of activation in the robot 's neural network ) and to determine if they are embodied or non - embodied representations , i.e. , if they reflect the robot 's actions and the reactions of the robot 's internal organs and systems to sensory input rather than the sensory input .
emotional robots which are not controlled by neural networks but by symbolic systems such as those of breazeal and brooks , 2005 . ) what we will do in this paper is describe a number of simple robots that may help us to construct an entire theory of mind as made up of a cognitive half and an emotional half .
the first step toward the construction of robots which have both a cognitive and an emotional mind is to construct robots that have many different motivations which can not all be satisfied at the same time and therefore the robots have to decide at any given time which motivation to pursue with their behavior .
their behavior is complex : for example , they may approach an object with their legs or wheels , reach the object with their arm , grasp the object with their hand , and put the object in their mouth . but behind this behavior there is a single motivation , say , the motivation to eat .
in contrast , a robot 's behavior may be very simple but the robot has many independent motivations .
an example is a robot that has both a motivation to eat and a motivation to drink .
the behavior which is needed to satisfy the motivation to eat or the motivation to drink may be very simple but the robot has to decide which motivation to satisfy if the two motivations can not be both satisfied at the same time . some current robots do have more than one motivation but it is their user which decides which motivation should control their behavior at any given time , i.e. , what they must do , and in this sense current robots are not really autonomous .
( for attempts at constructing robots that are motivationally autonomous or that take motivational decisions , cf . brooks , 1986 ; maes , 1990 , although the last two references are to symbolically controlled robots .
the difference between neural network and rule - based approaches to motivations and motivational decisions is discussed in seth , 1998 , 2007 . )
they have many different and largely independent motivations and one of the most important aspects of their behavior is that they have to autonomously decide which motivation to pursue at any given time .
in fact , the behavior of real organisms has two levels of functioning , the strategic or motivational level and the tactical or cognitive level ( ruini et al . , 2010 ) .
at the strategic level the organism has to decide which one of its many different motivations will control its behavior at any particular time . at the tactical level
, the organism has to execute the behavior which is appropriate to satisfy the motivation which has been decided at the strategic level .
imagine an organism which lives in an environment containing both food and water and which to survive has to both eat and drink .
food and water are located in different places in the environment so that , at any given time , the organism has to decide whether to approach and reach food , and satisfy its motivation to eat , or to approach and reach water , and satisfy its motivation to drink .
once one of the two different motivations has been chosen at the strategic level , the tactical level of functioning of the organism generates the appropriate behavior which allows the organism to satisfy the motivation .
we assume that the decision is based on a simple mechanism . at any given time each motivation has an intensity which may vary from time to time , and the organism decides to pursue the motivation which currently has the highest intensity .
we use the verb to decide but what we are talking about is implicitly expressed motivations and a purely physical mechanism that compares different motivational intensities , although in complex and verbal animals such as humans , the decision mechanism may involve talking to oneself , making explicit predictions , and producing explicit evaluations .
the intensity of the different motivations is determined by two classes of factors : ( 1 ) the intrinsic intensity of the different motivations , which may depend on the overall adaptive pattern of the organism ( e.g. , the organism 's body needs more food than water ) or on the properties of the organism 's environment ( e.g. , food is less abundant than water in the organism 's environment ) , and ( 2 ) the current stimuli arriving to the organism 's sensors from the external environment ( e.g. , the organism presently sees food rather than water ) or from the organism 's own body [ e.g. , the current level of nutrients ( hunger ) is lower than the current level of water ( thirst ) ] or , in more complex animals such as humans , the stimuli which are self - generated ( predicted , imagined , remembered ) in the organism 's brain .
once one motivation has been chosen at the strategic level , the organism produces the behavior that satisfies , or should satisfy , the motivation . notice
that since the intensity of the different motivations can change very rapidly because of the arrival of new stimuli and for other reasons , the organism should be able to shift very quickly from pursuing one motivation to pursuing another motivation , and this may happen even if the first motivation has not been satisfied or entirely satisfied .
that organisms function at two levels , the motivational and the cognitive level , is indicated by the fact that an individual may be good at the motivational level but not very good at the cognitive level while the opposite may be true for another individual
. an individual may be good at choosing to satisfy its hunger rather than its thirst because its body needs energy rather than water but then it may not be very good at finding food .
in contrast , another individual may be very good at finding both food and water but it makes the wrong motivational decisions , or is slow at deciding or , even more critically , is unable to decide and does nothing .
notice that to stay alive and possibly reproduce an individual should be sufficiently good at both levels since both being unable to decide correctly and rapidly and being unable to do what is necessary to satisfy the motivation decided at the motivational level may reduce the organism 's chances of surviving and reproducing or the organism 's well - being .
this indicates that a crucial component of behavior is that the organism 's motivational decision mechanism must function effectively and efficiently .
it must take the correct motivational decisions and it must take these decisions at the appropriate time , which in many cases means quickly .
emotions are states of the organism 's body that allow the motivational decision mechanism to function more effectively and more efficiently .
emotional states influence the current intensity of the organism 's motivations in such a way that the organism functions better at the strategic level .
the sight of a potential mate might cause an emotional state in the organism that increases the probability that the organism will pursue the motivation to mate rather than other motivations .
the sight of a present danger may induce an emotional state that increases the probability that the organism will stop pursuing other motivations and try to avoid the danger , and will do this fast . in more complex organisms such as humans , even the thought of a mate or of a danger may increase the importance of the motivation to mate or the motivation to avoid the danger , with the consequence that the organism will be less likely to pursue other motivations . in the next section
we describe some simple robots that have to decide among different motivations and we show that if the robots have emotions their motivational decisions are more correct and efficient .
we have constructed a robot which lives in an environment containing both food and a predator ( parisi and petrosino , 2010 ; ruini et al . , 2010 ) .
to remain alive the robot has both to eat the food and to avoid being killed by the predator .
the predator is not always present but when it appears the robot has to cease looking for food and escape from the predator .
the neural network controlling the robot 's behavior has sensory input units encoding the presence and location of both food and predator , motor output units encoding the movements that allow the robot to displace itself in the environment , and an intermediate layer of internal units . to eat
the robot has to approach and reach the food elements while to avoid being killed by the predator the robot has to avoid physical contact with the predator .
the connection weights of the robot 's neural network are developed using a genetic algorithm with a population of robots that reproduce selectively and with the constant addition of random variations to the inherited connection weights ( mitchell , 1998 ) .
they have a circular body with two wheels allowing the robot to displace itself in the environment and sensory organs allowing the robot to perceive what is in front of the robot within a given distance from the robot .
the robots neural network has the architecture we have already described . in the other population we add to the robot 's neural network an emotional circuit made up of a certain number of units which receive activation from the sensory units encoding the presence of the predator and send their activation to either the internal units or the output units and therefore influence the robot 's behavior .
these emotional units have special properties compared to the other internal units of the robots neural network .
they have no bias , they have an activation threshold , and an emotional unit is not only active in the particular cycle in which activation arrives to the emotional unit from the input units but its activation may persist in subsequent cycles . the unit 's activation threshold and the parameters that control how the activation of a unit persists in subsequent cycles all have evolved values .
( for a more detailed description of the emotional circuit and of the results of the simulations , see parisi and petrosino , 2010 . )
the results of the simulations show that the robots with the emotional circuit reach higher level of performance ( they live longer ) than the robots which do not have the emotional circuit in their brain .
if we look at the robots behavior , we see that they immediately cease looking for food and fly away when the predator appears , thereby reducing the probability of being reached and killed by the predator .
the robots without the emotional circuit are less fast at shifting from the motivation to eat to the motivation to avoid being killed by the predator , and this leads to shorter lives .
in other simulations the robots have to make other motivational decisions : they have to decide whether to eat or drink , whether to eat or look for a mate , whether to eat or take care of their offspring , or whether to eat or rest when their body incurs some physical damage that can be healed by resting .
the neural network of the robots has sensory units , motor units , and an intermediate layer of internal units and , in addition , it has internal inputs units encoding the current level of energy inside their body ( hunger sensors ) and , for the robots that have to both eat and drink , also internal input units encoding the level of water ( thirst sensors ) , while the robots which can incur physical damage have internal input units encoding the presence of physical damage ( pain sensors ) .
all these robots have to take motivational decisions , and their fitness depends on both their ability to take the appropriate motivational decisions with the required rapidity and their ability to produce the behavior which satisfies the motivation which has been chosen .
the results of the simulations indicate that for all robots the possession of an emotional circuit allows them to take better and more rapid motivational decisions so that their fitness is higher than the fitness of the robots lacking the emotional circuit .
the robots we have described respond to the input from the external environment and/or from within their body not only with actions but also with emotional states , i.e. , states of their emotional circuit , that make their motivational decisions more effective and efficient and therefore their behavior more fit . the emotional circuit of these robots is very simple .
the emotional units receive activation from the external environment ( e.g. , the sight of a predator ) and/or from inside the body ( e.g. , the current level of energy in the robot 's body ) and they send their activation to the internal units or to the motor units of the robot 's neural network , thereby influencing the robot 's behavior .
the equivalents of our robots emotional units send their activation to various internal organs and systems such as the heart , the gut , the hormonal system , to the muscles of the face , and to other parts of the body , and receive activation from all these parts of the body , and it is this activation which influences the organism 's motivational decisions and therefore the organism 's behavior . in fact , as originally proposed by james and lange ( 1922 ) , and recently elaborated by damasio ( 1994 , 2004 ) and ledoux ( 1996 , 2000 ) , felt emotional states are largely the product of these interactions .
however , although very simple , our robots can be said to have emotions and to implement an embodied theory of the other half of the mind .
they live alone in their environment , and predators , mates , and offspring are not robots themselves but are only objects which are present in the environment and are perceived by the robots .
many animals , and especially humans , are social , which means that they live with conspecifics and a large portion of their adaptive pattern consists in being able to interact appropriately with conspecifics . what is the relation of emotions to sociality ?
many motivations in social animals can be satisfied only with the participations of conspecifics , i.e. , they are social motivations . for example , in species that reproduce sexually , an individual can not satisfy its motivation to have offspring without the participation of an individual of the opposite sex .
since emotional states help the strategic level of functioning of the organism to take better motivational decisions , social animals tend to have social emotional states that allow them to take better motivational decisions when these decisions concern social motivations . the other way in which emotions and sociality are related is that emotional states are associated with postures and movements of the organism 's body which can be perceived by other individuals and therefore can inform these individuals about the emotional states of the organism .
examples of social motivations are the motivation to mate with another individual , the motivation to take care of one 's offspring , and the motivation to be helped or to avoid being damaged by another individual .
all these motivations enter into the motivational decisions of the organism which has to decide which motivation to pursue at any given time .
hence , social organisms tend to have social emotional states which regulate the current intensity of their social motivations and positively influence their motivational decisions that have to take into account social motivations
. it may not be too difficult to construct robots that have social emotions . in some recently completed simulations
, the robots can be either female or male and to reproduce a robot has to mate with a robot of the opposite sex .
the robots live in an environment with both food and other robots of the two sexes and to leave their genes to the next generation they have both to eat to remain alive and to approach and reach a robot of the opposite sex to reproduce .
female and male robots have different colors so that they can be recognized as females or males by conspecifics .
after reproductively mating with a male robot , a female robot can not reproduce for a certain number of time steps and during this non - reproductive period the female robot changes its color and this change of color is perceived by the other robots .
a pregnant female knows its current state because its neural network has internal input units encoding the pregnant state of its body .
the results show that while the average number of offspring is necessarily identical for females and males , males have more reproductive variability than females , that is , there are males with many offspring and males with very few or no offspring while females all have more or less the same number of offspring .
furthermore , the robots alternate appropriately between looking for food and looking for mates , with reproductive females behaving differently toward males compared to non - reproductive females , and males approaching only reproductive females .
the next step is to add an emotional circuit to the neural network of these robots and to see if in this case too the possession of the emotional circuit leads to better performance .
what would make the states of this circuit social emotional states is that , unlike the emotional states of the robots described in the preceding section , the emotional states of these robots would be activated by the sight of a conspecific and they would allow a robot to take better motivational decisions about what to do socially .
the emotional states of the robots we have just described are social only in the sense that they are associated with social motivations but they are not social in the sense that they are expressed , that is , they are communicated to other individuals .
what appears to be really important to understand the role of emotions in sociality is to construct robots that express their emotional states and in this manner cause other individuals to know their emotional states and to be influenced in their behavior by this knowledge .
as we have said , current emotional robots express emotions that they do not have , that is , that do not play any functional role in their behavior . to construct robots that express emotional states which they really have it is necessary to link the emotional circuit of the robots we have described in the preceding section to postures and movements of the robot 's body that can be perceived by other robots . in the robots described in the preceding section , the emotional circuit influences the manner in which the robot responds to both external and internal inputs but it has no interactions with the rest of the robot 's body . as we have said , this is not so in real organisms , in which the emotional circuit of the brain sends its activation to other parts of the body and these parts of the body respond by sending activation to the brain .
as we have also said , some of the parts of the body activated by the emotional circuit are external and therefore their state or change of state ( postures and movements ) can be perceived by another individual . in this way
an individual may know the emotional states of another individual by observing the postures and movements of the body of the other individual that result from the activations sent to the body by its emotional units .
why should the emotional states of an individual be reflected ( expressed ) in the postures and movements of the individual 's body and therefore be accessible to the sensors of another individual ?
why should the other individual be able to understand the emotional states of the individual by perceiving the postures and movements of its body ?
postures and movements of the body may be simply a by - product of having emotional states , with no specific adaptive value .
but the richness of the expression of emotions in some animals , and especially humans , seems to indicate that expressing one 's emotions has adaptive value and has evolved for this reason .
this adaptive value is informing other individuals of one 's emotional states . the adaptive value appears to consist in two things : predictability and manipulation . for the other individual it may have adaptive value to know the emotional states of the first individual by perceiving the postures and movements of its body .
adapting to the environment is to a large extent to be able to predict the future state of the environment given its present state in order to prepare for the future state . for social animals
an important component of their adaptive environment is constituted by conspecifics in that many of the motivations of an individual can only be satisfied with the participation of other individuals .
therefore , for a social individual it is important to be able to predict the behavior of other individuals , and knowing the emotional states of other individuals is a powerful predictor of their behavior .
this may explain why social animals ( of some complexity ) tend to attend to and to be able to understand the emotional states of other individuals as these emotional states are expressed by the postures and movements of certain parts of their body .
but why should an individual care to express its emotional states through the postures and movements of its body so that another individual can know them ?
the explanation in this case is not in terms of predictability but in terms of manipulation , where manipulation is behaving in such a way that the other individual will behave in some desired manner . in other words ,
an individual will express its emotional states because this will induce another individual which is informed of such emotional states to behave in ways which are desirable for the first individual .
both functions of the expression of emotional states can be simulated with robots possessing an emotional circuit which interacts with the robot 's body so that specific states of the circuit will cause specific postures and movements in the robot 's body which can be perceived by other robots .
this will allow the first robot to let its emotional state be known by other robots and therefore to influence their behavior and will allow the other robots to predict the behavior of the first robot .
being able to predict x is an important component of ( or perhaps the same thing as ) understanding x. what is for individual a to understand individual b ?
the embodied theory of sociality says that a understands b by simulating b 's perceived actions in its own brain ( gallese , 2010 ) .
but the behavior of b does not only consist in doing actions but also in expressing emotions , and sociality implies understanding not only b 's actions but also b 's expressed emotions .
hence , a more complete theory of sociality proposes that a understands b not only by observing b 's actions and simulating these actions in its own brain but also by observing b 's expressed emotions and simulating these emotions in its own brain body .
( remember that , while the cognitive half of the mind is a product of the brain , the emotional half is a product of the interaction between the brain and the body . ) there is an accumulating experimental literature on the role of expressed emotions in sociality .
( 2007 ) have shown that how objects are affectively evaluated by an individual is influenced by the gaze and emotional expression of another individual , and ferri et al .
( 2010 ) that the emotional expression of another individual may affect the goal - directed behavior of the observer .
these are among the experimental results which our robots that have emotions should be able to replicate .
an extension of the embodied view of mind to language proposes , and tries to show with experiments , that we understand nouns by internally representing in our brain the action with which we respond to the object designated by the noun and we understand verbs by simulating in our brain the action designated by the verb ( fischer and zwaan , 2008 ) .
however , if the mind has two halves , the cognitive and the emotional half , an embodied conception of language should give an account of both the cognitive and emotional meanings of words .
what we do in this section is describe some simple robots that ( begin to ) have language , and to suggest how words can evoke in these robots not only a cognitive meaning but also an emotional meaning .
most words are sounds , or phono - articulatory movements that produce acoustic sounds , which co - vary with specific objects ( nouns ) or actions ( verbs ) .
the cognitive orientation of most current theories of the mind can also be seen in the privilege accorded to the cognitive component of the meanings of words rather than to their emotional component , where the cognitive component refers to the perceptual properties of the object designed by a noun or to the action designed by a verb while the emotional component refers to the emotional states evoked by the noun or verb .
but if we want to construct robots that can be said to have language , it will be necessary that their words evoke emotional states , not only cognitive meanings , in other robots .
( for a more detailed description of the model , see parisi , 2010 . for robotic models of nouns and verbs , see cangelosi and parisi , 2001 . )
our robots live in an environment with other robots and their neural network is made up of two sub - networks , the non - linguistic sub - network ( nol ) and the linguistic sub - network ( l ) .
nol is made of input units encoding non - linguistic sensory input ( perceived objects and perceived actions of another robot ) and output units encoding non - linguistic actions ( e.g. , reaching and grasping an object ) .
l has input units encoding linguistic sounds ( produced by another robot ) and output units encoding phono - articulatory movements that produce linguistic sounds .
both nol and l have a layer of internal units which connects the input units to the output units .
in addition , the two internal layers also have horizontal connections linking the internal units of nol to those of l , and vice versa .
given these horizontal connections , perceiving an object can lead to executing a non - linguistic action but also to executing a phono - articulatory action , i.e. , producing the word which designates the object . and hearing a word may lead to reproducing the word by executing the appropriate movements of one 's phono - articulatory organs ( imitating the sound of the word ) or to executing a non - linguistic action . when the robot learns language ( which , in children , begins at 1 year of age ) , the robots learns the appropriate connection weights for these horizontal connections .
what is the role of these connection weights ? in the robot 's social experience one specific linguistic sound tends to co - vary with one specific object or action , and vice versa .
the robot incorporates these co - variations in the connection weights of its neural network so that when the robot hears a linguistic sound and activation spreads from the internal layer of l to the internal layer of nol , the pattern of activation evoked in the internal units of nol is more or less the same pattern of activation evoked by perceiving the object or action which co - varies with the linguistic sound .
when the robot perceives an object or action , activation spreads from the internal units of nol to the internal units of l , which causes the robot to produce the sound which in its experience co - varies with that object or action . in other words , the robot is able to both produce and understand language .
a crucial assumption of the model we have described is that there is no entity in the robot 's neural network which can be called the meaning of a word .
if we assume that the internal units of nol have internal connections linking the units of the same layer , when an activation pattern is evoked in the internal units of nol , this activation pattern will evoke a second activation pattern in the same or other units , then a third , and so on , so that the initial activation pattern is only the first step of a process which has no natural end and no fixed boundaries and is influenced by a number of factors such as the linguistic and non - linguistic context in which the word is being experienced by the robot , inter - individual differences among the robots , the frequency with which a word has been experienced by the robot , and others .
notice that the internal layer of nol is not a specialized semantic module but is the entire brain ( minus the l sub - network ) .
this implies that the spreading of activation in nol can invade the emotional circuit of the robot 's neural network and in this manner it can trigger emotional states in the robot .
words have emotional meaning if a word co - varies in the robot 's experience with non - linguistic experiences that cause emotional states in the robot .
this of course is only a first step toward a robotic account of the emotional meaning of words .
here is a list of interesting questions that this account should be able to answer .
why , while all words have a cognitive meaning , only some words appear to have an emotional meaning ?
why the cognitive meaning of words appears to be more well - defined , articulated , and specific than their emotional meaning ?
words often appear to have emotional meaning not in isolation but in the context of other words , i.e. , in sentences ( havas et al . , 2007 ) .
why this is so ? in some experiments it has been shown that abstract words tend have more emotional meaning than concrete words ( kousta et al . , 2009a )
other experiments indicate that emotional words are processed more rapidly than non - emotional words ( kousta et al . , 2009b ) .
theories expressed as robots have two important advantages compared to verbally expressed theories : they are unambiguous because they refer to things that can observed and measured and they generate many detailed and non - controversial empirical predictions , which are the behaviors of the robot and what happens in the robot 's brain .
we have described some robotic models that begin to address the question of how to develop a theory of mind that takes into consideration both the cognitive and the emotional halves of the mind .
we have shown that if we add an emotional circuit to the neural network that controls a robot 's behavior , the robot 's behavior becomes more effective because the emotional circuit allows the robot to take more correct and faster motivational decisions . unlike current emotional robots , robots that possess this circuit can be said to actually have emotions in that one
can show that the circuit plays a clear functional role in the robot 's behavior .
we have then addressed the question of how emotions are related to sociality and we have distinguished two aspects of this relation .
robots can have social motivations , that is , motivations that can only satisfied with the participation of conspecifics , and emotions can be said to be social if they cause the robot to make better motivational decisions when the choice set includes social motivations . the other link between emotions and sociality is the expression of emotions .
the emotional circuit allows the brain ( neural network ) to interact not only with what is inside the body but also with the external body , causing postures and movements of some parts of the body ( especially the face ) that can be perceived by other robots .
we have advanced the hypothesis that this expression of emotions has two adaptive advantages : it allows a robot that expresses its emotions to manipulate the behavior of other robots that perceive the expressed emotions and it allows the robot which perceives the emotions expressed by another robot to predict and anticipate the behavior of the other robot . finally ,
we have briefly discussed which type of neural network should control the behavior of robots that have language and how words can have both cognitive and emotional meanings for a robot .
the robotic models we have described are very simple and very tentative and one still has to show that they are able to explain ( reproduce ) the constantly accumulating empirical facts about brain and behavior that involve the other half of the mind .
( for some attempts at simulating the brain involved in emotions , see rolls and treves , 1998 ; rolls , 1999 ; avila - garcia and canamero , 2004 . )
furthermore , we have said that current emotional robots do not actually have emotions because emotions do not play any clearly identifiable functional or adaptive role in their behavior , but the results obtained with our robotic models should be compared with those of alternative models , both robotic and non - robotic .
an important test of the models will be their ability to reproduce not only the results of experiments but also other empirical facts such as inter - individual differences in the emotional half of the mind , i.e. , differences in personality and character rather than in cognitive ability , the pathologies of the emotional half of the mind , i.e. , psychiatric and psychological disturbances rather than neurological ones ( stein and ludik , 2008 ) , and the expression of the emotional half of the mind in the production and appreciation of works of art .
the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
Output:
| embodied theories of mind tend to be theories of the cognitive half of the mind and to ignore its emotional half while a complete theory of the mind should account for both halves .
robots are a new way of expressing theories of the mind which are less ambiguous and more capable to generate specific and non - controversial predictions than verbally expressed theories .
we outline a simple robotic model of emotional states as states of a sub - part of the neural network controlling the robot 's behavior which has specific properties and which allows the robot to make faster and more correct motivational decisions , and we describe possible extensions of the model to account for social emotional states and for the expression of emotions that , unlike those of current emotional robots , are really felt by the robot in that they play a well - identified functional role in the robot 's behavior . |
PubmedSumm7861 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: malaria parasite transmission remains a serious international public health problem . in sub - saharan africa ( ssa ) , anopheles gambiae s.s .
funestus are the primary vectors of malaria parasites and show highly anthropophilic tendencies [ 1 - 3 ] .
approximately 70% of the total ssa population lives in areas infested with malaria vectors , although urban areas typically have lower anopheline mosquito populations and less malaria as compared to rural areas .
it is generally thought that the abundance of clean , sun - lit , and shallow bodies of water makes rural populations especially vulnerable to increased contact with anopheline mosquitoes .
likewise , the absence of suitable habitat and increased water pollution generally inhibits the development of anopheline larvae in urban centers , resulting in fewer anopheles mosquitoes .
other studies on the epidemiology of urban malaria have demonstrated that the density of anophelines , and corresponding malaria parasite transmission , increases as the distance to the city center increases , with rural areas being more likely to harbor anopheles mosquitoes as compared to urban areas [ 7 - 13 ] .
these studies further concluded that city centers were significantly less likely to harbor mosquitoes as a result of decreased open space , increased pollution , different economic activities , and improved socioeconomic conditions . to
what extent this is unequivocally true , or changing , is unclear , as many urban ssa populations live in overcrowded and denuded areas without access to safe water and sanitation services , paved roads , adequate housing , or engineered drainage systems , and continue to engage in rural - type activities to sustain an urban existence .
commercial and household - level urban farming represents one rural - type activity that is both abundant in many ssa cities , and has been associated with anopheline mosquitoes [ 15 - 17 ] . on the coast of kenya ,
urban residents often supplement their diet and income with produce grown on small patches of cultivated land around the household , and shallow garden wells are a common source of water for urban residents engaged in farming , or who are without access to piped water . given that agricultural areas represent moist , disturbed environments that can sustain both larval - stage and adult mosquitoes , and
water storage or irrigation is often necessary to sustain agricultural activity within the urban context , urban farming may be increasing the availability of potential habitat for anopheles mosquitoes .
retract to relatively few water bodies in the absence of sustained precipitation , bite near the larval site of emergence , survive long dry periods with limited feeding activity and slower reproductive cycles , and disperse only so far as needed to acquire a blood meal , it stands to reason that populations in close proximity to mosquito habitat may be at an increased risk of receiving an infectious bite .
other features of the ssa urban environment may also act to affect the overall propensity of an area to harbor anopheles mosquitoes .
high human population density for example , provides additional blood meal opportunities , as well as additional habitat in the form of artificial water storage containers , debris , or human - made depressions that retain water .
conversely , in the presence of anopheles mosquitoes , high human population density may act to reduce the overall chance of receiving an infectious bite , as an increase in the number of potential hosts may result in fewer overall bites per person .
the built environment is likely to reduce the abundance of mosquitoes by reducing or eliminating standing water and vegetation , thus reducing potential habitat .
soil and vegetation are often replaced with asphalt , concrete , brick , or stone for housing , or commercial and industrial centers ; and drainage systems are installed and enclosed to drain water . in general , the built environment decreases as the distance from the city center increases , and is accompanied with corresponding changes in community level land - use .
thus areas further away from the city center are less likely to have access to utilities , drainage systems and paved roads , and may be more likely to be supplement household incomes with rural - type activities .
distance to the city center may also be associated with community level socioeconomic status , as cities tend to expand outward with settlement occurring along the periphery where space permits .
these newly formed communities may not have access to the resources needed to modify the environment in such as way as to reduce the overall threat of disease , or improve the respective infrastructures .
communities on the fringes of urban centers , often called peri - urban areas , represent the interface between rural and urban areas , where livelihoods are dependent upon on both natural resources and farming activities , and the economic and social opportunities found with urban areas .
the purpose of this research was to characterize larval habitats in malindi , identify associations between the presence of anopheline larvae and human - ecological attributes , and describe the relationship between household - level urban agricultural activity and the occurrence of water bodies in the grid cell , while controlling for potential confounding effects associated with features of the urban environment .
this paper builds upon previous ecological field studies conducted in kisumu and malindi , kenya during 2001 . a stratified geographic sampling strategy and cross - sectional study design provided the framework for this study .
the city of malindi , which is a major tourist destination as well as a significant local market town and small industrial center , is located on the indian ocean in coast province , kenya and has a population of 81,000 people .
april through june and october through november are considered the long and short rains , respectively , with precipitation varying from 750 to over 1,200 mm per year .
although most roads in malindi are a mixture of sand and dirt , the city center is paved and has both covered and uncovered engineered drainage systems along main streets .
the main roads used for travel and transport in and out of the city , as well as some roads along the beach are also paved .
tourism , fishing , commercial trade and retail , and service professions are the major economic activities .
the informal economic sector comprises street vendors , sex workers , and tour guide services . according to the latest census ,
approximately 60% of the urban population has access to piped water , either in the home or at community taps .
malaria parasite transmission occurs year - round on the coast of kenya , although the incidence usually increases shortly after the onset of the rains .
although the approach used in this study was fundamentally the same , changes to the design were made and are described herein .
an existing base - map for malindi was updated in september of 2002 using arcview 3.3and garmin e - trexgps receivers , to include additional landmarks and points of reference throughout the study area .
latitude , longitude , and elevation data were collected for roads and reference points , and information relative to land - use type and the level of drainage were noted .
the information contained in the 1999 census , existing town maps , and environmental descriptions from the field formed the basis for urban boundary demarcation in this study .
arcview 3.2was used in 2001 to generate and overlay a series of 270 meter 270 meter grid cells on the base - map .
the grid created in 2001 was also used in this study because data collection teams were already familiar with the boundaries of the existing grid cell locations relative to important landmarks .
two hundred and forty eight grid cells fell within the urban study area , which constituted the sampling frame for this study .
stratifying malindi into two categories involved assessing the level of drainage in each grid cell and assigning a value of 1 if the grid cell was well drained and 0 if poorly drained .
a grid cell was classified as well - drained if functional ( e.g. clear of debris or vegetation at the time of observation ) engineered drainage systems covered the majority of the grid cell and no standing water was visible , or if the grid cell was located on a slope and no standing water was visible .
a grid cell was classified as poorly drained if it was located in a depression or valley and had either no drainage systems , or the drainage systems were blocked with debris or vegetation .
topographical and town maps were used to assist with this process . although the same person characterized all grid cells in this study , no algorithm or coding system
seventy - three grid cells were classified as well drained and 175 grid cells were classified as poorly drained .
twenty - five grid cells were selected from each stratum ( n = 50 ) .
this insured that the probability of selection was equal for each grid cell within the respective strata .
the probability of selection was equal to 0.1429 ( 25/175 ) for the poorly drained stratum and 0.3424 ( 25/73 ) for the well - drained stratum .
the boundaries of selected grid cells were located in the field using hand - held navigational units ( gps ) , a compass , and base - maps with landmarks , paths , and roads indicated .
latitude and longitude readings were taken at the corners and center of each selected grid cell to confirm the location and extent of grid cell boundaries .
each selected grid cell was visually inspected for the presence of water bodies during november and december 2002 .
all accessible water bodies within the selected grid cells were identified to avoid the bias associated with sampling in areas most likely to contain anopheline larvae . in this analysis ,
multiple water - filled containers in close proximity ( e.g. bucket or tire piles ) were considered to be one aquatic habitat .
likewise , artificial water storage containers existing in isolation of other containers were considered to be one aquatic habitat .
water bodies containing no larvae were revisited two weeks later to confirm the absence of mosquito larvae .
a two - stage cluster format was used to select households from within the 50 grid cells .
the grid cells served as primary sampling units ( psu ) , or clusters , from which the ultimate sampling units ( usu ) , or households , were selected .
equal allocation , and a design effect of 3 , was used to calculate the target sample size .
the most conservative estimate of p ( 0.50 ) was used in the sample size calculation .
the sample size formula was equal to : n 3(1.96)(0.50)(1 - 0.50 ) / ( 0.10 ) .
an additional 10% was added to account for non - response , yielding a target sample size of 318 households in the well - drained stratum and 318 households in the poorly drained stratum ( n = 636 ) .
because household level enumeration lists were not available for grid cells , a random direction method was used to approach approximately 13 houses ( 318/25 ) from within each selected grid cell .
the middle of the grid cell was located and a random direction was selected for each interviewer .
additional houses were sampled along the same axis until the boundary of the grid cell was reached . at which time , a new direction from the center was selected and the process repeated until approximately 13 houses had been sampled . in grid cells containing fewer than 13 households , all responsive households were approached .
households selected , but with no resident adult available were revisited once and then replaced with the closest house .
multiple structures within a compound occupied by dependents of household head were considered one household .
the total number of households per selected grid cell was obtained by counting the total number of occupied households contained within each selected grid cell .
interviews were conducted with any resident adult ( > 15 years ) willing to be interviewed . a brief explanation of the study was provided and informed consent obtained .
variables used in this analysis were created based on responses to specific questions related to agricultural practices , land - use , home ownership , and access to electricity .
the tulane university institutional review board ( irb ) and the kenya national ethical review board approved the study .
the first objective was to describe the water bodies identified and determine if the characteristics were fundamentally the same in well and poorly drained areas , and to identify human - ecological factors associated with the probability of anopheline larvae occurring in a water body .
the variables used were based on field observations and information obtained at the time the water body was identified .
land - use was equal to 1 if the water body was located in a residential , or residential and commercial area , and equal to 0 if located in an agricultural or undeveloped area .
water body size was equal to 1 if less than or equal to 3 meters squared , and 0 if not .
water body nature was dichotomized as natural ( 0 ) or human - made ( 1 ) .
the level of permanency was equal to 1 if the water body was permanent or semi - permanent ( > 3 mo ) , and 0 if temporary ( < 3 mo ) . because this study used a cross - sectional approach , and water bodies
could not be observed over time , permanency was determined based on the source of water , water body size , previous experience with specific habitat types , and expert opinion .
substrate type was classified as cement ( 1 ) , mud or soil ( 2 ) , or rubber or plastic ( 3 ) .
the substrate variable was equal to 1 if substrate was cement or plastic and 0 if mud or soil .
the distance to the nearest house variable was recorded as 1 if a water body was located < 20 meters from the nearest house , and 0 if > 20 meters .
a 20-meter dichotomization criterion was used based on the distribution of the data , as many of houses were less than 20 meters from a water body , with very little variation in values .
pollution and floating debris was recorded as 1 if debris were present or the water body was discolored or foul smelling , and 0 if absent .
this distinction was also based on expert opinion , as no physiochemical analysis of water samples were conducted .
the shade variable was equal to 1 if some canopy coverage was present , or if a structure provided shade , and 0 if no coverage was present .
chi - square analysis was conducted to determine if the proportions of the respective independent variable categories for water bodies differed by strata ( n = 29 ) .
chi - square analysis was also conducted to determine if the proportions of water bodies positive for anopheline larvae differed by strata , and by the respective categories of the data described above ( n = 29 ) .
although the original intention was to test the direction and magnitude of the controlled effect of the respective covariates using logistic regression , the low number of water bodies identified , coupled with the low number of anopheline larvae collected and lack of variability in some habitat characteristics precluded further analysis on the distribution or abundance of anopheline larvae .
the second research objective was to quantify the effect of household - level farming on the probability of water body occurrence within the grid cell , while controlling for potential confounders .
chi - square analysis was first conducted to investigate whether grid cells differed by strata in terms of household level farming , the existence of water bodies , and access to resources ( n = 50 ) .
the research hypothesis was that the abundance of farming within or around the household , as recorded on the household questionnaire , increases the probability that at least 1 potential anopheline larval habitat ( water body ) exists within the community .
the density of houses , distance from the city center , the level of access to resources , and the level of drainage per grid cell were treated as potential confounders .
the dependent variable was binary and equal to 1 if at least one water body was found within the grid cell , and 0 if no water bodies were found within the grid cell ( psu = 50 , usu = 629 ) . in this analysis ,
although communities are rarely uniform in space or character , and spatial units may fail to capture physical or human - ecological heterogeneity at a smaller scale , this analysis assumes a specific level of homogeneity within the grid cell based on previous studies conducted within malindi .
the proportion of households sampled per grid cell reporting house ownership plus access to electricity was used as a surrogate for the community 's overall ability to access resources and thus control their own environment .
the proportion of households reporting home ownership plus electricity for each selected grid cell was calculated from the household survey .
the variable was dichotomized to equal 1 if the grid cell value was above the overall mean and 0 if below the overall mean .
the proportion of households engaged in farming in or around the household per grid cell was calculated in the same way , and further dichotomized to equal 1 if the grid cell value was above the overall mean and 0 if below . in all cases where
household level survey data were used to create a grid cell level variable , the number of households satisfying each respective condition was divided by the total number of households sampled within each grid cell to obtain the respective proportion .
the number of households per grid cell was a continuous variable and served as a surrogate measure of population density per grid cell .
the spatial join function was used to calculate and assign a distance from the centroid of each selected grid cell to a point designated as the city center .
this study used a roundabout just south of the old commercial district as the center of town based on its centrality , urban features , and access .
the variable was also continuous and served as a proximate determinant of a range of community level variables , including access to infrastructure and services , levels of pollution , community level land - use and the relative socioeconomic status of the area .
multi - level logistic regression was used to quantify the controlled effect of household - level agricultural activity on the probability of water body occurrence .
sampling weights , equal to the inverse of the probability that a grid cell was selected , were applied to the regression .
the grid cell , and corresponding data from households interviewed therein , was treated as a cluster using the " cluster " option in stata for the regression .
robust standard errors were used because data were collected at both the grid cell and household level .
the city of malindi , which is a major tourist destination as well as a significant local market town and small industrial center , is located on the indian ocean in coast province , kenya and has a population of 81,000 people .
april through june and october through november are considered the long and short rains , respectively , with precipitation varying from 750 to over 1,200 mm per year .
although most roads in malindi are a mixture of sand and dirt , the city center is paved and has both covered and uncovered engineered drainage systems along main streets .
the main roads used for travel and transport in and out of the city , as well as some roads along the beach are also paved .
tourism , fishing , commercial trade and retail , and service professions are the major economic activities .
the informal economic sector comprises street vendors , sex workers , and tour guide services . according to the latest census ,
approximately 60% of the urban population has access to piped water , either in the home or at community taps .
malaria parasite transmission occurs year - round on the coast of kenya , although the incidence usually increases shortly after the onset of the rains .
although the approach used in this study was fundamentally the same , changes to the design were made and are described herein .
an existing base - map for malindi was updated in september of 2002 using arcview 3.3and garmin e - trexgps receivers , to include additional landmarks and points of reference throughout the study area .
latitude , longitude , and elevation data were collected for roads and reference points , and information relative to land - use type and the level of drainage were noted .
the information contained in the 1999 census , existing town maps , and environmental descriptions from the field formed the basis for urban boundary demarcation in this study .
arcview 3.2was used in 2001 to generate and overlay a series of 270 meter 270 meter grid cells on the base - map .
the grid created in 2001 was also used in this study because data collection teams were already familiar with the boundaries of the existing grid cell locations relative to important landmarks .
two hundred and forty eight grid cells fell within the urban study area , which constituted the sampling frame for this study .
stratifying malindi into two categories involved assessing the level of drainage in each grid cell and assigning a value of 1 if the grid cell was well drained and 0 if poorly drained .
a grid cell was classified as well - drained if functional ( e.g. clear of debris or vegetation at the time of observation ) engineered drainage systems covered the majority of the grid cell and no standing water was visible , or if the grid cell was located on a slope and no standing water was visible .
a grid cell was classified as poorly drained if it was located in a depression or valley and had either no drainage systems , or the drainage systems were blocked with debris or vegetation .
topographical and town maps were used to assist with this process . although the same person characterized all grid cells in this study , no algorithm or coding system
seventy - three grid cells were classified as well drained and 175 grid cells were classified as poorly drained .
twenty - five grid cells were selected from each stratum ( n = 50 ) .
this insured that the probability of selection was equal for each grid cell within the respective strata .
the probability of selection was equal to 0.1429 ( 25/175 ) for the poorly drained stratum and 0.3424 ( 25/73 ) for the well - drained stratum .
the boundaries of selected grid cells were located in the field using hand - held navigational units ( gps ) , a compass , and base - maps with landmarks , paths , and roads indicated .
latitude and longitude readings were taken at the corners and center of each selected grid cell to confirm the location and extent of grid cell boundaries .
each selected grid cell was visually inspected for the presence of water bodies during november and december 2002 .
all accessible water bodies within the selected grid cells were identified to avoid the bias associated with sampling in areas most likely to contain anopheline larvae . in this analysis ,
multiple water - filled containers in close proximity ( e.g. bucket or tire piles ) were considered to be one aquatic habitat .
likewise , artificial water storage containers existing in isolation of other containers were considered to be one aquatic habitat .
water bodies containing no larvae were revisited two weeks later to confirm the absence of mosquito larvae .
a two - stage cluster format was used to select households from within the 50 grid cells .
the grid cells served as primary sampling units ( psu ) , or clusters , from which the ultimate sampling units ( usu ) , or households , were selected .
equal allocation , and a design effect of 3 , was used to calculate the target sample size .
the most conservative estimate of p ( 0.50 ) was used in the sample size calculation .
the sample size formula was equal to : n 3(1.96)(0.50)(1 - 0.50 ) / ( 0.10 ) .
an additional 10% was added to account for non - response , yielding a target sample size of 318 households in the well - drained stratum and 318 households in the poorly drained stratum ( n = 636 ) .
because household level enumeration lists were not available for grid cells , a random direction method was used to approach approximately 13 houses ( 318/25 ) from within each selected grid cell .
the middle of the grid cell was located and a random direction was selected for each interviewer .
additional houses were sampled along the same axis until the boundary of the grid cell was reached . at which time , a new direction from the center was selected and the process repeated until approximately 13 houses had been sampled . in grid cells containing fewer than 13 households , all responsive households were approached .
households selected , but with no resident adult available were revisited once and then replaced with the closest house .
multiple structures within a compound occupied by dependents of household head were considered one household .
the total number of households per selected grid cell was obtained by counting the total number of occupied households contained within each selected grid cell .
interviews were conducted with any resident adult ( > 15 years ) willing to be interviewed . a brief explanation of the study was provided and informed consent obtained .
variables used in this analysis were created based on responses to specific questions related to agricultural practices , land - use , home ownership , and access to electricity . the tulane university institutional review board ( irb ) and the kenya national ethical review board approved the study .
the first objective was to describe the water bodies identified and determine if the characteristics were fundamentally the same in well and poorly drained areas , and to identify human - ecological factors associated with the probability of anopheline larvae occurring in a water body .
the variables used were based on field observations and information obtained at the time the water body was identified .
land - use was equal to 1 if the water body was located in a residential , or residential and commercial area , and equal to 0 if located in an agricultural or undeveloped area .
water body size was equal to 1 if less than or equal to 3 meters squared , and 0 if not .
water body nature was dichotomized as natural ( 0 ) or human - made ( 1 ) .
the level of permanency was equal to 1 if the water body was permanent or semi - permanent ( > 3 mo ) , and 0 if temporary ( < 3 mo ) . because this study used a cross - sectional approach , and water bodies could not be observed over time , permanency was determined based on the source of water , water body size , previous experience with specific habitat types , and expert opinion .
substrate type was classified as cement ( 1 ) , mud or soil ( 2 ) , or rubber or plastic ( 3 ) .
the substrate variable was equal to 1 if substrate was cement or plastic and 0 if mud or soil .
the distance to the nearest house variable was recorded as 1 if a water body was located < 20 meters from the nearest house , and 0 if > 20 meters .
a 20-meter dichotomization criterion was used based on the distribution of the data , as many of houses were less than 20 meters from a water body , with very little variation in values .
pollution and floating debris was recorded as 1 if debris were present or the water body was discolored or foul smelling , and 0 if absent .
this distinction was also based on expert opinion , as no physiochemical analysis of water samples were conducted .
the shade variable was equal to 1 if some canopy coverage was present , or if a structure provided shade , and 0 if no coverage was present .
chi - square analysis was conducted to determine if the proportions of the respective independent variable categories for water bodies differed by strata ( n = 29 ) .
chi - square analysis was also conducted to determine if the proportions of water bodies positive for anopheline larvae differed by strata , and by the respective categories of the data described above ( n = 29 ) .
although the original intention was to test the direction and magnitude of the controlled effect of the respective covariates using logistic regression , the low number of water bodies identified , coupled with the low number of anopheline larvae collected and lack of variability in some habitat characteristics precluded further analysis on the distribution or abundance of anopheline larvae .
the second research objective was to quantify the effect of household - level farming on the probability of water body occurrence within the grid cell , while controlling for potential confounders .
chi - square analysis was first conducted to investigate whether grid cells differed by strata in terms of household level farming , the existence of water bodies , and access to resources ( n = 50 ) .
the research hypothesis was that the abundance of farming within or around the household , as recorded on the household questionnaire , increases the probability that at least 1 potential anopheline larval habitat ( water body ) exists within the community .
the density of houses , distance from the city center , the level of access to resources , and the level of drainage per grid cell were treated as potential confounders .
the dependent variable was binary and equal to 1 if at least one water body was found within the grid cell , and 0 if no water bodies were found within the grid cell ( psu = 50 , usu = 629 ) . in this analysis ,
although communities are rarely uniform in space or character , and spatial units may fail to capture physical or human - ecological heterogeneity at a smaller scale , this analysis assumes a specific level of homogeneity within the grid cell based on previous studies conducted within malindi .
the proportion of households sampled per grid cell reporting house ownership plus access to electricity was used as a surrogate for the community 's overall ability to access resources and thus control their own environment .
the proportion of households reporting home ownership plus electricity for each selected grid cell was calculated from the household survey .
the variable was dichotomized to equal 1 if the grid cell value was above the overall mean and 0 if below the overall mean .
the proportion of households engaged in farming in or around the household per grid cell was calculated in the same way , and further dichotomized to equal 1 if the grid cell value was above the overall mean and 0 if below . in all cases where
household level survey data were used to create a grid cell level variable , the number of households satisfying each respective condition was divided by the total number of households sampled within each grid cell to obtain the respective proportion .
the number of households per grid cell was a continuous variable and served as a surrogate measure of population density per grid cell .
the spatial join function was used to calculate and assign a distance from the centroid of each selected grid cell to a point designated as the city center .
this study used a roundabout just south of the old commercial district as the center of town based on its centrality , urban features , and access .
the variable was also continuous and served as a proximate determinant of a range of community level variables , including access to infrastructure and services , levels of pollution , community level land - use and the relative socioeconomic status of the area .
multi - level logistic regression was used to quantify the controlled effect of household - level agricultural activity on the probability of water body occurrence .
sampling weights , equal to the inverse of the probability that a grid cell was selected , were applied to the regression .
the grid cell , and corresponding data from households interviewed therein , was treated as a cluster using the " cluster " option in stata for the regression .
robust standard errors were used because data were collected at both the grid cell and household level .
the timing and near failure of the short rains were such that data were collected under unusually dry conditions . in 2002 , 126 mm and 86.5 mm of precipitation was recorded for the months of november and december , respectively .
twenty - nine water bodies were identified from within 17 of the grid cells twenty - seven percent of the 29 water bodies identified were positive for anopheline larvae .
twenty - one percent of the water bodies had anophelines only , and 28% had culicines only .
table 1 lists the distribution of anopheline larvae in relation to culicine larvae and habitat type .
fifty - five percent ( n = 110 ) of all anopheles larvae were collected from the well - drained grid cells .
the number of anophelines per water body ranged from 0 to 30 in both strata , with 27% of the total number of larvae coming from one habitat in the poorly drained stratum . of the 110-anopheline larvae collected , 101 were morphologically identified as anopheles gambiae s.l .. the remaining nine larvae were unidentifiable due to rearing difficulty in the laboratory .
subsequent analysis of the 101 larvae by polymerase chain reaction ( pcr ) yielded all an .
gambiae s.s .. a total of 826 culicine larvae were also collected from within the 29 water bodies , although not identified to species nor considered further in this analysis .
distribution of mosquito larvae in water bodies identified within malindi during november and december 2002 . ninety percent of the 29 water bodies identified were classified as human - made .
types of human - made water bodies in malindi included drained or abandoned swimming pools , drainage channels , abandon bathtubs , roadside ditches , water tanks , and broken pipes .
eighty percent of the habitats identified were classified as temporary habitats , while the remaining 20% were classified as permanent bodies of water .
fifty percent of all water bodies contained debris such as plastics , paper , aluminum , polypropylene gardening bags , and organic refuse .
most water bodies had cement or rock substrates ( 83% ) , although 3 ( 10% ) had mud substrate and 2 ( 7% ) were comprised of plastic .
figure 2a,2c & 2e illustrate the types of water bodies found in the well drained stratum , while figure 2b,2d & 2f represent the types of water bodies identified in the poorly drained stratum .
although many of the selected grid cells contained various levels of both commercial and household farming activities , no water bodies were identified from within these areas .
pictures illustrating the types of habitat identified by strata during this study : ( a ) swimming pool in well drained tourist area ; ( b ) broken water pipe in well drained residential area ; ( c ) open water tank in poorly drained area ; ( d ) pond in poorly drained area ; ( e ) drainage channel in well drained area ; and ( f ) ditch and tire tracks in poorly drained area .
table 2 presents results from the first stage bivariate analysis . although the proportion of water bodies classified as human - made versus natural , the proportion of water bodies with some shade versus no shade , and the proportion of water bodies located within 20 meters of a house were different by strata , insufficient variability in the distribution of data about the 2 2 table rendered the results difficult to interpret ; thus , no test statistic was calculated .
the proportion of water bodies with animals present versus without animals present was the only variable significantly different by strata , with water bodies in well - drained areas significantly less likely to have animals present , as compared to water bodies in the poorly drained stratum ( o.r .
this result is most likely due to the fact that animals typically eat grass , and grass tends to grow best in wet areas , which may be more abundant in poorly drained areas .
bivariate results for proportions of water bodies located in well drained versus poorly drained grid cells by environmental variables collected about the water body ( n = 29 ) . * d.f .
= 1 , * * insufficient variability in the data table 3 presents results from a second first - stage bivariate analysis .
the proportion of water bodies with anopheline larvae present was significantly different for water bodies with pollution versus without pollution only ( o.r . = 14.0 ; 95% c.i .
polluted water bodies were 14 times more likely to have anopheline larvae present as compared to water bodies with no pollution or floating debris , although the confidence interval is quite large .
this finding was opposite what one would expect and was most likely due to the low number of water bodies identified .
the proportion of water bodies with anopheline larvae present versus absent was not significantly different for other variables measured .
further , calculating a meaningful chi - square statistic was not possible for 4 of the variables due to the lack of variability in the data about the 2 2 table .
bivariate results for proportions of water bodies with anopheline larvae versus no larvae by environmental variables collected about the water body ( n = 29 ) . *
= 1 * * insufficient variability in the data thirty - three grid cells contained no water bodies during the study period .
the well - drained stratum contained 67% of the 29 water bodies identified , distributed across 11 grid cells , while the poorly drained stratum contained 33% of the total , distributed across 6 grid cells .
all selected grid cells were within 3 km of the city center , while the average number of households per grid cell was equal to 110 ( min .
the average proportion of households harboring animals and the average proportion of households engaged in agricultural activity within or around the property were both equal to 41% .
only 15% of households per grid cell reported doing some form of larval source reduction on a regular basis , including removing standing water and clearing debris or vegetation from blocked drains .
forty - seven percent of the 629 households reported having access to electricity and 52% reported owning their own home .
results from a grid cell level bivariate analysis ( n = 50 ) indicated that the proportion of grid cells with at least one water body did not differ significantly between the poorly drained and well - drained strata ( o.r . = 2.4 ; c.i .
the number of grid cells with higher than the average proportion of households engaged in some form of agriculture within or around the property was not different by strata , although grid cells in the well drained stratum were less likely to be above the mean , as compared to grid cells within the poorly drained stratum ( o.r .
results from a second grid cell level chi - square analysis ( n = 50 ) indicated that the presence of at least one water body per grid cell was not significantly different between high and low household farming groups ( o.r .
= 0.59 , 6.4 ) , although grid cells with higher than the mean number of households engaged in some form of farming within or around the property were almost twice as likely to have at least one water body present .
figures 3a and 3b illustrate a large commercial plot of maize behind a house and a household farm plot on the edge of town , respectively .
although large commercial farms also exist in malindi , few were included within the selected grid cells , and even fewer were adjacent to , and managed by , households selected for an interview .
3a illustrates a cultivated field , 3b illustrates a household farm , and 3c represents an ornamental garden .
results from the logistic regression suggest that the distance to the city center , drainage , and the house ownership plus electricity variables were significantly associated with the occurrence of water bodies .
the abundance of households per grid cell was marginally significant , and the household - level farming variable tested insignificant .
although not significant , the odds of the outcome occurring was almost 6 times more likely for grid cells with higher than average levels of household farming as compared to those with less than the average , while controlling for other covariates in the model ( or = 5.77 ; p = 0.199 ) .
the unadjusted odds of the outcome occurring was 1.5 more likely for grid cells with higher than average levels of household - level agricultural activity , as compared to those with less than the mean ( o.r .
0.32 , 6.34 ) , while controlling only for the clustering of houses in the regression .
the signs of the beta coefficients were in the expected direction for the house density variable , the distance to the city center variable , and the household farming variable .
that is to say , the probability of the outcome occurring increased as house density decreased , increased as distance to the city center increased , and increased for grid cells with higher than average levels of households engaged in farming activities within or around the property .
both the drainage and house ownership plus electricity variable signs of the betas were opposite what one might expect , suggesting that an increased level of house ownership plus electricity was associated with an increased probability of the outcome occurring .
the household - level farming variable did not test significant in the model after accounting for potential confounders , suggesting that other factors may be important determinants of water body occurrence .
however , the sign of the beta coefficient was in the expected direction , suggesting that farming may have a positive effect on the probability of water body occurrence at some level . as well
, irrigated commercial farm plots also exist in malindi , but may not have been adequately represented within selected grid cells .
figure 4 illustrates the estimated risk of water body occurrence within the selected grid cells . in this illustration
, the distribution of risk suggests that areas in close proximity to the city center may be at a reduced risk , as compared to areas further away .
as well , areas of high and low risk appear to be somewhat clustered , suggesting possible spatial correlation in the outcome variable , as well as the presence of additional factors operating to effect the overall risk of water body occurrence in malindi . as such , a properly designed spatial analysis may yield more precise standard errors for model coefficients .
this study characterized larval habitats within malindi , examined relationships between the occurrence of anopheline larvae and human ecological characteristics of the water body , and quantified the effect of household - level farming on the occurrence of water bodies .
nearly all water bodies were human - made , with the well - drained stratum harboring 67% of the total larvae collected .
although this observation was interesting and may be important with respect to the epidemiology of malaria parasite transmission within malindi , the limited number of water bodies located , and the lack of simultaneous adult mosquito sampling in the area precludes our ability to unequivocally draw conclusions regarding associations with malaria parasite transmission .
a key assumption in this analysis was that the abundance and distribution of water bodies was a proximate determinant of the number of adult mosquitoes in the area , although we recognize that a plethora of factors interact on multiple biological and physical scales to affect the actual abundance and distribution of anophelines .
as such , the results from this study may hold true in dry periods only , and in areas where humans are modifying the urban landscape in similar ways .
first , water bodies with pollution or floating debris were 14 times more likely to have anopheline larvae , as compared to water bodies identified with no pollution or floating debris .
this is in sharp contrast with what one might expect , where the general rule is that pollution has an inhibitory affect on anopheline larval development .
it is possible that the types of pollution and debris found in malindi have little biological affect on oviposition preference or mosquito larval development .
as well , the types of debris and pollution found may have an inhibitory affect on natural predators of mosquito larvae , rendering aquatic habitats free of predation , which in theory could lead to increased nutrients and space for larval development within the habitat .
no statistical difference was detected between water bodies with anopheline larvae present and categories of additional human - ecological variables measured in this study .
this result is most likely affected by the small sample size used and the lack of variability in some of the data . to understand the mechanisms driving the observed relationships increased sample sizes and in depth case studies on the physiochemical properties of the habitat are needed . secondly , the results from the first bivariate analysis suggest that characteristics of water bodies do not fundamentally differ between well and poorly drained areas .
more habitats were identified and larvae collected in the well - drained stratum , suggesting that water body occurrence and subsequent oviposition operates independent of precipitation in certain circumstances . drained or abandoned swimming pools , which have subsequently filled with rainwater , were the most important type of habitat identified .
these swimming pools within the well - drained , and high - income and tourist areas are situated for access to sunshine , rendering water temperatures sufficient for larval development , and typically have high levels of natural and ornamental vegetation nearby for adult mosquito resting habitat .
this suggests that although the influence of drainage in terms of oviposition behavior may be similar across the strata , the strata are actually measuring human - ecological variations in socioeconomic status and community level infrastructure development , which influence the behavior of the adult mosquito .
further , the well - drained stratum is predominantly characterized by commercial and tourism related activities , while the poorly drained stratum consists mostly of residential and patches of undeveloped or cultivated land .
this observation is important in terms of the types of human activities that may be influencing mosquito population dynamics . in the absence of sustained precipitation , such as in this study , no difference appears to exist between the two strata .
this study also quantified the effect of household - level farming on the probability of water body occurrence .
results from the logistic regression analysis suggest that farming within or around the home does not necessarily contribute to the occurrence of water bodies , after accounting for the effects of distance , house density , access to resources , and drainage typology of the area .
further , independent variables used within this analysis may actually be measuring the same thing . although the grid cells were relatively homogeneous within the well - drained and poorly drained areas in terms of human activities , land - use , and drainage ,
there exist pockets of heterogeneity within the grid cell that this analysis failed to capture .
this unobserved heterogeneity might have indirectly influenced the outcome , which suggests that the scale and assumptions used regarding the study area may not be the most appropriate .
the sampling strategy employed may have also failed to capture important heterogeneity , as clusters tend to be more homogeneous with respect to human activity .
first , farming within or around the household was not significantly associated with the occurrence of water bodies , after controlling for community confounders , although the sign of the beta coefficient was in the expected direction .
this is in contrast to the results from a study in ghana , which found that irrigated urban farm plots were associated with increased numbers of anopheles mosquitoes . in this analysis ,
it is possible that the distance to the city center variable was acting as a surrogate for a vector of community level variables , including small - scale land - use and the likelihood of urban agriculture within an area .
because the built environment and the density of people generally decrease as the distance from the city center increases , and the types of habitats found were predominantly human - made , the abundance of people was more important in terms of predicting the occurrence of water bodies .
the house density variable had a negative effect on the outcome and the distance to city center variable had a positive effect on the outcome , suggesting that human perturbation , reductions in open space and the built environment influence mosquito ecology .
increasing human perturbation reduces open space and increases the level of pollution in the area , if adequate sewer and sanitation services are lacking .
the built environment is assumed to reduce the abundance of mosquitoes by reducing or eliminating standing water .
soil and vegetation are replaced with asphalt , concrete , brick , or stone for housing , commercial , or industrial activities .
drainage systems and paved roads are built and enclosed water delivery systems introduced , thus further reducing potential anopheline habitat . however , as population settlements extend toward the rural areas , new construction activities , excavation sites , and irrigation schemes are introduced , which can provide important larval habitats in the presence of precipitation .
secondly , the opposite direction of the beta coefficient for the drainage variable suggests that engineered drainage systems and topography may be less important than suspected in terms of water body development during periods of little precipitation .
although in periods of increased precipitation , as in our earlier studies in kisumu and malindi , kenya , many water bodies were observed in the poorly drained strata , suggesting that drainage does effect water body development at some level .
the informal economy and lack of access to piped water may also be acting to distort the effect of drainage in this model . in malindi ,
water pipes are broken in an attempt to procure free water for sale or consumption in many of the well - drained areas ( figure 2b ) .
community taps and urban garden wells , in areas of high population density , can also provide excellent aquatic habitat for anopheline mosquitoes .
as people move into areas with little access to piped water , there is more community use at the taps , increases in the number of artificial water storage containers , and an increase in the amount of standing water around the tap .
open containers , excavation projects , and container type equipment also provide ample habitat if water - filled .
however , most aquatic habitats were found in the well - drained stratum and on properties that were considered either high - income or tourism related .
swimming pools that were drained or abandoned , and containing rainwater , were the most important larval sites found in this study .
this observation suggests the need to reconsider the potential deleterious health effects of tourism development , as well as the environmental and health effects associated with the mismanagement of private property in malindi .
given the relatively low number of habitats identified , and the highly significant relationship between water body occurrence and distance to the city center , community level source reduction may be effective in reducing the number of mosquitoes in the area in the absence of sustained precipitation .
although urban agriculture may play a role in the creation of anopheline habitat at some level , individual or household - level human agricultural activity may be less important than community level land - use and the overall abundance of human perturbation in the area . during the data collection phase of this study , engineered drainage systems and
buried water delivery and sewer systems were being installed throughout malindi and peri - urban areas .
although the excavation and movement of earth , as well as the machinery tire tracks left in the area may have a positive effect on the development of potential larval habitat in the short - term , the long - term benefits of access to piped water , covered drainage systems , and improved sanitation service will reduce the propensity of the area to harbor anopheline mosquitoes .
in this analysis , household -level agricultural activity was not found to be a significant factor affecting the occurrence of water bodies within the community . however , because areas of standing water have been observed in many areas under cultivation in malindi ( keating per observation 2001 & 2002 ) , it is crucial that we continue to explore methods for mitigating the development of larval habitats .
the importance of proper drainage should be stressed as one tool for reducing urban mosquito populations .
further , the fact that most aquatic habitats were human - made suggests that increased awareness at all levels , as to the benefits of reducing standing water and corresponding mosquito populations , should be enforced .
the fact that many larvae were coming from few sites , and few sites in general were found under relatively dry conditions suggests that mosquito populations could be reduced by active targeting of specific areas . a door - to - door effort
may then be necessary , as most water bodies in this study were found on private or commercial property . as well , because drained swimming pools , which have subsequently filled with rainwater , were found to be an important source of standing water , it is paramount that efforts be made to disseminate the appropriate information to both residents and businesses with swimming pools .
secondly , the importance of economic development at both the community and household level can not be understated . in the absence of economic opportunities normally associated with urban livelihoods
, individuals will continue to engage in rural - type activities , which may modify the urban landscape in unforeseen ways . in malindi
, the presence of active community groups , municipal councils , mosquito abatement programs , economic incentive in the form of tourism , suggests that reducing mosquito populations and the overall burden of malaria disease is a reasonable and attainable goal .
institutional review board pcr polymerase chain reaction psu primary sampling unit usu ultimate sampling unit
jk led the data collection , analysis , and write - up of the manuscript ; km co - developed the research protocol and sampling strategy , co - wrote sections of the manuscript and assisted with the editing ; cm co - developed the study design , supervised data collection , and assisted with the editing ; jg co - developed the study design and assisted with the editing ; jb co - developed the research protocol and sampling design , co - developed the study design , and assisted with the write - up and editing .
summary statistics for a multi - level logistic regression model estimating controlled effect of agricultural activity within or around households on the probability that a water body exists within the grid cell . * continuous variables , no odds ratio reported
we are grateful for the assistance provided by the scientific and technical staff at the center for geographic medicine research - coast , kemri .
we would like to thank nellie njoki , samuel kahindi , lydiah kibe , bonface nyaga , and roselyn kasati for data collection efforts .
we would also like to thank maurice ombok and richard amimo at kemri - center for vector biology and control research , kisian , kenya , who assisted with the mapping in 2001 .
this paper is published with the permission of the director of the kenya medical research institute .
Output:
| backgroundthis study characterized anopheles mosquito larval habitats in relation to ecological attributes about the habitat and community - level drainage potential , and investigated whether agricultural activities within or around urban households increased the probability of water body occurrence .
malindi , a city on the coast of kenya , was mapped using global positioning system ( gps ) technology , and a geographic information system ( gis ) was used to overlay a measured grid , which served as a sampling frame .
grid cells were stratified according to the level of drainage in the area , and 50 cells were randomly selected for the study .
cross - sectional household and entomological surveys were conducted during november and december 2002 within the 50 grid cells .
chi - square analysis was used to test whether water bodies differed fundamentally between well and poorly drained areas , and multi - level logistic regression was used to test whether household - level agricultural activity increased the probability of water body occurrence in the grid cell.resultsinterviews were conducted with one adult in 629 households .
a total of 29 water bodies were identified within the sampled areas .
this study found that characteristics of water bodies were fundamentally the same in well and poorly drained areas .
this study also demonstrated that household - level urban agriculture was not associated with the occurrence of water bodies in the grid cell , after controlling for potential confounders associated with distance to the city center , drainage , access to resources , and population density.conclusionshousehold-level urban agricultural activity may be less important than the other types of human perturbation in terms of mosquito larval habitat creation .
the fact that many larvae were coming from few sites , and few sites in general were found under relatively dry conditions suggests that mosquito habitat reduction is a reasonable and attainable goal in malindi . |
PubmedSumm7862 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: birth weight , like growth , is determined by the complex interplay of genetic and environmental factors .
however , birth weight varies within genetically similar populations [ 1 , 2 ] , suggesting that environmental factors play a significant role
. low birth weight ( lbw ) is defined as weighing less than 2500 g ( 5.5 pounds ) at birth , and is an important predictor of mortality and morbidity in the neonatal period , early postnatal growth , and growth during childhood .
it also has negative effects on cognitive and behavioral development in the first years of life , health status during childhood , and adult health .
infants who are born with low birth weight ( lbw ; birth weight < 2500 g ) are divided into 2 categories : those who were born too early and those born too small .
the 2 categories of lbw preterm delivery ( ptd ) and intrauterine growth retardation ( iugr ) separate infant health outcomes and have different causes . causes and risk factors for lbw ,
attributable to both ptd and iugr , have been studied extensively , although earlier literature primarily grouped ptd and iugr into the larger lbw category . in developing countries ,
most cases of lbw are attributed to intrauterine growth retardation ( iugr ) rather than to preterm delivery .
maternal risk factors for having an infant with lbw in general include young age , unmarried marital status , less education , lower income , smoking , poor nutrition , and having had a previous infant with lbw [ 8 , 9 ] .
the association of other factors such as stress and exposure to some types of work during pregnancy remains unproven .
other risk factors for lbw such as maternal age , although not themselves environmental factors , are strongly influenced by the social environment .
recent literature has demonstrated that maternal stress , isolation , depression , and anxiety were associated with lbw [ 1014 ] .
some studies have linked high maternal self - esteem , optimistic personality traits , and strong social networks with higher birth weight [ 15 , 16 ] .
other studies , however , did not demonstrate association between birth weight and psychosocial factors after controlling for confounding variables , such as smoking [ 17 , 18 ] . as much as 16% of all live births worldwide are lbw with a range of 3 , 338% , > 90% being in low - income countries .
birth weight figures are a useful parameter for assessing the effectiveness of prenatal medical care and indirect indicators of the share of at - risk newborns in the newborn population .
perinatal outcome is the measure of the quality of perinatal care given to the mother and child before , during , and after delivery .
low birth weight is a public health problem , and complicates around 17% of all births .
the aim of this study was to examine association between incidence rate of low birth weight in live born infants and perinatal outcome with maternal sociodemographic status in tuzla canton during 19921995 war in bosnia and herzegovina .
population of 4.39 million of which 2.78 million lived on the territory of the present federation of bosnia and herzegovina , one of the two political entities in the republic of bosnia and herzegovina .
tuzla canton ( 2909 km ) has 13 municipalities and 510 353 inhabitants ( figure 1 ) . before the 19921995 war in bosnia and herzegovina ,
primary health care was provided in health centers and their outpatient facilities , secondary health care in general and regional hospitals and only partially in health care centers ( specialized counseling ) , while tertiary health services were provided in medical centers which were also university teaching hospitals .
perinatal care in tuzla canton had not been provided at the primary health care level mostly due to insufficient perinatal knowledge and clinical skills of primary care physicians and other staff , and a lack of adequate equipment and space as well .
thus , as an addition to tertiary health care , secondary health care which was easily accessible provided most of health care services to pregnant women , women giving birth , and newborns .
all deficiencies of the health care system organization in tuzla canton became obvious during the war period .
regular examinations during pregnancy could not be performed at any level of health care , health care at birth was inadequate , and neonatal health care was almost nonexistent .
many hospital systems and the existing equipment were damaged or destroyed in war , shortages of medicines was evident , and a large proportion of health care staff either left the country or was needed on the battlefield .
furthermore , there was a massive migration of the population due to the war and some parts of the country , such as tuzla canton , were overburdened with a large number of refugees and displaced persons .
the present study covers a 22-year period ( 19882009 ) , including the war period ( 19921995 ) , and it is based on the basis of the existing delivery protocols and medical histories of pregnant women treated at the gynecology - obstetrics clinic in tuzla . for measuring socioeconomic conditions of mothers we used definition that socioeconomic status ( ses ) is an economic and sociological combined total measure of a person 's work experience and of an individual 's or family 's economic and social position relative to others , based on income , education , and occupation . when analyzing a family 's ses , the household income earners ' education and occupation
are examined , as well as combined income , versus with an individual , when their own attributes are assessed .
socioeconomic status is typically broken into three categories , high ses , middle ses , and low ses to describe the three areas a family or an individual may fall into .
when placing a family or individual into one of these categories any or all of the three variables ( income , education , and occupation ) can be assessed .
we retrospectively collected data on a total of 108 316 liveborn infants and their mothers from three different socioeconomics periods : before ( 19881991 , middle ses ) , during ( 19921995 , low ses ) , and after the war ( 19962009 , low to middle ses ) .
the available data with the known birth weights comprised 23 194 live births over the 4 years of the prewar period ( 5 798 annually ) , 18 302 live births over the 4 years of the war period ( 4 575 annually ) , and 66 820 live births over the 14 years of the postwar period ( 4 722 annually ) .
we analyzed collected data such as the number of lbw , stillbirths , early neonatal deaths , perinatal deaths , gestational age , birth weights , and body length .
we restricted the analysis to singleton liveborn infants of mothers who were between 15 to 49 years old , had complete information on birth weight , perinatal care , and age .
data about material and economic situation were not available during the war , because the refugees were allocated in collective accommodation and they together with domestic people had limited quantities of food .
data about marital status were not valid because pregnant women are traditionally married in bosnia and herzegovina , but during the war a lot of families were separated women had been raped and husbands were killed .
newborns were defined as low birth weight if their estimated birth weight was < 2500 g at birth , irrespective of gestational age .
infants who are born with low birth weight ( lbw ; birth weight < 2500 g ) are divided into 2 categories : those born too early and those born too small .
standard practice in this institution is to weigh infants without diapers and with the umbilical cord shorter than 10 cm using spring scales to the nearest 100 g. we investigated the proportion of liveborn infants with low birth weight ( < 2500 g ) by comparing the proportions of birth weight subgroups of 500999 g , 10001499 g , 15001999 g , and 20002499 g in the pre - war , war , and postwar periods .
body length ( cm ) was measured from crown to heal in a newborn with completely extended legs and feet at the angle of 90. the ponderal index was calculated as 100 ( birth weight ( g)/birth length ( cm ) ) .
gestational age in weeks was estimated from the number of days between the first day of the last menstrual period and date of birth and from ultrasound examination if performed .
if these data were not available , gestational age was assessed on the basis of external physical characteristics of the newborn .
stillbirth rate was defined as the number of stillbirths after 24 weeks of gestation per 1000 total births in the same time period .
ante partum stillbirths were those that occurred before the onset of labor , whereas intrapartum stillbirths were those that occurred during labor .
the fetus was assumed to be alive at the beginning of labor unless there was evidence for otherwise .
early neonatal mortality was defined as the number of liveborn babies who died within the first 168 hours ( 7 days ) after birth per 1000 live births .
perinatal mortality was defined as the number of deaths of newborns born after 24 weeks of gestation or with body weight of 500 g per 1000 live births .
differences in categorical data between the study periods were assessed by the test . for 2 by 2 tables ,
the linear trend was calculated for the 500-g birth weight subgroup rates per 1000 liveborn infants with extended mantel - haenszel test for trends .
statistica 6.0 ( stat soft inc . , tulsa , ok , usa ) was used for all statistical analyses .
between 1988 and 2009 , records on 108 316 singleton births were registered via medical childbirth notification forms . a total of 4088 ( 3.8% ) mothers had infants who had lbw . during the war , 1373 ( 7.5% ) mothers gave a birth to children with low birth weight ( had birth weight of < 2500 g ) which is significantly more in comparison with 851 ( 3.6% ) mothers who gave a birth to children with lbw before ( rate ratio 2.129 ; 95% confidence interval ( ci ) ; 1.9502.324 ) and 1864 ( 2,8% ) after the war ( rate ratio 2.826 ; 95% confidence interval ( ci ) ; 2.6303.036 ) . during the war , in the group of term infant 4.5% of liveborn had lbw , which is significantly more in comparison with the two other groups before 1.8% and after the war 1.1% ( p < .0001 ) . however , during the war , more infants had lbw because the iugr , while in the two other period more infants had lbw because of the preterm delivery ( ptd ) . during the war of 39.5% of mothers with lbw had preterm labor ( < 37 weeks ) and in comparison to the other two periods ( 45.5% and 47.4% ) the difference is statistically important ( p < .0001 for both periods ) .
bigger number of mothers who gave birth with lbw on time ( 51.1% ) and after term ( 9.1% ) , which is in comparison to period after and before war important statistic difference ( table 1 ) .
however , 92 mothers gave a birth to stillborns with lbw during the war and in comparison to mothers before the war , prevalence among stillborns with lbw was on the edge of statistical importance while in after war period prevalence of stillborns with lbw was smaller .
there is significant difference before and during the war ( p = .04 ) , but it significantly decreased after the war ( p = .0001 ) .
the proportion of deliveries attended by health care providers was 75.9% during the war , which was significantly lower than before ( 99.1% ) and after ( 99.5% ) the war ( p < .001 ) .
the number of examinations during pregnancy was 1.8 in the war period , which was low in comparison with the number of examinations before ( 4.6 ) and after ( 7.1 per pregnant woman ) the war ( p < .001 for both ) . we found that 7.9% of mothers with lbw had first - trimester prenatal care during the war compared with 52.4% of mothers with lbw before ( rate ratio : 0.078 ; 95% confidence interval ( ci ) : 0.0610.099 ) and 33.8% after the war which was statistically significant ( rate ratio : 0.168 ; 95% confidence interval ( ci ) : 0.1350.209 , resp . , ( table 2 ) ) . during the war ,
68.9% mothers who delivered infants with lbw began pnc in third trimester , which is a statistically significant difference comparing to mothers who delivered infants with lbw before ( rate ratio 11,193 ; 95% confidence interval ( ci ) : 0.03813.862 ) and after the war ; ( rate ratio 5.854 ; 95% confidence interval ( ci ) : 5.0236.822 ) .
the early neonatal deaths , 5.8 per 1000 total births was significantly higher during the war than before the war 2.1 per 1000 total ( p < .0001 ) , but after the war 2.4 per 1000 total births they did not have significant difference ( p < .448 ) .
perinatal mortality rate of 10.8 per 1000 total births was significantly higher during the war than before and after the war ( 6.2 and 5.2 per 1000 total births , respectively ; p < .05 for both ) .
the proportion of liveborn infants with birth weight of 500999 g during the war did not have significant difference in comparison to the other two periods ( p < .239 ) .
the proportion of liveborn infants with birth weight 20002499 g ( 50.9% ) was the highest after the war .
the average birth weight , birth length , and gestation age of newborns with lbw during the war was significantly lower than before and after the war ( table 3 ) .
average weight of newborns with lbw during the war in relation to gestation age and ponderal index suggests that lbw occurred not because of preterm birth , even though average gestation age was less than 37 weeks , but for unsatisfactory intrauterine growth or stagnation in intrauterine growth .
mothers with infants who had lbw were during the war more likely to be muslim , refugees , had less than a high school education , married , and mostly younger than 20 years .
the number of mothers between 2529 years with infants who had lbw was noted during the war was by 5% lower than their number before the war , but not very different from the number after the war ( table 2 ) .
significantly higher number of mothers aged 35 and older ( 28.9% ) was during the war than before and after the war ( 18.6% and 20.5% , resp .
our results suggest that the impact of socioeconomic status on birth weight is mediated through the differential utilization of prenatal care and access to medical facilities .
we found that the number of newborns with lbw in tuzla canton significantly increased during the 19921995 war . during the war , bosnia and herzegovina
did not introduce any measures ( e.g. , increase the level of health consciousness in collective centres and distribute larger quantities of humanitarian aid to pregnant women ) to counteract the unfavourable socio - economic situation at least partly .
we believe that a low maternal sense of control was associated with lbw which occurrence increased to 7.5% compared with the prewar rate of 3.6% and 2,8% after the war .
however , during the war more infants had lbw because of the iugr , while in the two other periods more infants had lbw because of the preterm delivery ( ptd ) .
low birth weight and preterm delivery are the most important determinants of neonatal mortality , as well as infant and childhood morbidity .
we found perinatal mortality rate lbw of 10.8 per 1000 liveborn infants was significantly the highest during the war , as well as early neonatal mortality rate .
however , the rate of stillborns was significantly higher during the war than before and after the war .
the incidence of low birth weight shows a marked geographical pattern [ 26 , 27 ] .
more than 20 million infants worldwide , representing 15.5 per cent of all births , are born with low birth weight , 95.6% of them in developing countries .
the level of low birth weight in developing countries ( 16.5% ) is more than double the level in developed regions ( 7% ) .
half of all low birth weight babies are born in south central asia , where more than a quarter ( 27% ) of all infants weighs less than 2,500 g at birth .
central and south america have , on average , much lower rates ( 10% ) , while in the caribbean the level ( 14% ) is almost as high as in sub - saharan africa .
a geographical pattern characterized the incidence of low birth weight in europe , with lower rates in the more northerly countries .
our study shows that during the war , 68.9% of mothers who delivered infants with lbw began pnc in the third trimester , which is statistically significant difference in comparison to mothers before 16.6% and after the war 27.6% .
if we add other negative factors related to war condition it seems that insufficient health care for pregnant women and newborns in bosnia and herzegovina in war circumstances , combined with poor socioeconomic conditions , constant fear , stress , and destruction of homes and families , was the main factor accounting for the increase in number of mothers who gave a birth to a children with lbw during that period .
the beneficial effects of prenatal care have been documented in many observational studies over several decades [ 3235 ] .
studies that have assessed the influence of advanced maternal age on lbw , preterm , and iugr deliveries among primigravidas have provided conflicting and inconclusive results . in our study , as a result of the increasing proportion of births in women aged 35 years and older during the 19921995 war perhaps influenced to increase in number of children with lbw .
so the main factors of lbw were fewer examinations of women during pregnancy , more unattended deliveries , and perinatal care in country during war period .
rohrer 's ponderal index in newborns was used as an indicator of fetal growth status and lower ponderal index , as in our study , indicates a strong impact of maternal factors with lbw .
there is limited earlier literature on the role of sense of control and pregnancy outcomes , especially iugr .
the limitations of our study were incomplete data on the parity and pathological conditions of mothers and children during pregnancy , such as pathology associated with premature childbirths and intrauterine growth retardation with consequential low birth weight and hypertrophy of infants .
we were also unable to examine risk factors such as chronic and comorbid conditions , congenital malformations , obstetric complications , and infections .
limited accessibility and quality of perinatal health care during the war had detrimental effects on infants ' weight .
associations between other psychosocial factors and iugr should be explored further for better understanding of how stress and psychosocial resources have an impact on fetal growth and possibly in a prospective manner to limit potential biases .
our results suggest that the impact of socioeconomic status on birth weight is mediated through the differential utilization of prenatal care and access to medical facilities . during the war , bosnia and herzegovina did not introduce any measures ( e.g. , increase the level of health consciousness in collective centers and distribute larger quantities of humanitarian aid to pregnant women ) to counteract the unfavorable socio - economic situation at least partly .
higher number of low birth weight newborns during the war had influence on current surveillance , but long - term effects will be seen in the future .
further investigations in tuzla canton should be in that direction with the aim of showing the ventual consequence on population over these years .
Output:
| objectives . we examined association between incidence rate of low birth weight in liveborn infants and maternal sociodemographic status in tuzla canton during 19921995 war in bosnia and herzegovina . methods .
the present study covers a 22-year period ( 19882009 ) , including the war period ( 19921995 ) , and we retrospectively collected data on a total of 108 316 liveborn infants and their mothers from three different socioeconomic periods : before ( 19881991 ) , during ( 19921995 ) , and after the war ( 19962009 ) .
association between incidence rate of low birth weight in liveborn infants and maternal sociodemographic status were determined for each study period .
results .
there were 23 194 live births in the prewar , 18 302 during the war , and 66 820 in the postwar period . among the liveborn infants born during the war , 1373 ( 7.5% ) had birth weight of < 2500 g , which is significantly more in comparison with 851 ( 3.6% ) liveborn infants in this birth weight group born before and 1864 ( 2.8% ) after the war .
we found the number of examinations during pregnancy was 1.8 per pregnant woman in the war period , which was low in comparison with the number of examinations before ( 4.6 per pregnant woman ) and after ( 7.1 per pregnant woman ) the war ( p<.001 for both ) .
prewar perinatal mortality lbw infants of 6.2 per 1000 live births increased to 10.8 per 1000 live births during the war ( p<.001 ) , but after the war , perinatal mortality lbw infants ( 5.2 ) and early neonatal mortality ( 2.4 ) decreased .
conclusions .
we found statistically significant association between low - birth - weight and maternal sociodemographic status in tuzla canton during 19921995 war in bosnia and herzegovina . |
PubmedSumm7863 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: sepsis and septic multiple organ failure are leading causes of morbidity and death in critically ill patients .
alterations to the patient 's immune system , with an excessive systemic inflammatory response on one hand and paralysis of cell - mediated immunity on the other , appear to be the key elements in the pathogenesis of multiple organ failure and susceptibility to infection .
thus far , immune - based interventions have met with limited success , at least in phase iii trials . a better understanding of the immunopathogenesis of multiple organ failure is needed if we are to develop new therapeutic strategies . during the past few years our knowledge in the field of sepsis improved through the use of new animal models that are closer to the human situation than were their predecessors , and as a result of novel immune diagnostic techniques .
the paper by angele and faist focuses on the effects of blood loss and surgical injury on cell - mediated responses , and it provides a comprehensive review on this important issue .
those authors themselves significantly contributed to our current ' state of the art ' knowledge .
the studies summarized in that review indicate that injury , trauma and blood loss result in a marked suppression in cell - mediated immunity that is associated with an increased susceptibility to wound infection and sepsis . in particular , the alterations in monocyte / macrophage and lymphocyte function are addressed .
monocytes from patients after blood loss , trauma and major surgery frequently exhibit depressed ex vivo secretion of tumour necrosis factor ( tnf ) , il-12 and other cytokines in response to lipopolysaccharide , and a downregulation in hla - dr expression and antigen - presenting capacity . in addition ,
t cells , in particular type 1 cytokine - secreting t cells , show functional abnormalities . in some clinical situations an expansion of type 2 cytokine - secreting cd8 t cells was observed .
in addition , the review notes important differences between sexes in altered immune responsiveness following trauma , injury and blood loss .
it is well established that male critically ill patients are more susceptible to infections and sepsis , and have a higher mortality than do female patients . by using murine models
, it was demonstrated that sex hormones and dehydroepiandrosterone play important roles in sex - specific immune responsiveness following blood loss , trauma and injury . on the basis of the well established observation of immunodeficiency following trauma , blood loss and major surgery , three questions arise .
activation of the stress response plays an important role in downregulating systemic immune responsiveness following trauma , injury and blood loss ( fig .
the regulatory role of the hypothalamic - pituitary - adrenal axis , which can stimulate corticosteroid release , is well established .
recent data show that the sympathetic nerve system and the vagus are also involved in the regulation of immune responsiveness .
the three systems downregulate monocyte / macrophage proinflammatory ( e.g. tnf release ) and antigen - presenting functions both directly and indirectly by induction of immunomodulatory cytokines ( e.g. il-10 )
. il-10 also deactivates t cells , in particular type 1 cytokine - secreting t cells .
regulation of monocytic hla - dr , tumour necrosis factor ( tnf ) secretion and antigen - presenting cell ( apc ) activity .
g - csf , granulocyte colony - stimulating factor ; gm - csf , granulocyte / macrophage colony - stimulating factor ; ifn , interferon ; lps , lipopolysaccharide ; tgf , transforming growth factor .
this interaction between immune and central nervous systems is important for preventing excessive inflammatory reactions in intensive care unit patients .
however , extensive systemic inflammation ( e.g. following endotoxin translocalization or severe infection ) leads to a strong and long - lasting activation of the immune deactivating stress axis , which increases susceptibility to infection .
in addition , high levels of corticosteroids and catecholamines induce apoptosis of lymphocytes , resulting in defects in the adaptive immune system . moreover , a strong inflammatory response of monocyte / macrophages also directly deactivates these cells via negative feedback mechanisms ( endotoxin desensitization , tnf - induced il-10 and il-1 receptor antagonist release , etc . ) .
inflammation- and hypoxia - related tissue injury results in release of apoptotic cells , which are taken up by monocyte / macrophages via a receptor that deactivates their inflammatory and antigen - presenting pathways . in summary ,
during the past few decades several assays for measurement of immune responsiveness have been reported . a problem , however , is standardization of the assays .
many of the assays developed thus far do not fulfill the criteria of a modern diagnostic assay .
as suggested in the review , measures of monocyte / macrophage and t - cell function play key roles in diagnosis . during the past few years some well standardized assays for detecting monocytic cytokine secretion ( whole blood assay with semi - automatic cytokine measurement ) , monocytic hla - dr and cd86 expression ( quantitative flow cytometry , allowing counting of molecules per cell ) , and t - cell cytokine profiling ( differentiation of type
1/2 cytokine patterns by intracellular cytokine staining and flow cytometric analysis ) have been developed . using standard operation procedures , interassay variation of less than 20% can be achieved .
what can we do to prevent / overcome excessive immunodepression ? following high - dose immunosuppression in transplant patients using corticosteroid bolus or pan - t - cell antibodies , we observed a temporary decrease both in monocyte and t - cell function .
long - lasting ' immunoparalysis ' is predictive of the occurrence and outcome of bacterial / fungal infectious complications .
those data suggest a direct relation between immune responsiveness and susceptibility to and course of infection .
as suggested above , a strong perioperative systemic inflammation contributes to long - lasting immune depression .
therefore , it makes sense to attempt to prevent extensive counter - regulation by blocking systemic inflammation .
angele and faist reported on a pilot trial of granulocyte colony - stimulating factor ( g - csf ) in surgical patients .
interestingly , g - csf , which can not directly stimulate monocytes and t cells , prevented immune deactivation ( monocytic tnf secretion , hla - dr expression , il-10 release , etc . ) .
however , it is likely that , in addition to the advanced antimicrobial capacity of g - csf - activated neutrophils , the anti - inflammatory capacity of g - csf contributes to the effect .
endotoxin - neutralizing approaches may also help to prevent inflammation - related immunodepression . in animal models ,
targeting stress mediators ( e.g. steroid receptor or 2-adrenergic receptor antagonists ) is very successful in preventing immune depression , but transfer of this approach from animal house to bedside is difficult because of the short therapeutic window . if ' immunoparalysis ' becomes established , then immunostimulatory approaches may be considered . in pilot trials ,
treatment with plasmapheresis ( removal of inhibitory factors ) , interferon- and gm - csf showed promise .
the availability of well standardized immunoassays will now permit enrollment of patients with ' immunoparalysis ' into multicentre trials .
g - csf = granulocyte colony - stimulating factor ; il = interleukin ; tnf = tumour necrosis factor .
Output:
| multiple organ failure is the major problem in intensive care patients . the failure of the organ ' immune system ' is frequently overlooked , however . in this issue
the article by angele and faist provides an excellent review of the topic .
deactivation of monocyte and lymphocyte functions seems to play a key role in post - traumatic immunodepression . to accompany that review
we summarize our knowledge of the mechanisms of deactivation .
stress response , lipopolysaccharide translocalization and tissue injury contribute to ' immunoparalysis ' .
recently developed , well standardized assays now allow us to monitor the immune system like other organ functions and opens new approaches for therapeutic interventions . |
PubmedSumm7864 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 34-year - old female presented with history of injury to the left eye while viewing bursting firecrackers during a local festival . on initial evaluation , the patient was noted to be alert and oriented , and to have an isolated injury to the left orbit with normal neurologic examination .
local examination showed a metallic bar embedded in her left orbit with a part of it protruding out through her upper eyelid [ fig .
anterior segment examination was unremarkable except a relative afferent pupillary defect in the left eye .
( a ) clinical photograph showing metallic foreign body protruding through left upper eyelid , ( b ) computed tomography scan of the orbits showing the
l- shaped metallic foreign body , ( c ) computed tomography scan three - dimensional reconstruction showing spike - like protrusions along the foreign body ( streak artifacts ) , ( d ) foreign body measurement after removal fundus examination of the left eye revealed blurred optic disc margins , disc hemorrhage , multiple choroidal folds , and retinal hemorrhages at the posterior pole [ fig .
foreign body indentation was present nasal to the optic disc which became more prominent with adduction .
a localized retinal detachment of 34 disc diameters size with subretinal hemorrhage was present adjacent to it [ fig .
2b ] , but no retinal break was noted , which indicated the possibility of posterior scleral injury by the sharp end of the foreign body and self - sealing of the wound subsequently .
( a ) fundus photograph showing indistinct optic disc margins , retinal hemorrhages , and choroidal folds at posterior pole , ( b ) foreign body indentation with subretinal hemorrhage and localized retinal detachment in the nasal retina , ( c ) postoperative resolution of disc edema , hemorrhages , and choroidal folds , ( d ) postoperative disappearance of foreign body indentation and resolution of retinal detachment , with persistent subretinal hemorrhage computed tomography ( ct ) scan of the orbits [ fig .
l- shaped metallic foreign body passing through left upper eyelid , coursing through medial rectus , bending laterally , indenting the sclera , passing superior to the optic nerve compressing it downward .
extraorbital part measured 8 mm , vertical limb of intraorbital part was 27 mm , and posterior limb was 20 mm .
three - dimensional reconstructed ct image showed spike - like protrusions along the foreign body [ fig .
there was decreased amplitude and increased latency on visually evoked response in the left eye . under general anesthesia , surgical removal of the foreign body
laser delimitation around the retinal detachment was done . on examination of the removed foreign body [ fig .
1d ] , no sharp protrusions were seen and the imaging findings were considered as streak artifacts . she was advised oral antibiotics and oral steroids , with topical antibiotic - steroid drops for 2 weeks .
the patient recovered well with restoration of full ocular movements and improvement in optic nerve function . at 2-week follow - up , retinal hemorrhages cleared [ fig . 2c ] and
retinal detachment was well delimited and settled with absorption of subretinal fluid though some subretinal hemorrhage persisted [ fig .
metallic intraorbital foreign bodies are known to be well tolerated and associated with minimal adverse visual prognosis when their path does not traverse through the globe and globe integrity is maintained .
however , there have been several reports of orbital foreign bodies with potential serious eye injuries [ table 1 ] .
clinical characteristics and outcome of various intraorbital foreign bodies in this case , on initial evaluation , the foreign body did not appear to cause any harm to the eyeball as it was embedded in upper lid with its sharp protruding end away from the globe and there were no signs of trauma in anterior segment .
the relative afferent pupillary defect alerted that the optic nerve was compromised , either due to direct injury or through orbital compartment syndrome secondary to hemorrhage and/or edema .
posterior segment examination provided an important clue that the foreign body passed through the medial orbit to cause injury from behind the globe .
we emphasize the need for evaluation of the posterior segment and optic nerve function in every case of intraorbital foreign body .
ct scanning assists in the proper localization of the foreign body , estimation of its consistency , size , path , and the relation to the adjacent orbital tissue . in this case , the unusual path of the foreign body was well delineated by ct scan , which supported the clinical findings of optic nerve compression and globe indentation by the posterior part of foreign body , and helped in planning surgical removal . however
, streak artifacts should be differentiated from any protrusion of the linear metallic foreign body .
surgical intervention in a case with intraorbital foreign body is usually indicated in the presence of a sharp foreign body , signs of infection , proptosis , restricted motility , palpable orbital mass , optic nerve compression , abscess , suspicion of organic material , fistula formation , or when adjacent structures are compromised . in our case ,
indications for surgical intervention were direct optic nerve compression by the foreign body , risk of infection along the foreign body tract , restricted ocular motility , and foreign body compressing the globe on posterior surface .
our experience with this case shows that curved metallic orbital foreign bodies with benign appearance may be associated with sight - threatening retinal injuries .
although foreign bodies with protruding end can simply be removed along their tract , one should be aware of an unusual intraorbital course . in our case ,
thus , we advocate early surgical exploration and guarded extraction of the foreign body to improve the visual prognosis and outcome in such cases .
Output:
| a 34-year - old female presented with firecracker injury with curved metallic foreign body embedded in the left orbit and protruding out through the upper eyelid .
the report highlights notable aspects in diagnosis , decision - making , and successful removal of this unusual case of retro - orbital foreign body . |
PubmedSumm7865 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in a study in the previous issue of critical care , huang and colleagues observed that , in the critically ill , adipose - fatty acid - binding protein ( a - fabp ) concentrations were elevated and that the serum a - fabp concentrations were independently related to serum creatinine , fasting plasma glucose , total cholesterol , tumor necrosis factor - alpha ( tnf- ) , albumin , and the acute physiology and chronic health evaluation ii scores , suggesting that higher a - fabp levels ( > 40 ng / ml ) were associated with an unfavorable outcome in patients with sepsis .
these results not only are interesting but also suggest that perhaps a - fabp could be used a biomarker of prognosis in the critically ill .
but it is not clear why a - fabp levels should be increased in the critically ill or what this increase signifies .
adipocyte fatty acid - binding protein ( a - fabp or fabp4 ) , also known as ap2 ( adipocyte protein 2 ) , is a carrier protein for fatty acids and is expressed primarily in adipocytes and macrophages .
a - fabp belongs to the fatty acid - binding protein super - family whose members have relative molecular masses of approximately 15,000 .
a - fabp is a predominant cytosolic protein of mature adipocytes , accounts for approximately 6% of total cellular proteins , and is an important regulator of systemic insulin sensitivity and lipid and glucose metabolism .
mice deficient in a - fabp are protected from development of hyperinsulinemia , hyperglycemia , and insulin resistance .
adipocytes obtained from a - fabp - null mice had markedly reduced efficiency of lipolysis in vivo and in vitro and showed a two- to three - fold decrease in fatty acid release , suggesting that a - fabp regulates efflux of fatty acids under normal physiological conditions .
acute insulin secretory response to -adrenergic stimulation was profoundly suppressed in a - fabpmice compared with their wild - type littermates , indicating that a - fabp could regulate systemic insulin sensitivity through its actions on other distal target tissues .
a - fabp is also present in macrophages , and its expression in macrophages can be induced by oxidized low - density lipoprotein ( ldl ) and toll - like receptor ( tlr ) agonists and suppressed by statins .
this evidence suggests that a - fabp , by integrating metabolic and inflammatory pathways , provides a key link between components of metabolic syndrome , implying that blocking a - fabp protein could be considered in the treatment of heart disease , diabetes mellitus , asthma , obesity , and fatty liver disease , which are all inflammatory conditions . in this context , it is interesting to note that a - fabpmice are protected from experimental autoimmune encephalomyelitis and showed reduced levels of pro - inflammatory cytokine mrna expression in central nervous system tissue as compared with wild - type mice . in vitro ,
antigen recall responses of myelin oligodendrocyte glycoprotein 35 - 55-immunized a - fabpmice showed reduced proliferation and impaired interferon - gamma production .
dendritic cells deficient in fabps were poor producers of pro - inflammatory cytokines - interleukin-6 ( il-6 ) and tnf-- and did not promote pro - inflammatory t - cell responses , suggesting that metabolic - inflammatory pathway cross - regulation by a - fabps plays a significant role in adaptive immune responses and inflammation .
these results - coupled with the observations that unsaturated fatty acids , such as palmitoleic acid , oleic acid , linoleic acid , linolenic acid , and eicosapentaenoic acid , significantly repressed the basal as well as lipopolysaccharide - induced a - fabp expression in macrophages and depletion of a - fabp expression by rna interference ( rnai ) decreased cyclooxygenase 2 ( cox-2 ) mrna expression and potentiated the repression by linoleic acid -give interesting insights into the relationship among a - fabp , cytokines , and unsaturated fatty acids and their involvement in sepsis and other critical illnesses .
recent studies revived the controversy of whether unsaturated fatty acids are beneficial in the management of sepsis .
the fact that a - fabp is increased in sepsis , induced by oxidized ldl and tlr agonists , and suppressed by statins and enhances the production of il-6 and tnf- and cox-2 expression whereas unsaturated fatty acids suppress a - fabp expression and il-6 and tnf- production indicates the complexity of the involvement of tlrs , a - fabp , cytokines , unsaturated fatty acids , and their products in sepsis .
the unsaturated fatty acid arachidonic acid ( aa ) is the precursor of two series of prostaglandins ( pgs ) , two series of thromboxanes ( txs ) , and four series of leukotrienes ( lts ) ; eicosapentaenoic acid ( epa ) is the precursor of three series of pgs , three series of txs , and five series of lts .
pgs , txs , and lts formed from epa are less pro - inflammatory in nature compared with pgs , txs , and lts formed from aa but still are pro - inflammatory in nature .
interestingly , aa , epa , and docosahexaenoic acid ( dha ) suppress the production of pro - inflammatory cytokines il-6 and tnf- both in vitro and in vivo . in addition , free radicals act on unsaturated fatty acids to give rise to f2-isoprostanes , a group of pro - inflammatory substances , whereas nitric oxide and unsaturated fatty acids interact to form nitrolipids that have anti - inflammatory action .
furthermore , aa is the precursor of lipoxin a4 ( lxa4 ) , and epa and dha give rise to resolvins and dha gives rise to protectins ; resolvins and protectins have potent anti - inflammatory actions , resolve inflammation , and enhance wound healing by suppressing the production of free radicals , myeloperoxidase , il-6 , tnf- , and hmgb1 ( high - mobility box 1 ) and antagonize the pro - inflammatory actions of leukotrienes .
resolvins and protectins block tlr - mediated activation of macrophages and enhance the anti - bacterial action of antibiotics and augment the clearance of bacteria .
this implies that the optimal production of lipoxins , resolvins , and protectins from unsaturated fatty acids is essential for clearing the invading pathogens , resolving inflammation , and preventing tissue damage .
under normal physiological conditions , a balance between pro- and anti - inflammatory molecules is maintained .
a tilting of this balance in favor of the former would lead to initiation and progression of inflammation , insulin resistance , and consequent tissue damage .
such an inflammatory process could be due not only to increased expression of a - fabp and augmented production of pro - inflammatory molecules but also to deficiency of anti - inflammatory molecules such as il-4 , il-10 , lipoxins , resolvins , and protectins ( figure 1 ) . in this context , it is noteworthy that a - fabp suppresses cardiomyocyte contraction whereas unsaturated fatty acids seem to prevent cardiac failure , reinforcing close interaction(s ) among various pro- and anti - inflammatory molecules and their role in sepsis .
hence , a better understanding of the interaction(s ) among these molecules in inflammatory conditions is essential in order to develop meaningful and novel therapeutic strategies especially for sepsis .
interaction(s ) among adipose - fatty acid - binding protein ( a - fabp ) , toll - like receptor ( tlr ) , cytokines , free radicals , unsaturated fatty acids , and their products and inflammation and resolution of inflammation . infections , injuries ( including surgery ) , and high - fat diet activate macrophages and tlrs , leading to secretion of increased amounts of pro - inflammatory cytokines that , in turn , produce an excess of free radicals .
pro - inflammatory cytokines , tlrs , and free radicals activate a - fabp and cyclooxygenase 2 ( cox-2 ) , leading to increased production of pro - inflammatory prostaglandins ( pgs ) , leukotrienes ( lts ) , and thromboxanes ( txs ) from unsaturated fatty acids and decreases in the synthesis and release of anti - inflammatory lipoxins ( lxs ) , resolvins ( rsvs ) , and protectins ( prts ) .
unsaturated fatty acids and lxs , rsvs , and prts are expected to suppress macrophage activation and expression of a - fabp and tlrs and inhibit inflammation .
increased expression of a - fabp also occurs in obesity , type 2 diabetes mellitus ( dm ) , and coronary heart disease ( chd ) .
interleukin-6 ( il-6 ) , tumor necrosis factor - alpha ( tnf- ) , macrophage activation , increased expression of a - fabp , and increased production of pgs , lts , txs , and free radicals enhance insulin resistance in infections and sepsis .
aa , arachidonic acid ; dha , docosahexaenoic acid ; epa , eicosapentaenoic acid ; hmgb1 , high - mobility group box 1 ; lps , lipopolysaccharide ; nl , nitrolipid ; no , nitric oxide ; ros , reactive oxygen species .
aa : arachidonic acid ; a - fabp : adipose - fatty acid - binding protein ; cox-2 : cyclooxygenase 2 ; dha : docosahexaenoic acid ; epa : eicosapentaenoic acid ; il : interleukin ; ldl : low - density lipoprotein ; lt : leukotriene ; pg : prostaglandin ; tlr : toll - like receptor ; tnf- : tumor necrosis factor - alpha ; tx : thromboxane .
und is the recipient of a ramalingaswami fellowship from the department of biotechnology , new delhi , india .
this work was supported by grants from the department of biotechnology ( bt / pr11627/med/30/157/2010 ) , the department of science and technology ( ir / so / lu/03/2008/1 ) under intensification of research in high priority areas ( irpha ) , and the defence research and development organisation , new delhi ( tc/2519/inm-03/2011/cars ) under r&d project inm-311 .
Output:
| sepsis due to unabated inflammation is common .
increased production of pro - inflammatory cytokines , free radicals , and eicosanoids has been detected in sepsis and other critical illnesses but could also be due to decreased synthesis and release of anti - inflammatory molecules .
increased serum adipose - fatty acid - binding protein ( a - fabp ) levels can cause insulin resistance and have been reported in the critically ill , serve as a marker of prognosis , and thus link metabolic homeostasis and inflammation .
a - fabp can be linked to the expression of toll - like receptors , macrophage activation , synthesis and release of pro - inflammatory cytokines interleukin-6 and tumor necrosis factor - alpha , activation of cyclooxygenase 2 ( cox-2 ) expression , and eicosanoid synthesis , events that can cause insulin resistance and initiation and progression of inflammation and sepsis .
unsaturated fatty acids and their anti - inflammatory products , such as lipoxins , resolvins , and protectins , may suppress a - fabp expression , inhibit macrophage and cox-2 activation , and decrease production of pro - inflammatory cytokines and ultimately could lead to a decrease in insulin resistance and resolution of inflammation and recovery from sepsis .
serial measurement of these pro- and anti - inflammatory molecules and correlation of their levels to the progression to or recovery from ( or both ) sepsis and other inflammatory processes may form a new approach to predict prognosis in inflammatory conditions and eventually could lead to the development of new therapeutic strategies . |
PubmedSumm7866 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: diabetes mellitus is a chronic disease that has become a major health and economic problem nowadays .
387 million people in the world suffer from diabetes and it is forecast that the number will be 205 million more in 2035 .
the state expenses incurred on the disease include not only medications , hospital inpatient care , and medical visits but also indirect costs like absenteeism , reduced productivity , and inability to work . because of that
, more attention is paid to prophylaxis of obesity as well as to optimization and individualization of diabetes treatment .
type 2 diabetes mellitus ( t2 dm ) is determined by genetic and environmental causes . the risk factors contributing to the disease are , inter alia , age , body mass index , physical inactivity , and sedentary lifestyle [ 4 , 5 ] . as far as genetic factors predisposing to t2 dm
are concerned , genetic variants modifying the risk of development of the disease have been identified ; however , altogether , they explain only a small proportion of the genetic background of t2 dm [ 6 , 7 ] .
among possible causes of missing heritability gene , environment interactions are mentioned . in recent years
, there have been many studies on the relationship between the composition of the gastrointestinal bacterial flora , t2 dm , and obesity [ 911 ] .
these analyses indicate that the etiology of the various forms of diabetes , especially those associated with obesity and insulin resistance , such as t2 dm , may be related to intestinal microflora [ 9 , 10 ] . on the other hand , monogenic forms of the disease , like maturity onset diabetes of the young ( mody ) , are determined mostly by genetic factors , with minor effect of the environment .
hnf1a - mody is one of the most common forms of subtypes of mody [ 12 , 13 ] .
it is caused by mutation in hnf1a ( hepatic nuclear factor 1 alpha ) gene .
hnf1a - mody is characterized by progressive hyperglycemia , with the onset of diabetes in youth .
the differences in the gut microbiota between patients with t2 dm and hnf1a - mody in relation to healthy individuals could be a new argument for an influence of microbiota as an environmental risk factor for some forms of diabetes .
the gut microbiota perform multiple functions , produce vitamins , inhibit the growth of potential pathogenic bacteria , and lower the cholesterol level in blood .
the bacterial metabolite indole can modulate the secretion of glucagon - like peptide-1 ( glp-1 ) by l - cells .
it is hypothesized that remission of diabetes after bariatric surgery is connected with neurohormonal signaling or changes in the ecosystem of microbiota of the gastrointestinal tract [ 18 , 19 ] . the intestinal microbiota play a role in the circulation of bile acids .
it is suggested that the increased levels of bile acids after bariatric operation stimulate glp-1 secretion and lead to improvement in glucose metabolism .
the nuclear farnesoid x receptor ( fxr ) is also the molecular target for metabolic condition after bariatric surgery .
the new approach is to assess the bacterial flora through the use of the noncultivated methods allowed for identifying bacteria that are difficult to culture .
these include targeted gene sequencing , genome sequencing , and shotgun metagenomic sequencing .
the aim .
the aim of the investigation was to compare the qualitative parameters of the colonic flora in patients with hnf1a - mody diabetes , matched controls , and patients with t2 dm in a single stool sample .
the study was designed in collaboration with the department of metabolic diseases , jagiellonian university medical college , krakw , poland ; university hospital , krakw , poland ; and center for medical genomics omicron and department of microbiology , jagiellonian university medical college , krakw , poland .
the project has obtained the consent of the ethics committee of the jagiellonian university number kbet/272/b/2013 .
participants were the patients of the department of metabolic diseases and volunteers , all of whom consented to participate in the research .
we collected stool samples from ten patients with hnf1a - mody and twenty - three patients with t2 dm .
all participants declared not using antibiotics 4 weeks prior to stool sample delivery and they denied having met the exclusion criteria ( see the following list ) .
exclusion criteria
patients who did not agree to participate in the study and who withdrew during the investigation patients below 18 years of age and over 65 years of age patients taking antibiotics for up to 30 days before giving the sample of stool patients using probiotics patients with confirmed infection of the gastrointestinal tract patients with chronic inflammatory bowel disease of unknown etiology patients with active cancer ( especially of the gastrointestinal tract ) patients with immunodeficiency patients with features of liver damage ( with the exception of nonalcoholic fatty liver transaminase levels less than three times the upper limit of the normal level )
patients who did not agree to participate in the study and who withdrew during the investigation patients below 18 years of age and over 65 years of age patients taking antibiotics for up to 30 days before giving the sample of stool patients using probiotics patients with confirmed infection of the gastrointestinal tract patients with chronic inflammatory bowel disease of unknown etiology patients with active cancer ( especially of the gastrointestinal tract ) patients with immunodeficiency patients with features of liver damage ( with the exception of nonalcoholic fatty liver transaminase levels less than three times the upper limit of the normal level ) in most patients , blinded continuous glucose monitoring ( cgm , ipro2 , medtronic ) was implemented .
in addition , we utilized results of stool sample analysis of healthy individuals done previously ( project supported by the national science centre in poland , number dec-2011/03/d / nz5/00551 ) .
one control group of healthy individuals was matched with mody patients with respect to age and bmi ( body mass index ) , and the second one was matched to t2 dm patients with respect to age .
the bacterial dna was isolated using genomic mini ax stool spin ( a&a biotechnology ) modified to include enzymatic treatment ( lysozyme , lysostaphin , and lyticase ) and bead - beating step .
libraries were prepared according to illumina 16s metagenomic sequencing library preparation protocol ( https://support.illumina.com/downloads/16s_metagenomic_sequencing_library_preparation.html ) . in short ,
after the polymerase chain reaction ( pcr ) clean - up , samples were indexed , cleaned , and pooled .
10 pm libraries with 10% phix spike - in were sequenced on illumina miseq using v3 sequencing kit ( 300
resulting short reads were joined on overlapping regions using fastq - join tool from ea - utils package .
otus ( operational taxonomic units ) were picked using open - reference protocol . in the first step , closed reference otu
subsequent reads that failed to hit the reference database were filtered out and used to perform de novo otu picking .
relative otu abundance was calculated using qiime ( http://qiime.org/ ) . to estimate alpha diversity chao 1 , the observed otus and phylogenetic
distance metrics were calculated . both weighted and unweighted unifrac distances were calculated to analyze beta diversity .
frequency of otu across sample groups was compared using nonparametric anova ( kruskal - wallis test ) and mann - whitney u test .
post hoc tests using statistica were performed if there were significant differences between groups . to correlate clinical parameters with relative otu abundance , spearman 's rho test was applied .
to compare the clinical parameters , the adequate parametric ( t - test ) and nonparametric ( mann - whitney u test , kruskal - wallis test ) tests were used . as diet
is concerned at disease diagnosis , all mody and t2 dm patients were educated to follow the diet recommended in diabetes with 4050% of calories coming from carbohydrates , 2030% from fat , and 20% from protein .
there were 23 t2 dm patients ( 13 women and 10 men ) and 10 hnf1a - mody individuals ( 5 women and 5 men ) included in the study .
the median age in the t2 dm group was 60 ( 5662 ) years and in the hnf1a - mody group was 36.5 ( 3056 ) , p = 0.0133 .
the mean duration of diabetes in t2 dm group was 4.46 2.95 years versus 19.1 13.37 years , p < 0.0001 .
the median hba1c ( glycosylated haemoglobin ) level in t2 dm group was 8.12% ( 7.11%8.78% ) versus 7.205% ( 5.4%7.86% ) , p = 0.0479 , respectively .
the first control group , matched for age ( p = 1.0 ) and bmi ( p = 0.26 ) with hnf1a - mody group , consisted of 16 healthy individuals ( 11 women and 5 men ) with median age of 39.5 ( 31.549.5 ) years and median bmi of 23.77 ( 22.8524.95 ) kg / m .
the median bmi in hnf1a - mody group was 25.74 ( 24.2229 ) kg / m and in t2 dm group was 30.25 ( 27.6833.25 ) kg / m , p = 0.0290 .
the t2 dm group differed in age ( p = 0.0006 ) and bmi ( p < 0.0001 ) in comparison to the first control group ( figure 1 ) .
the second control group consisted of 10 people ( 7 women and 3 men ) .
the median bmi in the second control group was 25.57 ( 24.3227.38 ) kg / m , and the median age was 56 ( 53.558 ) years .
there was no difference in age between this control group and t2 dm group ( p = 0.3059 ) , but the groups differ in bmi ( p = 0.0012 ) .
based on the questionnaire data , we found no major differences in the dietary profile between t2 dm and mody patients .
the questionnaire included four possible answers regarding following the prescribed diet : always , most of the time , rarely , or never .
the majority ( 16 out of 23 patients with t2 dm and 8 out of 10 individuals with mody ) declared following always or most of the time the diet recommended in diabetes with respect to the proportion of calories coming from carbohydrates , fat , and protein and with respect to food quality . unfortunately , we had no reliable data concerning diet in control group .
the patients ' treatment included metformin , sulfonylurea , acarbose , and insulin ( supplementary material available online at http://dx.doi.org/10.1155/2016/3876764 ) .
the analysis of the samples by sequencing obtained an average of 180353.52 paired reads per sample , with median 140780 and standard deviation 152430.2 .
after preprocessing ( removing adapters , pcr primers , filtration of low quality bases , pair joining , and removal of chimeric reads ) , we received an average of 115782.34 readings per sample , with median 87994 and standard deviation 104992.4 .
the bacterial composition was analyzed at the phylum , class , order , family , and genus level .
the bacteria and archaea profiles for the first control , hnf1a - mody , and t2 dm at the phylum level were as follows : euryarchaeota 0.12% versus 0.11% versus 0.13% ; actinobacteria 9.53% versus 9.31% versus 11.70 ; bacteroidetes 6.39% versus 1.09% versus 1.30% ; firmicutes 77.02% versus 87.36% versus 80.09% ; proteobacteria 0.36% versus 0.35% versus 2.82% ; synergistetes 0.00% versus 0.00% versus 0.10% ; tenericutes 0.05% versus 0.005% versus 0.001% ; verrucomicrobia 6.52% versus 1.78% versus 3.85% ( figure 2 ) .
there were significant differences between t2 dm and the first control groups at the phylum level ( kruskal - wallis test with a false discovery rate ( fdr ) correction ) . in t2
dm group , in comparison to the first control group , the amount of proteobacteria was higher ( p = 0.0006 ) and the amount of bacteroidetes was lower ( p = 0.0005 )
. in hnf1a - mody group , the frequency of bacteroidetes was lower than in the control group ( p = 0.0143 ) .
there were no significant differences between t2 dm and hnf1a - mody groups at the phylum level .
the firmicutes / bacteroidetes ( f / b ) ratio was significantly higher in both t2 dm and hnf1a - mody groups than in the first control group ( figure 3 ) .
the firmicutes / bacteroidetes ratio was correlated positively with the hba1c level in hnf1a - mody group ; we did not observe such phenomenon in t2 dm .
there were significant differences at the class level : the proportion of flavobacteria and bacteroidia was higher in the first control group than in t2 dm and hnf1a - mody groups .
the amount of gammaproteobacteria was higher in t2 dm group than in the first control group ( p = 0.0002 ) .
the amount of erysipelotrichi was higher in hnf1a - mody group than in the first control group and t2 dm group ( supplementary data ) .
there were significant differences at the order level : flavobacteriales and bacteroidales were higher in the first control group than in hnf1a - mody and t2 dm groups .
actinomycetales was lower in the first control group than in hnf1a - mody and t2 dm groups .
turicibacterales was higher in the first control group than in t2 dm group ( p = 0.0073 ) , and also turicibacterales was higher in hnf1a - mody group than in t2 dm group .
erysipelotrichales was higher in hnf1a - mody group than in the first control group and in t2 dm group ( supplementary data ) .
there were significant differences at the family level : flavobacteriaceae and bacteroidaceae were higher and promicromonosporaceae and the other family of actinomycetales were lower in the first control group than in both t2 dm and hnf1a - mody groups .
enterobacteriaceae was higher and porphyromonadaceae was lower in t2 dm group than in the first control group ( p = 0.004 ) .
the frequency of clostridiaceae and turicibacteraceae was lower in t2 dm group than in the first control group and hnf1a - mody group .
the amount of erysipelotrichaceae was higher in hnf1a - mody group than in the first control group and t2 dm group ( supplementary data ) .
there were significant differences at the genus level : bacteroides and the unnamed genus of flavobacteriaceae were higher and cellulosimicrobium and the other genus of the other family of actinomycetales were lower in the first control group than in t2 dm and hnf1a - mody groups .
the amount of parabacteroides , unnamed genus of clostridiaceae , turicibacter , lachnospira , and anaerostipes was higher , and the unnamed genus of enterobacteriaceae was lower in the first control group than in t2 dm group .
the frequency of the other genus of clostridiaceae and smb53 was lower in t2 dm group than in the first control group and hnf1a - mody group ( supplementary data ) .
comparing the microbiome between t2 dm group and the second control group ( matched with respect to age ) revealed the differences in the following otus : the frequency of proteobacteria ( phyla level ) , actinomycetales ( order level ) , the other family of actinomycetales , promicromonosporaceae ( family level ) , the other genus of the other family of actinomycetales , cellulosimicrobium , bulleidia , and eubacterium ( genus level ) was higher and the frequency of clostridiaceae , ruminococcaceae ( family level ) , and the unnamed and the other genus of clostridiaceae and smb53 ( genus level ) was lower in t2 dm group than in the second control group ( supplementary data ) .
the observed otus alpha diversity ( p = 0.027 ) but not chao 1 ( p = 0.063 ) was significantly lower in t2 dm than in the control group ; there was no difference in alpha diversity between control and hnf1a - mody , hnf1a , and t2 dm groups ( figure 4 ) .
the beta diversity analysis revealed the differences in communities structure between t2 dm and the second control group .
we obtained data of continuous glucose monitoring from 21 patients with t2 dm and 9 patients with hnf1a - mody .
the mean glucose level in t2 dm group was 167.33 35.34 mg / dl , and the mean glucose level in hnf1a - mody group was 143.11 38.07
mg / dl ; the groups did not differ in mean glucose level ( t - test , p = 0.1037 ) .
the percentage of time with glucose level above 140 mg / dl was higher in t2 dm group ( mann - whitney u test , p = 0.0235 ) ; the percentage of time with glucose level within 70140 mg / dl was higher in hnf1a - mody group ( mann - whitney u test ; 29% ( 14%54% ) versus 49% ( 32%81% ) , p = 0.0352 ) ; the percentage of time with glucose level below 70 mg / dl was higher in hnf1a - mody group ( mann - whitney u test ; 2% ( 0%6% ) versus 0% ( 0%-0% ) , p = 0.0127 ) .
this study for the first time compares the bacterial flora of patients with hnf1a - mody with the bacterial flora of individuals with t2 dm and control group .
herein , we have shown for the first time significant differences in the bacteria profile of stool samples between hnf1a - mody and both control and t2 dm groups .
it is true that the diabetes subpopulations differed at the baseline in age , duration of diabetes in years , bmi , and hba1c .
it is also possible that other confounders like diet or medications [ 2527 ] could influence the results .
some differences between the control group and diabetes cohorts can result from medications including antidiabetic drugs [ 26 , 27 ] .
it was demonstrated that the f / b ratio depends on age . in infants and elders , it is significantly lower than in adults .
it has also been presented that the obese people have increased f / b ratio .
t2 dm and hnf1a - mody groups in comparison with control group share some between - group differences but the study also revealed some type of diabetes - related differences . between diabetes groups in otu taxa
, we observed that the frequency of turicibacterales was significantly higher in hnf1a - mody group than in t2 dm group and in the first control group than in t2 dm group .
in the study results , the amount of enterobacteriales was statistically higher in t2 dm group than in the first control group .
we can not forget that only hnf1a - mody group was matched with respect to age and bmi with the first control group .
the baseline differences between t2 dm and hnf1a - mody group could be prone to and mask some differences in the microbiome profile between diabetes groups . nevertheless , the study showed differences in the bacterial profile between hnf1a - mody and control groups
. this can be an argument for the thesis that also hnf1a - mody is associated with changes in colonic bacterial flora .
the differences in microbiome profiles between the first control group and t2 dm group were not the same as between the second control group and t2 dm group .
this could result from the differences in age ; only the second control group was matched with respect to age with the t2 dm group .
still , the second control group was not matched with respect to bmi with the t2 dm group . in recent studies
, it has been revealed that the alpha diversity ( within samples diversity ) is decreased in obese individuals , but no significant differences were found in alpha diversity between healthy people and diabetes patients [ 30 , 31 ] . in our study , we observed lower otus alpha diversity in t2 dm group than in the control group , but the groups differ in bmi .
we did not observe differences in alpha diversity between hnf1a - mody and both control and t2 dm groups .
nevertheless , the alpha diversity in hnf1a - mody group was lower than in the control group and higher than in the t2 dm group , but the differences were not significant .
one could suggest that the colonic microbiome plays a different role in the metabolic control in t2 dm in comparison to hnf1a - mody .
one could speculate that manipulation in the structure of gut microbiota , in order to improve glucose metabolism in patients with diabetes , could be more effective in some types of diabetes ( like t2 dm ) than in others and should be individualized to the type or subtype of diabetes . some bacteria that belong to the firmicutes phylum are butyrate producers .
they play a key role in human gut energy supply by producing butyrate , the main source of energy for the colonic epithelium .
furthermore , butyrate improves insulin sensitivity and is able to trigger the secretion of glp-1 from l - cells .
demonstrated that short fatty acids stimulate the secretion of glp-1 in vitro . also , some suggest that there is a relationship between the short fatty acid as histone deacetylases inhibitors and the role of epigenetics in the development of diabetes .
it has to be emphasized that , in recent studies , it is reported that the amount of butyrate producers such as roseburia species and faecalibacterium prausnitzii is lower in patients affected with t2 dm [ 11 , 36 ] . in our data ,
the frequency of the genus faecalibacterium was 0.5% in control , 0.2% in hnf1a - mody , and 0.5% in t2 dm group but the differences did not approach a level of significance ( p > 0.05 ) .
the genus roseburia was abundant in 0.5% in control , in 1.1% in hnf1a - mody , and in 0.3% in t2 dm ( p > 0.05 for each comparison ) . in our study , the relative abundance of akkermansia tended to be higher in the first control group ( 6.5% ) than in hnf1a - mody ( 1.8% ) and t2 dm ( 3.9% ) groups .
it has been shown that in humans the percentage of akkermansia muciniphila in the healthy population is 14% [ 37 , 38 ] .
the abundance of the bacteria was reported to be decreased in genetically ( t2 dm ) and diet - induced obesity mice model . on the other hand
, it has been shown that in t2 dm microbiota genes belonging to akkermansia are increased . of note ,
four individuals in the t2 dm group had very high relative abundance of akkermansia : 31.4% , 32.1% , 21.1% , and 20.6% .
three controls from the first control group ( 29.2% , 17.8% , and 14.3% ) and two hnf1a - mody patients ( 9.5% and 13.7% ) were also characterized by high frequency of akkermansia .
it was demonstrated that higher amount of akkermansia muciniphila in overweight and obese people resulted in healthier metabolic status and better glucose homeostasis after introducing calorie restriction diet .
definitely , one of the limitations of our study is due to the age differences between the t2 dm and mody individuals .
the difference is due to the fact that mody individuals are usually diagnosed at much younger age in comparison to patients with type 2 diabetes .
the individuals from older generations representing mody families were usually not available for genetic testing ( either death or no willingness for testing ) . on the other hand , hardly ever do we diagnose type 2 diabetes in patients below 50 years of age .
this is why matching t2 dm and mody patients for the age was not possible . to address these differences
we failed , however , to match controls with t2 dm as far as bmi is concerned ( nondiabetic obese individuals were not willing to follow the study protocol ) .
the estimation was based on a self - reported questionnaire and was not verified ; thus , we can not fully exclude the notion that the results of our study to some degree were affected by differences in dietary patterns . however , the major limitation of our study was the relatively small sample size , which was partially due to protocol requirements .
comparison of bacterial profiles between patients with hnf1a - mody and individuals with mutation in hnf1a gene without clinical diabetes could be significant .
it could be suggested that all of the particular genus of bacteria , proportion of bacteria ( including shifts and the proportion within the same phyla , class , order , or family ) , and percentage of bacteria with the same function should be taken into account in consideration of the influence of microbiota on the development of different types of diabetes .
the differences in microbiota between patients with different types of diabetes could be also a novel strategy in distinguishing subtypes of diabetes . in conclusion
, it appears that there are differences in gut microbiome composition between patients with hnf1a - mody , control individuals , and patients with type 2 diabetes .
Output:
| background .
type 2 diabetes mellitus ( t2 dm ) is determined by genetic and environmental factors . there have been many studies on the relationship between the composition of the gastrointestinal bacterial flora , t2 dm , and obesity .
there are no data , however , on the gut microbiome structure in monogenic forms of the disease including maturity onset diabetes of the young ( mody )
. methods .
the aim of the investigation was to compare the qualitative parameters of the colonic flora in patients with hnf1a - mody and t2 dm and healthy individuals .
16s sequencing of bacterial dna isolated from the collected fecal samples using the miseq platform was performed .
results .
there were significant between - group differences in the bacterial profile . at the phylum level , the amount of proteobacteria was higher ( p = 0.0006 ) and the amount of bacteroidetes was lower ( p = 0.0005 ) in t2 dm group in comparison to the control group . in hnf1a - mody group ,
the frequency of bacteroidetes was lower than in the control group ( p = 0.0143 ) . at the order level , turicibacterales was more abundant in hnf1a - mody group than in t2 dm group .
conclusions .
it appears that there are differences in the gut microbiome composition between patients with hnf1a - mody and type 2 diabetes
. further investigation on this matter should be conducted . |
PubmedSumm7867 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: multiple sclerosis ( ms ) is an immune - mediated disease affecting central nervous system ( cns ) , characterized by demyelination and axonal degeneration .
the etiology of ms is still unknown , although it is believed a complex interplay between genetic and environmental factors may have a role .
although ms is classically considered a white matter ( wm ) disease , the involvement of gray matter ( gm ) in the pathogenic process has been confirmed by pathology studies [ 3 , 4 ] . in the last years cognitive impairment ( ci ) has been recognized as an important feature of ms , affecting up to 65% of patients .
impairment of cognitive domains such as memory , mental processing speed , attention , and executive function can occur from the early stage of the disease and tends to worsen over time , resulting in significant functional impairment at work and at home , despite minimal physical disability [ 6 , 7 ] .
it has been shown that wm demyelination is moderately correlated with ci , suggesting that probably wm abnormalities alone can not fully explain the extent of clinical symptoms in ms , including ci [ 8 , 9 ] .
the definition of the pathogenic mechanism underlying the development of ci is crucial in order to identify novel biomarkers to monitor disease progression and therapy neuroprotective effect .
several mri techniques have shown the involvement of gm in ms and the association between gm damage , physical disability , and ci [ 1012 ] .
the aim of this review is to provide an overview of ci and gm damage assessed by structural mri .
a review of functional imaging and its correlation with cognitive performance has not been included in the present paper .
ci may affect patients at any stage of the disease , including patients with clinically isolated syndrome ( cis ) .
a rarely occurring variant of ms , with an exclusive impairment of cognitive function , has also been described .
cognitive deficit can be detected in benign ms patients ( bms ) ; however it has been shown that ci tends to increase with worsening disability and disease duration [ 16 , 17 ] and could be associated with the onset of a progressive disease course [ 5 , 17 , 18 ] .
learning , memory , attention , processing speed , visuospatial abilities , and executive functions are affected most frequently in ms , whereas dementia and language deficits are less common [ 18 , 19 ] .
large studies have shown that information processing speed and episodic memory are the more often impaired domains in ms patients .
large longitudinal studies on cognition in ms often failed to show a significant cognitive decline , because of heterogeneity in the disease course and the potential influence of disease subtype and duration on ci . according to these assumptions
, it has been shown that only during the course of a sufficiently long follow - up period , cognitive dysfunction can emerge and progress with different degrees of severity . the most sensitive tool to detect ci is neuropsychological testing ( nps ) .
nps testing , often perceived as time - consuming and expensive , should be administered by trained specialists and requires expertise , because physical disability ( such as visual and other sensory deficits ) can influence performance on cognitive test .
nps testing , widely used in other diseases , such as mini mental state examination ( mmse ) , is not sensitive to detect ci in ms patients and was not adequately validated in ms population .
two batteries of cognitive testing have been developed in the last years and have been widely used in clinical and research settings , the rao 's brief repeatable battery of neuropsychological test ( brb - n ) and the minimal assessment of cognitive function in ms ( macfims ) .
both batteries assess cognitive impairment covering the domain most commonly affected in ms , such as processing speed and working memory , new learning and episodic memory , and language .
macfims has the advantage to include the assessment of spatial processing speed and higher executive functions and to have stronger psychometric properties .
brb - n is less time - consuming and has been translated in several european languages [ 23 , 24 ] .
it has been demonstrated that ms patients tend to fail more often tests of information processing speed .
there are two tests investigating processing speed in ms : symbol digit modality test ( sdmt ) and paced auditory serial addition task ( pasat ) .
sdmt has been proposed as an alternative to pasat in ms functional composite ( msfc ) , showing a slightly better ability to predict disease course , diagnosis , and disability and a good correlation with mri findings [ 25 , 26 ] .
mri is considered a valuable tool to evaluate the extent of brain damage in ms patients .
many efforts have been made to develop new mri techniques able to detect not only wm matter lesions but also the extent of normal appearing white matter ( nawm ) and gray matter ( gm ) .
the role of mri is crucial in the diagnosis of ms and cis , being mri formally included in the diagnostic criteria .
conventional mri techniques have been extensively used in clinical practice , being fundamental in the assessment of disease activity and in the exclusion of alternative neurological conditions .
t2-weighted and gadolinium - enhanced t1-weighted sequences are highly sensitive in detecting ms lesions , providing a quantitative assessment of inflammatory activity and lesion load .
the t2-hyperintense lesions represent various degrees of inflammation , demyelination , gliosis , edema , and axonal damage .
they affect periventricular wm region , corpus callosum , the juxtacortical region , the infratentorial region , and spinal cord .
the use of intravenous gadolinium agent shows the disruption of the blood brain barrier and acute inflammatory lesions , appearing as bright areas on t1-weighted scans .
fluid - attenuated inversion recovery ( flair ) sequences , suppressing the signal from cerebrospinal fluid ( csf ) , are more sensitive than t2-weighted images in detecting periventricular and juxtacortical lesions , being less accurate in detecting posterior fossa lesions and spinal cord lesions , due to flow related artifacts .
these lesions are commonly called black holes ( bh ) and may range from mild hypointensity to severe hypointensity , similar to csf signal .
based on longitudinal changes , bh originating from gd - enhancing lesions may be classified as acute bh or persistent bh .
the acute bh disappear in 612 months , reflecting edema and demyelination with subsequent recovery .
brain atrophy , reflecting irreversible tissue loss , is another parameter of disease progression , usually quantified on t1-weighted images .
normalized volumes are more adequate for cross - sectional studies , whereas absolute volumes measures are optimal for longitudinal measurement .
volume loss occurs in both wm and gm and tends to correlate better with disability and ci than other mri measures .
in particular gm atrophy seems to be a better marker of disease progression compared to whole brain or wm fraction .
although conventional mri techniques are crucial in the ms diagnostic workup , their accuracy in evaluating and predicting disease progression is less relevant .
the introduction of quantitative mri techniques improved our understanding of the mechanism of tissue damage , shedding light on the pathogenesis of the disease .
standard mri techniques are not able to detect cortical lesions ( cls ) , so more advanced techniques have been developed . a multislab three - dimensional ( 3d ) double inversion recovery ( dir )
was applied to ms population with improvement of the detection of cortical damage . later on a new single slab , isotropic version of 3d - dir
was developed , in order to reduce the acquisition time and flow artifact . in the last years quantitative measures
have been developed in order to better quantify the burden of pathological changes occurring in ms patients .
magnetization transfer ( mt ) , a measure based on the exchange of magnetization between protons bound to the brain tissue matrix and the surrounding free water , provides a quantification of subtle tissue damage , preceding by several months the appearance of lesions .
mt ratio reflects demyelination and axonal loss . decreased mt ratio in lesions and normal appearing ( na ) wm / gm shows a good correlation with clinical disability .
diffuse tensor imaging ( dti ) mri measures the random diffusional motion of water molecules , through the calculation of fractional anisotropy ( fa ) and mean diffusivity ( md ) .
furthermore dti provides the basis for tractography , useful to assess the integrity of corticospinal tract and corpus callosum and the connectivity between regions [ 38 , 39 ] .
proton mr spectroscopy ( h - mr spectroscopy ) is a quantitative mr technique able to provide chemical - pathological characterization of visible lesion and normal appearing brain tissue .
various central nervous system ( cns ) metabolites have been used as marker of pathological process in ms brain . in particular decreased levels of n - acetyl aspartate
are considered a marker of neuroaxonal loss , while increased choline and myoinositol levels are marker of demyelination / inflammation and gliosis , respectively .
other quantitative methods have been developed to better quantify iron deposition such as t2 relaxation time ( rt ) and susceptibility - weighted imaging techniques ( swi ) [ 42 , 43 ] , although their utility in assessing brain damage needs to be fully investigated . in recent years imaging at an ultrahigh field ( > 3.0 t ) provided great advantage in image contrast and resolution .
in particular swi sequences and in vivo mrs may benefit from imaging at an ultrahigh field providing new insights into the understanding of ms pathology [ 44 , 45 ] .
in the last years , the classical view of ms as a wm pathology has been overcome by mri techniques , able to detect the involvement of gm in the development of the disease .
nonconventional mri technique showed that gm involvement can precede wm damage and is associated with physical disability and ci [ 4648 ] .
these findings were also confirmed by postmortem studies , showing that wm changes are accompanied by gm demyelination .
demyelination can be found in other gm areas such as the thalamus , basal ganglia , hypothalamus , hippocampus , cerebellum , and spinal cord [ 50 , 51 ] .
later , in vivo atrophy studies showed that gm changes could be detected in the early stage of the disease .
interestingly , the burden of gm demyelination tends to become more prominent with the accrual of disability in the progressive stage of the disease [ 11 , 52 ] .
mri has been widely used as a surrogate marker to differentiate patients with ci in ms .
several studies have shown a modest correlation between wm lesion load and cognitive performance , suggesting the involvement of other structures .
studies about whole brain atrophy have shown a modest association with ci , whereas regional atrophy studies have demonstrated a better correlation with cognitive performance [ 9 , 53 , 54 ] .
postmortem studies of ms brains have showed that demyelination can occur in every region of the cns , including wm , cerebral cortex , and deep gray matter . in recent years
the use of immunohistochemistry for myelin protein demonstrated the presence of myelin in cortex of normal subjects and the extensive cortical demyelination in ms brains .
cls have been described in pediatric ms patients , in cis patients , in radiological isolated syndrome ( ris ) , and early ms suggesting gm damage can be detected in the very early stage of the disease .
based on these findings the detection of cls in the mri diagnostic criteria has been proposed .
type i lesions are close to subcortical wm lesions ( juxtacortical lesions ) ; type ii are confined to the cortex , often perivascular ( intracortical lesion ) ; type iii lesions extend from the pial surface to the cortical layers ( subpial lesions ) .
a combined histopathologic mri study confirmed that not all cls can be detected with dir , in particular the type iii subpial lesions .
a study combining two different mri techniques , such as dir and t1-weighted phase - sensitive inversion recovery ( psir ) , showed that both intracortical lesion and mixed lesions play a more significant role than juxtacortical lesions and measures of atrophy in ci .
a longitudinal study showed in a small group of ms patients ( 13 subjects ) that cls tend to increase over time and were associated with a cognitive decline .
in particular the authors observed a significant correlation between hippocampal lesion load and the location learning test score ( llt ) , investigating visuospatial memory .
mike et al . found a similar correlation between cls load , wm volume damage , and sdmt .
they also found cls were a good predictor of verbal learning and memory assessed by california verbal learning test ( cvlt - ii ) .
calabrese et al . demonstrated that cl , gm damage volume , and age are good predictors of ci , showing also a better correlation of ci with cl than wm damage in a group of ms patients .
did not confirm these findings , demonstrating that wm lesion volume plays a major role in the development of ci compared to cls .
it occurs early in the disease course and tends to progress over time to a greater degree than whole brain and wm atrophy .
high - resolution mri and automated segmentation techniques have been used to quantify gm tissue volume and to improve our understanding of the pathogenic mechanism responsible for gm damage .
the assessment of gm atrophy and its topographic distribution may help to correlate cognitive domain to a specific brain region .
nevertheless , it is believed that not only demyelination is responsible for gm atrophy , but also axonal transection , neuronal , glial , and synaptic loss can be found in cortical gm lesions and could be responsible for atrophy and cortical thinning in ms .
several authors investigated the role of gm and its association with ci . in a group of rrms patients , amato et al .
in particular neocortical atrophy was associated with impairment in verbal memory , verbal fluency , and attention . after a followup of 2.5 years the authors found higher changes in cortical volume in cognitively
benedict et al . have shown the correlation between neocortical volume and many neuropsychological measures ( verbal and visuospatial , memory , processing speed , and working memory ) .
also they demonstrated the third ventricle width , reflecting thalamic atrophy , could be considered a good predictor of ci .
the association of cortical atrophy with slower speed and memory impairment , controlling for iii ventricle width , demonstrated that both central and cortical atrophy were predictor of ci in ms .
. showed in a group of rrms patients a significant difference in gm volume between cognitively impaired patients and cognitively preserved while no differences were found in wm volume .
they suggested that wm loss is associated with impaired processing speed and working memory , while gm is more closely involved in impaired verbal memory . a study by calabrese et al .
they found a widespread atrophy in cognitively impaired patients while a frontotemporal thinning in cognitively preserved patients , suggesting that probably the involvement of gm in the pathology of ci starts in these regions .
the involvement of certain area of gray matter and the association with specific domain have been investigated .
in a group of rrms and spms patients it has been shown that temporal lobe atrophy is associated with a poor outcome in memory performance while whole brain or central atrophy is more related to processing speed performance .
another study about regional atrophy showed a correlation between hippocampal atrophy and a poor performance in memory - coding test .
regional volumetric analysis has been used to better characterize the topographical distribution of gm atrophy .
voxel - based morphometry ( vbm ) is a technique able to identify difference in the local composition of brain tissue , comparing voxel by voxel features between subjects group and correlating voxel features with relevant subject variables .
the use of this technique has allowed investigating the relationship between ci and gm regional atrophy .
in particular they found a correlation with regional atrophy in a number of cortical areas , such as prefrontal cortex , precentral gyrus , superior parietal cortex , and right cerebellum .
these findings were confirmed by a recent study investigating cognition in ms patients , using vbm and tract - based spatial statistics ( tbss ) to assess regional gm and wm damage , respectively .
they found a correlation between gm volume and pasat in orbito - frontal cortex , while tbss showed significant correlations between dti metrics and pasat scores in many wm tracts including corpus callosum , internal capsule , posterior thalamic radiations , and cerebral peduncles . in another study mesaros et al .
did not find any difference in regional gray matter atrophy between cognitively impaired benign ms patients and spms patients .
. showed a different pattern of gm atrophy between cognitively impaired rrms and spms patients .
they found a prominent involvement of deep gm region in rrms whereas a major involvement of cortical area in spms patients . during the course of the disease , cortical and subcortical
demyelination has been observed in gm structures , including thalamus , caudate , putamen , globus pallidus , and other structures of the basal ganglia .
it has been postulated that deep gray matter atrophy is not the result of a direct damage from ms pathology , but it is the consequence of the disconnection via axonal transection within wm damage [ 83 , 84 ] . between the structures of the deep gm , the thalamus has shown the strongest correlation with ci .
the loss of volume in the thalamus has been demonstrated in cis patients and pediatric ms patients , representing one of the earlier markers of subcortical gm pathology .
another study of an independent group confirmed these data and found that putamen atrophy may also play a role in the development of ci . using a high field strength 3 t mri , a significant association between memory , deep gray matter structures , and cortical thinning of
a recent study investigated the role of sex in cognition and subcortical gray matter in a group of early relapsing ms patients .
they found all cognitive domains except visuospatial memory were affected in men ; none were significantly affected in women .
deep gm volume was more affected in men compared to women with bilateral hippocampus , amygdala , and right nucleus accumbens in men and right hippocampus and nucleus accumbens , bilateral amygdala , and putamen in women , showing no atrophy compared to controls .
these findings , again , underline the involvement of deep gm damage in ci and the relevance of a sex specific atrophy mechanism in ms .
over recent years many studies started measuring abnormalities in nagm by using various quantitative mri techniques such as mtr , t1 relaxation time measurements , dti , and mrs .
the recent use of high - field scanners has improved our ability to detect and quantify such abnormalities .
in particular a correlation has been shown between pasat score and left and right brodmann area , right superior longitudinal fasciculus , and splenium in a group of cis patients .
another study investigating the extent of ci in cis patients showed cortical mt ratio was the only mri parameter associated with impaired mental processing speed , suggesting cortical mt - ratio changes may be considered as a biomarker of tissue damage in the very early stage of the disease .
a strong association between gm mtr and a worse overall cognitive performance was demonstrated in progressive patients .
another study using a voxel - based method confirmed these findings in primary progressive ms , showing significant correlations between decrease of mtr value in specific cortical regions and pasat performance .
a recent 13-year follow - up study showed gm mtr was the only mri predictor of global ci , supporting the notion that gm plays a major role in the long - term development of ci .
a dti study in a group of mildly disabling rrms patients has demonstrated a moderate correlation between gm md and the degree of ci , in the absence of correlation with physical disability . using a voxel - based approach ,
ceccarelli et al . found gm dti abnormalities in brain area ( thalami , right insula ) associated with cognition in a group of ppms , explaining in part the discrepancy between the low brain lesion load and the severe clinical status of progressive patients .
a recent study investigated the correlation between fatigue , ci , and damage in the anterior thalamic tract and corpus callosum , measured by dti , in a group of benign ms patients .
the authors showed that fatigue was associated with increased md of the anterior thalamic tracts while impaired executive functions and verbal learning were associated with decreased fa in corpus callosum .
impairment of processing speed and attention was associated with t2 lesion volume in the anterior thalamic tract .
several studies have found metabolite abnormalities in the cortical and subcortical gray matter in ms patients . a significant reduction of n - acetylaspartate ( naa ) ,
a marker of neuronal damage , measured in the frontal cingulate gyrus , has been found to correlate with global memory functions in a group of early ms patients . in another study chard
et al . found significantly reduced naa , choline ( cho ) , and glutamate - glutamine ( glx ) in cortical gm .
they also observed a significant correlation between ms functional composite score and the metabolites concentrations .
t1- and t2-based measures allowed the quantification of gm microscopic damage , usually not detectable with conventional mri technique .
t2 hypointensity in the gm , usually seen in ms patients , has been related to iron deposition .
paramagnetic substance , like iron , reduces t2 relaxation time , resulting in hypointensity in t2 images .
t2 hypointensity has been described in the red nucleus , thalamus , dentate nucleus , lentiform nucleus , caudate , and rolandic cortex .
showed that t2 hypointensity of the globus pallidus was most closely associated with overall cognitive performance ( see table 1 for mri outcomes and cognitive functions investigated ) .
following charcot neuropathological studies , the involvement of gm in the pathogenic mechanism of ms has been described .
conventional mri techniques are not able to detect cortical lesion , cortical and deep gm atrophy . in the last years
the use of new mri techniques has improved our understanding of the mechanism responsible for ci in ms patients .
many studies have shown a correlation between cortical lesions , cortical and deep gm atrophy , and cognition although a clear localization of a cognitive domain on a specific brain region has not been clearly demonstrated .
although in the last years many efforts have been made to better clarify the correlation between gm damage and cognition in ms , many questions are still unanswered .
large mri longitudinal studies are needed to better understand the development of ci and to evaluate the temporal evolution of associated tissue damage and the role and the reciprocal influence of wm and gm structures .
new mri techniques and postprocessing methods are confined in research field and have not yet been fully implemented in clinical routine .
based on this the use of standardized acquisition of mri sequences between scanner manufacturers and different centers is crucial and should be considered in the future .
the understanding of cognitive pathway and the use of mri as a surrogate marker of ci are needed in order to better investigate the evolution of this disabling symptom and preserve cognitive function .
the definition of a valid and sensitive mri biomarker is crucial to clarify the pathogenesis of ci and to monitor the neuroprotective effects of novel drugs .
Output:
| multiple sclerosis ( ms ) is an immune - mediated disease affecting central nervous system ( cns ) .
although ms is classically considered a white matter ( wm ) disease , the involvement of gray matter ( gm ) in the pathogenic process has been confirmed by pathology studies and mri studies .
impairment of cognitive domains such as memory , mental processing speed , attention , and executive function can occur from the early stage of the disease and tends to worsen over time , despite stable physical symptoms .
wm demyelination is moderately correlated with ci , suggesting that probably wm abnormalities alone can not fully explain the extent of clinical symptoms in ms , including ci .
several mri techniques have shown the involvement of gm in ms and the association between gm damage , physical disability , and ci .
the aim of this review is to provide an overview of ci and gm damage assessed by structural brain mri . |
PubmedSumm7868 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the mammalian gastrointestinal ( gi ) tract harbors a dense and diverse microbial community , which is composed primarily of bacteria but also includes fungi , archaea , and viruses ; collectively , these are referred to as the intestinal microbiota .
these microorganisms establish symbiotic relationships with their hosts , playing crucial roles in the digestion of food and exerting a considerable influence on the physiological , metabolic , nutritional , and immunological state of the host [ 24 ] .
recent studies have demonstrated that alterations in the composition of intestinal microbiota are linked to multiple metabolic and inflammatory diseases in humans , including obesity , inflammatory bowel disease ( ibd ) , colorectal cancer , allergy , type 2 diabetes , liver cirrhosis , rheumatoid arthritis , and neurodevelopmental disorders [ 512 ] .
these associations raise fundamental questions regarding the immunomodulatory mechanisms by which components of the intestinal microbiota and their metabolites influence resistance or susceptibility to a broad range of clinically important diseases .
allogeneic hematopoietic stem cell transplantation ( allo - hsct ) is the only curative therapy for hematologic malignant tumors , bone marrow failure , and congenital metabolic disorders .
however , the development of acute graft - versus - host disease ( agvhd ) limits the success of allo - hsct and is fatal to approximately 15% of transplant recipients [ 13 , 14 ] .
agvhd results from an immunological attack on target recipient organs and tissues ( such as the skin , liver , lung , and gi tract ) by donor allogeneic t cells that are transferred along with the allograft .
the development and severity of agvhd in transplant recipients depend on factors such as recipient age , toxicity of the conditioning regimen , hematopoietic graft source , and agvhd prophylaxis approaches .
steroids are the first line of treatment , but patients with steroid - refractory agvhd have a dismal outcome , with long - term mortality rates that can reach 90% .
recent studies have demonstrated a close relationship between intestinal microbiota composition and the severity of agvhd [ 1719 ] .
for many years , our understanding of the composition of mammalian intestinal microbiota depended on culturing and identifying commensal microorganisms .
however , this approach is insufficient to catalog intestinal microbial species because the majority of intestinal bacteria can not be cultured by currently available methods .
the emergence of new molecular profiling techniques , such as 16s rrna sequence - based microbial identification and high - throughput sequencing analysis , has led to a revolution in the understanding of the intestinal microbiota by allowing culture - independent analysis of microbial community composition .
the human gut harbors approximately one hundred trillion microbes , which is ten times the number of human cells in the body .
their combined genomes contain more than five million genes , outnumbering the human genetic potential by two orders of magnitude .
the most abundant phyla in the human intestine are firmicutes and bacteroidetes , which constitute over 90% of the human intestinal microbes .
the firmicutes consist primarily of bacteria belonging to the clostridia class and include a subset of bacilli ( bacillaceae , enterococcaceae , and lactobacillaceae ) , which are capable of oxidizing organic sugars via fermentation to produce large amounts of lactic acid and carbon dioxide [ 24 , 25 ] .
members of the gut bacteria belonging to the bacteroidetes are represented by several bacteroides species , including b. acidifaciens , b. sartorii , and b. uniformis . the remainder of the commensal bacteria , accounting for less than 10% of the total population , belongs to the phyla proteobacteria , fusobacteria , actinobacteria , verrucomicrobia , cyanobacteria , and tm7 .
these bacteria are capable of successfully competing with members of the firmicutes and bacteroidetes in a strict anaerobic environment , such as the colon [ 26 , 27 ] .
the importance of the intestinal microbiota to host health is highlighted by alterations in community composition in metabolic and inflammatory diseases , such as obesity and ibd [ 5 , 6 ] .
the impact of the gut microflora on agvhd has been shown to be highly significant ( table 1 ) .
earlier studies in mice showed that symptoms of agvhd could be reduced with antibiotics and transplantation in germ - free conditions [ 28 , 29 ] .
one recent study showed how intestinal microbiota influences agvhd progression following allogeneic bone marrow transplantation ( allo - bmt ) .
analysis of the microbiota composition indicated that recipient mice that developed agvhd had a dramatic loss of bacterial diversity and a distinct composition compared with recipient mice that did not develop agvhd . in mouse models of agvhd , there is marked expansion of lactobacillus johnsonii and a decrease in both clostridiales and in other members of the phylum firmicutes in the ileum . to determine the connection between l. johnsonii and agvhd , the recipient mice were treated with antibiotics and then gavaged with l. johnsonii prior to allo - bmt .
antibiotic - treated mice showed a loss of clostridiales and an emergence of enterococcus spp .
, which was associated with exacerbated agvhd . in contrast , mice reintroduced with l. johnsonii showed no expansion of enterococcus spp . and did not experience increased agvhd lethality or pathology .
these results suggest that l. johnsonii may reduce agvhd severity by preventing the expansion of enterococcus spp .
a clinical research study elucidated variations in the intestinal microbiota of 31 patients receiving allogeneic hsct .
the result of metagenomic analysis showed that patients had a predominance of commensal bacteria at the time of admission .
after transplantation , a relative shift toward enterococci was observed , and this shift was particularly prominent in patients that developed subsequently active gastrointestinal agvhd .
another clinical study revealed that the diversity of intestinal microbiota at engraftment is an independent predictor of mortality in allo - hsct recipients .
first , the graft infused into the patient must contain immunological cells , such as mature t cells .
second , the recipient must be immunocompromised and can not reject cells from the donor .
it is accepted that the development of agvhd can be conceptualized as a three - stage process [ 15 , 36 ] .
underlying diseases , previously administered therapies and the hsct conditioning regimen can damage host tissues , resulting in the production of danger signals , such as proinflammatory cytokines , chemokines , mhc antigens , and costimulatory molecules on host apcs .
both cellular mediators , such as cytotoxic lymphocytes ( ctls ) and nk cells , and inflammatory factors , such as tumor necrosis factor alpha ( tnf- ) , interferon gamma ( ifn- ) , and interleukin-1 ( il-1 ) , can cause the destruction of the target tissue , typically the skin , liver , and gut .
it has been proposed that the gi tract may be particularly critical at the initial stage . both total body irradiation ( tbi ) and high - intensive chemotherapy as part of the conditioning regimen
however , such treatments may also stimulate host tissues to secrete inflammatory cytokines , such as tnf- and il-1 , and their direct influence on epithelial cells of the gi tract allows for the translocation of intestinal microbes and their by - products , including lipopolysaccharide ( lps ) and peptidoglycan , into the systemic circulation ( figure 1 ) .
the symbiotic nature of the intestinal host - microbial relationship is dependent on limiting bacterial penetration of host tissues .
controlling bacterial interactions with the intestinal surface is an important strategy for minimizing bacterial translocation .
the intestinal epithelial surface is the primary interface between the gut bacteria and deeper tissues .
given the enormous numbers of commensal microbes and the persistent invasion of pathogens , it is important that the host immune system monitors and regulates microbial interactions with the intestinal surface .
the intestinal surface maintains an intact barrier through formation of complex protein - protein networks that firmly join together via tight junctions . in hsct
, intestinal bacteria may translocate into deeper tissues from the damaged gi tract and cause infection and septicemia . in a mouse model of agvhd ,
serious impairment of intestinal barrier function in the jejunum was detected , with increased permeability and morphological changes owing to both decreased protein expression and altered localization of the tight junction protein occluding .
there is a significant relationship between gut microbiota and intestinal radiosensitivity . in a mouse model of tbi - bmt ,
several commensal bacteria or their components have the ability to protect intestinal mucosal tissue from irradiation damage .
bacteria - derived flagellin pretreatment protected mice from radiation - induced intestinal mucosal injury and apoptosis via a toll - like receptor 5 ( tlr5)-dependent mechanism . in a human trial , patients taking the probiotic mixture vsl#3 ( a mixture of eight probiotic strains ) experienced radiation - induced diarrhea less frequently than patients taking a placebo in a double - blinded study .
another study showed that a lactobacillus rhamnosus gg- ( lgg- ) derived soluble protein , p40 , ameliorates intestinal injury and colitis , reduces apoptosis , and preserves barrier function by transactivation of the egf receptor ( egfr ) in intestinal epithelial cells .
the paneth cell is an intestinal epithelial cell that plays a key role in limiting bacterial penetration into host tissues .
these cells have a much longer half - life than other cells found in the small intestine .
paneth cells can secrete a number of microbicidal proteins , including -defensins , which selectively kill pathogens , while preserving commensals .
when paneth cells sense bacterial signals , they react by discharging their microbicidal granule contents into the gut lumen . therefore , paneth cells are critical to the immune response to pathogens and the maintenance of a noninflammatory commensal flora in the small intestine .
current studies show that paneth cells are targeted by agvhd , resulting in a substantial loss of paneth cells in the intestine and marked reduction in the expression of -defensins in recipients with agvhd .
restriction fragment length polymorphism ( rflp ) of intestinal microbial communities showed loss of physiologic diversity among the microbiota and the overwhelming expansion of a rare bacterium .
16s rrna gene sequencing demonstrated that this peak was almost certainly due to the presence of escherichia coli in the intestine of recipients suffering from agvhd .
another clinical study showed that enumeration of duodenal paneth cells is a readily available index of disease severity that provides important information regarding agvhd prognosis .
septicemia is the most life - threatening infection following allogeneic hsct , and gram - negative bacteria are the most dominant pathogens of septicemia .
agvhd is regarded as one of the major predisposing factors for the development of septicemia .
lps can enter the circulation through the impaired mucosal barrier after the conditioning regimen . in experimental studies ,
probiotic microorganisms have been shown to alter the composition of the intestinal microflora and thereby mediate anti - inflammatory effects . modifying the intestinal microbiota by oral administration of lgg before and after transplantation resulted in improved survival and reduced agvhd .
connections between pathogen - associated molecular patterns ( pamps ) and pathogen recognition receptors ( prrs ) control adaptive immune responses in inflammatory disorders , including agvhd . intestinal bacteria and their components
the stimulation of prrs leads to transcription of inflammatory genes and upregulation of proinflammatory cytokines and class ii and costimulatory molecules , resulting in local tissue inflammation and migration of leukocytes .
intestinal mucosal surfaces are rich in resident innate immune cells , such as macrophages and dendritic cells ( dcs ) . signaling through prrs
regulates the activity of dcs , leading to phagocytosis , chemokine receptor expression , cytokine secretion and migration from peripheral tissue to draining lymph nodes , and antigen presentation ( figure 1 ) .
several tlrs have been described to recognize different pamps , including gram - positive bacteria - derived lipoproteins ( tlr2 ) , gram - negative bacteria - derived lps ( tlr4 ) , bacterial flagellin ( tlr5 ) , rna ( tlr3 , tlr7 , and tlr8 ) , cytosine - phosphorothioate - guanine ( cpg ) dna ( tlr9 ) , profilin ( tlr11 , tlr12 ) , and bacterial 23s ribosomal rna ( tlr13 ) [ 50 , 51 ] .
tlr downstream signaling activates a complex signaling cascade , eventually leading to host resistance against pathogens by increased production of cytokines , chemokines , adhesion molecules , and antimicrobial peptides , as well as to enhanced antigen presentation by apcs .
pamps are recognized not only by tlrs but also by nucleotide - binding oligomerization domain- ( nod- ) like receptors ( nlrs ) .
nlrs include proteins such as nalps , nod1 , and nod2 , which are involved in the secretion of inflammatory cytokines , such as il-1 and il-18 .
as recognized molecular patterns of invading and resident microbes , tlrs are fundamental to controlling intestinal tissue homeostasis in studies that involve intestinal epithelial cell damage . in experimental agvhd ,
tlrs appear to have a significant role in disease outcomes . in models of hsct ,
however , the role of tlr4 in agvhd is still unclear , with conflicting findings in different studies [ 54 , 55 ] .
evaluation of the expression of tlrs on t lymphocytes and monocytes in 34 patients showed that levels of tlr5 on monocytes and t lymphocytes are positively correlated with agvhd , whereas levels of tlr1 and tlr9 are negative predictors .
the pathophysiology of agvhd is a multistep process that eventually results in t helper 1-driven ( th1-driven ) tissue damage .
recently , increasing evidence indicates the involvement of t helper 17 ( th17 ) and regulatory t cells ( tregs ) in agvhd pathogenesis .
one clinical study showed that in situ quantification of the th17/treg ratio was a specific marker of human agvhd .
murine experimental studies provide inconsistent results on the role of th17 in agvhd [ 5961 ] .
in contrast , treg contributes to tolerance acquisition to donor antigen in solid organ transplantation and protects the development of fatal agvhd in murine model .
the homeostasis of steady - state mucosal t cell subsets is controlled by signals from various components of the intestinal microbiota [ 63 , 64 ] .
treg and th17 cells are the most abundant lamina propria cd4 t cell subsets at steady state .
tregs are crucial in inhibiting excessive inflammatory responses toward intestinal bacteria [ 65 , 66 ] .
th17 cells are characterized by the production of il-17 and other effector cytokines , such as il-17f and il-22 .
th17 cell - derived cytokines function as important activators of innate immune mechanisms , such as recruitment of neutrophils and induction of antimicrobial peptide production from epithelial cells .
treg and th17 cell numbers in the gut are controlled by signals from different species of the commensal microbiota [ 68 , 69 ] .
colonic treg cells are induced by bacteria belonging to group iv and xiva clostridia , and small intestinal th17 cells are induced by segmented filamentous bacteria ( sfb ) [ 7072 ] .
patients undergoing allo - hsct have a substantially increased risk of bacterial , fungal , and viral infection . multiple approaches to decrease the risk of infections after hsct
have been explored , including laminar airflow housing , the use of antibiotics , and prophylactic antiviral and antifungal therapies .
antibiotic resistance in pathogenic bacteria has been an increasing threat to human health during the last decade , and it is widely accepted that the antibiotic resistance development and spread in microbes can be largely attributed to the abuse and misuse of antibiotics . in addition , breakdown of the normal microbial community by antibiotic use increases the risk of pathogen infection and the overgrowth of harmful disease .
clostridium difficile infection ( cdi ) is the most common cause of severe diarrhea and occurs with increased frequency after broad - spectrum antibiotic treatment [ 75 , 76 ] .
results from a retrospective study showed that cdi is strongly associated with agvhd and increased nonrelapse mortality in allo - hsct patients . in recent years
, fecal microbiota transplantation ( fmt ) has emerged as an efficacious method for the treatment of cdi [ 78 , 79 ] .
fmt refers to infusion of a fecal suspension from a healthy individual into the gi tract of a patient to restore healthy intestinal microbiota and cure disease .
an alternative solution to this problem is to screen some beneficial bacteria from stool and only infuse these bacteria as a cocktail into the gi tract [ 80 , 81 ] .
probiotics are live microorganisms , which when administered in adequate amounts confer a health benefit to the host .
various animal and human studies have demonstrated that some probiotic strains can successfully modify the mucosal immune response due to species and strain specificity of the probiotics [ 82 , 83 ] .
the most commonly used probiotics are bifidobacterium , bacillus , and the lactic acid bacteria ( lab ) , including genus lactobacillus and streptococcus .
lactobacillus rhamnosus atcc 53103 , isolated from a healthy human intestinal commensal , is one of the most widely used and well - documented probiotic strains [ 17 , 45 , 8587 ]
. some of the beneficial impacts of probiotics have been scientifically documented , and three main categories of probiotics contributing to host health have been described [ 83 , 88 , 89 ] . first , certain probiotics can exclude or inhibit pathogens .
second , probiotics can enhance the function of the intestinal epithelial barrier by modulating various signaling pathways , inducing mucus and antimicrobial peptide production , enhancing tight junction functioning , and preventing apoptosis .
third , probiotics can modulate host immune responses , resulting in both local and systemic effects .
the rationale for using probiotics to treat gastrointestinal disorders is supported by several clinical studies . in one study ,
ingestion of bifidobacterium infantis 35624 was shown to alleviate symptoms of irritable bowel syndrome ( ibs ) associated with normalization of the ratio of anti - inflammatory to proinflammatory cytokines . to assess the effects of probiotics in diarrhea , a meta - analysis that included 63 studies ( n = 8014 )
was carried out ; the results showed that probiotic strains appear to be safe and have clear beneficial effects in shortening the duration and reducing stool frequency in acute infectious diarrhea .
animal models indicate the close connection between gut microbiota and ibd , and several kinds of probiotics were evaluated in human clinical trials [ 92 , 93 ] .
escherichia coli nissle 1917 shows efficacy and safety in maintaining a remission equivalent in patients with ulcerative colitis .
the once daily high dose probiotic vsl#3 is effective in maintaining antibiotic - introduced remission for at least one year in patients with recurrent or refractory pouchitis .
there are several bottlenecks that need to be overcome before probiotics can be applied in clinical treatment .
one important limitation is the delivery of viable cells to the lower gi tract without a significant loss of cell viability and metabolic features through the harsh conditions of the stomach . in addition , compared to animal models , a major challenge for understanding the interactions between intestinal microbiota and human hosts is the heterogeneity of microbial composition that can colonize the intestine
. different components of microbiota can have very different effects on the host , and the composition of microbial communities can be influenced by a variety of factors , including diet , antibiotic therapy , and environmental exposure to microbes [ 97 , 98 ] .
an increasing number of studies have identified an important interaction between intestinal microbiota and mammalian host health and disease .
recent evidence has demonstrated that specific species of intestinal bacteria appear to be specialized in their ability to induce particular immune cell subsets .
probiotic bacteria can modulate immune responses to promote health by altering the composition of intestinal microbiota .
manipulation of the intestinal microbiota through probiotics or their components holds great promise for the treatment of inflammatory diseases , including agvhd . despite some notable successes from probiotics trials ,
there are numerous obstacles to overcome before probiotic strains can be utilized as agvhd therapeutics .
thus , they should be tested in vitro and then evaluated for their suitability and efficacy in vivo .
hence , there remains a pressing need to screen for probiotic strains that display more remarkable therapeutic responses to agvhd .
second , although changes in microbiota associated with agvhd progression are apparent , it is unknown which exact components of the microbiota are responsible for aggravating or ameliorating agvhd .
therefore , monitoring intestinal microbiota changes of patients before and after agvhd is of vital significance .
however , causality of agvhd in response to probiotic - induced microbiota changes still has not been demonstrated .
along with research on screening for safe and effective probiotic strains moving towards increasing profundity , more attention should be focused on the immune mechanisms governing probiotic effects in agvhd .
several creative therapeutic methods might originate from a better understanding of the relationship among probiotic strains , intestinal microbiota , and immune regulation during agvhd .
Output:
| the mammalian intestinal microbiota is a complex ecosystem that plays an important role in host immune responses .
recent studies have demonstrated that alterations in intestinal microbiota composition are linked to multiple inflammatory diseases in humans , including acute graft - versus - host disease ( agvhd ) .
agvhd is one of the major obstacles in allogeneic hematopoietic stem cell transplantation ( allo - hsct ) , characterized by tissue damage in the gastrointestinal ( gi ) tract , liver , lung , and skin . here , we review the current understanding of the role of intestinal microbiota in the control of immune responses during agvhd .
additionally , the possibility of using probiotic strains for potential treatment or prevention of agvhd will be discussed . |
PubmedSumm7869 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: we obtained data from the edhs 2008 4 and ehis 2015 5 , both of which were conducted by elzanaty and associates with support from the united states aid of international developmentsponsored dhs7 project . the national surveys in 2008 and 2015 were crosssectional household surveys , where sampling weights were used to provide estimates considered representative of the egyptian population on the basis of a complex , threestage probability sampling approach .
the two surveys provide estimates of hcv prevalence in egypt for the country as a whole and broken down for the major administrative regions ( urban governorates , lower egypt , upper egypt and the frontier governorates ) . in both edhs 2008 and ehis 2015 ,
those aged 1559 years were invited to participate , however , in ehis 2015 , children aged 6 months to 14 years were also included 4 , 5 .
basic demographic information was collected , including : age , gender , marital status , place of residence , level of education , work status and wealth status .
the laboratory procedures applied in 2015 were similar to those in 2008 4 , 5 .
in 2015 , consented individuals provided 7 ml of venous blood added to an edta vacutainer tube . in the field laboratory ,
the 2015 ehis biomarker staff centrifuged the blood and transferred the serum to five microvials that were stored in liquid nitrogen tanks before being transferred to the central public health laboratory ( cphl ) in cairo . a hepatitis c testing algorithm
used thirdgeneration enzyme immunoassay ( elisa ) to determine the presence of hcv antibodies . a more specific assay ,
the chemiluminescent microplate immunoassay ( cia ) was used to confirm hcv antibody status for elisapositive samples and 5% of the elisanegative samples .
quantitative realtime pcr was used to test for hcv rna in hcv antibodypositive samples to confirm active infections . a quality control procedure of retesting of approximately 10% of all samples
was undertaken at the cphl and a further external quality control was done at the theodor bilharz research institute , in cairo , by retesting approximately 5% of the samples tested at the cphl 5 . the only key difference between this procedure and that of the previous survey is that , in 2008 , the quality control measure ( 10% of samples retested ) at cphl was not carried out .
comparisons were carried out for hcv antibody and hcv rnapositive tests , by estimating the absolute and relative risk reductions between the two surveys in comparable age groups . to calculate the 95% confidence interval for the risk difference , newcombe
wilson 's method without continuity correction was applied 6 . in order to estimate confidence intervals for the relative risk
the level of significance ( pvalue ) was inferred to be less than 0.05 if the corresponding 95% confidence intervals for the relative and absolute effect measures were devoid of
hcv virus clearance was estimated by finding the absolute difference between the proportion of hcv antibody and hcv rnapositive participants , and dividing this by the proportion of hcv antibodypositive participants .
comparisons of hcv clearance between combined age groups in 2008 and 2015 were done using the chisquare test . in order to demonstrate the cohort effect ,
the 2008 dhs data were shifted forward ; 7 years were added to each participant 's age from the 2008 dhs survey and the hcv antibody and hcv rna prevalence estimates were recalculated using the new numerator and denominator in each age category .
the estimated number of population positive for hcv antibodies and hcv rna was calculated by multiplying the age and genderspecific prevalence of 2015 by the population census of january 2015 categorised by age and gender .
no ethical approval was needed for the data analysis presented in this paper ; the anonymised data is publically available online .
elzanaty and co is the responsible party for the ethical considerations of the edhs 2008 and ehis 2015 ; verbal informed consent was obtained from all individuals aged 18 years and older and from married minors aged 1517 years . for children less than 18 years
we obtained data from the edhs 2008 4 and ehis 2015 5 , both of which were conducted by elzanaty and associates with support from the united states aid of international developmentsponsored dhs7 project .
the national surveys in 2008 and 2015 were crosssectional household surveys , where sampling weights were used to provide estimates considered representative of the egyptian population on the basis of a complex , threestage probability sampling approach .
the two surveys provide estimates of hcv prevalence in egypt for the country as a whole and broken down for the major administrative regions ( urban governorates , lower egypt , upper egypt and the frontier governorates ) . in both edhs 2008 and ehis 2015 ,
those aged 1559 years were invited to participate , however , in ehis 2015 , children aged 6 months to 14 years were also included 4 , 5 .
basic demographic information was collected , including : age , gender , marital status , place of residence , level of education , work status and wealth status .
the laboratory procedures applied in 2015 were similar to those in 2008 4 , 5 . in 2015 , consented individuals provided 7 ml of venous blood added to an edta vacutainer tube . in the field laboratory ,
the 2015 ehis biomarker staff centrifuged the blood and transferred the serum to five microvials that were stored in liquid nitrogen tanks before being transferred to the central public health laboratory ( cphl ) in cairo . a hepatitis c testing algorithm
used thirdgeneration enzyme immunoassay ( elisa ) to determine the presence of hcv antibodies . a more specific assay ,
the chemiluminescent microplate immunoassay ( cia ) was used to confirm hcv antibody status for elisapositive samples and 5% of the elisanegative samples .
quantitative realtime pcr was used to test for hcv rna in hcv antibodypositive samples to confirm active infections . a quality control procedure of retesting of approximately 10% of all samples
was undertaken at the cphl and a further external quality control was done at the theodor bilharz research institute , in cairo , by retesting approximately 5% of the samples tested at the cphl 5 . the only key difference between this procedure and that of the previous survey is that , in 2008 , the quality control measure ( 10% of samples retested ) at cphl was not carried out .
comparisons were carried out for hcv antibody and hcv rnapositive tests , by estimating the absolute and relative risk reductions between the two surveys in comparable age groups . to calculate the 95% confidence interval for the risk difference , newcombe
wilson 's method without continuity correction was applied 6 . in order to estimate confidence intervals for the relative risk
the level of significance ( pvalue ) was inferred to be less than 0.05 if the corresponding 95% confidence intervals for the relative and absolute effect measures were devoid of
hcv virus clearance was estimated by finding the absolute difference between the proportion of hcv antibody and hcv rnapositive participants , and dividing this by the proportion of hcv antibodypositive participants .
comparisons of hcv clearance between combined age groups in 2008 and 2015 were done using the chisquare test . in order to demonstrate the cohort effect ,
the 2008 dhs data were shifted forward ; 7 years were added to each participant 's age from the 2008 dhs survey and the hcv antibody and hcv rna prevalence estimates were recalculated using the new numerator and denominator in each age category .
the estimated number of population positive for hcv antibodies and hcv rna was calculated by multiplying the age and genderspecific prevalence of 2015 by the population census of january 2015 categorised by age and gender .
no ethical approval was needed for the data analysis presented in this paper ; the anonymised data is publically available online .
elzanaty and co is the responsible party for the ethical considerations of the edhs 2008 and ehis 2015 ; verbal informed consent was obtained from all individuals aged 18 years and older and from married minors aged 1517 years . for children less than 18 years , consent was obtained from the parent or child caretaker .
in edhs 2008 , 4757 households including 12 780 individuals aged 1559 years were identified for interview and blood testing .
a total of 4662 households complied ( 98% ) , 12 008 persons were interviewed ( 93.9% ) and out of these , 11 126 persons provided blood samples for testing ( 92.7% ) . in ehis 2015 ,
a total of 7516 households complied ( 98.3% ) , and 27 549 persons ( age : 159 years ) were interviewed ( 98.1% ) . of the total 28 079 persons
identified , 17 182 were aged 1559 years , of which 16 671 were interviewed ( 97.0% ) and out of these , 16 003 provided blood samples for testing ( 96.0% ) .
the remaining 10 897 persons identified were children aged 114 years , and of these , 10 878 ( 99.8% ) were interviewed through their caregivers and 10 044 ( 92.3% ) children provided blood samples for testing .
children therefore represented 39.5% of the total study population ( those interviewed ) in ehis 2015 .
the characteristics of the two populations surveyed in edhs 2008 and ehis 2015 are presented in table 1 . for comparison purposes ,
participant characteristics of egyptian demographic health surveys in 2008 compared to ehis 2015 there was an overall significant reduction of 32 and 29% in the prevalence of hcv antibody and hcv rnapositive individuals , respectively , between the dhs in 2008 and the ehis in 2015 ( table 2 ) .
the agespecific prevalence of hcv antibody and hcv rnapositive individuals in 2008 and 2015 is presented in table 2 and fig .
the pattern of increased prevalence of hcv antibody and hcv rnapositive persons with age was observed in both the 2008 and the 2015 survey .
a statistically significant reduction in hcv antibody prevalence was observed in all age groups , and the greatest relative prevalence reduction ( 75% ) was observed among those aged 1519 years .
a statistically significant reduction in hcv rnapositive individuals was observed in all except the two age groups encompassing those 2029 years of age .
the agespecific prevalence of hcv antibody and hcv rnapositive individuals from 2008 shifted forward by 7 years is presented alongside the 2015 prevalence estimates ( fig .
1 ) . the current data ( ehis 2015 ) for the three oldest age groups ( 4559 years ) show a similar hcv clearance percentage when compared to the same age groups in the shiftedforward 2008 data ( 31.2% in 2015 , 32.0% in the shifted 2008 , p = 0.756 ) . for the cohort of children aged 114 years in 2015 ,
the overall prevalence of hcv antibody and hcv rnapositive individuals was 0.4% ( 95% ci 0.30.5 ) and 0.2% ( 95% ci 0.10.3 ) respectively ( table 3 ) .
prevalence of hepatitis c virus ( hcv ) antibody and hcv rna positive persons ( age 1559 years ) by age , gender and region ( edhs 2008 and ehis 2015 surveys ) statistically significant ( p < 0.05 ) .
( a ) agespecific prevalence of hepatitis c virus ( hcv ) antibodypositive persons in 2008 and 2015 ( left ) , then shifted ( by 7 years ) 2008 and 2015 ( right ) .
( b ) agespecific prevalence of hcv rnapositive persons in 2008 and 2015 ( left ) , then shifted ( by 7 years ) 2008 and 2015 ( right ) .
estimated population numbers who are hepatitis c virus ( hcv ) antibody and hcv rna positive ( ehis 2015 ) a significant reduction of hcv antibody and hcv rnapositive individuals was observed when looking at the overall prevalence in the urban governorates and , and for lower and upper egypt governorates ( fig .
2 ) . no significant change in prevalence of either hcv antibody or hcv rna positivity was observed in the frontier governorates .
prevalence of hepatitis c virus antibody in the 2008 and 2015 egyptian demographic and health surveys .
table 3 shows the age and genderspecific prevalence of hcv antibody and hcv rnapositive persons in 2015 , as well as the estimated total number of persons positive for hcv antibody and hcv rna in egypt at this time . in the population aged 059 years
, we estimated a total of 3 693 180 persons with chronic hcv infection ( hcv rna positive ) , and 5 309 555 persons with hcv antibodies .
in 2015 , hcv still affects a substantial proportion of the egyptian population , where it is estimated that , in the 159year age group , 5.3 million persons are positive for hcv antibodies and , of these , approximately 3.7 million ( 69.5% ) are hcv rna positive .
this is an underestimate of the total human hcv reservoir in egypt because older age groups ( > 59 years ) were not included in the ehis 2015 .
this recent survey shows a similar epidemiological pattern of increased hcv antibody prevalence with age as did the edhs 2008 .
this phenomenon was described in many studies 9 , 10 and is because of the continuing exposure and risk of infection with age 11 , while the proportion of persons with hcv infection who go on to develop severe disease and die of it remains low until 30 years after infection ; the rate of progression to cirrhosis is estimated at 7% after 20 years of being infected 12 .
the increase in hcv antibody prevalence with age is therefore demonstrating the cumulative hcv incidence over time until hcvrelated mortality becomes manifest .
this study shows a significant reduction in the overall prevalence of hcv antibody from 14.7 to 10.0% , and hcv rna from 9.9 to 7.0% , between 2008 and 2015 among those aged 1559 years .
the main explanation for this marked reduction in hcv prevalence is the disappearance of the group infected during the mass schistosomiasis treatment campaign with reused syringes ( 1960s through early 1980s ) to outside the age range covered by the survey ( i.e. those older than 59 years ) 13 , 14 . indeed , as demonstrated in fig .
1 , the agespecific hcv antibody and hcv rna prevalence for 2015 matches well with the 2008 prevalence estimates shifted by 7 years , suggesting that the ageing of the infected cohort , the socalled cohort effect , is the driving mechanism underlying the hcv age distribution ; this was also demonstrated in the earlier reduction of hcv antibody prevalence from 30% in 1996 14 to 14.7% in 2008 4 . in order to see whether or not a decrease in hcv incidence may have also been a contributor to the reduction in hcv prevalence , the most interesting age groups to look at are those less than 20 years of age ; persons who were not affected by the mass treatment campaigns and for whom hcvrelated mortality remains low .
if we assume that mothertochild hcv transmission is a negligible source of infant infection , as suggested by the < 0.5% hcv antibody prevalence in the 14year age group , then the hcv antibody prevalence at age 19 indicates the cumulative incidence over the past 20 years . in 2008 and 2015 , the prevalence of hcv antibodies in those aged 1519 years was 4.1 and 1.0% , respectively ; the percentage of relative risk reduction was 75% ( 95% ci 6485 ) , implying a very substantial reduction in hcv incidence in the past 20 years in this age group .
furthermore , the prevalence of hcv antibody ( 0.4% ) and hcv rnapositive persons ( 0.2% ) observed in ehis 2015 among the age group 114 years is low compared to several studies conducted in early 2000s , which described the hcv antibody prevalence to be ranging from 2 to 7% in children under 10 years in rural areas of the nile delta 15 , 16 , 17 .
this change in incidence in the younger age groups could possibly be because of the various public health interventions implemented by the ministry of health and population and its partners since 2008 . in this time
, several efforts have been made to promote and expand the infection prevention and control programmes beyond ministry of health and population hospitals , particularly to the university hospitals .
auto disabled syringes were introduced to the routine immunisation sector in 2008 in order to promote safe injection practices among children .
safe blood transfusion activities , including policies and guidelines , have been intensified since 2009 .
raising the awareness of the public , by targeting universities and schools to improve their understanding on the epidemiology and prevention of viral hepatitis , was also carried out .
preservice education targeting healthcare staff has been carried out since 2008 to enforce the concepts of safe healthcare and prevention of bloodborne pathogens .
one may question whether the national treatment programme , which managed to treat more than 350 000 persons in the past 7 years 18 using pegylated interferon and ribavirin 19 , has had an impact on hcv prevalence figures .
in such a case , it would be expected that cured patients would have cleared hcv rna , but kept hcv antibodies .
therefore , the impact would be seen through an increase in hcv clearance percentage in the age groups most targeted by the national treatment programme .
owing to established approximate 50% cure rates of the combination of pegylated interferon and ribavirin 20 , only half of these persons ( i.e. 175 000 ) would have cleared their hcv infection after treatment .
the national treatment programme prioritises persons with more advanced forms of liver disease , and therefore , at least half of the beneficiaries of this service are in their 40s or 50s .
indeed , in a group of 3235 patients treated for hcv in a hospital run by the ministry of health in cairo , between 2007 and 2011 , the mean age was 41 years with a standard deviation of approximately 10 years 21 . in order to see whether or not treatment has , as of yet , had an impact on lowering the prevalence of persons with hcv rna in egypt , we can see whether or not there has been increased clearance in the four older age groups ( i.e. encompassing 4059 years ) over the past 7 years .
if we assume that around half ( 87 500 ) of the total persons cured was in the 4059year age group , and considering that we have estimated 2.87 million persons with hcv antibodies in the same age group in 2015 ( table 3 ) , we would have expected to see around a 3% higher clearance percentage in this group , in comparison with 2008 .
however , an increase in clearance in these older age groups was not observed when comparing data from 2015 and the shiftedforward 2008 data .
indeed , it would require around 4000 antihcvpositive persons in this age group , in each data set , in order to have enough power to demonstrate this expected 3% difference ; unfortunately , the antihcv population examined in this survey was much lower than that .
treatment may show a larger impact in the near future as it is expected that emphasis will be put on an upscale of treatment of infected persons to prevent longterm complications 22 , particularly considering that new directacting antiviral ( daa ) drugs were approved for the treatment of hcv by the u.s . food and drug administration ( fda ) in late 2013 , and then introduced into egypt in late 2014 .
these new treatment regimens have reduced treatment duration to 1224 weeks , decreased side effects and improved outcomes , with cure rates of 8595% across all patient populations 23 , 24 .
finally , differential migration and mortality of persons infected with hcv could have contributed to the reduced prevalence of both hcv antibody and hcv rnapositive persons in 2015 , as long as these rates are higher than infection incidence 25 , 26 , 27 ; these topics needs to be explored further . the prevalence of hcv antibody and hcv rnapositive individuals varied among governorates and was reduced in several geographical regions .
lower egypt governorates , which are mostly rural in nature , still show a higher prevalence of hcv antibodies and hcv rna when compared to urban governorates .
this pattern of high hcv prevalence in rural areas is similar to previous multiple studies conducted in rural lower egypt governorates which showed a prevalence ranging from 14.4 to 18.5% 28 , 29 , 30 .
the frontier governorates did not show any significant change , however , this is possibly owing to the fact that the sample size was very low ( n < 200 ) , in both the 2008 and 2015 surveys . based on our findings in this study , we recommend the expansion of national health surveys in egypt in order to include older age groups and allow further followup of elderly persons who have been
the most affected by hcv and who , by the cohort effect , are being pushed out of view .
furthermore , there should be continued prioritisation of prevention programmes to increase the effects we are seeing in incidence in young age groups , with a focus on interventions which promote injection safety by reducing the frequency of unnecessary injections and syringe reuse .
interventions could include introduction of singleuse materials and engineered safety devices , such as autodisabled or autodestructive syringes into the curative sector .
expansion of infection prevention and control programmes are of utmost importance , along with development of elaborate systems for delivering and renewing licenses of healthcare facilities to ensure continuity of safe procedures and application of standard precautions
. other analyses of the ehis data should be done , using tools such as mathematical modelling , in order to properly estimate and explain changes in hcv incidence in egypt ; this could lead to further evidencebased recommendations related to prevention and control efforts .
finally , access to treatment should be a priority , and although economic constraints are faced by the country , treatment has been shown to be costeffective in this context 31 , 32 and focused , early treatment strategies may be effective in supporting prevention measures and reducing transmission 33 .
Output:
| abstractbackground & aimsin 2015 , a national egyptian health issue survey was conducted to describe the prevalence of hepatitis c virus ( hcv ) infection . in this paper
, we describe the hcv burden in 2015 , compare the results with the national survey conducted in 2008 , and discuss the implications of the new findings on prevention of hcv in egypt.methodsa multistage probability sampling approach was used , similar to the national demographic survey conducted in 2008 .
more than 90% of sampled individuals complied with the interview and provided blood samples.resultsin the 1559year age groups , the prevalence of hcv antibody was found to be 10.0% ( 95% ci 9.510.5 ) and that of hcv rna to be 7.0% ( 95% ci 6.67.4 ) . in children , 114 years old , the prevalence of hcv antibody and hcv rna were 0.4% ( 95% ci 0.30.5 ) and 0.2% ( 95% ci 0.10.3 ) respectively .
approximately , 3.7 million persons have chronic hcv infection in the age group 1559 in 2015 .
an estimated 29% reduction in hcv rna prevalence has been seen since 2008 , which is largely attributable to the ageing of the group infected 4050 years ago during the mass schistosomiasis treatment campaigns .
prevention efforts may have also contributed to this decline , with an estimated 75% ( 95% ci 645 ) decrease in hcv incidence in the 019 year age groups over the past 20 years.conclusionsthese findings can be used to shape future hcv prevention policies in egypt . |
PubmedSumm7870 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: sjgren 's syndrome ( ss ) is a chronic , progressive autoimmune disease that mainly affects exocrine glands including the salivary and lacrimal glands1 )
. functional impairment of these glands by focal lymphocyte infiltration diminishes the production of tears and saliva and produces the clinical findings of persistent dry mouth and eyes .
in addition to glandular manifestations , some patients with ss have a disorder that is complicated by multiple organ involvement ; extra - glandular or systemic clinical features such as : arthritis , fatigue , lymphoma , and vasculitis may be present2 ) .
antinuclear antibody ( ana ) and rheumatoid factor ( rf ) are frequently detected in serologic tests of these patients in the course of the diagnosis of ss .
antibodies directed to extractable nuclear antigens , such as anti - ro or anti - la , are known to be more specific for a diagnosis of ss3 ) .
ss may occur as primary ss , which develops alone , or it can be associated with a variety of systemic autoimmune diseases such as rheumatoid arthritis , systemic lupus erythematosus , or primary biliary cirrhosis4 - 6 ) .
few cases of ss associated with seronegative spondyloarthropathy ( spa ) , such as ankylosing spondylitis , reactive arthritis ( rea ) , psoriatic arthritis , and undifferentiated spa , have been reported until recently7 - 9 ) .
however , most of the overlapping features have occurred in undifferentiated spa and ss , whereas ss in patients with rea is rarely reported in the literature .
we report a case of ss and concurrent chlamydia - induced rea ; this is the first report in the korean population .
a 40-year - old man presented with a history of swelling and pain of both ankle joints and plantar surfaces , and inflammatory back pain for 5 years .
the patient had a medical history of urethritis with a recurrent dysuria and pyuria , which was intermittently treated with systemic antibiotics .
a physical examination revealed significant swelling of both ankle joints and severe tenderness around the bony insertion portions of the achilles tendon .
tenderness was also noted in the : iliac crest ( bilaterally ) , tibial tuberosities , and calcaneus .
bilateral keratoconjunctivitis sicca was confirmed by an ophthalmologic examination which included the schimer 's test ( 3 mm left eye and 2 mm right eye ) .
however characteristic manifestations of rea including keratoderma blennorrhagica , circinate balanitis , and painless oral ulcer were absent .
laboratory analyses on admission demonstrated a c - reactive protein of 2.0 mg / dl ( normal : < 0.3 mg / dl ) and a erythrocyte sedimentation rate of 36 mm / hr ( normal : 0 - 20 mm / hr ) . complete blood count and blood biochemistry produced normal findings .
routine analysis and culture of urine showed pyruia ( wbc 10 - 19/high power field ) without identification of any bacterial organisms .
rf and anti - ro antibody were elevated to 56 iu / ml ( normal : < 15 iu / ml ) and 460 aau ( normal : < 150 aau ) , respectively .
however , anti - neutrophil cytoplasmic antibody , double - strand dna antibody , anti - sm antibody , anti - rnp antibody , and anti - la antibody were all negative .
igg titer for chlamydia trochomonas was 4.0 ( normal : < 0.9 ) ; this value is almost four fold elevated compared to the cut - off value using the elisa method .
the radiological finding of the sacroiliac joints revealed mild marginal irregularity and subchondral sclerosis at the left joint surface ( figure 1 ) .
in addition to periostitis , soft tissue thickening , and subchondral sclerosis along the inferior and posterior aspects of the calcaneus , bony erosion was also present at the bony insertion site of the achilles tendon ( figure 2 ) .
a whole body bone scan using tc99m - mdp showed more increased uptake at the left sacroiliac joint compared to the right joint ; in addition , increased uptake of the left foot compared to the right was observed ( figure 3 ) .
a reduced excretion or abnormal uptake of the salivary glands was not noted in the evaluation by salivary scan . on the basis of : inflammatory back pain , asymmetrical sacroiliitis , evidence of urethritis by chlamydia infection , recurrent pyuria , peripheral arthritis dominant in lower extremities , and enthesitis of achilles tendon with radiological changes , a diagnosis of rea combined with ss
the criteria were fulfilled for the diagnosis of rea based ib the european spondylarthropathy study group ( essg ) and ss of european - american consensus group , respectively10 , 11 ) . for the enthesitis and arthritis , we administered low dose corticosteroid ( prednisolone 5 mg / day ) , sulfasalazine ( 1,000 mg bid / day ) , and non - inflammatory anti - inflammatory drugs ( nsaids ) .
intra - articular injection or intra - lesional infiltration of steroid was also performed for swollen joints and tender lesions of enthesopathy . only 1 gram of oral azithromycine for urethritis was needed .
dry eyes were controlled by replacement with an artificial tear solution . the use of pilocarpine for dry mouth was withdrawn because of an erosive gastric lesion confirmed by endoscopy .
after discharge from the hospital , inflammatory back pain , swollen joints , and enthesitis subsided .
there are a few reports in the literature on concurrent spa and ss7 - 9 ) . the clinical characteristics of spa typically do not include the sicca symptoms of ss .
there are overlapping clinical and laboratory features that occur in spa ( particularly as or undifferentiated spa ) and ss .
the case of chlamydia - induced rea and ss may be the first report identified in the korean population .
central to the pathogenesis of ss is a chronic stimulation of the humoral or cellular immune system ; this includes b and t lymphocytes . circulating
organspecific autoantibodies for cellular antigens of the salivary gland are noted in patients with ss , whereas non - organ - specific autoantibodies are noted in approximately 60% of ss patients .
these nonspecific autoantibodies include rf , ana , and antibodies to the small rna - protein complexes ro / ss - a and la / ss - b ; these are the best available autoantibodies for the diagnosis of ss .
these autoantibodies may be related to functional impairment of exocrine glands by the destruction of glandular tissue13 ) .
our patient presented with the chronic , persistent sicca symptoms of dry mouth and dry eyes , showed a positive result to the schimer 's test , and showed a specific autoantibody to the ro / ss - a antigen .
our patient was diagnosed with ss without histopathologic investigation because the findings were compatible with the recently modified criteria for ss according to the european - american consensus group11 ) .
rea is a sterile inflammatory arthritis which may be triggered by a variety of urogenital or enteropathic infectious agents in the genetically susceptible host14 ) .
causative organisms identified in association with rea include the following species : chlamydia , ureaplasma , shigella , salmonella , yersinia , and campylobacter15 ) .
a well - known genetic predisposing factor is the hla - b27 type , which has been shown to be strongly related to the occurrence of a group of inflammatory arthritis conditions known as spa ; although its specific role in these disorders has not been clearly determined16 ) .
rea is typically an acute , asymmetric , and oligoarticular peripheral arthritis ; the joints affected are preferentially the joints of the lower extremities .
rea is frequently associated with one or more characteristic extra - articular manifestations such as conjunctivitis , achilles tendonitis , plantar fasciitis , dactylitis ( sausage digits ) , urethritis , circinate balnitis , and , rarely , carditis12 , 17 ) .
a positive history of recurrent urethritis and antibodies against chlamydia was observed in this case .
thus , this case also fulfilled the criteria for spa according to the essg10 ) .
rf and ana are frequently detected in patients with ss , but these autoantibodies are not considered to be a typical feature of spa . however , the frequency of reports of concurrent ss and spa have recently increased in the published literature , although this association has not been formally accepted.7 - 9 ) previous studies have examined the association between the development of ss and spa ; results have shown an increased prevalence of ss in spa with positive ana tests ; this suggests that ana may be a risk factor for the development of ss in spa8 , 9 ) .
prior studies have demonstrated that the prevalence of ana in spa is higher in patients with as and psoriatic arthritis18 , 19 ) .
recent studies have also shown that ana is increased in spa patients when compared to controls ; however , the prevalence was reported to be lower in ra patients8 , 9 ) .
although ana is common in spa patients , the specific role of ana in the pathogenesis of spa has not been elucidated .
the use of anti - inflammatory agents , including non - steroidal anti - inflammatory drugs ( nsaids ) , is the cornerstone of treatment in the management of rea.14 ) corticosteroids have also proven to be clinically valuable .
in the case of enthesis and persistent peripheral synovitis , intra - articular or intra - lesional corticosteroids are very effective .
the addition of sulfasalazine or methotrexate to suppress disease activity may be needed in patients who are refractory or can not tolerate nsaids .
long -term use of antibiotics has not been shown to be effective in controlling disease activity ; although prompt treatment with doxycycline for chlamydia infections reduced the risk of the development of rea in one study20 ) .
we chose to use azithromycin , instead of tetracycline , to control urethritis because the former agent is simple , effective and well tolerated when compared to the latter .
recently , monoclonal antibodies or receptor antagonists of tumor necrosis factor ( tnf ) such as infliximab and etanercept have been used in the treatment of rea and ss21 , 22 ) .
if a patient proves to be refractory or can not tolerate combined therapy including nsaids , sulfasalazine , and methotrexate , consideration of new biologic agents will follow .
however , the value of these biologic agents for the treatment of these diseases remains to be determined ; there is the possibility that reactivation - triggering bacteria may exacerbate disease symptoms after the administration of an anti - tnf agent . for the treatment of ss ,
, we described a rare case that presented with overlapping clinical features of chlamydia - induced rea and ss .
further study is needed to determine the nature of this apparent association between ss and spa .
Output:
| a 40-year - old korean man presented with painful swelling and tenderness of both ankle joints as well as the plantar surfaces of both feet , along with inflammatory back pain , and a purulent discharge from the urethral orifice .
the patient also complained of sicca - like symptoms including dry eyes and dry mouth .
an immunological analysis revealed a high titer of rheumatoid factor , positive results for antinuclear antibody and anti - ro antibody , and a positive result for hla - b27 .
an antibody titer for chlamydia was also significantly increased .
positive results of the schirmer 's test and for keratoconjunctivitis sicca were confirmed by an ophthalmologist .
these clinical manifestations were compatible with chlamydia - induced reactive arthritis ( rea ) accompanied by sjgren 's syndrome ( ss ) .
this is the first report of the combination of these two distinct disease entities in the korean population . |
PubmedSumm7871 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: nivolumab is an anti - programmed death 1 ( pd-1 ) monoclonal antibody and has been reported to be useful for treatment of cancers including malignant melanoma .
a recent case report documenting fatal nivolumab - related myasthenia gravis ( mg ) has caused concern about the risk of increased toxicity in patients with pre - existing mg who receive nivolumab for the management of metastatic melanoma .
it is unclear what will occur if a patient with pre - existing mg receives nivolumab .
a 79-year - old man began to receive immune checkpoint therapy with nivolumab at a dose of 2 mg / kg every 3 weeks for the management of submandibular lymph node metastasis from malignant melanoma , which arose in his forehead 3 years ago and was previously treated with cytotoxic chemotherapy .
the patient had a > 20-year history of ocular mg according to osserman s classification .
durable remission was maintained by treatment with oral corticosteroids ( 3 mg every other day ) .
a routine serum chemical test on day 43 , after the patient had received 2 doses of nivolumab , revealed a grade 3 elevation of the creatine phosphokinase ( cpk ) level to 1,627 iu / l ( institutional normal range , 62 to 287 iu / l ) ( fig .
the patient did not experience muscle pain , muscle weakness , or any other symptoms .
the cpk level decreased to 469 iu / l on day 100 and was at worst grade 1 subsequently .
however , after the third dose of nivolumab , the patient had diplopia , facial muscle weakness , and difficulty in drinking water on day 106 .
positive results of an acetylcholine receptor antibody test ( 20.0 nmol / l , normal range , 0.2 nmol / l ) supported the diagnosis .
. apparent shrinkage of the metastatic lymph nodes was observed on computed tomographic imaging after the patient had received 10 doses of nivolumab ( fig .
fdg - pet / ct before and after administration of nivolumab uptake of lymph node metastases decreased after ten doses of nivolumab .
anti - pd-1 antibodies enhance immune response to tumor cells and to normal host tissues as well , and cause adverse effects related to the autoimmune diseases .
other immune checkpoint inhibitors , anti - programmed death - ligand 1 ( pd - l1 ) antibodies and anti - cytotoxic t - lymphocyte - associated protein 4 ( ctla4 ) antibodies , also have been reported to cause immune - related diseases , such as myositis and myasthenia gravis .
the present case with pre - existing mg showed cpk elevation , and symptoms suggesting deterioration of mg such as diplopia and facial muscle weakness after nivolumab administration . after suspending nivolumab , cpk decreased and symptoms improved , and nivolumab was able to be administered safely . since cpk elevation is not usually observed in mg patients , we could not exclude the possibility the symptoms were caused by myositis but not by mg .
although it is not easy to distinguish symptoms of mg from those of myositis , the difference in the time of onset of cpk elevation and that of symptom exacerbation tends to indicate that the symptoms derived from mg rather than myositis . in a case previously reported , an acetylcholine receptor antibody test was low - titer positive ( 2.9 nmol / l ) before the onset of mg induced by nivolumab .
nmol / l one year and seven months prior to the beginning of nivolumab treatment , and it increased to 20 nmol / l when mg was exacerbated .
the antibody titer is considered to be useful to predict the onset of mg and to observe mg symptoms .
there are no clear criteria to decide whether nivolumab is allowed to be restarted after discontinuation of the administration due to adverse events such as cpk elevation or mg exacerbation .
we consider that the restart with careful observation might be allowed when the adverse events improved to mild symptoms , for instance , nci - ctcae grade 1 . despite the transient exacerbation of mg - associated symptoms , this patient - tolerated nivolumab therapy went well and provided substantial benefit , suggesting that the drug is not necessarily contraindicated in patients with preexisting mg .
nivolumab - related mg might have a distinct etiological background from that of primary mg .
yuichi ando received honoraria from ono pharmaceutical co. , ltd . , and has held a consultant / advisory role with ono pharmaceutical co. , ltd ..
Output:
| abstracta 79-year - old man with lymph node recurrence of malignant melanoma received nivolumab , an anti - programmed death 1 ( pd-1 ) monoclonal antibody .
he had pre - existing ocular myasthenia gravis ( mg ) and a continued small amount of corticosteroid .
grade 3 creatine phosphokinase elevation appeared after two doses of nivolumab , and the treatment was postponed until it improved to grade 1 .
after three doses of nivolumab , he experienced diplopia and facial muscle weakness which were consistent with an acute exacerbation of mg , and the symptoms relieved without additional treatment for mg .
he achieved shrinkage of metastasis after ten doses of nivolumab .
although a case who died due to mg after administration of nivolumab was reported recently , pre - existing mg is considered not to be always a contraindication of nivolumab . |
PubmedSumm7872 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a definitive diagnosis of a lymphoma is based on cytological analysis of the intraocular fluids or tissues .
we report two cases of intraocular lymphoma diagnosed by the analyses of vitreous and infusion fluid .
case 1 was a 66-year - old woman who complained of eye floaters and was found to have diffuse vitreous opacification bilaterally .
she received corticosteroid therapy , however the vitreous opacification was not resolved , and her visual acuity ( va ) remained reduced .
she underwent pars plana vitrectomy ( ppv ) , and vitreous and infusion fluid were collected to determine the cause of the reduced va .
the undiluted vitreous obtained from core ppv was submitted for cytokine analysis , and infusion fluid was obtained from the machine cassette after full ppv and used for cytological analysis .
case 2 was a 62-year - old man referred with low vision and was found to have diffuse vitreous opacification in the right eye and dot hemorrhages in both eyes .
four years earlier , he had been diagnosed with diffuse large b - cell lymphoma of the paranasal sinuses and was in remission after chemotherapy .
because metastasis of the lymphoma was suspected , he underwent ppv , and intraocular samples were collected as in case 1 .
the ratio of interleukin ( il)-10 to il-6 was greater than 1.0 in both cases .
these results allowed us to make a diagnosis of intraocular lymphoma : primary intraocular lymphoma in case 1 and metastatic intraocular lymphoma in case 2 .
vitreous and infusion fluid collected during ppv can be used for diagnosing an intraocular lymphoma .
intraocular lymphomas are rare , and they make up less than 1% of intraocular tumors1 and 1% of intraocular inflammations.2 blurred vision and vitreous opacifications are the most common ocular symptoms and signs of an intraocular lymphoma.3 the lifetime prognosis of this disease is poor:4 the 5-year survival rate is 61.1% in japan.3 thus , early diagnosis and treatment are needed .
a definitive diagnosis of an intraocular lymphoma is based on cytological findings of the intraocular fluid or tissues obtained from a biopsy or pars plana vitrectomy ( ppv).5,6 however , cytological examination can be difficult because only a small amount of sample can be obtained from a biopsy or during ppv .
in addition , the mechanical trauma associated with ppv may limit the use of the sample.7 in addition , if steroid therapy had been performed , the cellular necrosis induced will prevent any useful cytological analysis of fluids collected during ppv.8 we have reported that infusion fluid can be used for the cytological diagnosis of sarcoidosis.9 the purpose of this paper is to report two cases of intraocular lymphoma diagnosed with the results obtained from cytokine and cytological analyses of the vitreous and infusion fluid collected during ppv .
a 66-year - old woman was referred to our hospital complaining of floaters in both eyes in february 2010 . at the initial examination ,
her best - corrected visual acuity ( bcva ) was 20/25 in both eyes , and diffuse vitreous opacifications with aggregation of large cells were present in both eyes ( figure 1a and b ) .
although she was treated with corticosteroid therapy for 3 months , her va had decreased to 20/50 in both eyes with increased vitreous opacification .
the core vitreous was cut with a vitreous cutter , and about 1 ml of undiluted vitreous was collected by simultaneous manual aspiration . after the infusion line was opened ,
a full ppv was done , and the cortical vitreous was removed as much as possible .
, tokyo , japan ) used during full ppv was obtained from the machine cassette ( fortas cv-30000 ; nidek co , ltd , aichi , japan ) after the surgery ( about 300 ml ) , and immediately submitted for cytological analysis with use of cytospin .
atypical lymphocytes with anisonucleosis , aberrant chromatin , and dyskaryosis were detected by cytological analysis ( figure 1c ) .
the lymphoma cells were positive for leukocyte common antigen ( lca : figure 1d ) .
the ratio of interleukin ( il)-10 to il-6 ( il-10/il-6 ratio ) of the undiluted vitreous was greater than 1.0 ( il-10 = 7650 pg / ml : il-6 = 139 pg / ml ) .
she was diagnosed with primary intraocular lymphoma in both eyes and received intravitreal and intraspinal methotrexate therapy . at 3 years after the surgery
a 62-year - old man was referred to our hospital with reduced vision in february 2012 .
he was diagnosed with central retinal vein occlusion of the left eye ( figure 2a and b ) , and diabetic retinopathy in both eyes , and diffuse large b - cell lymphoma of the paranasal sinuses ( figures 2c and 3 ) in november 2008 .
he received chemotherapy at the department of internal medicine of our hospital , which led to a remission of the lymphoma . at our initial examination ,
the anterior chamber was not inflamed , but diffuse vitreous opacification with aggregation of large cells was observed in right eye , and dot hemorrhages were observed in both eyes .
the lymphoma in his right eye was suspected to be a metastasis because of the history of paranasal lymphoma and the ocular findings .
vitreous samples and infusion fluid were collected as in case 1 . from the infusion fluid ,
atypical lymphoid cells with large and irregular nuclei and prominent nucleoli were detected by cytological analysis ( figure 4a and b ) .
immunohistochemistry showed that the cells were positive for b - lymphocyte surface antigen ( cd20 ) and negative for t - lymphocyte surface antigen ( cd3 ) ( figure 4c and d ) .
the il-10/il-6 ratio of the undiluted vitreous was greater than 1.0 ( il-10 = 48 pg / ml ; il-6 = 9.0 pg / ml ) .
he was diagnosed with metastatic intraocular lymphoma in the right eye and received irradiation therapy . at 1 year after the surgery
a 66-year - old woman was referred to our hospital complaining of floaters in both eyes in february 2010 . at the initial examination ,
her best - corrected visual acuity ( bcva ) was 20/25 in both eyes , and diffuse vitreous opacifications with aggregation of large cells were present in both eyes ( figure 1a and b ) .
although she was treated with corticosteroid therapy for 3 months , her va had decreased to 20/50 in both eyes with increased vitreous opacification .
the core vitreous was cut with a vitreous cutter , and about 1 ml of undiluted vitreous was collected by simultaneous manual aspiration . after the infusion line was opened , a full ppv was done , and the cortical vitreous was removed as much as possible .
, tokyo , japan ) used during full ppv was obtained from the machine cassette ( fortas cv-30000 ; nidek co , ltd , aichi , japan ) after the surgery ( about 300 ml ) , and immediately submitted for cytological analysis with use of cytospin .
atypical lymphocytes with anisonucleosis , aberrant chromatin , and dyskaryosis were detected by cytological analysis ( figure 1c ) .
the lymphoma cells were positive for leukocyte common antigen ( lca : figure 1d ) .
the ratio of interleukin ( il)-10 to il-6 ( il-10/il-6 ratio ) of the undiluted vitreous was greater than 1.0 ( il-10 = 7650 pg / ml : il-6 = 139 pg / ml ) .
she was diagnosed with primary intraocular lymphoma in both eyes and received intravitreal and intraspinal methotrexate therapy . at 3 years after the surgery
a 62-year - old man was referred to our hospital with reduced vision in february 2012 .
he was diagnosed with central retinal vein occlusion of the left eye ( figure 2a and b ) , and diabetic retinopathy in both eyes , and diffuse large b - cell lymphoma of the paranasal sinuses ( figures 2c and 3 ) in november 2008 .
he received chemotherapy at the department of internal medicine of our hospital , which led to a remission of the lymphoma . at our initial examination ,
the anterior chamber was not inflamed , but diffuse vitreous opacification with aggregation of large cells was observed in right eye , and dot hemorrhages were observed in both eyes .
the lymphoma in his right eye was suspected to be a metastasis because of the history of paranasal lymphoma and the ocular findings .
vitreous samples and infusion fluid were collected as in case 1 . from the infusion fluid ,
atypical lymphoid cells with large and irregular nuclei and prominent nucleoli were detected by cytological analysis ( figure 4a and b ) .
immunohistochemistry showed that the cells were positive for b - lymphocyte surface antigen ( cd20 ) and negative for t - lymphocyte surface antigen ( cd3 ) ( figure 4c and d ) .
the il-10/il-6 ratio of the undiluted vitreous was greater than 1.0 ( il-10 = 48 pg / ml ; il-6 = 9.0 pg / ml ) .
he was diagnosed with metastatic intraocular lymphoma in the right eye and received irradiation therapy . at 1 year after the surgery
we report two cases in which an intraocular lymphoma was diagnosed from cytokine and cytological analyses of vitreous and infusion fluid collected during ppv .
the undiluted vitreous was used for cytokine analysis , and the infusion fluid for cytological analysis .
generally , the undiluted vitreous obtained from core ppv or vitreous biopsy is submitted for cytological analysis in cases suspected of having an intraocular lymphoma . submitting infusion fluid
mudhar et al reported that the lymphoma cells were concentrated more in the cortical vitreous than core vitreous.10 additionally , conlon et al reported that vitrectomy did not cause any more cellular degradation than simple aspiration.11 in our cases , we were able to obtain a sufficient volume of lymphoma cells from the infusion fluid .
the second advantage is that undiluted vitreous can be submitted for other examination , such as cytokine analysis , igh gene arrangements , and flow cytometry .
several studies have reported that cytokine analysis of vitreous had the highest detection rate for intraocular lymphomas.3,5 however , the amount of undiluted vitreous obtained from ppv or vitreous biopsy is usually too small to be submitted for several types of analyses . therefore , undiluted vitreous can be submitted for cytokine analysis , if the infusion fluid is submitted for cytological analysis.12 the third advantage is that the cell collection rate can be increased by cytospin of the infusion fluid , and the collected cells can be used for the cytological analysis .
undiluted vitreous is not as effective for collecting cells by cytospin because of its high viscosity .
in contrast , the infusion fluid is not as viscous and does contain diluted cortical vitreous , which allowed us to collect more cells .
finally , infusion fluid contains cellular protectants such as oxidized glutathione and glucose.13 the lymphoma cells are fragile because of mechanical trauma associated with ppv and cellular necrosis induced by steroid therapy .
lymphoma cells are known to infiltrate the vitreous , subretinal pigment epithelium , retina , choroid , iris , and optic nerve.3,5,8 in some cases of intraocular lymphomas , tumor masses in the subretinal pigment epithelium position can only be observed without vitreous infiltration . in those cases , only analysis of vitreous and infusion fluid may be difficult to detect lymphoma cells without chorioretinal biopsy.5 in conclusion , we found that undiluted vitreous and infusion fluid collected during full ppv could be used for cytokine and cytological analyses for diagnosing intraocular lymphomas .
Output:
| purposeintraocular lymphomas are rare , and they have poor prognosis . thus , early diagnosis and treatment are needed .
a definitive diagnosis of a lymphoma is based on cytological analysis of the intraocular fluids or tissues .
we report two cases of intraocular lymphoma diagnosed by the analyses of vitreous and infusion fluid.patientscase 1 was a 66-year - old woman who complained of eye floaters and was found to have diffuse vitreous opacification bilaterally .
she received corticosteroid therapy , however the vitreous opacification was not resolved , and her visual acuity ( va ) remained reduced .
she underwent pars plana vitrectomy ( ppv ) , and vitreous and infusion fluid were collected to determine the cause of the reduced va .
the undiluted vitreous obtained from core ppv was submitted for cytokine analysis , and infusion fluid was obtained from the machine cassette after full ppv and used for cytological analysis .
case 2 was a 62-year - old man referred with low vision and was found to have diffuse vitreous opacification in the right eye and dot hemorrhages in both eyes .
four years earlier , he had been diagnosed with diffuse large b - cell lymphoma of the paranasal sinuses and was in remission after chemotherapy .
because metastasis of the lymphoma was suspected , he underwent ppv , and intraocular samples were collected as in case 1.resultsatypical lymphoid cells were detected from the infusion fluid in both cases .
the ratio of interleukin ( il)-10 to il-6 was greater than 1.0 in both cases .
these results allowed us to make a diagnosis of intraocular lymphoma : primary intraocular lymphoma in case 1 and metastatic intraocular lymphoma in case 2.conclusionvitreous and infusion fluid collected during ppv can be used for diagnosing an intraocular lymphoma . |
PubmedSumm7873 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the repercussions of stroke can be devastating , given that it can suddenly and permanently impair some of the most basic functions we all take for granted , including our mobility , speech , and effective swallowing . a national campaign by the stroke association , termed
, has recently promoted the swift presentation to healthcare services for any patient suspected of having acute stroke , with assessment for possible early thrombolysis .
gold standard care in hospital involves admission to a designated stroke unit . here , a battery of investigations are performed to maximise secondary prevention , and a multidisciplinary team is able to coordinate timely rehabilitation and attention to ongoing medical , nutritional , and psychological needs . amongst the risks of developing anxiety states and disorders of ( usually low ) mood
, there exists a frequently occurring symptom of poststroke fatigue ( psf ) which can blight stroke patients ' recovery long after their physical disabilities have resolved . within the nervous system ,
the latter , for instance , is seen in neuromuscular junction disorders , such as myasthenia gravis , and does have definable parameters as a clinical sign these being diminished postexertional muscle power on the medical research council ( mrc ) scale and a 10% decrement of motor end - plate potentials on electromyography recordings .
however , central fatigue is not so easily defined and symptomatically lies on a continuous spectrum encompassing a whole host of fluid terms including vitality , motivation , and mood .
it has been described in multiple sclerosis patients as a subjective lack of physical and/or mental energy that is perceived by the individual or caregiver to interfere with usual or desired activities and is thus , by virtue of its own broad definition , a rather idiosyncratic experience open to personal interpretation .
this is reflected by the large number of assessment scales or scoring systems for fatigue to be found throughout the literature . to name a few ,
there are linear analogue scales ( visual analogue scale , vas [ 58 ] ) and questionnaire - based systems ( vitality domain in the short - form 36 , vit sf-36 [ 9 , 10 ] ; fatigue assessment scale , fas ; checklist individual strength , cis ; fatigue severity scale , fss [ 8 , 1316 ] ; modified fatigue impact scale , mfis ) which do make it impossible to standardise the data on fatigue . nevertheless , despite psf research being comparative in its infancy ,
some important studies have been conducted to help characterise the mechanisms of onset and provide some understanding of methods to diminish or , at least , control the symptoms for patients .
the symptom of fatigue following a stroke is commonly found and has been described as one of the most difficult to cope with .
the negative impact of psf can be felt irrespective of whether the patient is at the younger or older end of the spectrum as it hampers their attempts to return to normality and regain independence .
it is tricky to state a precise prevalence given that multiple studies have assessed patients at very wide - ranging times since their stroke onset , and each with different measurements of fatigue .
however , at least 30% of patients , if not double that , will experience it sometime in their recovery .
it can be present within weeks and persist for many months [ 14 , 21 ] or even years [ 6 , 10 , 13 , 22 ] afterwards .
lerdal and colleagues showed that within two weeks of stroke , 24% of patients had severe fatigue on the fss , 33% moderate , and 43% mild or none .
they reported that greater fatigue was related to a poorer physical function and symptoms of depression , with a similar correlation being reported at one year after stroke supported by appelros .
however , as time progresses , the association with the level of disability becomes disputed [ 12 , 13 ] . in addition , patients who suffered with premorbid fatigue had an increased chance of psf ; the risk elsewhere was quoted at over 60% .
the association of psf to the size of the infarct has not been shown , but the site of the lesion may be relevant . it has been suggested that lacunar infarcts located within the basal ganglia , internal capsule , and infratentorial areas have been linked to an increased occurrence of psf , although there is no systematic review available as yet on this .
interestingly , reduced thickness of the posterior parietal cortex in patients with multiple sclerosis has been associated with fatigue scores but , specifically , white matter lesions were not .
mead and coworkers , following people up for 64 months , did not find an association between psf and stroke location but instead found increased psf associated with female gender and older age .
harbison et al . were unable to demonstrate any such age or gender association , whereas snaphaan and colleagues found that older age may even be protective against fatigue following stroke .
there are clearly a lot of conflicting findings in the literature as regards risk factors for psf .
one rather less controversial association with psf is low mood [ 10 , 1214 , 2123 ] .
snaphaan and co - workers used the cis to show that fatigue at both two months and 18 months after stroke was present in roughly one - third of patients ( frequently the same people ) and had a statistically significant association with scores on the hospital anxiety depression scale .
interestingly , there was no residual physical impairment on indices of functional status leading the authors to surmise that the psf may be more psychological than physical .
similarly , park et al . found that at thirty - two months after stroke there was a positive correlation between the 30% of subjects who were fatigued on the fss and the 55% with symptoms of depression on a self - report questionnaire , but again there was no convincing relationship to functional impairment .
it is recognised that aspects of fatigue and depression can be difficult to tease apart as mood assessment scales often include questions on energy levels and fatigue , and vice versa .
tang et al . accordingly reported increased geriatric depression scale scores in fatigued patients ( also assessed by the fss ) , despite the fact that patients fulfilling the official dsm - iv diagnosis of depression were excluded from their cohort .
showed a strong relationship between constant tiredness and always being depressed , and it is difficult to know whether there is some causality .
nevertheless , when patients who often and always felt depressed were removed from analysis , psf was still a predictor for worse outcome , including more dependence in activities of daily living and poorer general health .
it was also a predictor for death , again independently of depression . with the potential for psf to have implications for mortality as well as morbidity ,
it is vital for us to further understand the possible mechanisms of fatigue so that effective management strategies can be devised .
fatigue does not only have a physical basis , but also comprises mental and psychological aspects which can all coexist in the same patient .
it may be that merely utilising executive thinking to plan certain activities gives rise to a feeling of fatigue and rapid exhaustion .
although it is clear low mood and , indeed , the degree of functional recovery do not necessarily account for a sizable proportion of psf , treating depressive symptoms may make a valuable difference to the emotional state and motivation of the patient . in a study where all the patients had psf on two assessment scales , the selective serotonin reuptake inhibitor antidepressant fluoxetine failed to make any change to the fatigue scores after three months ' therapy , yet dutifully improved poststroke depression and emotional disturbance .
acute or chronic infections , long - term autoimmune conditions such as rheumatoid arthritis or systemic lupus erythematosus , as well as malignant entities , particularly following oncological treatments , are commonly associated with fatigue .
even multiple sclerosis , which selectively affects the central nervous system ( cns ) , is notorious for its association with fatigue .
inflammation precipitates secretion of various cytokines necessary for immune signalling including interleukin-6 ( il-6 ) , interleukin-1 beta ( il-1 ) , and tumour necrosis factor alpha ( tnf ) all of which have sites of action within the central nervous system .
they are thought to induce the so - called sickness behaviour of decreased mood , lowered libido , poor appetite , sleep disturbances , psychomotor slowing , and , importantly , fatigue [ 25 , 26 ] .
these attributes are considered evolutionarily advantageous for overcoming injury and illness and , ordinarily , would resolve once the insult has passed
. however , in situations where there is ongoing activation the effects are accordingly continued .
studies on cancer patients who have chronic exposure to tnf over time show that two syndromes of sickness behaviour emerge : an early onset but persistent neurovegetative state encompassing fatigue , sleep problems , and psychomotor slowing followed later by an additional mood and cognitive state in which there are depression , anxiety , and impairment of memory and attention [ 25 , 27 , 28 ] .
the latter syndrome tends to be the one which responds to antidepressants whereas the former does not and might explain why fluoxetine did not affect chronic psf but did improve mood .
acute stroke similarly causes secretion of cytokines , chemokines , and proteases from activated microglia at the infarct epicentre accompanied by release of cytotoxic - free radicals .
there is also early upregulation of toll - like receptors ( tlrs ) in neurons , which may be involved in proapoptotic pathways , as well as in neighbouring microglia and astrocytes .
cascades downstream of these receptors enable the propagation of inflammation with production of further cytokines , and it may be that a greater response is mounted in older patients for whom the majority of strokes will befall .
the components of sickness behaviour , including fatigue , are then believed to be mediated through neural , immune , and endocrine mechanisms .
dopaminergic and serotonergic neurotransmitter systems are thought to be affected , with increased expression of their uptake transporters , interference with their synthesis , and possibly altered numbers of receptors . based on data collected in studies of exercise - induced fatigue
, it has been proposed that it is the relative predominance of serotonin compared to dopamine which precipitates fatigue [ 32 , 33 ] , and that exercise training increases plasticity of dopaminergic circuitry leading to a more delayed onset over time .
cytokines may also promote excitotoxic processes involving glutamatergic neurotransmission causing cell death , blood brain barrier breakdown , and impaired homeostasis of astrocyte and neuron metabolism [ 25 , 34 ] .
production of neurotrophins , such as brain - derived neurotrophic factor ( bdnf ) which is important for synaptic plasticity and neuron survival both in times of health and following nervous system injury , may be reduced .
a lack of bdnf may underlie the disorders of psychomotor slowing and memory disturbance particularly given that hippocampal functions rely heavily on its availability .
moreover , dopamine - secreting neurons involved in movement generation also widely express bdnf and its receptor , trkb .
both of these are upregulated within the cns by voluntary exercise and may underlie the postponement of fatigue onset as mentioned above .
the hypothalamic - pituitary - adrenal ( hpa ) axis and the autonomic nervous system , which enable communication between the cns and endocrine systems , oversee glucocorticoid and catecholamine production , respectively , in times of stress , and their activity can be modulated by cytokines as interleukin receptors can be found throughout the hpa axis and afferent vagal ganglia [ 25 , 26 ] .
short - term hyperactivity of the hpa may be achieved in the acute phase , but after prolonged stimulation , there is a blunting of the normal diurnal cortisol secretion curve with reduced glucocorticoid production and onset of fatigue and depressive symptoms [ 25 , 26 ] .
hypoactivity of the hpa axis owing to decreased corticotrophin releasing hormone has been accordingly found in patients with the chronic fatigue syndrome ( cfs ) as well as in chronic autoimmune conditions .
cortisol normally has a negative feedback role on the sympathetic nervous system and on inflammation , promoting humeral immune responses in preference to cytokine production [ 25 , 26 ] .
disordered sympathetic control , therefore , results and may underpin the observations by harbison and colleagues that systemic hypertension above 145/90 mmhg and diastolic dips below 50 mmhg on ambulatory blood pressure monitoring in chronic stroke patients is associated with psf .
il-6 is associated with higher scores of fatigue and , when measured peripherally during the first week after stroke , its peak level correlates positively with infarct volume , white blood cell count , and the acute phase response c - reactive protein ( crp ) and negatively with functional outcome and mortality at 1 year .
elevated crp has itself been associated with higher levels of psf , particularly when patients with depression were removed from the analysis , although statistical significance was not achieved .
it is additionally raised in patients suffering with evident and subclinical cfs , although it is acknowledged that crp may not be the best surrogate biomarker of cns inflammation as it is not specific to the condition .
nevertheless , inflammatory signalling is highly likely to play a central part in generating psf along with other forms of fatigue , given that il-6 is raised in cancer and cfs patients too .
disorders of sleep have been mentioned as part of sickness behaviour [ 25 , 26 ] and are commonly seen after stroke .
they have also been linked to psf [ 9 , 13 , 21 ] which may be improved when sleep issues are corrected . park and
co - workers found that patients ' fss score correlated significantly with subjective sleeping problems like insomnia or frequent waking . a year or more after suffering a stroke causing only upper limb deficits ,
half of patients said they were more sleepy than normal during daylight hours and slept for longer periods at night , although the latter tended to be less of an issue as time from stroke increased .
. it would be important to rule out an obstructive sleep apnoea , the aetiology of which may be entirely unrelated to stroke , but universal use of continuous airway pressure certainly does not resolve psf when it is absent .
in fact poststroke sleep disorders and psf may have their origins not only in cytokine signalling but perhaps also in the disruption of certain neural networks as a direct consequence of the infarct .
staub and bogousslavsky have proposed that the ascending reticular activating system concerned with maintaining tonic attention may become damaged by brain stem and subcortical lesions leading to psf which was inferred in the study by tang and co - workers mentioned earlier .
nevertheless , some of the putative mechanisms of psf discussed provide a basis for the investigation of effective interventions in stroke patients .
a systematic review in 2008 concluded that insufficient evidence existed to recommend any single treatment for psf and , to date , there continue to be no published guidelines .
however , management guidelines for cfs have been available from the national institute for health and clinical excellence for several years and may well be applicable to psf sufferers . whereas the diagnosis for cfs relies on there
being new onset fatigue for at least four months with no identifiable cause , we have discussed the overlap of symptoms between the two conditions , as well as the possible mutual roles of cytokine and inflammatory signalling in their generation .
the cfs guideline emphasises the need for patients to recognise their limitations and set realistic goals for improvement , with assistance from graded exercise for aerobic training and cognitive behavioural therapy ( cbt ) .
indeed , several studies have shown a relationship between poor physical stamina and psf [ 6 , 7 , 46 ] , and aerobic fitness , as measured by peak oxygen consumption ( vo2 ) , is often reduced in stroke survivors .
lewis and colleagues reported that extensor power of the unaffected lower limb in fully ambulatory chronic stroke patients was inversely proportional to their level of psf although , in this instance , vo2 was not found to correlate with psf .
tseng and kluding , conversely , did find a negative correlation between psf and vo2 and that motor control particularly was an independent predictor of psf .
( cognitive and graded activity training ) , which combines education , cbt , and increasing exercise programmes , has demonstrated a significant reduction of fatigue scores for patients with severe psf .
the authors recognise that a certain level of cognitive capability and physical aptitude is necessary to participate in cograt but that it fosters a more effective coping strategy with which patients can manage their fatigue .
nevertheless , it is clear that maximising cardiovascular fitness appropriately is to be encouraged , in addition to identifying other modifiable factors such as depression , sleep apnoea , concurrent infective illness , or biochemical abnormality which could be exacerbating psf .
the contribution of pharmacotherapy for psf is largely unexplored and , as such , none are licensed for use in these circumstances .
one of the few drugs to be included in a randomised controlled trial for psf has been the selective serotonin reuptake inhibitor fluoxetine but , as outlined above , it improved depressive symptoms but not fatigue scores .
indeed , with a high serotonin to dopamine ratio being implicated in central fatigue , enhancement of dopaminergic neurotransmission and bdnf availability might be more appropriate targets .
the free concentration of the amino acid precursor to serotonin , tryptophan , is believed to be increased in the blood during exercise and may contribute to central serotonin predominance and development of fatigue .
data in healthy subjects suggests that administering more branched - chain amino acids during exercise , and thus more competition for tryptophan uptake , can prolong fatigue onset .
interference with other neurotransmitters , such as gaba with use of the gabab receptor agonist baclofen , seems to have a similar effect on fatigue onset and may thus help symptoms of psf .
the cns stimulant modafinil , which is currently approved in narcolepsy and sleep apnoea , has also been piloted in a small number of psf and fatigued multiple sclerosis patients but only seemed to benefit the latter and those with lacunar infarcts of the brainstem or thalamus . moreover ,
a broad scope for further work trialling these and other drugs specifically for psf is , therefore , promising . perhaps the most intriguing possibility for treating psf is agents which can attenuate ischaemic neuro - inflammation and the development of the sickness behaviour syndromes .
il-1ra is a competitive antagonist of the il-1 receptor which is synthesised endogenously and blocks il-1 signalling .
administered peripherally in rodent models of middle cerebral artery ischaemia , il-1ra traverses the blood - brain barrier to protect neurons from excitotoxic cell death and reduced inflammatory damage from microglial activation .
emsley and co - workers have shown that a 72-hour infusion of recombinant human ( rh)il-1ra is safe for use in patients and , when commenced within six hours of acute stroke , leads to reduced levels of il-6 , crp , and white blood cell count in the days afterwards along with lower disability scores compared to placebo at three months .
although rh1l-1ra was associated with a slight increase in bacterial infections , none of these were serious .
no mention was made of fatigue levels in these patients but the study was powered really only for profiling safety . a suitably powered phase
activated protein c ( apc ) is another potentially emerging treatment for victims of stroke by virtue of its neuroprotective , anticoagulant , and anti - inflammatory properties and has the inherent ability to cross the bbb .
its effects of particular significance are that it reduces microglial activation and suppresses the production of nuclear factor kappa b ( nf-b ) on which the subsequent expression of 1l-1 , 1l-6 , and tnf relies .
if psf is indeed mediated by inflammatory signalling , apc would hold great potential for fatigue prevention as well as minimising functional deficits after stroke .
versions of recombinant apc can be synthesised which possess diminished anticoagulant properties whilst retaining their neuroprotective and anti - inflammatory ones .
fatigue after stroke is a common phenomenon which may have a pathological basis resulting from the infarct , but not dependent on its size or degree of functional loss .
it is associated the least controversially with low mood and sleep disturbances , but can arise in their absence .
it is also associated with poorer long - term outcome and it is , therefore , essential for physicians in both primary and secondary care to be able to recognise psf . there is convincing evidence that inflammatory cascades and cytokine signalling affect the neural , immune , and endocrine systems thereby precipitating fatigue symptoms , and these pathways may , therefore , provide multiple targets for interventions aimed at reducing psf .
Output:
| symptoms of fatigue are often reported by patients in both the acute and chronic stages of recovery following a stroke .
it is commonly associated with low mood and sleep disturbances , but can arise in their absence .
however , it has also been associated with poorer long - term outcome and , as such , its aetiology warrants a greater understanding .
there is convincing evidence that inflammatory cascades and cytokine signalling precipitated by the infarct promote fatigue , and these pathways may harbour therapeutic targets in its management . |
PubmedSumm7874 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: gastrointestinal endoscopy has become a routine medical procedure for diagnostic and therapeutic purposes in many diseases . as the number of cases needing an endoscopic procedure has increased ,
the incidence of various complications have also increased , making their proper management more important [ 1 - 4 ] .
air embolism is a very rare endoscopic complication that manifests with cardiopulmonary instability and neurologic symptoms .
however , because of similar symptoms , it is difficult to distinguish cerebral infarction from sedative - related complications and , owing to its rarity and the unexplained mechanism involved , physicians rarely suspect brain damage induced by air embolism .
we here report our experiences with two adult cases of cerebral air embolism after endoscopic procedures esophageal balloon dilatation and endoscopic papillary balloon dilatation ( epbd)and their clinical outcomes .
he had undergone a total gastrectomy with d2 dissection 2 years previously for gastric cancer , and the pathologic stage was t3n0m0 .
two months after the operation , bone metastasis was found and chemotherapy was applied with s-1 ( an oral fluorouracil chemotherapeutic agent ) . on admission , he had an eastern cooperative oncology group performance status of 3 and was restricted to a liquid diet .
this procedure was performed under sedation with intravenous midazolam ( 2 mg ) and with constant vital sign monitoring .
his vital signs were stable during the procedure , and through - the - scope ballooning was performed with a cover - edge wire - guided balloon dilatation catheter ( boston scientific , cork , ireland ) under the following conditions : to 8 mm for 30 seconds with 3 atmospheric pressure , 9 mm for 60 seconds with 4 atmospheric pressure , and 10 mm for 60 seconds with 9 atmospheric pressure ( fig .
after the procedure was completed , he became unresponsive ( glasgow coma scale , 3/15 ) , hypotensive ( systolic blood pressure / diastolic blood pressure , 66/41 mm hg ) , and hypopneic ( respiratory rate , 10 breaths per minute ) .
his vital signs stabilized after o2 was supplied through a venture mask ( fio2 50% ) , and after fluid resuscitation and flumazenil injection .
however , his altered mental status was not reversed after flumazenil injection . to determine the cause of the mental change , magnetic resonance imaging ( mri ) and brain computed tomography ( ct )
the therapy was instituted at 3 atmospheric pressure for 2 hours 45 minutes , and gradual decompressed was performed for 1 hour 5 minutes .
after hyperbaric therapy , the embolism had nearly disappeared in the follow - up mri and the vital signs had stabilized .
extubation was performed 4 days after the event , and left - sided weakness remained .
twelve months after the event , he still undergoes rehabilitation treatment for left - sided hemiparesis ; however , he can ambulate with minimal assistance .
a 69-year - old man was admitted to our hospital with persistent right upper quadrant pain since 2 weeks .
abdominal ct showed distal common bile duct stones , and he underwent therapeutic endoscopic retrograde cholangiopancreatography ( ercp ) under sedation with intravenous midazolam ( 2 mg ) .
multiple filling defects were found , and epbd was performed to avoid bleeding due to pericholedochal varices .
multiple stones were removed with a hurricane balloon dilatation catheter ( boston scientific ) ( fig .
1c , d ) , and a fully covered metal stent was inserted to compress the varices .
after ercp , he became unresponsive ( glasgow coma scale , 3/15 ) and hypoxic ( spo2 , 80% ) .
he subsequently became hypotensive and bradycardic , and finally progressed into pulseless electrical cardiac arrest .
brain mri and brain ct showed multiple cerebral infarctions ( right middle , left anterior , and left posterior cerebral artery territories ) ; however , the images could not distinguish air embolism from other causes .
high fio2 therapy was provided , and low - molecular - weight heparin was used because other infarction causes could not be ruled out . after 4 days , the patient s mental status was restored and he was extubated .
he underwent rehabilitation treatment for left - sided weakness , and the neurologic deficit improved considerably .
recently , at 2 months after the event , he is able to perform normal activities of daily living .
he had undergone a total gastrectomy with d2 dissection 2 years previously for gastric cancer , and the pathologic stage was t3n0m0 .
two months after the operation , bone metastasis was found and chemotherapy was applied with s-1 ( an oral fluorouracil chemotherapeutic agent ) . on admission , he had an eastern cooperative oncology group performance status of 3 and was restricted to a liquid diet .
this procedure was performed under sedation with intravenous midazolam ( 2 mg ) and with constant vital sign monitoring .
his vital signs were stable during the procedure , and through - the - scope ballooning was performed with a cover - edge wire - guided balloon dilatation catheter ( boston scientific , cork , ireland ) under the following conditions : to 8 mm for 30 seconds with 3 atmospheric pressure , 9 mm for 60 seconds with 4 atmospheric pressure , and 10 mm for 60 seconds with 9 atmospheric pressure ( fig .
after the procedure was completed , he became unresponsive ( glasgow coma scale , 3/15 ) , hypotensive ( systolic blood pressure / diastolic blood pressure , 66/41 mm hg ) , and hypopneic ( respiratory rate , 10 breaths per minute ) .
his vital signs stabilized after o2 was supplied through a venture mask ( fio2 50% ) , and after fluid resuscitation and flumazenil injection .
however , his altered mental status was not reversed after flumazenil injection . to determine the cause of the mental change , magnetic resonance imaging ( mri ) and brain computed tomography ( ct )
the therapy was instituted at 3 atmospheric pressure for 2 hours 45 minutes , and gradual decompressed was performed for 1 hour 5 minutes .
after hyperbaric therapy , the embolism had nearly disappeared in the follow - up mri and the vital signs had stabilized .
extubation was performed 4 days after the event , and left - sided weakness remained .
twelve months after the event , he still undergoes rehabilitation treatment for left - sided hemiparesis ; however , he can ambulate with minimal assistance .
a 69-year - old man was admitted to our hospital with persistent right upper quadrant pain since 2 weeks .
abdominal ct showed distal common bile duct stones , and he underwent therapeutic endoscopic retrograde cholangiopancreatography ( ercp ) under sedation with intravenous midazolam ( 2 mg ) .
multiple filling defects were found , and epbd was performed to avoid bleeding due to pericholedochal varices .
multiple stones were removed with a hurricane balloon dilatation catheter ( boston scientific ) ( fig .
1c , d ) , and a fully covered metal stent was inserted to compress the varices .
after ercp , he became unresponsive ( glasgow coma scale , 3/15 ) and hypoxic ( spo2 , 80% ) .
he subsequently became hypotensive and bradycardic , and finally progressed into pulseless electrical cardiac arrest .
brain mri and brain ct showed multiple cerebral infarctions ( right middle , left anterior , and left posterior cerebral artery territories ) ; however , the images could not distinguish air embolism from other causes .
. high fio2 therapy was provided , and low - molecular - weight heparin was used because other infarction causes could not be ruled out . after 4 days , the patient s mental status was restored and he was extubated .
he underwent rehabilitation treatment for left - sided weakness , and the neurologic deficit improved considerably .
recently , at 2 months after the event , he is able to perform normal activities of daily living .
we here present two cases of cerebral air embolism as a rare complication of therapeutic endoscopy .
however , the first patient now has a persistent left - sided hemiparesis . in our experience , early suspicion and proper management of air embolism
can improve clinical outcomes , although cerebral infarction due to air embolism is an extremely rare and unexpected complication that can not be completely explained and typically has a poor prognosis .
, the volume of air and rate of accumulation is important in determining the morbidity and mortality after a vascular air embolism develops . a large volume ( ~5 ml / kg ) or rapid entry of gas migrating to the pulmonary circulation places strain on the right ventricle .
this situation results in diminished cardiac output that leads to cardiovascular collapse and cerebral hypoperfusion .
venous gas embolism may migrate to the systemic circulation through a shunt such as a patent foramen ovale .
however , it has been reported that a large volume of venous gas can enter the arterial circulation through transpulmonary passage of air , without cardiac defects or shunt .
the air of the venous circulation enters the arterial systemic circulation and obstructs the end artery , which is a paradoxical embolism .
this mechanism can explain the presentation of our two current patients : the air around the balloon entered through the anastomosis site or biliary tract , and the venous embolism entered the arterial circulation through a transient patent foramen ovale or transpulmonary passage . to our knowledge , there have been 21 reported cases to date of cerebral embolism complications after an endoscopic procedure , including our current cases ( table 1 ) [ 7 - 24 ] .
the cerebral embolism occurred during or after ercp in 11 of these cases , and was found during or after another therapeutic esophagogastroduodenoscopy in the remaining 10 cases .
six of the 21 reported patients had undergone major surgery , such as billroth ii operation , total gastrectomy , or whipple s operation .
in addition , the presence of a shunt was evaluated in 17 of these patients , of whom seven did not have a shunt , such as a patent foramen ovale or arteriovenous malformation , including our two present patients .
there are no standard treatments for cerebral air embolisms that occur during or after an endoscopic procedure , and some previous reports have shown that early hyperbaric oxygen therapy has a beneficial effect .
hyperbaric oxygenation therapy may reduce air bubble size , accelerate nitrogen reabsorption , and increase the oxygen content of arterial blood , potentially reducing the ischemia .
however , the delay to treatment application has been reported to range from 3 to 48 hours . among the five previously reported patients who underwent hyperbaric oxygen therapy , two , including our first case herein , showed full or partial neurologic recovery .
the remaining 15 patients received high fio2 therapy or conservative management without hyperbaric oxygen therapy .
of these , six patients died and nine patients survived with or without a neurologic deficit . in conclusion , we here report two cases of cerebral air embolism as a rare complication of therapeutic endoscopy .
although it is difficult to make this diagnosis because it can be confused with a sedative - related problem , our patients underwent appropriate early management and achieved good outcomes .
physicians should therefore be aware of the risk of cerebral air embolism during or after endoscopic procedures in patients who show cardiopulmonary instability and neurologic symptoms .
Output:
| cerebral air embolism is an extremely rare complication of endoscopic procedure and often life threatening .
we present two cases of cerebral infarction due to air embolization caused by an endoscopic intervention .
the first case occurred during esophageal balloon dilatation for the treatment of a stricture of an anastomosis site in a 59-year - old man and the second case occurred during endoscopic papillary balloon dilatation in a 69-year - old man who had distal common bile duct stones .
after the procedure , cardiopulmonary instability and altered mental status were observed in both patients , and cerebral air embolism was diagnosed in both cases .
hyperbaric oxygen therapy was started in the first case , and high fio2 therapy was applied in the second case .
although this complication is rare , patient outcomes can be improved if physicians are aware of this potential complication , and immediately begin proper management . |
PubmedSumm7875 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 12-year - old , male neutered domestic shorthair cat was referred for investigation of suspected hyperaldosteronism due to persistent hypokalaemia , hindlimb ataxia , weakness of 1 month s duration and a left adrenal mass that was detected on abdominal ultrasound .
hyperaldosteronism and concurrent hyperprogesteronism were confirmed on endocrine testing . on computed tomography ( ct ) of the abdomen and thorax
there was no evidence of local vascular invasion by the adrenal mass or of metastatic disease .
ct and magnetic resonance imaging featured a large , focal rim - enhancing extra - axial left forebrain lesion consistent with a meningioma .
the tumours were classified on histopathology as a psammomatous meningioma and an adrenocortical adenocarcinoma , respectively .
in humans , elevated serum progesterone levels have been associated with rapid growth of meningiomas due to the presence of progesterone receptors on the tumour .
this is the first report of a cat with a progesterone and aldosterone - secreting adrenocortical adenocarcinoma and a concurrent meningioma .
clinicians should be aware of the potential effect of elevated progesterone on meningiomas in cats .
in humans , elevated serum progesterone levels have been associated with rapid growth of meningiomas due to the expression of progesterone receptors ( prs ) on tumour cells . here
we report a case of a meningioma in a cat with an adrenocortical carcinoma that was co - secreting aldosterone and progesterone .
a 12 year - old , male neutered , domestic shorthair cat was referred to the valentine charlton cat centre for investigation of persistent hypokalaemia ( 2.53.3 mmol / l ; reference interval [ ri ] 3.55.8 mmol / l ) , hypertension , hindlimb ataxia and weakness of approximately 1 month s duration . a palpable , left - sided
, cranial abdominal mass localised to the left adrenal gland was identified on abdominal ultrasound . on presentation at referral , the cat was agitated , vocalising and pacing compulsively in wide circles to the left .
the cat weighed 6.45 kg ( body condition score [ bcs ] 3/5 ) and had lost 500 g in body weight over the previous 2 months . on physical examination
a grade iii / vi left parasternal systolic heart murmur was auscultated and systolic arterial blood pressure was 220 mmhg ( doppler method ) .
a neurological examination revealed an absent right menace response and a proprioceptive deficit on the right forelimb .
on fundoscopy , there was evidence of hypertensive chorioretinopathy , including a focal , hyper - reflective bullous lesion in the left tapetal fundus and tortuous retinal vessels .
an aldosterone - secreting adrenal neoplasm was suspected , based on clinical history , hypokalaemia , systemic hypertension with evidence of end - organ damage and sonographic findings .
abnormalities on repeat haematology and serum biochemistry were confined to hypokalaemia ( 2.5 mmol / l ; ri 3.55.8
mmol / l ) , metabolic alkalosis ( bicarbonate 25 mmol / l ; ri 1721 mmol / l ) and mildly elevated creatinine kinase ( 460 u / l ; ri 64400 u / l ) .
serum total thyroxine was within normal limits ( 37 nmol / l ; ri 10 - 60
pmol / l ) , while plasma renin activity was low ( < 40 fmol / l / s ; ri 60630 fmol / l / s ) . an adrenocorticotropic hormone ( acth ) stimulation test
progesterone was increased at time zero ( 16.1 nmol / l ; ri 0.192.22 nmol / l ) and 1 h post - acth administration ( 23.2 nmol / l ; ri 2.8614.62 nmol / l ) .
based on these results , an aldosterone and progesterone - secreting adrenal neoplasm was diagnosed .
a repeat abdominal ultrasound confirmed the presence of a 3.1 cm diameter , circumscribed , hypoechoic mass involving the left adrenal gland , with no evidence of metastases or vascular or renal parenchymal invasion .
the right adrenal gland was of normal dimensions and appearance ( 3.9 mm diameter ) .
it was difficult to determine the clinical course of the neurological signs because profound weakness from hypokalaemia was also present . however , major differential diagnoses included metastasis from an adrenal carcinoma , a primary meningioma or a vascular accident secondary to hypertension .
the cat underwent computed tomography ( ct ) of the abdomen , thorax and skull under general anaesthesia ( figure 1 ) .
there was no evidence of vascular invasion of adjacent blood vessels by the adrenal mass .
on ct of the skull , an extra - axial , rim - enhancing , left forebrain lesion was evident after the administration of iohexol ( 2 ml / kg , omnipaque 350 ; ge healthcare ) .
meningioma was suspected and magnetic resonance imaging ( mri ) was performed to further characterise the lesion and to confirm that the tumour was solitary , prior to surgical excision ( figure 2 ) .
postcontrast ( a ) axial and ( b ) dorsal images acquired utilising 0.8 mm slice collimation computed tomography at the level of the cranial pole of the left kidney .
these images have been reconstructed using a maximum - intensity projection technique with osirix software ( v.6.1.1.64-bit ; pixmeo sarl ) .
there is a 2.4 cm ( width ) 3 cm ( height ) 3.2 cm contrast - enhancing left adrenal mass .
the mass is located immediately caudal to the renal artery and adjacent to the vena cava .
the right adrenal gland can not be visualised in these images t2-weighted ( a ) parasagittal , ( b ) dorsal and ( c ) axial , and t1-weighted precontrast ( d ) axial and ( e ) fluid attenuation inversion recovery ( flair ) axial 4 mm thickness magnetic resonance images .
there is a 2 cm 1.5 cm well - demarcated mass lesion with a broad base towards the periphery within the left parietal brain lobe ( thick arrow ) .
there is evidence of midline shift and impingement of the left lateral ventricle ( thin arrow ) .
the mass is isointense to grey matter in the t1-weighted sequences and hyperintense in t2-weighted and flair sequences .
the mass is consistent with a meningioma with evidence of increased intracranial pressure . on mri the forebrain mass ( 2 cm 1.5 cm )
was well demarcated and had a broad base towards the periphery associated with the left parietal lobe causing a midline shift and impingement of the left lateral ventricle .
the mass was isointense to grey matter in the t1-weighted sequence and hyperintense in t2-weighted and flair sequences .
there was transtentorial herniation of part of the mesencephalon into the caudal fossa and obliteration of the subarachnoid space between the cerebellum and medulla .
anaesthetic recovery was unremarkable and the cat was discharged on amlodipine besylate ( 1.25 mg q24h po , norvasc ; pfizer ) , spironolactone ( 6.25 mg q24h po , aldactone ; pfizer ) and potassium gluconate ( 156 mg q12h po , hypokal ; mavlab ) .
prednisolone ( 7.5 mg q12h po , pred - x 5 ; apex laboratories ) was given to treat suspected cerebral oedema .
twenty - four hours after discharge the cat re - presented with recurrent vocalisation , a left body turn , stilted hindlimb gait and hindlimb weakness .
serum acid base and electrolytes showed persistent hypokalaemia ( 2.9 mmol / l ) and metabolic alkalosis ( ph 7.482 [ ri : 7.317.46 ] ; bicarbonate 31.3 mmol / l [ ri 1721 mmol / l ] ) .
a potassium chloride infusion ( 0.5 mmol / kg / h iv ) was given , as well as mannitol ( 0.25 g / kg iv over 1 h ) for suspected increased intracranial pressure .
after stabilisation , the intracranial mass was removed 3 days later via a rostrotentorial craniotomy with no complications ( figure 3 ) . on histopathology
the mass was composed of spindle cells with ovoid plump nuclei , vesiculate chromatin and small multiple nucleoli .
immuno - histochemical staining of the meningioma using a mouse monoclonal antibody to human pr previously validated for use in the cat ( bio - genex insite pr antibody [ clone pr88 ] ; bio - genex ) was performed .
there was strong positive labelling of prs in the meningioma tissue ( figure 4 ) .
mammary adenocarcinoma tissue was utilised as a positive tissue control , and an affinity - purified normal mouse igg reagent control ( preimmune serum ) supplied by the manufacturer was used as the negative control .
( b ) cut surface of the resected adrenocortical adenocarcinoma photomicrograph of meningioma tissue ( a ) after immunohistochemical staining for progesterone receptors ( prs ) . note the positive labelling of most nuclei compared with the relative absence of labelling with the negative antibody control ( b ) .
( c ) prs are present within the positive antibody control ( mammary adenocarcinoma tissue ) .
immunohistochemistry was performed using a mouse monoclonal antibody to prs ( bio - genex insite pr antibody [ clone pr88 ] ; bio - genex ) and the peroxidise method with 3,3-diaminobenzidine chromagen and a light haematoxylin counterstain postoperative recovery from the craniotomy was uneventful and neurological status markedly improved over the next 2 weeks , except for persistent weakness .
mmol / l ) and hypertension persisted , while hypertension was controlled ( systolic blood pressure 150 mmhg ) .
histopathology of the adrenal tumour was consistent with a low - grade , encapsulated , adrenocortical carcinoma . at a recheck , 2 weeks after adrenalectomy , serum biochemistry was suggestive of mineralocorticoid deficiency ( mild hyperkalaemia [ 5.9 mmol / l ; ri 3.75.4
mmol / l ] and low na : k [ 24.7 ; ri > 29.0 ] ) .
fludrocortisone ( 0.15 mg daily divided dosage po , florinef ; aspen pharma ) was administered .
this medication was tapered and then ceased over a 3 week period . a week after stopping the fludrocortisone , serum potassium was normal and the cat continued to gain weight .
two years post - initial presentation the cat was clinically normal , normotensive and 1 kg heavier ( 7.5 kg , bcs 4/5 ) .
to our knowledge , this is the first report in a cat of an adrenal mass secreting aldosterone and progesterone with a concurrent meningioma .
the documentation of prs in a meningioma with concurrent elevation of serum progesterone is also novel .
clinical signs associated with hyperprogesteronism may be subtle , or as in this case , absent .
alternatively , hyperprogesteronism can resemble hypercortisolaemia with signs including polyuria , polydipsia , poor coat condition , seborrhoea , thin fragile skin and a pot - bellied appearance .
other co - hormone secretions reported in cats with adrenocortical tumours include androstenedione and testosterone in one case , and testosterone and oestradiol in another .
concurrent cortisol and sex steroid - secreting adrenal tumours have not been reported in cats .
we measured progesterone in this case because of our previous observation of hyperprogesteronism in a cat with concurrent hyperaldosteronism .
we can not rule out the possibility of cortisol or other adrenal steroid hormone secretion , as other adrenal hormones were not measured .
in other cases of feline adrenal progesterone / sex - steroid secreting tumours , low post - acth cortisol concentrations were reported .
potential mechanisms for this response include a lack of enzymes within the adrenal tumour to convert progesterone to cortisol , or hypothalamic pituitary adrenal axis suppression from excessive circulating levels of cortisol as a result of displacement from cortisol binding protein by progesterone . in humans , adrenal tumours
have been shown to co - secrete aldosterone with cortisol , testosterone , progesterone and androstenedione .
enhancement of the biosynthetic pathway of aldosterone in an aldosterone - secreting tumour , resulting in increased serum concentrations of the intermediates of aldosterone production , including progesterone , is proposed to account for some cases .
alternatively , neoplastic cells within the zona glomerulosa and fasciculata / reticularis may directly increase secretion of aldosterone and progesterone , respectively .
meningiomas are the most common primary intracranial tumour in cats , dogs and humans . in cats ,
meningiomas are derived from the arachnoid cap cells associated with the venous sinus of the dura . in cats , meningiomas are usually histologically benign , but their behaviour may be malignant .
rapid progression of neurological symptoms due to meningioma in human pregnancy was first reported by cushing and eisenhardt in 1938 , and the association between excessive progesterone secretion and the development , or accelerated growth , of meningiomas is now well established in human medicine , where hormone replacement therapy , contraceptive implants and breast carcinoma are also implicated .
the development of multiple meningiomas during prolonged progesterone agonist therapy that regressed with cessation of treatment is also compelling evidence of this association .
further , the incidence of meningiomas in women is twice as high as in men , especially during their reproductive life period .
there is also a known association between the development of meningioma and carcinoma of the breast .
sex hormone receptor expression in meningiomas from humans , cats and dogs has been reported . in humans ,
( er ) are expressed to a lesser extent . in vitro and in vivo studies
adamo et al reported that feline meningiomas , like human ones , have a high proportion of prs and an absence of ers . to our knowledge serum progesterone levels
pr expression is less likely in more aggressive and atypical meningioma cases in people and dogs . this association has not been definitively established in cats but appears likely .
assay of progesterone and other aldosterone intermediates in cats with aldosterone - producing tumours is recommended as co - hormone secretion may be under - reported . in a survey of laboratory submissions of feline sera for aldosterone assay ,
marked elevations in corticosterone and progesterone were detected in some cats with marked elevation of aldosterone ( > 3000 pmol / l ) .
elevated serum progesterone levels may contribute to muscle weakness and hypertension seen in these patients .
clinicians should maintain an index of suspicion for hyperprogesteronism in cats , particularly where progressive intracranial signs are detected .
Output:
| case summarya 12-year - old , male neutered domestic shorthair cat was referred for investigation of suspected hyperaldosteronism due to persistent hypokalaemia , hindlimb ataxia , weakness of 1 month s duration and a left adrenal mass that was detected on abdominal ultrasound .
neurological examination findings at referral were suggestive of a concurrent left forebrain lesion .
hyperaldosteronism and concurrent hyperprogesteronism were confirmed on endocrine testing . on computed tomography ( ct ) of the abdomen and thorax
there was no evidence of local vascular invasion by the adrenal mass or of metastatic disease .
ct and magnetic resonance imaging featured a large , focal rim - enhancing extra - axial left forebrain lesion consistent with a meningioma .
surgical excision of the forebrain mass was followed by adrenalectomy 2 weeks later .
the tumours were classified on histopathology as a psammomatous meningioma and an adrenocortical adenocarcinoma , respectively .
immunohistochemical staining of the meningioma confirmed the presence of progesterone receptors .
the cat remains well 2 years later.relevance and novel informationin humans , elevated serum progesterone levels have been associated with rapid growth of meningiomas due to the presence of progesterone receptors on the tumour .
this is the first report of a cat with a progesterone and aldosterone - secreting adrenocortical adenocarcinoma and a concurrent meningioma .
clinicians should be aware of the potential effect of elevated progesterone on meningiomas in cats . |
PubmedSumm7876 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: although traditionally preeclampsia has been viewed as a condition that resolves completely with the delivery of the placenta , there is now increasing evidence that preeclampsia may constitute a condition with significant long - term health implications for both the mother and child .
in particular preeclampsia has recently emerged as an independent risk factor for maternal cardiovascular disease 1015 years after the index pregnancy [ 13 ] .
a history of preeclampsia is therefore now considered a relevant factor in the cardiovascular risk assessment in women and is associated with an increase in risk similar in magnitude to a history of dyslipidemia .
meta - analysis has demonstrated that in the 1015 years following a preeclamptic pregnancy women have an increased risk of developing hypertension ( rr 3.7 95% c.i .
( 2.75.05 , p < 0.001 ) ) , coronary artery disease ( rr 2.16 95% c.i .
( 1.862.52 , p = 0.001 ) ) , and stroke ( rr 1.81 95% c.i .
( 1.452.27 , p = 0.00 ) . additionally , it has been demonstrated that there is a graded relationship between the risk of cardiac disease and the severity of preeclampsia with maternal risk being greatest with early onset or severe preeclampsia .
children born to preeclamptic women have also been demonstrated to have elevated blood pressure in childhood and adolescence [ 712 ] .
greater insight into these links may identify new opportunities to understand disease predisposition and treatment and may also raise the possibility that prevention of vascular dysfunction should be an important long - term goal of preeclampsia management .
this paper will consider the current literature considering the links between cardiovascular disease and preeclampsia and the implication of these findings for refining the management of patients whose care is complicated by preeclampsia .
the aetiology of preeclampsia remains incompletely understood , though disturbed placentation and placental functioning in early pregnancy remains the leading hypothesis . during normal placental development ,
fetal cytotrophoblasts invade the maternal spiral arteries transforming them to high - caliber capacitance vessels providing low resistance placental perfusion adequate to sustain fetal growth .
however , inadequate spiral artery remodeling in preeclampsia is thought to lead to chronic placental ischaemia or intermittent flow through the narrow muscular arteries thereby creating an ischaemia - reperfusion phenomenon .
reactive oxygen species and cytokines released from the ischaemic placenta trigger a systemic oxidative stress and contribute to the exaggerated systemic inflammatory reaction in preeclampsia [ 33 , 35 ] .
syncytiotrophoblasts undergoing apoptosis also shed increased numbers of microparticles in the maternal circulation which contribute to this process .
the release of cytokines and acute phase proteins , such as tnf , leptin , and pai-1 , not only enhance the inflammatory response but also induce some of the observed metabolic disturbances in preeclampsia including insulin resistance , lipolysis , and hyperlipidaemia [ 33 , 34 ] .
furthermore , hypoxic oxidative stress and inflammatory stimuli provoke the release of antiangiogenic factors ( via nf-b pathways ) [ 33 , 3638 ] .
soluble fms - like tyrosine kinase-1 ( sflt-1 ) , a circulating truncated form of vegf receptor , binds and reduces levels of vegf and plgf in the maternal circulation thereby inhibiting angiogenesis and vasodilatation .
this aberrant vasculature is thought to lead to a cascade of events which end in symptomatic systemic endothelial dysfunction .
soluble endoglin , a tgf- coreceptor , is one of the antiangiogenic factors that enhances vascular permeability and may possibly affect nitric oxide synthesis and vasodilatation via altered downstream signalling in the tgf- pathway contributing to the endothelial dysfunction ( figure 1 ) .
consistent with these biological changes , reduced endothelial - dependent vasodilatation in conduit and resistance arteries [ 21 , 4147 ] has been demonstrated in women who have preeclampsia .
they also appear to have increased arterial stiffness , increased atherosclerosis , and diminished capillary density .
biochemical markers of endothelial activation and dysfunction are also elevated in preeclampsia [ 34 , 50 ] .
maternal endothelial dysfunction is also present in conduit vessels before the onset of clinical disease and up to three years after an affected pregnancy [ 24 , 51 , 52 ] .
the increase in cardiovascular risk following preeclampsia may be a consequence of the pro - atherogenic impact of persistent endothelial dysfunction , a result of subclinical endothelial injury at the time of pregnancy , or to preexisting differences in endothelial function that predispose to both conditions ( figure 2 ) .
dysfunction of the vascular endothelium is a key factor in the development of atherosclerotic cardiovascular disease and has been demonstrated to precede clinically identifiable structural changes in the vasculature .
peripheral dysfunction of the vascular endothelium has been demonstrated to correlate with increased risk of clinical events and all cause mortality and associates with many traditional cardiovascular risk factors including hypertension , diabetes mellitus , insulin resistance , hypercholesterolemia , and smoking .
in addition to this , endothelial dysfunction has been demonstrated in young adults predisposed to hypertension without clinical evidence of arterial disease .
endothelial health and nitric oxide synthase activity are crucial in modulating arterial distensibility [ 5860 ] and carotid intima media thickness [ 61 , 62 ] independent of risk factors as well as myocardial hypertrophic responses in animals [ 6365 ]
. left ventricular mass , another powerful independent predictor of mortality and morbidity in adults free of clinical disease , has a graded relationship with vascular endothelial vasomotor responses in hypertensive adults [ 6772 ] .
the strong relationship between endothelial dysfunction and cardiovascular outcomes and risk factors make it an interesting pathophysiological endpoint in the evaluation of therapies designed to modify long - term cardiovascular risk .
as women who have experienced preeclampsia constitute a relatively young group , and there is potentially a prolonged period between exposure and clinical outcome , intermediate measures which may indicate a potentially modifiable change in risk are of particular value .
noninvasive measures of vascular function are widely used as surrogate markers of cardiovascular risk [ 73 , 74 ] .
for example , increasing arterial stiffness , demonstrated by an increase in pulse wave velocity , is an antecedent factor in elevated blood pressure , predicts the future cardiovascular risk of adults , and correlates strongly with the presence of atherosclerosis .
similarly , early evidence of atherosclerosis demonstrated by increased thickness of the arterial wall is correlated with coronary artery disease and is predictive of future infarction and stroke [ 75 , 76 ] .
changes in these parameters may therefore also offer unique insight into the cardiovascular risk of women and children following a preeclamptic pregnancy .
several relatively small - scale studies have also demonstrated vascular dysfunction after pregnancy complicated by preeclampsia with evidence of endothelial dysfunction in the macrocirculation [ 14 , 16 , 18 , 2224 , 26 ] up to a median of 3 years and the microcirculation up to 25 years later [ 15 , 27 , 30 ] , as well as increased arterial stiffness [ 13 , 14 , 16 , 17 ] up to almost 5 years after the index pregnancy and atherosclerosis over 3 months postpartum .
elevation of systemic biomarkers of endothelial injury and inflammation have also been described between 6 weeks and 20 years [ 7880 ] following preeclampsia .
the characteristics and results of current literature considering the impact of preeclampsia on vascular structure and function are summarised in table 1 .
there is , however , some disparity in results with some studies demonstrating no change in vascular function following preeclampsia [ 21 , 25 , 28 , 81 ] . this may in part reflect heterogeneity in patient cohorts , severity of preeclampsia , size of cohorts , the timing of the studies following the affected pregnancy , as well as differences in the vascular beds studied and the techniques employed
. in the future more detailed long - term follow - up studies of such women may clarify changes in cardiovascular physiology and inform future treatment .
even more than their mothers , children born following a preeclamptic pregnancy , constitute a cohort where early life preventative strategies may have a profound impact on future cardiovascular risk .
furthermore , adults whose mothers had preeclampsia themselves have a higher risk of the condition .
therefore , in this group evidence of subtle changes in vascular physiology indicating changes in risk are of particular importance .
the body of literature considering cardiovascular outcomes in the offspring of preeclamptic pregnancies is sparse when compared to that considering maternal health . a single 60-year - follow - up study of individuals born to preeclamptic women demonstrated an increased risk of stroke in later life ( rr 1.9 95% c.i .
offspring of hypertensive pregnancies have also been shown to have an increased risk of hypertension as adults [ 82 , 83 ] as well as having increased , although not pathological , blood pressure in childhood and adolescence .
meta - analysis suggests that the magnitude of this increase in young individuals for systolic blood pressure is 2.3 mmhg and for diastolic blood pressure is 1.7 mmhg .
although such increases are unlikely to be clinically recognisable , it may have significant public health significance as a 2 mmhg rise in systolic blood pressure has been associated with a 7% increase in ischaemic heart disease mortality and a 10% increase in stroke .
preterm offspring born to hypertensive pregnancies demonstrate a distinct cardiovascular phenotype , characterised by reduced conduit artery endothelial function and increased evidence of early atherosclerosis , compared to individuals born preterm to normotensive women .
a finding which has now been replicated in other groups [ 27 , 86 , 87 ] and may be similar to the vascular dysfunction seen in women following preeclamptic pregnancies .
although the underlying mechanisms remain unknown , there is substantial evidence of programming of aspects of vascular biology during fetal development , in particular endothelial responses and arterial stiffness .
the risk to the offspring is likely to be mediated through changes in maternal blood pressure , vascular resistance in the placenta , or exposure to maternal factors ( such as antiangiogenic factors , vasoactive substances , and reactive oxygen species ) in the fetomaternal circulation .
optimal management of preeclampsia may have indirect benefits to reduce cardiovascular risk in the offspring of such pregnancies .
hence , better understanding of the long - term vascular changes in offspring of preeclampsia may allow assessment of novel and previously unrecognised long - term outcomes of preeclampsia with important public health significance .
it is now becoming clear that preeclampsia is more than an isolated disease of pregnancy .
the long - term health implications of this condition for both the women and their children are increasingly being recognised and incorporated into clinical risk assessments . both women and children exposed to preeclampsia exhibit an adverse vascular phenotype , a propensity to subclinical atherosclerosis , and increased risk of adverse cardiac and vascular events in future life .
as preeclampsia affects 25% of the population this altered risk is relevant to the health of 1.2 to 3 million people in the uk and 6 to 15 million people in the usa .
optimal management of preeclampsia may be able to improve short and long - term vascular outcomes in these individuals . while we remain unable to effectively prevent preeclampsia attempts to reduce its long - term impact on those exposed are of potential importance .
future studies that define the detailed cardiovascular phenotype of those exposed to preeclampsia may allow identification of potential targets for future preventative strategies .
furthermore , studies into the mechanisms underlying the altered cardiovascular phenotype may provide unique insight into pathophysiological or molecular links between preeclampsia and cardiovascular disease , which may direct us to novel treatment strategies for both conditions .
vascular dysfunction is an early marker of cardiovascular risk , correlating with future risk of cardiac events and preceding structural vascular change .
improvement in vascular function would therefore be a valuable intermediate endpoint in studies aiming to reduce risk in this potentially young and generally asymptomatic population before the onset of clinical disease .
Output:
| preeclampsia is increasingly being recognised as more than an isolated disease of pregnancy . in particular , preeclampsia has emerged as an independent risk factor for maternal cardiovascular disease and has recently been recognised as a risk factor for cardiovascular disease in children exposed in utero .
preeclampsia and cardiovascular disease may share important pathophysiological and molecular mechanisms and further investigation into these is likely to offer insight into the origins of both conditions .
this paper considers the links between cardiovascular disease and preeclampsia and the implication of these findings for refinement of the management of patients whose care is complicated by preeclampsia . |
PubmedSumm7877 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: its hallmark features include the presence of cutaneous
granulomatous lesions noncontiguous with the gastrointestinal tract or fistulae
.
we report a very rare case of metastatic crohn 's disease
affecting the ear in a man with longstanding crohn 's disease .
we aim to
highlight the need for clinical suspicion of systemic diseases that may present
as a localised ear lesion , in particular , the rare entity of metastatic crohn 's
disease .
a 43-year - old man with an 18 years history of crohn 's disease
developed a severe erythematous and exudative skin lesion in the right postauricular
cleft region .
the patient had recently completed a course of the
therapeutic drug infliximab , a monoclonal antibody for tumour necrosis factor
( tnf ) , which is a key inflammatory agent in systemic inflammatory conditions .
gastroenterologists were concerned that the skin lesion was an infective
complication of the new therapeutic regimen due to a possible immunosuppressive
action .
several antibacterial agents were used with no clinical benefit , and
the patient was then referred to the ent department for a second opinion .
concurrently , the patient had a recurrence of severe perineal crohn 's disease
and warranted further course of infliximab .
however , given the issue of
possible association with the skin lesion , the treatment decision was deferred
pending resolution of the skin condition .
initial ent examination excluded an otitis externa causing local
inflammation from overspill onto the adjacent skin area .
appearance of the skin
lesion was in keeping with either an infection or severe eczematous
inflammation .
a skin swab for culture was taken and triadcortyl ointment
applied . during the initial consultation , the patient complained of a similar
lesion starting in the umbilicus region .
the swab result reported heavy growths
of beta - hemolytic streptococcus and staphylococcus aureus with moderate anaerobes .
triple therapy with flucloxacillin , erythromycin , and metronidazole proved to
be ineffective . during this period
, there was gradual deterioration of the
lesion , which prompted a biopsy of the periauricular skin lesion .
the
pathologist reported the biopsy to represent a chronic noncaseating
granulomatous lesion consistent with a diagnosis ofmetastatic crohn 's
disease ( please refer pathology report ) .
subsequently , with dermatology advice , treatment with high - dose
betnovate cream , oral steroids , and infliximab resulted in rapid remission of
the skin condition ( both the postaural and umbilical areas ) and the perineal
crohn 's disease .
histological haematoxylin
and eosin sections ( figure 1 ) demonstrated chronic inflammation of the dermis with
admixed epithelioid and giant cell granulomas .
furthermore , there was an absence of fungi , staining for acid and
alcohol fast bacilli were
negative , and birefringent foreign bodies were not seen .
metastatic cutaneous crohn 's disease refers to the presence of a
skin lesion containing epithelioid
and giant cell granulomas as seen in the affected bowel segments of patients with
crohn 's disease , but is physically separated from the gastrointestinal tract .
this condition is distinct from other more well - characterized cutaneous
manifestations which include pyoderma gangrenosum , erythema nodosum ,
polyarteritis nodosa , and epidermolysis acquisita .
although the estimated
incidence of cutaneous manifestation of crohn 's disease varies widely between
2% and 44% ,
true metastatic cutaneous crohn 's disease is exceedingly rare .
metastatic crohn 's disease does not appear to have any distinct
relationship with the severity of the crohn 's bowel disease , and indeed may
even precede gastrointestinal involvement .
however , there is a suggestion in the limited literature available that
there may be an association with perianal crohn 's disease . of the reported
cases of metastatic crohn 's disease involvement primarily of the lower limbs
and trunk regions with a predilection for skin fold areas and
there has been only one reported case of facial involvement documented more
than 30 years ago . to date ,
given the rarity of the condition , there is no
gold - standard therapy for metastatic crohn 's disease .
the use of systemic
and topical steroids , antibiotics , and immunosuppressive agents such as
azathioprine , sulfasalazine , and methotrexate has been described with variable success . the
use of infliximab , an antitumour necrosis factor monoclonal antibody , as one of
the latest treatment options has been described in a few case reports to be
more effective in maintaining disease remission , especially with repetitive
administration and when used concomitantly with other more mainstream therapies
[ 57 ] .
however , given their recent introduction
to clinical use , in addition to a better evidence for clinical efficacy in
various disorders , new side effects may also become apparent with time and
should be carefully evaluated . in the case
being presented , the possibility of an unusual
diagnosis for the skin lesion was raised by several features : the sudden onset
of postauricular rash in a gentleman with no previous ear or skin condition ;
the aggressive nature of the purulent rash ; the observed resistance to several
common treatments used including multiple antimicrobial agents and topical
steroid cream .
the diagnosis of the rare cutaneous crohn 's disease was first
suggested by the biopsy demonstrating chronic granulomatous inflammation in a
patient known to be suffering from active crohn 's disease .
biopsies
demonstrating chronic granulomatous inflammation of the skin require the
pathologists to consider other and more common disorders including sarcoidosis ,
tuberculosis and fungal or parasitic infections , foreign body granulomas , and
annular elastocystic granuloma .
histological analysis failed to demonstrate any
of the pathognomonic features of the other granulomatous conditions .
the
diagnosis of metastatic crohn 's was further supported by the rapid remission
both of the skin rash and perineal crohn 's disease in response to treatment
with high - dose
local steroid cream , oral steroids , and concomitant infliximab infusion . despite its rarity ,
a meticulous evaluation including a thorough
history and examination , and biopsy in cases unresponsive to simple measures ,
together with a high index of clinical suspicion in those with an established
diagnosis or presenting with concomitant clinical features of crohn 's disease ,
may provide early diagnosis of this skin condition which can be disfiguring and
emotionally distressing to the patient .
the diagnosis of metastatic crohn 's
disease may be relatively easier in patients with established crohn 's disease
compared to those cases where the skin lesions precede bowel involvement . in
the latter cases , diagnosis by biopsy should then lead to appropriate
counseling about the diagnosis of crohn 's disease and the future onset of the
more significant bowel disease .
we hope by reporting this rare and interesting case that we may highlight the
need to consider systemic diseases , in particular , chronic inflammatory
conditions such as crohn 's disease , as causes of skin lesions of the ear and
face that are unresponsive to simple treatments .
metastatic crohn 's disease is an uncommon cutaneous manifestation of crohn 's disease.metastatic crohn 's lesions have a predilection for the
skin fold , limbs , and trunk.metastatic
crohn 's involving ear is extremely rare.to date , there is no gold standard treatment for
metastatic crohn 's disease.treatment with
repetitive administration of infliximab together with other mainstream
therapies is promising in maintaining disease remission .
metastatic crohn 's lesions have a predilection for the
skin fold , limbs , and trunk .
treatment with
repetitive administration of infliximab together with other mainstream
therapies is promising in maintaining disease remission .
Output:
| objective . we reported a very rare case of metastatic crohn 's disease involving the retro - auricular region .
method . a case report and a review of literature concerning metastatic crohn 's disease .
results .
metastatic crohn 's disease is an uncommon extraintestinal cutaneous manifestation of crohn 's disease and a very rare case involving the retro - auricular region is reported here . given the limited existing literature little is known about this condition .
the skin lesions appear to have a predilection for the lower trunk and genitalia regions .
there is no clear association with the severity of crohn 's disease and in some cases , the cutaneous lesions predate the onset of gastrointestinal crohn 's disease .
treatment with immune - modulating medications together with the antitumour necrosis factor monoclonal antibody therapy appears to offer the best chance of remission . conclusion . by reporting this interesting and rare condition
we also hope to highlight the importance of considering underlying chronic systemic disorders , such as crohn 's disease , when presented with skin lesions resistant to simple local treatments . |
PubmedSumm7878 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the pentatricopeptide repeat ( ppr ) superfamily ( 1 ) is characterized by a degenerate 35 amino acid repeat and is specific to eukaryotes although most numerous and varied in the plant kingdom ( 2 ) , with over 400 identified in arabidopsis thaliana ( 3 ) .
ppr proteins function in rna stabilization ( 46 ) , editing ( 7 ) , maturation and post - transcriptional modifications ( 8,9 ) and are essential for organelle biogenesis ( 3 ) and translational control ( 1014 ) .
mutations can result in cytoplasmic male sterility ( 15,16 ) , impaired seed development ( 17 ) and diverse embryonic defects ( 18 ) .
ppr proteins can be broadly divided into two families , those consisting of tandem arrays of canonical p - class motifs and those composed of repeats of triplets of p- , l- and s - class motifs ( 3 ) .
regardless of repeat class , conservation of key amino acids from each motif has been correlated with the sequence of known rna targets to establish a statistically and experimentally validated predictive code for rna recognition by ppr proteins ( 1921 ) .
this code is consistent with a modular interaction where a base is coordinated by the sixth residue of one ppr repeat , and the first residue of the next repeat
. such a modular , predictable , mode of single - stranded rna binding makes ppr proteins a potential scaffold for the design of biotechnologically useful proteins ( 22,23 ) .
predictions of an -solenoid tertiary structure for ppr tracts ( 1,24 ) have been confirmed recently by a number of crystal structures including a segment of the mitochondrial rna polymerase ( 25 ) , arabidopsis proteinaceous ribonuclease p ( 26 ) , the p - class ppr protein tha8l ( 27 ) and a synthetic consensus p - class ppr protein ( 28 ) .
crystal structures of two ppr proteins , brachypodium tha8 ( 29 ) and zea mays ppr10 ( zmppr10 ) ( 30 ) , in complex with rna have partially confirmed the modular rna - binding mode , but revealed non - modular and idiosyncratic interactions that had not been anticipated based on prior data .
zmppr10 localizes to plastids where it binds cis - elements of two polycistronic transcripts ( 6,13 ) , the minimal binding sites identified as 17 and 18 nucleotide tracts in the atpi - atph and psaj - rpl33 intercistronic regions .
ppr10 binding was shown to stabilize the rna in vivo , protecting the transcripts from exoribonucleases in either direction , and to activate mrna translation by remodeling local rna structure ( 6 ) .
analytical ultracentrifugation experiments unambiguously demonstrated the association of ppr10 monomers into dimers at high concentration and dissociation of ppr10 dimers into monomers on binding an oligonucleotide representing atph rna , resulting in a 1:1 protein : rna stoichiometry ( 19 ) , with a dissociation constant that has been measured at ca . 1 nm ( 6 ) .
in the recent crystal structure of zmppr10 in complex with an 18 nucleotide rna fragment of psaj ( pdb 4m59 ( 30 ) ) , the protomer consists of a continuous array of 20\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{upgreek }
\usepackage{mathrsfs }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
} { } $ \frac{1}{2}$\end{document } p - class ppr repeats forming a right - handed superhelix .
a dimer is generated by the association of two anti - parallel molecules , and one rna molecule is bound at each end of the dimer by elements of both monomers .
notably , reported attempts to crystallize ppr10 with atph resulted in apparent dissociation of the dimer and failure to crystallize , suggesting the possibility of a different , higher - affinity , mode of rna binding compared to psaj , for which a dissociation constant of > 200 m has been measured ( 13 ) .
here we use size - exclusion chromatography - coupled synchrotron small - angle x - ray scattering ( saxs ) ( 31 ) to produce clear structural evidence for a monomeric ppr10:atph complex in solution , demonstrating a potential structural rearrangement with respect to the ppr10:psaj crystal structure , that is more consistent with the proposed ppr rna recognition code and with other prior data concerning ppr10rna interactions .
the zmppr10:pmal - tev plasmid generated as described previously ( 13 ) was used to transform e. coli rosetta 2 ( de3 ) ( novagen ) .
cells were grown in 2yt media containing 1% ( w / v ) d - glucose , 50 mm tris - hcl at ph 7.5 with kanamycin at 50 g ml and chloramphenicol at 50 g ml .
the culture was grown at 37c to an optical density ( 600 nm ) of 0.6 and then cooled on ice for 5 min .
expression was then induced with 1 mm isopropyl -d-1-thiogalactopyranoside and the culture shaken overnight at 16c for protein expression .
the bacterial pellet was resuspended in buffer a ( 50 mm tris - hcl at ph 8.0 , 500 mm kcl , 10% ( v / v ) glycerol , 1 mm dithiothreitol ) supplemented with 0.13 mm phenylmethanesulfonyl fluoride ( roche ) , 1 mini complete protease inhibitor tablet ( roche ) , 0.5 l benzonase ( sigma - aldrich ) and 1 mg ml lysozyme , and lysed under high pressure using a emulsiflex c5 homogenizer ( avestin ) .
lysate supernatant was batch loaded onto amylose resin ( ge healthcare ) and left at 4c for 1 h with agitation .
the column was washed with buffer a , and fusion protein eluted with buffer a supplemented with 50 mm maltose .
fusion protein was cleaved overnight at 4c with tobacco etch virus protease and then subjected to size - exclusion chromatography ( biologic duoflow , bio - rad ) with a hiload 16/60 superdex 200 prep grade column ( ge healthcare ) developed in buffer a. peak fractions were confirmed by sodium dodecyl sulphate - polyacrylamide gel electrophoresis ( nupagenovex 412% , bis - tris gel , invitrogen ) stained with coomassie brilliant blue .
purified proteins were concentrated in a vivaspin 20 ( mwco 30 000 ) centrifugal concentrator ( ge ) and quantified by absorption at 280 nm ( nanodrop lite , thermoscientific ) .
ppr10:atph complex was prepared by briefly incubating a 1:1 molar ratio of purified protein with rna ( 5-guauccuuaaccauuuc-3 [ idt ] ) .
purified ppr10 protein at a concentration of 0.1 mg ml was dialysed into 10 mm potassium phosphate at ph 8.0 , 100 mm kf , and analysed at 20c in a 1 mm path length quarz cuvette on a jasco j-810 spectropolarimeter .
measurements from 260 to 185 nm with wavelength steps of 1 nm were conducted in triplicate to facilitate the generation of error bars denoting standard deviation .
estimations of -helix content were made using characteristic signals at 208 and 222 nm:%208 = [ ( |[]208|4000 ) / ( 33 0004000 ) ] x 100 and % 222 = [ ( |[]222|3000 ) / ( 36 0003000 ) ] x 100 ( 32,33 ) .
saxs measurements were conducted at the saxs / waxs beamline of the australian synchrotron with continuous data collection on a 1 m pilatus detector ( 34 ) .
sec - sy - saxs was controlled by a shimadzu hplc system . for the ppr10:atph complex ,
scattering data were collected from 50 l of a 6 mg ml sample loaded onto a superdex200 precision column ( ge healthcare ) at 0.1 ml min in 50 mm tris - hcl at ph 7.3 , 250 mm nacl , 10% glycerol , 5 mm -mercaptoethanol . for the mbp - ppr10:atph complex
, 90 l of a 6 mg ml sample was run through the precision column at 0.5 ml min in buffer a. for experiments where timed shutter opening was critical , the delay between the fplc uv detector and x - ray detector was calibrated using glucose isomerase solution as a standard .
data were corrected for fouling by aggregates while the shutter was open , by using linear interpolation of background from averaged frames prior to the peak to averaged frames after the peak , in an analogous approach to that used in us - somo ( 35 ) . a high - q cutoff of 0.21 was used due to increasing noise beyond this resolution .
the radius of gyration ( rg ) , maximum dimension ( dmax ) and p(r ) distribution plots of the samples were determined with the atsas software ( 36 ) using primus ( 37 ) and gnom ( 38 ) respectively .
however , we chose to manually increase dmax as it was underestimated judging by the appearance of the p(r ) plot ( discussed below ) .
the starting model was derived from a single chain of ppr10 extracted from pdb 4m59 ( 30 ) , broken into seven
rna was included in the domain definition by placing the appropriate trinucleotide adjacent to the predicted rna - binding residues of each domain .
for the mbp - ppr10 data , pdb entry 1mbp was used as an additional protein domain .
two distance constraints per domain were added to ensure physically reasonable modeling , as the ppr motifs in ppr10 form a continuous array .
crysol ( 41 ) and moleman2 ( 42 ) were used to evaluate model quality by quantifying how representative the atomic models are of the data and p(r ) distribution plots .
the zmppr10:pmal - tev plasmid generated as described previously ( 13 ) was used to transform e. coli rosetta 2 ( de3 ) ( novagen ) .
cells were grown in 2yt media containing 1% ( w / v ) d - glucose , 50 mm tris - hcl at ph 7.5 with kanamycin at 50 g ml and chloramphenicol at 50 g ml .
the culture was grown at 37c to an optical density ( 600 nm ) of 0.6 and then cooled on ice for 5 min .
expression was then induced with 1 mm isopropyl -d-1-thiogalactopyranoside and the culture shaken overnight at 16c for protein expression .
the bacterial pellet was resuspended in buffer a ( 50 mm tris - hcl at ph 8.0 , 500 mm kcl , 10% ( v / v ) glycerol , 1 mm dithiothreitol ) supplemented with 0.13 mm phenylmethanesulfonyl fluoride ( roche ) , 1 mini complete protease inhibitor tablet ( roche ) , 0.5 l benzonase ( sigma - aldrich ) and 1 mg ml lysozyme , and lysed under high pressure using a emulsiflex c5 homogenizer ( avestin ) .
lysate supernatant was batch loaded onto amylose resin ( ge healthcare ) and left at 4c for 1 h with agitation .
the column was washed with buffer a , and fusion protein eluted with buffer a supplemented with 50 mm maltose .
fusion protein was cleaved overnight at 4c with tobacco etch virus protease and then subjected to size - exclusion chromatography ( biologic duoflow , bio - rad ) with a hiload 16/60 superdex 200 prep grade column ( ge healthcare ) developed in buffer a. peak fractions were confirmed by sodium dodecyl sulphate - polyacrylamide gel electrophoresis ( nupagenovex 412% , bis - tris gel , invitrogen ) stained with coomassie brilliant blue .
purified proteins were concentrated in a vivaspin 20 ( mwco 30 000 ) centrifugal concentrator ( ge ) and quantified by absorption at 280 nm ( nanodrop lite , thermoscientific ) .
ppr10:atph complex was prepared by briefly incubating a 1:1 molar ratio of purified protein with rna ( 5-guauccuuaaccauuuc-3 [ idt ] ) .
purified ppr10 protein at a concentration of 0.1 mg ml was dialysed into 10 mm potassium phosphate at ph 8.0 , 100 mm kf , and analysed at 20c in a 1 mm path length quarz cuvette on a jasco j-810 spectropolarimeter .
measurements from 260 to 185 nm with wavelength steps of 1 nm were conducted in triplicate to facilitate the generation of error bars denoting standard deviation .
estimations of -helix content were made using characteristic signals at 208 and 222 nm:%208 = [ ( |[]208|4000 ) / ( 33 0004000 ) ] x 100 and % 222 = [ ( |[]222|3000 ) / ( 36 0003000 ) ] x 100 ( 32,33 ) .
saxs measurements were conducted at the saxs / waxs beamline of the australian synchrotron with continuous data collection on a 1 m pilatus detector ( 34 ) .
sec - sy - saxs was controlled by a shimadzu hplc system . for the ppr10:atph complex ,
scattering data were collected from 50 l of a 6 mg ml sample loaded onto a superdex200 precision column ( ge healthcare ) at 0.1 ml min in 50 mm tris - hcl at ph 7.3 , 250 mm nacl , 10% glycerol , 5 mm -mercaptoethanol . for the mbp - ppr10:atph complex , 90 l of a 6 mg ml sample was run through the precision column at 0.5 ml min in buffer a. for experiments where timed shutter opening was critical , the delay between the fplc uv detector and x - ray detector was calibrated using glucose isomerase solution as a standard .
data were corrected for fouling by aggregates while the shutter was open , by using linear interpolation of background from averaged frames prior to the peak to averaged frames after the peak , in an analogous approach to that used in us - somo ( 35 ) .
a high - q cutoff of 0.21 was used due to increasing noise beyond this resolution .
the radius of gyration ( rg ) , maximum dimension ( dmax ) and p(r ) distribution plots of the samples were determined with the atsas software ( 36 ) using primus ( 37 ) and gnom ( 38 ) respectively .
however , we chose to manually increase dmax as it was underestimated judging by the appearance of the p(r ) plot ( discussed below ) .
the starting model was derived from a single chain of ppr10 extracted from pdb 4m59 ( 30 ) , broken into seven
rna was included in the domain definition by placing the appropriate trinucleotide adjacent to the predicted rna - binding residues of each domain .
for the mbp - ppr10 data , pdb entry 1mbp was used as an additional protein domain .
two distance constraints per domain were added to ensure physically reasonable modeling , as the ppr motifs in ppr10 form a continuous array .
crysol ( 41 ) and moleman2 ( 42 ) were used to evaluate model quality by quantifying how representative the atomic models are of the data and p(r ) distribution plots .
we have generated a plausible model of the solution structure of zmppr10 in complex with the 17 nucleotide minimal binding site of the maize atph transcript informed by a combination of saxs data , circular dichroism spectroscopy , and pre - existing bioinformatic , biochemical and crystallographic data .
the secondary structure content of ppr10 was estimated to be predominantly -helical ( 84% ) from circular dichroism as expected for the anti - parallel -helical topology of a ppr motif , and comparable with calculations based on the crystal structures ( 71% -helix ) .
preliminary saxs measurements on ppr10 alone and after incubation with atph rna yielded complex uninterpretable scattering profiles due to significant aggregation .
we therefore employed size - exclusion chromatography - coupled synchrotron small - angle x - ray scattering ( sec - sy - saxs ; figure 1 ) .
this method allowed us to separate the various complexes inline , identify their content from their a260/a280 ratios and examine the solution structure of specific sec fractions ( figure 1a ) . a significant challenge to this method
was encountered due to the earliest eluting aggregated proteins adhering to the sample capillary at the point of x - ray exposure , thus tainting all further images . by carefully timing the opening of the x - ray shutter to only measure regions of interest and appropriate background segments it was possible to measure high quality saxs on the protein : rna complex .
scattering data were obtained for a monodisperse peak with an a260/a280 ratio and molecular size commensurate with a monomeric ppr10:atph complex ( figure 1b ) .
( a ) size exclusion chromatography trace of ppr10:atph showing peaks corresponding to oligomers , ppr10:atph complex and unbound atph rna .
black bars indicate the part of the chromatogram for which saxs was collected by opening the beamline shutter .
the grey circle indicates position where the first data frame was recorded , and the bar , the region corresponding to frames 552710 .
( b ) scattering profiles of the ppr10:atph complex averaged across 20 frame segments , corresponding to the second half of the ppr10:atph peak ( grey bar in ( a ) ) .
( c ) guinier analysis of the low - q scattering data for the five most strongly scattering 20 frame segments indicates a radius of gyration of 36 .
( e ) dimensionless kratky plot is diagnostic of a globular but somewhat extended protein .
maximum dimension , dmax , and porod volume , vp , and molecular mass , mr , determined using gnom .
oligomeric state ( n ) determined from the ratio of mr(vp ) to mr ( theoretical ) .
guinier analysis of the low - q data indicated a consistent radius of gyration ( rg ) close to 36 for the most concentrated fractions ( table 2 , figure 1c ) .
an upturn at low - q became evident in the scattering profile during later fractions , possibly due to adhesion of protein on the capillary ( figure 1b ) , rendering guinier analysis of these lower concentration samples impossible .
thus , data from the peak fraction ( frames 552570 ) were averaged and used for subsequent analysis .
the p(r ) distribution ( figure 1d ) is indicative of a globular structure with an extended tail : an asymmetric distribution with a maximum at 40 with a shoulder at 20 and a steady decline through the longer distances with shoulders at 80 and 110 and a dmax of ca .
a dimensionless kratky plot contains a peak at 1.95 with a height of around 1.2 indicating a somewhat elongated , but generally globular protein ( with reference to ( 43 ) ) that is suitable for porod analysis ( figure 1e ) .
the molecular mass ( mr ) of the scattering particle , determined from the porod invariant ( vp ) , ( 44 ) , corresponds to a monodisperse , 1:1 ppr10:atph complex ( tables 1 and 2 ) . as the monomeric state of the complex as determined by auc , remsa and now saxs contrasts with the reported dimeric crystal structure , we next sought to build a molecular model taking into account the limitations of data quality that best reflects the scattering data .
we first examined the crystal structures of zmppr10 in the absence ( 4m57 ) and presence ( 4m59 ) of psaj rna .
initially , we generated candidate models of the observed dimers , and monomers extracted from the crystal structures , and compared their minimized fit with the observed scattering profiles , and compared their distance distributions with the observed p(r ) distribution ( figure 2 ) .
the relatively high values combined with the lack of common features in the distance distribution ( e.g. a maximum at 60 compared to 40 ) led us to conclude that there were notable differences between the solution structure and the crystallographic models .
bottom row : reconstructed pair distribution plots from the respective models ( solid histogram ) compared with the experimentally derived p(r ) distribution ( black line ) .
( a ) apoppr10 monomer extracted from pdb 4m57 ; ( b ) apoppr10 dimer from pdb 4m57 ; ( c ) ppr10:psaj monomer extracted from pdb m459 ; ( d ) ppr10:psaj dimer from pdb 4m59 ; ( e ) the best - fitting sasref model .
armed with this knowledge we generated rigid body models from ppr10 broken into seven domains , with rna fragments attached , and refined against the scattering data .
highly consistent results were obtained over multiple independent modeling runs for ppr10:atph ( figure 2e ) presented as a monomeric complex .
the best - fitting model is a right - handed superhelical array with the c - terminal region forming a toroid .
however , the pseudosymmetric nature of the ppr10 molecule a superhelical array made it impossible to objectively assign either end as the n- or c - terminus .
to address this problem , we repeated the data collection procedure with an n - terminal mbp - ppr10 fusion protein .
scattering data were analysed ( figure 3 ) revealing increases of rg to 61 and dmax to 250 , as expected from addition of an mbp domain .
rigid body modeling of this complex produced a satisfactory solution ( = 0.78 ) for a protein with mbp at the n - terminus and a toroidal arrangement at the c - terminus , thus supporting our model of the untagged protein , which is used in the following comparative analysis .
sec - sy - saxs analysis of mbp - ppr10 fusion protein : atph complex .
( a ) scattering profiles of averaged and background subtracted five - frame region of the peak fraction of mbp - ppr10:atph .
( b ) guinier analysis and ( c)p(r ) distribution for the 215220 averaged scattering profile .
alignment of monomeric ppr10 structures from three different available structural contexts ( a monomer extracted from the apo - ppr10 dimer ( pdb 4m57 ) ; a monomer extracted from the psaj - bound dimer ( pdb 4m59 ) and the monomeric atph - bound solution structure , this work ) reveals two notable regions of structural rearrangement ( figure 4a ) that are also discernable from the scattering profiles and distance distributions ( figure 2 ) .
while the c - terminal region of the apo- and psaj - bound monomers aligns well , the four n - terminal ppr motifs are arranged differently .
conversely , the psaj- and atph - bound conformations only differ significantly around the four c - terminal ppr motifs .
( a ) dynamic structure of a ppr10 monomer : a single ppr10 molecule extracted from the rna - free dimer structure ( 4m57 chain a , red cartoon ) , the ppr10:psaj dimer ( 4m59 chain a , gold ) and the monomeric ppr10:atph solution structure ( this work , blue ) can be superimposed effectively ( rmsd ranging from 7 to 11 including c atoms from most of the structure : black lines link superimposed c atoms between two structures ) .
the n - terminal region ( oriented at the top ) differs between apo- and psaj - bound proteins , while only the c - terminus differs significantly between psaj- and atph - bound proteins .
( b)psaj rna coordination by ppr10 motifs 6 and 7 in the crystal structure ( 4m59 ; chain a orange cartoon ; chain b , beige / gray surface ) .
residues asn284 , asp314 and asn319 , asn349 ( positions 6 and 1 for motifs 6 and 7 respectively ) are known to dictate rna specificity , however asn349 is displaced from rna binding by the dimeric interface .
( c ) the solution structure of ppr10:atph illustrates that the arrangement of the ppr motifs ( colored blue to red from n - terminus ) is conducive to ssrna binding ( black cartoon ) as a monomer ( note : breaks in rna chain are a consequence of the rigid body modeling approach used ) .
this study shows how the coupling of size - exclusion chromatography with synchrotron saxs allows productive study of challenging macromolecular complexes , particularly when studying a well - characterized system with ample orthogonal information , from genomic , biochemical and crystallographic sources .
we have determined that the solution structure of zmppr10 complexed with a fragment of atph is not compatible with the dimeric form observed in the ppr10:psaj crystal structure , thus confirming previous analytical ultracentrifugation analyses .
the nature of recognition of atph and psaj has been well characterized ( 6,13,19 ) , and the ppr
rna recognition code has been validated biochemically for the n - terminus/5 end of the ppr
rna duplex by mutating residues asn284 , asp314 and asn319 , asn349 in ppr motifs 6 and 7 , and observing a predictable change in binding specificity ( 19 ) .
the dimeric conformation observed in the psaj - bound ppr10 structure is not fully compatible with this result , as one of the key residues in motif 7 does not engage the rna ( figure 4b ) .
indeed the structure of the helix bearing asn349 is highly disturbed , presenting considerably different positions in the two subunits of the crystal structure : in both cases asn319 is well over 10 distant from the rna .
it seems likely that the presence of the other subunit of the dimer close to this region is a cause of the disruption of this binding site ( figure 4b ) . in the saxs structure ,
the more highly overwound superhelix of the c - terminal region would sterically hinder dimerisation of the protein ( figure 4c ) . in this tight , toroid - like part of the structure there are intramolecular interactions between residues of the c - terminal repeats and repeats earlier in the sequence , which in the dimeric crystal structure are involved in intermolecular interactions instead
. our results are consistent with the 1:1 stoichiometry established by analytical ultracentrifugation for a ppr10-atph complex ( 19 ) .
that a similar architecture would apply to the ppr10-psaj complex in solution is supported by the comigration of ppr10-atph complexes and ppr10-psaj complexes in native gels and by the extensive sequence conservation across the length of the psaj and atph rnas .
a question is raised about whether all of these unambiguously observed configurations can be correct .
the answer may lie in the necessarily convoluted dynamic process that is required for ppr10 to dissociate from a dimeric state to a monomeric state and to bind sequence specifically to rna in a cellular context involving other binding partners and rna secondary structures ( 6 ) .
it is unclear whether the dimeric ppr10:psaj structure observed crystallographically represents an intermediate state in the dynamic process of rna recognition by ppr10 , or if it represents a dead - end complex formed at the high concentrations required for crystallisation . at a late point in our analysis ,
a paper became available that raises further doubt regarding the dimeric nature of the complex ( 45 ) . here
, the authors of the ppr10 crystal structures determine that an n - terminal truncation and a point mutation that were essential for crystallogenesis in fact drive dimerization .
our wild - type ppr10 protein makes a more physiologically relevant model for the interaction between ppr10 and target rna , taking into account the miniscule cellular concentration of ppr10 ( with respect to the micromolar dissociation constant for dimerisation ) and the large excess of non - specific single - stranded rna . while it remains plausible that dimeric apoppr10 binds to an rna transcript in low - affinity mode causing a structural rearrangement that dissociates the dimer and allows the high - affinity monomeric complex to form , it is likely that in the cell a monomeric ppr10 interacts with bulk single - stranded rna before exchanging partners to achieve high - affinity binding to its target rna motif as a monomeric protein : rna complex similar to the solution structure presented here . despite their well - described modularity and relatively predictable rna - binding specificity
, this example of a native ppr protein reveals a potentially convoluted process of rna binding .
if the promise for ppr proteins to be applied as ssrna - binding tools in biotechnology is to be maximized , a fuller understanding of the detailed structural changes that occur on rna binding is essential .
australian research council ( discovery project dp120102870 to i.d.s . , a.b . , c.s.b . )
pearl technologies ltd ; university of western australia ( scholarship for b.s.g . ) . funding for open access charge : the university of western australia .
Output:
| the pentatricopeptide repeat ( ppr ) protein family is a large family of rna - binding proteins that is characterized by tandem arrays of a degenerate 35-amino - acid motif which form an -solenoid structure .
ppr proteins influence the editing , splicing , translation and stability of specific rnas in mitochondria and chloroplasts .
zea mays ppr10 is amongst the best studied ppr proteins , where sequence - specific binding to two rna transcripts , atph and psaj , has been demonstrated to follow a recognition code where the identity of two amino acids per repeat determines the base - specificity .
a recently solved zmppr10:psaj complex crystal structure suggested a homodimeric complex with considerably fewer sequence - specific protein
rna contacts than inferred previously . here
we describe the solution structure of the zmppr10:atph complex using size - exclusion chromatography - coupled synchrotron small - angle x - ray scattering ( sec - sy - saxs ) .
our results support prior evidence that ppr10 binds rna as a monomer , and that it does so in a manner that is commensurate with a canonical and predictable rna - binding mode across much of the rna protein interface . |
PubmedSumm7879 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: world health organization ( who ) has recommended artemisinin class of compounds as promising novel antimalarials for further clinical development .
several semisynthetic derivatives of artemisinin , the active ingredient of chinese herb qing hao ( artemisia annua ) used traditionally for treating fevers , have been used increasingly over past two decades .
discovery of artemisinin , as the active principle of chinese traditional drug artemisia annua , has opened new possibilities in malaria chemotherapy .
artemisinin and its more potent derivatives ( artemether , artemotil , and artesunic acid , etc . )
these drugs are fast acting and are well suited for treatment of cerebral malaria caused by p. falciparum ( drug sensitive as well as drug resistant species ) .
peroxide group , present in form of 1,2,4-trioxane , is essential for antimalarial activity of these drugs .
the endoperoxide sesquiterpene lactone moiety of this class of compounds is found to be indispensable for the erythorocytic schizontocidal activity and reacts with intraparasitic heme and forms free radicals .
these free radicals appear to damage intracellular targets and perform their antimalarial activity [ 24 ] . however , the existing artemisinin class of drugs is to be improved regarding efficacy , neurotoxicity , stability , and pharmacokinetic ( pk ) behaviors .
synthesis of a large number of structurally simple trioxanes have been reported , several of which have shown promising in vivo antimalarial activity .
central drug research institute ( cdri ) developed a promising antimalarial compound , 97/63 ( racemate ) ( figure 1(a ) ) , in its drug discovery program .
97/63 showed good potency against malarial parasites , in vitro as well as in vivo .
it possesses a 1,2,4-trioxane nucleus similar to endoperoxide lactone of artemisinins , essential for antimalarial activity [ 79 ] .
several synthetic trioxanes , simplified analogs of artemisnin retaining the crucial endoperoxide bridge , have been reported but only a few have entered successfully in clinical trials till date .
firstly , 97/63 was synthesized which showed promising antimalarial activity but , due to its poor bioavailabilty , it was resynthesized as a hemisuccinate derivative and coded as 97/78 which is currently into clinical trials phase i. the 1,2,4-trioxane nucleus present in antimalarial 97/63 is responsible for its pharmacological activity [ 711 ] . in continuation of drug development program after successful completion of pharmacological activities , the preclinical development was undertaken .
so , the present study describes pharmacokinetic behavior of 97/63 after single oral and intravenous dose administration in male rats .
characterization of preclinical pharmacokinetic studies in animal models is required for toxicological and preclinical studies and also for extrapolation of pharmacokinetics and pharmacodynamics in humans .
analytical method was developed and validated in terms of sensitivity , specificity , accuracy , precision , and recovery .
the study samples were analyzed using validated hplc - uv assay developed for quantification of 97/63 in rat serum .
pure reference standards ( purity > 99% ) of 97/63 and 99/411 ( figure 1(b ) ) used as internal standard ( is ) were obtained from medicinal and process chemistry division , cdri , lucknow , india .
acetonitrile , hplc grade , was purchased from thomas baker ( chemicals ) limited ( mumbai , india ) .
analytical grade potassium dihydrogen orthophosphate for buffer preparation was supplied by sd fine - chem limited , mumbai , india .
orthophosphoric acid ( analytical grade ) for ph adjustment of the buffer was purchased from qualigens fine chemicals , mumbai , india . for sample extraction , n - hexane
ultrapure water of 18.2 m cm was obtained from a milli - q plus pf system .
drug - free pool of serum was obtained from male rats ( sprague - dawley , sd ) which were obtained from laboratory animal services division , cdri .
animals were cared for in accordance with the guidelines laid by local ethical committee for animal experimentation and the principles of the guide for care and use of laboratory animals were followed ( department of health education and welfare , number [ nih ] 85 - 32 ) .
hplc system consisted of a pump ( lc-10atvp with scl 10avp system controller , shimadzu , japan ) with quaternary flow control valve system ( fcv-10alvp ) and a degasser ( dgu-14a ) to pump the mobile phase .
the detection of 97/63 and is was performed using spd-10a uv - vis detector at 244 nm .
chromatographic separation was performed isocratically on spheri-5 , rp-18 column ( 100 4.6 mm i.d .
5 mm ) ( pierce chemicals co. , rockford , il , usa ) coupled with a guard column ( 30 4.6 mm i.d . ,
5 mm ) packed with the same material . the mobile phase composed of acetonitrile : phosphate buffer ( 10 mm , ph 4.0 ) ( 70 : 30% v / v ) at flow rate 1 ml min .
phosphate buffer was prepared by dissolving 1.36 g of potassium dihydrogen orthophosphate in one liter triple - distilled water and its ph 4.0 was adjusted with 40% orthophosphoric acid .
phosphate buffer was filtered with 0.22 m cellulose membrane under vacuum and degassed for 20 min in sonicator ( bransonic cleaning co. , usa ) before use .
data was analysed using class - vp software ( shimadzu , japan ) running on compaq pc .
hplc system was equilibrated for approximately 30 min at flow rate 1 ml min before the commencement of analysis .
the chromatographic run time was 10 min and injection volume was optimized to 20 l .
a vortex - mixer ( thermolyne , usa ) , model svc-220h speed vac concentrator ( savant , ny , usa ) and model k130 centrifuge ( bhg hermle ) , was used for sample preparation .
serum samples were stored at 60c in ultra freeze u41085 , ultra low freezer ( new brunswick scientific , usa ) .
stock solution ( 1 mg ml ) of 97/63 and is was prepared by dissolving separately 10 mg of compounds in 10 ml acetonitrile . working stock solutions of strengths 10 g ml and 50 g ml were prepared by transferring 100 l and 500 l of stock solution into volumetric flask and final volume was made up to 10 ml with acetonitrile .
these solutions were serially diluted in mobile phase by adding 10 l ml of working stocks to get 10 , 25 , 50 , 100 , 250 , and 500 ng ml concentrations . spiking solution of
is was prepared by diluting 10 l of mother stock with 1990 l of acetonitrile to yield solution of 5 g / ml . these analytical standards were used to determine hplc system reproducibility and absolute recovery for 97/63 from biomatrix used .
calibration standards ( cs ) samples of 97/63 from 10500 ng ml in rat serum were prepared by adding appropriate volumes of working stocks in 200 l of pooled rat serum so that the volume ratio of organic phase added was less than 2.5% .
qc samples at low ( 10 ng ml ) , medium ( 100 ng ml ) , and high ( 500 ng ml ) concentrations were used for the method validation program . prior to hplc analysis these cs and qc samples were processed according to method outlined in the following paragraph .
cs , qc , and test samples were prepared separately using a simple and efficient two - step liquid - liquid extraction process using n - hexane .
to the blank or spiked serum ( 200 l ) , 10 l of is was added to each sample to get 250 ng / ml of 99/411 and 3 ml of n - hexane was added .
this mixture was vortexed for 3 min followed by centrifugation at 2200 g , at 4c for 10 min .
the organic layer was transferred by snap freezing the aqueous layer in liquid nitrogen into a clean tube and evaporated to dryness in speed vac concentrator .
the dry residue was reconstituted in 200 l mobile phase and injected for analysis .
method development involved use of different columns ( cyano and rp-18 ) to check noninterference in the region of compound of interest with endogenous substances , drug metabolite , and so forth in the determination of concentration .
use of different buffers with different ph range ( ph 47 ) was checked in different compositions of various organic solvents .
hplc - uv method was validated for five days at three different concentrations ( 10 , 100 , and 500 ng ml as low , medium , and high qc resp . ) in five replicates .
the method developed was validated in terms of hplc system sensitivity , specificity , linearity , absolute recovery , accuracy , precision , freeze - thaw ( f - t ) cycle stability , long - term stability at 60c , dry residual stability , and autosampler stability .
the lower limit of detection ( lod ) for 97/63 was the quantity in the serum after the sample cleanup corresponding to three times the baseline noise ( s / n > 3 ) .
the limit of quantitation ( loq ) is the concentration of sample that can be quantified with less than 20% variation in precision .
so matrix effect was evaluated by peak area ratio of the analytes dissolved in the supernatant of processed blank serum to that of analytical standard of same concentration .
moreover highly sensitive methods could be affected by carryover , visible in lc - uv detection . in this study carryover
was evaluated by analyzing the mobile phase after plasma samples with the highest analyte concentration 2000 ng ml .
linearity for cs ( n = 6 ) in five replicates for five days was assessed by subjecting the peak area of spiked concentrations to linear regression analysis ( y = mx + c ) with 1/x weighing factor showed the best fit for the calibration curve .
the choice of proper calibration method depends on the residuals obtained and the coefficient of correlation [ 14 , 15 ] .
the recovery of 97/63 prior to analysis was determined at qc samples of low ( 10 ng ml ) , medium ( 100 ng ml ) , and high ( 500 ng ml ) concentrations .
the extraction recoveries at three qc levels were determined by comparing peak areas obtained from plasma samples with those found by direct injection of standard solutions prepared in mobile phase of same concentrations .
accuracy was determined by injection of calibration standards and qc standards in five replicates on five different days ( n = 75 , five each of low , medium , and high concentration ) .
the interday and intraday accuracy was determined by calculating % bias from the theoretical concentration using equation ( % bias = ( observed concentration nominal concentration)/nominal concentration 100 ) of quality control samples . the interday and intraday precision was determined by subjecting the data to one - way analysis of variance ( anova ) in terms of relative standard deviation ( % rsd ) .
long - term stability of 97/63 was carried by preparing qc samples at low , medium , and high concentrations in three replicates for four different days and stored at 60c .
these sets of samples were analyzed after 0 , 7 , 15 , and 30 days of storage and their concentrations were read from the respective calibration standard curve .
f - t stability of 97/63 in serum samples was determined by preparing qc of strengths low ( 10 ng ml ) , medium ( 100 ng ml ) , and high ( 500 ng ml ) in three replicates for four different days .
one set of three concentrations was analyzed on day of preparation ( no f - t cycle ) before storing the remaining sets at 60c .
other sets were analyzed after 1 , 2 , and 3 f - t cycles .
thawing was achieved by keeping the sealed tubes at room temperatures for 30 min .
the effect of storage on dry residue stability was determined at qc 10 ng ml ( low ) , 100 ng ml ( medium ) , and 500 ng ml ( high ) concentration levels .
all the samples ( three replicates of three concentrations 4 sets ) were prepared and dry residue was stored in glass tubes sealed with aluminum foil and then with parafilm .
one set in triplicate was reconstituted on day 1 with mobile phase and analyzed on the same day ( without storage ) .
the remaining sets were similarly analyzed on days 2 , 4 , and 8 and results are expressed as % deviation . after sample preparation , stability of 97/63 in the autoinjector
was evaluated for 4 h ; the maximum duration for which the sample may have to wait in the autoinjector tray for pending analysis and results are expressed in % deviation with initial injection ( t = 0 h ) .
male sprague - dawley ( sd ) rats weighing 250 25 g for this study were obtained from institutional laboratory animal division , cdri , lucknow , prior to study .
rats were given standard pellets for feeding and filtered water was given ad libitum and they were housed in well ventilated cages which were kept at room temperature on a regular 12-h light - dark cycle .
animals were kept in accordance with the guidelines of local ethical committee ( ethical approval 58/08/pkm / iaec ) for animal experimentation and principles of the guide for care and use of laboratory animals were followed ( department of health education and welfare , number [ nih ] 85 - 32 ) .
oral and iv study was carried out in two sets ( i and ii ) .
each set contained two groups , that is , groups a and b. pk was carried out by dosing 97/63 in two groups ( a and b ) containing four rats in each group for sparse sampling .
young and healthy male sd rats weighing 250 25 g ( obtained from laboratory animal division of cdri ) were housed in well ventilated cages and kept at room temperature 25 2c on a regular 12-h light - dark cycle .
animals were cared for in accordance with the principles of guide for care and use of laboratory animals .
animals in oral study group were fasted overnight to minimize the effects of food on pharmacokinetic profile of 97/63 .
intravenous dose was administered as a single bolus injection through tail vein using a 26 g needle after dilating the tail vein .
an oral dose of 72 mg kg and intravenous dose of 18 mg kg as suggested by the efficacy studies were , therefore , used in the study .
the intravenous formulation for single dose , 18 mg kg , was a solution of 97/63 in dmso .
the oral formulation for single dose , 72 mg kg , was also a solution of 97/63 in dmso .
the formulations were subjected to quality control ( qc ) checks to ensure their strength and content uniformity prior to use .
the strength of formulation for intravenous and oral administration was 18 mg ml and 36 mg ml .
compound 97/63 formulated in dmso was administered to overnight fasted rats by oral and intravenous route .
the dose volume factor for intravenous administration was 1 ml kg , with 250 g rat receiving 0.25 ml , and for oral administration it was 2 ml kg , with 250 g rat receiving 0.5 ml of formulation .
the total volume of blood withdrawn within 24 hours was less than 5% of blood volume .
blood samples were collected in glass tubes at 0.083 , 0.25 , 0.5 , 0.75 , 1 , 1.5 , 2 , 3 , 4 , 6 , 8 , 10 , 18 , 24 , 48 , and 60 h after oral dose .
blood samples were stored at room temperature for 30 min to separate the serum .
serum was separated by centrifugation at 1500 g for 10 min and stored at 60c until analysis .
curve fitting and estimation of pharmacokinetic parameters of 97/63 were carried out using winnonlin ( 5.1 ) software program ( pharsight corp , usa ) .
the data were tested using gauss - newton algorithm , with noncompartment , one compartment , and two - compartment models after applying different weighting factor to the observed values of the concentrations .
decision on the suitability of a particular compartment model in explaining the data was undertaken based on the akaike or schwarz information criterion , correlation coefficient , and scatter of residuals .
data are reported as means sd and statistical analysis was performed using one way analysis of variance ( anova ) at 95% confidence interval ( ci ) .
the successful analysis of analytes in biological fluids using hplc relies on the optimization of sample preparation , chromatographic separation , and postcolumn detection .
each of these steps was carefully optimized for developing sensitive , selective , and reproducible assay of 97/63 in rat serum .
the effect of molar strength and nature of buffers in mobile phase on peak shape of 97/63 was studied .
buffers like ammonium acetate and potassium dihydrogen orthophosphate were used for the preparation of mobile phase .
the use of buffer is particularly important in separating polar compounds on reversed phase column , since a properly chosen ph can alter the retention time of the eluting peaks .
the absence of buffer salt resulted in increased retention time , peak broadening , and hence lower sensitivity .
appropriate ratio of buffer and organic solvent leads to better separation with decreased retention time , sharpening of peak , and adequate separation from the inherent serum components .
different columns ( cyano and rp-18 ) of varying length were used to check the peak shape and retention time .
the isocratic elution with 70 : 30 acetonitrile : phosphate buffer at 1 ml min on spheri-5 , rp-18 column showed no interference with any endogenous impurity .
the retention time of 97/63 and is was 6.38 0.25 and 8.21 0.07 min , respectively .
the hplc system reproducibility was checked with five replicate injections of each analytical standard and the % bias and % rsd were between 12.51 to 12.36 at all concentrations .
the variations in the peak areas of 97/63 were maximal at 10 ng ml ( 3.9% ) and were less than 2.0% at all other concentration levels indicating that the system yields reproducible data .
the results showed that the variations were within the acceptable limit of p > 0.05 in one - way anova .
sample clean - up techniques were also optimized to get rid of interfering endogenous substances without sacrificing the recovery of 97/63 and is .
extraction solvents like n - hexane , diethyl ether , ethyl acetate , and different composition of isopropyl alcohol in n - hexane were used .
the hplc chromatogram ( figure 2 ) shows no endogenous peak interferes with peaks of interest .
the recovery of 97/63 and is from spiked serum sample was calculated by comparing the peak area with those obtained from mobile phase standards .
the absolute recoveries of 97/63 over the range 10500 ng ml from serum are summarized in table 1 .
the peak area of 97/63 in rat serum varied linearly with concentration over the range 10500 ng ml .
the calibration model was selected on individual calibration data by linear regression with or without intercept and weighing factor .
the linear regression equation was y = 5.228x 3.869 and the regression coefficient for standard calibration curve was r = 0.999 .
the % accuracy and % rsd at three concentrations in five replicates for 97/63 are presented in table 2 for complete validation in rat serum .
the result showed that the analytical method was accurate as the intraday and interday variations ( 13.42 to 14.00 ) were within the acceptable limit 20% for low and 15% for all other concentrations . similarly
the % rsd for different qc samples was between 14.8 and 4.71 , well within the acceptable limit .
97/63 was found to be stable over a period of 30 days in normal serum when stored at 60c ( figure 3(a ) ) .
the analyte was found to be stable after three f - t cycles ( figure 3(b ) ) and the dry residue after extraction was also found to be stable over a period of 8 days when stored at 60c ( figure 3(c ) ) .
the percent deviation calculated was within 20% at low concentration and within 15% for all other concentrations .
the reinjection reproducibility was established to determine if an analytical run could be reanalyzed in case of unexpected delay in analysis .
the same set of qc samples was repeated after one analysis with 4 h gap in between the samples which were stored at 4c and in all cases the deviations were less than 10% . following oral dose administration in male rats , the levels of 97/63 showed biexponential decay up to 48 h. a two - compartment 1st - order pharmacokinetic model without lag time and first - order elimination rate was considered to be the best fit to explain the generated data .
mean serum concentration - time profile of 97/63 after single oral dose of 97/63 in male rats is shown in figure 4(a ) .
table 3 summarizes the pharmacokinetic parameters of 97/63 after oral administration at 72 mg kg to male rats .
the cmax , tmax , and auc0 were found to be 229.24 64.26 ng ml , 1 0.7 h , and 1268.97 27.04 ngh
ml , respectively . the distribution ( t1/2 ) and elimination ( t1/2 ) half - life were found to be 0.84 0.14 and 10.61 0.2 h , respectively .
serum concentration - time profile of 97/63 in male rats after intravenous administration at 18 mg kg dose has been depicted in figure 4(b ) .
the initial concentration ( c0 ) and auc0 were found to be 1799.99 330.24 ng ml and 2025.75 574.3 ngh ml , respectively .
the distribution and elimination half - life were found to be 0.45 0.08 and 10.57 0.16 h , respectively .
no abnormal clinical symptoms were noted following oral and intravenous administration of 97/63 in male rats .
compound analysis by hplc - uv method is a traditional technique for quantification and quantitation as well as easily available at affordable cost .
a well developed and validated hplc - uv method is more effective as compared to lc - ms method which is a costly affair .
so various parameters responsible for development of a new assay to quantify drugs by hplc were optimized .
the chromatographic conditions such as molarity and ph of buffer and type of columns were optimized .
the results suggested that the bioanalytical method is accurate , as the bias is within the acceptance limits of 20% of the theoretical value at lloq and 15% at all other concentration levels .
the precision around the mean value never exceeded 15% at any of the concentrations studied .
data from quality control samples revealed that the proposed method shows adequate specificity , sensitivity , accuracy , and precision .
no significant matrix suppression and/or enhancement as well as no endogenous peak interference were observed with peaks of interest .
the absolute recoveries of 97/63 over the range 10500 ng ml as well as is from serum were more than 74% .
the result showed that the analytical method was accurate and precise over the linearity concentration range .
97/63 was subjected to long - term , f - t cycle , dry residual , reinjection stability studies and the compound showed good stability .
following oral and intravenous dose administration in male rats , the levels of 97/63 could be monitored in serum from the first dose sampling point , that is , 5 min . after oral administration 97/63 was rapidly absorbed from the gastrointestinal tract , attaining maximum serum level concentration ( cmax ) at 1 h after oral dose administration .
a dominant phase characterized much of the profile and exhibited clear log - linear behavior from ~6 to ~18 h after dose administration .
the absorption rate constant ( ka ) was 0.82 h. no metabolite peaks were observed in rat serum .
the observed rapid absorption of the compound after administering a single oral dose ( 72 mg kg ) may also be due to the action of cosolvent dmso which is known to have penetration enhancing property .
the low bioavailability may be due to first - pass metabolism of drug which might be excreted through the bile or variable rate of gastric emptying and motility of the gastrointestinal tract along the alimentary canal .
metabolism in intestinal membrane during course of absorption as well as in liver is of major concern with the oral administration of many drugs , since it can reduce the systemic bioavailability of the drug . during gastrointestinal transit ,
the drug gets exposed to various ph conditions , gut flora , and enzymes due to which its systematic bioavailability may be reduced .
prodrug concepts at present are established tools for better fabrication of the physicochemical , biopharmaceutical , or pharmacokinetic properties of pharmacologically active agents .
many times prodrug concept application at early stages of drug discovery program are fruitful rather than as a technique of last report due to high percentage of enhanced and successful uptake of drug by suitable prodrug formation [ 20 , 21 ] .
prodrugs provide a rationale and opportunities to reach target physicochemical , pharmacokinetic , and pharmacodynamic properties .
they can be designed to overcome pharmaceutical , pharmacokinetic , or pharmacodynamic barriers such as insufficient chemical stability , poor solubility , unacceptable taste or odor , irritation or pain , insufficient oral absorption , inadequate blood - brain barrier permeability , marked presystemic metabolism , and toxicity [ 22 , 23 ] . with these concepts early stage development of prodrugs of 97/63 was undertaken and in due course of time different derivatives of 97/63 were synthesized . among derivatised 97/63 compounds ,
the present bioanalytical assay was found to be specific , accurate , and precise over the linearity range of 10500 ng ml .
liquid - liquid extraction method for sample preparation was efficient which shows extraction recovery of 97/63 from serum more than 74% .
there were no stability problems for 97/63 during storage and sample processing hence fulfilling the criteria for bioanalytical methods .
the relevance of pharmacokinetics in drug development has been well recognized and systematic interpretation of disposition behavior is of considerable use in reducing the expenditure and time involved in drug development besides optimization of drug therapy .
thus , a suitably validated method in different species can lead to rapid pharmacokinetic studies .
the observed low bioavailability ( 15.66% ) and high variability of 97/63 can be attributed to lower log p value ( < 3.5 ) which indicates poor absorption of the compound in the aqueous medium and less lipophillic behavior and hence produrg 97/78 was synthesized as hemisuccinate derivative of 97/63 which enhanced the solubility and absorption manyfold .
Output:
| single dose pharmacokinetics study of 97/63 ( ind191710 , 2004 ) , a trioxane antimalarial developed by central drug research institute , lucknow , india , was studied in rats following intravenous and oral administration .
serum samples were analysed by hplc - uv assay .
separation was achieved on a rp-18 column attached with a guard using acetonitrile : phosphate buffer ( 70 : 30% v / v ) with uv detector at wavelength 244 nm .
serum samples were extracted with n - hexane .
two - compartment model without lag time and first - order elimination rate was considered to be the best fit to explain the generated oral and intravenous data .
method was sensitive with limit of quantification of 10 ng ml1 .
recovery was > 74% .
terminal half - life and area under curve ( auc ) after administering single oral ( 72 mg kg1 ) and intravenous ( 18 mg kg1 ) doses were 10.61 h , 10.57 h , and 1268.97 ng h ml1 , 2025.75 ng h ml1 , respectively .
after oral dose , 97/63 was rapidly absorbed attaining maximum concentration 229.24 ng ml1 at 1 h. bioavailability of 97/63 was ~16% .
the lower bioavailability of drug may be due to poor solubility and first - pass metabolism and can be improved by prodrug formation of 97/63 . |
PubmedSumm7880 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: necrotizing fasciitis ( nf ) is a rare disease of superficial fascia and subcutaneous tissue which may take a fulminating course with systemic toxicity and a high mortality rate.1 incidence of nf following obstetric operative procedures is unknown .
it often starts following trauma and , rarely , a surgical procedure.2,3 nf in the obstetric population , though rare , has a more ominous outlook than non - obstetric nf.47 various microbial agents have been incriminated in the pathogenesis of nf , with existent literature reporting a variety of gram - positive and gram - negative aerobic and anaerobic organisms.8,9 the scenario in the obstetric population is further complicated by associated comorbidities such as diabetes mellitus , malnutrition , anemia , and intravenous substance abuse.4,5 of these comorbidities , undernourishment and anemia are highly prevalent in developing countries .
the association of undernourishment in pregnant women with nf and its impact on the prognosis of nf has not been discussed adequately in the obstetric literature .
prompt correction of nutritional status improves the survival rates in these patients.10 our study aims to highlight the risk of nf in undernourished and anemic women during the postpartum period following operative intervention .
rapid correction of severe undernourishment and anemia by total parenteral nutrition and blood transfusion is vital for successful management .
an undernourished and anemic woman of 26 years old , gravida 3 para 2 , presented to our hospital on the eighth postpartum day with extensive ulceration on the right side of the perineum following normal vaginal delivery with right mediolateral episiotomy done at a primary care center . according to the patient , she started experiencing severe excruciating pain over the episiotomy wound site from the fifth postpartum day .
along with pain , she also noticed swelling and redness over the area . within the next 2 days , the skin over the area sloughed out , leaving behind a big ulcerated area over the perineum
the patient also had high fever with nausea , vomiting , and passage of loose stools . at the time of admission , the patient looked pale , toxic , and dehydrated .
her temperature was 39.4c ; pulse rate 120/minute ; blood pressure 90/60 mmhg ; and respiratory rate 24/minute .
general health of the patient was poor , with body mass index ( bmi ) 12.8 . on local examination
, an ulcer of 128 cm was seen over the right perineal area extending laterally to the inner aspect of the proximal one - fifth of the right thigh .
the ulcer had an undermined edge , and the base of the ulcer was formed by granulation tissue with slough ( figure 1 ) .
the laboratory findings were hemoglobin 7 g / dl , total leucocyte count 20,000/l , total protein level 3.82 g / dl , serum albumin level 1.14 g / dl , serum creatinine 0.46 mg / dl , random blood sugar 83 mg / dl , serum sodium 130 mmol / l , serum potassium 2.7 mmol / l , and c - reactive protein 150 mg / l .
the laboratory risk indicator for necrotizing fasciitis ( lrinec ) score was 9 , which is highly significant for nf .
based on the clinical and laboratory findings , diagnosis of nf was made and the patient was immediately transferred to the intensive care unit .
the patient was put on total parenteral nutrition and had two units of packed red blood cells transfused , and broad - spectrum antibiotics were started . at the same time , pus from the discharge site was sent for culture and sensitivity testing .
the patient was empirically started on intravenous antibiotics with piperacillin tazobactam and gentamicin and , as the drug sensitivity report showed susceptibility to these antibiotics , the same was continued .
the histopathological report confirmed the diagnosis of nf by showing necrosis of superficial fascia and subcutaneous fat , with dense infiltration of polymorphonuclear leucocytes and thrombosis of cutaneous vessels .
minimal enteral feeding was initiated on day 5 of the intensive care unit , and the patient was discontinued from parenteral nutrition on day 7 once 50% of the target nutritional requirement was achieved . split skin grafting was done after 4 weeks , and the patient was discharged on the 42nd day in good condition . a 37-year - old woman , para 3 with 2 living children ,
was referred to us from a private nursing home on the fifth day of puerperium with an extensive ulcer over the cesarean section wound .
the patient had undergone cesarean section for fetal distress . the patient had fever and severe excruciating pain over the wound despite taking analgesics .
this was accompanied by soakage of the bandage with copious discharge on the fifth postoperative day . at the time of admission , the patient was febrile , pale , and undernourished .
her vitals were temperature 38.3c , blood pressure 90/60 mmhg , pulse rate 110/minute , and respiratory rate 22/minute .
her bmi was 12.55 . on local examination , a wide area of skin and superficial tissue surrounding the surgical site
the ulcer had undermined edges with surrounding edema , induration , and redness , along with copious discharge ( figure 2 ) .
the abdomen was otherwise soft and non - tender , with presence of normal bowel sounds .
her laboratory findings were hemoglobin 6.8 g / dl , total leucocyte count 19,000/l , total protein level 4.1 gm / dl , serum albumin level 1.14 gm / dl , serum creatinine 0.68 mg / dl , random blood sugar 106 mg / dl , serum sodium 142.1 mmol / l , serum potassium 2.69 mmol / l , and c - reactive protein 27.6 mg / l .
based on the clinical features , diagnosis of nf was made and the patient started on broad - spectrum antibiotics with inj.piperacillintazobactum and inj.gentamicin .
surgical debridement was done the day after admission and all the necrotic and dead tissue was removed , leaving behind a margin of healthy looking tissue .
pus was sent for culture and sensitivity testing and showed the growth of proteus and klebsiella spp . and susceptibility to the previously started antibiotics .
the patient was also gradually started on minimal enteral feed from the fourth day and parenteral nutrition was discontinued from the sixth day . as the patient refused skin grafting , regular dressing
was done , and she was discharged after 47 days in an improved condition ( figure 3 ) .
an undernourished and anemic woman of 26 years old , gravida 3 para 2 , presented to our hospital on the eighth postpartum day with extensive ulceration on the right side of the perineum following normal vaginal delivery with right mediolateral episiotomy done at a primary care center . according to the patient , she started experiencing severe excruciating pain over the episiotomy wound site from the fifth postpartum day .
along with pain , she also noticed swelling and redness over the area . within the next 2 days , the skin over the area sloughed out , leaving behind a big ulcerated area over the perineum
the patient also had high fever with nausea , vomiting , and passage of loose stools . at the time of admission , the patient looked pale , toxic , and dehydrated .
her temperature was 39.4c ; pulse rate 120/minute ; blood pressure 90/60 mmhg ; and respiratory rate 24/minute .
general health of the patient was poor , with body mass index ( bmi ) 12.8 . on local examination
, an ulcer of 128 cm was seen over the right perineal area extending laterally to the inner aspect of the proximal one - fifth of the right thigh .
the ulcer had an undermined edge , and the base of the ulcer was formed by granulation tissue with slough ( figure 1 ) .
the laboratory findings were hemoglobin 7 g / dl , total leucocyte count 20,000/l , total protein level 3.82 g / dl , serum albumin level 1.14 g / dl , serum creatinine 0.46 mg / dl , random blood sugar 83 mg / dl , serum sodium 130 mmol / l , serum potassium 2.7 mmol / l , and c - reactive protein 150 mg / l .
the laboratory risk indicator for necrotizing fasciitis ( lrinec ) score was 9 , which is highly significant for nf .
based on the clinical and laboratory findings , diagnosis of nf was made and the patient was immediately transferred to the intensive care unit .
the patient was put on total parenteral nutrition and had two units of packed red blood cells transfused , and broad - spectrum antibiotics were started . at the same time , pus from the discharge site was sent for culture and sensitivity testing .
the patient was empirically started on intravenous antibiotics with piperacillin tazobactam and gentamicin and , as the drug sensitivity report showed susceptibility to these antibiotics , the same was continued .
the histopathological report confirmed the diagnosis of nf by showing necrosis of superficial fascia and subcutaneous fat , with dense infiltration of polymorphonuclear leucocytes and thrombosis of cutaneous vessels .
minimal enteral feeding was initiated on day 5 of the intensive care unit , and the patient was discontinued from parenteral nutrition on day 7 once 50% of the target nutritional requirement was achieved . split skin grafting was done after 4 weeks , and the patient was discharged on the 42nd day in good condition .
a 37-year - old woman , para 3 with 2 living children , was referred to us from a private nursing home on the fifth day of puerperium with an extensive ulcer over the cesarean section wound .
the patient had undergone cesarean section for fetal distress . the patient had fever and severe excruciating pain over the wound despite taking analgesics .
this was accompanied by soakage of the bandage with copious discharge on the fifth postoperative day . at the time of admission , the patient was febrile , pale , and undernourished .
her vitals were temperature 38.3c , blood pressure 90/60 mmhg , pulse rate 110/minute , and respiratory rate 22/minute .
on local examination , a wide area of skin and superficial tissue surrounding the surgical site was found to be sloughed out .
the ulcer had undermined edges with surrounding edema , induration , and redness , along with copious discharge ( figure 2 ) .
the abdomen was otherwise soft and non - tender , with presence of normal bowel sounds .
her laboratory findings were hemoglobin 6.8 g / dl , total leucocyte count 19,000/l , total protein level 4.1 gm / dl , serum albumin level 1.14 gm / dl , serum creatinine 0.68 mg / dl , random blood sugar 106 mg / dl ,
serum sodium 142.1 mmol / l , serum potassium 2.69 mmol / l , and c - reactive protein 27.6 mg / l .
based on the clinical features , diagnosis of nf was made and the patient started on broad - spectrum antibiotics with inj.piperacillintazobactum and inj.gentamicin .
surgical debridement was done the day after admission and all the necrotic and dead tissue was removed , leaving behind a margin of healthy looking tissue .
pus was sent for culture and sensitivity testing and showed the growth of proteus and klebsiella spp . and susceptibility to the previously started antibiotics .
the patient was also gradually started on minimal enteral feed from the fourth day and parenteral nutrition was discontinued from the sixth day .
as the patient refused skin grafting , regular dressing was done , and she was discharged after 47 days in an improved condition ( figure 3 ) .
the immune - suppressed state of pregnancy may be responsible for a rapid fulminant course and high mortality.36 to further complicate the picture , women in developing countries are faced with two more comorbid conditions : undernourishment and anemia .
various predisposing factors described for nf in the obstetric population are diabetes mellitus , malnutrition , and intravenous substance abuse . in our study ,
the diagnosis of severe undernourishment and anemia was made from very low bmi , and low serum total protein , serum albumin , and hemoglobin levels .
poor nutrition and concomitant immune suppression play a crucial role by impairing the host s response to modulate the immune system and contain the infection .
cellular immunity is more compromised in undernutrition and presence of devitalized tissue at the site of the wound further increases the susceptibility manifold .
severely anemic patients are more prone to developing infection . in patients with severe anemia ,
there is alteration of the proliferation of t and b lymphocytes , which causes reduction of the bactericidal activity of the phagocytes and neutrophils , hence rapid correction of severe anemia is required .
bacteriology of the infection was polymicrobial in both cases , involving klebsiella and proteus spp .
broad spectrum antibiotics started on empirical basis was found to be effective as reported in sensitivity pattern subsequently .
early local signs are edema , erythema , crepitus , fluctuation , and tenderness , which are nonspecific . as the disease progresses , the skin sloughs out rapidly , leaving an ulcer with undermined edges and copious discharge which may be malodorous .
suspicion of nf should arise with severe pain disproportionate to these local inflammatory findings and the appearance of signs of systemic toxicity .
the lrinec score was developed by wong et al11 for diagnosis of nf based on a scoring system , where scores are assigned for levels of c - reactive protein , hemoglobin , total leucocyte count , serum sodium , serum creatinine , and blood sugar .
a score of 8 or more has a strong positive predictive value for diagnosing nf .
the lrinec score was 9 in case 1 and 3 in case 2 . probably due to previous antibiotics and intravenous fluid administration following cesarean section ,
incorporation of radiological imaging , computed tomography , and magnetic resonance imaging as diagnostic tools helps in early diagnosis and determining the extent of soft - tissue infection , and thereby the subsequent limit of surgical debridement.12,13 the spread of the disease process can be delineated by the presence of gas in the area visible radiologically well before clinical assessment of the tissue.13 however , availability and cost limit the applicability of ct scans and mris . in both
most physicians still have to depend upon the clinical presentation with a strong eye of suspicion and profound awareness of nf .
although the key to successful management of nf is strong clinical suspicion and aggressive surgical debridement under antibiotic cover , women with undernourishment and anemia need further individualization .
we successfully managed two cases of nf following episiotomy and cesarean section who presented with a double challenge of undernourishment and anemia by total parenteral nutrition and blood transfusion simultaneously .
the study highlights the risk of nf in undernourished and anemic women during the postpartum period and also the importance of total parenteral nutrition and correction of the anemic state in successful management of nf .
identification of risk factors for malnutrition should be part of antenatal visits , and patients with these factors should be categorized into the high - risk group .
significant risk to the health of a woman can be anticipated from their dietetic history and socioeconomic background , as these factors play a crucial role in the health statuses of women from low- and middle - income countries .
in addition to the routine aspects , general physical examination should consist of bmi recording and observation for signs of vitamin and mineral deficiencies .
Output:
| necrotizing fasciitis , a near - fatal soft - tissue infection complicating obstetric operative wounds , is a rare entity in obstetrics .
herein , we report two cases of necrotizing fasciitis in severely undernourished and anemic women following obstetric operative procedures . both undernourishment and anemia compounded the already existing immune - suppressed state in pregnancy and may have lead to life - threatening necrotizing fasciitis .
one of the patients developed necrotizing fasciitis following episiotomy and the other following cesarean section .
both the cases were diagnosed clinically .
management was done by total parenteral nutrition , prompt correction of anemia , and surgical debridement under broad - spectrum antibiotic coverage .
the raw areas were later reconstructed by split skin grafting in the first case , whereas , in the second case , due to the patient s refusal of skin grafting , the wound was allowed to heal by secondary intention .
both patients survived , although with morbidity .
our study aims to emphasize prompt correction of comorbidities along with aggressive management of necrotizing fasciitis for better outcomes in the obstetric population .
prompt correction of nutritional status improves the survival rate . |
PubmedSumm7881 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: according to the current guidelines of the european society of cardiology ( esc ) for patients with acute myocardial infarction with persistent st - segment elevation , intravenous anticoagulation is recommended in all patients undergoing primary percutaneous coronary intervention ( pci ) .
unfractionated heparin ( ufh ) has traditionally been used in the catheterization laboratory as the anticoagulant of choice during primary pci to prevent thrombosis and ischaemic events .
however , ufh has several pharmacological limitations including a high intra- and inter - individual variability .
bivalirudin is a thrombin - specific anticoagulant , which has the ability to inactivate both free and fibrin - bound thrombin . in several randomized clinical trials ,
bivalirudin has demonstrated efficacy and safety in patients undergoing pci . in the horizons trial ,
bivalirudin reduced the primary combined endpoint including death , myocardial infarction and bleeding complications compared to heparin plus routine glycoprotein iib / iiia inhibitors ( gpi ) in patients undergoing primary pci .
moreover , cardiovascular mortality was reduced after 30 days and at 3-year follow - up .
however , the use of gpi is not always routine in clinical practice anymore and might have contributed to the increase in bleeding complications seen in the control arm . in the euromax trial ,
the use of gpi was not mandated , but was left to the standard practice of participating centres .
the euromax study design has been previously described in detail . in brief , the study enrolled patients 18 years of age or older , presenting within 12 h after the onset of symptoms with a presumed diagnosis of st - segment elevation myocardial infarction ( stemi ) .
all patients had to be scheduled for angiography with the intention of performing primary pci within 2 h after the first medical contact .
patients were identified , initial consent was obtained , randomization was performed , and study drug administration was initiated in the ambulance or in a non - pci hospital .
patients were transported urgently to the primary pci hospital , where treatment was continued and outcomes data collected .
all patients provided written , informed consent and the study was approved by local ethics committees and health authorities .
bivalirudin was to be administered as a bolus of 0.75 mg / kg , followed by an infusion of 1.75 mg / kg / h .
the protocol specified that the infusion should be continued for at least 4 h after pci at a dose of be 0.25 mg / kg / h ; however , continuation of the full dose ( 1.75 mg / kg / h ) used during pci was also permitted .
both the decision for the use and the selection of gpi agent were left up to the investigator 's discretion and preference .
the use of gpi was classified as routine when treatment commenced before or during angiography but not after the start of pci .
bailout use of gpi was permitted after the commencement of pci in both bivalirudin- and heparin - treated patients , but was limited according to the protocol only for the presence of giant thrombus or no - reflow during or after the index procedure .
patients who were assigned to the heparins group ( control group ) were to receive either ufh or low - molecular - weight heparin ( lmwh ) .
unfractionated heparin was to be administered at a dose of 100 iu / kg without a gpi or 60 iu / kg with a gpi ; lmwh was to be given as a bolus of 0.5 mg / kg .
all patients received aspirin and an approved p2y12 inhibitor as early as possible after the first medical contact
. decisions regarding access site , performance of thrombus aspiration , and stent type were left to physician preference .
the primary outcome was the composite of death from any cause or protocol major bleeding not related to coronary - artery bypass grafting ( cabg ) at 30 days .
the principal secondary 30-day outcome was a composite of death from any cause , myocardial re - infarction , or non - cabg major bleeding .
pre - specified secondary endpoints included major adverse cardiovascular events [ mace ; death , reinfarction , ischaemia - driven revascularization ( idr ) , or stroke ] , net adverse clinical events ( nace ; composite of major adverse cardiovascular events and non - cabg major bleeding ) , each of the components of the primary and principal secondary outcomes , idr , and stent thrombosis ( as defined by the academic research consortium ) .
protocol - defined major bleeding was characterized as bleeding unrelated to cabg surgery that included intracranial , retroperitoneal , or intraocular bleeding ; access - site haemorrhage requiring radiological or surgical intervention ; a reduction in the haemoglobin level of more than 4 g / dl ( 2.5 mmol / l ) without an overt source of bleeding ; a reduction in the haemoglobin level of > 3 g / dl ( 1.8 mmol / l ) with an overt source of bleeding ; reintervention for bleeding ; or use of any blood - product transfusion .
note that access - site haematomas which did not require surgical or radiological intervention were not counted as major bleeds regardless of their size .
all cases of deaths , bleeding events , reinfarction , idr , stent thrombosis , and stroke were adjudicated by a blinded , independent clinical - events committee . in the present pre - specified analysis
, we compared outcomes among patients with routine bivalirudin treatment to patients in the control arm according to gpi use ( heparin plus routine gpi vs. heparin without routine gpi ) . in patients randomized to the control arm ,
routine ( treatment of patients before or during angiography but not once pci has commenced ) or
analyses were performed in the intention - to - treat ( itt ) population , which was defined as all patients who underwent randomization and provided written informed consent . the chi - square test was used for comparisons of event rates or , in the case of sparse data , fisher 's exact test was used .
log - rank test was used to compute the significance of time - to - event data .
continuous variables are reported as medians and interquartile ranges . a p - value of < 0.05 was considered significant .
categorical variables are reported as frequencies and percentages . to account for differences in baseline characteristics in this post - randomization subgroup analysis ,
variables in the logistic regression model included : age over 65 years , female sex , anaemia , hypertension , hyperlipidaemia , diabetes , smoking , creatinine clearance 60 ml / min , choice of p2y12 inhibitor , prior myocardial infarction , prior cabg , prior pci , killip class ii , access - site ( femoral vs. radial ) , pre - pci timi flow 0/1 , single - vessel disease , placement of a drug - eluting stent , and treatment with bivalirudin vs. heparins with routine gpi vs. heparins with bailout gpi only .
the euromax study design has been previously described in detail . in brief , the study enrolled patients 18 years of age or older , presenting within 12 h after the onset of symptoms with a presumed diagnosis of st - segment elevation myocardial infarction ( stemi ) .
all patients had to be scheduled for angiography with the intention of performing primary pci within 2 h after the first medical contact .
patients were identified , initial consent was obtained , randomization was performed , and study drug administration was initiated in the ambulance or in a non - pci hospital .
patients were transported urgently to the primary pci hospital , where treatment was continued and outcomes data collected .
all patients provided written , informed consent and the study was approved by local ethics committees and health authorities .
bivalirudin was to be administered as a bolus of 0.75 mg / kg , followed by an infusion of 1.75 mg / kg / h .
the protocol specified that the infusion should be continued for at least 4 h after pci at a dose of be 0.25 mg / kg / h ; however , continuation of the full dose ( 1.75 mg / kg / h ) used during pci was also permitted .
both the decision for the use and the selection of gpi agent were left up to the investigator 's discretion and preference .
the use of gpi was classified as routine when treatment commenced before or during angiography but not after the start of pci .
bailout use of gpi was permitted after the commencement of pci in both bivalirudin- and heparin - treated patients , but was limited according to the protocol only for the presence of giant thrombus or no - reflow during or after the index procedure .
patients who were assigned to the heparins group ( control group ) were to receive either ufh or low - molecular - weight heparin ( lmwh ) .
unfractionated heparin was to be administered at a dose of 100 iu / kg without a gpi or 60 iu / kg with a gpi ; lmwh was to be given as a bolus of 0.5 mg / kg .
all patients received aspirin and an approved p2y12 inhibitor as early as possible after the first medical contact
. decisions regarding access site , performance of thrombus aspiration , and stent type were left to physician preference .
the primary outcome was the composite of death from any cause or protocol major bleeding not related to coronary - artery bypass grafting ( cabg ) at 30 days .
the principal secondary 30-day outcome was a composite of death from any cause , myocardial re - infarction , or non - cabg major bleeding .
pre - specified secondary endpoints included major adverse cardiovascular events [ mace ; death , reinfarction , ischaemia - driven revascularization ( idr ) , or stroke ] , net adverse clinical events ( nace ; composite of major adverse cardiovascular events and non - cabg major bleeding ) , each of the components of the primary and principal secondary outcomes , idr , and stent thrombosis ( as defined by the academic research consortium ) .
protocol - defined major bleeding was characterized as bleeding unrelated to cabg surgery that included intracranial , retroperitoneal , or intraocular bleeding ; access - site haemorrhage requiring radiological or surgical intervention ; a reduction in the haemoglobin level of more than 4 g / dl ( 2.5 mmol / l ) without an overt source of bleeding ; a reduction in the haemoglobin level of > 3 g / dl ( 1.8 mmol / l ) with an overt source of bleeding ; reintervention for bleeding ; or use of any blood - product transfusion .
note that access - site haematomas which did not require surgical or radiological intervention were not counted as major bleeds regardless of their size .
all cases of deaths , bleeding events , reinfarction , idr , stent thrombosis , and stroke were adjudicated by a blinded , independent clinical - events committee . in the present pre - specified analysis
, we compared outcomes among patients with routine bivalirudin treatment to patients in the control arm according to gpi use ( heparin plus routine gpi vs. heparin without routine gpi ) . in patients randomized to the control arm ,
routine ( treatment of patients before or during angiography but not once pci has commenced ) or
analyses were performed in the intention - to - treat ( itt ) population , which was defined as all patients who underwent randomization and provided written informed consent . the chi - square test was used for comparisons of event rates or , in the case of sparse data , fisher 's exact test was used .
log - rank test was used to compute the significance of time - to - event data .
categorical variables are reported as frequencies and percentages . to account for differences in baseline characteristics in this post - randomization subgroup analysis ,
variables in the logistic regression model included : age over 65 years , female sex , anaemia , hypertension , hyperlipidaemia , diabetes , smoking , creatinine clearance 60 ml / min , choice of p2y12 inhibitor , prior myocardial infarction , prior cabg , prior pci , killip class ii , access - site ( femoral vs. radial ) , pre - pci timi flow 0/1 , single - vessel disease , placement of a drug - eluting stent , and treatment with bivalirudin vs. heparins with routine gpi vs. heparins with bailout gpi only .
a total of 2198 patients ( 1089 in the bivalirudin group and 1109 in the control group ) provided formal informed consent and comprised the itt population .
a breakdown of gpi use by treatment arm is presented in figure 1 . in the control arm , 649 ( 58.5% )
patients received routine gpi and 460 ( 41.5% ) did not . in the routine gpi group ,
gpi treatment was initiated in the ambulance in 68% and during coronary angiography in 32% of patients .
of the 460 patients who did not receive routine use of a gpi , 117 ( 25.4% ) patients received it as bailout during pci and most frequently due to the presence of giant thrombus . in the bivalirudin group , 1047 ( 96% )
patients did not receive a routine gpi , while 42 ( 3.9% ) patients did , despite the fact that this was a deviation from the protocol . of
the 1047 patients who did not receive routine gpi , 83 ( 7.9% ) received it as bailout also more commonly due to the presence of giant thrombus .
gpi , glycoprotein iib / iiia inhibitor ; itt , intent - to - treat ; lmwh , low - molecular - weight heparin ; ufh , unfractionated heparin .
gpi , glycoprotein iib / iiia inhibitor ; itt , intent - to - treat ; lmwh , low - molecular - weight heparin ; ufh , unfractionated heparin .
the baseline characteristics of patients in the three groups were generally well matched between the groups , although there was a higher rate of hypertension and lower rates of killip class ii
iv and creatinine clearance 60 ml / min in the heparins with routine gpi use treatment group compared with the heparins with bailout gpi use group ( table 1 ) .
heparins + routine gpi(n = 649)n / n ( % ) heparins + bailout gpi(n = 460)n / n ( % ) bailout gpi83/1046 ( 7.9)n / a117/460 ( 25.4)age , median ( iqr ) , years61 ( 52 , 71)61 ( 52 , 71)62 ( 53 , 73)age > 65 years394 ( 36.2)245 ( 37.8)189 ( 41.1)female275 ( 25.3)144 ( 22.2)104 ( 22.6)diabetes127 ( 11.7)89/648 ( 13.7)80 ( 17.4)current smoker ( within past 30 days)453 ( 41.6)271/648 ( 41.8)201 ( 43.7)hypertension459 ( 42.2)261/648 ( 40.3)243 ( 52.8)previous myocardial infarction80 ( 7.4)65/648 ( 10.0)48 ( 10.4)previous ptca / pci97 ( 8.9)57/648 ( 8.8)51 ( 11.1)previous cabg18 ( 1.7)14/648 ( 2.2)15 ( 3.3)hyperlipidaemia398 ( 36.6)222/648 ( 34.3)195 ( 42.4)killip class ii iv77/996 ( 7.7)27/568 ( 4.8)42/432 ( 9.7)creatinine clearance 60 ml / min147/1001 ( 14.7)81/617 ( 13.1)84/381 ( 22.0)creatinine clearance > 60 ml / min854/1001 ( 85.3)536/617 ( 86.9)297/381 ( 78.0)anaemia129/987 ( 13.1)86/606 ( 14.2)62/383 ( 16.2)cabg , coronary artery bypass graft surgery ; gpi , glycoprotein iib / iiia inhibitor ; iqr , interquartile range ; n / a , not applicable ; pci , percutaneous coronary intervention ; ptca , percutaneous transluminal coronary angioplasty.data are provided for patients who were eligible for bailout use of a gpi ( i.e. those who did not receive the drug routinely).known hyperlipidaemia or on lipid - lowering drugs.p < 0.05 .
baseline characteristics cabg , coronary artery bypass graft surgery ; gpi , glycoprotein iib / iiia inhibitor ; iqr , interquartile range ; n / a , not applicable ; pci , percutaneous coronary intervention ; ptca , percutaneous transluminal coronary angioplasty .
data are provided for patients who were eligible for bailout use of a gpi ( i.e. those who did not receive the drug routinely ) . known hyperlipidaemia or on lipid - lowering drugs .
enoxaparin was used in 51/649 ( 8% ) and 43/460 ( 9% ) of patients treated with routine or with bailout gpi , respectively .
a similar percentage of patients in each group received a loading dose of a p2y12 inhibitor , with clopidogrel as the most frequently given agent .
a significantly higher percentage of patients in the heparins plus bailout gpi group received prasugrel compared with the heparins plus routine gpi group .
conversely , ticagrelor was more commonly given to patients in the heparins plus routine gpi compared with heparins with bailout gpi group .
table 2treatment and procedural characteristicsvariablebivalirudin(n=1089)n / n ( % ) heparins + routine gpi(n = 649)n / n ( % ) heparins + bailout gpi(n = 460)n / n ( % ) p2y12 loading dose1048/1066 ( 98.3)629/643 ( 97.8)429/440 ( 97.5 ) clopidogrel524/1048 ( 50.0)329/627 ( 52.5)216/429 ( 50.3 ) prasugrel*323/1048 ( 30.8)119/627 ( 19.0)187/429 ( 43.6 ) ticagrelor*201/1048 ( 19.2)179/627 ( 28.5)26/429 ( 6.1)p2y12 maintenance dose958/1065 ( 90.0)585/643 ( 91.0)384/439 ( 87.5 ) clopidogrel377/955(39.5)220/583 ( 37.7)187/381 ( 49.1 ) prasugrel*321/955 ( 33.6)135/583 ( 23.2)163/381 ( 42.8 ) ticagrelor*257/955(26.9)228/583 ( 39.1)31/381 ( 8.1)catheter access site femoral*558/1069 ( 52.2)374/631 ( 59.3)208/453 ( 45.9 ) radial510/1069 ( 47.7)257/631 ( 40.7)245/453 ( 54.1)single - vessel disease*591/1069 ( 55.3)348/631 ( 55.2)208/453 ( 45.9)pre - pci timi flow 0 to 1 * 593/931 ( 63.7)319/563 ( 56.7)244/369 ( 66.1 ) 2143/931 ( 15.4)112/563 ( 19.9)46/369 ( 12.5 ) 3195/931 ( 20.9)132/563 ( 23.4)79/369 ( 21.4)post - pci timi flow 0 to 118/930 ( 1.9)7/563 ( 1.2)9/369 ( 2.4 ) 229/930 ( 3.1)22/563 ( 3.9)9/369 ( 2.4 )
3883/930 ( 94.9)534/563 ( 94.8)351/369 ( 95.1)drug - eluting stent*538/943 ( 57.1)364/573 ( 63.5)165/373 ( 44.2)thrombectomy304/943 ( 32.2)192/573 ( 33.5)106/373 ( 28.4)balloon angioplasty only48/943 ( 5.1)29/573 ( 5.1)13/373 ( 3.5)gpi , glycoprotein iib / iiia inhibitor ; pci , percutaneous coronary intervention ; timi , thrombolysis in myocardial infarction.*p < 0.05 .
treatment and procedural characteristics gpi , glycoprotein iib / iiia inhibitor ; pci , percutaneous coronary intervention ; timi , thrombolysis in myocardial infarction .
femoral artery access , drug - eluting stent use , and the presence of single - vessel disease were all more common in the heparins plus routine gpi group , while pre - pci timi flow of 0 or 1 was more frequent among the heparins with bailout gpi patients . comparisons of unadjusted event rates between the three treatment groups are shown in table 3 . among patients treated with heparins
, there were no significant differences observed in the rates of either the primary or key secondary outcomes according to the use of gpi .
the composite of ischaemic events ( mace ) , however , was significantly lower in patients treated with heparins plus routine gpi compared with patients treated with heparin and bailout gpi ( 4.3 vs. 7.2% , p = 0.04 ) . in the comparison between bivalirudin and either of the heparins arms the results were consistent with the overall results of the main trial .
specifically , bivalirudin resulted in significantly lower rates of the primary outcome and protocol major bleeding ( table 3 , figure 2 ) , as well as a higher rate of stent thrombosis . after adjustment ,
the benefit of bivalirudin over heparins with bailout gpi for the primary outcome , major bleeding , and nace was maintained ( figures 3 and 4 ) .
table 3primary and secondary outcomes by treatment groupparameterbivalirudin(n = 1089)n ( % ) heparins + routine gpi(n = 649)n ( % ) relative risk(95% ci)p - valueheparins + bailout gpi(n = 460)n ( % ) relative risk(95% ci)p - valuerelative risk(95% ci)p - valueprimary endpoint : death or major bleeding55 ( 5.1)49 ( 7.6)0.67 ( 0.46 , 0.97)0.0345 ( 9.8)0.52 ( 0.35 , 0.75)0.00061.30 ( 0.88 , 1.91)0.19key secondary endpoint : death , mi , or major bleeding72 ( 6.6)54 ( 8.3)0.79 ( 0.57 , 1.12)0.1848 ( 10.4)0.63 ( 0.45 , 0.90)0.011.25 ( 0.87 , 1.82)0.23death32 ( 2.9)15 ( 2.3)1.27 ( 0.69 , 2.33)0.4419 ( 4.1)0.71 ( 0.41 , 1.24)0.231.79 ( 0.92 , 3.48)0.09cardiac cause27 ( 2.5)15 ( 2.3)1.07 ( 0.58 , 2.00)0.8318 ( 3.9)0.63 ( 0.35 , 1.14)0.131.69 ( 0.86 , 3.32)0.13protocol major bleeding28 ( 2.6)38 ( 5.9)0.44 ( 0.27 , 0.71)0.000729 ( 6.3)0.41 ( 0.25 , 0.68)0.00051.08 ( 0.67 , 1.72)0.76death , mi , idr , or stroke ( mace)65 ( 6.0)28 ( 4.3)1.38 ( 0.90 , 2.13)0.1433 ( 7.2)0.83 ( 0.56 , 1.25)0.371.66 ( 1.02 , 2.71)0.04death , mi , idr , stroke , or major bleeding ( nace)85 ( 7.8)62 ( 9.6)0.82 ( 0.60 , 1.12)0.2156 ( 12.2)0.64 ( 0.47 , 0.88)0.0061.27 ( 0.91 , 1.79)0.16myocardial infarction ( mi)19 ( 1.7)5 ( 0.8)2.26 ( 0.85 , 6.04)0.105 ( 1.1)0.61 ( 0.60 , 4.27)0.341.41 ( 0.41 , 4.85)0.58stent thrombosis17 ( 1.6)4 ( 0.6)2.53 ( 0.86 , 7.49)0.092 ( 0.4)3.59 ( 0.83 , 15.48)0.090.71 ( 0.13 , 3.84)0.69cabg , coronary artery bypass graft ; ci , confidence interval ; gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiovascular events ; n / a , not applicable ; nace , net adverse clinical events.relative risk ( 95% ci ) and p - value comparing bivalirudin with heparins + routine gpi.relative risk ( 95% ci ) and p - value comparing bivalirudin with heparins + bailout gpi.relative risk ( 95% ci ) and p - value comparing heparins + bailout gpi with heparins + routine gpi .
figure 2kaplan meier curves of the primary composite endpoint .
arc , academic research consortium ; gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiac events ; mi , myocardial infarction ; nace , net adverse clinical events .
gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiac events ; mi , myocardial infarction ; nace , net adverse clinical events .
primary and secondary outcomes by treatment group cabg , coronary artery bypass graft ; ci , confidence interval ; gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiovascular events ; n / a , not applicable ; nace , net adverse clinical events . relative risk ( 95% ci ) and p - value comparing bivalirudin with heparins + routine gpi .
relative risk ( 95% ci ) and p - value comparing bivalirudin with heparins + bailout gpi .
relative risk ( 95% ci ) and p - value comparing heparins + bailout gpi with heparins + routine gpi .
arc , academic research consortium ; gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiac events ; mi , myocardial infarction ; nace , net adverse clinical events .
gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiac events ; mi , myocardial infarction ; nace , net adverse clinical events .
a total of 94 patients in the control group received enoxaparin , 62 ( 66% ) of the latter were treated with routine gpi .
the rates of the primary endpoint were not different between the patients treated with enoxaparin and ufh ( 9.6 vs. 8.2% , odds ratio 1.16 , 95% ci 0.602.24 , p - value ) ( see supplementary material online , table s1 ) .
a total of 2198 patients ( 1089 in the bivalirudin group and 1109 in the control group ) provided formal informed consent and comprised the itt population .
a breakdown of gpi use by treatment arm is presented in figure 1 . in the control arm , 649 ( 58.5% )
patients received routine gpi and 460 ( 41.5% ) did not . in the routine gpi group ,
gpi treatment was initiated in the ambulance in 68% and during coronary angiography in 32% of patients .
of the 460 patients who did not receive routine use of a gpi , 117 ( 25.4% ) patients received it as bailout during pci and most frequently due to the presence of giant thrombus . in the bivalirudin group , 1047 ( 96% )
patients did not receive a routine gpi , while 42 ( 3.9% ) patients did , despite the fact that this was a deviation from the protocol . of
the 1047 patients who did not receive routine gpi , 83 ( 7.9% ) received it as bailout also more commonly due to the presence of giant thrombus .
gpi , glycoprotein iib / iiia inhibitor ; itt , intent - to - treat ; lmwh , low - molecular - weight heparin ; ufh , unfractionated heparin .
gpi , glycoprotein iib / iiia inhibitor ; itt , intent - to - treat ; lmwh , low - molecular - weight heparin ; ufh , unfractionated heparin .
the baseline characteristics of patients in the three groups were generally well matched between the groups , although there was a higher rate of hypertension and lower rates of killip class ii
iv and creatinine clearance 60 ml / min in the heparins with routine gpi use treatment group compared with the heparins with bailout gpi use group ( table 1 ) .
heparins + routine gpi(n = 649)n / n ( % ) heparins + bailout gpi(n = 460)n / n ( % ) bailout gpi83/1046 ( 7.9)n / a117/460 ( 25.4)age , median ( iqr ) , years61 ( 52 , 71)61 ( 52 , 71)62 ( 53 , 73)age > 65 years394 ( 36.2)245 ( 37.8)189 ( 41.1)female275 ( 25.3)144 ( 22.2)104 ( 22.6)diabetes127 ( 11.7)89/648 ( 13.7)80 ( 17.4)current smoker ( within past 30 days)453 ( 41.6)271/648 ( 41.8)201 ( 43.7)hypertension459 ( 42.2)261/648 ( 40.3)243 ( 52.8)previous myocardial infarction80 ( 7.4)65/648 ( 10.0)48 ( 10.4)previous ptca / pci97 ( 8.9)57/648 ( 8.8)51 ( 11.1)previous cabg18 ( 1.7)14/648 ( 2.2)15 ( 3.3)hyperlipidaemia398 ( 36.6)222/648 ( 34.3)195 ( 42.4)killip class ii iv77/996 ( 7.7)27/568 ( 4.8)42/432 ( 9.7)creatinine clearance 60 ml / min147/1001 ( 14.7)81/617 ( 13.1)84/381 ( 22.0)creatinine clearance > 60 ml / min854/1001 ( 85.3)536/617 ( 86.9)297/381 ( 78.0)anaemia129/987 ( 13.1)86/606 ( 14.2)62/383 ( 16.2)cabg , coronary artery bypass graft surgery ; gpi , glycoprotein iib / iiia inhibitor ; iqr , interquartile range ; n / a , not applicable ; pci , percutaneous coronary intervention ; ptca , percutaneous transluminal coronary angioplasty.data are provided for patients who were eligible for bailout use of a gpi ( i.e. those who did not receive the drug routinely).known hyperlipidaemia or on lipid - lowering drugs.p < 0.05 .
baseline characteristics cabg , coronary artery bypass graft surgery ; gpi , glycoprotein iib / iiia inhibitor ; iqr , interquartile range ; n / a , not applicable ; pci , percutaneous coronary intervention ; ptca , percutaneous transluminal coronary angioplasty .
data are provided for patients who were eligible for bailout use of a gpi ( i.e. those who did not receive the drug routinely ) . known hyperlipidaemia or on lipid - lowering drugs .
enoxaparin was used in 51/649 ( 8% ) and 43/460 ( 9% ) of patients treated with routine or with bailout gpi , respectively .
a similar percentage of patients in each group received a loading dose of a p2y12 inhibitor , with clopidogrel as the most frequently given agent . a significantly higher percentage of patients in the heparins plus bailout gpi group received prasugrel compared with the heparins plus routine gpi group .
conversely , ticagrelor was more commonly given to patients in the heparins plus routine gpi compared with heparins with bailout gpi group .
table 2treatment and procedural characteristicsvariablebivalirudin(n=1089)n / n ( % ) heparins + routine gpi(n = 649)n / n ( % ) heparins + bailout gpi(n = 460)n / n ( % ) p2y12 loading dose1048/1066 ( 98.3)629/643 ( 97.8)429/440 ( 97.5 ) clopidogrel524/1048 ( 50.0)329/627 ( 52.5)216/429 ( 50.3 ) prasugrel*323/1048 ( 30.8)119/627 ( 19.0)187/429 ( 43.6 ) ticagrelor*201/1048 ( 19.2)179/627 ( 28.5)26/429 ( 6.1)p2y12 maintenance dose958/1065 ( 90.0)585/643 ( 91.0)384/439 ( 87.5 ) clopidogrel377/955(39.5)220/583 ( 37.7)187/381 ( 49.1 ) prasugrel*321/955 ( 33.6)135/583 ( 23.2)163/381 ( 42.8 ) ticagrelor*257/955(26.9)228/583 ( 39.1)31/381 ( 8.1)catheter access site femoral*558/1069 ( 52.2)374/631 ( 59.3)208/453 ( 45.9 ) radial510/1069 ( 47.7)257/631 ( 40.7)245/453 ( 54.1)single - vessel disease*591/1069 ( 55.3)348/631 ( 55.2)208/453 ( 45.9)pre - pci timi flow 0 to 1 * 593/931 ( 63.7)319/563 ( 56.7)244/369 ( 66.1 ) 2143/931 ( 15.4)112/563 ( 19.9)46/369 ( 12.5 ) 3195/931 ( 20.9)132/563 ( 23.4)79/369 ( 21.4)post - pci timi flow 0 to 118/930 ( 1.9)7/563 ( 1.2)9/369 ( 2.4 ) 229/930 ( 3.1)22/563 ( 3.9)9/369 ( 2.4 ) 3883/930 ( 94.9)534/563 ( 94.8)351/369 ( 95.1)drug - eluting stent*538/943 ( 57.1)364/573 ( 63.5)165/373 ( 44.2)thrombectomy304/943 ( 32.2)192/573 ( 33.5)106/373 ( 28.4)balloon angioplasty only48/943 ( 5.1)29/573 ( 5.1)13/373 ( 3.5)gpi , glycoprotein iib / iiia inhibitor ; pci , percutaneous coronary intervention ; timi , thrombolysis in myocardial infarction.*p < 0.05 . treatment and procedural characteristics gpi , glycoprotein iib / iiia inhibitor ; pci , percutaneous coronary intervention ; timi , thrombolysis in myocardial infarction .
femoral artery access , drug - eluting stent use , and the presence of single - vessel disease were all more common in the heparins plus routine gpi group , while pre - pci timi flow of 0 or 1 was more frequent among the heparins with bailout gpi patients .
comparisons of unadjusted event rates between the three treatment groups are shown in table 3 . among patients treated with heparins
, there were no significant differences observed in the rates of either the primary or key secondary outcomes according to the use of gpi .
the composite of ischaemic events ( mace ) , however , was significantly lower in patients treated with heparins plus routine gpi compared with patients treated with heparin and bailout gpi ( 4.3 vs. 7.2% , p = 0.04 ) . in the comparison between bivalirudin and either of the heparins arms the results were consistent with the overall results of the main trial .
specifically , bivalirudin resulted in significantly lower rates of the primary outcome and protocol major bleeding ( table 3 , figure 2 ) , as well as a higher rate of stent thrombosis . after adjustment ,
the benefit of bivalirudin over heparins with bailout gpi for the primary outcome , major bleeding , and nace was maintained ( figures 3 and 4 ) .
table 3primary and secondary outcomes by treatment groupparameterbivalirudin(n = 1089)n ( % ) heparins + routine gpi(n = 649)n ( % ) relative risk(95% ci)p - valueheparins + bailout gpi(n = 460)n ( % ) relative risk(95% ci)p - valuerelative risk(95% ci)p - valueprimary endpoint : death or major bleeding55 ( 5.1)49 ( 7.6)0.67 ( 0.46 , 0.97)0.0345 ( 9.8)0.52 ( 0.35 , 0.75)0.00061.30 ( 0.88 , 1.91)0.19key secondary endpoint : death , mi , or major bleeding72 ( 6.6)54 ( 8.3)0.79 ( 0.57 , 1.12)0.1848 ( 10.4)0.63 ( 0.45 , 0.90)0.011.25 ( 0.87 , 1.82)0.23death32 ( 2.9)15 ( 2.3)1.27 ( 0.69 , 2.33)0.4419 ( 4.1)0.71 ( 0.41 , 1.24)0.231.79 ( 0.92 , 3.48)0.09cardiac cause27 ( 2.5)15 ( 2.3)1.07 ( 0.58 , 2.00)0.8318 ( 3.9)0.63 ( 0.35 , 1.14)0.131.69 ( 0.86 , 3.32)0.13protocol major bleeding28 ( 2.6)38 ( 5.9)0.44 ( 0.27 , 0.71)0.000729 ( 6.3)0.41 ( 0.25 , 0.68)0.00051.08 ( 0.67 , 1.72)0.76death , mi , idr , or stroke ( mace)65 ( 6.0)28 ( 4.3)1.38 ( 0.90 , 2.13)0.1433 ( 7.2)0.83 ( 0.56 , 1.25)0.371.66 ( 1.02 , 2.71)0.04death , mi , idr , stroke , or major bleeding ( nace)85 ( 7.8)62 ( 9.6)0.82 ( 0.60 , 1.12)0.2156 ( 12.2)0.64 ( 0.47 , 0.88)0.0061.27 ( 0.91 , 1.79)0.16myocardial infarction ( mi)19 ( 1.7)5 ( 0.8)2.26 ( 0.85 , 6.04)0.105 ( 1.1)0.61 ( 0.60 , 4.27)0.341.41 ( 0.41 , 4.85)0.58stent thrombosis17 ( 1.6)4 ( 0.6)2.53 ( 0.86 , 7.49)0.092 ( 0.4)3.59 ( 0.83 , 15.48)0.090.71 ( 0.13 , 3.84)0.69cabg , coronary artery bypass graft ; ci , confidence interval ; gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiovascular events ; n / a , not applicable ; nace , net adverse clinical events.relative risk ( 95% ci ) and p - value comparing bivalirudin with heparins + routine gpi.relative risk ( 95% ci ) and p - value comparing bivalirudin with heparins + bailout gpi.relative risk ( 95% ci ) and p - value comparing heparins + bailout gpi with heparins + routine gpi .
figure 2kaplan meier curves of the primary composite endpoint .
arc , academic research consortium ; gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiac events ; mi , myocardial infarction ; nace , net adverse clinical events .
gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiac events ; mi , myocardial infarction ; nace , net adverse clinical events .
primary and secondary outcomes by treatment group cabg , coronary artery bypass graft ; ci , confidence interval ; gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiovascular events ; n / a , not applicable ; nace , net adverse clinical events .
relative risk ( 95% ci ) and p - value comparing bivalirudin with heparins + routine gpi .
relative risk ( 95% ci ) and p - value comparing bivalirudin with heparins + bailout gpi .
relative risk ( 95% ci ) and p - value comparing heparins + bailout gpi with heparins + routine gpi .
arc , academic research consortium ; gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiac events ; mi , myocardial infarction ; nace , net adverse clinical events .
gpi , glycoprotein iib / iiia inhibitor ; idr , ischaemia - driven revascularization ; mace , major adverse cardiac events ; mi , myocardial infarction ; nace , net adverse clinical events .
a total of 94 patients in the control group received enoxaparin , 62 ( 66% ) of the latter were treated with routine gpi .
the rates of the primary endpoint were not different between the patients treated with enoxaparin and ufh ( 9.6 vs. 8.2% , odds ratio 1.16 , 95% ci 0.602.24 , p - value ) ( see supplementary material online , table s1 ) .
the main finding of this pre - specified subgroup analysis of the euromax trial is that a strategy of upstream bivalirudin with bailout use of gpi in < 10% of patients reduces the composite endpoint of death or major bleeding compared with a strategy of heparins plus bailout use of gpi and a strategy of heparins plus a routine upstream use of gpi in patients with stemi scheduled for primary pci .
although this analysis was pre - specified , it still represents a post - randomization subgroup comparison within an open - label trial and should therefore be considered as hypothesis generating rather than definitive . in the horizons - ami trial ,
bivalirudin administered in the hospital reduced the combined clinical endpoint of death , myocardial infraction , and major bleeding compared with ufh and routine use of gpi .
however , contemporary practice has since evolved to include earlier treatment with initiation in the pre - hospital phase , increasing use of prasugrel and ticagrelor and a rise in the adoption of the radial approach .
one point of criticism on horizons - ami has been the routine use of gpi , which is not recommended in the current esc - stemi guidelines and many operators have adopted a bailout only strategy for gpi .
it has been argued that the routine use of gpi may have contributed to the higher bleeding rate , without any benefit on ischaemic outcomes . however , several randomized trials have consistently shown the benefit of gpi when added to heparin in this setting . in the on time-2 trial , upstream tirofiban given in the ambulance was beneficial compared with selective use during primary pci .
the euromax trial tested the hypothesis that bivalirudin , started upstream before primary pci , is beneficial in the context of the use of the new antiplatelet drugs prasugrel and ticagrelor and a high use of radial access .
the results of this pre - specified subgroup analysis are consistent with the overall trial results and provide evidence that the benefits of bivalirudin over heparins are consistent regardless of the use of gpi .
interestingly , the strategy of upstream heparins alone with bailout gpi was associated even with higher ischaemic and bleeding complications compared with the routine use of heparin and upstream gpi , replicating the results of on - time 2 . in a previous randomized trial comparing bivalirudin vs. heparin during pci in patients with acute coronary syndromes ,
bivalirudin reduced ischaemic complications ( 6.2 vs. 7.9% , p = 0.039 ) and bleeding complications ( 3.5 vs. 9.3% , p < 0.001 ) compared with heparin .
a recent meta - analysis found a consistent reduction of bleeding complications of bivalirudin vs. heparin regardless of the bleeding risk of the patients .
the advantage of bivalirudin was observed regardless of the planned ( or = 0.58 , 95% ci 0.470.72 ) or provisional use ( or = 0.40 , 95% ci 0.320.51 ) .
importantly , patients treated with bivalirudin were at higher risk for acute stent thrombosis , an observation consistent with the results of horizons - ami .
the excess risk for acute stent thrombosis was limited to the first 4 h after the index procedure and was probably the result of the combination of the short half - life and rapid clearance of bivalirudin and the delayed bioavailability of the oral p2y12 inhibitors , including the newer agents prasugrel and ticagrelor .
possible treatments that could mitigate this risk could include co - administration of ufh , prolongation of the bivalirudin infusion at the pci dose for the first few hours after the procedure , or the use of an immediate acting p2y12 inhibitor such as cangrelor ; however , they will need to be tested in prospective trials .
the decision to use an upstream therapy with heparin only or heparin plus routine gpi was completely left to the discretion of the investigators and therefore , the equilibrium of randomization in baseline characteristics is potentially lost .
therefore , these results should be considered as hypothesis generating rather than definitive . since enoxaparin was given in only 94 ( 8.4% ) patients the results apply only to the use of ufh , which has been shown to be inferior to enoxaparin in the atoll trial .
euromax was an open - label trial due to the logistic difficulties related to implementation of complex antithrombotic regimens in the pre - hospital setting while rushing patients to primary pci .
however , all events were reviewed by a central adjudication committee blinded to treatment allocation .
in this pre - specified subgroup analysis from euromax , pre - hospital bivalirudin reduced the composite outcome of death or major bleeding compared with both heparins with routine gpi and heparins with only bailout gpi , an effect largely driven by marked reductions in major bleeding .
this work was supported by the medicines company , parsippany , nj , usa . funding to pay the open access publication charges for this article was provided by the medicines company , new york , usa .
Output:
| aimsin the horizons trial , in - hospital treatment with bivalirudin reduced bleeding and mortality in primary percutaneous coronary intervention ( pci ) compared with heparin and routine glycoprotein iib / iiia inhibitors ( gpi ) .
it is unknown whether this advantage of bivalirudin is observed in comparison with heparins only with gpi used as bailout.methods and resultsin the euromax study , 2198 patients with st - segment elevation myocardial infarction ( stemi ) were randomized during transport for primary pci to bivalirudin or to heparins with optional gpi .
primary and principal outcome was the composites of death or non - cabg - related major bleeding at 30 days . this pre - specified analysis compared patients receiving bivalirudin ( n = 1089 ) with those receiving heparins with routine upstream gpi ( n = 649 ) and those receiving heparins only with gpi use restricted to bailout ( n = 460 ) .
the primary outcome death and major bleeding occurred in 5.1% with bivalirudin , 7.6% with heparin plus routine gpi ( hr 0.67 and 95% ci 0.460.97 , p = 0.034 ) , and 9.8% with heparins plus bailout gpi ( hr 0.52 and 95% ci 0.350.75 , p = 0.006 ) .
following adjustment by logistic regression , bivalirudin was still associated with significantly lower rates of the primary outcome ( odds ratio 0.53 , 95% ci 0.330.87 ) and major bleeding ( odds ratio 0.44 , 95% ci 0.240.82 ) compared with heparins alone with bailout gpi .
rates of stent thrombosis were higher with bivalirudin ( 1.6 vs. 0.6 vs. 0.4% , p = 0.09 and 0.09).conclusionbivalirudin , started during transport for primary pci , reduces major bleeding compared with both patients treated with heparin only plus bailout gpi and patients treated with heparin and routine gpi , but increased stent thrombosis . |
PubmedSumm7882 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: . however , focal abnormalities on electroencephalography ( eeg ) have also been observed in patients with generalized epilepsy . in such cases
, it is supposed that the cortical focus drives widespread epileptic networks that results in generalized seizures .
, we describe a patient who had eyelid myoclonia with absences , along with focal motor seizures .
ictal video - eeg recording showed generalized spike waves preceded by focal frontal discharges , suggesting that focal cortical abnormalities may induce eyelid myoclonia with absences .
the patient is a 7-year - old boy who exhibited eyelid myoclonia with absence seizures .
since the age of 5 years , he complained of involuntary movements of the eyelids , which occurred a few times per week . a physician diagnosed this as a tic disorder .
however , his parents and brother noticed brief episodes of unresponsiveness , often associated with jerks of the eyelids , lasting 35 s. these episodes gradually increased in frequency , occurring many times a day .
eyelid movement appeared like rapid blinking and was often accompanied with upward deviation of the eyeballs and retropulsion of the head .
1 ) . further , eeg recording during the interictal period showed normal background activity and focal epileptiform discharges over the frontal regions ( fig .
however , he experienced a focal motor seizure with impairment of consciousness and a generalized tonic seizure during sleep in the next 2 years .
the focal seizures consisted of clonic movements of the right upper limb and upward deviation of the eyeballs , lasting less than a minute . the onset of the generalized seizure was not detected .
when the patient started to have focal seizures , he underwent mri scanning of the brain , the result of which showed no abnormality .
we describe the case of a patient with eyelid myoclonia with absences who had been misdiagnosed with facial tic disorder .
our patient had eyelid myoclonia that appeared like rapid blinking and was often associated with jerky upward deviation of the eyeballs and retropulsion of the head .
the absences were brief , lasting 35 s. ictal eeg revealed 4- to 5-hz generalized polyspike waves .
these electroclinical features were in contrast to those of a typical absence seizure in childhood absence epilepsy wherein the eyes look straight ahead , and the absence seizures are associated with 3-hz spike - and - wave discharges over a longer duration .
eyelid myoclonia has been well recognized as the clinical feature of seizures in individuals with generalized epilepsy .
jeavons syndrome , a form of generalized epilepsy , is clinically characterized by the triad of eyelid myoclonia with or without absences , eye closure - induced seizures or eeg paroxysms , and photosensitivity .
electroencephalographic manifestations have been described as focal frontal or occipital predominant epileptiform discharges followed by generalized epileptiform discharges in both interictal and ictal recordings .
thus , it has been suggested that either the frontal or the occipital lobe initiates eyelid myoclonia .
a recent cortical stimulation study has demonstrated that vertical upward eye movements can be induced by electrical stimulation of the frontal eye field ( fef ) , which is located in the frontal cortex .
upward deviation of the eyeballs occured with frontal epileptiform activity in a patient with epilepsy .
a subgroup of children with absence epilepsy showed an eeg epileptic abnormality with frontal onset of the typical generalized 3-hz spike - and - wave discharges .
dense - array eeg , a technique that improves the spatial resolution of scalp eeg , has demonstrated that selective cortical networks in the frontal lobe are involved in the propagation of ictal discharges in absence seizures .
further , microarchitectural abnormalities in the frontal lobe have also been reported as potential facilitators of seizures in juvenile myoclonic epilepsy , another generalized epilepsy . in generalized epilepsy
, many brain regions have a tendency to reach an epileptogenicity level that exceeds the seizure threshold .
thus , generalized seizures may start from focal brain regions and tend to generalize very fast .
eyelid myoclonia with absences may represent a type of secondarily generalized seizure originating in the frontal lobe . in conclusion
, our case suggests an important role of the frontal lobe in the generation of eyelid myoclonia with absences .
eyelid myoclonia with absences is a unique type of absence seizure associated with a variety of epilepsy syndromes .
our case supports the concept that there is no absolute distinction between generalized and focal epilepsy but rather a continuum .
Output:
| eyelid myoclonia with absences is classified as a unique type of generalized seizure .
its pathogenesis is proposed to involve the functional abnormalities in cortical subcortical networks . here
, we describe the case of a 7-year - old boy who had eyelid myoclonia with absences , along with focal motor seizures .
video - eeg monitoring demonstrated eyelid myoclonia associated with 4- to 5-hz generalized polyspike
waves preceded by focal frontal discharges .
interictal eeg showed focal epileptiform discharges over the frontal regions .
our case suggests an important role of the frontal lobe in the generation of eyelid myoclonia with absences . |
PubmedSumm7883 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| lantibiotics are
a family of antibacterial peptide natural products
characterized by the post - translational installation of the thioether - containing
amino acids lanthionine and methyllanthionine . until recently , only
a single naturally occurring stereochemical configuration for
each
of these cross - links was known .
the discovery of lantibiotics with
alternative lanthionine and methyllanthionine stereochemistry has
prompted an investigation of its importance to biological activity .
here , solid - supported chemical synthesis enabled the total synthesis
of the lantibiotic lacticin 481 and analogues containing cross - links
with non - native stereochemical configurations .
biological evaluation
revealed that these alterations abolished the antibacterial activity
in all of the analogues , revealing the critical importance of the
enzymatically installed stereochemistry for the biological activity
of lacticin 481 . |
PubmedSumm7884 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: primary dysmenorrhea is a gynecological condition characterized by severe uterinepain during menstruation with a prevalence rateranging between 25% and 90% , inthe absence ofpelvicpathology .
it is very common during the teenage years after the menarche and less often in women after the age of 20 - 25 years .
the main symptoms are pain , nausea , vomiting , cramps , diarrhea , headache and syncope , which appear to be associated with menstruation with no any organic or pathological cause .
current evidences suggest that molecular compounds called prostaglandins are released during menstruation due to endometrial cells destruction .
pge2 stimulates uterine contractions , cervical narrowing and increases vasopressin release , which leads to ischemia and pain .
symptoms are frequently associated with socioeconomic difficulties such as loosing timeand absence of school or work . despite the frequency and scores of dysmenorrhea , most women often do not seek medical treatment .
the common treatments for dysmenorrhea are non - steroidal anti - inflammatory drugs ( nsaids ) and oral contraceptive pills , both of which work by reducing uterine contractions . due to the possible side effects of chemical drugs
there is evidences confirming that the nutritional intake and metabolism may play an important role in the cause and treatment of menstrual disorders .
thyme with broncholytic and secretomotoric effectson beta receptors is an essential element of shirazi thymus vulgaris that has already been used to reducethepain severity of menstrual disorders , probably due to thymol and carvacrol components , and its effects on smooth muscles of the trachea and ileum .
also the effect of thymus vulgaris on induced spasms in guinea - pig trachea has been investigated . the present clinical trial study aimed to compare the impact of the shirazi thymus vulgaris as an herbal medication and the ibuprofen as a classic medication in treatment ofprimary dysmenorrhea .
a written informed consent form was taken from each participant prior to the enrolment to the study .
sample size was computed using =5% and absolute error equal to 0.22 for correlation between medication and pain with acceptable absolute precision formula ( aapf ) . as the medication is licensed under the pharmacological regulations applied by the iranian pharmacopeia
data were analyzed using t - test chi - square test , mann - whitney u test , and t - test . a randomized , single - blind clinical trial ( irct201105236575n1 )
was conducted amongst 120 single students aged 18 - 25 years who suffered from the primary dysmenorrhea at the ilam university of medical sciences .
a check listwas used to collect the demographic data , menstrual history , smoking , diet , exercise and past medical and reproductive histories .
the primary outcome was intensity of menstrual pain , which was determined by the visual analogue scale ( vas ) to record pain severity ( 0=no pain , 10=unbearable pain ) .
participants who were single , suffered from primary dysmenorrheal , accommodated at the campus of ilam university of medical sciences and had no pathological disorders were included in this study .
the eligible participants fulfilled the self - completed questioner and the scale form and were visited physically by a licensed gynecologist before randomization .
stratification was done according to the scores of the pain ( mild : 1 - 3 ; moderate : 4 - 7 ; severe : 8 - 10 ) .
the extent of pain was evaluated using the cox menstrual symptom scale ( cmss ) , ( having no pain 0 , for 0.5 hours 1 , for 0.5 1 hours 2 , for several hours 3 and several days 4 ) .
each participant was randomly assigned to the herbal treatment ( shirazi thymus vulgaris ) , or the classic treatment ( anti - pg drug ibuprofen ) , ending with 60 participants in each group equally . according to the iranian pharmacopoeia , product of bronco - td , each 100 ml containing 25 mgzatariamultiflora ,
therefore , the first herbal group received 5 ml of the shirazi thymus vulgaris which , commercially named bronchot.d and is one of the formulateddrug used by the iranian pharmacopeia and according to the results of other studies , orally four times daily until the pain score reached less than 3 ( mild score ) .
the participants were permitted to take another drug that they usually took for their pain relief , in addition to the allocated treatment in case of continued pain . however , at the end of the trial , these participants were excluded in data analysis .
changes in the scores and the pain duration of clinical trial participants were compared at the first and second months in both groups .
statistical comparisons were determined using the mann - whitney u test , unpaired t - test , and within - group comparisons were analyzed by paired t test or wilcox on matched pairs rank sum test for paired data as appropriate .
this study was undertaken with the approval of the ethical committee of the ilam university of medical sciences .
the participation in the study was voluntary and the participants were free to withdraw from the study whenever they wished .
there was no significant differences between the two groups in terms of characteristics studied at randomization .
the symptoms reported during menstruation were as follows : all the participants showed uterus cramps among which those with low back pain were ( 44.1% ) , fatigue ( 22.6% ) , nausea ( 12.9% ) , headache ( 11.8% ) , diarrhea ( 7.5% ) and vomiting ( 1.1% ) , respectively .
all subjects evaluated for tow cycles . about 3 hours after intervention at the first day of menstruation the mean of pain severity amongst the herbal group was decreased from 7.480.69 to 5.371.59 while among the classical group it was lowered from 7.150.78 to 5.310.95 , respectively using the given dose ( explained at method section ) .
there was no statistically significant decrease in pain score and pain duration in the women who received classic treatment compared to those in herbal group .
the comparison of pain duration between two groups in the first month of intervention . in the second day of intervention ,
32.3% of participants in the herbal group and 24.8% in the classic group had mild score of pain and therefore did not ask for more interventions .
there was no significant difference in pain score between groups at the second month of intervention ( p<0.54 ) .
researches have already identified the over - production of uterine prostaglandins such as prostaglandins f2 and e2 as a contributing factor to primary dysmenorrhoea .
these trials confirmsthat nsaids inhibit the cyclooxygenase enzymes leading to inhibit the production of prostaglandins . in the present study ,
both herbal and classic treatments had equivalently reduced the severity and the duration of primary dysmenorrhea .
the effects of zatariamultiflord as an herbal treatment can be attributed to the reduction of pg synthesis by its acting as an antispasmodic and anti - pg .
marjoribanks et al . in a review study , evaluated 63 individuals in a randomized controlled trial in women with primary dysmenorrhea and found that nsaids were more effective than placebo for pain relief ( or 7.91 ; 95% ci 5.6511.09 ) , although overall adverse effects were also significantly more common among customers ( or 1.52 ; 95% ci 1.092.12 ) , .
a recent research has evaluated the effects of zatariamultiflora essential oil on primary dysmenorrhea in which participants were randomly divided into three groups : the first group received placebo , the second group received the essence of zatariamultiflora 1% and the third group received the essence of zatariamultiflora 2% .
results showed that mean dysmenorrhea severity was decreased from 7.81.6 to 7.4 1.8 in placebo group , from 7.31.5 to 3.11.5 in zatariamultiflora essential oil 1% group and from 7.51.7 to 2.61.4 in zatariamultiflora essential oil 2% group , respectively .
a significant difference was reported between two treated groups compared to the placebo group . in another randomized , double - blind trial ; the effect of an iranian herbal drug on the treatment of primary dysmenorrhea has been examined .
the participants were randomly divided into three groups : herbal drug ( a combination of saffron , celery seed , and anise ) , mefenamic acid , and placebo groups .
after an intervention , pain scores was reduced significantly and pain duration scores was also decreased in the herbal group ( p<0.001 ) as well as mefenamic acid group ( p<0.01 ) compared to the placebo group . in another clinical trial which evaluated the effects of valerian officinal ,
these results suggest that zatariamultiflord as an herbal treatment represents an effective treatment for primary dysmenorrhea .
Output:
| objective : primary dysmenorrhea is defined as painful cramps during menstruation with no pelvic pathology . due to the adverse effects of non - steroidal anti - inflammatory drugs ( nsaids ) are considered as the most common pharmacological treatment for this disorder .
the present study was conducted to assess the impact of shirazi thymus vulgaris compared to that of ibuprofen on primary dysmenorrhea.materials and methods : a randomized , single - blind clinical trial was conducted amongst 120 female students ofilam university of medical sciences , aged 18 - 25 years who suffered from primary dysmenorrhea .
the participants were randomly divided into two groups ; one received the herbal and the other classical treatments .
the herbal group received 5 ml of the shirazi thymus vulgaris medication that commercially called bronchot.d , orally four times a day .
the classic group received ibuprofen orally three times a day . a visual analogue scale ( vas )
was used to record pain severity.results:pain severity was reduced in both herbal and classic groups with no significant differences .
pain duration at the first and second month of treatment was also similar between two groups.conclusions:shirazi thymus vulgaris decreased dysmenorrhea symptoms , which might be attributed to its antispasmodic effects .
the herbal shirazi thymus vulgaris can be recommended as an effective medication fortreatment of the primary dysmenorrhea disorder . |
PubmedSumm7885 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the double duct sign is a simultaneous dilatation of both the pancreatic duct ( pd ) and the common bile duct ( cbd ) and is usually a result of narrowing of terminal parts of both the ducts due to various causes including encasement of the cbd and main pd by a pancreatic head tumour , ampullary carcinoma , pancreatitis and periampullary stenosis .
we report a 54-year - old male who came with abdominal pain and was found to have an unusual etiology of double duct sign .
a 54-year - old man presented to us with right upper abdominal pain of 4 months duration .
the pain was episodic , severe and used to last around h and occurred in relation to meals .
there was no associated vomiting , jaundice , fever , loss of weight or appetite .
he had a history of chronic alcohol abuse as well as oral opium ingestion for last 25 years .
he used to daily consume oral powdered form of opium husk ( vernacular bhukki ) .
blood tests revealed a serum bilirubin of 1.0 mg / dl ( normal , 0.2 - 1.4 mg / dl ) , aspartate aminotransferase of 47 u / l ( normal 1 - 35
u / l ) , alanine aminotransferase of 41 u / l ( normal , 1 - 35 u / l ) and alkaline phosphatase 156 u / l ( normal , 20 - 128 u / l ) . abdominal ultrasound revealed a dilated anechoic cbd with mild central intra - hepatic biliary radical dilatation and dilated pd .
contrast enhanced computed tomography of the abdomen showed a double duct sign with cbd dilated until lower end and a dilated pd [ figure 1 ] .
endoscopic ultrasound ( eus ) using a linear echoendoscope ( gf - uct 180 linear echoendoscope , olympus corp , tokyo ) revealed simultaneous dilatation of the cbd and pd ( double duct sign ) with anechoic lumens of both the ducts .
the ampullary region revealed a prominent hypoechoic layer suggestive of muscular hypertrophy [ figure 3 ] .
a diagnosis of opium - induced sphincter of oddi dysfunction ( sod ) was made , and patient underwent biliary sphincterotomy with improvement in his symptoms and normalization of his liver enzymes .
post sphincterotomy spy glass cholangioscopy ( boston scientific corp , natick , mass ) was also done for evaluation of the bile duct mucosa at the terminal end and it revealed normal mucosa [ figure 4 ] . he was referred for de - addiction and was asymptomatic after 3 months follow - up .
abdominal computed tomography showing dilated common bile duct ( arrow ) side viewing endoscopy revealing a bulky papilla endoscopic ultrasound showing dilated common bile duct and pancreatic duct with hypoechoic prominence at lower end ( arrow ) spy glass done for evaluation of common bile duct .
sphincter of oddi dysfunction is a benign , non - calculous obstruction at the major duodenal papilla that can produce variable clinical symptoms including pancreaticobiliary pain , cholestasis , and/or pancreatitis .
opiates produce multiple pharmacologic effects in the gastrointestinal tract with constipation being the most common .
constant prolonged use of this drug might be responsible for the contraction and permanent dysfunction of the sphincter of oddi and sod due to chronic opium use is now recognized as a distinct clinical entity .
clinical features of this entity are variable and may consist of anorexia , weight loss , constipation and abdominal tenderness .
the endoscopic visualization of the second part of the duodenum may reveal a prominent papilla , but even ulcerative and tumourous changes are common in opium related sod and therefore it is important to carefully exclude the malignancy .
eus is an important investigation for excluding the malignancy as even small lesions in the ampullary area can be detected by a carefully performed eus .
eus can also help in the detection of hypertrophy of the muscular sphincter of oddi as was seen in the index case .
the response to biliary sphincterotomy in such cases is excellent as was in the present case .
the case is reported because opium abuse is an uncommon cause of sod and the history of opium abuse must be sought in patients with unexplained biliary dilatation or dual duct dilatation and residing in areas where opium abuse is common .
furthermore , eus provides an excellent modality to rule out small malignant lesions resulting in double duct sign .
Output:
| double duct sign where there is a simultaneous dilatation of both the common bile duct ( cbd ) and pancreatic duct is usually associated with sinister causes like malignancies of pancreatic head or ampulla .
occasionally , benign causes like chronic pancreatitis or sphincter of oddi dysfunction ( sod ) may cause double duct sign .
chronic opium abuse is a rare cause of the double duct sign , and endoscopic ultrasound ( eus ) findings of this rare entity have been occasionally reported .
we report about a 54-year - old male with a history of chronic alcohol and opioid abuse evaluated for episodes of abdominal pain and found to have opioid - related sod and improved with biliary sphincterotomy .
eus was done to rule out malignancy and revealed hypoechoic prominence around terminal cbd suggestive of hypertrophied muscle . |
PubmedSumm7886 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: abdomen is the third most commonly injured region of the body , involving 20% of all injured civilians who undergo surgical intervention . penetrating wounds represent 25% of all urban traumas which include gunshot , shotgun and stab wounds .
these injuries are potentially life threatening and often warrant exploration . penetrating wounds presenting with in situ objects
are rarely encountered , and anesthetic and surgical management is complex due to inability in positioning the patient and the risk of sudden hemorrhage .
the anaesthetic management of these types of injuries is challenging with respect to airway control , urgency for the surgery and associated hemodynamic instability .
we report the management of a patient , who presented with through and through penetrating injury of the abdomen with an intact penetrating object projecting posteriorly .
a 50-year - old male patient was brought to the emergency medicine department ( emd ) with an in situ 2.8 heavy metallic bar projecting over the back in a through and through penetrating abdomen injury following road traffic accident ( rta ) .
the entry and exit wounds were in the back in the midline at l3 level and right iliac fossa , respectively [ figures 1 and 2 ] .
the penetrating heavy metallic bar had to be cut from the three wheeler vehicle prior to transporting the patient to hospital . penetrated object visible in anaesthetized patient . note a )
icd tube b ) inability to support the fractured pelvis . penetrating foreign body and nylon bag visible through anterior abdominal wall the patient presented with acute dyspnea , cough and abdominal pain .
he was in hypovolemic shock with blood pressure 76/30 mm of hg and pulse rate 140/minute and with cold extremities .
auscultation revealed decreased air entry in the right thorax with oxygen saturation on room air of 80% .
oxygen supplementation ( 8 l / minute ) with face mask and intravenous fluids were started .
abdomen displayed an iron bar which had entered through the back , and at its tip , another foreign body ( nylon bag ! ) was visible through an open anterior abdominal wall wound [ figures 13 ] .
intercostal drainage ( icd ) was planned but insertion was difficult owing to difficulty in positioning the restless patient .
the patient was rushed immediately to operating room ( or ) in a lateral position .
he was positioned supine over two operating tables arranged in parallel [ figure 4 ] , such that the metallic rod was positioned in between them .
icd was placed in the right 4th intercostal space and simultaneously anaesthesia was induced with intravenous ketamine 100 mg .
succinylcholine 75 mg i.v . was administered and modified rapid sequence tracheal intubation was performed .
anaesthesia was maintained with 50% air - oxygen mixture , fentanyl 2 mcg / kg , sevoflurane and vecuronium .
volume replacement with colloids and crystalloids along with dopamine 5 - 8 mcg / kg / minute were needed to maintain intraoperative blood pressures .
a central venous catheter was placed in the right subclavian vein and central venous pressure ( cvp ) was monitored .
two and a half liters of crystalloids , 2 units of plasma and 4 units of whole blood were replaced .
the patient was repositioned semi - laterally so as to visualize both ends of the foreign body which was then accessed and removed by anterolateral laparotomy approach .
laparotomy revealed retroperitoneal haematoma , lower renal pole injury , multiple mesenteric vascular tears and bowel injury .
postoperatively , the patient was mechanically ventilated for 8 hours and trachea was extubated , once hemodynamically stable .
rusted metallic bar with nylon bag operating room ( or ) tables in parallel , avoiding the foreign body hinging
although penetrating injuries of abdomen are common , presentation with projecting in - situ foreign bodies is rare .
various types of objects causing such injury include glass , knife , barbed wire , bearing scrapper , plank , forklift , broomstick and metal hooks .
survival following a through and through penetrating thoraco - abdominal injury with a large heavy iron rod is rare and rarer still when associated with polytrauma .
difficulties in managing such a patient are manifold due to hypoxia , hemorrhagic shock , urgency of surgical intervention and inability to position the patient supine .
airway control may be challenging if the projecting object in the back precludes supine positioning and any inadvertent manipulation can result in sudden collapse of the patient . resuscitation and close monitoring prior to and during surgery , especially at
the time of removal of penetrating object , is vital with anticipation of major vascular injuries .
there was delay in reaching the hospital as the penetrated metallic rod had to be cut from the vehicle .
progressive dyspnea , due to chest injury with fracture ribs mandated emergency icd insertion to relieve hemopneumothorax . however , icd insertion was not possible in the emd as the intoxicated , full stomach patient , with worsening hypoxia and hypotension was getting progressively restless .
cvp measurement and stomach tube insertion ( to empty the gastric contents ) , though ideally required prior to anaesthetic administration , were not possible due to the above reasons .
induction of anaesthesia in the emd was required , but inability to position the patient supine was a major hurdle .
tracheal intubation with the patient in lateral position was not practical as the long metal bar was projecting and there was associated chest injury and pelvic fracture . to position the patient supine without disturbing the projecting metal rod on the back , a two - table technique
two parallel tables were arranged and patient was positioned in such a way that the projecting rod takes the space between the two .
this two - table technique is a safe and simple solution for this life - threatening situation with projecting objects over back of chest and abdomen . during the removal of foreign body , anticipation of sudden gushing out of blood from an injured major vessel
surgical removal of the foreign body may relieve the plugging effect of the foreign body on the breach in the injured blood vessel wall .
fortuitously , our patient did not have any injury to the inferior vena cava or aorta although such association is well known . continued hypotension may indicate bleeding elsewhere and our patient also had an associated pelvic fracture with hematoma .
modified rapid sequence induction - intubation with ketamine in this circumstance may be the choice.[57 ] emergently placed icd relieved the pneumothorax , improved the blood pressure and saturation .
right side was preferred for subclavian central venous catheter as icd tube was already in place for the pneumothorax .
dopamine infusion was started along with volume replacement to maintain adequate blood pressure and organ perfusion .
advanced trauma life support ( atls ) curriculum advocates rapid infusion of up to 2 l of warmed isotonic crystalloid solution for any hypovolemic , hypothermic patient to restore normal bp and urine output .
Output:
| penetrating abdominal injuries are potentially life threatening due to the associated hemorrhagic shock and visceral injury . through and through penetrating injury with polytrauma is rarely encountered .
we report a case presenting with in situ projecting heavy metallic rod in a through and through penetrating abdominal injury along with foreign body in a road traffic accident .
anaesthetic management was difficult due to inability to position in supine , rapidly progressing hemorrhagic shock and hypoxia due hemopneumothorax .
two operating tables were used with adequate intervening space to accommodate the posteriorly projecting metallic rod during intubation in supine position .
intensive monitoring and resuscitation resulted in uneventful successful outcome . |
PubmedSumm7887 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: drinking water quality is a worldwide concern and has the greatest impact on human health ( 1 ) .
consumption of contaminated drinking water was associated with 80 percent of disease and one third of death in developing countries ( 2 ) .
therefore , an essential basic requirement for health protection is to provide the public with adequate supply of drinking water that is safe ( 3 ) .
advances in water treatment have significantly increased the quality and specially the safety of water ( 4 ) . however , drinking water quality can deteriorate by microbial and toxic chemicals during transport , storage and handling before reaching the consumer ( 5 , 6 ) .
distribution systems , service lines and home devices could influence the quality of drinking water ( 5 ) .
prevailing conditions in the devices that influence bacterial proliferation include high surface to volume ratio , absence or very low of chlorine residual and relative long stagnation period ( 7 ) .
biofilms , which are well organized communities of microorganisms , are wide spread in the nature .
they constitute a major problem in many environmental , industrial and medical settings ( 8) . the presence of dissolved organic compounds in finished drinking water is responsible for growth of bacteria and colonization of water surfaces ( 5 ) .
biofilm formation is also a concern from public health because it plays a key role in the persistence of bacteria in water systems and protects the bacteria from adverse environmental conditions , including disinfectants .
biofilms could also harbor pathogenic bacteria and support their proliferation which may contribute to the spread of waterborne diseases ( 9 ) . the heterotrophic plate count ( hpc )
it has been widely adopted as a standard and simple traditional technique for microbiological testing and safety management of drinking water ( 10 ) .
bacteria present in drinking water may attach to the bottle and dispenser surface of water coolers and form biofilm .
chemical water pollution due to leaching of organic compounds from polyethylene terephthalate ( pet ) bottles in drinking water is also a globally concern ( 11 , 12 ) .
therefore , bottled water coolers have the potential to release hazardous chemicals to the drinking water . to our knowledge , very few studies have been conducted on the bacteriological quality of bottled water coolers ( 13 , 14 ) .
levesque et al . found a significantly higher proportion of water cooler samples resulted contaminated than tap water ( 13 ) .
aerobic plate count was also higher in coolers compared with spring water used to supply the coolers ( 14 ) .
similar results have also been reported about the microbial quality of drinking water dispensed from bottleless water coolers ( water dispensers ) ( 1517 ) . in general ,
the water dispensed from water coolers was found to be more contaminated than the water supplied to them . given the importance of drinking water safety and identification of potential microbial and chemical pollution sources of drinking water this study was conducted to evaluate the microbial and physico - chemical quality of water from bottled water coolers . in particular , we studied some physicochemical factors that might influence the microbial quality of water from water coolers . since , the bacteriological quality of drinking water is highly dependent on the bacterial species encountered ; the identification of predominant bacteria was also performed .
a total of 32 drinking water samples were collected , over a 5-month period in 2012 - 2013 , from free standing bottled water coolers in office buildings in the city of isfahan .
thirty two control samples were also obtained from the water taps representing the tap water used to fill the bottles .
all samples were collected in sterile glass bottles containing sodium thiosulfate to neutralize any residual disinfectant after the tap water was allowed to run for one minute .
a water sample was also taken for physico - chemical analyses . for total heterotrophic bacteria ,
the samples were agitated by vortexing for 15 s and ten - fold serial dilutions were prepared for each sample . from all , volumes of undiluted and diluted samples were spread plated on r2a agar medium ( merck , germany ) and incubated at 35 c for 3 - 5 days as described in standard methods ( 18 ) . following incubation ,
plates were counted and results were ex pressed as colony - forming units per milliliter ( cfu / ml ) .
bacterial colonies were also characterized based on the colony and cell morphology on the agar plates and microscopic examination and the abundance percentage of different types of colonies were noted .
water temperature , ph [ corning ph meter ] and residual free chlorine [ meterrc ] were determined at the time of sample collection . the electrical conductivity and turbidity of samples were determined in the laboratory by conductivity meter ( sension7 , hach company , usa ) and turbidity meter ( 2100p , hach company , usa ) .
toc concentration of water samples was measured by using of a photo catalytic oxidation process employed by the anatoc series ii software ( sge international ltd . ,
titanium dioxide was employed as a catalyst with a continuous uv light source for its activation .
all of the analyses were performed at 350 nm to allow photo catalytic oxidation of the organic carbon in the samples . before any toc analysis ,
any residual inorganic carbon present in the sample was converted to co2 by injecting 500 l of sample into the acidified catalyst suspension and then toc results were calculated and reported via anatoc ii software .
predominant bacteria were isolated and subcultured on to r2a agar plates based on their gram stain and colony morphology .
the isolated colonies were suspended in 100 1 of deionized water , and genomic dna was extracted by boiling for 15 min and centrifugation at 13,000 rpm for 5 min .
the supernatant was used for pcr amplification with eubac 27f and 1492 r primers , which amplify a ~1,420 bp fragment of 16s rdna .
the pcr amplification was conducted in a final volume of 50 2 containing 2 1 of template dna , 0.2 m of each primer , 0.2 mm of each dntp , 5 1 of 10 pcr buffer and 1.25 units of taq polymerase .
dna sequencing of the amplified gene was performed , and dna sequences analysis was undertaken by blast algorithms and databases from the national center for biotechnology information ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) .
significant difference between the analyzed parameters in water coolers and control samples was tested using t - test .
the effect of physicochemical parameters on microbial quality of water samples was tested by pearson s correlation . a p - value of < 0.05 was considered significant .
a total of 32 drinking water samples were collected , over a 5-month period in 2012 - 2013 , from free standing bottled water coolers in office buildings in the city of isfahan .
thirty two control samples were also obtained from the water taps representing the tap water used to fill the bottles .
all samples were collected in sterile glass bottles containing sodium thiosulfate to neutralize any residual disinfectant after the tap water was allowed to run for one minute .
for total heterotrophic bacteria , the samples were agitated by vortexing for 15 s and ten - fold serial dilutions were prepared for each sample . from all , volumes of undiluted and diluted samples were spread plated on r2a agar medium ( merck , germany ) and incubated at 35 c for 3 - 5 days as described in standard methods ( 18 ) . following incubation ,
plates were counted and results were ex pressed as colony - forming units per milliliter ( cfu / ml ) .
bacterial colonies were also characterized based on the colony and cell morphology on the agar plates and microscopic examination and the abundance percentage of different types of colonies were noted .
water temperature , ph [ corning ph meter ] and residual free chlorine [ meterrc ] were determined at the time of sample collection .
the electrical conductivity and turbidity of samples were determined in the laboratory by conductivity meter ( sension7 , hach company , usa ) and turbidity meter ( 2100p , hach company , usa ) .
toc concentration of water samples was measured by using of a photo catalytic oxidation process employed by the anatoc series ii software ( sge international ltd . ,
titanium dioxide was employed as a catalyst with a continuous uv light source for its activation .
all of the analyses were performed at 350 nm to allow photo catalytic oxidation of the organic carbon in the samples . before any toc analysis ,
any residual inorganic carbon present in the sample was converted to co2 by injecting 500 l of sample into the acidified catalyst suspension and then toc results were calculated and reported via anatoc ii software .
predominant bacteria were isolated and subcultured on to r2a agar plates based on their gram stain and colony morphology .
the isolated colonies were suspended in 100 1 of deionized water , and genomic dna was extracted by boiling for 15 min and centrifugation at 13,000 rpm for 5 min .
the supernatant was used for pcr amplification with eubac 27f and 1492 r primers , which amplify a ~1,420 bp fragment of 16s rdna .
the pcr amplification was conducted in a final volume of 50 2 containing 2 1 of template dna , 0.2 m of each primer , 0.2 mm of each dntp , 5 1 of 10 pcr buffer and 1.25 units of taq polymerase .
dna sequencing of the amplified gene was performed , and dna sequences analysis was undertaken by blast algorithms and databases from the national center for biotechnology information ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) .
significant difference between the analyzed parameters in water coolers and control samples was tested using t - test .
the effect of physicochemical parameters on microbial quality of water samples was tested by pearson s correlation . a p - value of < 0.05 was considered significant .
the results of bacteriological analysis of water coolers and tap waters are presented in table 1 .
the microbiological results indicated that the bacteria count was higher in 62% ( 20 of 32 ) of water cooler samples than the stated drinking water limits for hpc ( 500 cfu / ml ) ( 5 ) .
the statistical analysis showed a significant difference between hpc number of water coolers and tap water samples .
table 2 shows the mean and range values of the physicochemical parameters for water coolers and tap waters .
bacteriological results of water coolers and tap water sample the mean temperature of the water coolers and water taps were 9.9 c and 24.2c , respectively .
significant differences were observed between the amounts of temperature and residual chlorine concentrations in water coolers and water taps ( p - value<0.05 ) .
however , the statistical analysis showed no significant difference between the values of ph , ec , turbidity and toc in water coolers and tap waters ( p - value>0.05 ) .
the results of correlation analysis between measured parameters in water coolers are given in table 3 .
the correlation analyses indicated that temperature and ec had a significant effect on the heterotrophic bacteria population in water coolers and also control samples .
however , toc did not show any significant effect on the microbial quality of water coolers .
this figure shows that bacilli were the predominant bacteria in all samples . according to 16s rrna gene sequence analysis of predominant bacteria ,
frequency of isolated bacteria from water coolers and tap waters analytical results of the physicochemical parameters for water coolers and tap water samples correlation matrix of the analyzed parameters in water coolers predominant bacteria identified by 16s rdna sequence analysis
the mean hpc of water coolers was determined at 38864 cfu / ml which exceeded the acceptable level for drinking water in high percentage of the analyzed samples .
microbiological quality control of drinking water during the distribution from water treatment plants to the consumer s tap is a major challenge in drinking water safety management ( 10 , 19 ) .
therefore , monitoring of drinking water quality from source to point - of - use is essential to ensure compliance with quality standards and to protect public health .
the results of the study showed that out of the 32 water cooler samples , 20 ( 62% ) of the samples highly loaded with microbes at levels exceeding 500 cfu / ml which recommended for drinking water ( table 1 ) . while in control samples , only one of the samples ( 3% ) exceeded the recommended values for hpc ( table 1 ) .
this finding is similar to those of levesque et al.(1994 ) , who found a significantly higher number of hpc in dispenser of water coolers when compared to the municipal tap water .
their results indicated that the bacteria count was higher than 1000 cfu / ml in 62% samples of water coolers ( 13 ) .
aerobic plate count was higher in coolers when compared with bottled samples of spring water used to supply the coolers ( 14 ) .
the present study supports the previous findings that the bacteriological water quality of water coolers is worse than the water used to supply these coolers and that regrowth and biofilm formation appear to occur in the bottled water coolers .
results in this study indicate that the surfaces of the bottle and dispensers favored excessive growth of bacteria and biofilm formation .
plastic materials such as ethylene - propylene and latex surface support greater bacterial growth than either glass or stainless steel ( 8) .
reported that rubber - lined hose contains high levels of plasticizer , which should encourage bacterial growth and replacing of these hoses with teflon - lined hoses could decrease the risk of contamination ( 20 ) .
bacteria adhere more readily to rough surfaces ( 9 , 21 ) and the characteristic of the plastic bottles used in water coolers is such that they could support biofilm formation . however , study of taheri et al . showed no difference between the hpc counts in bottleless water coolers and tap waters ( 22 ) .
indeed , they demonstrated that stainless steel small tanks in the bottleless coolers or fountains which were used for storage of chilled water did not support growth of biofim microorganisms .
however , biofilm formation could potentially occur in bottleless coolers or dispensers due to the presence of plastic waterlines or water treating filters ( 1517 ) .
the narrow bore water lines of dispensers which made of plastic material could provide a suitable surface for adhesion of the microorganisms on the inner surface of the waterlines ( 15 ) .
aerobic plate counts were higher in water plumbed in coolers from commercial stores compared with the tap water ( 16 ) .
the contamination may have been caused by the accumulation of small number of microorganisms from tap water or from faucet surface which are concentrated at filters used for bottleless coolers ( 16 ) .
high surface to volume ratio , absence or very low chlorine residual and relative long stagnation period are conditions which could also contribute to biofilm formation ( 5 ) in bottled water coolers .
therefore , water coolers must be thoroughly cleaned and disinfected in order to prevent the biofilm formation .
that showed that the periodic disinfection of microfiltered water dispensers with hydrogen peroxide made it possible to obtain water with hpc levels conforming to italian regulations for drinking water ( 100 cfu / ml ) ( 17 ) .
it is also known that a number of other factors such as temperature , ph and toc could influence the growth of biofilms in aquatic surfaces ( 23 ) .
the correlation analyses indicated that temperature and ec had a significant effect on the heterotrophic bacteria population in water coolers ( table 3 ) and also control samples .
although , there was a significant difference between the temperature of water coolers and tap water samples , the lower temperatures in the water coolers did not influence bacterial growth .
this result indicates that although higher temperature could speed up the bacterial growth but other conditions in water coolers were more effective on biofilm formation .
toc did not show any significant effect on the microbial quality of water coolers ( p - value>0.05 ) ( table 3 ) .
this may be related to this fact that presence of even microgram levels of dissolved organic compounds in aquatic systems allows growth of microorganisms and biofilm formation ( 24 ) . on the other hand
the statistical analysis showed no significant difference between the values of ph , ec , turbidity and toc in water coolers and tap waters ( p - value>0.05 ) .
the amounts of toc in coolers , as an indicator of organic compounds suggest that there is no migration of organic carbon from bottles of water coolers to drinking water .
several studies reported that formaldehyde and acetaldehyde are the most relevant carbonyl compounds migrating from pet bottles to drinking water .
phthalates which used as plasticizer in plastic packaging have also been found in pet material and in pet - bottled water ( 12 ) . however , more information on chemical mixtures and the effect observed in the water coolers is necessary .
the gram staining of microorganisms showed that bacilli were the predominant bacteria in all samples .
gram - positive bacilli were present in 93% and 81% of water cooler and tap water samples , respectively .
all samples were found to be completely free of gram - negative cocci ( fig .
1 ) . according to the16s rdna sequence analysis of predominant bacteria in water coolers and tap waters , eleven species of bacteria were identified ( table 4 ) .
are ubiquitous gram - positive rod - shape bacteria which isolated from water distribution systems ( 5 ) .
microbacterium paraoxydans and mycobacterium conceptionense are opportunistic gram - positive pathogens which belong to the order actinomycetales ( 26 , 27 ) .
blastomonas natatoria , porphyrobacter donghaensis and phenylobacterium lituiforme are gram negative bacteria which belong to the class alphaproteobacteria ( 28 ) .
are a group of chemoheterotrophic strictly aerobic rod shaped bacteria that are widely distributed in nature and found in water distribution lines ( 16 ) .
most of them are not clinically important , but some of species play a role in nosocomial infections .
blastomonas natatoria can colonize biofilm in water distribution system of neonatal intensive care unit ( nicu ) ( 20 ) .
the presence of porphyrobacter donghaensis and phenylobacterium lituiforme in sea water and subsurface aquifer , respectively also reported in other studies ( 29 , 30 ) .
high number of hpc in water coolers is indicative of microbial water quality deterioration in water coolers .
the presence of some opportunistic pathogens in water coolers , furthermore , is of concern from a public health point of view ; because of these microorganisms can lead to infection of vulnerable subpopulations .
the results highlight the importance of a periodic disinfection procedure and monitoring system for water coolers in order to keep the level of microbial contamination under control .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .
Output:
| abstractbackgrounddrinking water quality can be deteriorated by microbial and toxic chemicals during transport , storage and handling before using by the consumer .
this study was conducted to evaluate the microbial and physicochemical quality of drinking water from bottled water coolers.methodsa total of 64 water samples , over a 5-month period in 2012 - 2013 , were collected from free standing bottled water coolers and water taps in isfahan .
water samples were analyzed for heterotrophic plate count ( hpc ) , temperature , ph , residual chlorine , turbidity , electrical conductivity ( ec ) and total organic carbon ( toc ) .
identification of predominant bacteria was also performed by sequence analysis of 16s rdna.resultsthe mean hpc of water coolers was determined at 38864 cfu / ml which exceeded the acceptable level for drinking water in 62% of analyzed samples .
the hpc from the water coolers was also found to be significantly ( p < 0.05 ) higher than that of the tap waters .
the statistical analysis showed no significant difference between the values of ph , ec , turbidity and toc in water coolers and tap waters . according to sequence analysis eleven species of bacteria were identified.conclusiona high hpc is indicative of microbial water quality deterioration in water coolers .
the presence of some opportunistic pathogens in water coolers , furthermore , is a concern from a public health point of view .
the results highlight the importance of a periodic disinfection procedure and monitoring system for water coolers in order to keep the level of microbial contamination under control . |
PubmedSumm7888 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: lung cancer remains a deadly disease with an unsatisfactory overall survival [ 1 , 2 ] .
though the treatment of patients with lung cancer includes surgery , chemotherapy and radiotherapy , the overall survival remains poor .
moreover , due to the resistance to conventional therapy , the 5-year combined survival rate of patients with lung cancer of all stages is still only 16% .
non - small - cell lung cancer ( nsclc ) constitutes approximately 85% of all lung cancers and is the leading cause of tumor - related death worldwide , highlighting the need for more effective treatment strategies [ 4 , 5 ] .
therefore , the identification of potential drugs for treating patients with lung cancer is important . the use of taxanes and platinum ( pt)-based chemotherapy after surgery has been established as the first - line treatment by previous randomized controlled trials [ 7 , 8 ] .
however , cisplatin has nephro - toxicity , gastrointestinal toxicity and neurotoxicity . over the past decade
, significant progress has been made with respect to the development of novel nanoparticles ( nps ) designed for the detection and/or treatment of cancer [ 9 , 10 ] .
inorganic nanoparticles , notably metal nanoparticles , have raised much interest in research on their material properties , availabilities , capabilities , specific targeting , and sustained release .
biosynthesized nanoparticles are currently employed in the fields of bioremediation , biolabelling , biosensors and several more . for many years
, pt - based molecules have received considerable attention because of their electrocatalytic properties [ 13 , 14 ] . in medicine , pt nps have only been used as catalysts because of their conductivity and reactivity .
functional pt nps have shown apoptosis - inducing properties through target - specific pathways [ 17 , 18 ] .
pt nps have also been shown to induce death in cervical cancer cells through g2/m phase arrest gehrke et al demonstrated the cytotoxic effect of human colon carcinoma cell lines ht29 and caco-2 by using different sizes of pt nps . also ,
evidence for deoxyribonucleic acid ( dna ) damage and anti - oxidant response changes associated with pt - np treatment in vitro exists .
the present study aims at applying biosynthesized pt nps for their in vivo anticancer activity , an area in which the number of available reports is limited .
plants have been utilized extensively by mankind since the advent of civilization , and use of plant products in nano - biotechnology has grown tremendously in recent years .
hence , a new effective pt - based chemotherapeutic agent with less toxicity and non - cross - resistance is needed for the treatment of patients with lung cancer .
herein , an attempt is , therefore , made to use biosynthesized pt nps as an effective alternate method for treating patients with lung cancer .
the present study is a continuation of an earlier work and is carried out to assess the anti - tumor activity of pt nps against a human lung - cancer xenograft model . as human tumor xenografts are frequently used as predictive preclinical models for anticancer drug activity in humans , we chose this model for anti - tumor efficacy .
the cytotoxic effect of pt nps against a549 cells was measured by using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) assays .
the progression profiles of tumor growth kinetics and the body weights of the severe combined immune deficient mice ( scid ) mice used in this study were measured every week .
nevertheless , the efficacy of any chemo - modulatory agent is not scientifically validated until it has been examined through pre - clinical or clinical trials .
this is our first approach at an evaluation of the anti - tumor effect of orally - administered pt nps in mice bearing a549 lung tumor xenografts , given that most pt - based chemotherapeutic drugs are administered intravenously .
pt nps were synthesized through green technology and characterized based on particle size , zeta potential and surface morphology .
the human lung - cancer cell line a549 was obtained from the national centre for cell science ( nccs ) , sub - cultured , and then used to determine cell cytotoxicity after exposure to the drug .
the cells were cultured in dulbecco modified eagle medium ( dmem ) supplemented with 10% fbs at 5% co2 and 37c . at 85% confluence , the cells were harvested using 0.25% trypsin and seeded in 96-well plates .
the cells were allowed to 70% attach to the surface prior to treatment . a stock solution of pt nps 10 mg / ml
was prepared in vehicle and was diluted to appropriate concentrations for in vitro study . for the in vivo experiment , pt nps was administered as an oral suspension at a dose volume of 10 ml / kg based on animal s weight .
this study was carried out in two steps . in the first set of experiments , in vitro cytotoxicity
then , based on the in vitro results , we evaluated the in vivo anticancer activity in a second set of experiments .
the cytotoxicity of pt nps in human lung - cancer cells was determined by using mtt assays .
the mtt assay measures the cell proliferation rate and conversely , the reduction in cell viability , when metabolic events lead to apoptosis or necrosis .
the yellow compound mtt is reduced by mitochondrial dehydrogenases to the water - insoluble blue formazan compound , depending on the viability of the cells .
cells ( 2 10 cells / ml ) were grown on microtiter plates in 96-well microplates with different concentrations ( 50 , 100 and 200 g / ml ) of pt nps for a period of 48 hours .
after the treatment period , the cells were allowed to react with mtt for a period of 3 - 4 hours in the dark at 37c . by the end of the incubation period ,
these crystals were dissolved in an organic solvent ( e.g. , isopropanol ) , and the absorbance at 595 nm was measured spectrophotometrically .
to determine the cell viability , we calculated the percent viability as % viability = [ ( optical density { od } of treated cell - od of blank)/(od of vehicle control - od of blank ) ] 100 .
the results were determined based on three independent experiments . for the in vivo xenograft experiment , five- to seven - week - old female , scid mice were obtained from laboratory animal research services ( lars ) , navi mumbai , india .
this experiment was performed according to the guidelines for animal experimentation ( cpcsea ) at reliance life science , navi mumbai , maharashtra , india , and had been approved by the animal care and use committee of the same .
murine tumor models were used as previously described [ 25 , 26 ] . for the in vivo experiment ,
a549 cells ( 5 10 cells / mouse ) in 0.2 ml of phosphate buffered saline were injected subcutaneously into the flank region of the scid mice on day 0 , after which the mice were observed daily to look for the occurrence of a tumor ( fig .
the mice were inspected for tumor formation twice per week , and the tumor size was measured by using a vernier caliper . after the tumors had reached a mean volume of approximately 70 75 mm , the mice were randomly assigned to one of four groups ( 6 mice per group ) , and the following treatments were administered : ( a ) honey ( the vehicle control group ) and ( b ) 500 mg.kg body weight ( bw ) , ( c ) 1,000 mg.kg bw , and ( d ) 2,000 mg.kg bw of pt nps ( experimental groups ) .
based on the outcomes of an acute oral toxicity study in swiss albino mice ( data not published ) , we knew that pt nps were safe up to 5,000 mg / kg bw .
thus , in this study , we used doses of 500 , 1,000 , 2,000 mg / kg bw for evaluating anticancer activity .
the mice were examined for overt signs of any adverse drug - related side effects .
acceptable toxicity for cancer drugs was defined , based on national cancer institute ( nci ) guidelines , as a mean bw loss of the group of < 20% during the study period and not more than one toxic death among ten related animals .
the in vivo anti - tumor activity assessment was checked by determining the length and the width of the tumor by using a vernier caliper .
tumor growth was monitored and recorded twice weekly to evaluate the progression profile of tumor growth kinetics .
tumor volume was calculated by using the following formula : tumor volume ( mm ) = ( w2 l)/2 , where w = width ( in mm ) and l = length ( in mm ) of the tumor . the percentage growth inhibition ( % tumor growth inhibition , tgi )
was calculated as follows : [ 100 ( tumor volume of vehicle control - tumor volume of treated group ) ] tumor volume of the vehicle control .
the day on which the average size of the tumor of the vehicle control group reached the size of the tumor in the treated group on the last day gave the tumor growth delay ( tgd ) .
the first set of experiments was carried out to explore the cytotoxic effect of the dose of pt nps on a549 cells in vitro . in the second set of experiments ,
female scid mice were subcutaneously injected with a549 cells , and the mice were observed until the tumor volume had reached 70 75 mm .
then , the mice were divided in the four groups , and each animal was treated with either honey or a different dose of pt nps as described above and shown in fig . 1 . to check the cytotoxic effect of pt nps on a549 cancer cells , we cultured a549 cells in the presence of different concentrations of pt nps .
treatment of a549 cells with pt nps ( 50 200 g / ml ) for 48 hours reduced cell viability 71.48% ( p < 0.01 ) at 50 g / ml , 66.57% ( p < 0.001 ) at 100 g / ml , and 65.15% ( p < 0.01 ) at 200 g / ml ( fig .
these findings indicate that pt nps have a dose - dependent cytotoxicity effect on a549 cells . to determine whether biosynthesized pt nps have potential therapeutic value for the treatment of patients with a lung carcinoma , we further tested the inhibition caused by biosynthesized pt nps of a549 lung tumor growth in the scid mice xenograft model .
after treatment , the efficacy was assessed based on bw , tumor volume , tgi , tgd , and tumor weight . to monitor drug toxicity
an analysis of bw variations generally defined the adverse effects of the different therapy regiments .
no statistically significant changes in bw were observed when any of the treated group of animals was compared with the vehicle control group ( table 1 ) .
the progression profile of tumor growth kinetics was measured . in comparison with the vehicle control ,
the mid ( 1,000 mg / kg bw)- and the high ( 2,000 mg / kg bw)-dose groups showed significantly ( p < 0.05 ) lower tumor volumes from day 13 , but the low - dose group ( 500 mg / kg bw ) did not . on days 40 and 42 , even though the volumes of the tumors in the mid- and the high - dose animals were lower , that difference was not statistically significant ( table 2 ) .
3 summarizes the percent tumor size inhibition at various time points , demonstrating that tumor growth inhibition in the various treatment groups yielded a maximum effect .
, tumor inhibition was observed in all treated groups , except the low - dose group , up to day 13 . at the end of the treatment period , the percent inhibitions , in comparison to vehicle control group , for the low- ,
mid- and high - dose groups were 37% , 66% and 59% , respectively ( fig .
3 ) . in comparison to the vehicle control group , the tumor growth delay was 11 14 days for the low - dose group and 20 23 days for both the mid - dose and the high - dose groups ( fig .
the tumor weights of all the mice in the four groups were measured on day 42 . when compared with the vehicle control group , the tumor weights
the difference in tumor weight was significant in the middose group ( p < 0.05 ) when compared to the vehicle control ( table 3 ) .
although progress has been made in the management of advanced lung cancer , many challenges still remain .
the response rate in patients with a nsclc from treatment with cisplatin alone is about 20% and in combination with a second agent improves to about 26% .
however , recent reports suggest that no significant improvement in survival is likely to occur in those patients [ 29 , 30 ] .
the pt - based compounds cisplatin and carboplatin belong to the group of most frequently used anti - cancer drugs in clinical practice .
their use , however , is occasionally limited by severe organ toxicity , especially neuro - and nephrotoxicity . in the present study , we assessed the in vitro and the in vivo activities of biosynthesized pt nps against human lung cancer
. nanotechnology has the prospective to modernize cancer therapy , and the cytotoxicity of biosynthesized pt nps against a549 cells was confirmed by in vitro studies . a series of different doses ,
50 g / ml , 100 g / ml , and 200 g / ml were used , and the results showed that pt nps dose - dependently reduced the viability of a549 cells ( fig .
, we performed in vivo experiments by subcutaneously xenografting scid mice with human lung- carcinoma cells from the a549 cell line .
this is the first time investigation on the treatment of human lung - cancer xenografts by using biosynthesized pt nps . as shown in fig .
3 , pt nps exhibited a 66% tumor growth inhibition at 1,000 mg / kg bw .
of note is that the mid and the high doses ( 1,000 and 2,000 mg / kg bw ) of pt nps significantly inhibited the growth of lung cancer from day 13 ( p < 0.05 vs. vehicle control ) . among the three treated groups , the group that received 1,000 mg / kg bw
was observed to maintain the greatest amount of antitumor activity as the tumor volumes and the tumor weights were reduced significantly ( tables 2,3 ) . also of note
is that the mid and the high doses of pt nps inhibited the growth of tumors and delayed the progression of tumor growth more significantly than the low dose did .
this suggested a significant inhibitory and tumor suppression effect of pt nps on tumor growth in scid mice bearing a549 lung - tumor xenografts .
an analysis of bw variations generally defined the adverse effects of the different therapy regiments .
biosynthesized pt nps have been shown to achieve therapeutic cure against lung - cancer xenografts through oral administration .
our findings indicate that orally - administered pt nps therapeutically had no side effects even at the high dose .
bw measurements indicated that the animals were able to tolerate bio pt nps well even at the highest dose of 2,000 mg / kg bw .
the effective dose found in this study seems to be high compared to those of other pt - based anticancer drugs .
however , considering the safety profile of this drug as observed in an acute toxicity study ( data not published ) , these doses seem to be in the safe range .
this drug is currently in the early phase of exploratory clinical trials , and different doses are being tested on patients with advanced stage solid tumors .
the outcome from these studies will help to determine an effective dose in humans for further confirmatory trials .
ayurveda , a 5000-year - old traditional indian system of medicine , is believed to have been in existence from time immemorial .
evidence exists for the use of drugs derived from minerals , vegetables and animal products .
though modern science started exploring the term nano in the 21 century , ayurvedic medicinal systems already had been using noble metals , such as gold , silver etc .
, in nano form as bhasmas for various medical applications . because nps are more biocompatible than conventional therapeutics , they play an important role , due to their bio - availability and compatibility with conventional therapeutics , in the treatment of patients with diseases like cancer .
metal - based drugs were prepared by transmutation of base metals into noble ones and were used with plant extracts meant to eradicate the toxic effects of the metal [ 35 , 36 ] .
our novel biosynthesized nano - pt obtained through the ayurvedic process is less toxic and has a higher bio - availability .
the antitumor efficacy of biosynthesized pt nps for treating lung cancer in scid mice lends support for its use in various traditional systems of medicine .
the activity of biosynthesized pt nps in a549 human lung - carcinoma cells in vitro and in mouse xenografts provides the rationale for clinical use of this orally - administered agent in patients with lung cancer as most of the other pt - based chemotherapeutic drugs are administered intravenously and have side effects .
our results show that biosynthesized pt nps have antitumor activity in vitro and in vivo against lung cancer .
the results of this study are encouraging enough to undertake further clinical trials involving patients with lung cancer so that the effects of biosynthesized pt nps as a potent anti- lung - cancer agent and its safe use by complementary and alternative medicine ( cam ) practitioners can be verified .
vc , vehicle control ; low dose , 500 mg / kg bw ; mid dose , 1,000 mg / kg bw ; high dose , 2,000mg / kg bw ; bw , body weight .
Output:
| objectives : lung cancer remains a deadly disease with unsatisfactory overall survival .
cisplatin , a standard platinum ( pt)-based chemotherapeutic agent , has the potential to inhibit the growth of lung cancer .
its use , however , is occasionally limited by severe organ toxicity . however , until now , no systematic study has been conducted to verify its efficacy with proper experimental support in vivo .
therefore , we examined whether biosynthesized pt nanoparticles ( nps ) inhibited human lung cancer in vitro and in vivo to validate their use in alternative and complementary medicine.methods:we evaluated the in vitro and the in vivo anticancer efficiencies of biosynthesized pt nps in a subcutaneous xenograft model with a549 cells .
severe combined immune deficient mice ( scid ) were divided into four groups : group 1 being the vehicle control group and groups 2 , 3 and 4 being the experimental groups . once the tumor volume had reached 70 75 mm3 , the progression profile of the tumor growth kinetics and the body weights of the mice were measured every week for 6 weeks after oral administration of pt nps .
doses of pt nps of 500 , 1,000 and 2,000 mg / kg of body weight were administered to the experimental groups and a dose of honey was administered to the vehicle control group .
the efficacy was quantified by using the delay in tumor growth following the administration of pt nps of a549 human - lung - cancer xenografts growing in scid mice.results:the in vitro cytotoxicity evaluation indicated that pt nps , in a dose - dependent manner , inhibited the growth of a549 cells , and the in vivo evaluation showed that pt nps at the mid and high doses effectively inhibited and delayed the growth of lung cancer in scid mice.conclusion:these findings confirm the antitumor properties of biosynthesized pt nps and suggest that they may be a cost - effective alternative for the treatment of patients with lung cancer . |
PubmedSumm7889 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: worldwide ovarian cancer is the second leading cause of gynecologic cancer - related deaths behind cervical cancer .
approximately 240,000 new cases of ovarian cancer are diagnosed annually , accounting for about 4% of female cancers , and about 152,000 women die as a result of this disease . the majority of newly diagnosed ovarian cancer patients present with advanced - stage disease .
primary cytoreductive surgery followed by taxane- and platinum - based combination chemotherapy is the cornerstone of management for advanced ovarian cancer , and optimal cytoreduction is one of the most significant predictors of survival .
the prognosis of advanced ovarian cancer is significantly improved with no gross residual disease ( ngr ) after surgery , and the contemporary surgical objective is toward removing all visible disease . to achieve this , some surgeons perform aggressive surgical resections and they advocate that aggressive surgical effort can compensate for tumor biology and patients undergoing ultraradical procedures enjoy the longest survival time with acceptable operation - related morbidities . on the contrary , others stress that the prognosis of ovarian cancer depends on the biologic behavior of the tumor rather than surgical intervention . according to these investigators , it is the less advanced initial disease status that allows both optimal cytoreduction and improved survival , and for many surgeons and patients , aggressive surgery is accompanied by substantial morbidity , effecting quality of life and costs . the uncertain conclusion from a recent cochrane review on the effectiveness of aggressive surgery for advanced ovarian cancer reflects a lack of robust phase iii data in this field .
however , recent years have witnessed the appearance of a number of studies on not only the feasibility but also the favorable survival outcomes associated with extensive tumor resection .
although there is no randomized controlled trial supporting the benefit of radical procedures , the body of indirect data from a number of contemporary studies strongly supports the concept of aggressive surgical cytoreduction .
this review will focus on our current understanding of the correlation between aggressive surgical cytoreduction and improved survival .
since the landmark study by griffiths demonstrating survival benefit of maximal tumor debulking , a number of investigators validated the efficacy of cytoreductive surgery and optimal cytoreduction was defined as leaving residual cancer no larger than 1 to 2 cm in the largest diameter . in the mid-1990s , hoskins et al
. demonstrated that the less residual disease ( rd ) is achieved after primary cytoreductive surgery , the better survival outcome is obtained .
more recently the objective of surgery is evolving to reach the lowest residual tumor possible . in 2010 ,
the gynecologic cancer intergroup stated that the ultimate goal of cytoreductive surgery is to remove all macroscopic lesions and patients with ngr should be considered to achieve optimal cytoreduction . around the same time , the cochrane review by elattar et al .
these same authors suggested the surgical community should consider adopting the terms complete cytoreduction , near optimal ( for cases with rd < 1 cm ) and suboptimal ( rd > 1 cm ) given the survival benefits of less than complete cytoreduction .
a recent meta - analysis clearly shows the positive impact of complete cytoreduction to ngr on survival among patients with advanced ovarian cancer who underwent primary cytoreductive surgery .
the authors searched the pubmed and the cochrane library between january 1996 and july 2011 using common keywords related to surgery and ovarian cancer .
included studies met all of the following criteria : ( 1 ) primary epithelial ovarian , fallopian tube , or peritoneal carcinoma ; ( 2 ) international federation of gynecology and obstetrics ( figo ) stages iib to iv disease ; ( 3 ) primary cytoreductive surgery ; ( 4 ) adjuvant chemotherapy administered when both taxane and platinum agents were available ; ( 5 ) rd reported using the criteria of no gross ( microscopic ) rd , rd 0 to 1.0 cm , rd 0.1 to 1.0 cm , or rd > 1 cm ; and ( 6 ) survival analysis according to the aforementioned rd criteria . among 1,203 articles ,
a total of 18 consisting of six retrospective studies and 12 randomized controlled trials for adjuvant chemotherapy were included in the final analyses . on multiple linear regression analysis , the proportion of patients left with ngr was an important independent predictor of survival and each 10% increase in complete cytoreduction rate resulted in a concomitant 2.3 months prolongation in median survival time .
these data do not diminish the benefits of cytoreduction to minimal gross rd relative to suboptimal debulking , when ngr is not possible .
if surgery is undertaken , its goal is to remove as much of the gross tumor as possible and the operating surgeon should attempt to achieve complete cytoreduction . in those with less extensive tumor spread ,
complete cytoreduction can be easily achieved with relatively simple surgery , and most physicians agree to do this .
two - thirds of ovarian cancer patients present with advanced disease typically characterized by ascites , omental cake , peritoneal implants , and retroperitoneal lymph node metastases .
when cancer extensively involves diaphragm , liver , spleen , pancreas , stomach , or bowel , complex surgical procedures are required to obtain ngr . however , there is no consensus on the appropriate extent of surgical resection to which the surgeon should do to achieve complete cytoreduction .
opponents of aggressive surgery advocate that despite the importance of rd as a prognostic factor is well established , it is the inherent tumor biology to determine the resectability of the tumor , not surgical aggressiveness .
two ancillary data analyses of the scottish randomized trial in ovarian cancer ( scotroc)-1 and the gynecologic oncology group ( gog ) 182 trials are often cited as supporting this concept . in 2005 , crawford et al . reported the results of subanalysis on scotroc-1 trial data .
the authors retrospectively reviewed the clinical data on 889 patients with figo stage ic to iv ovarian cancer .
a prognostic score system reflecting each patient ' s presurgery biologic characteristics based on figo stage , tumor histology , presurgery cancer antigen 125 ( ca-125 ) , and omental cake was established using multivariate cox model .
the authors reported three main results : ( 1 ) non - uk patients underwent more radical surgery and had more optimal cytoreduction ( rd 2 cm ) than uk patients ; ( 2 ) optimal debulking was associated with increased progression - free survival ( pfs ) mainly for patients with less extensive disease ( with low prognostic score ) ; and ( 3 ) non - uk patients had more favorable pfs compared with uk patients who had similar rd and debulkability .
these investigators concluded that survival benefit associated with optimal surgery is limited to patients with less aggressive disease and tumor biology is a major survival determinant .
the authors retrospectively reviewed the gog 182 trial data on 2,655 patients with figo stage iii or iv ovarian cancer .
pfs and overall survival ( os ) were analyzed based on three indices : preoperative disease score ( ds ) , surgical complexity score ( cs ) , and rd .
the ds was defined as follows : ds low , with pelvic and retroperitoneal spread ; ds moderate , with additional spread to the abdomen but sparing the upper abdomen ; or ds high , with the presence of upper abdominal disease affecting the diaphragm , spleen , liver , or pancreas .
pfs and os were decreasing with increasing ds , and patients with high ds had the worst pfs and os . in patients with ngr
, the high ds still had a worse influence on pfs and os than those with low - moderate ds .
after adjusting for rd and ds , cs was not an independent predictor of survival .
these investigators suggested that , although complete cytoreduction to ngr is achieved , initial tumor burden is a powerful determinant in survival and aggressive surgery alone does not seem to have a positive impact .
although the authors stress that the results are based on the prospectively collected surgical data from the large , multi - institutional rcts , both studies are essentially retrospective re - analyses and have inherent biases which may influence the results . first , patients with less advanced stage disease - cases of stage ic - iiib disease for crawford study and stage iiiia - iiib disease for horowitz study - were included in both studies .
these patients are likely to be easily managed and have the best surgical outcomes with relatively simple procedures .
second , the index of surgical aggressiveness employed in both studies was not objective . in the crawford study ,
optimal surgery was defined as rd < 2 cm and rd was regarded as a surrogate of aggressive surgery .
however , rd is only the result of aggressive surgery , not aggressive surgery itself .
although the score is reproducible and reflects the surgical complexity well , high cs does not always mean aggressive surgical effort .
for example , if a patient with stage iiib disease involving the diaphragm undergoes the following procedures - total hysterectomy , bilateral salpingo - oophorectomy , omentectomy , pelvic / para - aortic lymphadenectomy , pelvic peritoneal stripping , segmental resection of the jejunum , and ileocecal resection , cs is 8 and the patient is found to have minimal rd on the diaphragm . according to horowitz et al . , the ds is high , cs is high , the patient has minimal rd , and the surgery does not overcome the tumor biology .
however , most experienced surgeons would consider that in that case , the ds is not high , cs is not high , and the patient is likely to have ngr employing upper abdominal procedures .
third , the quality of surgical care seems to be unsatisfactory . in the crawford study ,
although the length of surgery is not a surrogate of the surgical complexity , it is hard to imagine the possibility of performing aggressive surgery such as extensive upper abdominal and pelvic procedures within 2 hours . despite that , the rates of optimal cytoreduction were only 57.4% to 71.3% . in the horowitz study , only 16% of patients had high cs and 32.4% had ngr .
recent studies show that patients treated by surgeons and hospitals who frequently utilize the radical procedures have better surgical outcomes and prognosis .
all of these factors diminish the ability to demonstrate a benefit to aggressive surgical cytoreduction .
some surgeons utilize radical procedures such as diaphragm peritonectomy / resection , liver resection , splenectomy , distal pancreatectomy , subtotal colectomy , or multiple bowel resections for complete cytoreduction .
although these procedures are performed even by highly experienced gynecologic oncology surgeon , a considerable number of patients may experience severe perioperative complications .
retrospectively review the data from three centers and reported that the 30-day morbidity and 3-month mortality rates were 18.4% ( 95% confidence interval [ ci ] , 15.1 to 21.9 ) and 4.5% ( 95% ci , 3.3 to 6.9 ) , respectively . based on their risk prediction models , the calculated risk of complications ranged from 4.5% to 54.3% with significantly influencing on quality of life and costs .
there are three major limitations of radical debulking surgery : first , direct evidence from randomized trials as to whether extensive surgery itself actually improves survival is nonexistent ; second , radical cytoreductive surgical procedures are associated with a predictable risk of morbidity and mortality ; and third , complete tumor resection in non - expert centers is only achievable in a minority of patients with advanced ovarian cancer .
some physicians have abandoned radical surgery claiming that it is ineffective , that tumor biology determines not only but surgical outcome as well , and that the associated morbidity risk is too high . however , for more than a decade , a number of studies have consistently illustrated that aggressive surgery can largely make up for differences in tumor biology .
while it is apparent that approximately one third of patients may experience perioperative complications , the survival benefit from aggressive surgery would seem to make these morbidities tolerable .
additionally analysis of risk factors such as age , performance status , nutrition , and obesity can allow surgeons to sensibly triage those patients at highest risk of serious morbidity to alternative primary treatment .
contemporary studies from experienced centers clearly indicate that complete cytoreduction can be achieved in up to 60% of patients with figo stage iiic - iv ovarian cancer , such that the feasibility argument is highly related to center expertise . with these issues in mind
, we will now take a look at recent evidences supporting the survival benefit from aggressive surgical cytoreduction .
our starting point for the first question may well be as to whether individual surgeons and institutions can improve the proportion of patients achieving optimal cytoreduction by adopting systematic and programmatic change in surgical approach .
studies from both the memorial sloan - kettering cancer center and horst schmidt klinik are good examples to clearly illustrate that such a paradigm shift can result in the improved os of patients with advanced ovarian cancer .
chi et al . from the memorial sloan - kettering cancer center evaluated the effect of the incorporation of radical procedures into the surgical management of advanced ovarian cancer on both optimal cytoreduction and survival .
these investigators reviewed 378 stage iiic and iv ovarian cancer patients who had primary cytoreductive surgery in two different time periods based on before and after the incorporation of extensive upper abdominal surgery .
one hundred and sixty - eight patients undergoing standard surgery ( group 1 ) and 210 patients undergoing extensive upper abdominal surgery ( group 2 ) were identified and compared . by instituting a more comprehensive approach to removal of upper abdominal disease through the use of such procedures as diaphragm peritonectomy and/or resection , splenectomy , distal pancreatectomy , partial liver resection , cholecystectomy , and porta hepatis tumor resection , the proportion of patients achieving ngr increased from 11% to 27% without significantly increasing postoperative complications . the median os time
was significantly improved in group 2 patients compared to group 1 patients ( 54 months vs. 43 months , p=0.03 ) .
these investigators suggested that the incorporation of extensive upper abdominal procedures was associated with increased optimal cytoreduction rates and significantly improved survival .
their institution employed the quality management programs on the surgical management of ovarian cancer since 2001 .
these authors reported their experience with 396 patients with stage iib and iv ovarian cancer who had primary surgery according to the timeline change of the quality management program .
as aggressive surgical procedures - bowel resection , diaphragm resection , splenectomy , and liver resection - were more and more utilized over time , the rates of complete cytoreduction increased from 33% to 62% .
survival analysis revealed that the more increasing surgical aggressiveness was instituted , the longer the median os time was observed ( 26 months vs. 37 months vs. 45 months , p<0.003 ) .
these studies strongly suggest that implementing aggressive surgical approach is associated with a significant increase in the complete debulking rate and improved os in patients with advanced ovarian cancer .
recently , several investigators have demonstrated that there are wide disparities in optimal surgery rates and survival across the operating surgeons and institutions .
published a landmark study that drew a sharp distinction in patients ' survival outcome among the operating surgeons .
a total of 144 stage iiic ovarian cancer patients with peritoneal carcinomatosis treated from 1994 to 1998 were retrospectively reviewed . in multivariate analysis ,
the size of rd ( p<0.001 ) and the performance of radical surgery ( p=0.047 ) were the only independent factors predicting patient survival .
controlling for other factors , the 5-year os rate was 44% compared with 17% for patients treated by surgeons who had a high propensity for utilizing radical and nonradical procedures , respectively ( p<0.001 ) .
this study presents empirical evidence to support that radical surgery to achieve lowest rd can minimize the effect of tumor burden .
chang et al . reviewed 203 patients with stage iiic and iv ovarian cancer .
in both the entire cohort of 203 patients and subgroup of 139 stage iiic patients with carcinomatosis , ngr and the performance of radical surgery were significantly associated with the longest pfs and os .
the volume of rd and the performance of radical surgery were found to be independent factors affecting survival outcome after controlling for other factors .
examined 527 patients with stage iiic and iv ovarian cancer from seven centers in france .
on multivariate analysis , ultraradical procedures as well as rd were independent factors influencing survival .
conducted an exploratory analysis of the surgical data of 798 patients with figo iib - iv ovarian cancer from a prospectively randomized phase iii study of the arbeitsgemeinschaft gynaekologische onkologie ovarian cancer study group ( ago - ovar ) to evaluate the various prognostic factors for surgical outcome .
patients treated in centers with surgeons who performed comprehensive debulking surgery had a high rate of complete cytoreduction ( 32.8% vs. 22.9% , p=0.007 ) and showed incrementally improved os ( 45.2 months vs. 35.0 months , p=0.045 ) compared with those treated in other centers . after controlling for other factors , the type of center remained one of independent prognostic factors .
the authors concluded that complete cytoreduction was highly achievable in experienced centers capable of performing aggressive surgery .
most evidence suggests that advanced ovarian cancer patients treated at the high - volume hospitals and by high - volume surgeons have better outcomes than those treated at the low - volume hospitals and by low - volume surgeons .
high - volume surgeons tend to operate at high - volume hospitals and perform more extensive ovarian cancer surgery .
recently , bristow et al . demonstrated that there was a significant disparity in survival among even high - volume hospitals .
these investigators conducted a retrospective population - based analysis on a total of 9,933 patients with ovarian cancer in southern california .
hospitals were classified into three groups : ( 1 ) national cancer institute - designated comprehensive cancer centers ( nci - ccc ; n=5 ) ; ( 2 ) non - nci - ccc high - volume hospital ( n=29 ) ; and ( 3 ) non - nci - ccc low - volume hospital ( n=158 ) . there were significant differences in survivals according to hospital types .
patients treated at nci - ccc had the longest median survival time compared with those treated at other hospitals ( 77.9 months vs. 51.9 months vs. 43.4 months , p<0.001 ) .
treatment at nci - ccc was an independent predictor of favorable survival after adjusting other variables .
this study implies that specialized centers and high - volume surgeons are more likely to provide guideline - adherent care and this is intimately linked with improved survival .
our starting point for the first question may well be as to whether individual surgeons and institutions can improve the proportion of patients achieving optimal cytoreduction by adopting systematic and programmatic change in surgical approach .
studies from both the memorial sloan - kettering cancer center and horst schmidt klinik are good examples to clearly illustrate that such a paradigm shift can result in the improved os of patients with advanced ovarian cancer .
chi et al . from the memorial sloan - kettering cancer center evaluated the effect of the incorporation of radical procedures into the surgical management of advanced ovarian cancer on both optimal cytoreduction and survival .
these investigators reviewed 378 stage iiic and iv ovarian cancer patients who had primary cytoreductive surgery in two different time periods based on before and after the incorporation of extensive upper abdominal surgery .
one hundred and sixty - eight patients undergoing standard surgery ( group 1 ) and 210 patients undergoing extensive upper abdominal surgery ( group 2 ) were identified and compared . by instituting a more comprehensive approach to removal of upper abdominal disease through the use of such procedures as diaphragm peritonectomy and/or resection , splenectomy , distal pancreatectomy , partial liver resection , cholecystectomy , and porta hepatis tumor resection , the proportion of patients achieving ngr increased from 11% to 27% without significantly increasing postoperative complications . the median os time
was significantly improved in group 2 patients compared to group 1 patients ( 54 months vs. 43 months , p=0.03 ) .
these investigators suggested that the incorporation of extensive upper abdominal procedures was associated with increased optimal cytoreduction rates and significantly improved survival .
their institution employed the quality management programs on the surgical management of ovarian cancer since 2001 .
these authors reported their experience with 396 patients with stage iib and iv ovarian cancer who had primary surgery according to the timeline change of the quality management program .
as aggressive surgical procedures - bowel resection , diaphragm resection , splenectomy , and liver resection - were more and more utilized over time , the rates of complete cytoreduction increased from 33% to 62% .
survival analysis revealed that the more increasing surgical aggressiveness was instituted , the longer the median os time was observed ( 26 months vs. 37 months vs. 45 months , p<0.003 ) .
these studies strongly suggest that implementing aggressive surgical approach is associated with a significant increase in the complete debulking rate and improved os in patients with advanced ovarian cancer .
recently , several investigators have demonstrated that there are wide disparities in optimal surgery rates and survival across the operating surgeons and institutions .
published a landmark study that drew a sharp distinction in patients ' survival outcome among the operating surgeons .
a total of 144 stage iiic ovarian cancer patients with peritoneal carcinomatosis treated from 1994 to 1998 were retrospectively reviewed . in multivariate analysis , the size of rd ( p<0.001 ) and the performance of radical surgery ( p=0.047 ) were the only independent factors predicting patient survival .
controlling for other factors , the 5-year os rate was 44% compared with 17% for patients treated by surgeons who had a high propensity for utilizing radical and nonradical procedures , respectively ( p<0.001 ) .
this study presents empirical evidence to support that radical surgery to achieve lowest rd can minimize the effect of tumor burden .
chang et al . reviewed 203 patients with stage iiic and iv ovarian cancer .
in both the entire cohort of 203 patients and subgroup of 139 stage iiic patients with carcinomatosis , ngr and the performance of radical surgery were significantly associated with the longest pfs and os .
the volume of rd and the performance of radical surgery were found to be independent factors affecting survival outcome after controlling for other factors .
examined 527 patients with stage iiic and iv ovarian cancer from seven centers in france .
on multivariate analysis , ultraradical procedures as well as rd were independent factors influencing survival .
conducted an exploratory analysis of the surgical data of 798 patients with figo iib - iv ovarian cancer from a prospectively randomized phase iii study of the arbeitsgemeinschaft gynaekologische onkologie ovarian cancer study group ( ago - ovar ) to evaluate the various prognostic factors for surgical outcome .
patients treated in centers with surgeons who performed comprehensive debulking surgery had a high rate of complete cytoreduction ( 32.8% vs. 22.9% , p=0.007 ) and showed incrementally improved os ( 45.2 months vs. 35.0 months , p=0.045 ) compared with those treated in other centers . after controlling for other factors , the type of center remained one of independent prognostic factors .
the authors concluded that complete cytoreduction was highly achievable in experienced centers capable of performing aggressive surgery .
most evidence suggests that advanced ovarian cancer patients treated at the high - volume hospitals and by high - volume surgeons have better outcomes than those treated at the low - volume hospitals and by low - volume surgeons .
high - volume surgeons tend to operate at high - volume hospitals and perform more extensive ovarian cancer surgery .
recently , bristow et al . demonstrated that there was a significant disparity in survival among even high - volume hospitals .
these investigators conducted a retrospective population - based analysis on a total of 9,933 patients with ovarian cancer in southern california .
hospitals were classified into three groups : ( 1 ) national cancer institute - designated comprehensive cancer centers ( nci - ccc ; n=5 ) ; ( 2 ) non - nci - ccc high - volume hospital ( n=29 ) ; and ( 3 ) non - nci - ccc low - volume hospital ( n=158 ) .
patients treated at nci - ccc had the longest median survival time compared with those treated at other hospitals ( 77.9 months vs. 51.9 months vs. 43.4 months , p<0.001 ) .
treatment at nci - ccc was an independent predictor of favorable survival after adjusting other variables .
this study implies that specialized centers and high - volume surgeons are more likely to provide guideline - adherent care and this is intimately linked with improved survival .
if the patient can not undergo near optimal cytoreduction , radical cytoreductive procedures should not be performed except for palliation . to avoid unnecessary surgery
, many attempts have been made to predict surgical outcome , and various models predicting preoperatively optimal / suboptimal cytoreduction have been developed based on physical examination , computed tomography imaging , serum ca-125 , and other clinical features .
however , the accuracy of these models has been challenged in determining whether the disease can be successfully resected .
some investigators underscore the importance of inherent biologic condition of the tumor in determining the surgical success and have published the papers on predicting optimal / suboptimal debulking at the gene expression level .
if tumor biology determines the surgical resectability and the surgical outcomes , biomarkers associated with surgical outcomes could potentially be developed and feasibly used to tailor aggressive surgical intervention to the individual patient .
although some studies on the cancer genome atlas ( tcga ) gene expression data from patients with high - grade serous ovarian cancer showed the promising results , the majority of studies are limited by design , include heterogeneous samples and lack adjustment for major confounding factors . in our view , there are no up - to - date , clear , specific models predicting surgical outcome , so it is believed that further experimentation with various clinical and molecular signatures is worthwhile .
it is clear that multiple factors impact patient survival and complete cytoreduction to ngr is one of the most powerful determinants in survival .
. the philosophy of the surgeon and institution on what qualifies as unresectable disease also differs and will undoubtedly affect both surgical outcome and survival .
however , although published reports supporting the positive prognostic impact of aggressive surgical effort are almost entirely retrospective , the findings of these studies provide potential evidence for the hypothesis that surgical expertise at least partly counteracts the effects of underlying tumor biology . consequently , aggressive surgical cytoreduction can offer the best opportunity for achieving extended survival in women with advanced ovarian cancer .
Output:
| ovarian cancer is the eighth most frequent cancer in women and is the most lethal gynecologic malignancy worldwide .
the majority of ovarian cancer patients are newly diagnosed presenting with advanced - stage disease .
primary cytoreductive surgery and adjuvant taxane- and platinum - based combination chemotherapy are the standard treatment for advanced ovarian cancer .
a number of studies have consistently shown that successful cytoreductive surgery and the resultant minimal residual disease are significantly associated with survival in patients with this disease .
much has been written and even more debated regarding the competing perspectives of biology of ovarian cancer versus the value of aggressive surgical resection .
this review will focus on the current evidences and outcomes supporting the positive impact of aggressive surgical effort on survival in the primary management of ovarian cancer . |
PubmedSumm7890 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in europe the concepts of functioning / disability and autonomy / dependency deserve special interest from the point of view of medical ontology . while functioning / disability are concepts defined at the who international classification of functioning ( icf ) , the autonomy / dependency pair is not even mentioned at this classification system .
the council of europe has defined dependency as the condition related to the loss of autonomy and the need of support by a third person related to an impairment of activities of daily living , specially self - care .
laws and care services for the elderly and for persons with severe disability have been developed following this paradigm in several eu countries .
these concepts are based in the activities of daily living construct ( adls ) which divides these activities in basic and instrumental .
this construct can not be linked to the who - icf paradigm as stated in the spanish law . who has defined
personal autonomy as equivalent to self - direction , competence and self - empowerment , and there is no equivalent definition of function - related autonomy at the who family of classifications .
the different background of these concept pairs had a significant impact on the development of health and social services in several european countries during the last decade .
this is particularly important for those conditions where impairment is not related directly to basic adls but to other functional problems such as severe mental illness or intellectual disability .
the ontological disparities need careful review to avoid inequity in access to care for severe disability in europe .
Output:
| introductionin europe the concepts of functioning / disability and autonomy / dependency deserve special interest from the point of view of medical ontology . while functioning / disability are concepts defined at the who international classification of functioning ( icf ) , the autonomy /
dependency pair is not even mentioned at this classification system.descriptionthe council of europe has defined dependency as the condition related to the loss of autonomy and the need of support by a third person related to an impairment of activities of daily living , specially self - care .
laws and care services for the elderly and for persons with severe disability have been developed following this paradigm in several eu countries .
these concepts are based in the activities of daily living construct ( adls ) which divides these activities in basic and instrumental .
this construct can not be linked to the who - icf paradigm as stated in the spanish law . who has defined
personal autonomy as equivalent to self - direction , competence and self - empowerment , and there is no equivalent definition of function - related autonomy at the who family of classifications.conclusionthe different background of these concept pairs had a significant impact on the development of health and social services in several european countries during the last decade .
this is particularly important for those conditions where impairment is not related directly to basic adls but to other functional problems such as severe mental illness or intellectual disability .
the ontological disparities need careful review to avoid inequity in access to care for severe disability in europe . |
PubmedSumm7891 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the liver has a remarkable capacity to regenerate in response to injury ; however , in severe cases its regenerative capacity may prove to be insufficient , and the liver injury may progress to end - stage liver disease ( esld ) and subsequent liver failure . up to two million people suffer from chronic liver disease in the uk , many of whom remain unaware of their illness [ 1 , 2 ] .
chronic liver disease is the fifth leading cause of death in the uk after cancer , cardiovascular disease , stroke , and respiratory disease .
alcoholic liver disease ( ald ) , one of the major medical complications of alcohol abuse , is the commonest cause of esld in europe and north america and is one of the most controversial indications for transplantation .
alcohol abuse accounts for 80% of all liver cirrhosis cases seen in district general hospitals in the united kingdom and for a substantial and increasing proportion of all liver transplants performed .
chronic liver disease ( cld ) due to alcohol abuse continues to rise . in 2005 , 4,160 people died in england and wales from alcoholic liver disease , an increase of 37% since 1999 .
alcoholic liver cirrhosis ( alc ) has an unfavourable prognosis , with a mortality of 49% and 90% after 1 and 15 yr of followup , respectively . at present
orthotopic liver transplantation is the only therapeutic option for patients with acute and chronic eslds .
liver transplantation , however , has the disadvantage of requiring lifelong immunosuppression and followup , with 1015% of patients dying whilst on the waiting list due to the shortage of donated organs . in 2005
, only one - third of patients waiting for a liver transplant were transplanted . with
the number of donor organs likely to decrease over the coming decades , research into the alternative methods of treatment of whole - organ transplant is essential .
hepatocyte transplantation has been suggested as an alternative to liver transplantation , especially for hepatic disorders caused by inherited protein deficiency .
the widespread application of hepatocyte transplantation , however , is also limited by organ availability , by problems with viability of isolated hepatocytes after cryopreservation , and by the potential formation of hepatocyte aggregates during injection subsequently obstructing liver sinusoids and resulting in portal hypertension or fatal emboli .
recent advances in the understanding of stem cell biology and plasticity have raised expectations for using stem cells as a new type of cellular therapy in regenerative medicine .
in particular , adult hematopoietic stem - cell ( hsc- ) based treatment is evolving as a viable clinical alternative .
these cells are capable of differentiating into many types of tissues , including skeletal and cardiac muscles , neuronal cells , pneumocytes , and hepatocytes .
although stem cell therapy is not classically considered within the realm of clinical medicine , this technology will become increasingly important for clinicians in the future .
the bm compartment is largely made up of hscs , committed progenitor cells , and noncirculating stromal cells called mesenchymal stem cells ( msc ) which have the ability to develop into mesenchymal lineages [ 9 , 10 ] .
haematopoietic stem cells are adult stem cells that can be identified by their ability to differentiate into all blood cell types and reconstitute the haematopoietic system in a host that has been lethally myeloablated .
it was previously thought that adult stem cells were lineage restricted , but recent studies have shown that bm - derived progenitors participate in the regeneration of ischaemic myocardium , damaged skeletal muscle , and neurogenesis , in addition to haematopoiesis .
this paper focuses on the potential of hscs in the management of cld , concentrating on experimental models in animal and human tissue along with the current status of clinical trials .
one of the first demonstrations of the ability of bmscs to reconstitute liver was reported by petersen and colleagues in 1999 .
lethally irradiated female rats with induced hepatic injury , treated with 2-aminoacetylfluorine to prevent hepatic proliferation , and were rescued using bone marrow transplants from syngeneic males .
the y - chromosome markers dipeptidyl peptidase iv enzyme ( dppiv ) and l21 - 6 antigen were used to identify liver cells of bm origin .
this cross - sex model allowed the identification of male liver cells in the female rats ' livers indicating that bm - derived hscs have the capacity to transdifferentiate into hepatocytes .
although evidence of transdifferentiation to hepatocytes is compelling from animal studies , few have examined this possibility in humans .
alison and associates detected y - chromosome - positive cells in a retrospective analysis of the livers of 9 female recipients of bone marrow transplants from male donors .
the authors also looked for the presence of y - chromosome - positive cells in 11 female livers transplanted to male recipients that were later removed due to recurrent disease , finding a number that expressed cytokeratin-8 ( 0.5%2% ) .
there is much controversy concerning the mechanism by which bmscs contribute to hepatocyte regeneration or to liver repair .
transdifferentiation into hepatocytes represents genomic plasticity in response to the microenvironment and has been shown in several experiments in vivo [ 1719 ] .
however , some authors have proposed that conversion to hepatocytes may occur via cell fusion [ 20 , 21 ] . the so - called bystander effect
is postulated to be due to factors secreted by bmscs that are chemoattracted to the site of injury , leading to the stimulation of mitosis of endogenous liver cells .
this mechanism is thought to recruit endogenous bm for cardiac repair following myocardial infarction following administration of granulocyte colony - stimulating factor ( g - csf ) .
other possible explanations for target organ regeneration and improvement in function include facilitating the release of vascular endothelial growth factor ( vegf ) by stem cells , thus , increasing the blood supply to cells and helping to repair damaged tissue .
stem cells may also act by up - regulating the bcl-2 gene and suppressing apoptosis or by suppressing inflammation in the diseased organ via the interleukin-6 ( il-6 ) pathway .
both of these processes are thought to contribute to the regeneration of normal cells in the damaged organ .
finally , hscs may stimulate tissue - specific stem cells , such as oval cells in the liver , facilitating regeneration of the target organ .
jang and colleagues transplanted enriched cd45 hscs into lethally irradiated mice treated with a single dose of carbon tetrachloride ( ccl4 ) . in this model , 7.6% of liver cells were of donor origin within 7 days of transplantation .
there was early amelioration of liver disease with some improvement in liver function in transplanted mice compared to controls .
the most promising study to date demonstrates liver disease reversal following transplantation of enriched hscs into fumarylacetoacetate hydrolase- ( fah- ) deficient mice , an animal model of tyrosinemia type i .
bone marrow from metabolically competent donor mice was transplanted into a lethally irradiated fah - deficient mouse strain , resulting in the proliferation of large numbers of donor lacz hepatocytes and restoration of liver biochemical function . however , an animal study to investigate whether transplantation of hscs cd34 could improve hepatic fibrosis by their differentiation into hepatocytes found differing results .
hscs from human umbilical cord blood were purified , transduced with a lentiviral vector containing the green fluorescent protein ( gfp ) gene , and injected via the portal vein into rats with liver cirrhosis induced by the four - month administration of thioacetamide .
rats were killed at 15 and 60 days following transplantation . up to 37% and 22% fluorescent cells
were observed in the blood of control and cirrhotic rats respectively , at 15 days after transplantation . at 60 days after transplantation ; however , fluorescent cells were completely absent from the blood .
fluorescence was not detected in liver sections at either 15 or 60 days after transplantation .
a polymerase chain reaction study to detect the gfp gene ruled out silencing of the transgene .
these results suggest that the transplanted cells did not engraft in the liver and were eliminated from the rats .
oyagi and associates have transplanted mscs , induced to adopt hepatocyte phenotype in vitro , intravenously into nonirradiated ccl4-damaged recipients and observed both a rise in serum albumin and a histological decrease in hepatic fibrosis . similarly , jiang et al . transplanted rosa26 mouse multipotent adult progenitor cells ( mapc ) into nonobese diabetic / severe combined immunodeficiency disease ( nod / scid ) mice sacrificing them 424 weeks later .
since there was no noxious liver injury creating a donor cell survival advantage , there was no increase in the number of donor cells in the 6-month after transplant period .
persistent injury has been found to induce efficient trans - differentiation of bmcs into functional hepatocytes .
green fluorescent protein- ( gfp- ) transfected bmcs from nontreated mice injected into those with liver cirrhosis induced by ccl4 efficiently migrated into the periportal area of liver lobules after one day , repopulating 25% of the recipient liver by 4 weeks .
in contrast , no gfp - positive bmcs were detected following transplantation into control mice with undamaged livers .
serum albumin levels were significantly elevated to compensate for chronic liver failure in bmc transplantation suggesting that recipient conditions and microenvironments are key factors for successful cell therapy using bmcs .
several studies have demonstrated the presence of cells of bone marrow origin in the human liver .
alison and colleagues elegantly demonstrated that adult human liver cells can be derived from stem cells originating in bone marrow .
analysing livers from female patients who had received a bone marrow transplantation from a male donor , they found y - chromosome- and ck8- positive hepatocytes , thus , suggesting that extrahepatic stem cells can engraft in the liver .
theise et al . also studied autopsy and liver biopsy tissue from recipients of sex - mismatched therapeutic bone marrow and orthotopic liver transplantations .
they identified hepatocytes and cholangiocytes of bone marrow origin by immunocytochemistry staining for ck8 , ck18 , and ck19 and fish analysis for the y - chromosome .
they found up to 43% of hepatocytes and 38% of cholangiocytes were engrafted , showing that these cells can be derived and differentiated from bone marrow to replenish the liver .
korbling and associates , for example , confirmed bone marrow - derived hepatocytes in liver biopsies of sex - mismatched bone marrow transplantation , but these represented only 4%7% of hepatocytes .
similarly , ng et al . showed that only a small proportion of hepatocytes ( 1.6% ) were recipient derived in the liver allografts .
the inconsistency of these studies may relate to the use of varying techniques and markers to identify recipient - derived hepatocytes in the transplanted patients .
although studies have shown that bone marrow stem cells can give rise to hepatocytes , the use of bone marrow stem cells as therapeutic agents is still in its infancy .
these studies generally involve the mobilisation of bone marrow stem cells using granulocyte colony - stimulating factor ( g - csf ) or infusion of collected bone marrow stem cells , either peripherally or directly into the hepatic vasculature ( table 1 ) .
our group conducted a phase i clinical trial of the infusion of cd34 cells into the portal vein or the hepatic artery of five patients with chronic liver disease with no adverse effects .
although these patients received relatively low numbers of cells ( 2 10 ) , a moderate improvement in serum bilirubin was seen in 3 of the 5 patients which lasted for more than 18 months .
our experience is in keeping with the observations made by am esch ii and associates , who in their first publication demonstrated increased liver regeneration in 3 patients following intra - portal administration of autologous cd133 bm cells into the left lateral portal vein branches during right portal vein embolisation ( pve )
. by ct criteria , left lateral segment hypertrophy was 2.5-fold higher compared to 3 patients that had right pve only . in their second publication , which included patients from the first study , they recruited a total of 13 patients .
there was a significant increase in the daily liver growth in patients who had stem cell infusions in addition to pve ( n = 6 ) when compared to patients with pve alone ( n = 7 ) .
terai and colleagues have also shown improvement in liver function following peripheral infusion of autologous bm cells in patients with liver cirrhosis .
nine patients who received a peripheral vein infusion of an average of 5.2 10 autologous mononuclear cells ( cd34 , cd45 , and ckit ) demonstrated significant improvement in the child - pugh scores and serum levels of albumin .
liver biopsies were taken in 3 patients revealing an increase in proliferating cell nuclear antigen staining , an indirect marker of hepatocyte turnover .
yannaki and associates have reported 2 patients with alcohol - induced liver cirrhosis treated with autologous mobilised hscs .
each patient underwent three rounds of g - csf mobilisation and peripheral vein infusion of cd34 cells .
the procedure was well tolerated , and both patients improved their baseline child - turcotte - pugh ( ctp ) and model for end - stage liver disease ( meld ) scores during 30 months of followup . a further 2 patients with hepatitis - b - related decompensated liver cirrhosis treated with mobilised autologous peripheral blood monocytes ( pbmc ) also showed an improvement in serum albumin , bilirubin , alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , and ctp scores for greater than one year following transfusion .
lyra and associates performed a study on 10 patients with chronic end - stage liver disease , receiving committed progenitor cells and no bm cells via the hepatic artery .
this study showed improvement in serum bilirubin , albumin , and international normalised ratio ( inr ) .
they went on to perform the first randomised controlled study of autologous bmc transplantation in liver disease .
thirty patients were randomised to receive either a placebo or bmc , in the form of an autologous mononuclear cell preparation infused into the hepatic artery .
after 3 months followup , the treated patients had a significant improvement in albumin compared to controls ( 16% versus 2% ) and a significant reduction in their child - pugh status ( 8% versus + 4% ) .
have also reported the successful use of autologous cd34 bmscs via the portal vein as a rescue treatment in a patient with drug - induced acute liver failure . a liver biopsy performed at 20 days following infusion showed increased hepatocyte replication around necrotic foci
the patient , however , died secondary to multiorgan failure related to bacterial infection . in a study by khan and colleagues , four patients with liver insufficiency
all patients showed improvements in serum albumin , bilirubin , and alt after one month from the cell infusion .
in contrast to the previous studies , a trial of 4 patients with decompensated cirrhosis treated with cd34 stem cells via the hepatic artery was stopped prematurely due to one patient developing nephropathy and hepatorenal syndrome secondary to radiocontrast .
the same group showed that msc transplantation in a further 4 patients with decompensated liver cirrhosis , this time via a peripheral vein , was well tolerated and resulted in a meld score improvement in two .
another study injecting msc into either peripheral veins or the portal vein of patients with esld having a meld score 10 ( n = 8) showed significant improvement in their meld score .
kim et al . reported significant improvement in serum albumin , quality of life , and the child - pugh score in ten patients with advanced liver cirrhosis due to hepatitis b infection following autologous bone marrow infusion .
finally , our group has published the results of administering autologous expanded mobilised adult bm cd34 cells via the hepatic artery in 9 patients with alcoholic liver cirrhosis .
significant decreases in serum bilirubin , alt , and ast levels were observed , whilst the child - pugh scores and radiological ascites improved in 7 and 5 patients , respectively .
although all clinical trials to date have shown some improvement in liver function , it must be remembered that the natural history of cirrhosis tends to be variable .
thus , one would expect some patients to improve with time , particularly in compliant patients who can be followed up and remain abstinent from alcohol .
the liver contains approximately 2.8 10 hepatocytes , and the required mass of cells to correct a single enzyme biochemical defect is likely to be significantly less than that required for treatment of chronic or acute liver failure .
there is evidence to suggest that transplantation of only 15% of the total liver mass may be sufficient to restore adequate functional activity [ 7 , 50 ] .
cells can be delivered to patients via a peripheral vein , the portal vein , hepatic artery , or an intrasplenic injection .
as both fulminant and chronic , liver failure requires the replacement of greater than 10% of functional liver ; the cell mass required for transplantation will be significantly higher .
stimulation of regeneration , such as a partial hepatectomy , promotes increases in carbamoyl phosphate synthetase i activity with subsequent liver hypertrophy .
this early experience suggests that this therapeutic approach has the potential of both enhancing and accelerating hepatic regeneration in a clinical setting . unlike hepatocytes ,
the use of bmscs for liver regeneration does not depend on the procurement of cadaveric livers whose donors are often immunologically disparate and also in short supply .
the use of adult stem cells is attractive as it overcomes the moral and ethical barriers of es cell manipulation .
further advantages of the use of bmscs are that they are multipotent , there is already considerable experience in their use , they are easily accessible , and there is unlimited supply .
conversely , concerns have been raised about the adverse long - term effects of stem cell therapy .
there is evidence to suggest that treatment with bmscs may provide liver fibrogenic cells ( hepatic stellate cells and myofibroblasts ) which contribute to fibrosis and could have a deleterious effect on already decompensated cirrhotic livers [ 52 , 53 ] .
similarly , there are concerns that hepatocellular carcinoma ( hcc ) originates from hepatic oval cells and bmscs .
much of the data concerning the malignant potential of bmscs , however , originates from genetically modified rodent models and may not be present in humans .
new findings in adult stem cell biology are transforming our understanding of tissue repair raising hopes of successful regenerative hepatology .
although all clinical trials to date have shown some improvement in liver function and cd34 cells have been used safely for bm transplantation for over 20 years , only randomised controlled clinical trials will be able to fully assess the potential clinical benefit of adult stem cell therapy for patients with liver insufficiency secondary to ald .
Output:
| chronic liver disease ( cld ) is increasing worldwide yet there has been no major advance in effective therapies for almost five decades .
there is mounting evidence that adult haematopoietic stem cells ( hsc ) are capable of differentiating into many types of tissue , including skeletal and cardiac muscle , neuronal cells , pneumocytes and hepatocytes .
these recent advances in regenerative medicine have brought hope for patients with liver cirrhosis awaiting transplantation .
new findings in adult stem cell biology are transforming our understanding of tissue repair raising hopes of successful regenerative hepatology .
although all clinical trials to date have shown some improvement in liver function and cd34 + cells have been used safely for bm transplantation for over 20 years , only randomised controlled clinical trials will be able to fully assess the potential clinical benefit of adult stem cell therapy for patients with cld .
this article focuses on the potential of bone marrow stem cells ( bmscs ) in the management of cld and the unresolved issues regarding their role .
we also outline the different mechanisms by which stem cells may impact on liver disease . |
PubmedSumm7892 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: interaction between hosts and parasites is a complex relationship that can favour one or the other depending on a number of factors .
initially , the parasite attempts to establish itself in the host while the latter resists the infection via its defense mechanisms .
consequently , host susceptibility and resistance will determine whether or not the infection becomes established . in some fish species , the host 's age , behaviour , physiological and immunological condition ,
proximity to shore , location in the water column , and feeding habits could affect the relationship while the parasite 's mode of entry , ability to evade its host 's defense , nutritional requirements , and living in a site where the immune response is reduced and mimicking its host 's protein composition are factors that influence susceptibility and infectivity .
there are also environmental variables such as water temperature , crowding , and habitat changes that could affect the interaction .
moreover , this interrelationship between hosts and parasites has evolved some associations resulting in host specificity , latitudinal gradients , and diversity in communities and siblings within one species [ 14 ] .
other associations can exist in a harmonious compromise whereas host avoidance of the parasite to prevent an infection or evasion by the parasite of the host 's immune system can occur .
certain song birds in hawaii avoid plasmodium sp . infections from ground - feeding mosquitoes by remaining high up in the forest canopy .
in contrast , an african trypanosome , trypanosoma brucei complex , sheds its surface coats in response to its host 's antibodies .
some parasites have evolved methods , such as circadian rhythms , to maximize transmission to uninfected hosts .
synchrony of peak abundance of microfilaria of wucheraria bancrofti and mature gamonts of plasmodium species in the peripheral blood of humans , when female mosquitoes are actively seeking a blood meal at night , increases infectivity and development in the vector .
mccarthy also noted that a hemoflagellate , t. murmanensis , was more abundant in blood from the gills of atlantic cod , gadus morhua , at night when the vector , a marine leech , johanssonia arctica , fed on its piscine hosts than during daylight .
the leech , a deep - water ( > 90 meters ) species inhabiting the benthic zone where light is probably negligible , was significantly more abundant than at shallow depths ( 30 meters ) where some light penetrates .
cysticerci of taenia solium which infect the human brain , a site impervious to the immune response , are protected from destruction by the host .
similarly , plerocercoids of the fish tapeworm , proteocephalus ambloplitis , avoid shedding from the intestine of its host by migrating into parenteral sites as the water temperature declines in winter , a period when feeding is reduced and worms voided because of a lack of nutrients , . however , the parasites reenter the intestine as the water temperature increases in spring to mature as adult tapeworms .
some tissue - invading parasites can become encapsulated by fibrous tissue in their hosts as a result of the latter 's defence mechanism and appear as cysts .
they might remain viable for lengthy periods until acquired by new and/or appropriate definitive hosts .
xenomas of microsporans such as loma branchialis in salmonids , species of sarcocystis in birds and mammals , and cysticercoids of tapeworms as taenia saginata in cattle and trichinella spiralis in pigs use this strategy to infect new hosts following ingestion .
encapsulation can also be viewed as a defence mechanism by the host to curtail tissue damage by some migrating parasites .
however , sures discussed host - parasite interactions based on observations that some intestinal fish parasites accumulate heavy metals and can be useful as diagnostic tools to determine bioavailability .
the approach , in this presentation will focus on some factors that influence fish - parasite interactions including disease aspects , climatic change , and environmental pollution .
the immune response to foreign proteins in fish is lower in magnitude compared to mammals . some of the defense barriers include mucous in the skin and gills , bile , digestive enzymes , and immunological barriers , primarily cellular and antibody responses .
for example , a hemoflagellate , cryptobia salmositica , is infective to some salmonid species but salvelinus namaycush exhibits innate resistance .
lytic antibodies were responsible for resistance but these apparently were absent in s. fontinalis that was susceptible to the infection .
the immune response is temperature dependent as larval anisakine nematodes ingested in late autumn - winter , when water temperatures range from 0 to 4 ec , remain free in the tissues of atlantic cod , gadus morhua , whereas in summer , most become encapsulated ( khan , unpubl . data ) .
generally , ectoparasites differ from endoparasites as the defence mechanisms tend to be reduced externally in fish .
the interaction between an ectoparasitic ciliate , trichodina murmanica , and its host , the atlantic cod , is age and temperature - dependent .
prevalence and abundance of the parasite on the skin of 1-year juvenile fish in nature are extremely low and rare in older fish .
however , outbreaks have occurred in fingerling and 1-year fish cultured cod held in over - stocked conditions during winter when water temperature was 0 - 1c .
the infection and mortality declined with increasing water temperature and were rarely seen during summer at 814c .
infection of atlantic cod with trypanosoma murmanensis was also age and temperature dependant as mortality was greater in younger than older fish . moreover , the infection persisted for longer periods ( 68 weeks ) at lower ( 02c ) than higher ( 1012c ) temperature ( khan , unpubl .
it is probable that the host 's immunity is temperature - dependent or the parasite is adapted to low temperatures as noted in some subarctic marine leeches .
in contrast , a microsporan , loma branchialis , appearing as macroscopic cysts on the gills of fingerling and juvenile cod , caused die - offs only in summer - autumn when water temperatures were high .
die - offs have also occurred in commercial - size cod held in sea pens for market in summer ( barker , unpubl .
xenomas resembling tumours , occurred in all the internal organs and moribund fish , in an emaciated condition , succumbed in a matter of weeks .
similar temperature - related die - offs have occurred in cultured juvenile arctic charr , salvelinus alpinus , only in summer following infection with a myxozoan , tetracapsuloides bryosalmonae , held in earthen ponds .
outbreaks of disease caused by plerocercoids of a cestode , diphyllobothrium dendriticum , occurred in cultured rainbow trout , s. namaycush , after transfer from a hatchery to an embayment only in summer .
host response to the parasites was minimal except for loma branchialis as encapsulation of the xenomas did occur but some ruptured releasing spores that presumably infected other organs and tissues .
influence of water temperature on host - parasite interactions has also been reported previously .
some parasitic crustaceans interacting with their fish hosts can have a profound impact on their health .
the pennellid copepod , lernaeocera branchialis , anchors its holdfast into one of the branchial blood vessels causing anemia and mortality depending on the age of the fish and the number of infecting parasites .
mortality was high in juvenile cod about 3 years old but declined with increasing age .
commercial - size atlantic cod that were held in sea cages during the summer also succumbed when water temperatures were high but declined during winter .
reported that the parasite induced extensive hyperplasia in the gills , intravascular thrombus formation and moderate cellular response in the cardiac and branchial tissues .
in contrast , hundreds of larval stages that attach to the gills of the intermediate host , the lumpfish , cyclopterus lumpus , cause no effect .
another gadid fish , the rock cod , gadus ogac , that inhabits inshore embayments off st .
lewis , labrador ( 5222n , 5541w ) , appeared to tolerate multiple numbers of parasites without exhibiting debility in contrast to atlantic cod .
young fish were infected with a fewer mean number of parasites than older cod , some with as many as 7 parasites per older host ( table 1 ) .
prevalence of the infection was 84% in 1976 and mean abundance increased with the length of the fish . although fewer samples were caught in 1986 ( as a result of a population decline triggered by climatic changes ) , there was a slight increase in prevalence but no significant change in mean abundance .
unlike atlantic cod , the infected rock cod appeared robust and the gills pink to red without any indication of an anaemic condition observed in other gadids .
prevalence of the infection was considerably lower in atlantic cod captured inshore by cod trap in both 1976 ( 4% of 48 fish ) and in 1986 ( 5% of 36 fish ) .
the rock cod is cold - water - adapted fish that lives inshore beneath the ice in winter and apparently was not affected by oceanographic changes that occurred from the mid-1980s off eastern canada .
marine hematophagous leeches ( hirudinea : piscicolidae ) exhibit an interesting interrelationship with their fish hosts .
some species of leeches feed on a variety of teleosts while others tend to be host specific .
johanssonia arctica , a deep - sea species adapted to subarctic conditions , fed on several species of teleosts while two species of malmiana , m. scorpii and m. brunnea , were found only on shorthorn ( myoxocephalus scorpii ) and longhorn sculpins ( m. octodecemspinosus ) , respectively , in the nw atlantic ocean [ 26 , 27 ] .
several species of marine leeches attach to the skin of their hosts to feed on blood but others , such as oxytonstoma microstoma and o. sexoculata , adhere to the gills and on the angles of the oral cavity , respectively [ 26 , 27 ] .
these previously mentioned leeches remain permanently attached to their hosts , feeding intermittently until maturity , copulation , and cocoon deposition [ 26 , 27 ] .
others , such as j. arctica , myzobdella lugubris , and notostomum cyclostomum , after feeding on fish , detach and reattach to crabs ( crustacea : decapoda ) for transport and deposition of cocoons [ 9 , 16 , 28 , 29 ] . locating fish hosts for a blood meal
other leeches deposit their cocoons on the egg masses of their piscine hosts or on rocks frequented by fish .
synchronous hatching of larval fish and young leeches ensures that the latter can locate a host for their subsequent blood meals .
mace and davis reported slow growth rate and energy loss in shorthorn sculpins infected with m. scorpii .
hematophagous leeches can induce anemia , subcutaneous hemorrhage , and inflammation especially when a heavy infestation occurs .
j. arctica is capable of transmitting a trypanosome , t. murmanensis , a piroplasm , haemohormidium beckeri , and probably a hemogregarine , haemogregarina uncinata [ 3234 ] .
another genus of hemoflagellates , species of trypanoplasma ( cryptobia ) is transmitted by leeches .
trypanoplasma bullocki has caused mortality in summer flounder , paralichthys dentatus , populations in the middle atlantic bight .
consequently , interaction between hematophagous leeches and fish can result in stress as a result of blood loss and also in the transmission of pathogenic parasites .
some parasites are known to predispose their hosts for predation by alteration of their behavior as in some carnivore - herbivore interactions . in the three - spine stickleback , gasterosteus aculeatus , a larval cestode
, the plerocercoid of schistocephalus solidus , infects the body cavity and can impair swimming .
it has been reported that infected fish are more likely to be predated than uninfected sticklebacks [ 37 , 38 ] . some fish with distended abdomens
have been observed swimming near the surface in ponds in newfoundland ( khan , unpubl .
examination of the fish with swollen abdomens revealed at least two large larvae per host .
the arctic tern ( sterna paradisaea ) is also a definitive host of s. solidus .
nestlings on a small island near cow head ( 4955n , 5753w ) , newfoundland , were fed sticklebacks by the parental birds , and during one wet and cool summer , several nestlings were observed in an emaciated condition .
examination of nine freshly dead birds revealed cestode larvae in the coelomic cavity of six carcasses ( x- 3.91.2/nestling ) , all exhibiting evidence of hemorrhage in the body cavity and an absence of food in the digestive tract ( khan , unpubl .
it is likely that the parasite , lacking nutrients in the digestive tract , migrated from this site through the coelomic wall , causing the lesions observed and also predisposed them to predation by foraging gulls .
an unusual difference in the abundance and prevalence of parasites was observed in two populations of landlocked arctic charr inhabiting different habitats in a pristine deep - water lake in gander ( 4858n , 5457w ) , newfoundland ( khan , unpubl .
one of these , a pale - colored morph , pelagic and living in shallower water , fed primarily on mayfly nymphs , heptagenia spp .
( ephemeroptera : heptageniidae ) and other insect larvae were more parasitized than the dark morph inhabiting a mid - water - benthic zone feeding on macroinvertebrates and fish such as sticklebacks .
dna evidence has revealed that the two populations were distinct and might have been separated a long time previously probably during the postglacial period .
meristic results and colouration have revealed that mixing was rare , with each group occupying different niches .
species diversity , abundance , and prevalence of the parasitic helminth taxa , trematodes , cestodes , and nematodes were significantly greater in the pelagic than in the mid - water - benthic group ( table 2 ) .
these results are reminiscent of a hybrid salmonid , the splake ( salvelinus fontinalis s. namaycush ) , a cross between a brook trout ( s. fontinalis ) and lake trout ( s. namaycush ) , that was bred to avoid lamprey ( petromyzon marinus ) predation by inhabiting mid - water rather that the benthic area where lake trout frequented .
fewer parasitic species ( 23 spp . ) were observed in the splake than in the lake trout ( 75 spp . ) .
factors responsible for the separation of the two arctic charr populations in gander lake remain enigmatic but they suggest an example of parasite paucity resulting from habitat selection . oceanographic changes caused by a series of adverse climatic events have also had an impact on host - parasite interactions especially on the abundance and prevalence of metazoan parasites in the digestive tract of atlantic cod occurring off the coast of labrador , canada .
changes in the climate caused water temperatures to decrease resulting in a decline of ocean fish and sea birds .
prior to this time , the abundance of an acanthocephalan parasite , e. gadi , was high but , following a chain of cascading events during the mid-1980s , it decreased to extremely low levels .
outmigration of the main food source , the capelin , mallotus villosus , and also the paratenic host of the infection in older atlantic cod , was the underlying cause .
decline of the abundance of e. gadi should favour its fish host as the spines on the proboscis of some acanthocephalans are known to cause lesions in the intestinal wall and ultimately affect growth .
however , the abundance of cod in the area continues to be low as a result of a sparcity of capelin .
fish parasites can also be useful as bioindicators of habitat degradation caused by anthropogenic contaminants especially when sensitive species are sampled as sentinels .
these bioindicators include abundance , prevalence , and species diversity . these variables might increase or decrease following long - term exposure .
effluent , discharged by two pulp and paper mills in newfoundland , caused both external and internal lesions , disrupted gonadal development , and altered length - class distribution in all age groups of winter flounder , a sediment - inhabiting flatfish species [ 46 , 47 ] .
in both inlets , the fish were infected with large numbers of metacercaria of a digenetic trematode , cryptocotyle lingua , on the body , head , and fins compared to reference samples .
low levels of lymphocytes in the heavily parasitised fish were most likely indicative of a compromised immune system .
abundance of c. lingua was also high in nursery areas of the flounder where untreated municipal effluent , containing sewage- and crank - case petroleum waste , was discharged ( khan , unpubl .
it appears that an abundance of food for fish and sea gulls ( larus spp . ) , definitive hosts of the parasite , attracted them to these areas .
additionally , macroscopic xenomas of another parasite , a microsporan , glugea stephani , occurred in the internal organs including the heart , liver , spleen , kidneys , intestine , and gonads in samples taken near the mill whereas they were restricted to the wall of the digestive tract of reference samples .
lower than normal lymphocyte levels associated with host resistance probably provided an opportunity for the parasite to metastasise following release of spores from ruptured xenomas to infect other sites .
another study reported reduced numbers of digeneans and myxozoans but increased numbers of acanthocephalans in roach ( rutilus rutilus ) and perch ( perca fluviatilis ) in a lake receiving effluent from a pulp mill when compared to samples from two less polluted oligotrophic lakes .
changes in the density of the intermediate hosts , toxic effect on the ectoparasites , and impairment of the immune response were suggested as the underlying causes .
both field and laboratory studies have revealed that some parasites of winter flounder respond differently at various concentrations to discharges from a pulp and paper mill [ 47 , 51 , 52 ] .
gradient sampling of winter flounder inhabiting a fjord where pulp and paper mill effluent had been discharged for several decades revealed that two selected helminths , a digenean , s. furciger , and an acanthocephalan , e. gadi , increased in abundance down current from the outfall .
external and internal lesions , low body condition , and organosomatic indices , but elevated levels of detoxifying enzymes in the liver , were also noted in the affected fish .
winter flounder captured from a pristine site were exposed to sediment collected at the four sites down current from the discharge .
the results provided evidence to support the field study that enteric parasites were more abundant in flounder taken from the farthest location than others originating from the proximity of the paper mill .
these results suggest that host - parasite interactions can be affected after chronic exposure to anthropogenic discharges .
the balance between host and parasite interactions was also affected in sculpins and winter flounder living in coastal habitats where untreated domestic sewage and polychlorinated biphenyls ( pcbs ) were disposed .
untreated domestic sewage was responsible for an increase in the abundance of trichodina spp . and
gyrodactylus pleuronecti on the secondary gill lamellae of shorthorn sculpins sampled in an embayment located in eastern newfoundland .
the trichodinids were more abundant ( x- , 3.6 0.4 ; n = 16 ) where the sewage was discharged than at one ( x- , 4.1 1.3 ; n = 14 ) or 5 km ( x- , 2 0.3 , n = 23 ) offshore ( khan unpubl .
data ) . khan and hooper noted that abundance and prevalence of ectoparasitic ciliates and enteric helminths increased with distance from the point of discharge of thermal effluent in winter flounder .
however , myxozoans in the gall bladder were more prevalent at the discharge location than down current .
sculpins sampled at a site where pcbs had been discharged exhibited also a greater abundance of trichodinids on the gills and myxozoans in the gall bladder of the sculpin , m. scorpius , than at the reference site , while enteric helminthes and ectoparasitic leeches were fewer than in latter fish .
moreover , 14 species of parasites occurred in the pcb - affected sculpins in contrast to 11 in the reference samples . external and toxicopathic lesions in several tissues , significantly lower body condition and organ somatic indices as well as lower hemoglobin and lymphocyte levels , were noted in the pcb - contaminated fish when compared to reference fish .
lack of parasite diversity was likely associated with the brackish water conditions that affected the transmission of some sensitive parasite species in the reference samples .
studies on winter flounder exposed to petroleum aromatic hydrocarbons ( pahs ) , both in the field and in the laboratory in a dose - response trial , revealed a similar result .
ectoparasites such as trichodinid ciliates and a monogenean increased to a peak but declined as the concentration increased while enteric helminthes declined progressively .
trichodinid ciliates and monogeneans infecting the gills of sculpins and atlantic cod , respectively , also increased in abundance or prevalence following chronic exposure to pahs ( [ 57 , 58 ] and references therein ) .
additionally , exposure to pahs and a concurrent infection with the hemoflagellate , t. murmanensis , caused greater mortality and a greater abundance of parasites in both atlantic cod and winter flounder than in fish infected only with the parasite or exposed only to pahs . in contrast , endoparasitic helminthes declined after exposure , with the pahs probably simulating antihelminthic drug action and/or changes in host physiology [ 56 , 60 ] .
however , ectoparasitic abundance hinged on the concentration of the pollutant as it declined after a peak with increasing levels of the pahs . fewer species and their abundance of both groups of parasites
were also observed in sculpins exposed to pcbs at an impacted military dockyard than at a reference site as noted previously .
increase of ectoparasites was probably associated with a decline of the host 's immune response , hyperplasia in the secondary gill lamellae , excessive epidermal mucus secretion , and exfoliation that attracted opportunistic bacteria which served as additional food for them .
changes in host physiology , toxicity of the contaminants to the larval and adult stages of the helminths as well as to their intermediate hosts , especially in the field , might have been responsible for their decline .
sanchez - ramirez et al . also reported that a monogenean cichlidogyrus sclerosus increased in abundance after exposure of nile tilapia ( oreochromis niloticus ) to sediment contaminated with pahs , pcbs , and heavy metals in a static system for 15 days .
future studies on fish parasites as bioindicators should include additional information on the fish 's body condition , organ somatic indices , histopathological effects , and also hepatic detoxifying enzymes .
parasite richness in eels ( anguilla rostrata ) , including monogeneans and digeneans , was greater in less acidified locations than in more acidic sites in nova scotia .
other parasites including acanthocephalans and copepods did not appear to be affected . in summary , observations on host - parasite interactions
are complex , at times difficult to interpret on account of a number of variables that can shift the balance one way or the other .
factors such as host 's age , behaviour , immunological competence , and environmental change can play a role in the association .
alternatively , establishment and evasion by the parasite of the host 's responses appear to be significant factors .
consequently , the outcome in this interaction will hinge on host susceptibility and resistance and the parasite 's ability to infect its host .
it is suggested that future studies , investigating host - parasite interactions in habitats degraded by anthropogenic contaminants , should consider sampling multiple sites , especially along a gradient , and include more than one bioindicator and sensitive fish species .
Output:
| host - parasite interactions are complex , compounded by factors that are capable of shifting the balance in either direction
. the host 's age , behaviour , immunological status , and environmental change can affect the association that is beneficial to the host whereas evasion of the host 's immune response favours the parasite . in fish , some infections that induce mortality are age and temperature dependent .
environmental change , especially habitat degradation by anthropogenic pollutants and oceanographic alterations induced by climatic , can influence parasitic - host interaction .
the outcome of these associations will hinge on susceptibility and resistance . |
PubmedSumm7893 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: tumors require nutrients and oxygen to grow , and new blood vessels , formed by angiogenesis , provide these substrates .
its expression is regulated by a plethora of intrinsic and extrinsic factors , with hypoxia and hypoglycemia being the major stimuli .
little is known about the exact trigger mechanisms of vegf expression in hematolymphoid tumors , but mechanisms analogous to those observed in solid tumors are anticipated [ 4 , 5 ] .
tight control of angiogenesis is maintained by a balance of endogenous antiangiogenic and proangiogenic factors .
vegf has a key , rate - limiting role in promoting tumor angiogenesis and exerts its effects by binding to one of three tyrosine kinase receptors : vegf receptor-1 ( vegfr-1 ; fms - like tyrosine kinase-1 , flt-1 ) , vegfr-2 ( human kinase domain region , kdr / murine fetal liver kinase-1 , flk-1 ) , and vegfr-3 ( flt-4 ) [ 6 , 7 ] .
the identification of an acquired somatic mutation in the jak2 gene , resulting in a valine to phenylalanine substitution at position 617 ( jak2-v617f ) , has provided new insights into the pathogenesis of bcr - abl1-negative myeloproliferative neoplasms ( mpn ) , being present in most patients with polycythemia vera ( pv ) and in approximately 50 % of patients with essential thrombocythemia ( et ) and primary myelofibrosis ( pmf ) [ 8 , 9 ] .
although the molecular diagnostic gap in jak2v617f - negative pv was adequately addressed by the discovery of other jak2 mutations , the same had not been realized for the 3540 % of patients with et or pmf who do not express jak2 mutations . in december 2013
, two groups reported the occurrence of novel calreticulin ( calr ) mutations in jak2/mpl - unmutated pmf or et [ 10 , 11 ] .
both groups found mutual exclusivity between calr , jak2 , and mpl mutations . in the study by klampfl et al .
, calr mutations were not seen in 382 cases of pv but were detected in 25 % of patients with et ( n = 311 ) and 35 % of those with pmf ( n = 203 ) .
we and the others showed that angiogenesis and expression of vegf and its receptors in the bone marrow of patients with bcr - abl1-negative mpn is increased , especially in pmf [ 1217 ] .
we found significantly increased microvessel density ( mvd ) , particularly that assessed by cd105 , and vegf expression in mpn compared with controls ( pmf > pv > mds / mpn > et ) .
we observed stronger association between cd105-mvd and vegf expression , fibrosis , and jak2-v617f mutant allele burden , compared with cd34-mvd .
cd105/endoglin is a cell transmembrane glycoprotein and a key component of transforming growth factor - b receptor complex .
it is mainly expressed by angiogenic endothelial cells and has been correlated with tumor mvd .
cd105 is preferentially expressed by newly formed vessels [ 20 , 21 ] , and thus , cd105-based mvd quantification better reveals ongoing proangiogenic activity .
mvd was strongly increased in mpn with high jak2-v617f mutant allele burden . considering correlations between the jak2-v617f status and angiogenesis in mpn
, we showed that mvd , particularly if assessed by cd105 , in pv and pmf patients correlate with a high jak2-v617f mutant allele burden ( 55 % mutant alleles ) , but not with the diagnostic level for jak2 mutations of 3 % .
these observations implicate that higher activity of jak2-related pathways , as observed in cases with higher jak2-v617f mutant allele burdens , may influence angiogenesis in mpn .
this assumption is further supported by our observation that vegf cellular amounts did not concurrently rise with increasing jak2-v617f mutant allele burden regardless of rising mvd . whether this observed increased neovascularization in neoplastic bone marrow is instrumental for the neoplastic process or rather an
resulting from growth factors and cytokines being out of balance can only be determined by carefully designed experiments and clinical studies where inhibition of the angiogenic process does or does not inhibit the growth of the neoplasm .
antiangiogenic therapies are mostly based on inhibiting the binding of vegf to vegfr by neutralizing antibodies to the ligand or to the receptor , soluble receptors , or small molecule inhibitors or are directed against the tyrosine kinase activity of the vegf receptors ( table 1 ) .
a growing list of antiangiogenics is now available , either in various stages of clinical development or as components of standard clinical regimens .
the major classes of antiangiogenic therapy include ( 1 ) receptor tyrosine kinase inhibitors ( tki ) , targeting vegfr signaling as well as receptors of other ( proangiogenic ) factors , ( 2 ) direct anti - vegf acting molecules ( anti - vegf antibodies , vegf - antisense nucleotides ) , and ( 3 ) immunomodulatory drugs ( imids ) with antiangiogenic properties .
table 1selection of clinical trials and approved antiangiogenic therapies in hematological malignanciesdrugtargetstudy entitiesapproved for
receptor tyrosine kinase inhibitors
ptk787/zk 222584 ( vatalanib)vegfr1 - 3 , pdgfrb , c - kitaml , pmf , mds , cml , dlbcl , mmsu5416 ( semaxinib)vegfr1 - 2 , c - kit , flt3aml , mds , mm , mpnsorafenib ( nexavar)vegfr2 - 3 , b - raf , faf-1 , pdgfrbaml , all , mds , cml , cll , nhl , mmadvanced renal cell carcinoma , hccsunitinib ( sutent)vegfr1 - 3 , pdgfr + b , c - kit , flt3aml , mds , cll , myeloma , nhladvanced renal cell carcinoma , gistpkc-412 ( midostaurin)vegfr2 , pkc , pdgfr , flt3 , c - kitamlcediranib ( recentin)vegfr1 - 3 , pdgfrb , c - kitaml , mds , cll
proteasome inhibitors
bortezomib ( velcade)26s proteasome , nf-baml , all , mds , cml , nhl , mclmm , mcl
anti - vegf strategies
bevacizumab ( avastin)vegf - aaml , mds , cll , cml , nhl , mmmetastatic colorectal cancer , nsclc , breast cancer
immunomodulatory drugs
thalidomidebfgf , vegf , il-6aml , mds , mpn , cll , nhl , mmmmlenalidomide ( revlimid)bfgf , vegf , il-6aml , mds , cll , nhlmm , 5q - mds
aml acute myeloid leukemia , bfgf basic fibroblast growth factor , dlbcl diffuse large b - cell lymphoma , cll chronic lymphocytic leukemia , cml chronic myeloid leukemia , gist gastrointestinal stromal tumors , hcc hepatocellular carcinoma , il-6 interleukin-6 , nhl non - hodgkin lymphoma , nsclc non - small - cell lung cancer , mcl mantle cell lymphoma ; mds myelodysplastic syndrome , mm multiple myeloma , mpn myeloproliferative neoplasm , pmf primary myelofibrosis , vegf vascular endothelial growth factor , pdgfr platelet - derived growth factor receptor selection of clinical trials and approved antiangiogenic therapies in hematological malignancies
aml acute myeloid leukemia , bfgf basic fibroblast growth factor , dlbcl diffuse large b - cell lymphoma , cll chronic lymphocytic leukemia , cml chronic myeloid leukemia , gist gastrointestinal stromal tumors , hcc hepatocellular carcinoma , il-6 interleukin-6 , nhl non - hodgkin lymphoma , nsclc non - small - cell lung cancer , mcl mantle cell lymphoma ; mds myelodysplastic syndrome , mm multiple myeloma , mpn myeloproliferative neoplasm , pmf primary myelofibrosis , vegf vascular endothelial growth factor , pdgfr platelet - derived growth factor receptor
small tki that target vegfr are a further important class of antiangiogenic drugs with application to mpn , although their efficacy in hematolymphoid neoplasias might be attributable to inhibition of a variety of pathways .
small - molecule inhibitors targeting vegfrs and other kinases , e.g. , sorafenib ( nexavar ) and sunitinib ( sutent ) , have been approved based on their efficacy in treating renal cell and hepatocellular carcinoma [ 23 , 24 ] .
vatalanib is an oral angiogenesis inhibitor that is active against vegfr and platelet - derived growth factor receptor tyrosine kinases , thereby offering a novel approach to inhibiting tumor growth by interfering with the atp - binding sites of vegfr . in a phase i dose - escalation study , vatalanib , a vegfr tki , was administered to 29 pmf patients at doses of 500 or 750 mg bid .
one patient ( 3 % ) achieved cr ( complete remission ) and five ( 17 % ) achieved clinical improvement .
transient potentially vatalanib - related toxicities were mild nausea , vomiting , dizziness , fatigue , or thrombocytopenia .
the first antiangiogenic agent to be approved in solid tumors was bevacizumab ( avastin ) , a humanized anti - vegf monoclonal antibody .
administration of bevacizumab , in combination with cytotoxic chemotherapy , conferred benefits to patients with several tumor entities like metastatic colorectal cancer , nonsquamous , non - small - cell lung cancer , and metastatic breast cancer [ 27 , 28 ] . in a phase ii study , bevacizumab monotherapy was tested in patients with symptomatic , relapsed / refractory pmf .
a total of 13 patients were enrolled in the first stage of this two - stage trial . among the 11 patients who received therapy , only 3 received more than 4 cycles of therapy ; none of the patients achieved an objective response .
furthermore , significant toxicity , not directly related to the vascular or gastrointestinal events typically associated with the anti - vegf monoclonal antibody preparation in other disease states , was observed .
lack of objective responses coupled with toxicity led to the decision to terminate the study early .
the authors concluded that if future studies incorporate bevacizumab in combination therapy for myelofibrosis , more modest doses should be considered .
thalidomide was originally introduced as sedative and withdrawn in the 1960s due to deleterious side effects . recently , there is increasing evidence for the efficacy of thalidomide in cancer therapy
. the surprising effects of thalidomide have led to the development of a series of imids with even higher antiangiogenic potency [ 30 , 31 ] .
the interest on thalidomide as an antineoplastic agent rose after demonstration of its antiangiogenic activity in a rabbit model of corneal neovascularization that was induced in response to bfgf .
thalidomide and the newer imids ( e.g. , lenalidomide ) have been shown to significantly decrease the expression of the proangiogenic factors vegf and interleukin-6 in multiple myeloma .
the newer imids were found to be two to three times more potent compared with thalidomide concerning antiangiogenic activity in various in vivo assays .
the antiangiogenic activity of imids has been shown to be independent of their immunomodulatory effects .
in a recent study , the antiangiogenic effect of lenalidomide was studied in vitro in bone marrow endothelial cells of patients with multiple myeloma and in vivo using the chorioallantoic membrane assay . lenalidomide exerted a relevant antiangiogenic effect in vivo at 1.75
mol / l , a dose reached in interstitial fluids of patients treated with 25 mg / day . in vitro , lenalidomide inhibited angiogenesis and migration of multiple myeloma endothelial cells . in a phase ii study of 44 pmf patients , the efficacy of thalidomide monotherapy was assessed .
of 41 evaluable patients receiving treatment for at least 15 days , 17 ( 41 % ) showed a response .
cr ( complete remission ) ( without reversal of bone marrow fibrosis ) was achieved in four patients ( 10 % ) and partial response in four ( 10 % ) , and hematological improvements of anemia , thrombopenia , and/or splenomegaly were observed in nine patients ( 21 % ) . in phase ii studies with lenalidomide monotherapy in patients with symptomatic pmf ,
the overall response rates were 22 % for anemia , 33 % for splenomegaly , and 50 % for thrombocytopenia .
in a combination study of lenalidomide with prednisone in 40 pmf patients , responses were recorded in 12 patients ( 30 % ) and are ongoing in 10 ( 25 % ) , with a median time to response of 12 weeks .
three patients ( 7.5 % ) had partial response and nine ( 22.5 % ) had clinical improvement lasting a median of 18 months .
overall response rates were 30 % for anemia and 42 % for splenomegaly .
interestingly , all eight jak2-v617f - positive responders also experienced a reduction of the baseline mutant allele burden . in a study with pomalidomide , a newer imid , in patients with mf ,
overall anemia response was 27 % and increased to 53 % in jak2v617f - positive patients .
the comfort - i trial assessed the activity of ruxolitinib at 15 or 20 mg orally twice daily in 309 patients with pmf , or with post - pv or post - et mf , whereas comfort - ii trial compared the activity of ruxolitinib in 219 patients with pmf or post - pv or post - et mf against the best available therapy ( bat ) .
the proportion of patients with at least a 35 % reduction in spleen volume was detected by either magnetic resonance imaging ( mri ) or computed tomography at 24 ( comfort - i ) or 48 ( comfort - ii ) weeks of therapy . in comfort - i , the reduction in spleen volume was observed in 41.9 % of patients taking ruxolitinib compared with 0.7 % taking placebo ; the proportion of patients with a reduction of 50 % or more in the total symptom score from baseline to week 24 was 45.9 % in the ruxolitinib group versus 5.3 % in the placebo group [ 41 , 42 ] . in comfort - ii , the reduction in spleen volume was observed in 28 % of patients on ruxolitinib compared with 0 % on bat after a 48-week follow - up period [ 41 , 42 ] .
the 3-year follow - up data with ruxolitinib in patients with myelofibrosis showed , in the ruxolitinib arm , with continued therapy , spleen volume reductions of 35 % by mri were sustained for at least 144 weeks , with the probability of 50 % .
a total of 45 % of the patients randomized to ruxolitinib remained on treatment , and ruxolitinib continues to be well tolerated .
anemia and thrombocytopenia were the main toxicities , but they were generally manageable , improved over time , and rarely led to treatment discontinuation .
additionally , patients randomized to ruxolitinib showed longer overall survival than those randomized to bat .
angiogenic and especially vegf / vegfr pathways are possibly involved in the pathophysiology of mpn .
vegf / vegfr interactions can stimulate proliferation , migration , and survival of leukemia / lymphoma cells by autocrinous and paracrinous loops .
novel agents , targeting vegf , its receptors , and other angiogenic pathways , are in various stages of clinical development and investigation in mpn . as we know from the treatment of solid tumors , combination therapies of different antiangiogenic molecules with chemotherapy or irradiation
increases treatment efficacy . however , not all patients treated with antiangiogenic therapies benefit from this kind of therapy , and in most cases , the effect is transient .
it has to be kept in mind that most of these studies used anti - vegf monotherapy to treat heavily pretreated , refractory , or relapsed patients .
the molecular diagnostic gap in jak2/mpl - unmutated et / pmf is now partially addressed by the recent discovery of calr mutations in the majority of such cases .
angiogenesis is possibly involved in the pathophysiology of myeloproliferative neoplasms ( mpn).new molecular markers like calreticulin provide additional diagnostic and prognostic tools in mpn wild - type for jak2 and mpl .
new molecular markers like calreticulin provide additional diagnostic and prognostic tools in mpn wild - type for jak2 and mpl .
Output:
| tumor angiogenesis has been identified to play a critical role in tumor growth and tumor progression , and is regulated by a balance of angiogenic and antiangiogenic cytokines .
this has been documented for solid tumors , and there is emerging evidence suggesting that tumor progression of hematological malignancies also depends on the induction of new blood vessel formation .
data on angiogenesis in the bone marrow of bcr - abl1-negative myeloproliferative neoplasm patients suggest an increase of the microvessel density and vascular endothelial growth factor ( vegf ) expression , and there is a relation to the jak2-v617f status .
the most important proangiogenic agent is vegf , activating vegf receptors 1 and 2 .
inhibition of vegf signaling by monoclonal antibodies or small molecules ( kinase inhibitors ) has already been successfully established for the treatment of different cancer entities , and multiple new drugs are being tested in clinical trials .
most patients with essential thrombocythemia ( et ) or primary myelofibrosis ( pmf ) that was not associated with a jak2 or mpl alteration carried a somatic mutation in calreticulin ( calr ) .
thus , calr mutations should be included in the next classification system for et / pmf .
this review summarizes recent advances in the basic understanding of the role of angiogenesis in myeloproliferative neoplasms and the translation of such basic findings into clinical studies . |
PubmedSumm7894 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: advanced glycation end products ( ages ) are modifications of proteins , lipids or nucleic acids that become non - enzymatically glycated and oxidized after contact with reducing sugars .
this process may contribute to the pathogenesis of micro- and macrovascular disease . in diabetes ,
accumulation of ages in skin collagen is correlated with the presence of long - term vascular complications .
the formation and accumulation of ages is enhanced by chronic hyperglycemia , oxidative stress and a decreased renal function .
an age reader uses this property and measures skin autofluorescence ( af ) non - invasively and within seconds .
skin af as measured by an age reader significantly correlates with collagen - linked fluorescence and with specific ages such as pentosidine , n-(carboxymethyl)-lysine ( cml ) and n-(carboxyethyl)-lysine ( cel ) in skin biopsies .
the relationship between skin af and micro- and macrovascular disease has been studied in patients with diabetes , renal failure and cardiac disease .
skin af was shown to be associated with micro- and macrovascular complications in type 2 diabetes and to be an independent predictor of cardiovascular morbidity and mortality in patients with type 2 diabetes or cardiac disease .
waist circumference predicts the likelihood of developing diabetes beyond that explained by commonly evaluated cardiometabolic risk factors and body mass index ( bmi ) .
oxidative stress leads to insulin resistance and -cell dysfunction , and this in turn can increase oxidative stress , accelerating the progression to overt type 2 diabetes and diabetes related complications . taking this into account , people with central obesity might already have increased levels of ages before diabetes or cardiovascular disease become manifest .
skin af is , to the best of our knowledge , not assessed in a population with central obesity . to evaluate our hypothesis of accelerated accumulation of ages in central obesity ,
we compared the distribution of skin af as well as the associations between skin af and several clinical and biochemical parameters in people not treated for diabetes , hypertension or lipid disorders , with and without central obesity .
in total 1,860 participants underwent all screening procedures , in 1,386 of them skin af and reflectance were measured . 1,247 ( 90.0% ) were western european , with a skin reflection of at least 6.0% .
for the ten year age categories 2029 y , 3039 y , 4049 y , 5059 y and 6069 y , mean skin af was 1.39 0.22 , 1.59 0.31 , 1.84 0.37 , 2.03 0.41 and 2.21 0.47 au , respectively .
eight - hundred sixteen of the 1,247 persons had a waist circumference above 88 /102 cm ( women / men ) ; 431 had a waist circumference equal to or below this threshold . in both groups ,
smokers had a 12% respectively 17% higher skin af than non - smokers ( 2.03 0.48 vs. 1.82 0.41 au ; p < 0.001 and 2.01 0.48 vs. 1.72 0.36 au ; p < 0.001 ) .
blood pressure , blood lipids , fasting glucose and hs - crp differed across groups .
mean skin af in the centrally obese participants was 1.86 0.43 au , compared with 1.78 0.40 au in the group without central obesity ( p = 0.001 , after adjustment for age and smoking p = 0.13 ) .
n = 106 ) , central obesity without other risk factors ( n = 74 ) and central obesity with other risk factors ( n = 742 ) were 1.63 0.37 , 1.74 0.44 and 1.87 0.43 au , respectively ( p for trend < 0.001 , after adjustment for age and smoking p for trend = 0.12 ) .
participants with the metabolic syndrome ( n = 330 ) had a higher skin af than participants without the metabolic syndrome ( 1.90 0.43 vs. 1.81 0.42 au ; p = 0.001 ) . also within the centrally obese participants ( n = 816 ) , those with the metabolic syndrome ( n = 319 ) had a higher skin af than those without ( 1.90 0.43 vs. 1.84 0.44 au ; p = 0.07 ) .
in univariable regression analysis in the 816 individuals with central obesity age , waist circumference in women , systolic and diastolic blood pressure , hdl - cholesterol , ldl - cholesterol , fasting glucose , hs - crp , creatinine clearance and smoking showed a significant association with skin af . in individuals without central obesity diastolic blood pressure and hdl - cholesterol
did not show a significant association with skin af ; waist circumference was only significant in men .
table 2 shows the multivariable associations between skin af and the clinical and biochemical parameters for individuals with and without central obesity . in people with central obesity , age , current tobacco smoking , moderate alcohol consumption , creatinine clearance ,
age and current tobacco smoking together explained 26.9% of the total variance . adding waist circumference to the limited model with only age and current tobacco smoking led to an increase in explained variance from 26.9% to 27.5% . in the subgroup of 74 centrally obese individuals without other cardiometabolic risk factors the variance explained by age and smoking was 29.2% .
none of the other variables showed an independent association with skin af in this group . in the population without central obesity not only age , current tobacco smoking and alcohol consumption
however , in people without central obesity creatinine clearance and hs - crp were not associated with skin af .
this study shows that mean skin af for a western european population with central obesity but without previously known cardiovascular risk factors , aged 2070 , does not differ significantly between centrally obese and non - obese people , after adjustment for age and smoking .
age , current tobacco smoking , current alcohol consumption , waist circumference , creatinine clearance and hs - crp were independently associated with skin af and together these variables explained 29.4% of the total variance . mean skin af in our apparently healthy study population , in both centrally obese and non - obese persons , was lower than skin af in control groups of other studies .
lutgers et al . measured skin af in non - diabetic pre - operative visitors of an out - patient clinic .
they were both obese and non - obese , with a mean age of 52 17 y ( n = 231 ) .
the average skin af in this group was 2.14 0.6 au . this is higher than mean skin af in our population , which might in part be explained by the lower mean age in our study .
when comparing skin af within similar age categories , the mean values for the people aged 4049 y were comparable .
however , in the age groups 5059 and 6069 y , the mean values in our study are respectively 4% and 11% lower in centrally obese people and even more in non - obese people . in addition , koetsier et al . provide reference values of skin af for the age groups 2029 and 3039 y. these values are based on the combined data of the cohort described by lutgers et al . and another cohort of patients without known history of hypertension , diabetes , or cardiovascular disease . compared with these age groups ,
the mean values are respectively 7% and 8% lower in our centrally obese group and even more in the non - obese group .
possible explanations for these differences are the lower percentage of current smokers in our population compared with the population described by lutgers et al .
also the measurement of skin af after an overnight fast as performed in our study could contribute .
have shown that postprandial both vasodilatation of the microcirculation and an acute increase in serum ages occur .
they suggest this could explain the increase in skin af about 9% in healthy persons that they found postprandially .
we found six variables to be independently associated with skin af in a centrally obese population : age , current tobacco smoking , alcohol consumption , waist circumference , creatinine clearance and hs - crp .
age and current tobacco smoking are known to be important factors in determining skin af in healthy individuals .
the negative association between creatinine clearance and skin af can be explained from the fact that the kidney is the major site of age clearance .
this is in accordance with the fact that moderate alcohol intake has beneficial effects on endothelial function , reduces inflammation and thereby lowers cardiovascular risk .
lutgers et al . were the only ones to look at the relationship between obesity and skin af in a population without established diabetes or cardiovascular disease . in their multivariable analysis bmi , as measure of obesity ,
findings in populations with type 2 diabetes are inconsistent . both lutgers et al . and meerwaldt et al .
reported significant univariable associations between bmi and skin af ; however in multivariable analyses these associations lost their significance .
monami et al . did find significant correlations for both wc and bmi after correction for age , sex and hba1c .
the significant ( though limited ) independent association we observed in our centrally obese population supports our hypothesis that people with central obesity already have increased levels of ages before diabetes or cardiovascular disease become manifest .
this is further supported by the trend in increasing skin af when looking successively at subgroups of healthy non - obese , healthy obese and unhealthy obese groups . perhaps with a longer existing central obesity state and the subsequent development of other cardiometabolic risk factors the accumulation of ages accelerates , leading from no association between waist circumference and skin af in individuals with only central obesity to a significant though limited association in centrally obese with other cardiometabolic risk factors and finally to a strong association in established cardiovascular disease .
strengths of this study are the large number of people and the wide variety in age , also including younger people .
clinical and biochemical variables already known to influence skin af were taken into account , as well as some additional ones such as alcohol consumption .
our study population consisted of individuals without known cardiovascular disease and diabetes , including individuals with central obesity both with and without other cardiometabolic risk factors , thereby making it an appropriate population to study the accumulation of ages before cardiovascular disease or diabetes become manifest .
due to the cross - sectional design , our data only indicate associations and not causal relations between skin af and the variables under study .
with regard to age , current smoking , creatinine clearance and current alcohol use , there is sufficient evidence or pathophysiological understanding to assume that they are responsible for a higher , or in case of alcohol , for a lower skin af .
a higher skin af could also be the reason for higher levels of hs - crp .
both cross - linking of proteins caused by ages and receptor mediated cellular activation enhance inflammation and thereby levels of hs - crp .
although chronic hyperglycemia is known to enhance accumulation of ages , we did not find fasting glucose to be independently associated with skin af .
this might be due to the normal mean glucose and the limited variance in this population .
measurement of hba1c , as a measure of the duration and magnitude of chronic sustained hyperglycemia , might have shown a stronger association with skin af in our population .
however , we did not perform this measurement . since the age reader is not yet validated in populations with a darker skin type we restricted our analysis to caucasians with a skin reflectance of at least 6% .
. limitations of the age reader as a measure of tissue age accumulation are described in detail elsewhere : not all ages exhibit fluorescent properties and will therefore not be measured with the age reader .
we found a discrepancy in the explained variance between the centrally obese and non - obese group : 29.4% vs. 39.1% .
other factors that were not taken into account in our study might play a role .
ages are readily derived from heat - treated foods , especially animal products that have been broiled , grilled or fried .
uribarri et al . reported that the consumption of dietary ages , but not of calories , correlated independently with circulating ages .
however , serum age may not adequately reflect tissue age , so the influence of food - derived ages on tissue age content still remains to be clarified .
in conclusion , although waist circumference is a well - established risk factor for cardiovascular disease and skin af is associated with cardiovascular disease , in people with an increased waist circumference the contribution of waist circumference to the skin af s variability was limited and might also be determined by the duration of the central obesity .
the relationship between waist circumference and skin af is not as obvious as we hypothesized .
a cross - sectional study was performed in five general practices in ijsselstein , a small city in the center of the netherlands .
all patients from these practices between 20 and 70 y old and not known with diabetes , hypertension or dyslipidemia were offered the possibility of screening for metabolic syndrome according to the ncep atp iii criteria by measuring their waist circumference as a first step .
all participants had a physical examination to measure body weight , height , blood pressure and waist circumference .
central obesity was defined as a waist circumference above 88 and 102 cm for respectively women and men , according to the ncep atp iii criteria .
venous blood samples were drawn after an overnight fast to determine blood glucose , lipids ( triglycerides , total , hdl- and ldl - cholesterol ) , creatinine and high sensitive c - reactive protein ( hs - crp ) .
a questionnaire was used to determine ethnicity , lifestyle factors ( smoking habits , alcohol consumption , and physical activity ) , relevant medical history , family history type 2 diabetes and socio - economic and demographic variables .
smoking was regarded positive when the participant was currently smoking tobacco ; in case of former or never smoking it was regarded negative .
( 121 units per week in men or 114 units per week in women ) and excessive ( > 21 units per week in men and > 14 units per week in women ) .
physical activity was regarded positive when a person reported at least 150 min of moderate physical activity per week .
family history of diabetes was regarded as positive if at least one parent or sibling was known with type 2 diabetes before the age of 60 .
patients were advised to contact their general practice for the results of their screening . in case of detected cardiovascular risk factors they received usual care by their general practitioner .
skin af was measured with an age reader ( diagnoptics bv ) , which is described in more detail elsewhere . in short
, the age reader illuminates a skin surface ( shielded from surrounding light ) on the volar side of the underarm .
emission light and reflected excitation light from the skin are measured with a spectrometer . by dividing the average light intensity emitted per nm over the 420600 nm range by the average light intensity emitted per nm over the 300420 range the autofluorescence is calculated in arbitrary units ( au ) .
skin pigmentation may absorb light and thus influence skin af . to take this into account , skin reflection measurements across the 300420 nm range
skin reflection can then be calculated by dividing the mean intensity of light reflected from the skin by the mean intensity reflected from the white teflon block across the 300420 nm range . since skin af
is affected by skin color and the age reader is only validated in populations with a white skin type , we restricted our analysis to western europeans with a skin reflection of at least 6.0% .
descriptive statistics were used to determine means and proportions . for exponential variables ( hs - crp )
a log transformation was performed . to test for differences in characteristics between the centrally obese and non - obese groups
, we used chi - square tests for categorical variables , independent t - tests for normally distributed continuous variables and mann - whitney tests for not normally distributed continuous variables .
we also determined levels of skin af in subgroups of either centrally obese or non - obese individuals without other cardiometabolic risk factors .
these individuals were selected based on the absence of hypertension , dyslipidemia and impaired glucose ( levels of blood pressure , triglycerides , hdl - cholesterol and fasting glucose below the ncep atp iii criteria thresholds and a total cholesterol < 5.0
since age and smoking are the most important factors in determining skin af , we also evaluated the difference between the centrally obese and non - obese individuals with adjustment for these factors .
mean levels of skin af in smokers and non - smokers were calculated in both groups with and without central obesity as well as over ten years age categories . to assess the associations with skin af
, we performed univariable linear regression analyses for all variables mentioned in table 1 . in order to get reliable estimates of the regression coefficients ,
multicollinearity was checked ( pearson correlation coefficient 0.80 ) and the variables showing the weakest association with skin af were excluded from the multivariable analysis . consequently , diastolic blood pressure and bmi were excluded in favor of systolic blood pressure and waist circumference .
, we created a new variable for waist circumference , taking into account the gender specific thresholds for central obesity .
we did this by extracting the gender specific threshold ( 88 cm for women , 102 cm for men ) from the waist circumference value obtained by physical examination .
the new variable indicated the number of centimeters the waist circumference measured above or below the threshold for central obesity .
variables that did not retain significance in the multivariable analysis were subsequently excluded from the model ( backward selection ) .
multivariable analysis was also performed in the subgroup of centrally obese individuals without other cardiovascular risk factors .
a cross - sectional study was performed in five general practices in ijsselstein , a small city in the center of the netherlands .
all patients from these practices between 20 and 70 y old and not known with diabetes , hypertension or dyslipidemia were offered the possibility of screening for metabolic syndrome according to the ncep atp iii criteria by measuring their waist circumference as a first step .
all participants had a physical examination to measure body weight , height , blood pressure and waist circumference .
central obesity was defined as a waist circumference above 88 and 102 cm for respectively women and men , according to the ncep atp iii criteria .
venous blood samples were drawn after an overnight fast to determine blood glucose , lipids ( triglycerides , total , hdl- and ldl - cholesterol ) , creatinine and high sensitive c - reactive protein ( hs - crp ) .
a questionnaire was used to determine ethnicity , lifestyle factors ( smoking habits , alcohol consumption , and physical activity ) , relevant medical history , family history type 2 diabetes and socio - economic and demographic variables .
smoking was regarded positive when the participant was currently smoking tobacco ; in case of former or never smoking it was regarded negative .
none ( reference category ) , moderate ( 121 units per week in men or 114 units per week in women ) and excessive ( > 21 units per week in men and > 14 units per week in women ) .
physical activity was regarded positive when a person reported at least 150 min of moderate physical activity per week .
family history of diabetes was regarded as positive if at least one parent or sibling was known with type 2 diabetes before the age of 60 .
patients were advised to contact their general practice for the results of their screening . in case of detected cardiovascular risk factors they received usual care by their general practitioner .
skin af was measured with an age reader ( diagnoptics bv ) , which is described in more detail elsewhere . in short
, the age reader illuminates a skin surface ( shielded from surrounding light ) on the volar side of the underarm .
emission light and reflected excitation light from the skin are measured with a spectrometer . by dividing the average light intensity emitted per nm over the 420600 nm range by the average light intensity emitted per nm over the 300420 range the autofluorescence is calculated in arbitrary units ( au ) .
skin pigmentation may absorb light and thus influence skin af . to take this into account , skin reflection measurements across the 300420 nm range
skin reflection can then be calculated by dividing the mean intensity of light reflected from the skin by the mean intensity reflected from the white teflon block across the 300420 nm range .
since skin af is affected by skin color and the age reader is only validated in populations with a white skin type , we restricted our analysis to western europeans with a skin reflection of at least 6.0% .
descriptive statistics were used to determine means and proportions . for exponential variables ( hs - crp )
a log transformation was performed . to test for differences in characteristics between the centrally obese and non - obese groups , we used chi - square tests for categorical variables , independent t - tests for normally distributed continuous variables and mann - whitney tests for not normally distributed continuous variables .
we also determined levels of skin af in subgroups of either centrally obese or non - obese individuals without other cardiometabolic risk factors .
these individuals were selected based on the absence of hypertension , dyslipidemia and impaired glucose ( levels of blood pressure , triglycerides , hdl - cholesterol and fasting glucose below the ncep atp iii criteria thresholds and a total cholesterol < 5.0 mmol / l ) .
since age and smoking are the most important factors in determining skin af , we also evaluated the difference between the centrally obese and non - obese individuals with adjustment for these factors .
mean levels of skin af in smokers and non - smokers were calculated in both groups with and without central obesity as well as over ten years age categories . to assess the associations with skin af
, we performed univariable linear regression analyses for all variables mentioned in table 1 . in order to get reliable estimates of the regression coefficients ,
multicollinearity was checked ( pearson correlation coefficient 0.80 ) and the variables showing the weakest association with skin af were excluded from the multivariable analysis . consequently , diastolic blood pressure and bmi were excluded in favor of systolic blood pressure and waist circumference .
for multivariable analysis , we created a new variable for waist circumference , taking into account the gender specific thresholds for central obesity .
we did this by extracting the gender specific threshold ( 88 cm for women , 102 cm for men ) from the waist circumference value obtained by physical examination .
the new variable indicated the number of centimeters the waist circumference measured above or below the threshold for central obesity .
variables that did not retain significance in the multivariable analysis were subsequently excluded from the model ( backward selection ) .
multivariable analysis was also performed in the subgroup of centrally obese individuals without other cardiovascular risk factors .
Output:
| accumulation of advanced glycation end products ( ages ) is enhanced by chronic hyperglycemia and oxidative stress and this process may contribute to the pathogenesis of vascular disease .
skin autofluorescence ( af ) , a measure of accumulation of ages in skin collagen , is associated with vascular disease in patients with diabetes .
because central obesity enhances oxidative stress people with central obesity
might already have increased accumulation of ages before diabetes or cardiovascular disease become manifest . to test this hypothesis , we compared the distribution of skin af and its association with clinical and biochemical parameters in individuals with and without central obesity .
skin af was measured by a validated age reader in 816 persons with and 431 persons without central obesity , aged 2070
y.
mean skin af increased with age and smoking and was higher in centrally obese individuals compared with non - obese individuals ( p = 0.001 , after adjustment for age and smoking p = 0.13 ) .
mean skin af in the subgroups without central obesity and without other risk factors ( n = 106 ) , central obesity without other risk factors ( n = 74 ) and central obesity with other risk factors ( n = 742 ) was 1.63 0.37 , 1.74 0.44 and 1.87 0.43 au , respectively ( p for trend < 0.001 , after adjustment for age and smoking p for trend = 0.12 ) .
in the group with central obesity age , current smoking , alcohol consumption , waist circumference , creatinine clearance and hs - crp were independently associated with skin af ( r2 = 29.4% ) .
waist circumference hardly contributed to the explained variance .
the relationship between waist circumference and skin af is not as obvious as we hypothesized . |
PubmedSumm7895 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: malaria continues to be a major public health problem throughout the world despite more than a century of study , especially in africa where 90% of the global cases are recorded .
the situation is worsening due to the spread of drug resistant parasites strains , spread of insecticide resistance in the vector populations , and poor economic status of endemic populations . to alleviate the problem ,
an integrated approach against both the parasites and vectors for an effective control is necessary . over the last five years
, considerable efforts have been made to control malaria in many countries around the world ( especially in sub - saharan africa ) using strategic measures with available tools .
this has led to the decline in malaria transmission in many parts of africa [ 2 , 3 ] .
these changes are as a result of an extensive use of long - lasting insecticidal nets ( llins ) and improved malaria diagnosis and treatment .
however , despite these significant progresses , malaria remains an acute problem killing 800000 people each year , mostly children under five years living in sub - saharan africa .
the situation is particularly worrying with the increase in poverty for sustainability and more specifically as different models predict a loss of immunity of the populations with the current interventions [ 4 , 5 ] .
the rebound effect and age shift of malaria morbidity associated with an increasing susceptibility of older children and adults as seen in many places after the introduction of control strategies also help to sustain this hypothesis .
change in behaviour of the vector populations from being endophilic to exophilic also makes the populations vulnerable .
the need for efficient and effective sustainable strategies including curative treatments and vaccines for malaria control is therefore eminent .
the evaluation of such strategies requires detailed information on the epidemiology of malaria and the vector populations .
an ideal indicator of malaria risk is the entomological inoculation rate ( eir ) , a parameter that relates both the behaviour and human - biting activity of the anopheline vectors and the risk to humans of malaria infection .
risk of exposure of human to infectious bites of vectors is not uniform in any geographical setting even within limited distances in an area .
the variations in the abundance and dispersal of mosquitoes occur spatially and temporally in a given area and these variations can impact on the level of malaria transmission .
thus , the evaluation of interventions under conditions of natural transmission requires that testing sites should be identified and characterized with baseline information derived before the implementation of the interventions .
indeed , it is necessary to gather precise information and make a close follow up of variations in malaria transmission in an area identified for interventions to enable correct interpretations of malaria parameters such as parasitaemia , morbidity , and associated immune responses in relation to efficacy .
this study was undertaken within the european and developing countries clinical trials partnership ( edctp ) framework aimed at characterizing selected study sites for clinical trials in the sudanian bioclimatic area of senegal .
temporal and seasonal variations in species composition , density , biting behaviour , and intensity of malaria transmission rates and ecological parameters are the key indicators that have been studied .
the study was conducted in the rural community of toubacouta in the sine saloum region .
nine villages were identified in the area and 3 ( daga ndoup , keur samba guye , and toubanding ) were selected for entomological monitoring from july to december 2011 ( figure 1 ) .
the gps coordinates for each of the 9 villages were recorded and the water network system identified as well as socioecological features like landscape , agricultural practices , access to health facilities , and vector control measures .
epidemiological and demographic data were also collected and parameters include age variations , inclusion rates .
the selected villages are situated around the field research stations of dielmo and ndiop where extensive research on malaria has previously been conducted [ 10 , 11 ] .
nema river passes through toubanding , whereas the nearest water body ( a pool ) around keur samba guye is situated 1 km away with temporary puddles within the village of daga ndoup during the rainy season .
the climate is sudan - type savanna in this region with a rainy season that lasts from june to mid - october .
the recorded monthly rainfall derived from tropical rainfall measuring mission ( trmm ) data within the study area was 101 , 134 , 162 , 153 , and 118 mm from july to november 2011 , respectively .
farming activities are concentrated mainly on food and cash crops ( maize , millet , groundnuts , and vegetables ) .
trade and rearing of domestic animals like cows , sheep , goats , and chicken are also common practices of the people .
entomological surveys were conducted using two classical methods : all nights human - landing collections ( hlcs ) from two selected sentinel houses in each village ( indoors and outdoors for two consecutive nights each month ) and pyrethrum spray collections ( pscs ) in 10 randomly selected rooms in each village .
a proportion of unfed females from each species were dissected to extract ovaries and to determine parity by observing the degree of coiling of ovarian tracheoles .
the blood meals from freshly fed females collected by psc were squashed onto whatman filter paper and dried for host source identification .
all the mosquito samples collected were stored individually in numbered vials with desiccant until laboratory processing .
the origin of blood meals from freshly fed indoor resting females collected after pyrethrum spray collections was identified as human , bovine , ovine , and horse using an enzyme - linked immunosorbent assay ( elisa ) from beier et al .
the heads and thoraces of all anopheline females were tested by elisa for the detection of plasmodium falciparum circumsporozoite protein ( csp ) using wirtz et al . procedure . for each month , a random sample of 30 females belonging to the an .
gambiae complex was identified to species and molecular forms levels by the molecular method described by fanello et al . .
the human - biting rate ( hbr ) was defined for each species collected as the ratio of the total number collected to the total person - nights for the collection period .
the endophagous rate was defined as the proportion of mosquitoes captured indoors against the total of both indoors and outdoors collections from hlc .
the circumsporozoite rate was calculated as the proportion of total numbers of mosquitoes collected found to contain the plasmodium falciparum cs protein .
the anthropophilic rate was calculated as the proportion found with human blood out of the total analysed .
the entomological inoculation rate ( eir ) was calculated as the product of the human - biting rate ( hbr ) and the csp rate of mosquitoes collected from night catches .
all these parameters were computed and analysed using the free software r - gui version 2.15.1 .
a total of 468 anopheles specimens were collected from july to december 2011 by hlc and the composition includes mainly an .
gambiae s.l . was the predominant species in the three villages ( table 1 ) .
funestus was also collected in the three villages but its abundance was the highest only in toubanding village ( 20% ) . in daga ndoup and keur samba guye , 1.7% and 3% were represented by an .
pharoensis was less represented in the collections and was found only in keur samba guye and toubanding villages .
collections in human dwellings by psc have yielded 748 anopheline females ( table 1 ) .
gambiae was found to be the predominant species in all three villages followed by an .
pharoensis , on the other hand , was not found resting in dwellings in all three villages . out of the 468 an .
females collected by hlc , 168 ( 37 in daga ndoup , 47 in keur samba guye and 84 in toubanding ) were analysed using the pcr - rflp . in all 3 villages , an .
arabiensis was found to be the predominant species comprising 73% in daga ndoup , 91.5% in keur samba guye , and 65.5% in toubanding .
the mean number of bites per person per night ( bpn ) was significantly different for an .
gambiae between the three villages ( f2,33 = 15.8 , p < 0.001 ) and for an .
funestus ( f2,33 = 4.2 , p = 0.02 ) , with the highest biting rates being observed in toubanding village . for an .
pharoensis , no significant difference was observed in biting rates between the 3 villages ( f2,33 = 2.9 , p = 0.07 ) . in each of the three villages ,
funestus females were collected only in toubanding village throughout the study period with the highest density observed in december ( figure 2 ) . for daga ndoup ,
this species was only present in september ( 0.12 bpn ) and in september ( 0.25 ) and october ( 0.12 bpn ) for keur samba guye village .
pharoensis females were generally very low with keur samba guye recording 0.12 bpn for july only and toubanding , 0.25 bpn for september , and 0.37 bpn for both november and december .
these proportions were significantly different ( = 7.6 , df = 1 , and p = 0.006 ) .
gambiae collected by hlc indoors were not significantly different between the three villages , ( = 1.9 , df = 2 , and p = 0.38 ) .
a total of 413 blood meals from blood fed females from indoor resting mosquitoes ( 385 an .
the proportion of human blood meals was 62.6% in daga ndoup , 65.2% in keur samba guye , and 48.3% in toubanding and there was no significant difference between the three villages ( = 6.2 , df = 2 , and p = 0.05 ) .
gambiae in daga ndoup ( 8% ) , keur samba , guye ( 8.3% ) , and in toubanding ( 13.9% ) .
other sources of blood meal were from cattle ( bovine ) and equine for daga ndoup and keur samba guye and from ovine for toubanding .
overall , 24% were from human source , 72% bovine , and 4% equine ( table 2 ) .
were dissected for parity from daga ndoup , 51 from keur samba guye , and 206 from toubanding and the results are presented in table 3 .
gambiae between the three villages ( = 9.5 , df = 2 , and p = 0.009 ) .
parity rate was higher in keur samba guye , compared to the other two villages .
gambiae females collected in the same village ( = 8.6 , df = 1 , and p = 0.003 ) .
csp elisa to detect p. falciparum circumsporozoite antigen was conducted on all 468 anopheles specimens collected in the three villages .
a confirmatory test was done on all specimens giving positive elisa results . for the an .
species collected in the 3 villages ( toubanding , keur samba guye , and daga ndoup ) , the sporozoite rates were , respectively , 2.50% ( ci 95% = 1.155.35 ) , 1.05% ( ci 95% = 0.195.72 ) , and 1.72% ( ci 95% = 0.39.13 ) . in the an .
funestus samples collected in toubanding , 3.23% ( ci 95% = 0.8911.03 ) were positive ( table 4 ) . the differences were not statistically significant for an .
( = 0.7 , df = 2 , and p = 0.68 ) . the entomological inoculation rate ( eirs ) for this area was estimated at 30 infective bites per person during the study period in toubanding , 4 infective bites per person in daga ndoup and keur samba guye . in daga ndoup and keur samba guye , an .
was mainly responsible for the transmission and it was concentrated in september , whilst in toubanding both an .
gambiae were responsible for transmission for 3 months of the season ( august , september , and october ) .
during this study , five out of 20 anopheline species described in senegal as well as the molecular forms of an .
the predominant species within the anopheles gambiae complex from the collections in this area is an .
such differences could be due to differences in microgeographic ecological characteristics within the study area .
this discrepancy is sustained by the fact that other vector species were present . in daga ndoup and keur samba guye ,
mosquito - breeding sites are rain dependent with pools and puddles indiscriminately scattered around the village for short periods only .
toubanding , on the other hand , is located near a small stream that permits the development of anopheline breeding sites for longer periods . in dielmo village
situated 1.5 km apart , this stream permits the persistence of anopheline breeding sites all year round .
the populations ' dynamics of these species have similar characteristics to what is usually observed in sahelian zones [ 12 , 19 ] .
gambiae are related to rainfall pattern as is generally found in the other bioclimatic areas of senegal [ 2022 ] . despite the limited distances between the selected villages , there was an 8-fold variation between toubanding compared to the other two villages in terms of transmission potential .
such an observation was already assessed between the two most studied villages in the study area , namely , dielmo and ndiop [ 10 , 11 ] .
the transmission was seasonal , occurring for only one - to - three months of the year depending on the village locations .
in daga ndoup and keur samba guye , malaria transmission is observed only in september , whilst in toubanding , transmission occurs from august to october with a peak period observed in september .
daga ndoup and keur samba guye villages have temporal breeding sites and toubanding has what is a more permanent breeding ground for vectors throughout the year .
however , it is important to note that despite the existence of this stream in toubanding , malaria transmission does not proceed beyond october .
even if there is a transmission after october , it will be at low levels below the sensitivity of the method used to detect transmission .
this is contrary to the existence of perennial transmission in the village of dielmo thanks to the presence of the nema river that permits and supports the persistence of anopheline breeding sites all year round . in toubanding village , which showed the highest densities of an .
gambiae populations , compared with daga ndoup and keur samba guye , the anthropophilic rate is very low .
a similar scenario was observed for the same species in burkina faso , in burundi , and recently in an .
funestus populations from northern senegal . given the comparable levels of infestations observed , the highest transmission estimated in toubanding in the case of an .
it is noteworthy to mention the main reasons for low levels of transmission in keur samba guye and daga ndoup , which has similar transmission levels considering the fact that local divergences are obvious with the presence of the nema river near toubanding village .
the results obtained for daga ndoup and keur samba guye could be extrapolated to all other villages in the area with rain - dependent breeding sites .
however , one should be cautious of the fact that other local ecological features or interannual variations in rainfall could lead to differences between villages as was already observed elsewhere [ 10 , 11 , 25 , 26 ] .
taking into account our collated entomological results and the specific objectives of the study as set out initially , epidemiological field trials can be conducted in this area . in this process
, the timeline should target the peak transmission period , which is september , especially for vaccine in order to achieve peak antibody response or peak infection rate with increasing transmission .
Output:
| malaria transmission pattern was studied in 3 villages ( toubanding , daga ndoup , and keur samba guye )
situated within an area selected for clinical trials .
the study was conducted in the rainy season from july to december 2011 .
the main objective of this work was to gather baseline data on malaria transmission intensity and other entomological parameters
before the advent of clinical trials .
mosquitoes were collected by human - landing collections ( hlcs ) and by pyrethrum spray catches ( pscs ) .
five anopheline species were collected , namely , an .
arabiensis , an .
gambiae , an .
funestus , an .
pharoensis , and an .
rufipes ,
giving a heterogeneous distribution within the study area .
the populations dynamics of the vectors varied temporarily in each village depending on the pattern
of the rainy season .
transmission intensity estimated by the entomological inoculation rate ( eir ) was measured in each of the three villages with the variations
linked to the microecological differences between the villages .
measurements were calculated for august , september , and october and were found to vary
between 4 and 30 infected bites per person over the study period with a peak intensity observed in september .
these results indicate that epidemiological
field trials on malaria could be conducted in this area on the basis of the differences observed with transmission intensity , micro - ecological variations , and
the objectives of the trials . |
PubmedSumm7896 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: gastrocnemius muscle is commonly used as a local flap for coverage of soft tissue defect in the upper third of the leg .
the arc of muscle flap extends from the lower thigh , entire knee joint , popliteal fossa and upper third tibia .
gastrocnemius muscle is a workhorse flap to cover upper third tibial defects because of its wide arc of rotation , easy dissection and a reliable vascular pedicle .
the limiting factors in the case of gastrocnemius muscle are difficulties in covering middle one - third tibial defects .
one of the most challenging areas in reconstructive surgery is the closure of soft tissue defects of the middle third leg because of a small quantity of local tissue available for reconstruction , poor vascularisation and subsequent poor healing encountered in this region .
methods for coverage have evolved from the bipedical flap , local skin flaps ; cross - leg flap , soleus flap and microvascular free flaps . however , all these techniques have its inherent limitations .
the inferiorly based hemi gastrocnemius muscle flap can be useful for reconstruction of the middle third of the leg .
the majority of these arterial communications are arranged in bundles , although isolated , single ones are not infrequent .
all these studies were experimental and in 1983 , bashir first reported only three clinical cases of inferiorly based gastrocnemius muscle flap which was supplied from the lowermost vessel across the raphe .
after that , some authors also proposed the use of inferiorly based flap , but not many clinical applications were reported .
atchabahian and masquelet performed the anatomic study in thirty legs showing that it is not possible to raise this flap in almost 25% of patients due to small calibre of communicating branches .
till now , no indian studies have been carried out , and the reliability of the pedicle of such a flap needs to be further investigated . if this flap is feasible than it may be a reliable alternative for coverage of middle 1/3 lower leg defects , especially when other flaps are not available and free flaps are not indicated .
the objective of this study was to conduct a cadaveric study in the large specimen to determine the consistency of arterial communication between two heads of gastrocnemius muscle using radio - opaque contrast with future application of taking one head of muscle distally based for coverage of middle third defect of the tibia .
this study was conducted over a period of 1 year in the department of surgery - plastic surgery unit and department of forensic medicine ; in government medical college in central india .
sixty specimens of gastrocnemius muscle were harvested from thirty fresh cadavers and studied . before study institutional ethical committee permission was obtained .
cadavers with any congenital anomaly , fractures or crush injury and previous surgeries around knee joint were excluded from the study .
a posterior longitudinal midline incision was given extending from 5 cm above the knee joint up to achilles ' tendon .
deep fascia was incised longitudinally and retracted exposing the superficial surface of the gastrocnemius muscle .
mobilisation of muscle started at lower muscle tendon junction in the loose areolar tissue between gastrocnemius muscle and soleus .
sharp dissection was required to separate the muscle from aponeurosis which develops on its anterior surface .
a detachment of two heads of gastrocnemius muscle from femur was then done with careful dissection of the neurovascular pedicle .
popliteal artery ligated and divided just after it has given medial and lateral sural arteries and before bifurcation .
medial sural artery ligated and divided and 20 ml contrast given through popliteal artery . in remaining thirty specimens lateral sural artery ligated and divided and 20 ml contrast given through popliteal artery .
digital x - rays of gastrocnemius muscle specimen were taken , and collaterals between two bellies in lower half were noted , and the distance of collaterals from the muscles top edge was also noted .
after harvesting the muscle , the communications were studied using radio - opaque contrast injection using digital x - ray technique .
we found the communications between both bellies of the gastrocnemius muscle in all specimens in both legs [ table 1 and figures 14 ] .
presence of communication between bellies right leg - medial sural artery ligated and lateral sural artery injected left leg - medial sural artery ligated and lateral sural artery injected right leg - medial sural artery injected and lateral sural artery ligated left leg - medial sural artery injected and lateral sural artery ligated in the right leg , mean distance of communications from the upper edge of the medial belly was 15.88 cm ( maximum 23.66 cm and minimum 12 cm ) considering that mean length of the medial belly was 19.41 cm , communications were present in distal 3.53 cm .
the mean distance of communications from the upper edge of the lateral belly was 14.72 cm ( maximum 18.8 cm and minimum 10 cm ) and mean length of the lateral belly was 17.41 cm , therefore , communications were present in distal 2.69 cm [ table 2 ] .
right leg - distance of communication from upper edge of muscles in the left leg , mean distance of communications from the upper edge of the medial belly was 16.01 cm ( maximum 19.91 cm and minimum 13 cm ) , the mean length of the medial belly was 19.80 cm .
the mean distance of communications from the upper edge of the lateral belly was 13.78 cm ( maximum 16.38 cm and minimum 8.2 cm ) mean length of the lateral belly was 16.84 cm , therefore , communications were present in distal 3.06 cm .
communications were consistently present between the two bellies of the gastrocnemius muscle in lower part across the raphe [ table 3 ] .
reconstruction of lower extremity defects can be a difficult task because of the lack of intervening muscle between the skeletal elements and the skin , and the limited mobility of the overlying skin .
although microsurgical procedures provide excellent results in the head and neck region , the success rate is usually lower in the lower limbs .
it requires a long operative time ; experienced skilful technique ; and patent vascular status of the recipient site . free flap transfer to the lower limb in chronic posttraumatic conditions is known to have a higher complication rate with flap loss in up to 10% of cases . despite recent advances in microsurgical techniques , leading to major improvements in the quality of lower limb reconstruction , coverage of lower leg defects by loco - regional flaps remains indicated in selected cases .
a local random - pattern skin flap has an indistinct perfusion pattern and is limited in size .
defects of the middle third of the tibia can be covered with the soleus flap .
however , the defect will be covered by the least vascularised part of the muscle ; the volume of the flap is often too small to fill the defect .
local fascio - cutaneous flaps can provide an alternative for coverage of middle one - third tibial defects , but it may be in the zone of trauma hence not very safe .
the cross - leg flap has the disadvantage of long - term immobilization and two stage procedure .
the anterior tibialis flap is a useful option for providing soft tissue to cover open tibial injuries in the middle and distal thirds of the tibia .
it is limited by the transition of the muscle to the tendon in the distal third of the tibia . in 1983 , bashir treated many severe lower injuries due to high - velocity missiles and he described the alternate method of covering a defect in the middle third of leg and the upper part of lower third using the medial head of the gastrocnemius muscle as an inferiorly based flap .
he used medial head gastrocnemius muscle flaps as an inferiorly based in three cases with no failure rates .
after that , there was isolated reports of using distally based gastrocnemius muscle for coverage of middle third tibial defects .
mathes and nahai also proposed the use of an inferiorly based flap after having made a rough mention to anastomotic vessels .
the vascular basis of this flap is the vessels across the distal half of the raphe between the muscle heads .
tsetsonis et al . studied the 14 fresh cadaveric gastrocnemius muscles to describe the anatomy of the communicating ( anastomotic ) vessels between the gastrocnemius muscle heads and record the extent of their supply potential .
anastomotic veins were dissected along the raphe after perfusion of each muscle with 0.1% methylene blue solution .
he described mean distance 4.7 cm of lowest anastomotic vessels from the lower pole of the corresponding medial head . regarding arterial cross - supply ,
it was clearly evident that each head could be vascularised solely from the contralateral one , mostly through these bundles .
nevertheless , the location of this vessel varies significantly and can not be detected preoperatively .
measurements demonstrated that although this vessel is not found at a constant level , it is invariably detected in the lower third of the medial gastrocnemius head 's length and in 93% of cases , in the lower fourth .
given that the venous communication between the heads has been documented as well , the authors think that an inferiorly based flap of the medial gastrocnemius head for defects of the middle third of the tibia might be both reliable and applicable ; however , for reasons of safety , the muscle heads should remain attached along their lower third . in 2008
kishk did a study by performing inferiorly based hemigastrocnemius flap in a reconstruction of middle third leg defect with exposed tibia in 19 patients and concluded that inferiorly based hemigastrocnemius muscle flap based on the vascular bundles between the two heads can be useful for reconstruction of the middle third of the leg .
one flap ( 5.2% ) was lost in the early postoperative period because of venous congestion related to inadequate tunnelling of the flap .
this is the first study conducted on a larger number of cadavers ( sixty specimens of gastrocnemius muscle were harvested from thirty fresh cadavers ) .
we observed communications between the two bellies of gastrocnemius muscles in all specimens . in the right leg ,
the mean length of the medial belly was 19.41 cm and communications were present in distal 3.53 cm and mean length of the lateral belly was 17.41 cm and communications were present in distal 2.69 cm . in the left leg , the mean length of the medial belly was 19.80 cm and communications were present in distal 3.79 cm and mean length of the lateral belly was 16.84 cm and communications were present in distal 3.06 cm .
the distal communications between gastrocnemius bellies are not constant in their location , but all the connections were present in distal 3.79 cm of raphe .
therefore , the precise pivot point for distal rotation of muscle can not be ascertained but while taking distally based flap of gastrocnemius roughly 1/3 of distal attachment or distal 3.79 cm of connection between raphe should be maintained to preserve the vascular communications between the bellies . a study by tsetsonis et al .
showed mean distance 4.7 cm of lowest anastomotic vessels from the lower pole of corresponding medial head , therefore , our study support more distal pivot point for muscle head rotation .
our study supports the future application of inferior based gastrocnemius muscles flap to cover defects of the middle third leg .
it is a simple technique allowing rapid , durable , and reliable coverage of these defects without sacrificing a major vessel to the foot . no donor site morbidity and functional deformity , with primary closure of donor site .
this is the large study on sixty specimens of thirty fresh cadavers and first reported from india .
we found communications between both bellies of the gastrocnemius muscle in all sixty specimens in both legs in indian population .
although communications between gastrocnemius bellies are not constant in their location , they were present in all specimens .
our study supports the future application of inferior - based hemigastrocnemius muscles flap to cover defects of middle third leg safely .
when distally based hemigastrocnemius flap is planned , roughly 1/3 of distal attachment or distal 3.79 cm of connection between raphe should be maintained to preserve the vascular communications between the bellies .
Output:
| introduction : gastrocnemius muscle is a workhorse flap to cover upper third tibial defects but has a limitation in covering middle one - third tibial defects
. the inferiorly based hemi gastrocnemius muscle flap can be useful for reconstruction of the middle third of the leg .
the arterial communication between the gastrocnemius muscle heads has been demonstrated , the consistent location , however , was not studied in large specimens.materials and methods : this study was conducted on sixty specimens of gastrocnemius muscles harvested from thirty fresh cadavers to determine arterial communication between two heads of gastrocnemius muscle using radio - opaque contrast with future application of taking one head of muscle distally based for coverage of middle third defect of tibia .
a total of 60 specimens were obtained from thirty fresh cadavers . in thirty specimens ,
medial sural artery ligated and divided and 20 ml iohexol ( 350 ) given through popliteal artery . in remaining thirty specimens lateral sural artery ligated and divided and 20 ml iohexol ( 350 ) given through popliteal artery .
digital x - rays of gastrocnemius muscle specimens were taken , and collaterals between two bellies in lower half were noted and the distance of collaterals from the muscles top edge was also noted.results:we found the communications between both bellies of the gastrocnemius muscle in all specimens in both legs . the mean distance of communications from the upper edge of the medial belly was 15.88 cm and from upper edge of the lateral belly was 14.72 cm in the right leg , respectively .
the mean distance of communications from upper edge of the medial belly was 16.01 cm and from upper edge of the lateral belly was 13.78 cm in the left leg .
the distal communications between gastrocnemius bellies were not constant in their location , but all the connections were present in distal 3.79 cm of raphe.conclusion:this study supports the future application of inferior - based hemigastrocnemius muscles flap to cover defects of middle third leg .
when distally based hemigastrocnemius flap is planned roughly 1/3rd of distal attachment or distal 3.79 cm of connection between raphe should be maintained to preserve the vascular communications between the two bellies . |
PubmedSumm7897 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: preparation of tetrapod - shaped alpha tricalcium phosphate granules ( tb ) :
the procedure used in the preparation of the tb was previously described , and the materials ( tetrabones ) were
obtained from next21 , k.k .
( tokyo , japan ) . preparation of bfgf - binding ion complex gel matrix ( f - ic gel ) : the
procedure used in the preparation of the f - ic gel was previously described [ 18 , 19 , 22 ] .
briefly , the ic gel formed spontaneously at room
temperature by mixing the same volume of alkali - treated collagen modified with citric acid
derivatives ( cads ) and atelocollagen derived from pig tissues ( nitta gelatin inc . ,
, recombinant human bfgf ( kaken pharmaceutical co. , ltd . , tokyo ,
japan ) was added to the mixed solution at a final concentration of 100
ng / ml .
animals and surgical procedures : all the animal experiments in this study
were conducted in accordance with the guidelines of the animal care committee of the
graduate school of agricultural and life sciences at the university of tokyo .
five male
beagle dogs , aged 1319 months and weighing 10.511.3 kg , were used in the experiment .
intravenous propofol ( 8 mg / kg ) was used to induce anesthesia , which was maintained using
isoflurane ( 1.52.5% ) in oxygen .
fentanyl hydrate ( 1020
gkghr ) was administered as a constant - rate infusion
throughout the surgery to induce analgesia .
lactated ringer s solution ( 10
mlkghr ) was infused , and intravenous cefazolin ( 20 mg / kg )
was administered before the skin incision was made and every 2 hr thereafter .
after
sterilization , the radius shaft was exposed through a craniolateral skin incision , and a
critically sized ( 20-mm long ) mid - diaphyseal segmental defect was created using an oscillating saw .
a defect of the same size was
created in each side of the radius . a polypropylene mesh cage ( pmc ) , 9 mm in diameter and 28
mm in height , was fabricated to hold the tb granules in the defect , as previously described
( fig .
both ends of the pmc were tucked between the
plate and intact bone ends .
then , the pmc containing the tb with or
without the bfgf or f - ic gel was inserted to the defect and fixed with an 8-hole stainless
bone plate 1.8 mm thick ( custom - made buttress plate , mizuho co. , ltd . ,
tokyo , japan ) and 8
screws ( 2.7-mm stainless cortical screw , synthes vet , tokyo , japan ) .
both ends of the pmc
were tucked between the plate and the intact bone ends .
cefazolin ( 20 mg / kg , subcutaneously twice a day ) and
buprenorphine ( 15 g / kg , intramuscularly 3 times a day ) were administered
for 3 days after surgery .
a robert - jones bandage was used in all the dogs 1 day after
surgery .
both ends of the pmc were tucked between the
plate and intact bone ends .
five dogs with 10 radial defects were included in this study and were randomly
divided into the following groups : tb group ( n=4 ) , implanted with pmc and tb ;
tb / f group ( n=3 ) , implanted with pmc , tb ( 1.2 g ) and bfgf solution ( 100
ng / ml , 1.0 ml ) ; and tb / f - ic group
( n=3 ) , implanted with pmc , tb and f - ic gel ( 100 ng / ml , 1.0
ml ) . in the tb / f group , 100-ng / ml
bfgf / phosphate - buffered saline solution was poured into the tb during surgery .
fluorescent bone labeling : the dogs were intravenously injected with
oxytetracycline ( tc ; 20 mg / kg ; terramycin / la , pfizer japan , inc . , tokyo , japan ) 14 days
after surgery and calcein ( cl ; 20 mg / kg ; sigma - aldrich co. , tokyo , japan ) 21 days after
surgery .
radiography and micro - computed tomography : lateral radiographs were
obtained immediately after surgery and upon euthanasia . after removing the metallic
implants , with
the pmc retained , micro - computed tomographic ( micro - ct ) images ( smx-90ct ,
shimadzu co. , kyoto , japan ) of the defects at the midsagittal sections were obtained .
histomorphometry : the harvested radius was fixed with 70% ethanol for 5
days , stained with villanueva bone stain for 7 days , dehydrated in ascending grades of
ethanol , defatted in an acetone - methyl methacrylate monomer mixture ( 1:2 ) and embedded in
methyl methacrylate ( wako chemicals , odawara , japan ) without decalcification .
histological
sections of 40-m thickness were cut along the midsagittal plane from the
intact proximal and distal ends of the radius and defect .
the specimens were examined
microscopically ( bx-53 , olympus co. , tokyo , japan ) under natural and polarized light and on
fluorescence microscopy .
the histomorphometric measurements were made using a semiautomatic
image analyzing system ( system supply , ina , japan ) .
the standard bone histomorphometric
nomenclature , symbols and units described in the report of the american society for bone and
mineral research histomorphometry nomenclature committee were used . the ratios ( 100% ) of bone distance - tissue distance ( bd / td ) , bone
volume - tissue volume ( bv / tv ) and lamellar bone volume / bone volume ( lbv / bv ) ; the number of
vessels / analysis area ( n.ve/mm ) and mineral apposition rate ( mar ,
m / day ) were calculated for each sample .
the bd / td was calculated for
each sample in the midline of the defect .
lamellar bone was defined as the regular parallel alignment of collagen as distinguished
from woven bone , which was defined as a haphazard organization of collagen fibers .
n.ve/mm was calculated in 3 longitudinal areas ( cranial , medial and caudal ) of
the defect . a 20-mm rectangle ( 1 20 mm ) in each area was analyzed .
vessels
were defined as luminal structures containing red blood cells . using fluorescence
microscopy ,
the mar was calculated by dividing the bone thicknesses between the pairs of
lines marking the administration of the fluorescent bone markers tc and cl by the time
intervals between the doses ( tc - cl , days 14 and 21 ; cl - osteoid , days 21 and 28 ) . statistical analysis : results were expressed as mean standard deviation .
statistical analysis was performed using the statview version 5.01 software ( sas institute
inc . ,
statistical differences were analyzed using one - way analysis of
variance followed by the tukey - kramer test for multiple comparisons .
surgical outcome and clinical findings : macroscopically , the defect and
pmc were stabilized well using a plate and screws without tb leakage during the surgery . all
the dogs tolerated the surgical procedures and had a complete , uneventful recovery .
c ) radiographs and ( a c ) micro - computed tomographic images of the radial segmental
bone defects in each treatment group 4 weeks after surgery .
( a , a ) tb group ; ( b , b )
tb / f group ; and ( c , c ) tb / f - ic group .
the arrows indicate the osseous callus formation
extending from the intact proximal bone cortex over the defect .
dr : distal radius , pr :
proximal radius . ) and micro - ct images ( fig .
2a2c ) showed
that the tb granules were placed in the defects without leakage but with slight caudal
displacement of the middle portion of the tb .
although it was difficult to distinguish the
newly formed bone in the intergranular pores of the tb , osseous callus formation extending
from the intact bone cortex over the implant was observed 4 weeks after surgery in each
group .
( a c ) radiographs and ( a c ) micro - computed tomographic images of the radial segmental
bone defects in each treatment group 4 weeks after surgery .
( a , a ) tb group ; ( b , b )
tb / f group ; and ( c , c ) tb / f - ic group .
the arrows indicate the osseous callus formation
extending from the intact proximal bone cortex over the defect .
j ) histological sections ( villanueva bone stain ) at the midsagittal plane of the
tb ( a ) , tb / f ( b ) and tb / f - ic groups ( c ) 4 weeks after surgery .
dr : distal radius , pr :
proximal radius , pmc : polypropylene mesh cage .
the arrows indicate the distance of the
distal and proximal new bone tissues from the midline of the defect .
scale bar=5
mm . shows the histological sections for each group . in the tb / f - ic group ,
more newly
formed bone was observed , especially from the distal radius , compared with that in the tb
and tb / f groups .
4.histological findings of newly formed bone ( a c : natural light , d f : polarized light )
and neovascularization ( g i : natural light ) in the tb ( a , d and g ) , tb / f ( b , e and h )
and tb / f - ic groups ( c , f and i ) 4 weeks after surgery .
. shows the histological findings from the defect in each group . as shown in fig .
4a4c , the histological sections under natural
light revealed more extensive bone formation in the tb / f - ic group than in the tb and tb / f
groups
. detailed analysis of the histological sections under polarized light revealed that
the newly formed bone in each group mainly consisted of woven bone ( fig .
furthermore , more neovascularization was observed in the
tb / f - ic group than in the tb and tb / f groups ( fig .
the yellow and
green lines indicate the tetracycline and calcein signals , respectively , in the tb
( a ) , tb / f ( b ) and tb / f - ic groups ( c ) 4 weeks after surgery : the thicknesses ( i ) from
day 14 to 21 and ( ii ) from day 21 to 28 . scale bar=50 m . shows the histological sections of the fluorescence - labeled newly formed bone with tc
( yellow lines ) and cl ( green lines ) signals in each group .
the mineral apposition during
certain periods after implantation was analyzed by examining the incorporation of the
fluorescence labels , tc and cl , into the bones .
the bone thicknesses of the 2 pairs of
lines , tc - cl and cl - osteoid , did not differ grossly among the groups ( fig .
( a j ) histological sections ( villanueva bone stain ) at the midsagittal plane of the
tb ( a ) , tb / f ( b ) and tb / f - ic groups ( c ) 4 weeks after surgery .
dr : distal radius , pr :
proximal radius , pmc : polypropylene mesh cage .
the arrows indicate the distance of the
distal and proximal new bone tissues from the midline of the defect .
histological findings of newly formed bone ( a c : natural light , d f : polarized light )
and neovascularization ( g i : natural light ) in the tb ( a , d and g ) , tb / f ( b , e and h )
and tb / f - ic groups ( c , f and i ) 4 weeks after surgery .
the yellow and
green lines indicate the tetracycline and calcein signals , respectively , in the tb
( a ) , tb / f ( b ) and tb / f - ic groups ( c ) 4 weeks after surgery : the thicknesses ( i ) from
day 14 to 21 and ( ii ) from day 21 to 28 .
6.results of the histomorphometric analyses of the newly formed bone 4 weeks after
surgery .
( a ) the distances of the proximal and distal new bone tissues per total
tissue distance ( bd / td ) , ( b ) the volume of bone tissue per volume of total tissue
( bv / tv ) , ( c ) the volume of lamellar bone tissue per volume of bone tissue ( lbv / bv ) ,
( d ) the number of vessels per square millimeter ( n.ve/mm ) and ( e ) the
mineral apposition rate ( mar ) .
the
asterisks indicate statistically significant differences between the groups ( one - way
analysis of variance followed by the tukey - kramer test for multiple comparison ;
p<0.05 ) . shows the results of the histomorphometry using the histological findings in figs . 4 and
5 . as shown in fig .
6 ( a , b and d ) ,
bd / td , bv / tv and n.ve/mm were significantly higher in the tb / f - ic group than in
the other groups 4 weeks after surgery .
the values of bd / td , bv / tv and n.ve/mm
in the tb / f - ic group were 61.6 7.0% , 17.9 2.0% and 7.3 0.4 , respectively ; however , no
significant differences in these 3 parameters were found between the tb / f and tb groups .
the
values of bd / td , bv / tv and n.ve/mm in the tb versus tb / f group were 36.9 2.6%
versus 44.1 2.9% , 10.1 0.3% versus 9.5 1.3% and 3.7 0.3 versus 4.5 0.8 ,
respectively .
as shown in fig . 6 ( c and
e ) , no significant differences in lbv / bv and mar values were observed
between the groups .
results of the histomorphometric analyses of the newly formed bone 4 weeks after
surgery .
( a ) the distances of the proximal and distal new bone tissues per total
tissue distance ( bd / td ) , ( b ) the volume of bone tissue per volume of total tissue
( bv / tv ) , ( c ) the volume of lamellar bone tissue per volume of bone tissue ( lbv / bv ) ,
( d ) the number of vessels per square millimeter ( n.ve/mm ) and ( e ) the
mineral apposition rate ( mar ) .
the
asterisks indicate statistically significant differences between the groups ( one - way
analysis of variance followed by the tukey - kramer test for multiple comparison ;
p<0.05 ) .
in our recent study , the combination of tb and f - ic gel facilitated neovascularization and
new bone formation in a rabbit segmental femoral defect model .
the results also demonstrated that the combination successfully
facilitated neovascularization and new bone formation within 4 weeks after surgery in
critically sized ( 20 mm ) segmental radial defects in dogs . in the present study ,
the number of vessels in the defects in the tb / f - ic group was
significantly higher than that in the tb and tb / f groups , whereas no significant difference
was found between the tb and tb / f groups .
these results suggest that the f - ic gel induced
angiogenic effects in the dogs .
our previous studies demonstrated that the ic gel alone
markedly induced vessel growth and that its combined use with bfgf significantly enhanced
the vascularization ability of the ic gel in rats and rabbits .
furthermore , the enhanced
neovascularization in the tb / f - ic group was accompanied by a significantly greater ingrowth
of newly formed bone than that in the tb and tb / f groups , suggesting that the increased
formation of new bone might be because of the promotion of neovascularization by the f - ic
gel .
vessels produced in the defect were essentially
within the ecm , which functioned as a natural scaffold for the vessel structure .
the ic gel
has a stable three - dimensional matrix structure and is degradable to develop vascular
network by a variety of proteases generally released from vascular cells and related cells .
another crucial feature of the ic gel is that it serves as a reservoir of the bfgf as an
angiogenic factor .
given that bfgf is positively charged and the cad part of the ic gel is
negatively charged , the bfgf can bind to the cad with ionic bonds , fixing itself inside the
ic gel .
therefore , the bfgf stimulates neovascularization and accelerates the development of
a vascular network in the gel .
the concentration of bfgf ( 100
ng / ml ) in the ic gel used in this study was the minimum
level required to achieve the full effect on neovascularization .
bfgf is known as an osteoinductive factor [ 2 , 17 ] and has been demonstrated at a single local
application ( 100200 g / site ) to produce osteoinduction in animal bone
defects or fracture models in several species including rats , rabbits , dogs and nonhuman
primates [ 9 , 11 , 12 , 15 ] .
kawaguchi et al .
reported that the bfgf at high concentrations acted on osteoblastic cells and stimulated not
only bone formation but also bone resorption .
recent studies demonstrated that using a low
dose of the bfgf ( rabbits , 1.4 g / site ; dogs , 0.15
g / site ) combined with collagen minipellets as a drug delivery system
successfully facilitated bone regeneration in femoral segmental defects in rabbits and
guided bone regeneration ( gbr ) sites in dogs [ 7 , 8 ] .
although the bfgf dose ( 100 ng / site )
in this study was much lower than that used in previous studies , the f - ic gel in this study
successfully facilitated bone regeneration via the binding of the bfgf to the ic gel with
ionic bonds .
in addition , the f - ic gel was compatible with various granular artificial bones , in
contrast to the collagen minipellets .
the tb used in this study consisted of 1-mm
tetrapod - shaped granules and formed intergranular pores of an appropriate size ( 100400
m ) , interconnecting to facilitate cellular and vascular invasions when
packed together .
therefore , the combination of the
tb and f - ic gel may provide an ideal scaffold for bone regeneration in large bone defects
that require an osteoconductive scaffold and vascular network . in this study
, we calculated the lbv / bv and mar to precisely evaluate the osteoinductive
effect of the low - dose bfgf in the ic gel .
the lbv / bv value indicates the percentage of
remodeling area occupied by newly formed bone and is supposed to reflect an aspect of the
bone healing process in which initially formed bone , woven bone , is gradually replaced by
lamellar bone through cooperative actions of osteoblasts and osteoclasts .
meanwhile , the mar
value indicates the linear rate of production of calcified bone matrix by the osteoblasts .
the present study demonstrated that neither the lbv / bv nor mar values differed significantly
among the groups , suggesting that the ic gel in combination with the bfgf facilitated
increased bone regeneration through neovascularization rather than by enhancing bone
turnover , although the bfgf within the ic gel might have also contributed to bone
regeneration .
however , longer observation periods than 4 weeks are needed to get more
precisely evaluation of bone turnover , because lamellar bone appears relatively late phase
of the bone healing process . in conclusion , the present study revealed that the combination of tetrapod - shaped alpha
tricalcium phosphate granules and the f - ic gel facilitated bone regeneration by inducing
neovascularization in a canine segmental radial defect model .
this combination may be a
clinically suitable scaffold for the treatment of segmental long bone defects . however ,
additional long - term studies are necessary to predict its clinical efficacy .
Output:
| abstractthe effect of tetrapod - shaped
alpha tricalcium phosphate granules ( tetrabones [ tb ] ) in combination with
basic fibroblast growth factor ( bfgf)-binding ion complex gel ( f - ic gel ) on bone defect
repair was examined .
bilateral segmental defects 20-mm long were created in the radius of
5 dogs , stabilized with a plate and screws and implanted with 1 of the following : tb ( tb
group ) , tb and bfgf solution ( tb / f group ) , and tb and f - ic gel ( tb / f - ic group ) .
dogs were
euthanized 4 weeks after surgery .
radiographs showed well - placed tb granules in the
defects and equal osseous callus formation in all the groups .
histomorphometry revealed
that the number of vessels and volume of new bone in the tb / f - ic group were significantly
higher than those in the other groups .
however , no significant differences in
neovascularization and new bone formation were observed between the tb / f and tb groups .
furthermore , no significant difference in the lamellar bone volume or rate of mineral
apposition was observed among groups .
these results suggest that increased bone formation
might have been because of the promotion of neovascularization by the f - ic gel .
therefore ,
the combinatorial method may provide a suitable scaffold for bone regeneration in large
segmental long bone defects . |
PubmedSumm7898 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a male infant ( 3 kg , primi - gravida ) , was delivered vaginally without complications following a normal pregnancy .
the ultrasound scan at 35 weeks of gestation showed an irregular volume of liquid anechoic space in the midline of the brain .
a computerized tomography ( ct ) scan of the infant 's head conducted done three days after birth showed a vein aneurysm in the brain .
magnetic resonance ( mr ) imaging was also performed , and it showed a large area of flow void along the course of the deep vein and a marked supertentorial hydrocephalus ( fig .
1 ) . based on these findings , a diagnosis of vgam was made and elective endovascular treatment was planned .
this neonate was admitted to the hospital for further evaluation and vgam treatment was planned at 12 weeks of age .
the results of all other examinations were normal , including the haemoglobin , complete blood count , renal and liver function tests and the coagulation profile .
the electrocardiogram ( ecg ) showed evidence of biventricular hypertrophy , and echocardiography revealed a patent foramen ovale .
the results of digital substraction angiography ( dsa ) performed under general anaesthesia confirmed the ct and mri findings .
blood was being supplied to the vgam from the bilateral posterior cerebral arteries and their branches , and it drained into the straight sinus with high blood flow ( fig .
after the placement of a microcatheter ( tracker-10 ; boston scientific , fremont , ca ) on the distal part of the right feeding artery , the embolization was first performed with placing two berenstein liquid coils-10 ( boston scientific , new york , ny ) in the feeding arteries , and this was followed by slow injection of a mixture of n - butyl cyanoacrylate ( nbca ; b. braum melsnagen , germany ) and lipiodol ( guerbet ; aulnay - sous - bois , france ) at a ratio of 1:2 ( nbca : lipiodol = 1:2 ) .
post - procedure angiography displayed an immediate decrease in the size of the vgam and a marked decrease of blood flow through the fistulas ( fig .
three months after therapeutic intervention , the follow - up angiography that was done via both bilateral internal carotid arteries and the left vertebral artery showed that the vgam had totally disappeared together with the thrombosis of the straight sinus ( fig .
mr imaging showed the reversal of hydrocephalus without any abnormal growth of the brain parenchyma ( fig .
vein of galen aneurysmal malformation is a rare congenital vascular malformation that is characterized by shunting of the arterial flow into an enlarged cerebral vein of galen ( 1 - 3 ) .
although the cases of vgam constitute only 1% of all cerebral vascular malformations , they comprise up to 30% of all paediatric vascular malformations ( 1 ) .
the arteries feeding the vgam are the posterior cerebral artery , the choroidal arteries and the posterior perforating artery .
vein of galen aneurysmal malformation is believed to result from an insult to the cerebral vasculature at between six and 11 weeks of gestation after the development of the circle of willis ( 2 , 5 ) .
it is also thought to result from the development of an arteriovenous connection between the primitive choroidal vessels and the median prosencephalic vein of markowski ( 5 ) .
the abnormal flow through this connection interferes with the normal development of the vein of galen .
the shunt is maintained through a later period of brain development , with the persistent median vein draining into the sagittal sinus and often via a persistent falcine vein .
other venous anomalies commonly co - occur with vgams , including anomalous dural sinuses , sinus stenoses and an absence of the straight sinus ( 2 , 5 ) .
these anomalies commonly present during the neonatal period , although they may appear during early childhood as well . since vgams lack capillaries , blood drains directly into a single deep draining vein .
the blood flow can be fast , increasing the work load of the heart and the risk of heart failure ( 1 , 6 ) .
the associated congenital heart diseases include patent ductus arteriosus , patent foramen ovale , sinus venosus and atrial septal defects , partial anomalous pulmonary venous drainage to the superior vena cava and aortic coarctation ( 1 , 7 ) , and these maladies may be diagnosed instead of vgam . however , making an accurate and early diagnosis of vgam is very important . the high flow of blood can also interfere with the normal venous drainage of the brain , potentially causing hydrocephalus ( 8) . alternatively , the vgam may obstruct the flow of the cerebrospinal fluid ( csf ) , resulting in hydrocephalus .
in addition , a certain degree of developmental delay can be a major problem during the neonatal presentation of these infants .
as these infants have congestive heart failure , they have physical developmental delays and because of the cns problems , neurologic developmental delays as well .
surgical ligation of the fistula and radiotherapy are sometimes performed due to the high morbidity and mortality rates ( 1 , 3 ) .
endovascular procedures , either by transarterial or transvenous routes , have recently been used as a definitive or adjunct treatment ( 1 , 3 , 4 ) .
the transarterial approach is performed using microcatheter delivery systems , which may achieve superselective embolization of the fistulous connection .
transarterial embolization is more effective when there is only one or a limited number of arterial pedicles .
however , when there are numerous small arterial feeders , it is often impossible to achieve occlusion of a vgam via the transarterial route . in these cases , it is believed that transvenous embolization offers a greater chance of temporarily controlling any existing heart failure ( 6 ) .
the transvenous approach is performed through either an operatively exposed torcula or a transfemoral venous catheter .
large metal coils are deposited in the aneurysmal vein of galen to reduce the arteriovenous shunting .
the transvenous approach can be easily repeated several times and this may be supplemented by transarterial embolizations . for the vgams with high flow , nbca should be injected carefully through arteries into the inner vgam in order to avoid the nbca flowing into the venous route .
solid materials such as microcoils , microballoons and silk sutures have been used to embolize these vessels , and these materials have achieved variable success .
the liquid adhesives that have been used for embolization include cyanoacrylate monomers like nbca and ethylene such as ethylene vinyl alcohol copolymer ( 10 ) .
the berenstein liquid coil can be used for embolization of some vascular lesions ( 11 ) , but it was more dangerous to use in a large and high flow shunt as compared with the use of detachable coils because it may cause inappropriate embolization of the cerebral venous system or pulmonary embolization . considering the stenosis and tortuosity at the terminal portion of the feeding artery in our case , we chose the berenstein liquid coil for reducing the high flow of the shunt instead of using a detachable coil .
this report describes the effective process of transarterial embolization with using berenstein liquid coils and nbca for the treatment of vgams . in this case study ,
when considering the reports in the relevant literature , this approach appears to be a favorable option for the treatment of vgams .
Output:
| a 12-week - old baby with a vein of galen aneurysmal malformation ( vgam ) was successfully treated with performing transarterial microcatheter - directed embolization with berenstein liquid coils and n - butyl cyanoacrylate in the feeding arteries .
post - procedure angiography showed a marked decrease of the blood flow into the dilated vein of galen .
three months later , follow - up angiography showed that the vein of galen aneurysmal malformation had totally disappeared , and the baby recovered very well without any sequelae .
we report here on this interesting case along with a review of the relevant literature , and we aim to enhance physicians ' awareness of the treatment for vgams . |
PubmedSumm7899 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: it is clear that weight gain is a ubiquitous side effect of antipsychotic drugs ( apds ; allison et al . , 1999 ) and that apds are also associated with an increased risk of complications related to obesity , including insulin resistance , hyperlipidemia , type 2 diabetes mellitus , and cardiovascular disease ( lieberman et al . , 2005 ;
, 2008 ; de hert et al . , 2011a ) . however , the specific expression of apd - induced metabolic side effects varies widely across apds and across individuals .
although patients with mental disorders in general have increased morbidity and mortality , it is unclear how apds specifically affect both psychiatric illness and also metabolic function in order to yield the observed clinical outcomes .
it is widely accepted that most of the apds induce significant weight gain , with median weight changes of + 0.2 , 0.1 , + 0.7 , and + 0.3 kg / month are observed for haloperidol , ziprasidone ( zip ) , olanzapine ( olz ) , and risperidone ( risp ) , respectively , following 1 year of treatment ( parsons et al . , 2009 ) .
studies conducted within a first - episode schizophrenia sample , such as in the comparison of atypicals for first - episode psychosis ( caf ) study ( mcevoy et al . , 2007 ) or the european first - episode schizophrenia trial ( eufest ) study ( kahn et al . , 2008 ) , and in antipsychotic - nave youth ( correll et al . , 2009 ) have shown that all antipsychotics are associated with varying degrees of significant weight gain ( table 1 ) . moreover ,
when switching from an antipsychotic with a higher weight gain risk to one with a lower risk , patients tend to lose weight ( newcomer et al . , 2008 ) .
results of the clinical antipsychotic trials of intervention effectiveness ( catie ) study suggest that female patients may be at a higher risk for weight gain ; in fact 36.6% of male and 54.2% of female patients ( and an overall rate of 42.7% ) met the metabolic syndrome criteria ( mcevoy et al . , 2005 ) .
however , findings on predictors of apd related weight gain have been mixed and seem to be influenced by prior treatment effects ( correll et al . , 2011 ) .
mean ( 95% ci ) antipsychotic - induced weight gain in pediatric and adult patients ( kg ) .
the outcomes of a 2005 meeting underscored the significant contribution of apds to obesity - related conditions in psychiatric patients and the need for further research on weight - management programs tailored to this patient population ( allison et al .
, significant research efforts have focused on apd - induced weight gain and related metabolic consequences . in july of 2011 , a follow - up conference to examine the current state of the field was funded by the national institute of mental health , with additional funds from the national institute of diabetes and digestive and kidney diseases . the conference consisted of expert presentations addressing topics ranging from clinical findings to molecular mechanisms of apd - induced weight gain .
the discussion below reflects a distillation of the conference proceedings , highlighting progress , key pharmacoepidemiological observations , and future needs in five key research areas .
these areas include : ( 1 ) methodological issues in the study of apd effects ; ( 2 ) unique characteristics and needs of pediatric patients ; ( 3 ) genetic and life - style risk factors underlying susceptibility to apd - induced metabolic effects ; ( 4 ) apd effects on weight gain and adiposity in relation to their acute effects on glucose regulation and diabetes risk ; and ( 5 ) the utility of behavioral , dietary , and pharmacological interventions in mitigating apd - induced metabolic side effects . two major categories of methodological issues were identified during the conference : first , statistical challenges , and second , the detection and proper reporting of adverse effects of apds . in the category of statistical issues , two in particular were highlighted : 1 . dealing with missing data ; and , 2 .
missing data often arise when patients drop out of a study , discontinue antipsychotic treatment , or switch to a different antipsychotic drug , which produces a sample that is no longer a population in which treatment assignment is guaranteed to be independent of all pre - assignment covariates .
this is a particular challenge for studies of antipsychotic drug metabolic effects , because treatment discontinuation and switches are common , often take place relatively soon after treatment initiation , and do not occur randomly , being likely to be associated with clinical characteristics that may in turn be associated with treatment outcomes ( informative censoring ) in ways that may not be fully adjusted for by available covariates .
most commonly , the last observation carried forward ( locf ) technique is implemented ; however , this method is not likely to capture what would have occurred if the patients who dropped out had remained in the study .
alternatively , several mixed models and multiple imputation can be used to test treatment effects ( elobeid et al . ,
2009 ) , although caution is warranted when using mixed models approaches with small sample sizes and a large number of measurements , because type 1 error rates can become inflated ( ahn et al . , 2000 )
of course , it must be kept in mind that the use of mixed models or multiple imputation to conduct intention to treat ( itt ) analyses , allows one to obtain unbiased estimates of treatment assignment only under certain assumptions , the critical one being that the data are missing at random ( mar ) , meaning that the missing data are mar conditional on other variables in the model .
this is a less restrictive assumption than missing completely at random ( mcar ) which is required for analysis of completers only to be valid , but not an easily testable assumption ( little , 1988 ) .
moreover , these methods test the effect of treatment assignment , not treatment per se , and there is no easy way nor universally accepted procedure that solves this problem at the analytic level .
only designs which ensure perfect conformity of treatment to treatment assignment and eliminate drop - outs entirely can unequivocally solve such problems ( little and rubin , 2002 ) . empirical data can be used to inform expected dropout rates for weight loss trial design ( elobeid et al . , 2009 ) , to ensure a large enough sample size for adequate power .
additionally , it should be noted that the type of analysis used affects power , and that mixed models and multiple imputation have comparable power , and are preferred to locf methods ( elobeid et al . , 2009 ) .
a second statistical and methodological challenge is the analysis of heterogeneity in response to a given treatment , such as inter - individual variation in apd - induced weight gain , and in analyzing the contribution of genetic factors to this heterogeneity .
it is clear that genetic contributions to inter - individual variability in treatment response can be profound ( bronikowski et al . , 2006 ) .
however , detecting treatment response heterogeneity in randomized controlled trials requires a specific study design , because variation in outcome within the treatment group does not necessarily indicate treatment response heterogeneity .
conceptually , true treatment response for an individual is the difference between the change in the outcome variable after a pre - determined treatment period and the change in the outcome variable during the same time period had treatment not occurred ( gadbury et al . , 2001 ) .
commonly , studies seek to account for heterogeneity in weight gain response to apd treatment by correlating with baseline bmi or other baseline covariates .
such analyses may suffer from flaws , however , because any correlation may be a result of regression to the mean , such that obese persons gain relatively less weight and thin persons gain relatively more weight after an obesogenic treatment ( allison et al .
several alternative methods can be used to identify treatment response heterogeneity and covariates that may predict response . instead of a parallel group design , which can detect only a treatment effect ,
a repeated - period crossover design in which each patient receives both treatments at least twice is useful for detection of treatment - patient interactions and treatment response heterogeneity ( senn , 2001 ) .
in addition , a simple method to calculate the upper and lower bounds of treatment response heterogeneity in a parallel groups has been proposed by gadbury et al .
lastly , whole genome prediction can be used to predict which individuals may respond better or worse to a particular treatment ( de los campos et al .
, 2010 ) , and although the method does not necessarily explain why or which genes may be involved , it is a strong prediction tool that uses all genetic markers available instead of just a few . finally , there are methodological challenges in detecting adverse effects of apds .
postmarketing pharmacovigilance for adverse effects of drugs has improved with the fda amendment act of 2007 , which allowed for the creation of an active surveillance system using electronic data from health care providers via the sentinel initiative ( fda , 2011 ) .
nonetheless , observational pharmacoepidemiology studies examining apd - induced weight gain suffer from several confounders ( ramaswamy et al . , 2006 ) .
for example , patients taking antipsychotics often have higher background rates of metabolic disorders , longitudinal follow - up to detect metabolic abnormalities from chronic apd use is limited , the validity of using diagnosis codes may be questionable ( particularly for ascertaining obesity ) , there may be differential disease surveillance rates , and use of over - the - counter weight loss products may not be tracked .
data on family history , bmi status , dietary intake , and level of physical activity ( known risk factors for metabolic abnormalities ) are lacking in electronic claims data and represent sources of unmeasured confounding .
electronic medical records offer promise for studies of outcomes such as bmi , glucose , and lipid profiles , but careful exploration of the completeness of such data sources and the potential for confounding through informative absence of data ( e.g. , a higher likelihood of values being recorded when overweight or other metabolic problems exist ) is a necessary initial step in such studies . linking specific antipsychotic exposure to weight gain is also challenging because of frequent medication switching to optimize clinical response , as well as drug selection bias , e.g. , drugs with a greater propensity for weight gain
other psychotropic medications prescribed to patients with psychosis , including antidepressants and mood stabilizers , can also contribute to weight gain .
these methodological challenges lead to delays in drug causality determinations and result in delayed changes in clinical practice and policy decisions . however , despite these challenges , sufficient clinical and pharmacoepidemiologic evidence has been generated over time to result in changes in antipsychotic risk mitigation , including fda labeling and ada guidelines that recommends baseline assessment and monitoring of weight , hyperglycemia , and hyperlipidemia .
a review of medicaid datasets for 3-states suggests metabolic monitoring is not routinely practiced and did not increase substantially in the year following publication of ada guidelines ( figure 1 ) .
probably , the most notable risk mitigation response has been a decline in olz prescribing practices ( morrato et al . , 2010a ) .
some states , such as new york , have implemented quality improvement initiatives aimed at reducing the use of antipsychotic medications associated with higher risk of cardiometabolic disorders , such as olz , among patients who have risk factors such as diabetes or pre - diabetes , hypertension , hyperlipidemia , or cardiovascular disease ( nydh , 2010 ) .
apd use in children ( as young as 2 years of age ) has increased substantially over the past two decades ( olfson et al . , 2006 ) ; in particular , the off - label use of atypical antipsychotics in youth has increased in the past decade ( zito et al .
this increasing prescription of antipsychotic agents in children occurs against the concerning backdrop of childhood obesity in the general population ; childhood onset of obesity is known to be associated with increased obesity - related mortality risk in early adulthood ( morrison et al . , 2007 ) .
most recent estimates indicate that approximately 17% of the us population of youth ages 219 are considered obese , with an additional 15% of the pediatric population at risk for developing obesity ( ogden et al . , 2010 ) .
apds are commonly used to treat bipolar disorder and early onset schizophrenia in pediatric patients .
in addition , apds are increasingly used to treat non - psychotic disorders , such as autism , spectrum disorders , oppositional personality disorder , tourette syndrome , attention deficit hyperactivity disorder ( adhd ) , and pervasive developmental disorder .
apds are also increasingly used to treat oppositional , irritable , and aggressive behaviors across diagnoses ( connor et al . , 2006 ; cooper et al . ,
children who are publicly insured ( e.g. , medicaid ) are more commonly prescribed psychotropic medications than privately insured children ( olfson et al . , 2002 ) , and children in foster care who are publicly insured represent the population of publicly insured children with the greatest likelihood of being prescribed psychotropic medications ( zito et al . , 2008 ;
four percent of children aged 617 years of age enrolled in medicaid were using antipsychotics as of 2005 , which is a 4050% increase since 2001 , and most of these prescriptions ( approximately 50% ) were for the treatment of adhd or disruptive behavior disorders ( crystal et al . , 2009 ) .
the majority of children taking antipsychotics in this medicaid cohort were concomitantly taking other psychotropic drugs , whereas a minority were treated with psychotherapy ( crystal et al . , 2009 ) .
similar trends are seen in privately insured youth , although the annual percentage of enrollees using apds in this group was only 0.93% as of 2007 ( olfson et al . , 2010 ) .
several issues for concern arise in this context , such as the low monitoring of metabolic risk in both public- and privately insured populations ( haupt et al . , 2009 ;
, 2010b ) , and additional metabolic risk conferred by polypharmacy ( mcintyre and jerrell , 2008 ) , contributed to by poor access to high quality medical and mental health care related to socio - economic disparity .
this concurrent rise in apd use in children along with the paucity of information on the safety of such medications in children has led to a concerted effort among researchers , clinicians , and policymakers to better understand this issue .
data from commercially insured ( haupt et al . , 2009 ) and medicaid beneficiaries ( morrato et al . , 2010b ) indicate that most persons using apds do not receive glucose and dyslipidemia monitoring ( figure 1 ) , and that monitoring rates are lowest in the youngest age groups . in a restrospective new - apd user cohort study of 3-state medicaid claims data from 2004 to 2006 , rates of fasting glucose and lipid testing were higher in non - diabetic youth treated with apds than in a control population of non - diabetic youth ( morrato et al . ,
however , rates of incident diabetes and hyperlipidemia during the study period , defined as either a new diagnosis code or new prescription for anti - diabetes or hyperlipidemia treatment , were on average higher in the apd - treated group , with lower rates of anti - diabetes or hyperlipidemia treatment noted in the apd - treated group . in large observational databases like the multistate medicaid analysis , youth taking antipsychotics compared to albuterol - treated controls
have higher rates of treatment - incident diagnosis of diabetes and hyperlipidemia , without higher anti - diabetes or hyperlipidemia treatment in the apd - treated population .
this is associated with the adverse medical outcomes that could be predicted ; unfortunately at this stage and indication that it is not properly treated . however ,
these observational studies are to a large extent hypothesis - generating ; clinical trials are needed to test hypotheses and evaluate treatment - related metabolic changes over time .
similar or greater weight gain is seen across apds in children as in adults , although relative weight gain tends to be higher in children ( shin et al . , 2008 ) , with some indication that perhaps initial antipsychotic exposure accounts for the higher weight gain observed in younger patients ( table 1 ) .
the non - randomized second - generation antipsychotic treatment indications , effectiveness , and tolerability in youth ( satiety ) cohort study was one of the first studies to specifically include antipsychotic - nave patients ( correll et al . , 2009 ) .
the satiety study enrolled antipsychotic - nave patients aged 419 years ( n = 272 ) , with non - randomized assignment to either aripiprazole ( ari ) , quetiapine ( quet ) , risperidone ( risp ) , or olanzapine ( olz ) .
although there was potential for channeling bias at baseline in that many children who were overweight or obese at baseline were assigned to treatment with aripiprazole , weight gain was apparent in all treatment groups after 12 weeks , including in the ari treatment group , which in previously exposed youth showed only minimal weight gain ( de hert et al . , 2011b ) .
8.5 kg ) , with quet , risp , and ari producing somewhat less , but still substantial weight gain ( avg .
cholesterol and triglyceride levels also increased significantly in the olz and quet groups , triglycerides increased significantly with risp , but ari did not cause significant lipid increases despite significant weight gain .
by contrast , glucose , insulin , and insulin resistance increased significantly only with olz , at least during the first 12 weeks of antipsychotic exposure .
the researchers suggested that the increased weight gain seen in pediatric populations can be fully explained by a lack of prior exposure to antipsychotics , because the degree of metabolic effects was consistent with those seen in adult treatment - nave patients ( correll et al . , 2011 ) .
the recently completed nih - funded meac ( metabolic effects of antipsychotics in children ) study ( mh72912 , pi : newcomer ) was the first to specifically evaluate gold - standard metabolic outcomes in children and adolescents during an initial 12 weeks of exposure to antipsychotics .
antipsychotic - naive participants aged 618 with clinically significant aggression and irritability ( score of > 18 on aberrant child behavior checklist irritability subscale ) in the setting of one or more dsm - iv diagnosis indicating a disruptive behavior disorder were enrolled .
participants ( n = 144 ) were randomized to specific antipsychotic treatments ( risp , olz , ari ) following baseline assessments .
baseline and 12 week measures include body composition analysis with dual energy x - ray absorptiometry ( dexa ) and abdominal mri , as well as metabolic testing including hyperinsulinemic euglycemic glucose clamps with stable isotopomer tracing .
primary endpoints were change in whole - body and abdominal adiposity , and whole - body and tissue - specific insulin sensitivity . in the pooled group , combining all treatments , irritability scores were significantly improved .
however , during the 12 week trial , a mean dexa - measured 2.4 ( 3.1)% gain in total percent body fat was noted , corresponding to a 10 ( 7 ) lb weight gain , and an associated mean decrease in clamp - measured whole - body insulin sensitivity were observed .
half of the participants had a primary diagnosis of adhd and were concurrently treated with a psychostimulant during study participation .
there was no clear relationship between stimulant treatment and weight / adiposity change compared to non - stimulant treated participants , reflecting results of a recent study also suggested that stimulant medication may not mitigate the metabolic effects of apds in children ( penzner et al . , 2009 ) .
these results also support what was seen in large observational database studies ; the weight gain observed during antipsychotic treatment is largely attributable to ap drug effect .
results from long - term follow - up studies such as the treatment of early onset schizophrenia spectrum ( teoss ) study suggest that similar rates of weight gain continue during extended ap treatment , with a leveling off at 1 year after initial exposure ( findling et al . , 2010 ) , and that molindone and risp may exhibit more delayed - onset weight gain than does olz .
overall , these studies highlight the need for more frequent cardiometabolic monitoring in pediatric patients after the initial 3 months of treatment and for additional research addressing the long - term cardiometabolic effects of pediatric exposures .
given that the risk of metabolic syndrome risk associated with apd use differs across ethnic groups , it can be inferred that genetic factors may be playing a mediating role . in the general population ,
rates of metabolic syndrome are lower in black and hispanic patients than in white patients , whereas rates of diabetes and cvd are higher in black and hispanic patients when compared to white patients ( park et al . , 2003 ) .
ethnic differences in lipid profiles have also been noted , and may lead to under - diagnosis of metabolic syndrome in blacks ( gaillard et al . , 2009 ; sumner , 2009 ) .
in addition , the linear relationship between waist circumference and insulin resistance seen in white patients does not hold true for black or hispanic patients ( nelson et al .
the rates of death from cvd in hispanic and black patients receiving clozapine ( cloz ) are 4.3 and 11.5 times the rates in whites , respectively ( henderson et al . , 2005 ) .
several genes have been identified that may mediate the effect of apd - induced weight gain . a genome - wide association study ( gwas )
was conducted with the satiety cohort to determine whether differential metabolic responses to antipsychotics are associated with genetic markers .
the analysis was conducted on those exposed to quet , risp , and ari and approximately 20 single nucleotide polymorphisms ( snps ) on chr 18 , near the melanocortin four receptor gene ( mc4r ) , were associated with weight gain after antipsychotic exposure ( malhotra et al . , 2012 ) .
these results are consistent with other studies implicating rare mc4r mutations in early onset obesity ( loos et al
. , 2008 ) and more common variants downstream of mc4r that are associated with obesity ( loos , 2011 ) , and suggest that variants in this region may confer susceptibility to weight gain while taking apds .
as there was no randomized control group in this study to allow for testing of an apd by genotype interaction , it is unclear if these snps moderated the effects of apds on weight gain or were merely associated with weight gain among people taking apds .
in addition , snps in the serotonin 2c receptor ( 5ht2c ) promoter region ( reynolds et al . , 2002 ) and prohormone convertase 1 ( pcsk1 ) gene were associated with apd related weight gain in the satiety cohort and other obesity studies ( kilpelainen et al . , 2009 ) .
pcsk1 metabolizes an mc4r ligand , suggesting that the genetic variants found to date may converge on the proopiomelanocortin ( pomc ) pathway ( lett et al . , 2012 ) .
ultimately , a clearer understanding of the role of specific genes in treatment effect heterogeneity holds much promise for the development of genetically informed , personalized treatment approaches , but further research is needed before such approaches are practical on a routine basis ( lett et al . , 2012 ) .
, 2008 ; van winkel et al . , 2010 ) and variants in the methylenetetrahydrofolate reductase ( mthfr ) and catechol - o - methyl transferase ( comt ) genes was detected in schizophrenia patients , which suggests that perturbations in the aldo met cycle may be related to schizophrenia and apd - induced metabolic effects .
the aldo met cycle regulates homocysteine levels , a marker associated with cvd risk ; therefore these gene variants may particularly affect cvd risk .
other evidence suggests genes may interact with certain nutrients to modify cvd risk when taking apds .
for example , n3 fatty acid administration may offer a protective effect and interact with gene variants ( amminger et al . , 2010 ) . when endothelial functioning in schizophrenia patients was evaluated in relation to n3 fatty acid intake , endothelial function was lower in patients than in healthy subjects , and the relationship between n3 fatty acid intake and endothelial function was modified by antipsychotic exposure ( ellingrod et al . , 2011 ) .
in addition , the comt val variant showed a significant association with physical activity in these patients ( lott et al . , 2012 ) .
finally , preliminary evidence suggests that folate supplementation , which may restore balance of the aldo met cycle , improves endothelial function in schizophrenia patients with metabolic syndrome ( ellingrod et al . , 2012 ) .
not surprisingly , increases in treatment - related adiposity predict insulin resistance in adults and children ( haupt et al . , 2007 ; nicol and newcomer , 2008 ; newcomer et al . , 2009 ) .
consistent with relative weight gain across the apds , results from a recent post - marketing survey across three u.s .
insurer databases suggest significant increased risk of diabetes for users of olz and cloz but not ari , zip , risp , or quet , when compared to users of haloperidol ( yood et al . , 2009 ) .
an important aspect of this study was the inclusion of other non - psychiatric medications as covariates ( alpha and beta blockers , corticosteroids , oral contraceptives , statins , etc . ) .
recent mechanistic studies described below suggest that apd - associated insulin resistance can occur without weight gain .
while the specific mechanism or mechanisms of apd - induced weight gain are not fully understood , studies have shown that affinity for the type 1 histamine receptor explains the majority of the variance in weight gain between apds ( kroeze et al . , 2003 ) , with the proposed orexigenic mechanism being related to selective activation of hypothalamic amp - kinase ( kim et al . , 2007 ) .
however , the promiscuity of the various apd drugs for interacting with multiple receptor systems , many of which have direct ties to regulating energy balance , further complicates understanding the mechanism(s ) by which apds induce weight gain .
apds are almost exclusively dopamine receptor 2 ( drd2 ) antagonists , with the exception of partial agonists like ari .
all the second - generation apds also antagonize serotonin 2a and 2c receptors , with variable antagonist activity at histamine , muscarinic and -adrenergic receptors and some agents are agonists or partial agonists at the serotonin receptor 1a ( e.g. , ari ) . because of the differential weight gain associated with different apds , previous studies have suggested that apd binding to the serotonin 2c receptor ( 5ht2c ) , histamine receptor ( h1 ) , and the dopamine d2 receptor ( drd2 ) plays an important role in apd - induced weight gain ( nasrallah , 2008 ; reynolds and kirk , 2010 ) .
olanzapine and clozapine , which exhibit a particularly high affinity for histamine and muscarinic receptors , are associated with the most weight gain in patients and also cause increases in fasting glucose , insulin , and triglycerides .
the role of the neural control of food intake and glucose homeostasis in this effect is currently being explored .
the role of the vagal nerve in insulin release during and just after meals suggests that meal ingestion may uncover effects that can not be assessed in an intravenous glucose intervention study .
for example , a 12-day inpatient study of healthy individuals given olz and ari showed no increase in body weight or food intake , but increased hunger ( teff , unpublished data ) .
furthermore , no change in glucose production , small decreases in glucose disposal , and a doubling of postprandial insulin response were noted with olz , but not ari .
these results suggest that a compensatory postprandial response of olz may explain the insulin resistance seen in longer term studies .
this study raises the question of whether a sublingual route that avoids first - pass hepatic metabolism may alleviate this effect , although the largest randomized trial to date does not seem to support this assertion ( karagianis et al . , 2009 ) .
however , as noted above , the weight gain potential of individual agents and not adiposity - independent effects , is the primary factor associated with variation in insulin sensitivity during treatment .
it can be noted that there is some evidence in animals for adiposity - independent effects on insulin sensitivity ( houseknecht et al . , 2007 ) , but adiposity - independent effects in humans have not been demonstrated .
moreover , these results also raise the question of whether decreases in insulin sensitivity precede or follow weight gain .
results from animal models suggest olz may alter the adipose tissue profile in addition to affecting insulin secretion .
a canine model showed no significant changes in body weight or caloric intake , but a doubling of body fat , after 6 weeks of treatment with olz but not risp ( ader et al . , 2005 ) .
this model suggests olz promotes fat deposition associated with ppar expression , hepatic insulin resistance , and impairment of the pancreatic beta cell compensatory response .
however , no impairment of glucose tolerance was observed , and insulin levels were increased to a greater extent than c - peptide , which is co - secreted with insulin .
these data suggest that olz treatment may alter both insulin secretion and metabolic clearance of the hormone by the liver . in a canine model of preexisting obesity via high - fat diet , olz was associated with additional weight gain and adiposity compared with ari and placebo .
the volume of visceral fat cells was dramatically increased in the olz - treated animals .
other studies have suggested increased adipocyte inflammation in olz - treated animals ( victoriano et al . , 2010 ) and
importantly , while olz treatment impaired insulin secretory function in vivo , perfusion of these pancreatic islets in vitro demonstrated no significant defect of insulin release .
these data indicate that olz disturb pancreatic function not by direct damage to pancreatic -cells , but rather via interference with signals to the pancreas , possibly secondary to an effect on the central nervous system . while development of a rodent model that reflects the magnitude of weight gain seen in humans has been difficult due to rapid metabolism in rodents ( kapur et al . , 2000 ; remington , 2010 ) , research looking at acute effects have shown that hepatic glucose production increases with cloz and olz , and insulin and c - peptide responses to glucose load are reduced ( chintoh et al . , 2009 ) .
subsequent studies using specific receptor blockers suggest that d2/d3 , m3 , and 5ht2a antagonism may play a role in the apd - induced acute glucose dysregulation ( hahn et al . , 2011 ) .
although apds increase body fat , evidence suggests they may result in a paradoxical reduction of free fatty acid levels and upregulation of fatty acid utilization .
metabolomic and metabolic phenotyping after olz administration in rodents revealed increased adiposity without a concomitant change in body weight , decreased physical activity , an acute decrease in free fatty acids , decreased lipolysis , and increased whole - body lipid oxidation ( albaugh et al .
these studies are consistent with three human studies that also showed acute decreases in free fatty acids with apd treatment ( kaddurah - daouk et al . , 2007 ;
in addition , olz administration is associated with a shift in relative fuel consumption to fat oxidation , as measured by a rapid decline in the respiratory exchange ratio ( rer ) during the dark cycle without the normal rise in rer following meal ingestion ( albaugh et al . , 2012 ) .
a decline in rer would indicate greater consumption of fat as fuel in comparison to carbohydrate or protein .
it is unclear how these metabolic effects may or may not contribute to adiposity and insulin resistance associated with apd use , but suggests that high free fatty acids and lipotoxicity are unlikely to play a role .
the effect of antipsychotics on appetite regulation ( adapt ) study is an ongoing trial evaluating apd - induced changes in appetite - regulating hormones in a treatment - nave population over 4 months ( brownley , 2011 ) .
preliminary data indicate no changes in pre- or post - prandial insulin or glucose after an overnight fast resulting from apd use and apd reduced caloric intake on average , despite some , though not all , individuals gaining a significant amount of weight ( brownley , unpublished data ) .
an increase in hunger was reported in those who gained weight , but a decrease was reported in those who lost weight .
adp - induced weight gain was associated with decreased ghrelin levels and increased peptide tyrosine - tyrosine ( pyy ) , and resting energy expenditure was decreased .
the increases in pyy suggest compensation in peripheral release in response to down - regulated central pyy receptors and implicate perturbation of the reward system in the antipsychotic - induced metabolic changes .
such implications are supported by the results of wang and huang who demonstrated decreases in central pyy binding densities in rat brain after chronic administration of olz , but not haloperidol ( wang and huang , 2008 ) . similar to the differences seen in human populations , olz and cloz cause increased lipid accumulation in the nematode c. elegans , whereas haloperidol and fluphenazine did not ( dwyer et al . , 2005 ) .
consistent with the hypothesis of apd - induced appetite regulation disturbances , foraging behavior in c. elegans is increased following cloz and olz exposure and is associated with insulin receptor - controlled activation of akt and subsequent foxo ( daf-16 ) nuclear localization ( weeks et al . ,
the differences in incidence of obesity and metabolic complications in patients taking apds compared to the general population may be in part due to lack of preventative care for metabolic diseases in the psychiatric patient population ( newcomer and hennekens , 2007 ) .
particularly low rates of treatment for hypertension , dyslipidemia , and diabetes were evident in the patients enrolled in the catie trial when compared to the general population ( nasrallah et al . , 2006 ) .
furthermore , the food and drug administration ( fda ) warnings for apds have not produced substantial changes in practice , such as increased lipid and glucose monitoring , in both publicly and privately insured populations of patients ( haupt et al .
the gap in monitoring is particularly evident in pediatric patients ( haupt et al . ,
glucose and lipid testing among apd users varied significantly between states and counties ; patients with diagnosed cardiometabolic co - morbidity , serious mental illness , persistent use of apds , and with greater frequency of non - psychiatric medical office visits were more likely to be screened ( morrato et al . , 2011 ) .
more effort is needed to understand reasons for screening disparities in order to inform risk management quality improvement interventions .
for example , recent studies have shown that rates of metabolic monitoring have increased in some medicaid populations ( moeller et al . , 2011 ) and
significant improvements can be made in community mental health centers by applying principles of diffusion of innovation theory ( morrato et al .
the attitudes of psychiatric patients toward weight gain and their desire to lose weight are consistent with those of the general population ( strassnig et al . , 2005 ; ganguli and strassnig , 2011 ) .
the waist study introduced weight loss behavioral therapy in a group setting in a schizophrenia patient population ( brar et al . , 2005 ) .
the therapy included self - monitoring actions such as daily weighing , using a pedometer , using a food diary , and the additional incentive of a monetary reward ( brar et al . , 2005 ) .
therapy also included making eating a specific activity , slowing the rate of eating , and getting over the inhibition of wasting food .
physical activity was increased mainly by using a walking in place video program . as an active control ,
after 14 weeks , weight loss was significantly greater in the behavioral therapy group than in the social skills training and usual care groups , with one - quarter of the patients losing more than 5% of their body weight at the endpoint ( brar et al . , 2005 ) .
currently , research is focused on determining whether behavioral interventions are associated with increased maintenance of weight loss after 2 years in those patients who did lose weight .
several pharmacologic interventions have been tested in patients taking apds to counteract the weight gain and metabolic complications associated with these drugs .
metformin , and topiramate have demonstrated efficacy in weight loss trials in patients receiving apd treatment with an average weight loss of approximately 23 kg after 812 weeks of treatment ; fenfluramine , sibutramine , and reboxetine , show similar effects but have been removed from the market due to side effect concerns ( maayan et al . , 2010 ) .
metformin not only reduces weight , but also improves fasting insulin and insulin resistance in first - episode patients more efficiently than does a life - style intervention alone , but is even more effective when combined with a life - style intervention ( wu et al . ,
slow - release metformin induces weight loss even after long - term cloz treatment ( carrizo et al . , 2009 ) .
interestingly , metformin may act through improving leptin sensitivity , and certain mutations in leptin may prevent metformin action ( fernandez et al . ,
topiramate improves triglycerides , glucose , leptin , cholesterol , and blood pressure in olz - treated patients in addition to promoting weight loss ( narula et al . , 2010 ) .
improved interventions are needed , and the appropriateness of bariatric surgery in this population could be explored .
some evidence suggests that using pharmacologic agents for weight loss may interfere with the therapeutic effects of antipsychotic treatment ( baptista et al . , 2008 ) . in one study , the treatment algorithm producing the most weight loss via metformin administration suggested reduced improvement in depression ( hoffmann et al . , 2011 ) .
in addition , topiramate is associated with a worsening of cognitive functions , and amantadine may worsen psychosis ( baptista et al . , 2008 ) .
thus , patients taking amantadine and topiramate to reduce weight gain should be monitored carefully .
switching of antipsychotic medications has been investigated for effects on weight gain and metabolic complications .
overall , switching from risp or olz ( medium and high weight gain drugs ) to zip or ari ( lower weight gain drugs ) does produce weight loss and modestly improves triglycerides and cholesterol ( mukundan et al .
unfortunately , at least for a subgroup of patients , drugs that cause less weight gain may not be as effective in treating psychosis as are those that cause more weight gain , although the catie data shows a very modest correlation between clinical improvement and increase in bmi ( hermes et al . , 2011 ) .
in the catie trial , patients who stayed on the same medication and avoided switching were more likely to stay in treatment , and those taking an effective medication were more likely to regress if they switched ( essock et al . , 2006 ) . in another trial , switching from the higher risk olz to lower risk risp or quet did not result in increased psychiatric risk , and patients who switched gained less weight than did those who stayed on olz ( rosenheck et al . , 2009 ) .
regarding recommendations for clinicians , a meta - analysis of apd clinical trials suggests that cloz , olz , and risp appear to most consistently show superior efficacy ( leucht et al .
for first - episode schizophrenic patients , however , who are both most sensitive to apd adverse effects and have higher therapeutic response rates , antipsychotics showing less weight gain liability should be prescribed first and only those patients who do not respond should be switched to potentially more effective , higher weight gain treatments ( buchanan et al . , 2010 ; agid et al . , 2011 ) .
several pretreatment or early treatment characteristics have been associated with apd outcomes and may be useful for predicting apd response . although the initial analysis of the catie trial dataset suggested that patients with metabolic syndrome did not have lower cognitive performance than did patients without metabolic syndrome ( meyer et al . , 2005 ) , a recent re - analysis suggests a significant , although small and clinically irrelevant , negative association between bmi and the positive and negative symptom scale ( panss ) total score , and this association did not differ across antipsychotic medications ( hermes et al . ,
however , findings regarding associations of weight gain with improvement in symptoms after antipsychotic treatment are varied and controversial ( correll et al .
, 2011 ; de hert et al . , 2011a ) and kelly , unpublished data ) .
two major categories of methodological issues were identified during the conference : first , statistical challenges , and second , the detection and proper reporting of adverse effects of apds . in the category of statistical issues , two in particular were highlighted : 1 .
missing data often arise when patients drop out of a study , discontinue antipsychotic treatment , or switch to a different antipsychotic drug , which produces a sample that is no longer a population in which treatment assignment is guaranteed to be independent of all pre - assignment covariates .
this is a particular challenge for studies of antipsychotic drug metabolic effects , because treatment discontinuation and switches are common , often take place relatively soon after treatment initiation , and do not occur randomly , being likely to be associated with clinical characteristics that may in turn be associated with treatment outcomes ( informative censoring ) in ways that may not be fully adjusted for by available covariates .
most commonly , the last observation carried forward ( locf ) technique is implemented ; however , this method is not likely to capture what would have occurred if the patients who dropped out had remained in the study . alternatively ,
several mixed models and multiple imputation can be used to test treatment effects ( elobeid et al . , 2009 ) , although caution is warranted when using mixed models approaches with small sample sizes and a large number of measurements , because type 1 error rates can become inflated ( ahn et al . , 2000 ) .
of course , it must be kept in mind that the use of mixed models or multiple imputation to conduct intention to treat ( itt ) analyses , allows one to obtain unbiased estimates of treatment assignment only under certain assumptions , the critical one being that the data are missing at random ( mar ) , meaning that the missing data are mar conditional on other variables in the model .
this is a less restrictive assumption than missing completely at random ( mcar ) which is required for analysis of completers only to be valid , but not an easily testable assumption ( little , 1988 ) .
moreover , these methods test the effect of treatment assignment , not treatment per se , and there is no easy way nor universally accepted procedure that solves this problem at the analytic level . only designs which ensure perfect conformity of treatment to treatment assignment and eliminate drop - outs
empirical data can be used to inform expected dropout rates for weight loss trial design ( elobeid et al . , 2009 ) , to ensure a large enough sample size for adequate power . additionally , it should be noted that the type of analysis used affects power , and that mixed models and multiple imputation have comparable power , and are preferred to locf methods ( elobeid et al . , 2009 ) .
a second statistical and methodological challenge is the analysis of heterogeneity in response to a given treatment , such as inter - individual variation in apd - induced weight gain , and in analyzing the contribution of genetic factors to this heterogeneity .
it is clear that genetic contributions to inter - individual variability in treatment response can be profound ( bronikowski et al . , 2006 ) .
however , detecting treatment response heterogeneity in randomized controlled trials requires a specific study design , because variation in outcome within the treatment group does not necessarily indicate treatment response heterogeneity .
conceptually , true treatment response for an individual is the difference between the change in the outcome variable after a pre - determined treatment period and the change in the outcome variable during the same time period had treatment not occurred ( gadbury et al . , 2001 ) .
commonly , studies seek to account for heterogeneity in weight gain response to apd treatment by correlating with baseline bmi or other baseline covariates .
such analyses may suffer from flaws , however , because any correlation may be a result of regression to the mean , such that obese persons gain relatively less weight and thin persons gain relatively more weight after an obesogenic treatment ( allison et al . , 2009a ) .
several alternative methods can be used to identify treatment response heterogeneity and covariates that may predict response . instead of a parallel group design , which can detect only a treatment effect ,
a repeated - period crossover design in which each patient receives both treatments at least twice is useful for detection of treatment - patient interactions and treatment response heterogeneity ( senn , 2001 ) .
in addition , a simple method to calculate the upper and lower bounds of treatment response heterogeneity in a parallel groups has been proposed by gadbury et al .
lastly , whole genome prediction can be used to predict which individuals may respond better or worse to a particular treatment ( de los campos et al . , 2010 ) , and
although the method does not necessarily explain why or which genes may be involved , it is a strong prediction tool that uses all genetic markers available instead of just a few .
postmarketing pharmacovigilance for adverse effects of drugs has improved with the fda amendment act of 2007 , which allowed for the creation of an active surveillance system using electronic data from health care providers via the sentinel initiative ( fda , 2011 ) .
nonetheless , observational pharmacoepidemiology studies examining apd - induced weight gain suffer from several confounders ( ramaswamy et al . , 2006 ) .
for example , patients taking antipsychotics often have higher background rates of metabolic disorders , longitudinal follow - up to detect metabolic abnormalities from chronic apd use is limited , the validity of using diagnosis codes may be questionable ( particularly for ascertaining obesity ) , there may be differential disease surveillance rates , and use of over - the - counter weight loss products may not be tracked .
data on family history , bmi status , dietary intake , and level of physical activity ( known risk factors for metabolic abnormalities ) are lacking in electronic claims data and represent sources of unmeasured confounding .
electronic medical records offer promise for studies of outcomes such as bmi , glucose , and lipid profiles , but careful exploration of the completeness of such data sources and the potential for confounding through informative absence of data ( e.g. , a higher likelihood of values being recorded when overweight or other metabolic problems exist ) is a necessary initial step in such studies . linking specific antipsychotic exposure to weight gain is also challenging because of frequent medication switching to optimize clinical response , as well as drug selection bias , e.g. , drugs with a greater propensity for weight gain
other psychotropic medications prescribed to patients with psychosis , including antidepressants and mood stabilizers , can also contribute to weight gain .
these methodological challenges lead to delays in drug causality determinations and result in delayed changes in clinical practice and policy decisions .
however , despite these challenges , sufficient clinical and pharmacoepidemiologic evidence has been generated over time to result in changes in antipsychotic risk mitigation , including fda labeling and ada guidelines that recommends baseline assessment and monitoring of weight , hyperglycemia , and hyperlipidemia .
a review of medicaid datasets for 3-states suggests metabolic monitoring is not routinely practiced and did not increase substantially in the year following publication of ada guidelines ( figure 1 ) .
probably , the most notable risk mitigation response has been a decline in olz prescribing practices ( morrato et al .
. some states , such as new york , have implemented quality improvement initiatives aimed at reducing the use of antipsychotic medications associated with higher risk of cardiometabolic disorders , such as olz , among patients who have risk factors such as diabetes or pre - diabetes , hypertension , hyperlipidemia , or cardiovascular disease ( nydh , 2010 ) .
apd use in children ( as young as 2 years of age ) has increased substantially over the past two decades ( olfson et al . , 2006 ) ; in particular , the off - label use of atypical antipsychotics in youth has increased in the past decade ( zito et al . , 2007 ; crystal et al . , 2009
this increasing prescription of antipsychotic agents in children occurs against the concerning backdrop of childhood obesity in the general population ; childhood onset of obesity is known to be associated with increased obesity - related mortality risk in early adulthood ( morrison et al . , 2007 ) .
most recent estimates indicate that approximately 17% of the us population of youth ages 219 are considered obese , with an additional 15% of the pediatric population at risk for developing obesity ( ogden et al . , 2010 ) .
apds are commonly used to treat bipolar disorder and early onset schizophrenia in pediatric patients .
in addition , apds are increasingly used to treat non - psychotic disorders , such as autism , spectrum disorders , oppositional personality disorder , tourette syndrome , attention deficit hyperactivity disorder ( adhd ) , and pervasive developmental disorder .
apds are also increasingly used to treat oppositional , irritable , and aggressive behaviors across diagnoses ( connor et al . , 2006 ; cooper et al . , 2006 ) ,
children who are publicly insured ( e.g. , medicaid ) are more commonly prescribed psychotropic medications than privately insured children ( olfson et al . , 2002 ) , and children in foster care who are publicly insured represent the population of publicly insured children with the greatest likelihood of being prescribed psychotropic medications ( zito et al . , 2008 ; dosreis et al . ,
four percent of children aged 617 years of age enrolled in medicaid were using antipsychotics as of 2005 , which is a 4050% increase since 2001 , and most of these prescriptions ( approximately 50% ) were for the treatment of adhd or disruptive behavior disorders ( crystal et al . , 2009 ) .
the majority of children taking antipsychotics in this medicaid cohort were concomitantly taking other psychotropic drugs , whereas a minority were treated with psychotherapy ( crystal et al . , 2009 ) .
similar trends are seen in privately insured youth , although the annual percentage of enrollees using apds in this group was only 0.93% as of 2007 ( olfson et al . , 2010 ) .
several issues for concern arise in this context , such as the low monitoring of metabolic risk in both public- and privately insured populations ( haupt et al . , 2009 ;
morrato et al . , 2010b ) , and additional metabolic risk conferred by polypharmacy ( mcintyre and jerrell , 2008 ) , contributed to by poor access to high quality medical and mental health care related to socio - economic disparity .
this concurrent rise in apd use in children along with the paucity of information on the safety of such medications in children has led to a concerted effort among researchers , clinicians , and policymakers to better understand this issue .
data from commercially insured ( haupt et al . , 2009 ) and medicaid beneficiaries ( morrato et al . , 2010b
) indicate that most persons using apds do not receive glucose and dyslipidemia monitoring ( figure 1 ) , and that monitoring rates are lowest in the youngest age groups . in a restrospective new - apd user cohort study of 3-state medicaid claims data from 2004 to 2006 , rates of fasting glucose and lipid testing were higher in non - diabetic youth treated with apds than in a control population of non - diabetic youth ( morrato et al . , 2010b ) .
however , rates of incident diabetes and hyperlipidemia during the study period , defined as either a new diagnosis code or new prescription for anti - diabetes or hyperlipidemia treatment , were on average higher in the apd - treated group , with lower rates of anti - diabetes or hyperlipidemia treatment noted in the apd - treated group . in large observational databases like the multistate medicaid analysis , youth taking antipsychotics compared to albuterol - treated controls
have higher rates of treatment - incident diagnosis of diabetes and hyperlipidemia , without higher anti - diabetes or hyperlipidemia treatment in the apd - treated population .
this is associated with the adverse medical outcomes that could be predicted ; unfortunately at this stage and indication that it is not properly treated . however ,
these observational studies are to a large extent hypothesis - generating ; clinical trials are needed to test hypotheses and evaluate treatment - related metabolic changes over time .
similar or greater weight gain is seen across apds in children as in adults , although relative weight gain tends to be higher in children ( shin et al . , 2008 ) , with some indication that perhaps initial antipsychotic exposure accounts for the higher weight gain observed in younger patients ( table 1 ) .
the non - randomized second - generation antipsychotic treatment indications , effectiveness , and tolerability in youth ( satiety ) cohort study was one of the first studies to specifically include antipsychotic - nave patients ( correll et al . , 2009 ) .
the satiety study enrolled antipsychotic - nave patients aged 419 years ( n = 272 ) , with non - randomized assignment to either aripiprazole ( ari ) , quetiapine ( quet ) , risperidone ( risp ) , or olanzapine ( olz ) .
although there was potential for channeling bias at baseline in that many children who were overweight or obese at baseline were assigned to treatment with aripiprazole , weight gain was apparent in all treatment groups after 12 weeks , including in the ari treatment group , which in previously exposed youth showed only minimal weight gain ( de hert et al . , 2011b ) .
8.5 kg ) , with quet , risp , and ari producing somewhat less , but still substantial weight gain ( avg .
cholesterol and triglyceride levels also increased significantly in the olz and quet groups , triglycerides increased significantly with risp , but ari did not cause significant lipid increases despite significant weight gain .
by contrast , glucose , insulin , and insulin resistance increased significantly only with olz , at least during the first 12 weeks of antipsychotic exposure .
the researchers suggested that the increased weight gain seen in pediatric populations can be fully explained by a lack of prior exposure to antipsychotics , because the degree of metabolic effects was consistent with those seen in adult treatment - nave patients ( correll et al . , 2011 ) .
the recently completed nih - funded meac ( metabolic effects of antipsychotics in children ) study ( mh72912 , pi : newcomer ) was the first to specifically evaluate gold - standard metabolic outcomes in children and adolescents during an initial 12 weeks of exposure to antipsychotics .
antipsychotic - naive participants aged 618 with clinically significant aggression and irritability ( score of > 18 on aberrant child behavior checklist irritability subscale ) in the setting of one or more dsm - iv diagnosis indicating a disruptive behavior disorder were enrolled .
participants ( n = 144 ) were randomized to specific antipsychotic treatments ( risp , olz , ari ) following baseline assessments .
baseline and 12 week measures include body composition analysis with dual energy x - ray absorptiometry ( dexa ) and abdominal mri , as well as metabolic testing including hyperinsulinemic euglycemic glucose clamps with stable isotopomer tracing .
primary endpoints were change in whole - body and abdominal adiposity , and whole - body and tissue - specific insulin sensitivity . in the pooled group , combining all treatments , irritability scores were significantly improved . however , during the 12 week trial , a mean dexa - measured 2.4 ( 3.1)% gain in total percent body fat was noted , corresponding to a 10 ( 7 ) lb weight gain , and an associated mean decrease in clamp - measured whole - body insulin sensitivity were observed .
half of the participants had a primary diagnosis of adhd and were concurrently treated with a psychostimulant during study participation .
there was no clear relationship between stimulant treatment and weight / adiposity change compared to non - stimulant treated participants , reflecting results of a recent study also suggested that stimulant medication may not mitigate the metabolic effects of apds in children ( penzner et al . , 2009 ) .
these results also support what was seen in large observational database studies ; the weight gain observed during antipsychotic treatment is largely attributable to ap drug effect .
results from long - term follow - up studies such as the treatment of early onset schizophrenia spectrum ( teoss ) study suggest that similar rates of weight gain continue during extended ap treatment , with a leveling off at 1 year after initial exposure ( findling et al . , 2010 ) , and that molindone and risp may exhibit more delayed - onset weight gain than does olz .
overall , these studies highlight the need for more frequent cardiometabolic monitoring in pediatric patients after the initial 3 months of treatment and for additional research addressing the long - term cardiometabolic effects of pediatric exposures .
given that the risk of metabolic syndrome risk associated with apd use differs across ethnic groups , it can be inferred that genetic factors may be playing a mediating role . in the general population ,
rates of metabolic syndrome are lower in black and hispanic patients than in white patients , whereas rates of diabetes and cvd are higher in black and hispanic patients when compared to white patients ( park et al . , 2003 ) .
ethnic differences in lipid profiles have also been noted , and may lead to under - diagnosis of metabolic syndrome in blacks ( gaillard et al . , 2009 ; sumner , 2009 ) .
in addition , the linear relationship between waist circumference and insulin resistance seen in white patients does not hold true for black or hispanic patients ( nelson et al .
the rates of death from cvd in hispanic and black patients receiving clozapine ( cloz ) are 4.3 and 11.5 times the rates in whites , respectively ( henderson et al . , 2005 ) .
several genes have been identified that may mediate the effect of apd - induced weight gain . a genome - wide association study ( gwas )
was conducted with the satiety cohort to determine whether differential metabolic responses to antipsychotics are associated with genetic markers .
the analysis was conducted on those exposed to quet , risp , and ari and approximately 20 single nucleotide polymorphisms ( snps ) on chr 18 , near the melanocortin four receptor gene ( mc4r ) , were associated with weight gain after antipsychotic exposure ( malhotra et al . , 2012 ) .
these results are consistent with other studies implicating rare mc4r mutations in early onset obesity ( loos et al . , 2008 ) and
more common variants downstream of mc4r that are associated with obesity ( loos , 2011 ) , and suggest that variants in this region may confer susceptibility to weight gain while taking apds .
as there was no randomized control group in this study to allow for testing of an apd by genotype interaction , it is unclear if these snps moderated the effects of apds on weight gain or were merely associated with weight gain among people taking apds .
in addition , snps in the serotonin 2c receptor ( 5ht2c ) promoter region ( reynolds et al . , 2002 ) and prohormone convertase 1 ( pcsk1 ) gene were associated with apd related weight gain in the satiety cohort and other obesity studies ( kilpelainen et al . , 2009 ) .
pcsk1 metabolizes an mc4r ligand , suggesting that the genetic variants found to date may converge on the proopiomelanocortin ( pomc ) pathway ( lett et al . , 2012 ) .
ultimately , a clearer understanding of the role of specific genes in treatment effect heterogeneity holds much promise for the development of genetically informed , personalized treatment approaches , but further research is needed before such approaches are practical on a routine basis ( lett et al . , 2012 ) .
, 2008 ; van winkel et al . , 2010 ) and variants in the methylenetetrahydrofolate reductase ( mthfr ) and catechol - o - methyl transferase ( comt ) genes was detected in schizophrenia patients , which suggests that perturbations in the aldo met cycle may be related to schizophrenia and apd - induced metabolic effects .
the aldo met cycle regulates homocysteine levels , a marker associated with cvd risk ; therefore these gene variants may particularly affect cvd risk .
other evidence suggests genes may interact with certain nutrients to modify cvd risk when taking apds .
for example , n3 fatty acid administration may offer a protective effect and interact with gene variants ( amminger et al . , 2010 ) .
when endothelial functioning in schizophrenia patients was evaluated in relation to n3 fatty acid intake , endothelial function was lower in patients than in healthy subjects , and the relationship between n3 fatty acid intake and endothelial function was modified by antipsychotic exposure ( ellingrod et al . , 2011 ) .
in addition , the comt val variant showed a significant association with physical activity in these patients ( lott et al . , 2012 ) .
finally , preliminary evidence suggests that folate supplementation , which may restore balance of the aldo met cycle , improves endothelial function in schizophrenia patients with metabolic syndrome ( ellingrod et al . , 2012 ) .
not surprisingly , increases in treatment - related adiposity predict insulin resistance in adults and children ( haupt et al . , 2007 ; nicol and newcomer , 2008 ; newcomer et al . , 2009 ) .
consistent with relative weight gain across the apds , results from a recent post - marketing survey across three u.s .
insurer databases suggest significant increased risk of diabetes for users of olz and cloz but not ari , zip , risp , or quet , when compared to users of haloperidol ( yood et al . , 2009 ) .
an important aspect of this study was the inclusion of other non - psychiatric medications as covariates ( alpha and beta blockers , corticosteroids , oral contraceptives , statins , etc . ) .
recent mechanistic studies described below suggest that apd - associated insulin resistance can occur without weight gain .
while the specific mechanism or mechanisms of apd - induced weight gain are not fully understood , studies have shown that affinity for the type 1 histamine receptor explains the majority of the variance in weight gain between apds ( kroeze et al . , 2003 ) , with the proposed orexigenic mechanism being related to selective activation of hypothalamic amp - kinase ( kim et al . , 2007 )
. however , the promiscuity of the various apd drugs for interacting with multiple receptor systems , many of which have direct ties to regulating energy balance , further complicates understanding the mechanism(s ) by which apds induce weight gain .
apds are almost exclusively dopamine receptor 2 ( drd2 ) antagonists , with the exception of partial agonists like ari .
all the second - generation apds also antagonize serotonin 2a and 2c receptors , with variable antagonist activity at histamine , muscarinic and -adrenergic receptors and some agents are agonists or partial agonists at the serotonin receptor 1a ( e.g. , ari ) .
because of the differential weight gain associated with different apds , previous studies have suggested that apd binding to the serotonin 2c receptor ( 5ht2c ) , histamine receptor ( h1 ) , and the dopamine d2 receptor ( drd2 ) plays an important role in apd - induced weight gain ( nasrallah , 2008 ; reynolds and kirk , 2010 ) .
olanzapine and clozapine , which exhibit a particularly high affinity for histamine and muscarinic receptors , are associated with the most weight gain in patients and also cause increases in fasting glucose , insulin , and triglycerides .
the role of the neural control of food intake and glucose homeostasis in this effect is currently being explored .
the role of the vagal nerve in insulin release during and just after meals suggests that meal ingestion may uncover effects that can not be assessed in an intravenous glucose intervention study .
for example , a 12-day inpatient study of healthy individuals given olz and ari showed no increase in body weight or food intake , but increased hunger ( teff , unpublished data ) .
furthermore , no change in glucose production , small decreases in glucose disposal , and a doubling of postprandial insulin response were noted with olz , but not ari .
these results suggest that a compensatory postprandial response of olz may explain the insulin resistance seen in longer term studies .
this study raises the question of whether a sublingual route that avoids first - pass hepatic metabolism may alleviate this effect , although the largest randomized trial to date does not seem to support this assertion ( karagianis et al . , 2009 ) .
however , as noted above , the weight gain potential of individual agents and not adiposity - independent effects , is the primary factor associated with variation in insulin sensitivity during treatment .
it can be noted that there is some evidence in animals for adiposity - independent effects on insulin sensitivity ( houseknecht et al . , 2007 ) , but adiposity - independent effects in humans have not been demonstrated .
moreover , these results also raise the question of whether decreases in insulin sensitivity precede or follow weight gain .
results from animal models suggest olz may alter the adipose tissue profile in addition to affecting insulin secretion .
a canine model showed no significant changes in body weight or caloric intake , but a doubling of body fat , after 6 weeks of treatment with olz but not risp ( ader et al . , 2005 ) .
this model suggests olz promotes fat deposition associated with ppar expression , hepatic insulin resistance , and impairment of the pancreatic beta cell compensatory response .
however , no impairment of glucose tolerance was observed , and insulin levels were increased to a greater extent than c - peptide , which is co - secreted with insulin .
these data suggest that olz treatment may alter both insulin secretion and metabolic clearance of the hormone by the liver . in a canine model of preexisting obesity via high - fat diet , olz was associated with additional weight gain and adiposity compared with ari and placebo .
the volume of visceral fat cells was dramatically increased in the olz - treated animals .
other studies have suggested increased adipocyte inflammation in olz - treated animals ( victoriano et al . , 2010 ) and
importantly , while olz treatment impaired insulin secretory function in vivo , perfusion of these pancreatic islets in vitro demonstrated no significant defect of insulin release .
these data indicate that olz disturb pancreatic function not by direct damage to pancreatic -cells , but rather via interference with signals to the pancreas , possibly secondary to an effect on the central nervous system . while development of a rodent model that reflects the magnitude of weight gain seen in humans has been difficult due to rapid metabolism in rodents ( kapur et al . , 2000 ; remington , 2010 ) , research looking at acute effects have shown that hepatic glucose production increases with cloz and olz , and insulin and c - peptide responses to glucose load are reduced ( chintoh et al . , 2009 ) .
subsequent studies using specific receptor blockers suggest that d2/d3 , m3 , and 5ht2a antagonism may play a role in the apd - induced acute glucose dysregulation ( hahn et al . ,
although apds increase body fat , evidence suggests they may result in a paradoxical reduction of free fatty acid levels and upregulation of fatty acid utilization .
metabolomic and metabolic phenotyping after olz administration in rodents revealed increased adiposity without a concomitant change in body weight , decreased physical activity , an acute decrease in free fatty acids , decreased lipolysis , and increased whole - body lipid oxidation ( albaugh et al .
these studies are consistent with three human studies that also showed acute decreases in free fatty acids with apd treatment ( kaddurah - daouk et al . , 2007 ;
in addition , olz administration is associated with a shift in relative fuel consumption to fat oxidation , as measured by a rapid decline in the respiratory exchange ratio ( rer ) during the dark cycle without the normal rise in rer following meal ingestion ( albaugh et al . ,
a decline in rer would indicate greater consumption of fat as fuel in comparison to carbohydrate or protein .
it is unclear how these metabolic effects may or may not contribute to adiposity and insulin resistance associated with apd use , but suggests that high free fatty acids and lipotoxicity are unlikely to play a role .
the effect of antipsychotics on appetite regulation ( adapt ) study is an ongoing trial evaluating apd - induced changes in appetite - regulating hormones in a treatment - nave population over 4 months ( brownley , 2011 ) .
preliminary data indicate no changes in pre- or post - prandial insulin or glucose after an overnight fast resulting from apd use and apd reduced caloric intake on average , despite some , though not all , individuals gaining a significant amount of weight ( brownley , unpublished data ) .
an increase in hunger was reported in those who gained weight , but a decrease was reported in those who lost weight .
adp - induced weight gain was associated with decreased ghrelin levels and increased peptide tyrosine - tyrosine ( pyy ) , and resting energy expenditure was decreased .
the increases in pyy suggest compensation in peripheral release in response to down - regulated central pyy receptors and implicate perturbation of the reward system in the antipsychotic - induced metabolic changes .
such implications are supported by the results of wang and huang who demonstrated decreases in central pyy binding densities in rat brain after chronic administration of olz , but not haloperidol ( wang and huang , 2008 ) .
similar to the differences seen in human populations , olz and cloz cause increased lipid accumulation in the nematode c. elegans , whereas haloperidol and fluphenazine did not ( dwyer et al . , 2005 ) .
consistent with the hypothesis of apd - induced appetite regulation disturbances , foraging behavior in c. elegans is increased following cloz and olz exposure and is associated with insulin receptor - controlled activation of akt and subsequent foxo ( daf-16 ) nuclear localization ( weeks et al . , 2011 ) .
the differences in incidence of obesity and metabolic complications in patients taking apds compared to the general population may be in part due to lack of preventative care for metabolic diseases in the psychiatric patient population ( newcomer and hennekens , 2007 ) .
particularly low rates of treatment for hypertension , dyslipidemia , and diabetes were evident in the patients enrolled in the catie trial when compared to the general population ( nasrallah et al . , 2006 ) .
furthermore , the food and drug administration ( fda ) warnings for apds have not produced substantial changes in practice , such as increased lipid and glucose monitoring , in both publicly and privately insured populations of patients ( haupt et al .
the gap in monitoring is particularly evident in pediatric patients ( haupt et al . ,
in one medicaid study , glucose and lipid testing among apd users varied significantly between states and counties ; patients with diagnosed cardiometabolic co - morbidity , serious mental illness , persistent use of apds , and with greater frequency of non - psychiatric medical office visits were more likely to be screened ( morrato et al . , 2011 ) .
more effort is needed to understand reasons for screening disparities in order to inform risk management quality improvement interventions .
for example , recent studies have shown that rates of metabolic monitoring have increased in some medicaid populations ( moeller et al . , 2011 ) and
significant improvements can be made in community mental health centers by applying principles of diffusion of innovation theory ( morrato et al .
the attitudes of psychiatric patients toward weight gain and their desire to lose weight are consistent with those of the general population ( strassnig et al . , 2005 ; ganguli and strassnig , 2011 ) .
the waist study introduced weight loss behavioral therapy in a group setting in a schizophrenia patient population ( brar et al . , 2005 ) .
the therapy included self - monitoring actions such as daily weighing , using a pedometer , using a food diary , and the additional incentive of a monetary reward ( brar et al . , 2005 ) .
therapy also included making eating a specific activity , slowing the rate of eating , and getting over the inhibition of wasting food .
physical activity was increased mainly by using a walking in place video program . as an active control ,
after 14 weeks , weight loss was significantly greater in the behavioral therapy group than in the social skills training and usual care groups , with one - quarter of the patients losing more than 5% of their body weight at the endpoint ( brar et al . , 2005 ) .
currently , research is focused on determining whether behavioral interventions are associated with increased maintenance of weight loss after 2 years in those patients who did lose weight .
several pharmacologic interventions have been tested in patients taking apds to counteract the weight gain and metabolic complications associated with these drugs .
metformin , and topiramate have demonstrated efficacy in weight loss trials in patients receiving apd treatment with an average weight loss of approximately 23 kg after 812 weeks of treatment ; fenfluramine , sibutramine , and reboxetine , show similar effects but have been removed from the market due to side effect concerns ( maayan et al . , 2010 ) .
metformin not only reduces weight , but also improves fasting insulin and insulin resistance in first - episode patients more efficiently than does a life - style intervention alone , but is even more effective when combined with a life - style intervention ( wu et al . ,
slow - release metformin induces weight loss even after long - term cloz treatment ( carrizo et al . , 2009 ) .
interestingly , metformin may act through improving leptin sensitivity , and certain mutations in leptin may prevent metformin action ( fernandez et al . ,
topiramate improves triglycerides , glucose , leptin , cholesterol , and blood pressure in olz - treated patients in addition to promoting weight loss ( narula et al . , 2010 ) .
notably , however , all drug and behavioral interventions produced modest weight loss . improved interventions are needed , and the appropriateness of bariatric surgery in this population could be explored .
some evidence suggests that using pharmacologic agents for weight loss may interfere with the therapeutic effects of antipsychotic treatment ( baptista et al . , 2008 ) .
in one study , the treatment algorithm producing the most weight loss via metformin administration suggested reduced improvement in depression ( hoffmann et al . , 2011 ) .
in addition , topiramate is associated with a worsening of cognitive functions , and amantadine may worsen psychosis ( baptista et al . , 2008 ) .
thus , patients taking amantadine and topiramate to reduce weight gain should be monitored carefully .
switching of antipsychotic medications has been investigated for effects on weight gain and metabolic complications .
overall , switching from risp or olz ( medium and high weight gain drugs ) to zip or ari ( lower weight gain drugs ) does produce weight loss and modestly improves triglycerides and cholesterol ( mukundan et al .
, 2010 ; stroup et al . , 2011 ) . unfortunately , at least for a subgroup of patients , drugs that cause less weight gain may not be as effective in treating psychosis as are those that cause more weight gain , although the catie data shows a very modest correlation between clinical improvement and increase in bmi ( hermes et al . , 2011 ) . in the catie trial ,
patients who stayed on the same medication and avoided switching were more likely to stay in treatment , and those taking an effective medication were more likely to regress if they switched ( essock et al . , 2006 ) . in another trial , switching from the higher risk olz to lower risk risp or quet did not result in increased psychiatric risk , and patients who switched gained less weight than did those who stayed on olz ( rosenheck et al . , 2009 ) .
regarding recommendations for clinicians , a meta - analysis of apd clinical trials suggests that cloz , olz , and risp appear to most consistently show superior efficacy ( leucht et al .
for first - episode schizophrenic patients , however , who are both most sensitive to apd adverse effects and have higher therapeutic response rates , antipsychotics showing less weight gain liability should be prescribed first and only those patients who do not respond should be switched to potentially more effective , higher weight gain treatments ( buchanan et al . , 2010 ; agid et al . , 2011 ) .
several pretreatment or early treatment characteristics have been associated with apd outcomes and may be useful for predicting apd response . although the initial analysis of the catie trial dataset suggested that patients with metabolic syndrome did not have lower cognitive performance than did patients without metabolic syndrome ( meyer et al . , 2005 ) ,
a recent re - analysis suggests a significant , although small and clinically irrelevant , negative association between bmi and the positive and negative symptom scale ( panss ) total score , and this association did not differ across antipsychotic medications ( hermes et al . , 2011 ) .
however , findings regarding associations of weight gain with improvement in symptoms after antipsychotic treatment are varied and controversial ( correll et al . , 2011 ; de hert et al . , 2011a ) and kelly , unpublished data ) .
in conclusion , the conference presentations highlighted progress in many novel areas of apd - induced metabolic dysfunction research .
recent results from pharmacogenetic studies are suggestive of mechanistic pathways , yet methodological considerations will be important in designing future studies to tease apart apd - gene relationships .
more problematic weight gain trajectories are evident in the growing number of pediatric patients being prescribed apds , although long - term studies are needed to determine if metabolic consequences in pediatric patients lead to greater or earlier disease risk in later life since we have much less information on long - term effects than short - term effects , and long - term effects are very difficult to track with existing treatment designs .
this dilemma arguably demonstrates the importance of a conservative , cautious approach in dosing ( start low , go slow ) and careful metabolic monitoring of patients .
novel studies investigating acute effects of apd exposure on metabolic dysfunction in animal and human studies suggest immediate effects on glucose regulation may play a role in apd - induced metabolic dysfunction .
lastly , combined behavioral , dietary , and pharmacological interventions are showing some promise in mitigating apd - induced metabolic side effects , but novel agents are needed that can more completely prevent or reverse adp related weight gain and metabolic abnormalities .
future research is needed to determine mechanistically how apds lead to metabolic disturbances and weight gain in order to facilitate development of effective combination therapies to negate these effects or to develop new drugs that do not induce weight gain .
in addition , future work should also determine what factors predict weight gain so that clinical guidelines for prescribing apds and managing weight gain and its consequences can be improved .
david b. allison has , anticipates , or has had financial interests with the frontiers foundation ; vivus , inc . ; kraft foods ; university of wisconsin ; university of arizona ; paul , weiss , wharton and garrison llp ; and sage . in the last 36months ,
christoph u. correll has been a consultant and/or advisor to or has received honoraria from : actelion , alexza ; astrazeneca , biotis , boehringer - ingelheim , bristol - myers squibb , cephalon , desitin , eli lilly , gsk , intracellular therapies , lundbeck , medavante , medicure , medscape , merck , national institute of mental health , novartis , ortho - mcneill / janssen / j&j , otsuka , pfizer , prophase , schering - plough , sepracor / sunovion , supernus , takeda , teva , and vanda .
he has received research support from bms , feinstein institute for medical research , janssen / j&j , national institute of mental health ( nimh ) , national alliance for research in schizophrenia and depression ( narsad ) , and otsuka .
stephen crystal , emily j. dhurandhar , and julia m. gohlke declare no commercial or financial relationships that could be construed as a potential conflict of interest . in the past 3 years
, elaine h. morrato has received research support from janssen pharmaceuticals , inc and pfizer , inc . in the last 12months , henry a. nasrallah received research support from forest , lilly otsuka , roche and shire and served as a consultant for genentech , janssen , merck ,
novartis , sunovion , gruenthal , boehringer - ingelheim , and lundbeck and was on the speakers bureau of janssen , merck , novartis , and sunovion . in the last 36months ,
jwn has received research support from nimh , bristol - myers squibb , and pfizer , inc .
he has received consultant fees and/or been on data safety monitoring committees for astrazeneca pharmaceuticals , bristol - myers squibb , biovail , h. lundbeck , janssen pharmaceutica , obecure , otsuka pharmaceuticals , sepracor , inc . ,
he has received royalties / patents / other income from compact clinicals / jones and bartlett publishing .
louis , mo , usa and has no significant financial conflict of interest in compliance with the washington university school of medicine conflict of interest policy .
ginger nicol has received research funding from the nimh , narsad , the dana brown charitable trust foundation , the sidney r. baer , jr .
she also receives grant support from pfizer , inc . for an investigator - initiated clinical trial .
she receives royalties from jones & barlett learning for development of a pediatric metabolic monitoring form and has consulted to medscape . in the last 3 years , gary remington has received research support from the following external funding agencies : canadian institutes of health research ( cihr ) , schizophrenia society of ontario ( sso ) , and the canadian diabetes association ( cda ) .
he has also received support from novartis canada , medicure inc . , and neurocrine bioscience .
he has received consultant fees from laboratorios farmacuticos rovi , novartis , and roche , as well as speaker s fees from novartis .
Output:
| although offering many benefits for several psychiatric disorders , antipsychotic drugs ( apds ) as a class have a major liability in their tendency to promote adiposity , obesity , and metabolic dysregulation in an already metabolically vulnerable population .
the past decade has witnessed substantial research aimed at investigating the mechanisms of these adverse effects and mitigating them . on july 11 and 12 , 2011 , with support from 2 nih institutes , leading experts convened to discuss current research findings and to consider future research strategies .
five areas where significant advances are being made emerged from the conference : ( 1 ) methodological issues in the study of apd effects ; ( 2 ) unique characteristics and needs of pediatric patients ; ( 3 ) genetic components underlying susceptibility to apd - induced metabolic effects ; ( 4 ) apd effects on weight gain and adiposity in relation to their acute effects on glucose regulation and diabetes risk ; and ( 5 ) the utility of behavioral , dietary , and pharmacological interventions in mitigating apd - induced metabolic side effects .
this paper summarizes the major conclusions and important supporting data from the meeting . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.