id
stringlengths 11
16
| query
stringlengths 279
826k
| answer
stringlengths 174
4.34k
|
|---|---|---|
PubmedSumm6800 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the treatment of complicated crown - root fractures in many cases is compromised by tooth fractures that are well below the gingival margin or bone . after root canal obturation ,
proper isolation for a dry operation field is critical for successful restoration of traumatized teeth . in this respect ,
a wide range of treatment options have been advocated for traumatic permanent teeth include ; orthodontic extrusion1 osteotomy / osteoplasty2 intentional replantation3 re - attachment of fragments4 re - attachment of a tooth fragment should be preferable to restoring fractured teeth .
there are several advantages in this treatment such as obtaining esthetic in a single appointment , being more conservative procedure , obtaining healthy periodontal attachment and it maintains the original tooth contours and translucence as the patient s own.5,6 the present case report describes the re - attachment of an original tooth fragment using a glass fiber post .
a 32-year - old male patient was referred to the endodontic clinic of the faculty of dentistry , s. demirel university , with the complaint of a fractured right maxillary incisor tooth because of a trauma .
the patient related pain during breathing and bleeding through the line of fracture ( figure 1 ) .
the clinical and radiographic examinations showed an oblique crown - root fracture in the maxillary right central incisor involved the enamel
root canal pulp extirpation and canal preparation was performed using the standard step - back method .
the prepared teeth were dried with paper - points ( dentsply maillefer , tulsa , ok ) and filled with laterally condensed gutta - percha ( diadent group international inc . , chongju , korea ) and sealapex ( kerr , manufacturing co. , romulus , mi ) root canal sealer .
after sealer set , the gutta - percha was partially removed from the root canal using heated instrument , leaving 5 mm of the filling material at the apex to maintain a good sealing .
a post hole within root and coronal fragment was prepared using a drill recommended by manufacturer ( carbotech , ganges , france ) . a glass fiber post ( snowpost , carbotech , ganges , france ) was cemented within root canal with dual adhesive cement ( variolink ii , ivoclar vivadent , schaan , liechtenstein ) .
after taking his consent , full thickness buccolingual mucoperiostal flap was raised with an intrasulcular incision ( figure 3 ) .
after all debris on the fractured root surface was scaled , washed away with sterile serum physiologic and dried .
a primer ( kuraray co. ltd , osaka , japan ) was applied onto the fractured surfaces of the tooth fragments for 20 second .
clearfil se ( kuraray co. ltd , osaka , japan ) bonding agent was applied to the primed surfaces of the fragments and light cured for 10 second .
the fragments were reattached with a composite resin ( clearfil ap - x , kuraray co. ltd , osaka , japan ) .
the excess resin was removed with an excavator and the crown was light cured for 40 seconds from both buccal and palatal aspects .
final polishing of the crown - root interface was made with ultrafine diamond burs and polishing disks .
one week later , the sutures were removed and clinical examination was revealed proper healing ( figure 5 ) .
one month later , the clinical and radiographic examinations revealed a stable reattachment of the crown fragment ( figure 6 ) .
after 12 months , clinical and radiographic examinations showed a stable reattachment of the fragments , good aesthetics and periodontal health ( figures 7 and 8) .
the present case report described that tooth fragment reattachment is an alternative to composite resin build - up for restoring esthetics and function of oblique fractured teeth . up to date
, a lot of different approaches were proposed for treatment of fractured teeth depending on location of the fracture.7 one of the options for managing coronal tooth fractures is the reattachment of the dental fragment.4 re - attachment of fragments offers a good esthetic , less time - consuming and cost - effective restorative option .
contemporary resin adhesives and resin post systems that allow strong durable bonds to dentin enhance this option.8,9 in this case , a glass fiber post was used to retain the coronal segment and reduce the stress on the luting material .
the post interlocks the two separate fragments and minimizes the stress on the remaining tooth structure.7,10 the re - attachment of a tooth fragment is a viable technique that restores function and esthetics with a very conservative approach , but for each trauma case should be attempted to restore on an individual basis .
Output:
| this case report presents a 32 year old male with an oblique fractured maxillary right central incisor . the procedure used to repair the fracture included flap surgery with an intrasulcular incision and endodontic treatment .
the root canal was filled with a root canal sealer and gutta - percha .
after root canal obturation , fragments were luted with composite resin using a glass fibers post .
after 12 months , clinical and radiographic examinations showed a stable reattachment of the fragments , good aesthetics and periodontal health .
( eur j dent 2008;2:138141 ) |
PubmedSumm6801 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: mice with lesch - nyhan syndrome interpret all information as aggression , to which they respond by defensive aggression . in this x - chromosome
linked recessive syndrome , there is a deficiency of the enzyme hypoxanthlne guanine phosphorlbosyl transferase ( hprt ) , which does not degrade uric acid properly . in these conditions ,
the basal ganglia and the amygdala can be permanently activated by too much uric acid , an otherwise useful antioxidant .
this is a clear instance of a mood disturbance being induced by an endogenous substance .
another chromosomal abnormality , down 's syndrome , which is common in monkeys , induces a very different development , where the affected animal is easygoing and behaves like a superbaby .
the first example , among many others , reminds us how mood states are sometimes massively shaped by the biology of the brain , independently of the environment .
however , the example below illustrates how the environment interacts with the genes . in his paradigmatic protocol from the early 1960s ,
harlow used partial or total sensory deprivation and showed that this induced severe developmental disturbances .
eight very young rhesus monkeys were separated from their mother and raised in isolation in cages containing two surrogate mothers : one made of wire incorporating a nipple that gave milk ; the other covered in terry cloth with no nipple , thus giving no milk . at each stress , in the form of mechanical teddy bear beating a drum , the baby monkeys were startled and leapt for reassurance onto the terry - cloth mother .
as soon as they made contact with this secure base , the monkeys lost their anxiety .
but , in the absence of the terry - cloth mother , they would run in every direction , whimper , and stop eating or sleeping . in summary , they were soothed by contact with the soft mother surrogate and panicstricken in its absence .
although most baby rhesus monkeys are impaired in their development , some even fatally , a few pursue their growth as if they had no need of the secure base of a mother .
monkeys with the short form of the 5-hydroxytryptamine ( serotonin , 5-ht ) transporter ( 5-htt ) gene appear less able to cope with inadequate mothering .
those with the long form of the 5-htt allele , on the other hand , do not experience the inadequate mothering as a deprivation or as a cause for anxiety , and they continue their normal development .
the long form of the 5-htt allele leads to the synthesis of more 5-ht in the synapses and interstitial fluid .
these observations are synchronic , meaning that they refer to a single point in time .
the same maternal falling plunges the baby monkey with the short form of the 5-htt allele into mood disturbances , but the baby monkey with the long form of the 5-htt allele will not experience the same information as a loss .
i perceive defective mothering that impairs my mood , would say one baby monkey ; while another would say i perceive the same defective mothering , but it makes me seek out a sensory surrogate in my environment to maintain my peace of mind . the changes in physiological regulation ( homeostasis ) that occur with mood changes
this diachronlc dimension reveals that , through repetition of a given interpretation of the sensory information , the monkey with the short form of the 5-htt allele eventually develops a distinctive style of existence .
every encounter involves trauma and this monkey avoids socializing play and experiences all unexpected information as an alarm , often responding by fight or flight ; its path in life is littered with emotional alerts , dazed mood , and interaction difficulties .
thus , when a vulnerable baby monkey is raised by a competent mother , it acquires a style of attachment that is secure , calm , and confident . an environment with stable developmental tutors enables it to mature in security with a decline in vulnerability . on the other hand , a baby monkey with the long form of the 5-htt allele , although less vulnerable to emotional loss , may have developmental difficulties in an overstable environment .
a female rat stressed during the last part of pregnancy will give birth to a litter with durable increased biological correlates of stress , such as enhanced cortlcosterone secretion .
all these results from studies in observational and experimental ethology suggest that the same genetic pattern can produce emotional vulnerability in an unstable setting or emotional strength in a stable setting .
this model can also be applied to the development of children . at the embryonic stage ,
as its memory develops , the baby manifests habituation in the cognitive sense of the term , in that it decreases its response to tactile or auditory inputs that have become familiar through repetition .
the emergence of memory has made it possible for a present perception to be modified byor aftercomparison with a similar perception from the past .
absence of appropriate sensory stimulation during this stage of intense fetal neuronal and synaptic development could impair the organization of information circuits .
after birth and during the first years of life , this could lead to a failure to give a form to the perceived world , and to the fact that all information is flagged with an alert status because it does not fit into a circuit that would permit an appropriate response .
all information , even if purely physiological , thus becomes a stressor . in 1946 ,
clinical neurologists observed a very high frequency of frontal lobe and limbic system atrophy in the gas encephalograms of holocaust survivors , which they explained by a vitamin deficiency according to the scientific myth prevailing at the time .
after the fall of the iron curtain in 1989 , computed tomography scans of romanian orphans institutionalized under catastrophic conditions of sensory deprivation demonstrated the same frontal lobe and limbic system atrophy . on this occasion , however , the prevailing scientific interpretation took ethology into account , and this sometimes massive cerebral atrophy was attributed to sensory deprivation .
modern neurobiology can now describe stages and conditions of nervous system development where given stimuli can result in atrophy , normality , or repair .
to take the example of light - deprived kittens , sensory deprivation abolishes traffic across physiological synaptic pathways .
not only does the corresponding brain area then fail to develop the dendrites that would normally have filled their allotted space , but also any subsequent visual physiological stimulus and information will be interpreted as a stress . with functional imaging techniques ,
one observes that these light - deprived kittens , when later exposed to visual stimuli , have a profusion of occipital neuron activation , despite failing to process the visual information properly in contrast , when a neuronal circuit has been adequately trained by the repetition of normal sensory stimulation , it can handle information at a lower energy cost , le , neurons are not overly activated .
emotional deprivation might have toxic effects on brain development that make the individual more or less incapable of processing emotional information .
even the banal and everyday fact of being touched by another person or a simple glance or word unleashes aggression .
affected children bite themselves when somebody smiles at them or bang their head on the floor when somebody looks at them .
the interpretation of these sensory stimuli as being threats to oneself is accompanied by an increase in secretion of glucocorticoids .
this might lead to neuronal damage and death , in particular in the pyramidal cells of the ca3 area in the hippocampus . during the early phases of the dazzlingly fast development of the brain ,
external information can participate in dendrite formation : an environment of sensory impoverishment substantially decreases brain mass in the area of the hippocampus .
a large number of other factors also influence brain maturation . some of these factors are physical , such as the secretion of hormones .
for example in 1057 people followed from birth to the age of 26 years , neither life stress nor the polymorphism of the 5-htt alone was able to predict the occurrence of a major depressive episode .
however , the combination of a high load in life stressors and having the short form of the 5-htt allele did serve as a predictor . stress had no influence on people who had the long form of the 5-htt allele .
this suggests that the 5-htt polymorphism determines the taste of the world for the individual as well as temperamental dispositions , such as harm avoidance .
other factors are social and cultural , for example , the beliefs or myths about how to best take care of newborn babies and children .
imprinting is a process readily observed in nature and equally readily demonstrated in the laboratory .
it differs from other forms of learning by becoming established with great rapidity at a very early stage in development . at a particular time and
a sensitive stage in its growth , the body becomes highly sensitive to all external information reaching it . in this way ,
auditory , olfactory , or visual objects become imprinted in memory , in the limbic system , sensitizing the individual preferentially to a type of information . from then on , it is with heightened sensitivity that the individual perceives a particular maternal body languageor a song , intonation , landscape , or smellbecause this sensory object for the individual stands out from all others . from this stage of development onwards ,
the individual 's world is categorized into hyperfamillar imprinted objects , which induce a feeling of security that allows him or her to explore the environment and hence lead to other forms of learning . by contrast , in a world deprived of imprinted objects , the individual experiences all information as aggression .
he or she responds with alert reactions ( discharge of catecholamines and cortisol ; cerebral arousal ) and disorganized fight or flight behavior .
the plasticity of the human nervous system , the length of its development , makes it impossible to speak of imprinting in humans .
this does not exclude astonishing receptivity in the early years and a huge potential for rapid learning .
moreover , an apparently identical external fact could have completely different effects , depending on the development stage and the memories already acquired . although one can not talk of imprinting in the sense of the early and automatic affiliation that was studied by konrad lorenz
these phases , together with the keen memory of humans , explain why early interaction could mold temperaments , through incorporation into implicit memory of preferential sensitivity ( the taste of perception ) and relationship skill ( the style of attachment ) .
the imprinting of sensory objects thus tailors the nervous system to perceive a particular type of world , select certain items of information , and create a personal representation of oneself interacting with others .
several lines of research show that the experiences and the environment encountered during critical periods of development can lead to long - term changes in the expression of the genome .
for example , female rats who lick their newborn offspring more often during the first week of life induce in them a lesser responsivity to stressors , lasting into adulthood .
these behavioral changes are accompanied by a higher number of glucocorticoid receptors in the hippocampus due to an epigenetlc modification of a transcription factor of this receptor .
the above facts could induce resignation ( we are the puppets of our genes and environment ; we are molded by our experiences ) , were there not the option of reworking our representation through speech .
how we talk about our past , and the stories we tell ourselves about our present and our future , reflect our feelings and emotions
. the same facts can induce different feelings because each person has a different history , and does not attribute the same emotion to the same verbal representation .
the fact that the emotional response to the same story differs between listeners invites the speaker to make the effort of empathy , by which he or she looks at himself or herself from the outside .
this use of speechthis rhetoricexpresses the emotions of the inner world , organizes the behavioral consequences of these emotions , and thus explains the possibility of mental transmission . between molecular biology on the one hand and emotion - structuring speech on the other
, mood stands at a confluence of determinants , and is subject to modification by each .
Output:
| the insights of ethologythe science of animal behavior from a biological and psychological point of viewwere incorporated in the 1950s by the british developmental psychiatrist , john bowlby , into his attachment theory which argued that a secure affective base in infancy was critical to the normal development of perception , cognition , learning , and emotion , in addition to that of physical parameters .
the theory was illustrated by harlow 's pioneering experiments with baby monkeys : those raised with a wire - frame mother failed to thrive , compared with the more normal development of those deriving comfort contact from a terry - cloth surrogate .
modern neuroscience techniques have confirmed that the absence of sensory stimulation during periods of maximal synaptic expansion provides the substrate for a subsequent mood disorder , ethology offers a novel nature plus nurture approach to the development of abnormal mood , as well as a target for treatment . |
PubmedSumm6802 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: advances in 3d printing technology have made their applications in biomedical sciences a cost effective option in designing customized solutions . among the different techniques of 3d printing technology , stereolithography
is currently recognized to be one of the most common and accurate rapid prototyping techniques . this remarkable advantage in terms of resolution and precision
a major advantage in such custom designing is the ability to create structures with desired mechanical properties . of interest
are scaffolds with gyroid pore architectures designed by trigonometric equation with modulation of the pore size and prepared by stereolithography technique using a resin based on poly(trimethylene carbonate ) ( ptmc ) .
ptmc is known as a flexible and amorphous material which can degrade enzymatically by surface erosion .
its excellent properties make it possible to maintain mechanical properties of ptmc over degradation time , as the average molar mass remains constant .
in addition , the remarkable potential of ptmc - based scaffolds prepared by stereolithography in cell adhesion and proliferation was recently demonstrated [ 3 , 16 ] . when designing scaffolds with customized mechanical properties , the characteristics of the bulk material are taken into consideration .
however if the scaffolds have microstructures , any deviation from the bulk properties due to the heat extrusion process can potentially have significant effect on the micro - structural properties .
thus it becomes prudent to verify the mechanical behaviour of the scaffold under mechanical loads with respect to the simulated design .
any such verification process would involve gathering the structural geometry of a printed scaffold product , such as through tomographic imaging techniques [ 9 , 15 ] .
the novel method of characterising deformation for printed constructs is gaining ground and being increasingly used on products of various materials [ 1 , 11 ] .
such methods have not been applied on mathematically designed ptmc constructs to date and this study was designed to address this issue . in this study , ptmc scaffolds with 3 different designs produced by stereolithography were imaged in a ct device with in - situ mechanical deformation .
the scaffolds were designed such that the overall porosity was similar among the scaffolds . employing image based
analysis methods with image registration using triangular surface meshes , the deformation in the microstructure of the scaffolds was calculated and analysed .
the scaffolds were designed in and modelled in rhinoceros 3d ( robert mcneel & assoc . , usa ) and k3dsurf ( freeware ; http://k3dsurf.sourceforge.net ) . from a trigonometric function ( equation 1 ) ,
the software is able to generate cad - file that describes a gyroid surface architecture .
( 1)cos(x)*sin(y)+cos(y)*sin(z)+cos(z)*sin(x)=c
the different scaffolds investigated in this work were designed to have a fixed porosity around 72% , but different pore sizes and surface area .
the features of the investigated scaffolds are described in table 1 . by modulating the value of the constant c in the equation 1 , the pore characteristics such as the volume fraction and the pore size can be modulated . for this work
the value of the constant ( table 1 ) was determined to result in a porosity as close to the target ( 72% ) as possible .
the boundary conditions indicate the periodic repetition of the gyroid channel numbers that are present in the scaffolds . in this case , the scaffolds had a cubic shape as the number of gyroid channels was the same in the x , y and z axes .
briefly , the ring opening polymerization was achieved by reaction mixture of trimethylene carbonate monomer ( 0.98 mol , 100 g ; foryou medical , china ) , with stannous octanoate ( 0.05 wt% ; sigma - aldrich , germany ) as a catalyst and 1,1,1-tris(hydroxymethyl)propane ( tmp ) ( 0.0196 mol , 2.62 g ; sigma - aldrich , germany ) as an initiator , under stirring for 3 days at 130c in argon atmosphere .
proton nuclear magnetic resonance ( h - nmr , 300 mhz ) was used to determine the conversion rate and the number averaged molecular weight ( mn ) of the macromer . the second step of the resin preparation consisted of end - functionalization of the macromer by reactive methacrylate groups .
the reaction was performed in dichloromethane ( 100 ml ) solution by addition of methacrylic anhydride ( 94% ) in excess ( 0.176 mol ; 26 ml ; sigma - aldrich , germany ) at room temperature under argon atmosphere for 5 days .
the resin formulation was prepared by dissolution of the macromer in 30% of propylene carbonate solvent in presence of photo - initiator lucirin tpo - l ( 5 wt% ; basf , germany ) and orasol orange dye ( 0.15 wt% ; ciba specialty chemicals , switzerland ) in order to control the blue light penetration ( 400550 nm ) .
once the resin synthesized , the scaffolds were built using stereolithograph apparatus ( perfactory minimultilens , envisiontec inc .
, usa ) at a pixel resolution of 1616m and a layer thickness of 25m .
the irradiation time for solidifying each layer was fixed at 40 s for a light intensity of 20 mw / cm .
a mechanical compression device was fabricated to be used in conjunction with an xradia high - resolution ct device ( xradia xct400 , zeiss , germany ) ( fig . 1 ) .
the compression of a sample was performed by mechanically moving the top piston with the stationary bottom piston acting as a sample stage .
the top piston assembly ( 80 gms ) was screwed - in until it was resting on the sample and the position was fixed , thus providing an initial static loading force in the range of 0.80.1 n. in keeping with the scope of the study , the applied forces were not monitored .
subsequent to sample loading the pre and post compression tomographic image volumes were obtained . the imaging parameters ( table 2 ) were set similarly for all 3 samples . as the samples were of a single phase material with a low attenuation , filters were not required .
the reconstructed image volumes obtained from the ct device were imported into avizo image processing software ( vsg / fei , mrignac cedex , france ) .
the software is able to directly load the native file format ( txm ) from the xradia device .
thus all global coordinate positions with respect to the sample within the instrument were transferred forward in the analysis procedures .
subsequent to non - local means filtering to improve the signal to noise ratio , the image volumes were segmented using simple thresholding procedures . as the samples were of a homogenous material exhibiting high contrast with respect to the background ,
morphological methods were used to smooth and fill any speckles in the segmented region ; the closed surface of the labelled volume was subsequently extracted in avizo and simplified , smoothed and cleaned ( fig . 2 ) .
the triangular surface meshes of the corresponding pre and post compression samples were registered using iterative closest point ( icp ) algorithm with affine transformation .
the deformation of the scaffold under unidirectional compression loads was analysed by tracking the surface points of the pre - compression surface nodes when registered to the post - load scaffold surface .
the samples in this study exhibited geometric structures and were subjected to simple uni - axial deformation .
thus the global registration employed was sufficient for the study purposes to extract deformation values of the sample .
the registration algorithm was iterated until it reached the lowest possible root mean square ( rms ) error value with affine transformations .
subsequent to registration , the vertex positional differences were defined as the deformation at corresponding vertices . as the compression
was applied axially ( -z direction of the global axes ) , the deformation on axial planes was calculated by averaging the deformation of all vertices lying on the plane .
this value succinctly presented the distribution of deformation given in its corresponding 3d visualization . in order to visualize any deviation from an expected linear behaviour ,
the z - component of the deformation vector was subtracted from a linear deformation model .
the model assumes linear deformation along the z - axis starting with the maximum observed z - component deformation on the top surface and 0 on the bottom resting surface .
the remaining x and y - components were combined to visualize any variation within the plane of deformation along a given z - axis location .
the scaffolds were designed in and modelled in rhinoceros 3d ( robert mcneel & assoc . , usa ) and k3dsurf ( freeware ; http://k3dsurf.sourceforge.net ) . from a trigonometric function ( equation 1 ) ,
the software is able to generate cad - file that describes a gyroid surface architecture .
( 1)cos(x)*sin(y)+cos(y)*sin(z)+cos(z)*sin(x)=c
the different scaffolds investigated in this work were designed to have a fixed porosity around 72% , but different pore sizes and surface area .
the features of the investigated scaffolds are described in table 1 . by modulating the value of the constant c in the equation 1 , the pore characteristics such as the volume fraction and the pore size can be modulated . for this work
the value of the constant ( table 1 ) was determined to result in a porosity as close to the target ( 72% ) as possible .
the boundary conditions indicate the periodic repetition of the gyroid channel numbers that are present in the scaffolds . in this case , the scaffolds had a cubic shape as the number of gyroid channels was the same in the x , y and z axes .
briefly , the ring opening polymerization was achieved by reaction mixture of trimethylene carbonate monomer ( 0.98 mol , 100 g ; foryou medical , china ) , with stannous octanoate ( 0.05 wt% ; sigma - aldrich , germany ) as a catalyst and 1,1,1-tris(hydroxymethyl)propane ( tmp ) ( 0.0196 mol , 2.62 g ; sigma - aldrich , germany ) as an initiator , under stirring for 3 days at 130c in argon atmosphere .
proton nuclear magnetic resonance ( h - nmr , 300 mhz ) was used to determine the conversion rate and the number averaged molecular weight ( mn ) of the macromer . the second step of the resin preparation consisted of end - functionalization of the macromer by reactive methacrylate groups .
the reaction was performed in dichloromethane ( 100 ml ) solution by addition of methacrylic anhydride ( 94% ) in excess ( 0.176 mol ; 26 ml ; sigma - aldrich , germany ) at room temperature under argon atmosphere for 5 days .
the resin formulation was prepared by dissolution of the macromer in 30% of propylene carbonate solvent in presence of photo - initiator lucirin tpo - l ( 5 wt% ; basf , germany ) and orasol orange dye ( 0.15 wt% ; ciba specialty chemicals , switzerland ) in order to control the blue light penetration ( 400550 nm ) .
once the resin synthesized , the scaffolds were built using stereolithograph apparatus ( perfactory minimultilens , envisiontec inc .
, usa ) at a pixel resolution of 1616m and a layer thickness of 25m .
the irradiation time for solidifying each layer was fixed at 40 s for a light intensity of 20 mw / cm .
a mechanical compression device was fabricated to be used in conjunction with an xradia high - resolution ct device ( xradia xct400 , zeiss , germany ) ( fig . 1 ) .
the compression of a sample was performed by mechanically moving the top piston with the stationary bottom piston acting as a sample stage .
the top piston assembly ( 80 gms ) was screwed - in until it was resting on the sample and the position was fixed , thus providing an initial static loading force in the range of 0.80.1 n. in keeping with the scope of the study , the applied forces were not monitored .
subsequent to sample loading the pre and post compression tomographic image volumes were obtained . the imaging parameters ( table 2 ) were set similarly for all 3 samples . as the samples were of a single phase material with a low attenuation , filters were not required .
the reconstructed image volumes obtained from the ct device were imported into avizo image processing software ( vsg / fei , mrignac cedex , france ) . the software is able to directly load the native file format ( txm ) from the xradia device .
thus all global coordinate positions with respect to the sample within the instrument were transferred forward in the analysis procedures .
subsequent to non - local means filtering to improve the signal to noise ratio , the image volumes were segmented using simple thresholding procedures . as the samples were of a homogenous material exhibiting high contrast with respect to the background ,
morphological methods were used to smooth and fill any speckles in the segmented region ; the closed surface of the labelled volume was subsequently extracted in avizo and simplified , smoothed and cleaned ( fig . 2 ) .
the triangular surface meshes of the corresponding pre and post compression samples were registered using iterative closest point ( icp ) algorithm with affine transformation .
the deformation of the scaffold under unidirectional compression loads was analysed by tracking the surface points of the pre - compression surface nodes when registered to the post - load scaffold surface .
the samples in this study exhibited geometric structures and were subjected to simple uni - axial deformation .
thus the global registration employed was sufficient for the study purposes to extract deformation values of the sample .
the registration algorithm was iterated until it reached the lowest possible root mean square ( rms ) error value with affine transformations .
subsequent to registration , the vertex positional differences were defined as the deformation at corresponding vertices . as the compression
was applied axially ( -z direction of the global axes ) , the deformation on axial planes was calculated by averaging the deformation of all vertices lying on the plane .
this value succinctly presented the distribution of deformation given in its corresponding 3d visualization . in order to visualize any deviation from an expected linear behaviour ,
the z - component of the deformation vector was subtracted from a linear deformation model .
the model assumes linear deformation along the z - axis starting with the maximum observed z - component deformation on the top surface and 0 on the bottom resting surface .
the remaining x and y - components were combined to visualize any variation within the plane of deformation along a given z - axis location .
the maximum deformations applied to the 3 scaffold designs , measured from the images , were : 83812m ( scaffold 1 ) , 65712m ( scaffold 2 ) and 63612m ( scaffold 3 ) .
the segmentation procedure gave good results when viewed visually , in part due to the high contrast and high resolution of the reconstructed images .
the surface mesh representation was limited to 400 k faces , which was deemed adequate to represent the sample features and return acceptable execution times for the various image analysis tasks ( fig .
the rms errors for each of the samples were in the range of 2535 m ( 23 pixels in image data ) , indicating an acceptable registration given the scope of this study ( fig .
the direction of deformation and the corresponding magnitudes at each node when plotted over the sample surface mesh showed consistent patterns with no clearly observable anomalies .
an example of this visualization is presented in fig . 4 for scaffold b. for each of the 3 scaffold designs tested , the residual z - component deformations were present ( < 100 m ) that consistently indicated an axis of deformation that is not perfectly aligned with the z - axis .
to aid in grasping an intuitive understanding of the results , deformation magnitudes at mesh nodes were plotted against their axial dimension ( z axis ; direction of applied deformation ) ( fig .
thus , all nodes located on the same axial plane are indexed on the horizontal axis of the plots , starting from 0 ( sample bottom , resting on stage ) to ( 5000 m ( sample top ) .
the resulting scatter plot was averaged with respect to position along the horizontal axis . the distribution of vertex deformations around the average value ( fig .
5a c blue line ) showed an increased spread with increasing magnitudes of applied deformation .
however , for each scaffold design , the spread around the average value on the axial planes remains largely stable along its axial length .
this study demonstrated a novel in - situ imaging and image based deformation analysis procedure for analysing the structural response of ptmc scaffolds under compression .
the results indicate that the different scaffold designs exhibit a linear distribution in deformation throughout the inner structure . for scaffold
a which was subjected to the largest deformation , the structures at the bottom contact face showed a greater spread in the deformation values ( fig .
this was expected , as with increasing deformations , the individual unattached micro - struts at the boundary deform notably .
these structures at the boundary may not be complete due to their location in the design , leading to variation in deformation response . additionally from the residual z - component and xy - component images ( fig .
4b and c ) , it is evident that the compressing head was applied at a slightly inclined angle .
this would result in the applied deformation not being strictly perpendicular to the top surface of the sample .
hence the spread around the mean in the deformation plots in this study ( fig .
5 ) can be explained by two factors the expected variation in deformation within the xy - plane due to sample incompressibility and the effect of a deformation applied at a small angle to the z - axis instead of being exactly along it .
5b and c ) are also likely due to the incomplete printed structures at the sample boundary .
thus , these outliers and variations can be reasonably explained by the difference in the interconnectivity of the scaffold structure internally and on the boundaries .
when studying the performance of scaffold designs within their prospective biological environment , the size and distribution of pores have a direct bearing on the proliferation of the embedded cells . in a mechano - biological environment
, loads may be transmitted through the material matrix to the embedded cells within the scaffold
. thus it would be reasonable to assume that the structural response of the scaffolds to the loads may also have an influence on cell proliferation [ 5 , 17 ] . with various materials available for 3d printing and the numerous designs implemented
, structural verification of prototypes can be used to optimize the criteria for a selected scaffold design for a particular application .
this optimization may be critical in some cases where the design has to be a trade - off between structural support for tissue regeneration and stimulus for cell differentiation or proliferation .
the methodology described in this study serves in displaying the value in imaging and image analysis based verification of structural response of scaffolds .
the analysis includes registration of the 3d image sets of non - deformed data to the deformed data .
the registration of data was performed to track the deformation of only the surface of the sample which was segmented from the images and the represented as triangular surface meshes . in combination with high resolution image data ( ( 25 m ) and relatively large sample sizes ( up to 101010 mm , at this resolution ) , it is possible to image deformations at sub - pore resolutions .
various modifications of this algorithm assist in working with or observing the feature set of interest with higher resulting accuracy .
however , this initial study also brings to fore issues that will need to be addressed for accurate characterisation of such printed structures . in this
study the deformation device was a simple fabrication where movement of the piston was performed by a manual screw setup .
this results in loads effecting varied deformation magnitudes in our experiment ( 0.80.1 n ) , hindering direct comparison of scaffold design based on deformations .
this was mitigated in the analysis by calculating these deformations accurately from the high resolution images . in terms of the analysis procedure ,
thus for validation studies , high performance registration methods are called for , which result in residual errors at least lower than the resolution of the imaging ( 25 m in this study ) [ 8 , 10 ] . in the future
, an improved fabrication of the deformation device with force monitoring will be used in a systematic study for scaffold characterisation .
importantly , features reflecting functional performance of scaffolds such as porosity and the corresponding flow characteristics within the structure will need to be studied . however , in its current form , the deformation instrument and the image based analysis provide valuable insight into the mechanical characteristics of the scaffolds . in conclusion ,
ct based imaging with in - situ deformation and subsequent extraction of mechanically relevant features provides a vital tool in validating the design parameters and corroborating the simulated ideal design with the realized product .
Output:
| abstract
background : advances in rapid - prototyping and 3d printing technologies have enhanced the possibilities in preparing designed architectures for tissue engineering applications . a major advantage in custom designing is the ability to create structures with desired mechanical properties . while the behaviour of a designed scaffold can be simulated using bulk material properties , it is important to verify the behaviour of a printed scaffold at the microstructure level .
objective : in this study we present an effective method in validating the mechanical behaviour of designed scaffolds using a ct with an in - situ mechanical deformation device .
methods : the scaffolds were prepared from biodegradable poly(trimethylene carbonate ) ( ptmc ) by stereolithography and images obtained using a high - resolution ct with 12.25m isometric voxels .
the data was processed ( filtering , segmentation ) and analysed ( surface generation , registration ) to extract relevant deformation features .
results : the computed local deformation fields , calculated at sub - pore resolutions , displayed expected linear behaviour within the scaffold along the compressions axis . on planes perpendicular to this axis , the deformations varied by 150 200m .
conclusions : ct based imaging with in - situ deformation provides a vital tool in validating the design parameters of printed scaffolds .
deformation fields obtained from micro - tomographic image volumes can serve to corroborate the simulated ideal design with the realized product . |
PubmedSumm6803 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: treatment with a cardiac implantable electronic device ( cied ) , including a permanent pacemaker ( ppm ) or implantable cardioverter
an icd is needed not only to rescue survivors of life - threating ventricular arrhythmias , but is also first - line primary prevention to save patients with marked cardiac dysfunction . moreover ,
medical technology for resynchronization therapy has advanced , with a resulting increased rate of device implantation , . along with the increase in device implantation ,
the incidence of cied infection , which can have serious or fatal complications , has also increased , , , , .
reported that a total of 3390 ( 1.7% ) out of 200,909 implanted icds developed a device infection within six months .
other studies have reported a similar rate of cied infection ( 0.72.2% ) , , , .
the management of infected cied patients is difficult , and requires special knowledge and effort by physicians .
intensive treatment of cied infections is recommended , including administration of appropriate antibiotics and complete removal of the infected device , , , , , , , , , , , , .
consensus reports and statements from the literature also recommend prompt and complete device removal in combination with antimicrobial therapy , , . in this article , we present the role of conservative therapy for the management of cied infection .
when cied infection is diagnosed , early complete removal of the infected device is strongly recommended because of the high association with increased mortality .
no prospective randomized studies have assessed the value of conservative antibiotic therapy alone , compared with combined complete device removal and administration of appropriate antibiotics .
however , some reports cited the poor outcome using conservative antibiotic therapy in patients with cied infection , .
about 30 years ago , lewis et al . reported on treatment of patients with permanent pacemaker infections .
thirty - two patients received conservative antibiotic therapy without removal of the infected pacing system , which included limited debridement and irrigation or aspiration of the infected sites .
this conservative therapy failed in all , but one of the 32 patients , and complete removal of the device system was needed in 31 .
molina et al . subsequently reported the outcome of management in 38 patients with an infected cied , including 17 icds .
twelve patients received intravenous antibiotics without removal of the cied , but with relocation to a different area , with or without aspiration of the infected area .
the remaining 26 cied patients who underwent primary removal of the entire device system were completely cured .
although complete removal of an infected cied is first - line therapy , there can be a risk of device removal complications .
it was reported that complications of device extraction were associated with increased mortality in patients with cied infections at both 30 days ( hazard ratio [ hr ] : 4.33 , 95% confidence interval [ ci ] : 1.4712.70 ) and one year ( hr : 3.77 , 95% ci : 1.887.55 ) .
however , delayed device removal was associated with a 3-fold increase in one - year mortality , and antibiotic therapy without device removal was associated with a 7-fold increase in 30-day mortality , compared to immediate device removal in the previous paper .
margey et al . also described outcomes and mortality in infected cied patients . of 39 ( 82% ) patients ,
32 underwent device extraction , and complete device removal was accomplished in 27 ( 84% ) .
of these , none relapsed , and mortality was 7.4% during a median follow - up period of 36 months .
of those managed with only generator removal or conservative therapy , relapse occurred in 8 of 12 ( 67% ) , with mortality occurring in 8.4% . using data on patients with infective endocarditis and a cardiac device , athan et al reported that 28 of 141 ( 19.9% ) who underwent device removal during the index hospitalization died at one year , compared with 13 of 34 ( 38.2% ) who did not undergo device removal ( hr : 0.42 , 95% ci : 0.220.82 ) , which suggested that device removal was associated with improved survival at one year .
some patients have severe complicated medical problems and are considered too ill to tolerate aggressive surgical intervention .
in addition , some patients refuse surgery , or have a limited life span . in such cases ,
successfully treated exposed pacemakers relocated to deeper subfascial planes without relapse of infectious signs in 10 patients .
they concluded that subfascial relocation of a properly functioning pacemaker generator should be considered as an alternative to complete replacement of the unit .
hurst et al . also reported that 19 infected or extruded pacemaker patients were treated with local debridement and insertion of a closed irrigation system using solutions of tyloxapol and tobramycin . in order to achieve successful treatment , they insisted on careful debridement of the infected pocket and large pocket space to ensure adequate closure without tension . using this method ,
they have been successful in salvaging infected pacemaker pockets , and all 19 patients healed without complications after treatment ( the maximum follow - up period was 70 months ) .
clinical data on 51 patients with intravascular device - related infections who were administered long - term suppressive antibiotic therapy were also reported .
the categories included vascular graft infections in 30 ( 59% ) patients , prosthetic valve endocarditis in 12 , pacemaker - related infections in 5 , aortic graft infections in 3 , central venous catheter infections in 3 , and venous filter infection in one .
of 41 followed - up patients , 3 ( 7% ) had an infection relapse while on long - term antibiotic therapy .
three patients died , including one who had an infection relapse and died of the infection .
the report stated that long - term antibiotic therapy was well - tolerated and efficacious in nonsurgical candidates .
reviewed 18 patients with infected orthopedic prostheses who had been treated with long - term antibiotic therapy .
although side effects related to antibiotics occurred in 22% , 15 ( 83% ) patients with a mean follow - up of 5 years had a good response to suppression of infection and could retain a functional prosthesis .
ortler et al . experienced the case of one epileptic patient implanted with an infected vagus nerve stimulator system who underwent successful open wound treatment without removal of the system .
they reported that the deep wound was initially opened and debrided . with continuous antibiotic therapy and daily rinsing with 3% hydrogen peroxide solution and 5% saline , granulation tissue gradually appeared . in this case ,
the value of local treatment with 3% hydrogen peroxide for prevention of foreign body infection has been previously reported .
of 990 cieds treated with 3% hydrogen peroxide during the implant procedure , 2 ( 0.2% ) developed an infection , which was a significantly reduced infection rate compared to that of cieds treated without hydrogen peroxide during implantation ( 1.83% , p<0.05 ) .
although conservative therapies might be useful in limited cases , retained infectious devices have a risk of mortality .
additionally , these papers were published more than 10 years ago , and medical technology has advanced since then .
the excimer laser has also been used for cied lead removal in many countries . if possible , initial complete hardware removal is strongly recommended , and the indications for conservative antibiotic therapy for cied infections should be determined with great caution .
in 2010 , satsu et al . reported the use of a vacuum - assisted wound closure ( vac ) system as an option for treating an infected device . the vac system is comprised of polyurethane foam with an evacuation tube , a vacuum pump , and adhesive drape .
treatment with vac has been reported to be an efficacious modality for chronic and difficult wounds , .
after opening the wound , the polyurethane is cut and positioned on the defect area , with connection of the evacuation tube .
the wound is then covered with an adhesive drape , and suction is continued with a negative pressure of 100 mmhg .
the wound is treated by changing the foam every 2 or 3 days until healing occurs , or the incision is sutured when granulation appears . according to this paper ,
infections never relapsed after treatment with vac in all 4 patients for 515 months , and cied infection healed without complete removal of the pacemaker system in 2 patients . in our hospital ,
the vac system is sometimes applied to a large wound after removal of the cardiac device system and debridement of the pocket ( fig .
according to the heart rhythm society expert consensus report , cied removal is not recommended for a superficial or incisional infection without involvement of the device or lead ( class iii indication ) ( fig .
2 ) . however , it is difficult to distinguish whether a superficial pocket infection might have extended through the device .
it was reported that the intravascular parts of leads yielded positive cultures in 79% of 105 study patients who had local pocket complications , which were associated with a risk of progression to systemic infection .
chamis et al . reported no local signs or symptoms related to pocket infection in 60% of patients ( 9 of 15 ) with confirmed cied infections .
when superficial or incisional infection of a cied occurs , conservative antibiotic therapy may be administered as needed , and the patient should be closely followed for progression to a deeper infection , which would require extraction .
computed tomography ( fdg - pet / ct ) could diagnose cied infections , . in some suspected cied cases
, this new imaging modality may be useful in differentiating a superficial from a systemic infection , and may lead to appropriate therapy .
although several successful conservative therapies for cied infection have been reported , retained infectious devices remain a source of relapse , which is closely related to a higher mortality rate .
presently , complete hardware removal is initially recommended for infected cied patients , and the indication of conservative therapy for cied infections should be determined with great caution
Output:
| along with the increased frequency of implantation , the incidence of cardiac implantable electronic device ( cied ) infection , which can have serious or fatal complications , has also increased .
although several successful conservative therapies for cied infection have been reported , retained infected devices remain a source of relapse , which is closely related to a higher mortality rate .
presently , complete hardware removal is initially recommended for infected cied patients , and indications for conservative therapy , including continuous administration of antibiotics , require careful consideration.on the other hand , complete removal is not required for superficial or incisional infection at the device pocket if an infection does not involve the device , but the patient should be closely followed for progression to deeper infection , which would require extraction . |
PubmedSumm6804 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: we obtained data regarding temporal trends in fri incidence from military sentinel surveillance , which has been monitoring weekly fri rates since october 2011 .
monthly numbers of patients with pneumonia ( inpatients , outpatients , and emergency room patients ) were extracted from a computerized data warehouse that stores data from all military hospitals .
we identified pneumonia cases by using the international classification of diseases and related health problems , 10th revision , codes j12j18 .
the influenza season , which starts in october and ends the following may , was used as a surrogate for the hadv season in this study .
the trends in fri rates showed an unusual surge during the 201415 influenza season ( figure 1 , panel a ) .
the fri rate increased for 15 weeks in the 201415 season , compared with 10 weeks in the 201213 season and 5 weeks in the 201314 season .
peak fri rate in the 201415 season ( 10.4% ) was higher than rates in the preceding 2 seasons ( 4.7% and 7.5% ) .
the numbers of pneumonia cases in 201415 and 201516 seasons were 3,140 and 3,145 patients , respectively , a 191% increase from the mean number during 3 preceding seasons .
a ) weekly febrile respiratory illness ( fri ) rate ( solid line ) and monthly number of pneumonia patients ( dashed line ) in the south korea military , 20112016 .
b ) positive rate of human adenovirus from respiratory specimens ( red line ) and the number of respiratory virus pcr requested ( blue bar ) from a tertiary military hospital , south korea , 20142016 . the rate and number for each month
a multiplex real - time pcr for identifying 15 viruses from respiratory specimens was introduced at the armed forces capital hospital , the only tertiary hospital in the south korea military health care system ( detailed methods in technical appendix ) .
a total of 1,484 nonduplicate specimens were tested by the end of may 2016 ( figure 1 , panel b ; technical appendix table 1 , figure ) .
hadv was identified in 490 ( 33.0% ) of total specimens , and it accounted for 79.7% ( 282/354 ) and 53.2% ( 150/282 ) of positive results in the 201415 and 201516 seasons , respectively .
we reviewed the demographic and clinical information of 878 military patients with fri or pneumonia who were tested for respiratory viruses from october 2014 through may 2016 ( tables 1 , 2 ) .
soldiers of lower rank were markedly more likely to infected with hadv ; soldiers serving in the air force were less likely .
patients who had been referred from other hospitals were twice as likely to be hadv - infected than patients who visited the armed forces capital hospital directly .
rhinorrhea , sore throat , diarrhea , and nausea / vomiting were more common in patients with hadv infection .
the proportion of patients with pneumonia and the hospitalization rate did not differ between those with and without hadv infection .
however , hadv - infected patients had a significantly higher risk of requiring intensive care or mechanical ventilator support . in the hadv - infected group ,
8 patients required intubation and 1 died ; no one in the noninfected group died or required intubation .
length of hospital stay was also significantly longer among those the hadv - infected group than among those in the noninfected group ( 12.6 vs. 9.4 days ) .
hadv , human adenovirus ; na , not available ; or , odds ratio ; pfc , private first class .
hadv , human adenovirus ; na , not available ; or , odds ratio.n = 877 .
we conducted molecular typing by the sequencing of hexon and fiber genes with 74 hadv - positive respiratory specimens collected from march through june 2016 ( methods and general characteristics of the patients are available in the technical appendix table 2 ) . among them , 49 samples were successfully sequenced ( genbank numbers in online technical appendix ) .
phylogenetic analyses showed that all 49 hadv strains from south korea clustered with hadv-55 strains from china , singapore , taiwan , spain , and the united states ( figure 2 ) .
phylogenetic analysis of human adenoviruses based on the partial nucleotide sequences of hexon ( a ) and fiber ( b ) genes , south korea , 2016 .
phylogenetic trees were generated by the neighbor - joining method , using the kimura 2-parameter method .
the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test ( 1,000 replicates ) are shown next to the branches .
hadv is a well - known major cause of fri in the military , accounting for > 50% of fri and pneumonia cases in military recruits ( 1 ) .
our study also confirmed the predominance of hadv , which was identified in 49.1% of specimens from patients with fri or pneumonia .
these findings are similar to those of previous studies from south korea and the united states ( 9,10 ) .
the most notable finding of our study is the emergence of hadv-55 in the south korea military .
hadv-55 is a novel type that has been associated with a severe clinical course and death in healthy young adults ( 7,8 ) .
we also found that hadv infection was associated with intensive care , mechanical ventilator support , and longer hospital stay .
in addition , we found that the only patient who died was hadv infected . from a molecular perspective , hadv-55 is a novel type with a hexon gene recombination between hadv-11 and hadv-14 ( 11 ) .
phylogenetic analysis by using the hexon and fiber gene sequence of 49 strains collected in our study showed that they clustered with previously reported hadv-55 strains .
spread of infection of traditionally military - associated hadv types into civilians has been recently reported in the united states and china ( 3,12,13 ) .
thus , surveillance of hadv types among both military and civilian populations is warranted ; such measures are being implemented by the us centers for disease control and prevention ( atlanta , ga , usa ) ( 12 ) .
first , our findings may not be generalizable due to the retrospective nature of the study
. however , the military health system in south korea provides healthcare exclusively to all military personnel ; therefore , epidemiologic information gathered from our surveillance is accurate and comprehensive .
second , we conducted molecular typing with samples collected from february 2016 , which was substantially later than the onset of the epidemic .
however , hadv-55 had already been identified in a case series from our center during june 2014may 2015 ( 8) . because evidence shows that hadv-55 has been already circulating since early 2014 ,
we believe we can assume that hadv-55 was the causative agent of the outbreak described in this study .
previously , the hadv typing study conducted in 2007 reported hadv-7 as the most prevalent type ( 14 ) .
lack of continuous surveillance makes it difficult to estimate exactly when this novel type was introduced into south korea .
further genomic analysis of the collected samples and enhanced surveillance , including of civilian populations , would provide more information on the epidemiology of hadv infection .
detailed methods of the study of febrile respiratory illness associated with human adenovirus in south korea military , 20142016 .
Output:
| an outbreak of febrile respiratory illness associated with human adenovirus ( hadv ) occurred in the south korea military during the 201415 influenza season and thereafter . molecular typing and phylogenetic analysis of patient samples identified hadv type 55 as the causative agent .
emergence of this novel hadv necessitates continued surveillance in military and civilian populations . |
PubmedSumm6805 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: subdural hygroma is a subdural body of cerebrospinal fluid ( csf ) collection , without blood .
they can be caused by leakage of csf following minor trauma in the setting of cerebral atrophy , following meningitis in children or more commonly after ventricular shunting .
however , some of them can be large and cause compression and secondary neurological symptoms .
hence , it is important to detect the secondary effects of subdural hygroma on adjacent normal brain parenchyma early and intervene before it causes permanent damage .
we here present the case of a child with post meningitis subdural hygroma and highlight the role tc - ehylene cysteine dimer ( tc - ecd ) hybrid spect / computed tomography ( ct ) can play in such a scenario .
the child had a history of bacterial meningitis 2 year back for which he was treated and declared cured .
magnetic resonance imaging ( mri ) findings revealed bilateral frontal subdural csf collections , suggestive of hygroma , more marked on the left side [ figure 1 ] .
similar collection was also noted in relation to the right cerebellum [ figure 1c and f ] . as subdural hygroma
are known to resolve spontaneously and there was no associated hydrocephalus , the clinician decided for a conservative medical management . because of the parents concern the child was referred to department of nuclear medicine for evaluation of cerebral perfusion .
the child was injected 185 mbq ( 5 mci ) of tc - ecd intravenously and rested in a quiet room .
the spect / ct images confirmed the subdural hygroma [ figure 2a c ] .
in addition , it also revealed hypoperfusion in bilateral frontal , parietal and temporal cortices [ figure 2d i ] .
the occipital cortex and cerebellum showed preserved perfusion while the basal ganglia showed relative hyperperfusion .
based on the combination of spect / ct findings and clinical signs , the patient underwent drainage of the subdural hygroma with significant clinical improvement .
trans - axial t1 weighted images ( a , b ) reveal hypointense subdural collection in bilateral fronto - parietal region ( arrows ) , more marked on the left side .
furthermore , noted is the hypointense subdural collection over the right cerebellum ( c , arrow ) .
transaxial t2w image shows hyperintense collections in the same corresponding areas ( d - f , arrows ) .
the ventricles are normal in size and there is no midline shift transaxial tc - ehylene cysteine dimer ( tc - ecd ) hybrid single photon emission tomography / computed tomography ( spect / ct ) images .
the non - contrast transaxial ct images ( a - c ) confirms the subdural hygroma ( arrows ) seen on mri .
transaxial spect ( d - f ) and spect - ct ( g - i ) images demonstrates hypoperfusion involving bilateral frontal , parietal , and temporal cortices ( arrows ) .
contrary to the subdural hygroma , the hypoperfusion is more marked on the right side .
the occipital cortex and the cerebellum show preserved perfusion , while the basal ganglia demonstrate relative hyperperfusion , more marked on the left ( e )
subdural hygroma is subdural accumulation of csf , most commonly seen following head trauma or decompressive craniotomy .
it has also been found to be associated with meningitis , the cause in present patient , and intrathecal chemotherapy .
the factors contributing to the development of subdural hygroma are unknown , but there is probably an underlying disturbance of normal csf absorption or an alteration of the dynamics of csf circulation .
various theories have been proposed to outline the pathogenesis of subdural hygroma including , arachnoid rupture , arachnoid flap , blood - brain - barrier failure , and brain atrophy .
the general consensus is on that of due to arachnoid membrane rupture or arachnoid flap leading to csf accumulation in the subdural space .
subdural hygroma can be seen on ct ; however , the differentiation form subdural hematoma or cerebral atrophy is not always possible .
however , conventional mri is not able to assess the impact of the subdural hygroma on underlying brain parenchyma .
functional imaging in the form of perfusion spect has been shown to be useful to assess these changes secondary to extracerebral fluid collection .
spect with tc - ecd is an established method for assessment of cerebral perfusion , especially for detection of early changes . in the present patient ,
tc - ecd brain perfusion spect showed hypoperfusion in bilateral frontal , parietal , and temporal cortices and provided the imaging correlate for patient symptoms .
in addition , hybrid spect / ct can provide both structural and functional information in a single setting , as in the present case , thereby avoiding the need for a dedicated ct examination .
however , a subset of patients who develop compression symptoms will require surgical intervention to avoid permanent neurological sequelae .
combined structural and functional imaging in the form of tc - ecd brain spect / ct may be especially advantageous for guiding surgical therapy .
these include transfontanel percutaneous aspiration , subdural drains , placement of bur hole(s ) with or without a subdural drain , and shunting .
while shunt placement typically provides good long - term success it has well - known early and late complications .
the minicraniotomy technique may be superior to the burr - hole method , especially in children and was employed in the present case .
the present report highlights the potential role of tc - ecd brain perfusion spect / ct in a case of post meningitis subdural hygroma .
integration of tc - ecd brain perfusion spect / ct in management of such patients can help in decision making with respect to conservative versus surgical management .
Output:
| subdural hygroma is the collection of cerebrospinal fluid in the subdural space .
most often these resolve spontaneously .
however , in cases with neurological complications surgical drainage may be needed .
we here , present the case of an 8-year - old boy with post meningitis subdural hygroma .
99mtc - ehylene cysteine dimer ( 99mtc - ecd ) hybrid single photon emission tomography / computed tomography ( spect / ct ) carried out in this patient , demonstrated the subdural hygroma as well as the associated cerebral hypoperfusion .
if 99mtc - ecd spect / ct is integrated into management of these patients , it can help in decision making with respect to conservative versus surgical management . |
PubmedSumm6806 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the ability of the immune system to keep tolerance to commensals while remaining capable of responding to injury or infection with pathogenic microorganisms is essential for tissue homeostasis .
any disturbances in this balance either by genetic , environmental , or infectious causes can lead to chronic inflammatory and/or autoimmune diseases .
the mucosal immune system should sense pathogens versus innocuous dietary antigens or commensal microorganisms . while a strong and protective response is required to eliminate pathogens , tolerance is essential for harmless antigens or nutrients , thus avoiding inflammatory responses . during oral tolerance
systemic immune effector function including delayed type hypersensitivity response and ige antibody production are affected [ 1 , 2 ] . furthermore , intestine - resident effector cells also undergo tolerance .
impairment of oral tolerance seems to be associated with coeliac disease , characterized by an aberrant th1-mediated dth triggered by dietary gluten [ 1 , 3 ] .
similarly , ige - mediated food allergies can be derived from the break of tolerance to food antigens [ 1 , 4 ] . along the same lines ,
break of tolerance at the large intestine is thought to trigger hyperreactivity to commensal bacteria resulting in inflammatory bowel diseases , including crohn 's disease .
interestingly , tolerance to commensal flora does not exert a systemic effect [ 6 , 7 ] .
moreover , iga production is maintained , thus supporting commensalism , because of the noninflammatory properties of iga [ 8 , 9 ] .
it is well accepted that clonal deletion and/or t cell anergy are components of the mechanism of action of oral tolerance , however induction of regulatory t cells ( treg 's ) has become widely known as its central component .
the induction of foxp3 + treg cells requires cd103 + dendritic cells ( dcs ) .
herein , we will review the development / differentiation of mucosal resident dc subsets and their relative contribution to tolerance and immunity .
intestinal dcs are located throughout the villus lamina propria and in intestinal lymphoid tissue ( peyer 's patches , solitary isolated lymphoid tissue , and mesenteric ln ) , where they play a central role in sampling and processing luminal as well as peripheral self - antigen for presentation to t cells .
a seminal study by rescigno et al . showed that cd11c+ cells send transepithelial dendrites from the lamina propria that penetrate through tight junctions and capture salmonella from the lumen .
lamina propria contains two major populations of cd11c+ mononuclear phagocytes : cd11ccd103+cd11b+cx3cr1 cells ( dcs ) and cd11ccd103cd11b+cx3cr1 + cells ( macrophages ) [ 6 , 9 , 1215 ] .
cx3cr1 + macrophages , rather than the cd103 + dcs , are sampling the intestinal luminal content by extending transepithelial dendrites [ 11 , 13 , 1618 ] .
dcs ( cd11c+cx3cr1 cells ) can be further subdivided into three major subsets based on the expression of cd11b and cd103 , with cd11b+cd103 + , cd11bcd103 + , and cd11bcd103 [ 19 , 20 ] ( figure 1 ) .
lymphoid tissue resident dcs include plasmacytoid dcs ( pdcs ) and cd8+ and cd11b+ conventional dcs ( cdcs )
. they can be found along the lymphoid organs associated with the intestine , including pps , isolated lymphoid follicles , and mlns .
nonlymphoid tissue dcs , found in the parenchyma of tissues , are also known as migratory dcs . under steady - state conditions ,
migratory dcs promote the expansion of regulatory t cells , required for tolerance to self - antigens [ 21 , 22 ] ( figure 1 ) .
on the other hand , during inflammatory response to infection , these cells promote protective t cell responses [ 23 , 24 ] .
the expression of the chemokine receptor ccr7 and its ligands ccl21 and ccl19 control whether migratory dcs move into draining lns . classic process of dc maturation occurs upon exposure to microbial stimuli or proinflammatory cytokines .
such modifications are essential for effective nave t cells priming and activation . on the other hand ,
migratory dc maturation is associated with tolerance induction rather than activation and proliferation , despite upregulation in mhc ii and cd40 .
induction of tolerance versus immunity by intestinal dc is , at least in part , mediated by retinoic acid receptors ( rar ) signaling [ 2629 ] .
thus , exposure to ra triggers expression of gut - homing receptors along with enhancing expansion of foxp3 + t cell and iga b cell differentiation . on the other hand ,
induction of gut - homing receptors on primed t cells as well as foxp3 + t cell differentiation in vitro is best achieved in the presence of migratory ( cd103+cd11b or cd11b+ ) dcs among other dc subsets [ 4 , 5 , 7 ] .
raldh2 is one of the enzymes that metabolize retinal to ra , cd103 + dcs express high levels of the gene encoding it aldh1a2 .
small intestine - lamina propria and mln resident cd103 + dcs trigger rar signals and induce expression of ccr9 in responding t cells .
all dcs trigger limited rar signaling in t cells ; however high levels of ccr9 induction are a key function associated with small intestine - lamina propria and mln cd103 + dcs . on the other hand ,
the cd103+cd11b+ subset seems critical for the induction of proinflammatory th17 cells [ 19 , 20 ] given its high induction of il6 in response to microbial stimulation .
the interaction of fms - like tyrosine kinase 3 ( flt3 ) with its ligand ( flt3-l ) is critical for the generation of cd103 + dcs , both in mice and humans [ 37 , 38 ] .
pre - b cells as well as myeloid and monocytic lineages show upregulated flt3 mrna , while flt3-l mrna expression is ubiquitous .
treatment of mice with human flt3-l leads to activation of mouse flt3 triggering bone marrow hyperplasia along with hematopoietic stem and progenitor cell proliferation .
common dc progenitors are comprised within lineage ( lin)- negative , flt3-l+ cell subset [ 42 , 43 ] ( figure 1 ) .
pdcs and cdcs are both derived from the common dc precursor within this lin- flt3 + compartment [ 44 , 45 ] .
the transcription factor irf8 is required for development and activation of pdcs and cd8+ dcs [ 4648 ] and pu.1 is important for all conventional ( nonplasmacytoid ) dcs [ 49 , 50 ] .
intestinal cd103+cd11b dcs are developmentally related to the cd8+ lymphoid dc subset , since both subsets are dependent on the presence of the transcription factors irf8 , id2 , and batf3 .
most cd103 + small intestine - lamina propria dcs have been shown to develop directly from a circulating flt3 + common dc precursor and not from cd103 small intestine - lamina propria dcs ( figure 1 ) .
interestingly , a great proportion of mln resident cd103 + dcs are thought to be derived from a migratory population arriving from small intestine - lamina propria that plays a critical role in presenting orally derived soluble antigen to t cells ( figure 1 ) .
presumably , these cells seize antigens locally in the small intestine and subsequently migrate into the mln .
cd103 mln dcs appear to be derived from a blood population that populate and expand the mln and is involved in the t cell priming to systemic antigens .
importantly , cd103 + dcs are present in normal and inflamed human mln and display similar phenotypic and functional properties to their murine counterparts .
ccr7 , a chemokine receptor which is required for dc migration from peripheral tissues into the draining ln , is required for accumulation of cd103 + dc in the mln , as ccr7-deficient hosts have reduced numbers of mln cd103 + dcs [ 5456 ] .
intestinal flora is composed of trillions of resident bacteria that can provide beneficial effects to the host . for example , bacterial metabolites including vitamins and short chain fatty acids are relevant for the host development , including lymphoid populations in the intestine . moreover ,
several host immune - regulatory mechanisms have evolved to prevent inappropriate activation of inflammatory responses in response to the commensal flora , including the hyporesponsiveness of intestinal epithelium and resident macrophages to bacterial toll - like receptor ligands [ 59 , 60 ] .
chemically induced and spontaneous colitis are reduced or abolished in antibiotic - treated mice and germ - free mice [ 6165 ] and bacteroides species and members of the enterobacteriaceae family including klebsiella pneumoniae and proteus mirabilis can promote colitis [ 66 , 67 ] .
inflammasome , a multiprotein complex that leads to caspase-1 initiated proteolytic processing of pro - interleukin-1 and pro - il18 into their active forms . in the intestine , salmonella triggers resident phagocytes to produce il-1 in an nlrc4-dependent manner leading to neutrophil recruitment .
the role of the nlrp3 inflammasome in intestinal inflammation is controversial . on one hand , mice lacking nlrp3 or caspase-1
were shown to be less susceptible to chemically induced colitis [ 71 , 72 ] .
on the other hand , it was shown that these same animals had increased susceptibility and worsened pathology [ 73 , 74 ] .
while il-1 blockage improves intestinal inflammation in different animal colitis models [ 75 , 76 ] , another study showed that genetic deficiency of il-1 leads to increased susceptibility to experimental colitis .
although it is not clear what the reasons for such differences in results are , one potential explanation is the composition of gut flora .
for instance , escherichia coli trigger nlrp3 inflammasome in bone marrow derived macrophages to produce il-1 [ 77 , 78 ] .
several commensal bacteroides and bifidobacteria strains can directly induce monocyte - derived dcs to acquire a tolerogenic phenotype . polysaccharide a from bacteroides fragilis , a gram - negative anaerobic commensal bacterium ,
can also associate with cd11c+ cells in mlns and drive a mixture of th1 systemic responses and il10-producing treg cells in the colonic lp .
these effects are associated with the modulation of apc function in the lamina propria [ 19 , 81 , 82 ] .
antigen presentation by cd103 + dcs can be tolerogenic [ 5 , 7 ] or immunogenic , dictated by the microenvironment [ 8385 ] .
those conditions should be crucial for the development of novel therapeutic approaches using cd103 + dcs in triggering mucosal immunity or tolerance . under steady - state conditions , lamina propria - resident cd103 + dcs are tolerogenic
for instance , mln cd103 + dcs purified from colitic mice triggered th1 responses along with high levels of il6 production [ 83 , 86 ] . during intestinal inflammation , mln cd103 + dc acquires these proinflammatory properties with no phenotypical and ontogenetic changes . naturally occurring cd4+cd25+foxp3
+ treg cells are thymus - derived and are important to modulate a wide range of immune - mediated pathologies , including autoimmunity , colitis , and chronic infection . however , inducible treg cells arising from the nave pool are particularly beneficial in the intestine .
the balance of triggering protective immunity to invading pathogens while retaining tolerance to dietary antigen and the commensal flora is critical .
these cells can be generated in the periphery from the naive t cell pool after , for example , the oral administration of antigen or the targeting of peptide ligands to dcs in vivo .
some specific nutrients are known to have notable effects on the modulation of mucosal immunity .
vitamin a , whose only source in mammals is through the diet , mediates several functions of cd103 + dcs .
its depletion from the diet inhibits treg differentiation induced by mln cd103 + dcs as well as inducing gut - homing receptors on t cells [ 88 , 89 ] .
tryptophan is another example of dietary element that is required for the ido - dependent tolerogenic effects of mucosal dcs and for generation of ligands of the aryl hydrocarbon receptor ( ahr ) , such as l - kynurenine that regulates the balance between th17 and treg cell differentiation [ 9193 ] and has powerful direct anti - inflammatory activity on dcs .
diet - derived lipid mediators can activate anti - inflammatory peroxisome proliferator - activated receptor ( ppar) .
short chain fatty acids ( including acetate , butyrate , and propionate ) are among the most abundant metabolites derived from microbiota - mediated digestion of dietary fiber .
exposure of monocyte - derived dcs to butyrate and propionate prevented proinflammatory cytokine release induced after lps incubation .
in fact , animals deficient for butyrate receptor , gpr109a , are susceptible to the development of colitis and colon cancer .
exposure of curcumin triggers a tolerogenic activity in dcs , including upregulation of aldh1a2 and il10 while promoting foxp3 + treg cells .
the mucosal neural anatomy is disrupted in inflammatory bowel diseases ; intestine is permeated by a complex nervous system .
on the other hand , hematopoietic cells are responsive to neurotransmitters and mediators from the enteric nervous system exert immune - regulatory effects .
vasoactive intestinal peptide ( vip ) is produced by intestinal enteroendocrine and immune cells and has vasodilator and regulator of epithelial permeability activities .
vip suppresses lipopolysaccharide - induced dc maturation while promoting differentiation of il10- and tgf--secreting treg cells [ 103105 ] . in agreement with these observations ,
taken together , these studies revised here point to the complexity of interactions between mucosal dcs , nonimmune cells , the microbiota , and ingested nutrients .
all these factors contribute to promoting and maintaining tolerance mediated by intestinal dcs under steady - state conditions .
while no single mediator plays a dominant role , redundancy among several pathways and components is evolutionary advantageous to ensure that homeostasis is maintained .
Output:
| dendritic cells present in the digestive tract are constantly exposed to environmental antigens , commensal flora , and invading pathogens . under steady - state conditions ,
these cells have high tolerogenic potential , triggering differentiation of regulatory t cells to protect the host from unwanted proinflammatory immune responses to innocuous antigens or commensals . on the other hand
, these cells must discriminate between commensal flora and invading pathogens and mount powerful immune response against pathogens .
a potential result of unbalanced tolerogenic versus proinflammatory responses mediated by dendritic cells is associated with chronic inflammatory conditions , such as crohn 's disease , ulcerative colitis , food allergies , and celiac disease
. herein , we review the dendritic cell population involved in mediating tolerance and immunity in mucosal surfaces , the progress in unveiling their development in vivo , and factors that can influence their functions . |
PubmedSumm6807 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: they have multifactorial etiologies , mainly related to genetic and environmental factors . a growing body of evidence exists about the early life origins of chronic diseases , and the tracking of cvd risk factors from childhood into adulthood .
it is well - documented that high concentration of total cholesterol ( tc ) and low - density lipoprotein cholesterol ( ldl - c ) as well as low concentration of high - density lipoprotein cholesterol ( hdl - c ) are important risk factors of cvd in adults .
the accumulating number of studies confirmed the tracking of cvd risk factors including dyslipidemia from childhood to adulthood .
they showed that about 50% of children and adolescents with dyslipidemia will continue to have this disorder as adult .
tc levels increase from birth , stabilize at about 2 years of age , reach a peak before puberty , and then turn down slightly during adolescence .
normal values for lipids in the pediatric age group are actually defined according to the population distributions of lipid levels from the lipid research clinics ( lrc ) prevalence study , which was conducted in the 1970s .
dyslipidemia is commonly defined as tc higher than 200 mg / dl and ldl - c higher than 130 mg / dl ; these values correspond to the 95 percentile of the lrc study .
timely identification of children with dyslipidemia is important for considering early interventions to prevent or postpone the development of atherosclerosis . to reduce the burden of cvd , there are two approaches for screening dyslipidemia in children and adolescents . one of these approaches is presented by the american academy of pediatrics ( aap ) , and recommends that individuals aged 2 years and older should be screened for high cholesterol if they have a family history ( fh ) of premature cvd ( 55 years of age ) or a parent with history of hypercholesterolemia ( 240 mg / dl [ 6.2 mmol / l ] or higher ) or existence of other cvd risk factors in a child or adolescent .
controversial results have been reported in this respect . in the study of eissa et al . , using the aap criteria for screening dyslipidemia had a sensitivity of 54 to 66 and a specificity of 50 to 53 , with the positive predictive value ( ppv ) ranging from 16 to 32 .
this study indicated that using fh criteria had a low yield for identifying children and adolescents with abnormal lipids and lipoproteins .
found that screening the offspring of patients with premature cvd was highly productive in identifying young people who were at excessive risk for future coronary artery disease .
they proposed that early identification of this young and at - risk population was an opportunity for the early initiation of preventive measures .
have shown that the prevalence of dyslipidemia was 6.75 times higher in children with parents of hyperlipidemia than in their counterparts . in the study of lin et al . in taiwan , 16 - 18% of the children had a positive fh of cvd or hyperlipidemia ; also , children with fh of hyperlipidemia were significantly more likely to have elevated tc [ odds ratio ( or):1.4 , p < 0.05 ] and ldl - c ( or:1.4 , p < 0.05 ) than those without such a history but the ppv of hyperlipidemia were less than 13 according to fh . in the study of promise et al .
, 63 children of the 190 patients had hypercholesterolemia ; the sensitivity and specificity of fh for screening the children were 33.2 and 71.5 , respectively .
the abovementioned points indicate that the effectiveness of the strategies of screening children for dyslipidemia according to their fh of premature cvd or universal screening remains controversial .
systematic review and meta - analysis may serve in resolving the conflicts and provides credible evidence .
the current study is a systematic review and meta - analysis on the results of primary studies that investigated screening dyslipidemia in children and adolescents according to the existence of positive fh of cvd risk factors .
this systematic review was conducted in accordance with the preferred reporting items for systematic reviews and meta - analyses ( prisma ) statement .
the search was conducted in december 2013 . to find primary studies published electronically from november 1980 until 30 november 2013
we used the following keywords : hypercholesterolemia , cardiovascular disease family history , cvd family history , coronary heart disease family history , atherosclerosis family history , chd family history , familial hypercholesterolemia , lipid , lipoprotein , ldl , low density lipoprotein , hdl , high - density lipoprotein , hdl - c , high - density lipoprotein cholesterol , ldl - c , low - density lipoprotein cholesterol , cholesterol , tc , triglycerides , tg , dyslipidemia screening , pediatrics , children , childhood , universal screening dyslipidemia , and we used and/or conjunctions .
moreover , reference lists of published studies were also investigated to increase the search sensitivity and to select a higher number of studies .
search evaluation was conducted randomly by two independent researchers , and it was confirmed that all relevant studies were considered . the titles and abstracts of papers were studied and relevant papers were selected . then , the full texts of pertinent papers were studied and their findings were rescreened .
two independent researchers ( mm and ma ) screened the titles and abstracts of the papers identified by the literature searches for their potential relevance or assessed the full text for including them in the review . in the case of disagreement
, the discrepancy was determined in consultation with a third arbitrating reviewer ( rk ) .
the full texts or summaries of all the searched articles , documents , and reports were extracted . after reviewing and studying the titles , author(s ) , journal name , and publication year , the repetitive items were excluded .
it is noteworthy to mention that for avoiding cross - publication bias , we reviewed findings to identify and to eliminate duplicates
. then , researchers carefully studied the full texts of the articles ; the relevant articles were selected and the irrelevant ones were excluded . in this systematic review and meta - analysis
, we included all relevant studies that evaluated the program of lipid screening in a child and obtained at least the minimum score of 8 in the abovementioned checklist . after reviewing and examining the full text or abstract of the articles and after recognizing the disagreements ,
the studies with the following criteria were excluded :
the results of the papers , documents , or reports that were not clear;review articles ; andevidences that showed the article was not a primary study .
the results of the papers , documents , or reports that were not clear ; evidences that showed the article was not a primary study .
after determining the related studies in terms of titles and contents , the quality of documents was evaluated by using a checklist [ figure 1 ] .
this checklist considered the study objective , study method , sample size , sampling method , data collection tool , variables evaluation status , and studied target group , and then the analysis status was examined by using 12 questions ( one score for each question ) .
we selected those articles that obtained at least the minimum acceptable score , and then the related information was extracted and analyzed .
checklist for assessment of the articles quality data were extracted by researchers in terms of article title , first author , publication year , total sample size , sample size according to gender , study setting , data source , mean tc , mean hdl - c , mean ldl - c , tg as well as the percentage of sensitivity , specificity , ppv , and negative predictive value ( npv ) for fh of dyslipidemia or premature cvd . in each study ,
the standard error of sensitivity , specificity , and ppv were calculated based on binomial distribution formula .
finally , the heterogeneity index was determined by using q- and i - squared test . for determining the existence of heterogeneity among primary studies according to q test
furthermore , i2 test presented a range of 0% ( no heterogeneity ) to 100% ( significant heterogeneity ) ; values of 25% , 50% , and 75% were considered as representing low , medium , and high heterogeneity , respectively .
for this study , we considered that i2 values above 25% or p value < 0.05 to be indicative of significant heterogeneity . according to the heterogeneity results with meta command in meta - analysis , the random effect model was used to estimate the sensitivity , specificity , and ppv percent of fh of dyslipidemia or cvd for predicting dyslipidemia in children . in order to minimize the random variation of the estimations of studies , we used bayesian - adjusted estimation in the forest plots . at the final step ,
the effects of variables , which were determined as probable sources of heterogeneity in the study , were examined by using the meta - regression method .
the point estimation for the sensitivity , specificity , and ppv with confidence interval of 95% was calculated in forest plots in which the square size represents the weight of each study and lines in its both sides represent the confidence interval of 95% .
moreover , the sensitivity analysis was conducted to estimate the effect of each primary study in the pooled rate estimation .
analysis was performed by using the stata software version 11 ( stata corporation , college station , tx , usa ) .
the search was conducted in december 2013 . to find primary studies published electronically from november 1980 until 30 november 2013
we used the following keywords : hypercholesterolemia , cardiovascular disease family history , cvd family history , coronary heart disease family history , atherosclerosis family history , chd family history , familial hypercholesterolemia , lipid , lipoprotein , ldl , low density lipoprotein , hdl , high - density lipoprotein , hdl - c , high - density lipoprotein cholesterol , ldl - c , low - density lipoprotein cholesterol , cholesterol , tc , triglycerides , tg , dyslipidemia screening , pediatrics , children , childhood , universal screening dyslipidemia , and we used and/or conjunctions .
moreover , reference lists of published studies were also investigated to increase the search sensitivity and to select a higher number of studies .
search evaluation was conducted randomly by two independent researchers , and it was confirmed that all relevant studies were considered .
then , the full texts of pertinent papers were studied and their findings were rescreened .
two independent researchers ( mm and ma ) screened the titles and abstracts of the papers identified by the literature searches for their potential relevance or assessed the full text for including them in the review . in the case of disagreement
, the discrepancy was determined in consultation with a third arbitrating reviewer ( rk ) .
the full texts or summaries of all the searched articles , documents , and reports were extracted . after reviewing and studying the titles , author(s ) , journal name , and publication year , the repetitive items were excluded .
it is noteworthy to mention that for avoiding cross - publication bias , we reviewed findings to identify and to eliminate duplicates
. then , researchers carefully studied the full texts of the articles ; the relevant articles were selected and the irrelevant ones were excluded .
in this systematic review and meta - analysis , we included all relevant studies that evaluated the program of lipid screening in a child and obtained at least the minimum score of 8 in the abovementioned checklist .
after reviewing and examining the full text or abstract of the articles and after recognizing the disagreements , the studies with the following criteria were excluded :
the results of the papers , documents , or reports that were not clear;review articles ; andevidences that showed the article was not a primary study .
the results of the papers , documents , or reports that were not clear ; evidences that showed the article was not a primary study .
after determining the related studies in terms of titles and contents , the quality of documents was evaluated by using a checklist [ figure 1 ] .
this checklist considered the study objective , study method , sample size , sampling method , data collection tool , variables evaluation status , and studied target group , and then the analysis status was examined by using 12 questions ( one score for each question ) .
we selected those articles that obtained at least the minimum acceptable score , and then the related information was extracted and analyzed .
data were extracted by researchers in terms of article title , first author , publication year , total sample size , sample size according to gender , study setting , data source , mean tc , mean hdl - c , mean ldl - c , tg as well as the percentage of sensitivity , specificity , ppv , and negative predictive value ( npv ) for fh of dyslipidemia or premature cvd .
in each study , the standard error of sensitivity , specificity , and ppv were calculated based on binomial distribution formula .
finally , the heterogeneity index was determined by using q- and i - squared test . for determining the existence of heterogeneity among primary studies according to q test
furthermore , i2 test presented a range of 0% ( no heterogeneity ) to 100% ( significant heterogeneity ) ; values of 25% , 50% , and 75% were considered as representing low , medium , and high heterogeneity , respectively . for this study , we considered that i2 values above 25% or p value < 0.05 to be indicative of significant heterogeneity . according to the heterogeneity results with meta command in meta - analysis , the random effect model was used to estimate the sensitivity , specificity , and ppv percent of fh of dyslipidemia or cvd for predicting dyslipidemia in children . in order to minimize the random variation of the estimations of studies , we used bayesian - adjusted estimation in the forest plots . at the final step ,
the effects of variables , which were determined as probable sources of heterogeneity in the study , were examined by using the meta - regression method .
the point estimation for the sensitivity , specificity , and ppv with confidence interval of 95% was calculated in forest plots in which the square size represents the weight of each study and lines in its both sides represent the confidence interval of 95% .
moreover , the sensitivity analysis was conducted to estimate the effect of each primary study in the pooled rate estimation .
analysis was performed by using the stata software version 11 ( stata corporation , college station , tx , usa ) .
we then removed 15,864 of them by applying an operator to have maximum specificity ; another 234 remaining documents were also removed because of being repetitive .
thereafter , we studied the titles and abstracts of 1,116 remaining papers out of which 998 were irrelevant and were removed .
it is worth mentioning that three further studies were identified and finally 22 studies were selected .
three of them were set aside because they did not meet the inclusion criteria ; as a result , 19 primary studies were entered to this study [ figure 2 and table 1 ] .
literature search and review flowchart for selection of primary studies results of primary studies on screening dyslipidemia in the pediatric age group and included in the meta - analysis in the primary studies entered into this systematic review and meta - analysis , 37,304 children and adolescents were assessed for dyslipidemia .
the age group considered in these studies was between 2 years and 20 years . as presented in table 1 , the bases for predicting dyslipidemia in children were the history of premature cvd in parents ( in six articles ) , history of dyslipidemia in parents ( in eight articles ) , and history of premature cvd or dyslipidemia in parents ( in nine articles ) . in six out of seven studies that reported elevated ldl - c among children with fh of premature cvd or dyslipidemia ,
the frequency of high ldl - c was significantly higher among children with fh of premature cvd or dyslipidemia than in children without this history .
in five primary studies that reported the levels of ldl - c among children and adolescents , the frequency of elevated ldl - c varied from 4.8% to 25.2% [ table 1 ] .
one out of four primary studies that reported low hdl - c level among children with fh of dyslipidemia or premature cvd indicated that the frequency of low hdl - c was significantly lower in children with fh of dyslipidemia or premature cvd than in their other counterparts . in these primary studies , the frequency of low hdl - c varied from 13.4% to 24.8% [ table 1 ] .
two out of five studies that reported high levels of tc among children with fh of dyslipidemia or premature cvd indicated that high cholesterol was significantly more frequent among children with fh of dyslipidemia or premature cvd than in those without this history .
the frequency of hypercholesterolemia varied from 6.4% to 24.3% in the five primary studies that reported it [ table 1 ] .
one out of three primary studies that reported high tg levels among children with fh of dyslipidemia or premature cvd indicated that the frequency of hypertriglyceridemia was higher among children with fh of dyslipidemia or cvd than in other children .
the frequency of elevated tg varied from 14.1% to 25.8% in primary studies that reported this measure [ table 1 ] .
, ldl - c level increased in 9.5% of the 5,798 studied children without fh of dyslipidemia or premature cvd . the sensitivity of fh of premature cvd or dyslipidemia for predicting dyslipidemia among children varied from 15 to 93 . in total , 78.9% of primary studies reported sensitivity levels lower than 60% .
the specificity of fh of premature cvd or dyslipidemia for predicting dyslipidemia among children varied from 13 to 82.2 .
the effectiveness of screening children for dyslipidemia on the basis of their fh of premature cvd or dyslipidemia was low [ table 1 ] .
the meta - analysis showed that the sensitivity of fh of dyslipidemia , premature cvd , and dyslipidemia or fh of premature cvd in predicting dyslipidemia among children was 42.5 ( 28.2 - 56.8 ) , 28.3 ( 24 - 32.5 ) , and 53.4 ( 37.8 - 68.9 ) , respectively .
furthermore , the specificity of fh of dyslipidemia , premature cvd , and dyslipidemia or premature cvd in predicting dyslipidemia among children was 62.2 ( 44.2 - 80.2 ) , 68.7 ( 61.5 - 76 ) , and 48.8 ( 32.1 - 65.5 ) , respectively .
the ppv of fh of dyslipidemia , premature cvd , and dyslipidemia or premature cvd in predicting dyslipidemia among children was 23.7 ( 14 - 33.5 ) , 22.7 ( 1.3 - 46.6 ) , and 13 ( 9.2 - 16.8 ) , respectively .
after including all primary studies , the overall ppv was 20.7 ( 12.3 - 29.1 ) .
the significance level of chi - square ( < 0.001 ) and i - square indicated that the heterogeneity was very high among primary studies [ table 2 and figures 35 ] .
pooled estimation of sensitivity , specificity , and positive predictive value of family history of dyslipidemia or cardiovascular disease to predict dyslipidemia in children the adjusted sensitivity percentage of predicting dyslipidemia in children in each study and overall by the family history of cvd or dyslipidemia .
this chart shows that the minimum and maximum of adjusted sensitivity percent among primary studies is 15.1% and 92.5% , respectively ; pooled estimate : 42.6 ( 35.7 - 49.6 ) , i2 = 99.5% the adjusted specificity percentage of prediction of dyslipidemia in children in each study and overall by the family history of cvd or dyslipidemia .
this chart shows that the minimum and maximum of adjusted specificity percent among primary studies is 13.2% and 80.7% , respectively ; pooled estimate : 59 ( 50.9 - 67.1 ) , i2 = 99.6% the adjusted ppv percentage of prediction of dyslipidemia in children in each study and overall by the family history of cvd or dyslipidemia .
this chart shows that the minimum and maximum of adjusted sensitivity percent among primary studies is 7.4% and 51.4% , respectively ; pooled estimate : 20.7 ( 12.3 - 29.1 ) , i2 = 99.7% the selected risk factors for predicting dyslipidemia among children were investigated in primary studies by meta regression to determine the possible influential factors of sensitivity heterogeneity .
this analysis indicated that the sensitivity of fh of dyslipidemia was 6.9% higher than the sensitivity of the fh of premature cvd , and the sensitivity of fh of dyslipidemia or premature cvd was 6.9% higher than the sensitivity of the fh of dyslipidemia in predicting dyslipidemia in children ; however , these differences were not statistically significant ( = 6.9 , p = 0.2 ) .
moreover , the parents risk factor was investigated as the criteria for dyslipidemia screening in children to determine factors that are effective on specificity ( = 7.2 .
p = 0.2 ) and ppv heterogeneity ( = 3.8 , p = 0.3 ) .
we also conducted a sensitivity analysis to identify studies that were effective on the results of the meta - analysis . after removing the effective studies
, we repeated the meta - analysis in which the q indicator and i2 indicator decreased from 35775.8 to 266.2 and from 99.5% to 97.4% , respectively ; however , the heterogeneity remained notable and significant .
the present systematic review and meta - analysis were conducted in order to appraise screening dyslipidemia in the pediatric age group .
it indicated that the frequency of dyslipidemia was higher in children of parents with cvd or dyslipidemia than in other children .
however , it is worth mentioning that the prevalence of dyslipidemia among children of parents without cvd or dyslipidemia was notable and a considerable part of dyslipidemia in the populations studied was related to these children . in most primary studies ,
the effectiveness of parental history of cvd or dyslipidemia was low for predicting dyslipidemia in their children .
the results of meta - analysis on sensitivity , specificity , and ppv indicators confirmed that the efficacy of the history of cvd or dyslipidemia was low for predicting dyslipidemia in children .
a study in the us examined the efficacy of fh as the screening criteria for children 's hypercholesterolemia .
they demonstrated that maternal [ odds ratio ( or):7.3 ] and paternal ( or:2.9 ) histories of hypercholesterolemia were significantly linked to elevated ldl - c in their children but the sensitivities of maternal and paternal history for predicting hypercholesterolemia in children were 9 and 15 , respectively .
a case - control study in iran showed that the mean tc , ldl - c , and tg were significantly higher , and the mean hdl - c was lower in children with fh of premature cvd than in those without it .
a study in canada examined the usefulness of parental history of hypercholesterolemia and premature cvd as the screening criteria for hypercholesterolemia in youths .
they found that the frequency of a positive parental history was 25.6% and 18.3% among children who had borderline or high ldl - c , and 4.8% had high ldl - c .
they also documented that the sensitivity , specificity , ppv , and npv of parental history were 33.1 , 76.0 , 23.7 , and 83.5 , respectively .
another study in the us found that only 8 out of 37 children with dyslipidemia had a positive fh of premature cvd and 29 did not .
the sensitivity of fh was low ( 21.6 ) in predicting children with high blood cholesterol concentrations .
the universal lipid screening versus selective screening was compared in a general population of 20,266 american students of the 5th grade .
a total of 14,470 ( 71.4% ) children met the criteria of national cholesterol education program ( ncep ) guidelines for lipid screening according to positive fh .
out of them , 1,204 ( 8.3% ) had elevated ldl - c , and 170 ( 1.2% ) of the total number of children studied warranted possible pharmacologic treatment ( ldl - c 160 mg / dl ) .
of the 5,798 ( 28.6% ) students who did not have a positive fh for premature cvd , 548 ( 9.5% ) had elevated ldl - c .
universal lipid screening could identify children with either modest or more marked elevations in ldl - c who were undetected by the high - risk approach .
another study among american students indicated that 135 of 2,096 participants had elevated levels of tc ( i.e. , 200 mg / dl ) and 83 students had elevated serum ldl - c levels ( i.e. , 130 mg / dl ) .
of the participants , 64.4% had fh of hyperlipidemia but no relation existed between fh and serum lipid levels .
this study suggested that regardless of fh , all children who were above 5 years of age should be screened for hyperlipidemia . a review article on pediatric screening for hypercholesterolemia in europe concluded that selective screening strategies mainly based on fh were imperfect .
it suggested that the universal screening of 1 - 9-year - old children was a strategy that was likely to be most effective with respect to sensitivity and specificity for identifying children with elevated cholesterol levels .
proposed that although an elevated cholesterol level wasa risk factor for succeeding adult hypercholesterolemia , the predictive value of an increased cholesterol level in childhood was inadequate to rationalize universal screening .
likewise , porkka et al . suggested that the selection of children for screening serum lipids should be done on the basis of high - risk approach .
they reported that universal screening approach was not appropriate because of its limited predictive power for serum lipid levels at the individual level , the incomplete data on the safety of intervention measures on the growing child , and the limited knowledge on the ethical aspect of such a type of screening .
similarly , elizabeth et al . proposed that the general screening of children for hypercholesterolemia was not warranted . on the other hand , some studies supported the universal screening for dyslipidemia in children .
suggested that the high - risk approach was not sufficient for screening hypercholesterolemia in children .
showed that the high - risk approach could not identify 17% to 90% of children who had abnormal lipid levels .
the current systematic review and meta - analysis demonstrated that the sensitivity and ppv of the high - risk approach by selecting screening target population based on the fh of premature cvd or dyslipidemia was low .
given that lipid disorders track from childhood to adulthood and accelerate the process of atherosclerosis , it is important to use strategies that would have a higher sensitivity for detecting dyslipidemia in the pediatric age group .
it should be acknowledged that most of the abovementioned studies have determined the serum lipids in the western populations , and most have focused on tc and ldl - c levels .
the ethnic differences in the types of dyslipidemia in children are well - documented ; therefore , it is necessary to conduct more studies on elevated tg and low hdl - c , which are more prevalent than hypercholesterolemia in some populations .
this study has some limitations , which originate from the differences in the methodologies of various studies and in the studied populations .
the criteria of defining dyslipidemia are different and the prevalence of dyslipidemia varies in different races and ethnicities ; so combining the results of different studies may limit the drawing of a definite conclusion .
moreover , the studied age groups of primary studies were diverse and given that the prevalence of dyslipidemia varies in different age groups , combining the results of different studies would account for some limitations ; however , all studies were in the pediatric age group , and a general assumption can be drawn .
the high heterogeneity observed among primary studies of their source not being identified could be regarded as another limitation of the present study .
probably the small sample size of a few of the primary studies included in the current review could be regarded as the reason of heterogeneity not being significant .
it should be underscored that this systematic review was performed to overcome the mentioned limitations .
one of the strengths of the present study , which enabled us to reach an explicit and reliable conclusion , is the fact that the reported upper limit of confidence interval of meta - analysis for sensitivity , specificity , and ppv was low and also the efficacy of the high - risk approach for screening children for dyslipidemia was reported in the primary studies .
this meta - analysis indicated that selecting the target population for screening children for dyslipidemia based on their parents risk factors is not accurate , and it might lead to missing many children with dyslipidemia .
this meta - analysis proposes universal screening for detecting dyslipidemia in the pediatric age group ; however , for implementing this strategy , some issues including the needlestick risk , ethical considerations , and available resources should be also taken into account .
mm contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work aah contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
rk contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work mh contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
mk contributed in the conception and design of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
Output:
| background : different viewpoints exist about lipid screening in all children or only in children with positive family history ( fh ) of premature cardiovascular diseases ( cvds ) or hypercholesterolemia .
this systematic review and meta - analysis aim to assess the effectiveness of lipid screening in children and adolescents according to the existence of positive fh of cvd risk factors.materials and methods : pubmed , scopus , and google scholar were searched to identify relevant papers that were published from november 1980 until 30 november 2013 .
irrelevant studies were set aside after studying their title , abstract , and full text .
then , the relevant studies were assessed by using a quality appraisal checklist .
we used random effect model for meta - analysis and calculating the total estimation of sensitivity , specificity , and the positive predictive value ( ppv ) of fh in predicting dyslipidemia among children and adolescents.results:overall , 17,214 studies were identified in the primary search , out of which 19 primary studies were qualified for study entry . the sensitivity of positive fh of premature cvd or dyslipidemia for predicting dyslipidemia among children varied between 15 and 93 .
moreover , the effectiveness of screening children for dyslipidemia according to premature cvd or dyslipidemia in their relatives was low in 86.9% of the primary studies .
the total estimation of sensitivity , specificity , and predictive value was 42.6 , 59 , and 20.7 , respectively , according to the meta - analysis results.conclusion:the present meta - analysis indicated that selecting target population for screening children and adolescents for dyslipidemia according to their fh has low sensitivity . |
PubmedSumm6808 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the one of the principal reforms of health system in federation of bosnia and herzegovina ( fbih ) is focused on strengthening of primary health care and rationalization of hospital care ( 1 ) . in spite of numerous criteria on how to differ rural or urban areas ,
studies worldwide refer to differences in health , as well as health care resources in rural areas in comparison to urban ones ( 2 ) .
rural uninsured rates are higher than urban ( 3 ) and the uninsured often have difficulty obtaining needed care ( 4 ) .
the factors with the clearest relationship to satisfaction with health care system include the accessibility of medical care , the organizational structure of clinics , treatment length , perceived competence of physicians , clarity and retention of physicians ' communication to patients , physicians affiliative behavior , physicians control and patients expectations ( 5 ) .
counties has higher likelihood to yield poor health outcomes in accordance to measurements being encompassed within the county health rankings ' indexed domains of health quality .
there is strong evidence that rural population has a higher percentage of acute and chronic conditions treated within hospital facilities , but could have been prevented within primary health care ( 2 ) .
there are no reliable data dealing with the rural urban differences within health care system in fbih , and we aimed our study to determine the rural - urban differences in primary care practice , hospital inpatient care and total services in one canton in fbih .
a cross - sectional study was conducted and included all 12 municipalities of zenica - doboj canton .
out of total number ( n=1 995 ) , 47.9% was urban population and median of age was 42 years for both populations .
the study included patients with recent experience in general practice , aged 18 years or older .
individual interviews were conducted in one randomly selected day of the week , except monday and friday .
the questionnaire was made on the basis of europep standardized questionnaire , related to the patient satisfaction with a health care ( 6 , 7 , 8) .
a patient satisfaction was rated on a 5 point scale , response categories being poor , fair , good , very good , and excellent .
statistical analysis was performed using the ibm spss version 21.0 for windows system ( spss inc . ,
data are presented as mean standard deviation or as median with interquartile range ( iqr , 25 to75 percentiles ) dependent on normality of variables distribution .
smirnov statistic test with a lilliefors significance level was used for testing normality of distribution . in the case of categorical variables ,
the most of urban residents ( 81.4% ) had finished high school or higher education compared to rural residents ( 58.5% ) ( p < 0.001 )
. there are significant differences in employment status between rural and urban population ( p < 0.001 ) ( table 1 ) .
socio - demographic characteristics rural and urban population as figure 1 demonstrates , rural residents are more likely to travel more than 15 minutes to see their health facilities compared to urban residents ( 61.7% vs. 24.4% , respectively ) .
median of distance ( kilometers ) from residence location to the nearest hospital was statistically significantly higher in rural ( me = 8.0 ; iqr= 5.0 do 14.5 ) km compared to urban population ( me = 1.5 ; iqr = 1.0 to 3.0 ) km ( p < 0.001 ) ( figure 1 ) .
urban differences in time ( minutes ) needed to reach health facilities ( p < 0.001 ) rural residents are more likely to use public transport ( 26.0% vs. 3.0% ) , taxi service ( 9.2% vs. 4.0% ) but not walking ( 23.4% vs. 51.1% ) to reach health facilities , compared to urban residents , respectively ( p < 0.001 ) .
our results indicate that every fourth patient in rural ( 25.1% ) and urban population ( 23.2% ) waits for admission in doctor s office less than 15 minutes , for 30.1% of rural and 26.0% of urban population the waiting time is more than an hour .
there was not statistically significant differences in waiting time for admission in doctor s office in primary health care between rural and urban population ( p = 0.487 ) .
there was not a statistically significant association between residence in overall satisfaction proceedings of hospital staff in dealing with the patient ( p = 0.144 ) , professional conduct of hospital staff at admission ( p = 0.790 ) and professional conduct during the hospital stay ( p= 0 .
urban differences in patients satisfaction with : q1- proceedings of hospital staff in dealing with the patient ; q2professional conduct of hospital staff at admission ; q3professional conduct during the hospital stay ( ns p > 0.05 ) .
rural residents are more likely to buy drugs for medical treatment ( 93.4% vs. 87.2% ; =21,940 ; df=1 ; p<0,001 ) and parenteral injections in primary care practice compared to urban residents ( 54.8% vs. 46.6% , respectively ; =12,976 ; df=1 ; p<0,001 ) ( figure 3 ) .
urban differences in health care system : q1- they visited phyisican in the last month ; q2 they have health problems in the past 12 months but they did not request medical treatment ; q3 they be ordered for physical examination ; q4 they bought drugs for medical treatment ; q5 they bought parenteral injections in primary care practice ; q6 they paid unoffically to someone from medical staff ( ns p > 0.05 ; * * * p < 0.001 ) .
there was not a statistically significant association between residence and : visiting a physician in the last month ( =0.674 ; df=1 ; p=0.412 ) ; if they have health problems in the past 12 months but they did not request medical treatment ( =0.401 ; df=1 ; p=0.527 ) ; ordering for a physical examination ( =0.031 ; df=1 ; p=0.860 ) , unofficial payments to someone from medical staff ( =0.002 ; df=1 ; p=0.968 ) .
urban residents are more satisfied with primary health care center ( p = 0.001 ) , ambulatory health care ( p < 0.001 ) and specialist services ( p = 0.022 ) compared to rural residents ( figure 4 ) .
urban differences in patients satisfaction with : q1- primary health care center ; q2 the general hospital in tesanj ; q3 the cantonal hospital in zenica ; q4 ambulatory health care ; q5 specialist services ( ns p > 0.05 ; * p < 0.05 ; * * p < 0.01 ; * * * p < 0.001 ) .
this study compared urban and rural populations in zenica - doboj canton in fbih about health care quality assessment .
rural residents in zenica - doboj canton usually travel long distance from the village to ambulatory health care or higher level hospitals to deal with complicated situations and to receive better services .
counties have statistically significantly ( p 0.05 ) lower scores in such areas as health behavior , morbidity factors , clinical care , and the physical environment ( 2 ) . in our study , rural residents are more likely to use public transport and cab service to reach health facilities , and more likely to buy drugs for medical treatment and parenteral injections in primary care practice which suggests that rural populations spent more on travelling and medication . in the study of farmer j et al . , satisfaction with local doctors and hospital services was higher in rural locations ( 9 ) . in the study of zhihua yan et al , rural patients were generally more satisfied with healthcare service compared to urban and suburban residents , also ( 10 ) . in our study ,
urban residents are more satisfied with primary health care center , ambulatory health care and specialist services compared to rural residents .
these findings could be explained by that urban population have a grater possibility of health care professionals choice .
our results indicate that there are significant differences in the overall health care assessment of rural populations compared to urban populations .
we would like to point out that health care policy decision makers in the federation of bosnia and herzegovina have to take into account all these differences in order to address the health inequalities between urban and rural areas of the country .
our results can not be representative for the planning of public health policy but can certainly point out to weaknesses of health system and contribute its reform in fbih .
Output:
| aim : to determine the rural urban differences in primary care practice , hospital inpatient care and total services.methods:this cross - sectional study used data from zenica - doboj canton in federation of bosnia and herzegovina ( fbih ) .
the overall sample size for the study was 1,995 .
individual interviews were conducted in one randomly selected day of the week , except monday and friday , on the basis of europep ( european task force on patient evaluations of general practice care ) standardized questionnaire.results:out of total number ( n=1 995 ) , 47.9% was urban population and median of age was 42 years for both populations . the most of urban residents ( 81.4% ) had finished high school or higher education compared with rural residents ( 58.5% ) ( p < 0.001 ) .
there are significant differences in employment status between rural and urban population ( p < 0.001 ) .
rural residents are more likely to travel more than 15 minutes to see their health facilities compared with urban residents ( 61.7% vs. 24.4% , respectively ) .
median of distance ( kilometers ) from residence location to the nearest hospital was statistically significantly higher in rural me = 8.0 ( 5.0 do 14.5 ) km compared to urban population me = 1.5 ( 1.0 to 3.0 ) km ( p < 0.001 ) . the rural population was more likely to buy drugs for medical treatment ( p < 0.001 ) and parenteral injections in primary care practice ( p < 0.001).conclusion : there are significant differences in the overall health care assessment of rural populations as compared to urban populations . |
PubmedSumm6809 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: adolescents are perhaps the most important group in a society , and given their size and characteristics , majority are exposed early to unplanned and unprotected sexual intercourse leading to unwanted pregnancy and sometimes unsafe abortions . vast majority of these young individuals are going through their reproductive years with very little access to sexual and reproductive health information and services .
consequently , unintended pregnancy becomes a major challenge to the reproductive health of young adults in developing countries .
the increase in sexual activity , early pregnancy , and induced abortions among adolescents and have become major concerns in sub - saharan africa and understanding adolescent sexual behavior remains a challenge in the region .
the consequences of unprotected sex , such as unintended pregnancy and unsafe abortion , can be prevented by access to contraceptive services including emergency contraception . given the high prevalence of adolescent pregnancy , developing interventions aimed at reducing unintended adolescent pregnancy has the potential to have a major impact on public health and one avenue for prevention of unwanted pregnancy is the emergency contraceptive pills .
emergency contraceptive pills are hormonal oral contraceptive pills that a woman can take within 72 hours after unprotected intercourse to reduce her risk of becoming pregnant .
although emergency contraceptive pill is not recommended as a regular family planning method , it is a useful method after unprotected sexual intercourse to reduce the chance of unwanted pregnancies .
emergency contraception is most useful when there is a failure of barrier methods such as slippage and breakage of condoms or when sexual intercourse was unpredicted .
furthermore , parker reported that many adolescent females are at high risk of unintended pregnancy because they have limited knowledge of contraception and generally lack access to services or do not feel comfortable using these services .
parker added that in general , adolescents access to and awareness of regular contraception are low , while awareness of and access to emergency contraceptive pills are even lower .
even where the concept of emergency contraception is known , knowledge of accurate use of the method is very low .
study carried out among university and post secondary students in several african countries found that while a quarter to three - quarters of youth had heard of emergency contraception , accurate knowledge about its use was minimal .
parker reported that in a study conducted by arowojolu and adekunle in nigeria , 75 percent of students surveyed were aware of emergency contraception , but only 12 percent knew that the first dose of ecps should be taken within 72 hours of unprotected intercourse .
tamire et al , stated that adequate knowledge and utilization of emergency contraception are particularly important because of high rates of teenage pregnancy , which in this regard has been observed to be high in bayelsa state , nigeria .
however , these studies focused on adolescents with an educational background or within an educational institution , despite the fact that sexual activities are rampant among adolescents regardless of their educational background .
this study is a community based study that focused on the female adolescents in totality irrespective of the educational or religion or socioeconomic background .
furthermore , emergency contraceptive pills are used to prevent pregnancy after unprotected sexual intercourse unlike the regular methods of contraception that are taken before sexual contact .
this is of paramount importance to the adolescents , since they have affinity for risky unprotected sexual intercourse , it is for this reason that the study aimed to assess the knowledge , attitude and utilization of emergency contraceptive pills among female adolescents in amassoma community , bayelsa state .
this community based descriptive cross - sectional research design was used to assess the knowledge , attitude and utilization of emergency contraceptive pills among female adolescents in amassoma community , bayelsa state , which is in the core niger delta region between delta and rivers states respectively .
the research was conducted among ijaw speaking community in southern ijaw local government area of bayelsa state between september 2014 and february , 2015 .
the questionnaire contained 37 question items and it was divided into 4 sections : 1 ) socio - demographic data ; 2 ) knowledge on emergency contraceptive pills ; 3 ) attitude to emergency contraceptive pills ; and 4 ) utilization of emergency contraceptive pills and factors influencing the utilization of emergency contraceptive pills .
out of 220 questionnaires administered , 200 copies were retrieved resulting in 91% response rate . to ensure reliability of the instrument ,
a pre - test was conducted using 20 respondents from ogobiri community within an interval of three weeks .
the test - retest at a three week interval period was subjected to a pearson correlation coefficient of 0.84 .
ethical approval for the study was obtained from the paramount ruler of the community amananaowei through the office of the public relations officer ( pro ) after a meeting with the council of chiefs to explain in detail the purpose of the study .
thereafter , respondents were briefed about the purpose of the study and their right to participate , or withdraw from the study .
data was analyzed using descriptive statistics of frequencies , percentages , and presented in table while inferential statistics of pearson s chi square ( x ) was used to establish associations between the variables with level of significance set at 0.05(5% ) .
statistical packages for social science ( spss version 20 ) was used to analyze the data .
table 1 shows that majority 135 ( 67.5% ) of the respondents were within the age range of 15 - 20 years , more than half 158 ( 79% ) were christian .
majority 170 ( 85% ) of the respondents were students while 86 ( 43% ) had tertiary education and 128 ( 64% ) of the respondents claimed to be sexually active while 72 ( 36% ) are not .
sociodemographic characteristics of the study participants ( n=200 ) table 2 shows that majority 173 ( 86.5% ) of respondents have heard of emergency contraceptive pills while 81 ( 46.8% ) of the respondents first heard of the emergency contraceptive pills from their friends , most 116 ( 58% ) of the respondents mentioned postinor-2 as a type of emergency contraceptive pills against other pills while 42 ( 21% ) did not mention any pills .
more than half 165 ( 82.5% ) of the respondents said that emergency contraceptive pills are used to prevent unwanted pregnancy and 138 ( 69% ) of them opined that emergency contraceptive pills is used within 72 hours of intercourse . majority 140 ( 70% ) of them said that emergency contraceptive pills are not used when pregnancy is suspected as against 60 ( 30% ) who disagreed .
respondents knowledge of emergency contraceptive pill ( n=200 ) table 3 shows that majority 102 ( 51% ) of the respondents agreed that they can use emergency contraceptive pills if need be .
more than half 149 ( 74.5% ) of the respondents disagreed to the opinion that emergency contraceptive pills are taken only by promiscuous girls .
majority 113 ( 56.5% ) of the respondents stated that emergency contraceptive pills are effective .
half 100 ( 50% ) of the respondents affirmed that emergency contraceptive pills should not be used by married couple only and that it is not sin to use emergency contraceptive pills .
most 112 ( 56% ) of the respondents agreed that emergency contraceptive pills will help to reduce abortion and its resultant effects .
attitude towards emergency contraceptive pills ( n=200 ) table 4 shows that 117 ( 58.5% ) of the respondents have never used any form of contraceptive pills .
more than half 139 ( 69.5% ) of the respondents have never used ecp , only 61 ( 30.5% ) have used it .
most 40 ( 78.4% ) of the respondents that have used it stopped because of heavy bleeding , 8 ( 15.7% ) stopped because they wanted to use other methods , while 3 ( 5.9% ) stopped because of nausea and vomiting .
forty ( 65.6% ) of the respondents used postinor-2 each time they had unprotected sex .
the 26 ( 42.6% ) of the respondents that have used emergency contraceptive pills reported that they were introduced to emergency contraceptive pills by their friends , 11 ( 18% ) mentioned health care provider while 18 ( 29.5% ) mentioned patent medicine vendor .
majority 139 ( 69.5% ) of the respondents said they dislike the use of emergency contraceptive pills because it can cause infertility later in future , while 50 ( 82% ) of the respondents that used emergency contraceptive pills used it because of fear of interruption of education .
utilization of emergency contraceptive pills ( ecp ) table 5 shows that majority 120 ( 60% ) of the respondents said that side effect of the drug , 153 ( 76.5% ) said concern about others opinion , 146 ( 73% ) said poor knowledge about the method , 116(58% ) said attitude of health care provider , 122 ( 61% ) said non legalization of abortion in nigeria , 155 ( 77.5% ) said parental attitude , 119 ( 59.5% ) said stigmatization associated with abortion , 134 ( 67% ) said availability , 147 ( 73.5% ) said accessibility and 146 ( 73% ) said peer influence are the factors responsible for the attitude of adolescents to emergency contraceptive pills .
factors influencing the utilization of emergency contraceptive pills ( n=200 ) table 6 shows that there was no significant relationship between the level of knowledge of respondents and their attitude towards emergency contraceptive pill , as well as level of knowledge and their utilization of emergency contraceptive pills with p value > 0.05 .
the study has assessed the knowledge , attitude and utilization of emergency contraceptive pills among female adolescents in amassoma community , bayelsa state .
result showed that the majority of the respondents were within the age range of 15 - 20 years . according to arowojolu and adekunle teenagers are the group mostly at risk of unplanned pregnancy following unprotected sexual intercourse .
akani et al , noted that young people are exposed early to unplanned and unprotected sexual intercourse leading to unwanted pregnancy with decreasing age of menarche and onset of sexual activity .
this contradicts the statement of mollen et al , that ecp is widely used in many countries and many women particularly adolescents are unaware of this pregnancy prevention option .
this contradicts tamire et al , in their study conducted in addis ababa university where the main source of information was the media .
more than half of the respondents knew one form of emergency contraceptive pill with postinor-2 being the most popular .
the result also showed that most of the respondents knew the recommended timeframe for the use and mode of action of emergency contraceptive pills .
however this is in contrast to parker statement that even where the concept of emergency contraception is known , knowledge of accurate use of the method is very low .
result of the study showed that most of the respondents agreed to the opinion that they can use emergency contraceptive pills if need be and that emergency contraceptive pills are not taken only by promiscuous girls or married couple .
moreover , half of the respondents affirmed that it is not a sin to use emergency contraceptive pills .
majority of the respondents also said that emergency contraceptive pills are effective and can help to reduce abortion and its resultant effect .
this shows that majority of the respondents have positive attitude towards emergency contraceptive pills usage .
the result of this study correlate with the finding of a similar study conducted by tesfaye , tilahun and girma that respondents have positive attitude towards emergency contraception pill .
our study showed that despite the fact that majority of the respondents are sexually active , more than half of them have never used emergency contraceptive pills .
this result corroborates the finding of okonofua , ( 1999 ) ; cited by aziken , okonta , and ande that contraceptive use among adolescents is low .
postinor-2 ( levonorgestrel ) was the most commonly used emergency contraceptive pills among respondents and majority of the respondents stopped using it because of side effect of heavy bleeding during menstruation and risk of infertility later in future .
majority of the respondents were introduced to emergency contraceptive pills by friends and preferred it because of its secrecy .
the finding of this study illustrated that there is low level of usage of emergency contraceptive pills which supported the findings of tesfaye , tilahun and girma who reported low usage of contraceptives despite positive attitude .
concern about what others may say , parental attitude , availability , accessibility and peer influences were the major factors identified by the respondents that influences the utilization of emergency contraceptive pills by adolescents .
this finding is in with lee and ogden that barriers to the use of emergency contraceptive pills exist , such as concerns about what others may think , concerns about adverse effects , a perceived threat to the woman s moral identity and the reluctance by health workers to provide the method because of the belief that they are abortificients.[10 , 14 ] in addition , parker stated that providers have biases and misconceptions which pose significant barriers to ecp use by adolescents .
some health care providers , parents , and policy - makers fear that adolescent knowledge or use of ecps may lead to more unprotected intercourse and a decrease in the use of a regular method of contraception .
findings of this study revealed that there was no significant relationship between the knowledge of respondents and their attitude towards emergency contraceptive pill , as well as knowledge and their utilization of emergency contraceptive pills with p value > 0.05 .
this implies that attitude and utilization are not influenced by the respondents level of knowledge of emergency contraceptive pills .
this study contradicts arowojolu and adekunle report that lack of utilization is due to poor knowledge and perception of the method and their effectiveness by youths .
adolescents need reliable information about and access to contraceptives in order to protect themselves from unintended pregnancies .
this information is important for all adolescents whether they are sexually active or abstaining from sex .
in addition , health care professionals especially nurses should organize enlightenment programs to educate adolescents , parents and the general public on adolescents contraceptives , since others opinion , parental attitude and accessibility were the major factors influencing utilization .
furthermore , in order for the adolescents to practice contraception , there is need to have counseling as well as confidential and safe services in a favorable environment , hence government should provide youth friendly services for the adolescents where they can have easy access to sexual and reproductive health issues including contraceptives .
most of the adolescents had low utilization of emergency contraceptive pills ( ecps ) despite their adequate knowledge and positive attitude.more than half of the adolescents in our study have never used ecps , although majority of them were sexually active.parental attitude , contraceptive availability , contraceptive accessibility , other people s opinions , and peer pressure were the major factors influencing utilization of ecps by adolescents in our study .
most of the adolescents had low utilization of emergency contraceptive pills ( ecps ) despite their adequate knowledge and positive attitude .
more than half of the adolescents in our study have never used ecps , although majority of them were sexually active .
parental attitude , contraceptive availability , contraceptive accessibility , other people s opinions , and peer pressure were the major factors influencing utilization of ecps by adolescents in our study .
Output:
| background and objective : risky sexual activity among adolescents is on the increase and contraceptive prevalence rate is low which is evidenced by high rate of teenage pregnancy in bayelsa state , nigeria .
this study assesses the adolescents knowledge , attitude and utilization of emergency contraceptive pills ( ecp ) in amassoma community , bayelsa state , in the niger delta region of nigeria.methods:the study was a descriptive cross - sectional research design .
a purposive sampling technique was used to select a sample of 220 respondents from the target population .
data were collected using a self - structured questionnaire .
descriptive and inferential statistics were used to analyze the data generated.results:majority of the respondents had high level of knowledge and positive attitude towards emergency contraceptive pills but had low level of utilization .
concerns about what others may say , parental attitude , contraceptive availability , contraceptive accessibility , and peer influences were the major factors that influenced the utilization of contraceptive pills .
there was no significant relationship between knowledge and utilization of emergency contraceptive pills , as well as level of knowledge and their utilization of emergency contraceptive pills.conclusions and global health implications : adolescents in the study were more likely to use emergency contraceptive pills , if parents and others reaction to adolescents contraceptive use were positive about those .
health care professionals , especially nurses , should organize enlightenment programs to educate adolescents , parents and the public on the benefits of adolescents contraceptives use , especially ecp . |
PubmedSumm6810 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 17-year - old boy sustained blunt trauma from a tennis ball to his left eye , 5 h before examination . only hand movements were perceivable and projection of light rays was accurate .
clinically , a full - thickness mh , sized 415 m , with coexistent macular detachment of height 458 m on optical coherence tomography ( oct ) examination ( stratus oct , carl zeiss meditec inc . ,
usa ) , was detected along with commotio retinae and widespread subretinal hemorrhages of the posterior pole and inferior retina [ fig .
examination by microperimetry ( mp-1 , nidek technologies srl , italy ) demonstrated reduced sensitivity of the macula to high - intensity light stimuli [ fig .
surgical intervention was contemplated . however , follow - up examination 3 days later surprisingly revealed that the mh had reduced in size to 218 m .
careful serial follow - up found complete closure of the mh and near complete resolution of the macular detachment 7 days after presentation [ fig . 2a and b ] .
three weeks posttrauma , the chorioretinal scarring and pigmentary changes at the macula were very prominent [ fig .
2d ] . significant atrophy and thinning of all the retinal layers was evident on oct examination ; the foveal thickness was 82 m [ fig .
large atrophic holes were noticed at this time in the inferior retina and were delimited by laser photocoagulation [ fig .
microperimetry , done with four - cross target because of poor fixation , reveals loss of perceived stimuli at the macula ( c ) .
the macular hole is smaller and the detachment shallower after 3 days ( d and e ) .
microperimetry shows absolute scotoma ( f ) seven days later , the macular hole is closed and the subretinal fluid nearly completely absorbed ( a and b ) .
three weeks later , the chorioretinal scarring is very prominent ( d and e ) .
two considerations relevant to the management of the present subject are , first , the mechanisms involved in the formation and closure of the traumatic mh and detachment , and second , whether a waiting period is advisable before undertaking any surgical repair . with respect to the first issue , the most important fact to understand is that the vitreous is very tightly adherent to the macula in young normal eyes , putting considerable stress upon this region when compression expansion of the globe occurs in a concussion injury .
most eyes with a traumatic mh have an attached vitreous.[68 ] oct imaging corroborates this finding lending credence to the belief that the pathogenesis of mh is independent of the occurrence of a posterior vitreous detachment ( pvd ) and occurs likely as an immediate mechanical disruption in a coup contrecoup injury .
delayed mh may however develop if pvd is incomplete , causing continued foveal traction , or due to contusion necrosis , or consequent to the formation and rupture of a foveal cyst.[57 ] a pvd was absent in our case and we believe that the hole occurred due to mechanical disruption as an immediate effect of concussion [ supplementary figs . 1 and 2 ] . a rd may occur due to the mechanical distortion that occurs between the retina and the vitreous ; loss of the retinal pigment epithelial ( rpe ) function and the hyperpermeability of retinal vessels consequent to the retinochoroidal concussion injury may be the important contributing factors .
vertical scan through the macula on optical coherence tomography at presentation showing discontinuous retinal pigment epithelium and a full - thickness macular hole - associated retinal detachment horizontal scan through the macula on optical coherence tomography at presentation showing discontinuous retinal pigment epithelium and a full - thickness macular hole - associated retinal detachment the mechanisms responsible for the spontaneous closure of a traumatic mh include proliferating glial cells and rpe cells from the edges that fill the hole ; formation of an epiretinal membrane that constricts the hole ; and reattachment of the operculum to the mh .
there was no operculum or membrane formation in our case but we expect the proliferating potential of the recovering glial and rpe cells to be high in our patient , considering his young age , which eventually led to the closure of the mh .
this mechanism is consistent with the histopathologic study of a surgically treated mh which was closed by bridging glial tissue .
a quick recovery of the rpe function in young eyes also ensures the rapid absorption of the subretinal fluid .
the resolution of the rd , simultaneous to the closure of the mh seems necessary for the successful resolution of both pathologies .
we observed these processes occurring concurrently in our patient , leaving anatomically resolved rd and mh within 7 days of presentation .
the time and need of surgical intervention is an open question with no available answer ; mhs and rds rarely arise simultaneously after trauma and therefore specific management guidelines are lacking .
traumatic mhs are known to close spontaneously and a period of observation till 6 months has been advised before undertaking a surgical repair .
chen et al . achieved retinal reattachment with the vitrectomy procedure and gas tamponade in seven patients out of eight who had traumatic mh - related rds .
recently , spontaneous resolution of a traumatic mh - related macular detachment , which occurred within 3 weeks , has been described in a young patient .
our patient experienced a complete closure of the mh and resolution of the macular detachment 1 week after the incident of trauma , young age and a relatively small size of the hole apparently being the factors responsible for a better anatomical outcome .
however , functional visual improvement failed to occur despite anatomical reattachment of the retina because of irreversible changes at the macula .
one must understand that functional and anatomical results may not correlate depending on the severity of the trauma ; the final va depends upon the degree of photoreceptor and rpe cell disruption .
immediate visual loss after injury due to retinal dehiscence is followed by a delayed visual loss due to secondary changes in the retinochoroidal layer [ supplementary fig .
besides this , our case illustrates that the spontaneous reattachment of a traumatic mh - related macular detachment is possible and a clear evidence of progressive clinical improvement entails a waiting period in the expectation of a spontaneous recovery .
fast macular thickness scan showed marked atrophy and thinning of the retina at the macula at 4 months following trauma
Output:
| the association of macular detachment with posttraumatic macular hole is a known but rare occurrence . spontaneously occurring resolution of the detachment and closure of the macular hole
has been reported only once in the literature .
we describe a similar rare event in a young male , the documentation of which was done serially by microperimetry ( mp ) and optical coherence tomography ( oct ) . a 17-year - old male presented with a decrease in vision following a closed globe injury to the left eye .
a coexisting macular hole and macular detachment were detected in the affected eye .
serial follow - up with oct and mp documented complete resolution of the macular hole and the macular detachment within 1 week of presentation .
the case highlights that spontaneous resolution of traumatic macular hole and related macular detachment may occur and a waiting period is advisable before undertaking any corrective surgical procedure .
the pathophysiologic mechanisms of causation and the resolution of posttraumatic macular hole - related retinal detachment are discussed . |
PubmedSumm6811 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: traumatic brain injury ( tbi ) accounts for more than one million admissions to emergency centers leading to more than 50,000 deaths as well as millions disabilities annually in the world .
both genders and different age subgroups can be affected by this problem with different mechanisms .
due to the necessity for proper management of these injuries , understanding pathophysiology , mechanisms , and also recent diagnostic and therapeutic modalities is certainly critical .
pathophysiologically , tbis can be classified as the primary with direct damaging the cerebrovascular tissues leading to direct neuronal injuries or the secondary to cerebral responses to other baseline pathological conditions such as cerebral edema , infections , hemorrhages , cerebral hypoxia , or increased intracranial pressure .
eventually , both types of injuries may result in ischemic or hemorrhagic cerebral events or neuronal death .
along with pathophysiological changes following brain injury , some changes have been also identified in molecular basis .
both primary and secondary mechanisms of injuries commonly generate reactive oxygen species ( ros ) that mediate oxidative stress leading to neural dysfunction and even neuronal death . in this regard ,
the excessive expression and production of ros following exhaustion of the endogenous antioxidant system can induce cellular and vascular peroxidation , dna cleavage , and inhibition of the mitochondrial electron transport chain in background of brain injuries .
in other words , because balanced production of ros is essential for brain enzymes activities and cell signaling , the imbalance between oxidants and antioxidants and thus excessive production of ros may be disrupted following injuries . thus , defense mechanisms based on controlling ros production and creating balance between oxidants and antioxidants are the main aim for controlling the cellular consequences resulting from brain trauma injuries .
it has been revealed that selenium dependent to glutathione ( gsh ) has a central antioxidant role that prevents cellular damages caused by ros excessive production .
in fact , gsh activity can modulate body selenium level by balancing ros that is necessary for preventing development of neural defects following brain injuries . based on these evidences ,
it is now suggested that intake of selenium supplements may bolster preventive mechanisms against cellular injuries caused by misbalancing between oxidants and antioxidants .
accordingly , the present study was carried out to examine this hypothesis that administration of selenium can prevent the development of injuries by brain trauma and thus can modulate patients functional recovery and also improve posttraumatic outcome .
after obtaining approval from the ethics committee of iran university of medical sciences ( ir .
iums.rec . 1394.9311692002 ) and also getting written informed consent in accordance with national legislation ( from the alert patients or from the patient 's legal representative for unconscious condition ) , this randomized double - blinded controlled trial was performed with irct registration number of irct2015090223865n1 .
the study population included the patients aged higher than 18 years that were hospitalized following brain trauma with glasgow coma scale ( gcs ) score 12 or less and with at least one pupil reaction to light .
the exclusion criteria were gcs of 3 , no bilateral pupil reaction to light , chance of live being of < 24 h , the presence of hypotension ( systolic blood pressure < 90 mmhg ) for more than 10 min , spinal cord injury , pregnancy , single epidural hematoma , or history of renal dysfunction .
the participants were randomly ( through simple randomization , according to the first right digit of national code that could be even or odd ) assigned into two groups as the case group ( that received selenium [ selenase , biosyn co. , germany ] 500 g intravenously at 100 ml normal saline for 30 min and then 500 g at 100 ml normal saline during 24 h continuously for 14 days in addition to standard care ) and the control group ( that benefited only from standard care ) .
the standard treatment in both groups consisted of respiratory support , prevention of seizure , fluid and electrolyte balancing , and prevention of stress ulcers and deep vein thrombosis . if there was evidence of cerebral edema in computed tomography ( ct ) scan , proper treatment ( head elevation , osmotic therapy , diuretic therapy , hyperventilation , analgesics , sedatives , and cerebrospinal fluid drainage ) was considered .
both infused solutions had similar color and volume ( 100 ml ) and were marked with code a or b. for all participants , acute physiology and chronic health evaluation ( apache ) iii score was determined on the 1 and 15 days . since the beginning of the study to 15 days , the level of consciousness was daily determined based on four score , and functional status of the organs was also determined on sequential organ failure assessment ( sofa ) score .
the patients were also assessed regarding selenium side effects including nausea , vomiting , nail changes , hair loss , the smell of garlic , and facial flushing .
the primary endpoint was to assess patients functional recovery in 60 10 days after tbi based on extended glasgow outcome scale ( gos - e ) scale . in this scaling system ,
the recovery was leveled as e1 ( death ) , e2 ( vegetative status ) , e3 and e4 ( severe disability ) , e5 and e6 ( moderate disability ) , and e7 and e8 ( good recovery ) .
appropriate recovery was defined as gos - e 7 in patients with moderate injuries ( gcs of 912 ) , gos - e 5 in patients with moderate to severe injuries ( gcs of 68 ) , and gos - e 3 in patients with severe injuries ( gcs of 4 or 5 ) .
the second endpoint was to determine and compare the change in apache iii score on the 15 day compared to the 1 day , the daily changes in four score and sofa score within 15 days of first interventions , side effects of selenium , length of intensive care unit ( icu ) stay , and length of hospital stay between the two groups . for statistical analysis ,
results were presented as mean standard deviation for quantitative variables and were summarized by absolute frequencies and percentages for categorical variables .
categorical variables were compared using chi - square test or fisher 's exact test when more than 20% of cells with expected count of < 5 were observed .
quantitative variables were also compared with t - test or mann whitney u - test .
for the statistical analysis , the statistical software spss version 16.0 for windows ( spss inc . , chicago , il , usa ) was used .
after obtaining approval from the ethics committee of iran university of medical sciences ( ir .
iums.rec . 1394.9311692002 ) and also getting written informed consent in accordance with national legislation ( from the alert patients or from the patient 's legal representative for unconscious condition ) , this randomized double - blinded controlled trial was performed with irct registration number of irct2015090223865n1 .
the study population included the patients aged higher than 18 years that were hospitalized following brain trauma with glasgow coma scale ( gcs ) score 12 or less and with at least one pupil reaction to light .
the exclusion criteria were gcs of 3 , no bilateral pupil reaction to light , chance of live being of < 24 h , the presence of hypotension ( systolic blood pressure < 90 mmhg ) for more than 10 min , spinal cord injury , pregnancy , single epidural hematoma , or history of renal dysfunction .
the participants were randomly ( through simple randomization , according to the first right digit of national code that could be even or odd ) assigned into two groups as the case group ( that received selenium [ selenase , biosyn co. , germany ] 500 g intravenously at 100 ml normal saline for 30 min and then 500 g at 100 ml normal saline during 24 h continuously for 14 days in addition to standard care ) and the control group ( that benefited only from standard care ) .
the standard treatment in both groups consisted of respiratory support , prevention of seizure , fluid and electrolyte balancing , and prevention of stress ulcers and deep vein thrombosis . if there was evidence of cerebral edema in computed tomography ( ct ) scan , proper treatment ( head elevation , osmotic therapy , diuretic therapy , hyperventilation , analgesics , sedatives , and cerebrospinal fluid drainage ) was considered .
both infused solutions had similar color and volume ( 100 ml ) and were marked with code a or b.
for all participants , acute physiology and chronic health evaluation ( apache ) iii score was determined on the 1 and 15 days . since the beginning of the study to 15 days
, the level of consciousness was daily determined based on four score , and functional status of the organs was also determined on sequential organ failure assessment ( sofa ) score .
the patients were also assessed regarding selenium side effects including nausea , vomiting , nail changes , hair loss , the smell of garlic , and facial flushing .
the primary endpoint was to assess patients functional recovery in 60 10 days after tbi based on extended glasgow outcome scale ( gos - e ) scale . in this scaling system ,
the recovery was leveled as e1 ( death ) , e2 ( vegetative status ) , e3 and e4 ( severe disability ) , e5 and e6 ( moderate disability ) , and e7 and e8 ( good recovery ) .
appropriate recovery was defined as gos - e 7 in patients with moderate injuries ( gcs of 912 ) , gos - e 5 in patients with moderate to severe injuries ( gcs of 68 ) , and gos - e 3 in patients with severe injuries ( gcs of 4 or 5 ) .
the second endpoint was to determine and compare the change in apache iii score on the 15 day compared to the 1 day , the daily changes in four score and sofa score within 15 days of first interventions , side effects of selenium , length of intensive care unit ( icu ) stay , and length of hospital stay between the two groups .
for statistical analysis , results were presented as mean standard deviation for quantitative variables and were summarized by absolute frequencies and percentages for categorical variables .
categorical variables were compared using chi - square test or fisher 's exact test when more than 20% of cells with expected count of < 5 were observed .
quantitative variables were also compared with t - test or mann whitney u - test . for the statistical analysis , the statistical software spss version 16.0 for windows ( spss inc . , chicago , il , usa ) was used .
in total , 113 patients were randomized to two selenium ( n = 57 ) and control ( n = 56 ) groups [ table 1 ] . the two groups were similar in male gender ( 78.9% vs. 80.4% , p = 0.85 ) and mean age ( 40.07 17.82 vs. 42.93 17.19 years , p = 0.38 ) . the most frequent cause of brain trauma in selenium and control groups included traffic accident ( 71.9% vs. 71.4% ) , followed by falling ( 21.1% vs. 17.9% ) , dispute ( 3.5% vs. 5.4% ) , and other causes ( 3.5% vs. 5.4% ) without between - group difference ( p = 0.90 ) . the frequencies of single brain and multiple trauma were 77% and 23% in selenium group and 75% and 23% in control group with no difference ( p = 0.66 ) .
there was no difference in the mean gcs score at baseline between selenium group ( 8.00 2.23 ) and control group ( 8.32 2.31 ) ( p = 0.68 ) .
regarding severity of injury in case and control groups , severe injury was found in 15.8% and 12.5% , moderate - to - severe injury in 43.9% and 39.3% , and moderate injury in 40.4% and 48.2% , respectively ( p = 0.68 ) .
there was also no difference in mean size of pupils at left- and right - sided as well as reaction to light [ table 1 ] .
the frequency of brain edema in selenium group was 35.1% and in control group was 28.6% with no difference ( p = 0.45 ) .
there was also no difference between the groups in marshall scoring at the first ct scan , craniotomy , external ventricular drainage , and mean blood pressure .
the mean time for mechanical ventilation was 8.44 8.09 days in selenium group and 9.30 11.20 days in another group ( p = 0.63 ) .
there was also no difference in mean length of icu stay ( 14.51 8.01 vs. 15.91 13.24 days , p = 0.49 ) as well as in mean length of hospital stay ( 19.40 8.76 vs. 20.04 13.14 days , p = 0.76 ) between the group received selenium and the group received routine treatment alone . as shown in figure 1 , the mean four score gradually increased from the 1 day to the 15 day without difference in the trend of the changes between the selenium and control groups .
adversely , the mean sofa score gradually decreased within 15 days of first interventions without any between - group difference [ figure 2 ] .
the mean apache iii score on the 1 and 15 days in selenium group was 49.91 17.12 and 30.55 17.32 and in control group was 49.34 18.13 and 25.50 15.60 with no difference between groups ( p = 0.86 and p = 0.16 ) , respectively .
with respect to drug - induced side effects , nausea was found in one patient and facial flushing in three patients who receiving selenium . in total , 15.8% in selenium group and 19.6% in control group died ( p = 0.59 ) .
the mortality rate in selenium and control group was 66.7% and 42.9% in severe injuries ( p = 0.34 ) , 0.0% and 13.6% in moderate - to - severe injuries ( p = 0.56 ) , and 13.0% and 18.5% in moderate injuries ( p = 59 ) , respectively . as indicated in table 2 , no difference was revealed between the two interventional groups in appropriate outcome according to gos - e score at 60 10 days and also 30 5 days according to the severity of traumatic injury . in this
regard , severe disability was revealed 42.1% and 41.1% and good recovery in 24.6% and 19.6% of patients in selenium and control group , respectively , with no significant difference .
baseline information in selenium and control groups trend of the changes in four score in selenium and control groups .
trend of the changes in sequential organ failure assessment score in selenium and control groups .
because of beneficial effects of selenium use in balancing oxidants and antioxidants and thus its impact on regulating ros function , we hypothesized that administrating selenium as intravenous infusion might improve outcome in patients who were hospitalized due to tbis .
in other words , along with standard supportive protocols and treatment approaches in these patients , using intravenous selenium on admission may lead to lower mortality and morbidity . in the present study , administration of 500 g selenium per day for
14 days in addition to standard treatment could not change patients outcome including functional recovery , mean time for mechanical ventilation , level of consciousness , and also living status and length of hospital and icu stay .
as previously pointed , tbi as a main reason for mortality and disability in the world has been identified as a progressive disorder with primary defects such as intracranial hemorrhage , contusion , or diffuse cerebral defects after trauma led to secondary injuries .
the basis of metabolic disturbances includes the production of free oxygen radicals , stimulatory amino acids ( aspartate and glutamate ) , inflammatory cytokines ( interleukins 1 and 6 [ il 1 and 6 ] and tumor necrosis factor - alpha ) , and finally brain edema and tissue damages . despite employing different treatment protocols for improving outcome of traumatic injuries , most clinical trials with the purpose of inhibiting secondary factors such as lipid peroxidation ( steroids and tirilazad ) , free radicals ( superoxide dismutase ) , calcium channel blocking ( nimodipine ) , glutamate ( selfotel ) , apoptosis ( cyclosporine a ) , and edema ( substance p antagonists ) had limited success .
the present study is the first human clinical trial that assessed the therapeutic effect of selenium .
previous studies were carried out as animal studies that could show significant effects of selenium as brain tissue support . in a recent study by naziroglu et al . , it was shown that selenium as a thiol redox system antioxidant can protect brain tissue against inflammation and stress oxidative .
they could show that the effect of selenium can be induced by affecting apoptosis , oxidative stress , and ca ( 2 + ) influx through trpv1 channel activations in brain tissue , particularly in the hippocampus . in another study by senol et al .
, the lipid peroxidation and il-1 values were decreased by selenium treatments , whereas plasma levels of il-4 , brain cortex gsh , total antioxidant status , and vitamin c and e values were increased by administrating selenium .
yeo and kang also indicated that selenite potentially inhibited h2o2-induced apoptosis of neural progenitor cells in tbi .
this in vivo protective function could be associated with inhibition of h2o2-induced ros generation , cytochrome c release , and caspase-3 and -9 activation .
considering significant effects of selenium use on critical ill conditions and its positive effects on diseases outcome , the lack of association between selenium use and outcome of tbis might be related to using low dosages of selenium and considering short follow - up time .
thus , to ensure the beneficial effects of drug , further studies with administrating different selenium dosages and with longer follow - up times are essential .
this human trial study could not demonstrate beneficial effects of intravenous infusion of selenium in the improvement of outcomes in patients with acute tbi .
Output:
| aim : the present study was carried out to examine this hypothesis that administration of selenium can prevent the development of injuries by brain trauma and thus can modulate patients functional recovery and also improve posttraumatic outcome.materials and methods : this double - blinded controlled trial was carried out on 113 patients who were hospitalized following traumatic brain injury ( tbi ) with glasgow coma scale score of 412 that were randomly assigned to receive selenium within 8 h after injury plus standard treatment group or routine standard treatment alone as the control .
the primary endpoint was to assess patients functional recovery at 2 months after the injury based on extended glasgow outcome scale score ( gos - e ) .
secondary outcomes included the changes in full outline of unresponsiveness score ( four ) score , sequential organ failure assessment ( sofa ) score , and acute physiology and chronic health evaluation ( apache ) iii score , side effects of selenium , length of intensive care unit ( icu ) stay , and length of hospital stay.results:there was no difference in the length of icu and hospital stay , the trend of the change in four and sofa scores within 15 days of first interventions , and the mean apache iii score on the 1st and 15th days between the two groups .
mortality was 15.8% in selenium group and 19.6% in control group with no between - group difference .
no difference was revealed between the two groups in appropriate outcome according to gos - e score at 60 10 days and also 30 5 days according to the severity of tbi.conclusion:this human trial study could not demonstrate beneficial effects of intravenous infusion of selenium in the improvement of outcomes in patients with acute tbi . |
PubmedSumm6812 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in the past decade , geographic information systems ( gis ) have become an innovative and somewhat crucial tool for analysing relationships between public health data and environment . according to longley et al .
( 2005 ) , a gis is an application - led technology , which can be used , in this instance , for monitoring and understanding observed spatial distribution of attributes such as the geography of environmental health .
thus , it is required to transpose data stored in a health care related database to a spatial related database , assigning to each record a univocal spatial location ( x , y coordinates ) .
its role continues to grow and evolve as new forms of geocoding emerge and as geocoded data are applied to an ever - diverse set of spatially based investigations .
geocoding technology has been applied in many fields : social , political , and economic and more recently in public health research and practice . in general , these applications are related to interpolation rather than matching .
the literature provides many examples focused on the surveillance of infectious and chronic diseases [ 3 - 5 ] , environmental exposures [ 6 , 7 ] , drinking water epidemiology [ 8 , 9 ] and pharmacoepidemiology . in general
, the limitation is the spatial accuracy of the geographic location computed for any particular subject .
accuracy represents an important issue particularly in italy due to the complexity of the address name and street morphology .
address complexity and street morphology depend on historical heritage of italy , so georeferencing requires additional manipulation of place names data . in this scenario , the improvement of geocoding accuracy plays a key role in developing a reliable tool for public health research in italy .
the main aim of this paper is to describe the procedures involved in the conversion from database collected data into geocoded dots representing a health event , in order to display the spatial distribution of five major chronic - degenerative diseases within the rovigo local health unit ( ulss n.18 ) in the rovigo province ( veneto region - north italy ) .
the highly accurate geographic localization of patients , served by the local health unit , will widen the range of opportunities for further spatial analysis and modelling , such as environmental related hazard or monitoring the prevalence of certain diseases through time , gender or age .
this paper therefore provides a step - by - step instructions on the standardization of address elements specific for italian language and traditions
. a description of the methodology involved in the geocoding process will be as crucial as outlining some guidelines for a standardized method , strongly required for the data collection component , involving local addresses .
this study , though focusing on the local health unit of rovigo , could be taken as a benchmark for developing a standardized national data - acquiring format .
the local health unit of rovigo ( ulss n.18 ) has collected data on their catchment area , made up of 41 municipalities , over a period of 10 years , starting from 2001 up to 2010 , and stored it in microsoft access database format , for 268,517 records ( fig .
it is crucial to understand that 268,517 is the total amount of records collected in the above - mentioned period , while the population census , provided by the national institute of statistics ( istat ) at 1 of january 2011 was 175.816 persons residing in those 41 municipalities . for this study 's purpose ,
the year 2010 has been chosen as sample group , hence the provided data had to be checked and sorted carefully . by means of sql query language ,
a sequence of selection criteria has been applied on the original database and the amount of valid records significantly shrank , from 268,517 to 178,183 .
this decrement is ascribed to the number of subjects whose status was ' deceased ' or ' transferred ' to a different ulss up to the 31 of december 2009 , as well as to those subjects who have their domicile outside the ulss of rovigo . to obtain a consistent sample ,
it has been decided to remove those subjects having a residence address within the ulss of rovigo , yet having their permanent address outside of it .
forthcoming analysis will use this data for mapping and clustering health events associated to environmental hazards , therefore it is assumed that domicile related data has a greater deal of truthfulness compared to residence data .
the difference of 2,367 subjects between the census data and the collected data lies in the amount of persons residing in a different municipality , though attending to the local health unit of rovigo . for personal data protection policy , a progressive sequential unique identifier , linking to a different database ,
further information stored were gender , date of birth and mostly important , an alphanumerical code ( tax code ) for personal and unambiguous identification issued by the national health service ( nhs ) .
moreover , a numeric code is included , which identifies the current status of patients within the local health unit ( lhu ) , for instance , if the patient is active , transferred to a different ulss or dead .
the geocoding process involves converting a string information , such as a street names , town or place name , into geographic features located on the earth 's surface , which can be spatially displayed within a gis .
finding good quality up - to - date reference data becomes a crucial point , hence different commercially available street network databases have been weighed .
the map service , named world street map 2010 , provided by the environmental research system institute ( esri , redlands , ca ) , and arcmap 10.0 by esri were , respectively , the reference data and the gis software , employed in the geocoding process . within the tools available for geocoding , the geocode address tool was implemented as it allows for the geocoding of a table of addresses .
however , in order to match the addresses in the input table , this tool needs to link to the reference data using a service provided by the esri address locator .
it was opted for the ta_address _ eu.geocodeserver locator , specific for the european zone , where the domicile address is parsed into 4 syntactic components . the fields required by the operation are : address : street name with suffix type ( e.g. road , avenue , boulevard ) and house number .
the result of a geocoding process is an output table returning the addresses with a score of the probability of having matched the correct location .
in fact , geocoding is a probabilistic system , where each field participating in the linkage comparison is subject to error and is measured by the probability that the field agrees versus the probability of chance agreement of its values .
consequently , two fields are generated in the output table showing the match type and the score : the former indicates whether there was a match ( m ) , an unmatched result ( u ) , or tied results ( t ) , which requires to be manually checked by the operator . on the other hand ,
the score is expressed as the percentage of having identified the best possible candidate of the address within the reference data .
for the manual localization of those addresses not matched automatically , a wide range of open source resources have been employed ( tab .
the local health unit of rovigo ( ulss n.18 ) has collected data on their catchment area , made up of 41 municipalities , over a period of 10 years , starting from 2001 up to 2010 , and stored it in microsoft access database format , for 268,517 records ( fig .
it is crucial to understand that 268,517 is the total amount of records collected in the above - mentioned period , while the population census , provided by the national institute of statistics ( istat ) at 1 of january 2011 was 175.816 persons residing in those 41 municipalities . for this study 's purpose ,
the year 2010 has been chosen as sample group , hence the provided data had to be checked and sorted carefully . by means of sql query language ,
a sequence of selection criteria has been applied on the original database and the amount of valid records significantly shrank , from 268,517 to 178,183 .
this decrement is ascribed to the number of subjects whose status was ' deceased ' or ' transferred ' to a different ulss up to the 31 of december 2009 , as well as to those subjects who have their domicile outside the ulss of rovigo . to obtain a consistent sample ,
it has been decided to remove those subjects having a residence address within the ulss of rovigo , yet having their permanent address outside of it .
forthcoming analysis will use this data for mapping and clustering health events associated to environmental hazards , therefore it is assumed that domicile related data has a greater deal of truthfulness compared to residence data .
the difference of 2,367 subjects between the census data and the collected data lies in the amount of persons residing in a different municipality , though attending to the local health unit of rovigo . for personal data protection policy , a progressive sequential unique identifier , linking to a different database ,
further information stored were gender , date of birth and mostly important , an alphanumerical code ( tax code ) for personal and unambiguous identification issued by the national health service ( nhs ) .
moreover , a numeric code is included , which identifies the current status of patients within the local health unit ( lhu ) , for instance , if the patient is active , transferred to a different ulss or dead .
the geocoding process involves converting a string information , such as a street names , town or place name , into geographic features located on the earth 's surface , which can be spatially displayed within a gis .
finding good quality up - to - date reference data becomes a crucial point , hence different commercially available street network databases have been weighed .
the map service , named world street map 2010 , provided by the environmental research system institute ( esri , redlands , ca ) , and arcmap 10.0 by esri were , respectively , the reference data and the gis software , employed in the geocoding process . within the tools available for geocoding ,
the geocode address tool was implemented as it allows for the geocoding of a table of addresses .
however , in order to match the addresses in the input table , this tool needs to link to the reference data using a service provided by the esri address locator .
eu.geocodeserver locator , specific for the european zone , where the domicile address is parsed into 4 syntactic components . the fields required by the operation are : address : street name with suffix type ( e.g. road , avenue , boulevard ) and house number .
the result of a geocoding process is an output table returning the addresses with a score of the probability of having matched the correct location .
in fact , geocoding is a probabilistic system , where each field participating in the linkage comparison is subject to error and is measured by the probability that the field agrees versus the probability of chance agreement of its values .
consequently , two fields are generated in the output table showing the match type and the score : the former indicates whether there was a match ( m ) , an unmatched result ( u ) , or tied results ( t ) , which requires to be manually checked by the operator . on the other hand ,
the score is expressed as the percentage of having identified the best possible candidate of the address within the reference data .
for the manual localization of those addresses not matched automatically , a wide range of open source resources have been employed ( tab .
the first attempt of geocoding produced a poor quality result having about 60% of the addresses tied while only 40% matched .
after having manually verified those records it was noticed that although the street name was present in both , the reference data and the input table , it was spelled the other way round .
a procedure of manual standardization was performed in the input table , so that all the streets name were spelled correspondingly to those in the reference data . after carrying out the previously mentioned adaptations ,
the result of the geocoding had significantly improved , reaching almost 98% of matched ( m ) records and 2% of tied ( t ) records , yet this outcome does not reflect the real precision of the result .
in fact , as previously explained , the address is parsed into 4 components , and a match ( m ) result is achieved every time just 2 of these are met by the query . as a result ,
3 different levels of matching precision have been identified , depending on the number of the address components available during the geocoding process .
therefore , when merely the city and country fields are matched the m type is specified as eu_city.ita ; likewise eu_postcity.ita identifies those records where only the postcode and country proved to correspond , whilst eu_streetname.ita refers to those record matched at a street name level . as shown in table
ita addresses matched is 90.9% while the addresses geocoded at a city and postcode level are respectively 0.18% and 6.8% .
successively , addresses matched at a street name level , were weighed against the score achieved during geocoding .
locations that yield a score of 90 were considered a good match whilst those with score 89 , approximately 9,700 records , required be checking individually and adjusting by hand . though assuming the correctness of those 151,221 results having a match at a street name level and a score 90 , it was opted to verify if the addresses did actually coincide with the true location on the map . for this purpose ,
the municipality of rovigo was chosen as the sample unit , since it is the largest municipality with the highest number of people attending to the lhu .
the 32% of the above mentioned addresses , that is roughly 48,000 patients , fall within the administrative boundaries of rovigo and their geometry has been checked using the intersect tool of arcinfo .
the point feature class , representing the patients ' domicile , was intersected with the line feature class of all the road segment attributes , and a new point feature dataset was generated which includes , for each address , the name of the street segment that was overlapped .
after carrying out a sql query on 48,615 records , as many as 9,165 patients appeared to have the domicile address matched to the wrong street segment
. however , after a double - check it was realized that differences were caused mainly by the presence / absence of the apostrophe , article or capital letters in the street 's name , yet the correctness of the match was not compromised .
only 324 records , equal to the 0.7% , were wrongly matched since the error was caused by the street names , in the line feature class , being more up - to - date than the address associated to the patient 's domicile stored in the lhu database .
on the other hand , a procedure of manual geocoding had to be carried out for those addresses with a city or postcode level match ( m ) , for a total amount of 12,451 patients .
that is to say , the geocoding process was not able to assign a street segment to the address , therefore positioned the patient 's location at the geometric center of the municipality .
this entailed to seek for the correct coordinates by means of several web mapping service applications , online telephone directories and , in the most difficult cases , even by contacting the municipality office .
furthermore , all results with a tied ( t ) match type were assessed individually to remove any uncertainty ; for this , only 447 proved wrongly geocoded and the right coordinates have been assigned manually .
the guiding principles , which should be pursued for preparing data for geocoding , are summarized and exposed in table iii .
these , however , do referred strictly to the esri world street map web service , used as the main reference data , to which addresses should conform .
the result of having a high detail geocoded population could increase the perception and comprehension of the distribution of any given health event , thus allowing for an administrative boundless view .
as showed in figure 2 , the population density can be represented with neat lines , according to the municipality geographical layout ( fig .
2 part a ) , or boundless , that is to say representing any event , in this case the permanent address of the case study subjects , with no constrains associated to human made frontiers ( fig .
this instance could be applied when mapping the spatial distribution of some chronic - degenerative diseases , such as asthma , and analyzing if a given pattern could be linked to an environmental hazard , such as air pollution or the proximity to dumps , industries , incinerator , etc .
the prospect of a wide range of spatially related health analysis , such as disease clustering and risk exposure to environmental hazards , on a large number of patients , was the leading endeavor of this project . out of the 286,517 records provided by the local health unit of rovigo ,
178,183 had the prerequisites for being assessed in this study , having lost 2% due to void entries in the database and 31.6% of the data being irrelevant for the study area . the standardization procedures of the address database , produced a result of 162,103 matched and 3,605 tied addresses , both at a street name level , equal to the 93% of all records . for the remaining 7% , that is 12,475 addresses , matched or tied at a city or postcode level , the geocoding had to be performed manually by the operator , using a wide range of open source data and , if necessary , with the aid of the municipalities involved .
the geocoding process revealed a dearth of homogeny between the address labeling used by the local health unit , during the registration procedures of patients , and the label attributes of the street segments in the reference data .
in particular , there was a conflicting approach in using abbreviations for streets named after saints , clergy characters and military ranks , as well as the reverse writing of historical figures names , for instance , surnamename order in the input data and name - surname order in the reference data .
furthermore , streets named in memory of historical dates were written in arabic numeral and in roman numeral , respectively . overall , a lack of consistency in the approach of storing personal data has emerged . in particular ,
the street prefixes were stored with a variety of abbreviations leading to ambiguity . as far as the street name is concerned ,
the name and the title , when included , should not be shortened , as it will result in misspelling errors or in homonymy .
with respect to the municipality details , a few points should be considered : firstly , the name should be written in full length to avoid false mismatch and , secondly , it should always be coupled to the postcode . unlike in the united states , where the u. s. postal service ( usps ) uses a zoning improvement plan ( zip ) code as a postal addressing standard , in italy the post code does not serve as an unambiguous identifier , hence more than one municipality can have the same post code .
health data should be collected originally with compliance to a set of well - defined parameters , if possible using a menu - driven interface with drop - down lists to facilitate users by selecting among a list of pre - compiled values . misspelling errors of streets , for instance ,
could be reduced considerably , as well as gross inconsistencies between the municipalities ' name and postcodes .
the national health service ( ssn ) should consider acquiring a common program and standardize parameters to collect health data .
the main achievement was to outline some of the difficulties encountered during the geocoding of health data and to put forward a set of guidelines that could be useful to facilitate the process and enhance the quality of the results .
first , given the massive amount of records that had to be geocoded , it was opted to ignore the house number , as it would introduce an additional time consuming and labor - intensive effort to locate manually the wrongly matched addresses .
georeferencing with street centerline data can affect location accuracy , since it introduces many assumptions including the equal parsing of addresses along a road network and the uniform distancing of houses from the road network .
second , there was no possibility to account for the positional accuracy of the results obtained by the use of the esri streetmap as reference data . accordingly to zhan et al .
( 2006 ) , the validity of epidemiologic research depends on the match rate of geocoding ( the percentage of addresses geocoded ) , as well as the positional accuracy of locations of geocoded addresses .
thus , in this study it was not possible to calculate the positional accuracy , defined as the difference between the geographic location of a geocoded address and the ' ' true '' ground location of that address determined by using a field survey method , i.e. , surveying using a global positioning system ( gps ) device . according to a recent study , the current state - of - practice lacks of standard resources for geocoding , geocoding accuracy assessment , and for evaluating the impacts of geocoding error on public health decisions .
even though in the last decade several studies have been carried out on the accuracy of geocoded data [ 14 , 17 , 18 ] . no studies have addressed the completeness and accuracy of the reference street network database in italy . as a matter of fact , no research has been found in literature which evaluates the topic of geocoding methods in this country , although implementing address coded data in epidemiology research is becoming rather frequent [ 19 , 20 ] .
the research project will now proceed by evaluating risk exposure to environmental hazards , for instance air pollution , and the spatial distribution of some chronic - degenerative diseases , such as asthma , linking health data to the georeferenced patients in the local health unit of rovigo .
the main achievement of this study was to outline some of the difficulties encountered during the geocoding of health data and to put forward a set of guidelines that could be useful to facilitate the process and enhance the quality of the results .
health data should be collected originally with compliance to a set of well - defined parameters , if possible using a menu - driven interface with drop - down lists to facilitate users by selecting among a list of pre - compiled values and avoid misspelling bias .
public health informatics represents an emerging specialty that highlights on the application of information science and technology to public health practice and research .
therefore , this study could draw the attention of the national health service of italy to the underestimated problem of geocoding accuracy in health related data for environmental risk assessment .
Output:
| summaryintroduction.geographic information systems ( gis ) have become an innovative and somewhat crucial tool for analyzing relationships between public health data and environment .
this study , though focusing on a local health unit of northeastern italy , could be taken as a benchmark for developing a standardized national data - acquiring format , providing a step - by - step instructions on the manipulation of address elements specific for italian language and traditions.methods.geocoding analysis was carried out on a health database comprising 268,517 records of the local health unit of rovigo in the veneto region , covering a period of 10 years , starting from 2001 up to 2010 . the map service provided by the environmental research system institute ( esri , redlands , ca ) , and
arcmap 10.0 by esri were , respectively , the reference data and the gis software , employed in the geocoding process.results.the first attempt of geocoding produced a poor quality result , having about 40% of the addresses matched .
a procedure of manual standardization was performed in order to enhance the quality of the results , consequently a set of guiding principle were expounded which should be pursued for geocoding health data .
high - level geocoding detail will provide a more precise geographic representation of health related events.conclusions.the main achievement of this study was to outline some of the difficulties encountered during the geocoding of health data and to put forward a set of guidelines , which could be useful to facilitate the process and enhance the quality of the results .
public health informatics represents an emerging specialty that highlights on the application of information science and technology to public health practice and research .
therefore , this study could draw the attention of the national health service to the underestimated problem of geocoding accuracy in health related data for environmental risk assessment . |
PubmedSumm6813 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: cryoballoon pulmonary vein isolation ( pvi ) has emerged as an alternative to radiofrequency pvi in the treatment of drugresistant atrial fibrillation ( af ) .
cryoballoon pvi , compared with radiofrequency pvi , offers potential advantages , including shorter procedure times,1 , 2 , 3 decreased hospital length of stay,1 and decreased fluoroscopy time.3 the data are limited that define the major complication rate of cryoballoon pvi .
additionally , previous literature identifies phrenic nerve injury ( pni ) as the most frequent complication of cryoballoon pvi.4 , 5 , 6 , 7 , 8 , 9 methods including monitoring diaphragmatic electromyographic signals with compound motor action potential ( cmap)10 , 11 , 12 , 13 , 14 and immediate balloon deflation15 have been described to help detect pni and decrease its incidence and longterm persistence .
identifying predictors of major complications and pni will assist in patient selection for this procedure .
the study population included 450 consecutive patients undergoing cryoballoon pvi for af at the university of pittsburgh medical center between august 2011 and august 2015 as part of a prospective registry .
baseline clinical characteristics and detailed medical history , including specific af history , were recorded for all patients .
all patients underwent preprocedural cardiac computed tomography to assess pulmonary venous anatomy and transesophageal echocardiography to rule out intracardiac thrombus .
the cryoballoon pvi procedure has been previously described in detail.16 , 17 , 18 in brief , all ablation procedures were performed with the patient under general anesthesia , avoiding paralytic agents after induction to allow monitoring of phrenic nerve function .
all cases were performed by using the arctic front cryoballoon ( medtronic ) via a transseptal approach . for most cases , after confirming pulmonary vein occlusion via venography , two 180 to 240second lesions were applied in each pulmonary vein and additional lesions were applied if conduction persisted .
isolation was confirmed through elimination or dissociation of pulmonary vein potentials , differential pacing maneuvers , and high output pacing within the pulmonary veins to confirm exit block . for the rightsided pulmonary veins
, pacing was performed from the superior vena cava ( svc ) to monitor phrenic nerve function , and ablation was immediately terminated with any decreased diaphragmatic excursion .
cmap monitoring10 , 11 , 12 , 13 , 14 , 19 and immediate balloon deflation15 were used in a subset of patients once these techniques were described .
anticoagulation during the procedure was with intravenous heparin to maintain an activated clotting time of 300 to 400 seconds .
for patients on warfarin , the procedure was performed with an international normalized ratio 1.5 to 2.5 and for novel oral anticoagulants , the agent was held 1 to 2 days before the procedure and usually restarted 6 hours after the procedure .
patient followup was as per standard protocol with outpatient visits at 6 weeks , 3 months , 6 months , 1 year , and yearly thereafter postprocedure . at the time of the procedure ,
in addition , retrospective chart review of all procedure notes , hospitalizations , office visits , and emergency department visits was performed to assess for additional complications postprocedure .
predefined major complications were persistent pni , symptomatic pericardial effusion , deep vein thrombosis , arteriovenous fistula , atrioesophageal fistula , major bleeding , stroke , or death .
persistent pni was defined as pni that persisted or occurred beyond discharge from the electrophysiology laboratory , while episodes of pni that resolved before discharge from the laboratory without recurrence were termed
identification of complications was based on objective evidence of any of the predefined complications or after workup of new symptoms postprocedure .
variables found to be associated with the outcomes in univariable analyses at p<0.2 were selected for multivariable analyses .
the study population included 450 consecutive patients undergoing cryoballoon pvi for af at the university of pittsburgh medical center between august 2011 and august 2015 as part of a prospective registry .
baseline clinical characteristics and detailed medical history , including specific af history , were recorded for all patients .
all patients underwent preprocedural cardiac computed tomography to assess pulmonary venous anatomy and transesophageal echocardiography to rule out intracardiac thrombus .
the cryoballoon pvi procedure has been previously described in detail.16 , 17 , 18 in brief , all ablation procedures were performed with the patient under general anesthesia , avoiding paralytic agents after induction to allow monitoring of phrenic nerve function .
all cases were performed by using the arctic front cryoballoon ( medtronic ) via a transseptal approach . for most cases , after confirming pulmonary vein occlusion via venography , two 180 to 240second lesions were applied in each pulmonary vein and additional lesions were applied if conduction persisted . isolation was confirmed through elimination or dissociation of pulmonary vein potentials , differential pacing maneuvers , and high output pacing within the pulmonary veins to confirm exit block . for the rightsided pulmonary veins ,
pacing was performed from the superior vena cava ( svc ) to monitor phrenic nerve function , and ablation was immediately terminated with any decreased diaphragmatic excursion .
cmap monitoring10 , 11 , 12 , 13 , 14 , 19 and immediate balloon deflation15 were used in a subset of patients once these techniques were described .
anticoagulation during the procedure was with intravenous heparin to maintain an activated clotting time of 300 to 400 seconds .
for patients on warfarin , the procedure was performed with an international normalized ratio 1.5 to 2.5 and for novel oral anticoagulants , the agent was held 1 to 2 days before the procedure and usually restarted 6 hours after the procedure .
patient followup was as per standard protocol with outpatient visits at 6 weeks , 3 months , 6 months , 1 year , and yearly thereafter postprocedure . at the time of the procedure ,
in addition , retrospective chart review of all procedure notes , hospitalizations , office visits , and emergency department visits was performed to assess for additional complications postprocedure .
predefined major complications were persistent pni , symptomatic pericardial effusion , deep vein thrombosis , arteriovenous fistula , atrioesophageal fistula , major bleeding , stroke , or death .
persistent pni was defined as pni that persisted or occurred beyond discharge from the electrophysiology laboratory , while episodes of pni that resolved before discharge from the laboratory without recurrence were termed
identification of complications was based on objective evidence of any of the predefined complications or after workup of new symptoms postprocedure .
variables found to be associated with the outcomes in univariable analyses at p<0.2 were selected for multivariable analyses .
all 450 consecutive patients who underwent cryoballoon pvi between august 2011 and august 2015 were included in the final analysis .
there were 9 physicians who performed the procedures described , with a mean of 56.470.2 and median of 27 cryoballoon procedures per operator and a range of 2 to 170 .
the study population was a mean of 599.9 years old , and 26% were women , with a mean cha2ds2vasc score of 1.71.3 and left atrial dimension of 4.32.4 cm .
hypertension was present in 57.6% of the patients , persistent af was present in 30% of the patients , and 75% had af duration > 1 year .
additional baseline characteristics for the total study population , patients stratified by major complications , and patients with phrenic nerve injury are shown in table 1 .
major complications included 5 cases of persistent pni , 3 episodes of symptomatic pericardial effusion , 1 deep vein thrombosis , and 1 arteriovenous fistula .
there were no major bleeds , periprocedural strokes , atrioesophageal fistulas , or periprocedural deaths .
cxr indicates chest radiograph ; ed , emergency department ; pacu , postanesthesia care unit ; pni , phrenic nerve injury ; rspv , right superior pulmonary vein ; sob , shortness of breath .
there were 3 symptomatic echocardiogramconfirmed pericardial effusions that presented during the postprocedural period ; all resolved within 1 week without intervention .
there was 1 case of a right femoral pseudoaneurysm and arteriovenous fistula requiring surgical intervention .
there was 1 right saphenous vein deep vein thrombosis that was discovered 6 days postprocedure .
univariate logistic regression analysis did not reveal any significant potential predictors of major complications . in our study population ,
pni ( transient and persistent ) was the most common complication , occurring in 49 ( 10.8% ) procedures , of which pni was persistent in 5 ( 1.1% ) cases .
two of the persistent pni cases were not detected in the laboratory during svc pacing but rather discovered on chest radiography with right hemidiaphragm elevation during followup after the patients reported symptoms .
persistent pni resolved in all cases at 2 , 20 , 30 , 34 , and 48 days postprocedure ( table 3 ) .
the distribution of veins for the cases of pni was 73% right superior , 23% right inferior , and 4% right middle pulmonary veins .
univariate analysis identified age ( 62.87.7 years versus 58.70.12 years , p=0.006 ) and use of the 23mm balloon ( 16.3% versus 5.3% , p=0.005 ) as associated with pni ( table 4 ) .
there was no significant difference between estimated vein orifice area for veins with pni compared with rightsided veins without pni ( table 4 ) .
variables selected for multivariate analysis by using a cutoff of p<0.2 included redo procedures , age , hypertension , use of 23mm balloon , cha2ds2vasc score , early procedures , and total fluoroscopy time .
multivariate analysis identified 23mm balloon use ( odds ratio 2.94 , p=0.011 ) and age ( odds ratio 1.058 , p=0.014 ) as significant independent predictors for pni . comparison of patients with pni to those without values are presented as meansd or n ( % ) .
af indicates atrial fibrillation ; chf , congestive heart failure ; htn , hypertension ; pni , phrenic nerve injury .
procedural characteristics , including cryoballoon temperature data , number of lesions , and freeze times , were available for 68.0% of patients .
these procedural characteristics were compared for the rightsided veins with pni and the rightsided veins without pni ( table 5 ) .
patients with pni had a significantly shorter total freeze time ( 301148 versus 404117 seconds , p<0.001 ) and number of lesions per vein ( 1.90.7 versus 2.30.6 , p=0.006 ) .
all 450 consecutive patients who underwent cryoballoon pvi between august 2011 and august 2015 were included in the final analysis .
there were 9 physicians who performed the procedures described , with a mean of 56.470.2 and median of 27 cryoballoon procedures per operator and a range of 2 to 170 .
the study population was a mean of 599.9 years old , and 26% were women , with a mean cha2ds2vasc score of 1.71.3 and left atrial dimension of 4.32.4 cm .
hypertension was present in 57.6% of the patients , persistent af was present in 30% of the patients , and 75% had af duration > 1 year .
additional baseline characteristics for the total study population , patients stratified by major complications , and patients with phrenic nerve injury are shown in table 1 .
major complications included 5 cases of persistent pni , 3 episodes of symptomatic pericardial effusion , 1 deep vein thrombosis , and 1 arteriovenous fistula .
there were no major bleeds , periprocedural strokes , atrioesophageal fistulas , or periprocedural deaths .
cxr indicates chest radiograph ; ed , emergency department ; pacu , postanesthesia care unit ; pni , phrenic nerve injury ; rspv , right superior pulmonary vein ; sob , shortness of breath .
there were 3 symptomatic echocardiogramconfirmed pericardial effusions that presented during the postprocedural period ; all resolved within 1 week without intervention .
there was 1 case of a right femoral pseudoaneurysm and arteriovenous fistula requiring surgical intervention .
there was 1 right saphenous vein deep vein thrombosis that was discovered 6 days postprocedure .
in our study population , pni ( transient and persistent ) was the most common complication , occurring in 49 ( 10.8% ) procedures , of which pni was persistent in 5 ( 1.1% ) cases .
two of the persistent pni cases were not detected in the laboratory during svc pacing but rather discovered on chest radiography with right hemidiaphragm elevation during followup after the patients reported symptoms .
persistent pni resolved in all cases at 2 , 20 , 30 , 34 , and 48 days postprocedure ( table 3 ) .
the distribution of veins for the cases of pni was 73% right superior , 23% right inferior , and 4% right middle pulmonary veins .
univariate analysis identified age ( 62.87.7 years versus 58.70.12 years , p=0.006 ) and use of the 23mm balloon ( 16.3% versus 5.3% , p=0.005 ) as associated with pni ( table 4 ) .
there was no significant difference between estimated vein orifice area for veins with pni compared with rightsided veins without pni ( table 4 ) .
variables selected for multivariate analysis by using a cutoff of p<0.2 included redo procedures , age , hypertension , use of 23mm balloon , cha2ds2vasc score , early procedures , and total fluoroscopy time .
multivariate analysis identified 23mm balloon use ( odds ratio 2.94 , p=0.011 ) and age ( odds ratio 1.058 , p=0.014 ) as significant independent predictors for pni .
comparison of patients with pni to those without values are presented as meansd or n ( % ) .
af indicates atrial fibrillation ; chf , congestive heart failure ; htn , hypertension ; pni , phrenic nerve injury .
procedural characteristics , including cryoballoon temperature data , number of lesions , and freeze times , were available for 68.0% of patients .
these procedural characteristics were compared for the rightsided veins with pni and the rightsided veins without pni ( table 5 ) .
patients with pni had a significantly shorter total freeze time ( 301148 versus 404117 seconds , p<0.001 ) and number of lesions per vein ( 1.90.7 versus 2.30.6 , p=0.006 ) .
the main findings of our study were that in our cohort of 450 consecutive cases , the major complication rate of cryoballoon pvi was 2.2% .
overall , the most frequent complication was pni , which was usually transient and eventually resolved in all cases .
our major complication rate is consistent with previously published rates of major complications : 2% to 5.1%.5 , 20 , 21 , 22 the lack of significant predictors for major complications is consistent with most previous studies5 and likely is limited by a lack of statistical power , given the low rate of complications ( table 6).1 , 5 , 6 , 9 , 15 , 20 , 23 , 24 , 25 a previous study has identified predictors that included female sex and procedures performed in july or august.21 further research in larger cohorts may identify additional predictors of major complications . alternatively , cryoballoon pvi may have such a low rate of major complications that no predictors will be identified for most specific complications .
previous literature for complications and pni af indicates atrial fibrillation ; n / a , not available ; pni , phrenic nerve injury ; rspv , right superior pulmonary vein ; svc , superior vena cava .
the most common complication was pni ; the overwhelming majority of cases resolved before discharge from the electrophysiological laboratory , and the persistent cases resolved within 2 months .
other study populations have described longterm resolution of all or nearly all pni cases.5 , 6 , 7 , 16 despite the apparent temporary nature of phrenic nerve injury occurring during cryoballoon pvi , it is important to continue to use methods to reduce the incidence of pni and identify predictors to aid in patient selection and guide estimation of risks and benefits of the procedure in individual patients .
we found that the use of the 23mm balloon and increased age were associated with pni .
we have compared our study with other literature that reviewed complication rates , pni rates , and predictors and found we had identified a similar or an improved pni and major complication rate ( table 6 ) .
we did identify 2 cases of persistent pni that were not detected during the procedure but were discovered after discharge from the electrophysiological laboratory .
both cases were identified when the patients presented as outpatients with symptoms and confirmed with right hemidiaphragm elevation on chest radiography .
these cases highlight the possibility of delayed pni , which is currently not widely described . both cases used svc pacing but not cmap monitoring .
possibilities include missed injury during the procedure ( with svc pacing below balloon position , which is unlikely given operator experience , and in 1 case , stored cine confirms appropriate position ) versus a subtle injury not detected during the procedure with progression over the next several days .
previous studies have established a decrease in cmap of 30% to 35% as highly sensitive for detecting pni , with a decrease in 30% correlating with a cstatistic of 0.965.11 , 14 it is unclear if cmap would have detected subtle injury in these cases .
regardless , our findings emphasize the importance of followup and monitoring for complications after the index cryoballoon procedure . in our cohort ,
there was increased 23mm balloon use for patients with pni which has been reported in previous studies.15 , 16 , 26 an increased risk of pni is likely when the balloon is positioned distal toward the vein , which occurs more frequently with the 23mm balloon compared with the 28mm balloon given its smaller size.16 , 20 , 26 , 27 another hypothesis may be that the 28mm balloon represents later cases in which the operator has gained experience ; however , even when we controlled for early versus late cases , the effect of the 23mm balloon was seen .
we saw that the patients who had pni were older than patients without pni , which is also a novel finding .
this may be a result of deeper tissue penetration in advanced age because of changes in extracellular matrix or possible agerelated shifts in relative position of the phrenic nerve relative to the right pulmonary veins.28 , 29 while pvi has been shown to be effective and safe when evaluating major complications in elderly populations,30 this slight increase in incidence of pni is important to note when offering cryoballoon pvi to elderly patients .
given that there were no differences in maximum negative temperature or average 30second temperature for patients with pni , it is unlikely that more aggressive freezing contributed to pni .
in fact , the patients with pni had lower total freezing duration and number of lesions , which is likely a result of no further ablation performed after pni was detected .
since the adoption of cryoballoon pvi for af , methods to reduce the incidence of pni have emerged .
monitoring using surface electrodes during phrenic nerve pacing to detect a 30% to 35% reduction in diaphragmatic cmap has decreased the incidence of pni by allowing for early detection.14 , 19 additionally , double deflation or rapid balloon deflation , which leads to more rapid tissue rewarming , reduces the risk of persistent pni.15
our study has several potential limitations .
it is a retrospective observational study of a prospective registry involving only a single center and , thus , its generalizability may be limited .
it is important to note that this is one of the larger studies to date looking at complications in cryoballoon pvi . given the small percentage of major complications , some potential predictors may not have been identified .
all patients had at least 1 month of followup , and given that the overwhelming majority of pni occurs acutely because of its pathophysiology , it is likely that most of the pnis were detected by using our surveillance methods .
additionally , it is possible that operator experience affected the complication and pni rates ; however , when comparing the first onethird of cryoballoon procedures with the second twothirds of procedures performed at our institution , we did not see a significant difference in pni rates .
finally , we did not include the procedural characteristics in the multivariate analysis because the differences in these characteristics were likely a result of acute pni ( ie , shorter freeze time and number of lesions ) ; however , in doing this , we may have missed some predictors of pni .
it is a retrospective observational study of a prospective registry involving only a single center and , thus , its generalizability may be limited .
it is important to note that this is one of the larger studies to date looking at complications in cryoballoon pvi . given the small percentage of major complications , some potential predictors may not have been identified .
all patients had at least 1 month of followup , and given that the overwhelming majority of pni occurs acutely because of its pathophysiology , it is likely that most of the pnis were detected by using our surveillance methods . however , it is possible that any delayed pni may have gone undetected .
additionally , it is possible that operator experience affected the complication and pni rates ; however , when comparing the first onethird of cryoballoon procedures with the second twothirds of procedures performed at our institution , we did not see a significant difference in pni rates .
finally , we did not include the procedural characteristics in the multivariate analysis because the differences in these characteristics were likely a result of acute pni ( ie , shorter freeze time and number of lesions ) ; however , in doing this , we may have missed some predictors of pni .
in a prospective observational cohort of 450 consecutive cases , the major complication rate of cryoballoon pvi was 2.2% with no identified predictors of major complications .
dr saba reports a research grant from boston scientific ( significant ) , medtronic ( modest ) , and st .
dr jain reports research support from medtronic ( modest ) . the remaining authors have no conflicts of interest to disclose .
Output:
| backgroundcryoballoon pulmonary vein isolation ( pvi ) has emerged as an alternative to radiofrequency pvi for atrial fibrillation ( af ) .
data are lacking to define the rates and predictors of complications , particularly phrenic nerve injury ( pni).methods and resultswe evaluated a singlecenter prospective registry of 450 consecutive patients undergoing cryoballoon pvi between 2011 and 2015 .
patients were 5910 years old , 26% were women , 58% had hypertension , their mean cha
2
ds
2
vasc score was 1.71.3 , 30% had persistent atrial fibrillation , and 92% received a secondgeneration 28mm balloon . predefined major complications were persistent pni , pericardial effusion , deep vein thrombosis , arteriovenous fistula , atrioesophageal fistula , bleeding requiring transfusion , stroke , and death .
pni was categorized as persistent if it persisted after discharge from the laboratory .
logistic regression was performed to identify predictors of complications and specifically pni .
we identified a major complication in 10 ( 2.2% ) patients . in 49 ( 10.8% )
patients , at least transient pni was observed ; only 5 persisted beyond the procedure ( 1.1% ) .
all cases of pni resolved eventually , with the longest time to resolution being 48 days .
we also describe 2 cases of pni manifesting after the index hospitalization .
regression analysis identified 23mm balloon use ( 16.3% versus 5.2% , odds ratio 2.94 , p=0.011 ) and increased age ( 62.87.7 versus 58.70.12 years , odds ratio 1.058 , p=0.014 ) as independent significant predictors of pni .
there were no significant predictors of major complications.conclusionsin a large contemporary cohort , cryoballoon pvi is associated with low procedural risk , including lower rates of pni than previously reported . older age and 23mm balloon use
were associated with pni .
our low rate of pni may reflect more sensitive detection methods , including compound motor action potential monitoring and forced doubledeflation . |
PubmedSumm6814 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: trans fatty acids ( tfas ) are created from vegetable oils through hydrogenation . in the trans configuration ,
the carbon chain extends from opposite sides of the double bond , rendering a straight molecule .
elaidic acid ( ea ; c18:1 ) is the principal tfa often found in partially hydrogenated vegetable oils , margarine , and shortening [ 1 , 2 ] .
young people in japan have come to prefer a western - style diet , and now more than 29% of the calories consumed by japanese people are provided by fat .
the consumption of trans fats increases the risk of coronary heart disease ( chd ) by raising the levels of ldl cholesterol and lowering the levels of hdl cholesterol [ 2 , 4 , 5 ] .
it has been reported that an elevated tfa blood cell content increased the risk of acute coronary syndromes ( acs ) [ 6 , 7 ] .
infants are exposed to tfa before and after birth by the transfer of fatty acids originating from the maternal diet . on average ,
mature human milk provides 3.7 g fat/100 ml , representing about 50% of the dietary energy intake of the young infant [ 10 , 11 ] .
infants receiving human milk ingest levels of tfas and essential fatty acids that reflect short - and long - term maternal diets [ 1214 ] .
recent studies have indicated that the ea content of the maternal diet may be associated with both maternal and infant body composition in the early postpartum period .
we previously reported that dietary fish oil intake during pregnancy and lactation provides more n-3 polyunsaturated fatty acids ( pufa ) to pups and alters their brain fatty acid composition .
however , it has been reported that prenatal essential fatty acid deficiency may result in myelin with an abnormal composition and structure , at least during the critical period of brain development .
trans - enriched isomers of -linolenic acid ( ala ) were fed to female adult rats during gestation and lactation .
the trans ala can be desaturated and elongated in vivo and thus provides trans isomers of the n-3 fatty acids eicosapentaenoic acid ( epa ) and docosahexaenoic acid ( dha ) , even in pup brain structures .
animal studies have demonstrated that brain dha concentrations reduced after relatively high intakes of ea .
thus , a dam 's dietary ea intake during pregnancy and lactation may affect the development of the brain of her pups .
although trans ala was reportedly absorbed in the rat brain , there are no reports on the effects of dietary ea on the brain fatty acid composition of pups , to the best of our knowledge .
the aim of the present study was to determine whether a dam 's dietary ea intake during pregnancy and lactation would affect the plasma , erythrocyte , and brain fatty acid composition in pups .
we investigated the effects of the maternal ingestion of a shortening diet ( shd ) and a soybean oil diet ( sod ) on 82-day - old offspring .
body and fat tissue weights as well as plasma lipid concentrations were alsomeasured , as was the growth of the pups .
ten sperm - positive pregnant rats of the sprague - dawley strain on day 3 of pregnancy ( 10 weeks old ) were commercially obtained from clea japan ( tokyo ) .
they were housed individually in plastic cages with paper chip ( alpha - dritm , shepherd specialty papers , chicago , il ) bedding .
they were maintained in a room kept at a constant temperature ( 22 1c ) and 50% relative humidity with a 12 h dark / light cycle ( 19:007:00 ) .
they were weighed , and their food intake was measured every day between 16:00 and 18:00 during the experimental period .
the diets were prepared by adding soybean oil ( 10% ) and shortening ( 10% ) , respectively , to the ain-93 g , substituting for cornstarch .
soybean oil , the triglyceride e - test wako , the cholesterol e - test wako , and other chemicals were purchased from wako pure chemical industries ( osaka ) .
ten pregnant rats ( on day 3 of pregnancy ) were divided into two equal groups .
one group was fed the sod and the other group the shd during the experimental period ( pregnancy and lactation ) . within 24 h of birth ,
each litter was culled to 10 pups ( 5 males and 5 females ) and nursed by their dams for 21 d. on days 8 and 21 after birth , two pups ( a male and a female ) from each litter were killed by decapitation and their blood was collected .
whole blood was centrifuged for 15 min at 1400 g , and plasma was aliquoted into microcentrifuge tubes .
the buffer layer of white blood cells was removed using a pasture pipette , and then the erythrocytemembrane was aliquoted into separate microcentrifuge tubes .
perirenal fat tissue and liver were removed and weighed . after weaning ( at 21 d of age )
the pups were fed the same diet regardless of group . on days 47 , 68 , and 82 after birth ,
the pups were fasted for 16 h and sacrificed without affliction under ether anesthesia for collection of the liver , perirenal fat tissue , and brain .
the plasma , liver , and brain were stored at 80c until they were analyzed .
all procedures were performed in accordance with the animal experimentation guidelines of the laboratory animal care committee of seitoku university .
triacylglycerol ( tg ) and total cholesterol ( t - cho ) concentrations in plasma as well as liver extracts were measured using test kits ( triglyceride e - test wako , cholesterol e - test wako ) .
packed erythrocytemembranes were diluted in 500 l of water and thoroughly mixed by vortex , and the mixture was kept on ice for 15 min . to initiate the lipid extraction , isopropanol ( 4 ml )
was added , and the samples were vigorously mixed by vortex and kept for 1 h with frequent mixing .
then hexane ( 6 ml ) was added , followed by frequent mixing for another hour .
the samples were subjected to centrifugation at 1200 g for 10 min , and the lipid - containing organic fraction was removed .
fatty acid in the plasma , erythrocytemembrane , and brain extract was methylated according to the procedure of morrison and smith .
first , 1.5 ml of 0.5 mol naoh dissolved in methanol was added to 0.2 ml of plasma , and the solution was subjected to vortex mixing and then boiled in a water bath at 100c for 9 min .
next , 2 ml of boron trifluoride methanol complex methanol solution was added to the mixture , followed by vortex mixing and incubation in a water bath at 100c for 7 min . after cooling ,
n - hexane ( 3 ml ) was added to the mixture , which was shaken well . the saturated nacl solution ( 5 ml )
was added to the mixture during vortex mixing , followed by centrifugation at 1500 g for 10 min .
the n - hexane phase containing the fatty acids methyl esters ( fames ) was extracted .
the fames were analyzed by a hitachi g-3500 gas chromatograph ( gc ) fitted with a split injector ( 250c ) and a flame ionization detector ( 260c ) coupled with a chromatointegrator ( hitachi d-2500 ) .
we used a tc-70 column ( 0.25 mm i d 60 m length , 0.2 m film thickness ; gl sciences , tokyo ) , with a helium ( he ) carrier gas flow rate of 1 ml / min .
the column was isothermally kept at 190c for 15 min , heated from 190c to 200c at a heating rate of 5c / min , kept at 200c for 10 min , heated from 200c to 210c at a heating rate of 5c / min , and kept at 210c for 4 min .
each fame peak was identified with a standard fame ( funakoshi co. , tokyo ) .
during pregnancy and lactation , no significant difference in the total food intake of the dams was observed between the sod and shd groups .
no significant difference in body , liver , or perirenal fat tissue weights was observed between the two groups ( table 3 ) .
no significant difference was found in total litter size between the groups ( 13.2 2.49 and 11.0 4.64 ) .
the male and female litter sizes in the sod group were 7.00 2.24 and 6.20 1.10 , respectively , whereas those in the shd group were 6.20 1.10 and 4.60 2.19 , respectively .
therefore , the two maternal diets did not affect the litter size or the ratio of female versus male pups . within 24 h after birth ,
the pups nursed by dams fed the sod and shd weighed 7.40 0.18 g and 7.27 0.34 g , respectively , indicating no significant difference between the groups . no significant differences in plasma tg or t - cho concentrations in the dams
table 4 shows the fatty acid composition of stomach content in 8-day - old pups nursed by dams fed sod and shd .
the level of saturated fatty acids in the stomach content was the highest in both groups , and no significant difference was observed between the groups .
the monounsaturated fatty acid in the stomach content of the shd group was significantly higher than that of the sod group ( p < 0.05 ) .
the n-6 and n-3 fatty acids in the stomach content of the sod group were significantly higher than those of the shd group ( p < 0.01 ) .
the ea in the stomach contents of the shd group was 11.6 1.03 , but ea was not detected in the stomach contents of the sod group .
the ratios of n-6/n-3 of the sod and shd groups were 15.1 and 54.7 , respectively . on days 8 , 21 , 47 , 68 , and 82 after birth ,
no significant differences in body , liver , or perirenal fat tissue weights were observed between the groups ( table 5 ) .
the liver and perirenal fat tissue weights of the pups of both groups increased with growth . on days 8 and 21 after birth ,
the plasma tg and t - cho concentrations in the pups of both groups were high but decreased after weaning ( table 6 ) .
no significant difference in plasma tg concentration was observed between the groups . on day 21 after birth ,
the plasma t - cho concentration of the shd group was significantly lower than that of the sod group ( p < 0.05 ) .
however , on day 47 after birth , no significant difference in the plasma t - cho concentration was observed between the groups .
on days 8 and 21 after birth , the saturated , n-6 , and n-3 fatty acids were significantly higher in the plasma of the sod group than in that of the shd group ( p < 0.05 ) ( table 7 ) .
on the other hand , the monounsaturated fatty acid in plasma was significantly higher in the shd group than in the sod group ( p < 0.05 ) .
ea was detected in the plasma of the shd group but not in that of the sod group .
the ea in the plasma of the shd group on day 21 after birth was significantly higher than that on day 8 after birth ( p < 0.05 ) . on day 8 after birth , compared with the fatty acid composition of the stomach contents and the plasma , the saturated fatty acid in plasma was decreased in both groups , whereas the n-6 and n-3 fatty acids were significantly increased in the plasma of both groups ( p < 0.05 ) .
although no significant difference in the saturated fatty acid in the erythrocyte membrane of the pups on days 8 and 21 after birth was observed between the groups , the n-6 and n-3 fatty acids in the erythrocyte membrane were significantly higher in pups of the sod group than in those of the shd group ( p < 0.05 ) ( table 7 ) . on days 8 and 21 after birth ,
the monounsaturated fatty acid in plasma and blood cell membrane was higher in the shd group than in the sod group ( p < 0.05 ) ( table 7 ) .
the ea in the erythrocyte membrane of the shd group was significantly higher on day 21 after birth than on day 8 after birth ( p < 0.05 ) .
in the shd group on days 8 and 21 after birth , the ea was significantly higher in plasma than in erythrocyte membrane , and n-3 fatty acid levels were significantly higher in erythrocyte membrane than in plasma ( p < 0.05 ) . the brain weight ( g/100 g bw ) of pups of both groups decreased significantly with growth ( p < 0.05 ) ( table 8) . the total fat ( mg / g brain ) in the pup brains of both groups increased significantly with age ( p < 0.05 ) .
however , on days 8 , 21 , and 82 after birth , no significant differences in the brain weight and total fat were observed between the groups .
although no significant difference was found between the groups in the level of saturated fatty acid in the brains of pups on day 8 after birth , on day 21 the shd group had significantly higher levels than the sod group ( p < 0.05 ) .
although the level of monounsaturated fatty acid in the brains on day 8 after birth was higher in the shd group than in the sod group ( p < 0.05 ) , no significant differences were observed between the groups at 21 and 82 days after birth .
the monounsaturated fatty acid levels in the brains of pups of both groups decreased with growth ( p < 0.05 ) ( table 8) . although no significant difference between the groups was observed in the n-6 fatty acid in brains of pups on day 8 or day 21 after birth , on day 82 the shd group had higher levels than the sod group ( p < 0.05 ) .
although on days 8 and 21 after birth n-3 fatty acid levels were lower in the brains of the shd pups than in those of the sod pups ( p < 0.05 ) , no significant difference was observed between the groups at 82 days .
although the ea of the brains of pups of the shd group on day 8 after birth was 0.56 0.24% , ea was not detected on day 21 or day 82 .
on days 8 , 21 , and 82 after birth , the n-6/n-3 ratio in pup brains was higher in the shd group .
on day 8 after birth , the saturated fatty acid composition of the stomach contents of pups of both groups was higher than that of the dams fed either diet .
this indicated that a large amount of saturated fatty acid was synthesized in the dam body in order to produce high - fat milk .
reported that the specific activity of lipogenic enzyme was higher in the mammary gland and liver of lactating rats than in those of virgin animals . on the other hand ,
level of monounsaturated fatty acid , as well as of n-6 and n-3 fatty acids , was lower in the stomachs of pups in both groups than the levels of the same fatty acid composition of either diet .
we considered that this phenomenon happened because of the increased ratio of saturated fatty acid in the stomachs of the pups .
kavanagh et al . fed female c57/bl6 mice a trans diet containing hydrogenated vegetable oil during pregnancy and lactation and investigated the fatty acid composition in their breast milk .
the ea ( 18:1 n-9 ) in the trans diet and breast milk was 26.9% and 11.9% , respectively . in the present study ,
ea in the shd was 25.3% , and in the stomach content of the shd group on day 8 after birth it was 11.6 1.03% ( table 4 ) ; these data are mostly consistent with the results of kavanagh et al .
moreover , those authors reported that although the n-3 fatty acid was lower in the ea diet than in the control diet , the n-3 fatty acid levels in breast milk were almost the same between the groups . in our previous report
, pregnant rats were fed a corn oil diet or a perilla oil diet , and their fatty acid levels in breast milk were compared .
we reported that n-3 fatty acid was preferentially provided to breast milk when the dams were fed the n-3 fatty acid - deficient diet ; the ratio of n-6/n-3 in the breast milk in that group was lower than that in dams fed the other diet .
in the present study , the ratios of n-6/n-3 in shd and in the stomach content of the shd group were 64 and 54.7 , respectively .
the ratio of n-6/n-3 in stomach content of the shd group was lower than the ratio of n-6/n-3 in the shd group , similar to the results of the report of kavanagh et al .
there are several reports on the effects of tfa intake during pregnancy and lactation on fetuses and infants .
innis et al . indicated that a low intake of essential fatty acids during pregnancy lowed fetal development and that it was possible that tfa accumulated in the plasma of fetuses [ 10 , 26 ] . in the present study ,
tfa intake during pregnancy and lactation showed no effect on birth weight or growth after birth ( table 5 ) .
although no significant differences in plasma tg and t - cho concentrations were observed between the groups , the plasma t - cho concentration in pups on day 82 after birth tended to be higher in the shd group ( p = 0.062 ) ( table 6 ) . it was reported that tfa intake during pregnancy and lactation increased ldl - cholesterol levels in plasma and induced changes in maternal and infant body composition and the development of obesity later in childhood [ 5 , 15 ] .
it is possible that the plasma concentration in pups of the shd group was changed after 82 days of age .
compared with the plasma fatty acid composition of pups between 8 and 21 days old , the ea in plasma of the shd group on day 21 after birth was approximately twice that on day 8 after birth ( table 7 ) .
the pups were fed only breast milk until day 8 after birth . although the pups were weaned on day 21 after birth , they were fed breast milk and shd .
therefore , the pups of the shd group on day 21 after birth were fed a large quantity of ea in the shd , and this caused the ea to increase in the plasma of pups in that group .
the ea in the erythrocyte membrane of pups of the shd group on day 21 after birth was higher than that of pups at 8 days old , the same pattern that was found in plasma ( table 7 ) .
although the n-6 and n-3 fatty acids in the erythrocyte membrane were lower in the shd group than in the sod group , the ratio of n-6/n-3 in erythrocyte membrane of the shd group was higher on days 8 and 21 .
reported that , compared to controls , the blood cell membrane content of n-3 pufa was lower in acs cases ; levels of tfa and arachidonic acid ( aa ; 20:4 n-6 ) were higher .
aa is found in cell membrane phospholipids and is important in infant growth and central nervous system development .
in a recent study , significant positive relationships were found between tfa level in erythrocyte membrane and c - reactive protein ( crp ) , suggesting that the tfa intake might be a predictor of increased risk for metabolic syndrome . during pregnancy and lactation in the present study ,
tfa was provided in breast milk and increased the tfa levels in erythrocyte membrane of shd group pups .
these results indicated that tfa intake during pregnancy and lactation threatened the health of pups . from days 8 to 21 after birth ,
the rates of increase in the total fat in pup brain were 2.6 times and 2.3 times in the sod and shd groups , respectively .
previously , we reported on the effects of a deficiency of n-3 fatty acid during pregnancy and lactation on the composition of fatty acid in the brains of rat pups . whereas fish oil contains high levels of n-3 fatty acids , such as epa and dha , there are no fatty acids in lard .
although levels of n-3 fatty acids in the brains of pups nursed by dams fed fish oil during pregnancy and lactation were higher than the levels in a group whose dams were fed lard , there was no significant difference in the ratio of n-3/n-6 in the brains of pups between the groups . in this study ,
the ratios of n-6/n-3 in the brains of pups of the shd group on days 8 , 21 , and 82 were 1.6 , 1.3 , and 1.1 times that of the sod group , respectively , and the fatty acid composition of the brains of pups remained constant ( table 7 ) .
although the ea in shd dams taken during pregnancy and lactation was 25.3% , the ratio of ea decreased as the ea moved into breast milk , plasma , and blood cells and brains of pups on day 8 after birth .
n-3 fatty acids are not consumed as a source of energy because of their poor intake ; these acids are used in the composition of the body . on the other hand
, it is supposed that the ea is used as a source of energy with oleic acid ( c18 - 1 ) , which is contained abundantly in shd .
ea was not detected in pup brains of the shd group , although the pups of the shd group on day 21 after birth showed 25.3% ea in shd and the erythrocyte membrane was 8.6% ea .
it was supposed that very small amounts of ea in the brains of pups of the shd group were detected because the blood brain barrier is not yet formed by day 8 after birth .
lipids in the maternal diet were reported to affect the myelination of the rat brain .
moreover , dha was essential for myelination of the rat brain , and dha deficiency during infancy delays brain development , while in aging a dha deficiency accelerates deterioration of brain functions [ 30 , 31 ] .
while the ala in shd was only 0.1% , the synthesized n-3 pufa from ala moved from the dams into the pups via breast milk , and the n-3 pufa was synthesized in body of pups . on day 82 after birth , no significant difference in the n-3 fatty acid levels in the brains of pups was observed between the groups ( table 8) .
therefore , it was considered that dha was synthesized in the bodies of the pups . in one study
, pregnant mice were fed a diet containing 21.5% tfa and 0.1% ala , and the relationship between the fatty acid composition of the brain and behavioral development in 7-week - old mice was investigated .
the brain dha level of the tfa group was lower than that of the control group .
reversal learning in the t - water maze was significantly slower in the tfa group compared with the control group .
the authors of that study referred that future studies of the long - term effects of dietary tfa during the pre- and postnatal periods should measure behavioral development and neural function of brain .
fed pregnant and lactating rats a diet containing 14.1% tfa and investigated the relationship between relative fatty acid composition in total lipids of the hippocampi of offspring and the spatial memories of young rats .
although tfa was detected in the brains of pups immediately after birth , the effects of dietary tfa on brain development and function remain unclear .
the fao / who joint meeting of fat and fatty acid in human nutrition , held in japan in 2008 , set out the target to intake of tfa less than 1% of total energy intake .
kawabata et al . pointed out that daily tfa intake could become higher than the predicted value if processed foods containing high levels of tfa were consumed , while the average intake of tfa in young women was lower than the who - recommended energy ratio ( < 1% ) .
it is advisable to avoid especially high levels of tfa - containing foods during pregnancy and lactation . in summary
, we have shown that ea intake during pregnancy and lactation supplies ea to plasma , remains in the erythrocyte membrane of pups , and moves into the brain in early infancy .
we have also shown that the plasma t - cho concentration in pups on day 82 after birth tended to be higher in the shd group ( p = 0.062 ) .
these data highlight the need for further studies which should examine in more detail the long - term effects of dietary tfa during the pre- and postnatal periods and measure behavioral development and neural function of brain .
Output:
| to investigate the effects of a dam 's dietary elaidic acid ( ea ) intake during pregnancy and lactation on the fatty acid composition of plasma , erythrocyte membrane , and brain in rat pups , we fed two groups of dams either a soybean oil diet ( sod ) or a shortening diet ( shd ) containing soybean oil ( 10% ) or shortening ( 10% ) , respectively . although ea was not detected in the sod , ea accounted for 25.3% of all fatty acid content in the shd . on day 8 after birth
, the ea levels in the stomach , plasma , and erythrocyte membrane of pups nursed by the dams fed the shd were 11.6 1.03% , 7.18 1.20% , and 5.82 1.00% , respectively .
although on day 8 after birth the ea level of the brains of pups nursed by shd - fed dams was 0.56 0.24% , ea was not detected on day 21 or day 82 after birth .
these results suggest that ea intake during pregnancy and lactation supplies ea to plasma , remains in the erythrocyte membrane of pups , and moves into the brain in early infancy . |
PubmedSumm6815 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: age - related macular degeneration ( amd ) is a leading cause of visual impairment and blindness in western countries among people aged 50 years and older .
the prevalence of amd in various european countries ( norway , estonia , united kingdom , france , italy , greece , and spain ) was 3.32% with the of geographic atrophic amd of 1.2% , neovascular amd 2.3% and bilateral amd 1.4% .
amd is also a significant health problem in the united states , with a current estimate of about 1.75 million persons with advanced amd in the general population and about 7.3 million people with early stages of amd defined by large retinal drusen .
it has been projected that by the year 2020 , approximately about 2.95 million people will have advanced amd and an additional 6.4 million white individuals will have the early stages of amd in at least one eye .
as the average life span of humans continues to increase , especially in the developed countries , the incidence of amd is expected to nearly double within the next 25 years .
the aetiology of amd remains elusive because it is a multifactorial disease in which both genetic and environmental factors have been implicated . to date ,
age , smoking , exposure to light , and diet have been successfully identified [ 4 , 5 ] .
various studies have indicated a significant genetic contribution to amd , including those reported a higher occurrence of amd among monozygotic twins and first - degree relatives than spouses and unrelated individuals .
amd was also associated with several dna single nucleotide polymorphisms ( snps ) [ 79 ] .
the retinal pigment epithelium ( rpe ) cells function in an environment that is rich in endogenous reactive oxygen species ( ros ) .
the activity of rpe cells , the high local oxygen concentration , and the chronic exposure to light contribute to the production of ros [ 1013 ] .
although multiple physiologic mechanisms protect the rpe from the toxic effects of light and oxidative damage , mounting evidence suggests that chronic exposure to oxidative stress over the long term may damage the rpe and predispose it to the development of amd . supporting
this theory is the observation that large drusen , which are deposited under the rpe in patients with macular degeneration , consist of insoluble aggregates of oxidized lipids and proteins derived from the photochemical reactions of visual transduction [ 14 , 15 ] . in the present paper we checked the correlation between the level of dna damage measured with the alkaline comet assay and the kinetics of removal of dna damage induced by hydrogen peroxide in peripheral blood lymphocytes of patients with wet form of amd and individuals without visual disturbances .
most oxidative damage associated with amd will occur within postmitotic cells of the retina and will be environmental in origin .
we chose peripheral blood lymphocytes as they would be affected by the environmental condition causing oxidative dna damage in the retina .
moreover , they could provide evidence on inherited defect in dna damage / repair , which would be enhanced by oxidative stress .
we also correlated the metrics of dna damage and repair with the genotype of the hogg1 gene polymorphism : a c g transversion at 1245 position producing a ser cys substitution at the codon 326 ( the ser326cys polymorphism ) .
we chose the hogg1 gene due to its central role in the repair of oxidatively damaged dna . to evaluate the extent of dna damage , the efficacy of dna repair and the sensitivity to exogenous mutagens in amd patients we determined ( 1 ) the level of dna damage measured by alkaline comet assay and oxidative dna damage and ( 2 ) the capacity to remove dna damage induced by hydrogen peroxide in the peripheral blood lymphocytes of amd patients and healthy individuals .
dna damage and repair were evaluated by alkaline single cell gel electrophoresis ( comet assay ) .
hydrogen peroxide is a standard agent to induce oxidative dna damage . in order to assess the role of oxidative dna damage in amd patients , we employed two dna repair enzymes : endonuclease iii ( nth ) and formamidopyrimidine - dna glycosylase ( fpg ) , preferentially recognizing oxidized dna bases .
nth converts oxidized pyrimidines into strand breaks , which can be detected by the comet assay .
it recognizes and removes 7,8-dihydro-8-oxoguanine ( 8-oxoguanine ) , the imidazole ring - opened purines , 2,6-diamino-4-hydroxy-5-formamidopyrimidine ( fapy - gua ) , and 4,6-diamino-5-formamido - pyrimidine ( fapy - ade ) as well as small amounts of 7,8-dihydro-8-oxoadenine ( 8-oxoadenine ) .
the removing of specific modified bases from dna by this enzyme leads to apurinic or apirymidinic sites , which are subsequently cleaved by its ap - lyase activity , giving a gap in the dna strand , which can be detected by the comet assay .
blood samples were obtained from patients with wet form of amd ( n = 30 ) and healthy sex- and age - matched individuals ( n = 30 ) .
the patients underwent ophthalmic examination including best - corrected visual acuity , intraocular pressure , slit - lamp examination , and fundus examination using noncontact and contact fundus lenses with a slit lamp .
diagnosis of wet form amd was confirmed by optical coherence tomography ( oct ) , fluorescein angiography ( fa ) , and in some cases indocyanin green angiography ( icg ) .
oct evaluated retinal thickness , the presence of subretinal fluid and intraretinal oedema ; angiography assessed the anatomical status of the retinal vessels , the presence of choroidal neovascularisaton ( cnv ) and leakage .
the fa and icg examinations were completed with a topcon trc-50i ix fundus camera with the digital image net image system ( ver . 2.14 ; topcon co. , tokyo , japan ) .
neither patients nor controls reported cancer , diabetes , or other disease known or suspected to affect dna repair .
blood samples were immediately transported to the laboratory on ice . peripheral blood lymphocytes ( pbl )
were isolated by centrifugation in a density gradient of histopaque-1077 ( 15 minutes , 280 g , 4c ) and suspended in rpmi 1640 medium at 13 10 cells per ml .
the comet assay was performed at ph > 13 essentially according to the procedure of singh et al . with modifications [ 16 , 18 ] as described previously .
a freshly prepared suspension of the cells in 0.75% lmp agarose dissolved in pbs was spread onto microscope slides precoated with 0.5% nmp agarose .
the cells were then lysed for 1 hour at 4c in a buffer consisting of 2.5 m nacl , 100 mm edta , 1% triton x-100 , 10 mm tris , ph 10 . after the lysis ,
the slides were placed in an electrophoresis unit , dna was allowed to unwind for 20 minutes in the electrophoresis solution consisting of 300 mm naoh and 1 mm edta , ph > 13 .
electrophoresis was conducted at ambient temperature of 4c ( the temperature of the running buffer did not exceed 12c ) for 20 minutes at an electric field strength of 0.73 v / cm ( 28 ma ) .
the slides were then washed in water , drained and stained with 2 g / ml dapi , and covered with cover slips . to prevent additional dna damage ,
all the steps described above were conducted under dimmed light or in the dark .
the comets were observed at 200 magnification in an eclipse fluorescence microscope ( nikon , tokyo , japan ) attached to cohu 4910 video camera ( cohu , san diego , ca , usa ) equipped with a uv-1 filter block ( an excitation filter of 359 nm and a barrier filter of 461 nm ) and connected to a personal computer - based image analysis system lucia - comet v. 4.51 ( laboratory imaging , praha , czech republic ) .
one hundred images were randomly selected from each sample and the percentage of dna in the tail of comets was measured .
hydrogen peroxide was added to the suspension of the cells to give a final concentration of 10 m .
. a freshly prepared suspension of the cells in lmp agarose dissolved in pbs was spread onto microscope slides .
the slides were processed as described in the section 2.3 . to examine dna repair , the cells , after treatment with hydrogen peroxide , were washed and resuspended in a fresh , rpmi 1640 medium preheated to 37c .
aliquots of the cell suspension were taken immediately time zero and at 120 minutes later .
we considered a relative difference between the extents of dna damage at time zero and 120 minutes as a measure of the efficacy of dna repair .
a freshly prepared suspension of the cells in lmp agarose dissolved in pbs was spread onto microscope slides .
the slides after cell lysis were washed three times ( 5 minutes , 4c ) in an enzyme buffer containing 40 mm hepes - koh , 0.1 m kcl , 0.5 mm edta , 0.2 mg / ml bovine serum albumin , ph 8.0 .
the slides were then drained and incubated for 30 minutes at 37c with 0.03 g of nth or fpg in this buffer [ 16 , 18 ] .
each value of oxidative dna modification recognized by these enzymes derives a mean difference between fpg / nth - treated and nontreated control from 30 patients with amd and 30 healthy controls . to check the ability of the enzymes to recognize oxidized dna bases in our experimental conditions , the cells were incubated with hydrogen peroxide ,
genomic dna was prepared from peripheral blood of amd patients and healthy individuals by using of commercial blood mini kit ( akor laboratories , gdansk , poland ) .
the genotypes of the ser326cys polymorphism of the hoog1 gene were determined with the following primers : sense 5-gttttcactaatgagcttgc-3 , antisense 5-agtggtataatcatgtgggt-3. the 200 bp pcr product was digested overnight with 5 u of the restriction enzyme sati ( fermentas , vilnius , lithuania ) .
the cys allele was digested into 100 bp fragments , whereas the ser variant remained intact .
the values of the comet assay in this study were expressed as mean s.e.m . from two experiments , that is ,
data from two experiments , 100 measurements each , were pooled and the statistical parameters were calculated . if no significant differences between variations were found , as assessed by snedecor - fisher test , the differences between means were evaluated by applying the student 's t test .
relative difference between extents of dna damage in time zero and 120 minutes expressed in percentage was used as a measure of the efficacy of dna repair after treatment with hydrogen peroxide .
the data were analysed using statistica package ( statsoft , tulsa , ok , usa ) .
the mean extent of endogenous dna damage measured as the percentage of dna in comet tail of lymphocytes of amd patients and controls is displayed in figure 1 .
we observed a higher level of endogenous dna damage in amd patients than in the controls ( p < .001 ) .
figure 2 presents the mean dna damage measured as percentage tail dna of lymphocytes from amd patients and healthy individuals , lysed and posttreated with nth ( figure 2(a ) ) or fpg ( figure 2(b ) ) . subtracting the values for an enzyme - specific buffer only treatment normalized these results .
therefore , the results indicate solely the dna base - modification , which are not alkali - labile . there were significant differences
( p < .01 ) between the mean extent of oxidative dna damage recognized by nth between amd patients and controls ( figure 2(a ) ) .
there were no significant differences ( p > .05 ) between the mean extent of oxidative dna damage recognized by fpg between amd patients and controls ( figure 2(b ) ) . because high level of oxidative dna damage may be associated with an impaired dna repair , individuals with the extent of oxidative dna damage higher than the mean for respective group were selected for further genotype analysis .
the mean percentage tail dna of lymphocytes from amd patients and controls exposed for 10 minutes to 10 m hydrogen peroxide immediately after the exposure as well as 120 minutes thereafter is presented in table 1 along with the efficacy of dna repair .
sign indicates that the extent of dna damage at 120 minutes was greater than at the zero time .
the efficacy of dna repair in amd patients was significantly ( p < .001 ) lower than that observed in the controls .
moreover , the extent of initial dna damage after hydrogen peroxide treatment was significantly higher in amd group than in the control ( p < .01 ) .
we assumed that inefficient dna repair occurred when we did not observe significant decrease in dna damage after 120 minutes of repair incubation .
we did not observe any difference in the mean efficacy of dna repair between amd patients ( 21 subjects with inefficient dna repair ) and control group ( 17 subjects with inefficient dna repair ) .
however , the data show that all control samples showed decrease in dna damage after 120 minutes .
43% of the amd patients ( 13 persons ) show a further increase in dna damage at 120 minutes .
these results suggest that the efficacy of the repair of oxidative dna damage in amd patients was lower than in the controls .
we observed considerable differences in the efficacy of dna repair between individuals enrolled in the study , especially in amd patients .
we speculate that it could be linked with different activity of allelic variants of genes involved in the repair of oxidative dna lesions . to verify this hypothesis , we selected only individuals with inefficient dna repair ( table 1 ) for further genotype analysis
. there were no significant differences between the distributions of genotypes of the ser326cys polymorphism of the hogg1 gene and the frequency of the ser and cys alleles for amd patients and controls with high level of endogenous oxidative dna damage ( table 2 ) .
there also were no significant differences between the distributions of the genotypes and frequencies of the alleles of the ser326cys polymorphism for amd patients and controls with impaired dna repair after hydrogen peroxide treatment ( table 3 ) .
oxidative damage to rpe cells and photoreceptors has been implicated in the pathogenesis of amd .
this kind of cellular stress induces various types of dna damage , like base modifications , dna breaks , and alkali - labile sites .
8-hydroxydeoxyguanosine ( 8-oh - gua ) glycosylase 1 ( hogg1 ) is the primary enzyme for the repair of 8-oh - gua in human cells .
the presence of 8-oh - gua residues in dna leads to a gc ta transversion , unless it is repaired before dna replication .
for this reason , the presence of 8-oh - gua in dna may lead to mutagenesis and the level of 8-oh - gua is commonly used as a biomarker of oxidative dna damage .
a growing body of evidence suggests that mitochondrial dysfunction may be associated with amd and proposes a specific pathophysiological mechanisms involving mtdna oxidative damage , altered mitochondrial translation , import of nuclear - encoded proteins and atp synthase activity as an explanation of this association [ 2325 ] .
these reports suggest increased mitochondrial dna damage and downregulation of mitochondrial dna repair in rpe cells and choroid .
an increased level of 8-ohdg and downregulation of base excision glycosylases in aged rodent rpe and choroid as compared with young controls was also reported .
the recent data indicate also that the altered function of the putative mitochondrial protein loc387715/arms2 by a 69a > s substitution strongly enhances the susceptibility to aging - associated degeneration of macular photoreceptors .
the number of patients we analyzed may not seem to be impressive as compared with epidemiological studies assessing a risk linked with particular genotype / phenotype .
the primary goal of our study was to search for a correlation between genotype and phenotype , although we calculated the odds ratio , because it is a standard procedure in polymorphism study .
such studies with comet assay are typically performed on a population of several dozen individuals and very exceptionally this number exceeds one hundred . although oxidative stress is usually linked with the dry amd and so are the disturbances in the dna repair machinery , our results suggest extending this point of view to wet amd .
they should have been performed on the retina cells , but these can not be obtained from live amd patients as easily as the lymphocytes .
lymphocytes are easily accessible and their genetic constitution with the regards of dna repair processes reflects that of the retina cells .
however , we found a decreased efficacy of dna repair in peripheral blood lymphocytes of amd patients , but we do not have any solid evidence that this effect was a consequence of amd .
we hypothesize that amd may be a result of a decreased capability of every cell of an organism to repair dna damage and increased exposure of ocular cells to etiological agents , like uv radiation , inducing dna damage in these cells . on the other hand
, we can not exclude the possibility that the observed decrease in the efficacy of dna repair may be a consequence of general metabolic disturbance associated with amd .
we think that the results we obtained suggest that there may be an interplay between disturbances in the general state of an organism , manifested by decreased efficacy of dna repair and local ( ocular ) changes evoked by genetic and environmental factors .
this technique is a versatile and sensitive method for measuring dna damage such as single- and double - strand breaks as well as alkali - labile sites in dna .
it is a valuable tool in population monitoring , for example , in assessing the role of oxidative stress in human disease and in monitoring the effects of dietary antioxidants .
a simple modification allows the measurement of dna repair . in combination with the analysis of polymorphisms in relevant genes ,
comet assay may provide important information on the interaction between genetic variation and environmental factors in the maintaining genome stability .
although the increase in the tail dna in amd patients as compared with the controls was statistically significant it should not be a priori considered as biologically or medically relevant .
however , because amd may be considered as a multifactorial disease , this increase may significantly contribute to the disease .
several types of genetic polymorphisms can be found within the human genome , such as repeat polymorphisms , insertions , and deletions .
however , most dna sequences variation in human populations is in the form of snps .
snps can be defined as persistent substitutions of a single base with a frequency of more than 1% in at least one population .
recently , it has been demonstrated the potential role of snps in amd and other age - related diseases .
three snps in the mnsod , mehe , and paraoxonase genes related to oxidative stress have previously been reported in association with amd in japanese populations [ 30 , 31 ] .
it seems that the hogg1 gene is a good candidate to study dna repair genes , which can be associated with amd .
ogg1-type 1a of hogg1 gene is constitutively expressed in cancerous and noncancerous human cells as nuclear form of protein .
the protein level of hogg1 decreases in aged rpe and choroids cells . a c g transversion at 1245 position in the exon 7 of the hogg1 gene results in an amino acid substitution from serine to cysteine in the codon 326 .
there are contradictory results of studies on the role of this polymorphism in the catalytic activity of hogg1 protein , but it was shown that the ser326 allele exhibited higher enzymatic activity than the cys326 variant in an in vitro e. coli complementation assay .
several studies have suggested that cys326 type allele may be associated with the increased risk for esophageal , otolaryngeal , lung , stomach , and prostate cancers . in our studies
we did not find significant differences between the distributions of ser326cys polymorphism of hogg1 gene and the frequency of the ser and cys alleles for amd patients and controls with high level of endogenous oxidative dna damage and impaired dna repair after hydrogen peroxide treatment .
this is not surprising due to a limited number of patients enrolled in our study and a high variability in the dna repair rate between them .
a lack of association between the ser326cys polymorphism and amd was also demonstrated in other research . however , further studies are needed to confirm the lack of association between the ser326cys polymorphism and amd .
genetic variability of the genes involved in the expression of the hogg1 gene may also contribute to the efficacy of dna repair .
the cockayne syndrome b ( csb ) gene , also called ercc6 , collaborates with hogg1 to carry out preferential dna repair in eukaryotes [ 41 , 42 ] .
this gene also plays a role in the maintenance of an efficient expression of the hogg1 gene .
it was shown that the g allele of the c-6530c polymorphism of the ercc6 gene could be associated with a risk of amd development and possibly interacted with an snp in the cfh gene ( complement factor h gene ) to influence amd susceptibility . recently
, several studies have also shown a strong association of cfh snps with amd [ 4345 ] .
it was revealed that ercc6 c-6530 g , which is located in the regulatory region of the gene , upregulated the transcript and protein expression .
these data support the hypothesis that dna repair mechanisms may play a role in amd pathogenesis .
our results suggest that endogenous oxidative dna damage and low efficacy of dna repair can be associated with the occurrence of amd in wet form .
high level of oxidative dna damage and impaired repair of such damage may not be associated with the variants of the ser326cys polymorphism of the hogg1 gene .
Output:
| oxidative stress is thought to play a role in the pathogenesis of age - related macular degeneration ( amd ) .
we determined the extent of oxidative dna damage and the kinetics of its removal as well as the genotypes of the ser326cys polymorphism of the hogg1 gene in lymphocytes of 30 wet amd patients and 30 controls .
oxidative dna damage induced by hydrogen peroxide and its repair were evaluated by the comet assay and dna repair enzymes .
we observed a higher extent of endogenous oxidative dna damage and a lower efficacy of its repair in amd patients as compared with the controls .
we did not find any correlation between the extent of dna damage and efficacy of dna repair with genotypes of the ser326cys polymorphism .
the results obtained suggest that oxidative dna damage and inefficient dna repair can be associated with amd and the variability of the hoog1 gene may not contribute to this association . |
PubmedSumm6816 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: advances in biological and medical research and their translation into diagnostic , prognostic and therapeutic tools are relying increasingly on partnerships between the academic ( government and university ) and industrial ( biotechnology , pharmacy and technology ) sectors , with essential participation and support from patient organizations and charities . despite these concerted efforts and the promises of genomics and systems biology , over the past two decades
the cost of research and development has continuously escalated , while the number of truly novel drugs coming to market has constantly declined . to a large extent , this has been addressed in the private sector through mergers and outsourcing , with downsizing of the research and development workforce .
these trends can not be sustained further as they threaten the economic viability of the healthcare system worldwide . at a time of a global crisis , it is crucial to identify how we can overcome these hurdles .
i argue here that we should look again at how knowledge can be shared between all the stakeholders , redefining the frontier between what can be the subject matter of valuable intellectual property rights and what is the basic knowledge that should be made freely available to all .
it was hotly debated at the beginning of the human genome project ( hgp ) , and for its entire duration in relation to competition between the public and private sectors .
i suggested early on that the nucleic acid sequences collected on a genome scale should be considered as elements of description insufficient to warrant property rights by themselves in the absence of a genuine invention and should thus be placed in the public domain .
a similar attitude was taken by the participants of the hgp in 1996 , as expressed in the ' bermuda rules ' , with the result that the openly accessible reference human genome sequence is now the common basis for current research .
these proposals contributed to the ' universal declaration on the human genome and human rights ' adopted by the united nations and its educational , scientific and cultural organization ( unesco ) in 1997 - 1998 , which stated about the human genome : " in a symbolic sense , it is the heritage of humanity " , and " the human genome in its natural state shall not give rise to financial gains . "
the issue was , and remains to a large extent , how best to balance general and particular interests to sustain basic research while promoting efficient healthcare product development .
this has been discussed extensively on ethical , legal and social grounds , and the counterproductive underuse of scarce resources when they are protected by excessive intellectual property rights ( the tragedy of the ' anticommons ' ) has been pointed out ; these discussions have led to proposals to establish patent pools to facilitate development of diagnostic tests .
the recent advent and rapid development of new generations of very - high - throughput dna sequencing methods makes it now possible to foresee that in the next few years the sequencing and assembly of thousands of human genomes ( and transcriptomes ) will be achievable at a cost of $ 1,000 each or less , which is a projected decrease of almost a million - fold in less than ten years . without the availability of the reference sequence ,
run delivering information on the scale of the entire genbank , it is clear that data quality assessment and analysis are becoming the limiting steps , beyond the capability of single individuals or groups .
similar trends can be anticipated for proteins and metabolites when reference proteomes and metabolomes also become available in the coming years .
public electronic repositories for these large - scale datasets , together with standards and open access publications for their description , have been important developments in the past decade for ensuring that they become available for further studies .
however , despite requirements by prominent journals and funding agencies for submission of primary data as a condition for publication and financial support , recent surveys indicate variable compliance with these rules in both academia and industry .
there is clearly room for significant improvements in this area if researchers are to take the best advantage of the large datasets produced .
the same issues of data quality and availability are becoming prominent in the assembly of ever - increasing patient cohorts for the purpose of clinical trials and genome - wide genetic association studies , now often reaching tens of thousand of samples .
great efforts have been made , initially in developed countries , to establish standards of good practice for informed consent , clinical trial registration and sample collection and storage in biobanks , and these are now being enforced in newly industrialized countries such as china and india .
although these are welcome developments , much also remains to be done to ensure that these essential resources are used to the best advantage of the patients themselves , and to use genomics and bioinformatics to sustain the development of systems biology and medicine .
the issues are many and complex , given the sensitive status of human material with respect to legal rules and practices that can vary substantially from country to country .
international harmonization of health regulations and intellectual property rights is ongoing ; this is necessary but insufficient to overcome the major bottlenecks in the development of healthcare products , and it will take time to mature and adapt to the rapid pace of technology development .
all stakeholders should work together to identify topics and areas in which joint actions would improve the situation significantly in the short term .
i would like to suggest that one such topic is the status and availability of large amounts of underexploited experimental and clinical data in public and private laboratories .
in many cases , these existing databases have been developed for a specific purpose , with a focus on a small number of biological elements . with the shift from targeted to global analyses ,
most of the data collected are not exploited at all , although they could be relevant in another context .
it must be recognized that the high potential value of these datasets relies to a large extent on the quality of the biological and clinical annotations , which becomes significant only if the experimental data are properly collected and described .
when that is the case , the added value will come from provision of the combined data for further analysis by other experts addressing related and complementary questions . recognizing this as a topic for sharing of knowledge between academic and industrial partners and establishing data warehouses with agreed open access rules would be a significant step in this direction .
Output:
| to help overcome the bottlenecks that limit the development of diagnostic and therapeutic products , academic and industrial researchers , patient organizations and charities , and regulatory and funding institutions should redefine the basis for sharing the knowledge collected in large - scale clinical and experimental studies . |
PubmedSumm6817 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: dilatation of pulmonary arteries is a well - known clinical entity commonly encountered in many congenital and acquired heart lesions .
idiopathic dilatation of pulmonary arteries ( idpa ) was first recognized as a benign anomaly in 1923 by wessler and jaches .
the incidence of this disease is 6 cases per 1000 cases of congenital cardiac disorders .
diagnosis of idpa is made after excluding all possible causes that can induce pulmonary artery ( pa ) dilatation .
it is usually an incidental finding not fully explained by the patient symptoms and clinical condition .
treatment is usually not required as it is considered to be a benign condition , although literature on long - term follow - up is lacking .
a 68-year - old female presented with insidious onset gradually progressive shortness of breath from mmrc stage 1 to stage 3 for the last 10 years , which further increased over the past 2 months .
she had no associated history of a cough , fever , palpitations , chest pain , pedal edema , orthopnea , or paroxysmal nocturnal dyspnea . on clinical examination , her vitals included pulse rate
there was no pallor , icterus , cyanosis , pedal edema , or raised jugular venous pressure .
5600/dl with a differential count of neutrophils 72% , lymphocytes 10% , eosinophils 1% , and monocytes 7% .
serum c - reactive protein level was normal ( 0.24 mg / dl ) with elevated serum brain natriuretic peptide levels ( 162 pg / ml ) .
anti - nuclear antibodies along with anti - neutrophil cytoplasmic autoantibody levels and thyroid function tests were within normal limit , and there was no evidence of infectious diseases such as tuberculosis or syphilis .
x - ray chest revealed mild cardiomegaly of the right ventricular ( rv ) type with mild right atrial dilatation and massive enlargement of the main pa with normal pulmonary vascular markings [ figure 1 ] .
( a ) chest x - ray showing dilated pulmonary artery , ( b ) contrast - enhanced computed tomography chest showing enlarged main pulmonary artery ( 49.75 mm ) , ( c ) contrast - enhanced computed tomography chest showing dilated left pulmonary artery ( 36.96 ) , ( d ) contrast - enhanced computed tomography chest showing dilated right pulmonary artery ( 37.76 mm ) , ( e ) contrast - enhanced computed tomography showing no evidence of pulmonary embolism , ( f ) computed tomography pulmonary artery reconstruction image showing dilated pulmonary artery echo - cardio - graphic findings revealed a normal - sized left ventricle and left atrium with 55% ejection fraction .
rv was dilated with adequate systolic function , with dilated right atrium , mild tricuspid regurgitation , and mild pa hypertension ( mean pa pressure 36 mmhg ) .
a computed tomography ( ct ) pulmonary angiography with high - resolution ct was done [ figures 1 and 2 ] which revealed dilated main pa with a maximum diameter of 49.75 mm , dilated right main trunk with a diameter of 37.76 mm , and dilated left trunk with a diameter of 36.96 mm .
pulmonary function test revealed restrictive airway defect with a normal diffusing capacity of carbon monoxide .
she was made to walk for 6 min in which she covered 216 meters without desaturation but had moderate fatigue and severe breathlessness at the end of the test .
high - resolution computed tomography sections of lung showing ground glass opacities in lung parenchyma cardiac catheterization was done through right femoral vein / right femoral artery approach .
rv angiogram showed the adequate systolic function of rv with normal pulmonary valve and massively dilated the main pa .
results of right heart catheterization on the basis of mild symptoms and pulmonary artery pressure ( pap ) < 30 mmhg , a massive dilation of pa could not be explained so the diagnosis of idpa was made after ruling out all possible causes .
kaplan et al . postulated it as mal - development of the entire pulmonary tree and congenital weakness of the arterial wall whereas assman thought of it as an unequal division of truncus arteriosus communis . in 1949 , greene et al . and associates established the following pathologic criteria for its diagnosis :
simple dilatation of the pulmonary trunk with or without involvement of the rest of arterial treeabsence of intra - cardiac or extracardiac shuntsabsence of chronic cardiac or pulmonary diseaseabsence of arterial disease , such as syphilis , or more than minimal atheromatosis or arteriosclerosis of the pulmonary vascular tree .
simple dilatation of the pulmonary trunk with or without involvement of the rest of arterial tree absence of intra - cardiac or extracardiac shunts absence of chronic cardiac or pulmonary disease absence of arterial disease , such as syphilis , or more than minimal atheromatosis or arteriosclerosis of the pulmonary vascular tree . in 1960 , deshmukh et al . , presented report of 13 patients in whom right heart catheterization was performed aimed at elaborating its clinical and physiological aspects and to further draw attention to this anomaly .
they opined that normal pressure in the rv and pa should be introduced as the fifth criteria in the diagnosis .
our case showed massive dilatation of pa with no apparent intra- or extra - cardiac shunt or any significant heart or lung disease . on right heart catheterization ,
pap was only 28 mmhg which does not explain the massive dilatation of pa in our case thus confirming the diagnosis . in spite of the well - marked clinical , radiologic and electrocardiographic features ,
the absence of shunt , the normal relationship in cardiac chambers and normal oxygen saturation are important findings .
long - term prognosis of idpa is usually excellent compared to pathological dilatation of pa .
however not much data on long - term follow - up of these patients exist .
management is also not well established , and any patient with an apparent diagnosis of idiopathic pulmonary hypertension needs to be followed up for a long time to know its benign course .
our case adds to the existing literature and spreads physician awareness about this entity and its diagnosis , which should be established after ruling out all possible causes of pulmonary dilatation .
Output:
| idiopathic dilatation of pulmonary arteries ( idpa ) is a rare abnormality of pulmonary arteries , the reported incidence in literature being as low as 0.007% in autopsy samples . with the improvement in diagnostic modalities ,
antemortem diagnosis of idpa has been increasingly established by excluding diseases that induce pulmonary arterial enlargement . here ,
we present a rare case of idiopathic dilatation of the pulmonary artery admitted with shortness of breath where idpa was diagnosed as an incidental finding using computed tomography pulmonary angiography and cardiac catheterization . |
PubmedSumm6818 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: after the tuberculosis agent was discovered by robert koch in 1882 , it was hoped that the disease would be controlled and eradicated .
unfortunately , more than a century has passed since the discovery and tb still claims lives across the world ( 1 ) .
world health organization ( who ) declared tb as urgency in 1993 and urged all nations to control the disease ( 2 ) . in the 21st century , tb poses itself as a major medical concern for all countries .
furthermore , with advances in technology , particularly in the biological molecular field and genetic engineering , new horizons have opened in different research areas ( 3 ) .
tb is a ne - crotizing chronic or acute disease caused by various strains of mycobacterium , namely , m. bovis and m. africanum , and mostly due to m. tuberculosis ( 4 ) .
tuberculosis attacks lungs and involves different body organs and tissues including lymph nodes , pleura , pericardium , kidney and bones ( 5 ) .
every 4 seconds one person contract tb and every10 se conds one dies of the disease .- given the current trend and by every decade , almost 300 million people get infected with the tb bacterium worldwide . despite the discovery of the causing agent , vaccine and highly effective medications , the disease still poses a major health challenge globally ( 6 ) .
if a person with pulmonary tb and sputum smear positive is not diagnosed and treated in time , he may infect 10 to 15 other people annually .
the best way through which one can prevent and control tb is timely diagnosis of smear positive pulmonary tb and effective treatment of the disease ( 7 ) .
so far , one third of the world s population has been infected with tb bacillus and 9 million people contract the disease annually .
75% of deaths happen among economically active groups ( 1554 ) ( 8) . in 2009 ,
tb cases have been reported in all provinces of iran , with most cases seen in sistan and balouchestan , golestan , khorasan razawi , khuzestan , hormozgan , qom , kermanshah and gilan provinces .
80% of the world tuberculosis cases have been reported in 22 countries including pakistan and afghanistan .
figures dating back to 40 years ago show that 140 out of 100 thousand people suffered from tb at the time in iran .
the patient suffering from drug - resistant tb must be treated for 2 years instead of 6 months .
such a patient must be hospitalized , though it is not necessary , and the cost of his medication increased from 4,500,000 irr to 300 million irr .
only 50% of the cases survive and the rest die of tb ( 9 ) .
the incidence of smear positive pulmonary tb has been declining in iran and each year on average the incidence and the recurrence decreased by 4.1% and 3.6% , respectively . on average , tb mortality rate has decreased by 6.8% and tb case - detection rate has increased by 2.5% annually ( 10 ) .
the incidence of tb in iran decreased by 10.1% annually during the first 11 years of assessment ( 19641973 ) ; it increased by 4.3% during the second period from 1977 to 1993 ; the incidence of tb decreased by 4.5% in the third period . during at least the last 10 years , the incidence of tb decreased by 4.5% ( 11 ) .
the present study aimed to assess the 10-year trend of tb rate in west azarbaijan province from 2001 to 2010 and to explore some risk factors that affect the trend .
this was a time series study conducted on the data recorded in the tb care system within the healthcare system in west azerbaijan province from 2001 to 2010 .
the study counted the number of tb cases based on the data recorded by the health care system over the years between 2001 and 2010 . on average , 256 cases of tb
were recorded each year , which translates into 2,560 cases over a period of 10 years . to collect the necessary data , a checklist was developed through considering the nature of the study , and studying the recorded data .
the questionnaire was design based on the demographic information of the patient files which had 17 simple questions .
the questionnaire was given to an epidemiologist and an infectious diseases specialist to control the appropriateness of questions related to tb cases , and after approval , it was used for data collection .
the outcome variable was the count of tb and demographic variables were sex , place of residency , pulmonary type , bcg status , employment , education level , age group , and job .
the researcher collected all the data of the patients from 2001 to 2010 using the checklist , after coordinating with relevant authorities and obtaining necessary permits from west azerbaijan university of medical sciences .
then , all the data were entered into spssv.16 software program . there was not any missing value in the study . a poisson log - linear regression analysis used to explore some factors that might affect the trend of tb rate .
all the collected data were entered anonymously in the checklist and the researchers observed the individual s right for confidentiality with regard to the personal details .
results of relative risks were adjusted for demographic confounding , which were mentioned above to estimate the relative risk of tb more precisely .
probably one of the sources of bias might be overlooking of some tb cases in the western azerbaijan province , although it was not considerable as the expertise of the province claimed it .
sampling strategy was a time series and it was considered in the poisson regression analysis by including year of study as a covariate . adjusted and unadjusted results along with 95% ci for relative risks were presented in statistical tables .
this was a time series study conducted on the data recorded in the tb care system within the healthcare system in west azerbaijan province from 2001 to 2010 .
the study counted the number of tb cases based on the data recorded by the health care system over the years between 2001 and 2010 . on average , 256 cases of tb
were recorded each year , which translates into 2,560 cases over a period of 10 years . to collect the necessary data , a checklist was developed through considering the nature of the study , and studying the recorded data .
the questionnaire was design based on the demographic information of the patient files which had 17 simple questions .
the questionnaire was given to an epidemiologist and an infectious diseases specialist to control the appropriateness of questions related to tb cases , and after approval , it was used for data collection .
the outcome variable was the count of tb and demographic variables were sex , place of residency , pulmonary type , bcg status , employment , education level , age group , and job .
the researcher collected all the data of the patients from 2001 to 2010 using the checklist , after coordinating with relevant authorities and obtaining necessary permits from west azerbaijan university of medical sciences .
a poisson log - linear regression analysis used to explore some factors that might affect the trend of tb rate .
all the collected data were entered anonymously in the checklist and the researchers observed the individual s right for confidentiality with regard to the personal details .
results of relative risks were adjusted for demographic confounding , which were mentioned above to estimate the relative risk of tb more precisely .
probably one of the sources of bias might be overlooking of some tb cases in the western azerbaijan province , although it was not considerable as the expertise of the province claimed it .
sampling strategy was a time series and it was considered in the poisson regression analysis by including year of study as a covariate . adjusted and unadjusted results along with 95% ci for relative risks were presented in statistical tables .
distribution of demographic characteristics of the study population is shown in table 1 . in our
tb study the percentage of male and percentage of female were close to each other ( 52.2% against 47.8% , respectively ) .
the percentage of tb cases were living in the urban area of west azerbaijan was 62.4% .
also , most of the tb cases were aged between 31 and 65 years old . in terms of education level
the highest percentage of tb people ( 75% ) fell in primary school or illiterate group .
interesting of the study population was that the frequency of pulmonary tb was higher than the frequency of external pulmonary tb ( 62.6% against 37.4% ) .
the coverage of bcg vaccine in the tb population was not remarkable and estimated by 56.4% which is not an acceptable coverage . to understand the trend of tb rate over the years of 2001 and 2010
1 . trend of tb by year in the west azerbaijan , iran distribution of demographic variables of the tb study sample , the west azerbaijan , iran figure 1 shows the overall increasing trend of tb rate over the ten years of our study .
fluctuations in the graph suggests that there was a reduction in tb rate for year 2003 then a slightly increase up to 2007 .
the important pick of the graph is on year 2008 in which the percentage of tb cases was increase dramatically to 14.5% .
however , the trend came back to the same level of percentages belong to the years previous to the year of 2008 .
the fluctuation over the years was statistically significant ( chi - square=89.08 ; df=9 ; p < 0.001 ) . to study the effect size of each demographic variable on the mean of the number of tb cases over the followed up years
, a poisson log - linear analysis was used and its results were given in table 2 .
table 2 shows the regression coefficients ( b ) , standard errors of the coefficients , estimated risk ratio ( rr ) , and 95% confidence interval for rr .
all results were adjusted for the size of population of azerbaijan province , as an offset variable , and years of the study .
single variable poisson log - linear analysis results for tb count data the most important risk factor was the level of education so that people with primary level or with illiterate level had a statistically significant tb rate of 5.21 ( 4.66 - 5.81 ) times the same rate for people with diploma level or higher degrees adjusted for the years of study .
next risk factor was age and as table 2 shows people who aged between 31 and 65 years had 1.85 ( 1.70 - 2.03 ) times rate of tb compare to the reference group , significantly .
the next two risk factor were type of tb and place of residency , i.e. , pulmonary tb cases had higher rate than external pulmonary tb cases ( rr=1.67 ; ( 1.54 - 1.80 ) ) and rate of tb in urban area was 1.66 ( 1.54 - 1.80 ) times more than the rate of rural area . in terms of gender ,
rate of tb in male cases was 1.09 ( 1.01 - 1.19 ) times the rate of tb in females and statistically significant .
finally , the last factor with the lowest risk was bcg with rr=1.29 ( 1.20 - 1.40 ) for people who received bcg compared to the people who had not received it .
this is probably a significant result by chance and should be tested in a multiple analysis to see if bcg still has a significant effect as the above after adjustment for the other factors . as some risk factors may modify the size effects of the other factors we used a multiple poisson log - linear analysis to estimate the adjusted effects of each factor on the rate of tb for the years of study , population offset , and for the other factors in the log - linear model .
the interesting result of the multiple analysis was that although the bcg factor had a significant rate of rr=1.29 in the single variable analysis , it was not a protective significant factor in the multiple variable analysis , i.e. rr= 1.07 ( 0.98 - 1.16 ) .
it was in accordance with the coverage percentage of bcg which was very low in the tb population ( 56.4% ) as mentioned in the descriptive results .
all the remaining factors had significant effects on the trend of tb even after adjustment for year and population size . among them education level and being housewife had higher rr , i.e. rr= 1.86 ( 1.63 - 2.10 ) and rr = 1.61 ( 1.39 - 1.86 ) , respectively ( table 3 ) .
multiple poisson log - linear analysis results for tb study sample , west azerbaijan , iran to justify the log - linear results for the tb trend in the data of azerbaijan province in iran , the good - ness - of - fit statistics of the log - linear model used in our study was checked and as likelihood ratio and pearson statistics in table 4 show the model was accepted in terms of assumptions of linearity , poisson distribution for tb count data , and stability of variance ( p= 1.000 ) .
it is important to note that in the log - linear model only main effects of the factors were included in the analysis , i.e. , the model was not a saturated one .
a key factor in health planning in any society is to determine the incidence trend of diseases .
knowing the pattern of changes in the incidence of diseases in a country can be of high significance for countrywide planning strategies .
public health organizations believe that assessing or monitoring the incidence trend of diseases , mortality rate and social , behavioral and health risk factors may contribute to unfavorable health incidents .
studying the trend of changes in prevalence or incidence rates provides valuable information for needs assessment , design and revision of programs and development indices in a country .
assessing the data over a period can also help predict the frequency of future incidents .
the present study investigated the tb incidence in 10 years and its incidence in west azerbaijan province in 5 years .
the findings of this survey suggest that only 3.8% of the patients were hiv positive .
aids has been the most common factor in spreading tb as it weakens the body s immune system .
a rise by two to three times in hiv cases was documented for the incidence of tb in the 1990s ( 12 ) .
the comorbidity of hiv and myco - bacterium tuberculosis increased the risk of active tb by 5 to 10% annually ( 20 to 37 times the number of non - hiv positive people ) .
the figure is 5 to 10% for non - hiv positive people in their lifetimes ( 2 ) . in countries where the prevalence of hiv is more than 1% , the rate of tb is higher among women than among men ( 13 ) .
the effects of aids virus on tb are as follows : low rate of treatment , high morbidity , recurrence and non - adherence to treatment due to side - effects of drugs , death during the treatment , and rise in the possibility of transmission of drug - resistant species ( 11 ) .
the present research showed that the total number of recorded tb cases within 10 years ( 20012010 ) was 2,560 .
most cases occurred in 2008 when 370 people contracted the disease while the least number of cases was reported in 2005 when 184 people contracted it .
the number of recorded cases in the first year ( 2001 ) was 215 people while it increased to 298 in the last year , that is , 2010 .
an assessment of the incidence rates showed that it was 8.70% per 100,000 people in 2006 .
this comes as the rate reached 9.91% in 100,000 in 2010 with a rising trend in the incidence of the disease .
they assessed 1,323 cases recorded in the tb healthcare system of the province between 2004 and 2009 . in the period ,
the rate of smear positive during the period was within the acceptable range of iran s program to control tb .
however , the incidence of extrapulmonary tb was higher than the acceptable index ( 14 ) .
. showed in isfahan that the rate of case - detection was 90% and 77% , the rate of successful treatment was 80% and 58% and the incidence rate of smear positive pulmonary tb was 2.28% and 1.11% , respectively for 2005 and 2006 .
the reason why they went for a 5-year period was that they had no access to accurate population data over a period of 10 years .
this is a main drawback to the program and a weakness of the healthcare system in that statistics are not stored and sorted out properly , which by itself led to a disruption in appropriate application of the statistical methods and better reasoning .
however , the nature of this study has made it difficult to accurately determine the cause of the changes in the trend of the disease . assessing tb in terms of gender
thus , most of the recorded tb patients were men . however , a study on the trend of smear positive pulmonary tb between 2001 and 2008 showed the west azerbaijan province was witnessing a decreasing trend of tb incidence ( 10 ) .
the rate was 9.11 per 100,000 people among men in 2005 and 8.27 per 100,000 people among women in 2010 .
the rate also increased from 8.27 per 100,000 among women in 2006 to 10.73 per 100,000 in 2010 .
the results of our study show that despite the low percentage of female tb cases , the high number of women contracting the disease in 2006 compared to men shows how vulnerable they are to tuberculosis .
it seems that the number of female cases of tb is obviously rising in comparison to men .
the findings of our study also showed that the mean age of the recorded patients was 49.6920.68 .
overall , the mean age of men was higher and most reported cases were higher than 60 years old . given the rise in the age of tb patients in iran , it seems that one of the features of tuberculosis in developing countries is evident among the population under study .
a study conducted in the us between 1994 and 2007 showed that of 18,965 reported cases , 31% were adolescents under 18 .
the research found that more than 40% of decrease came about among adolescents ( 16 ) .
tb is mainly found in industrial nations among the elderly and it is often caused by the recurrence of old infections .
that is due to the weakness of the immunity system , as a result of age . in those countries ,
although most cases were recorded in urban areas ( see the results of a study in damghan ) ( 17 ) , the incidence rate among urban people decreased from 9.97 in 100 thousand in 2006 to 8.99 in 100 thousand in 2010 .
the rate increased among rural people from 6.79 in 100 thousand in 2006 to 11.33 in 100 thousand in 2010 . however , a study showed a higher recovery success rate in the treatment for positive smear lung tb among rural patients as compared to urban patients in the province ( 14 ) .
a comparison of results showed that the incidence rate of the disease was higher among rural people .
different studies show that the incidence rate of tb among urban people is more than rural people ( 1 ) .
a study showed , the results of puissan regression aimed at determining the concurrent effects of such factors as gender , age and place of living were significant only for age and place of living .
given the fact that tb is a disease of poverty , economic shortages and lack of knowledge , the decreasing trend of the disease is indicative of a rise in people s awareness about tb and an increase in income and living standards of people .
the rise in the arte also stems from social and political changes in the country and in neighboring nations ( 20 ) .
it was impossible for us to conduct 10-year calculations that would involve all necessary variables .
this was due to lack of access to separate population statistics , which was a major restriction faced by our study .
another drawback was that the data recorded with the healthcare deputy office were possibly incomplete .
hence , any deficiencies or changes in the system can change the results and cause problems over which the researchers have no control .
conside - ring the results of the present study , we can improve the status quo by taking the following measures :
most tb patients are poor and may be addicts ; there is no way to get them to follow the right medical regimen . for the reason
, we need to make appropriate measures to help them earn a living so that they can afford the expenses of dots treatment .
we must prevent test treatments practiced in some parts of iran and authorities must deal with violators appropriately .
decisions should be made and directives should be issued as to listing some diseases as a threat to public health and making the treatment of patients particularly tb patients mandatory so that they can not escape treatment .
proper knowledge of epidemiological differences and critical parts of towns ; case - detection interventions among vulnerable people , particularly more susceptible age groups ; studying the implementation of tb case - detection programs at healthcare centers ; standardizing sputum microbiology labs and using them optimally ; properly communicating with private healthcare centers ; strengthening infrastructures ; educating the population ; empowering the personnel involved in controlling the disease , and following up on people in contact with the patients are all a necessity .
we need to take more effective and comprehensive measures to achieve the goals of the millennium , that is , identifying at least 70% of expected positive smear tb cases , reducing the incidence and mortality rate among tb patients to 50% by 2015 as compared to 1990 and finally eradicating the disease by 2050 ( decreasing the number of tb cases to less than 1 person in a million ) .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .
Output:
| abstractbackgroundthe present study aimed to explore some risk factors affected the mean of the number of tuberculosis ( tb ) in west azerbaijan province , iran between 2001 and 2010.methodsour time series study analyzed the data of 2,560 tb patients as registered with tb patients care system in west azerbaijan province from early 2001 to 2010 .
a checklist was prepared for collecting the data and they were then analyzed in spss v.16 software.resultsthe percentage of male and percentage of female were close to each other ( 52.2% against 47.8% , respectively ) .
a significant increasing trend of tb rate was found over the years of 2001and 2010 with a pick at 2008 ( p<0.001 ) .
a poisson log - linear analysis showed that the most important risk factor of the trend of rate was the level of education so that people with primary level or with illiterate level had a statistically significant tb rate of 5.21 ( 4.66 - 5.81 ) , adjusted for years .
the next risk factor was type of tb and place of residency , i.e. , pulmonary tb cases had higher rate than external pulmonary tb cases ( rr=1.67 ; ( 1.54 - 1.80 ) .
the last factor with the lowest risk was bcg with rr=1.29 ( 1.20 - 1.40 ) for people who received bcg compared to the people who had not received it.conclusionalthough the co morbidity of aids and tb was not a major problem , it is necessary that special attention be paid to the way of implementing the tb control program based on the demographic risk factors of the study population . |
PubmedSumm6819 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: subclavian route for insertion of central venous catheters ( cvcs ) is commonly employed in critically ill patients requiring long - term central venous access as it has a lower risk of infection and has better patient comfort .
misplacement of cvc tip can rarely cause erosion of the catheter through the right atrium or right ventricle , leading to haemothorax , hydrothorax or cardiac tamponade and can be fatal .
it is hence recommended to locate the tip in the superior vena cava , outside the pericardium to avoid cardiac tamponade .
there is no universally accepted standard method of estimating the depth of insertion of cvcs .
surface landmarks , various formulae , electrocardiography and transesophageal echocardiography have been used for positioning the catheter tip in adults .
cadaver studies and computerised tomography in adults have shown the carina to be above the level of pericardium .
the pericardium can not be seen on a chest x - ray that is routinely done to check the position of the catheter tip .
however , carina can be easily identified on a chest x - ray and can be used as a reference point for optimal position of cvc tip .
the clavicular notch is an oval articular surface on either side of the manubrium sternum for articulation with the sternal end of the clavicle , and can be easily identified .
the angle of louis , the prominence formed by the manubriosternal joint is at the same horizontal plane as the carina .
the present study compares the measurement of surface landmarks along the course of right scv with that of the formula method to estimate the appropriate depth of insertion for right sided subclavian cvcs .
the patients admitted to critical care units at our institution in whom subclavian cvc was deemed necessary were recruited into the study after approval from ethics committee .
patients with gross deformities of the chest ( pigeon chest , barrel chest ) were excluded from the study .
the patients were randomly assigned to one of the two groups with a computer generated random number table to formula group or topographic group for calculating the depth of catheter insertion .
the right scv was cannulated by infraclavicular approach under standard aseptic precautions using a double - lumen cvc ( certofix , b braun , melsugen , germany ) as per the institutional protocol for cvc insertions .
the formula as described by peres was used to calculate the depth of catheter insertion in the formula group ( for right scv , height [ cm]/10 , -2 ) .
the depth of insertion for the topographic group was determined as described by kim et al .
patient 's head and neck were placed in neutral position after insertion of the guide wire .
topographical measurement was done by placing the catheter naturally with its own curvature over the draped skin ( without direct contact with the skin ) , starting from the insertion point of the needle through the ipsilateral clavicular notch , and to the insertion point of the second right costal cartilage to the manubriosternal joint .
the position of cvc tip , in relation to carina , was measured on a post procedure chest x - ray from the picture archiving and communication system .
cvc tips positioned above the carina were presented as positive values , and those below the carina were presented as negative values .
catheter tip position was considered acceptable if it was in the range of up to 1 cm above and up to 1 cm below the carina .
if the tip was more than 1 cm above the carina , a new catheter was inserted .
if the tip was more than 1 cm below the carina , it was repositioned by pulling back .
any other untoward immediate periprocedure complications were also noted . in a study with the landmark technique , 96.1% of cvc tips
expecting similar results with 10% minimum difference between landmark and formula method , and to get 80% power , 95% confidence level in the results , a minimum of 124 subjects in each group was required .
a mann whitney test and chi - square test was performed for statistical analysis using spss for windows version 18.0 ( armonk , ny : ibm corp ) .
patient characteristics are as described in table 1 . there were no catheterisation failures during the study period .
one patient in the formula group and two from the topographic group had catheter malposition and were excluded from the data analysis .
the median ( interquartile range ) cvc tip position relative to the carina was 0 .
9 cm ( 2.93 , 0.6 ) in the formula group and 0.96 cm ( 3.1 , 0.95 ) in the topographic group .
the cvc tips , positioned by both methods were situated > 1 cm below the carina ( 49.6% in formula group and 44.5% in topographic group ) [ table 2 ] .
immediate complications such as catheter site haematoma , arrhythmia and catheter malposition noted in both groups were similar [ table 3 ] .
this study did not find any significant difference in the cvc tip position with either method used to estimate the depth of catheter insertion . nearly , half of the catheters inserted in both the groups were > 1 cm below the carina , thus requiring repositioning .
it is intended that the cvc tip should lie at the superior venacava - right atrial junction .
the most reliable radiological landmark in identifying this point is the right tracheobronchial angle or carina .
the package insert that accompanies the cvc packs states that it is not advisable to site the catheter tip in the right atrium , due to the potential risk of cardiac tamponade if the tip erodes the vessel wall below the pericardial reflection .
the upper boundary of pericardial sac is not visible on a chest x - ray .
cadaver studies have shown that it is very unlikely to be above the level of carina .
the parallax effect is the magnification of structures located anteriorly or posteriorly and peripherally on a chest x - ray and should be taken into account when using chest x - ray for measurements .
this effect is more pronounced in anteroposterior chest x - ray obtained in the critical care unit .
the carina is located in the centre of the thorax , thus has less potential for image distortion and measurement error due to parallax effect . hence , in the present study we considered the carina as the radiological reference point for measuring the distances to the catheter tip .
other investigators in their study found landmark technique to be a reliable bedside predictor of optimal insertion depth for right subclavian cvc .
variation in anatomical morphological features among various racial groups is a well - known fact .
our study population being different form the one in the above study may explain the difference .
the landmark techniques employed to estimate the depth of catheter insertion may need to be validated in various racial groups before applying them universally .
a study in asian population with computerised tomography found formula method to be less accurate in optimal positioning of cvc catheter tip .
landmark technique was no better than formula method in estimating the appropriate depth of catheter insertion for right scv cvcs in indian population .
bedside predictors of cvc insertion depth may need to be validated prior to universal use in specific population groups .
Output:
| background and aims : subclavian central venous catheterisation ( cvc ) is employed in critically ill patients requiring long - term central venous access .
there is no gold standard for estimating their depth of insertion . in this study
, we compared the landmark topographic method with the formula technique for estimating depth of insertion of right subclavian cvcs.methods:two hundred and sixty patients admitted to intensive care unit requiring subclavian cvc were randomly assigned to either topographic method or formula method ( 130 in each group ) .
catheter tip position in relation to the carina was measured on a post - procedure chest x - ray .
the primary endpoint was the need for catheter repositioning .
mann
whitney test and chi - square test was performed for statistical analysis using spss for windows version 18.0 ( armonk , ny : ibm corp).results : nearly , half the catheters positioned by both the methods were situated > 1 cm below the carina and required repositioning.conclusion:both the techniques were not effective in estimating the approximate depth of insertion of right subclavian cvcs . |
PubmedSumm6820 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: missile injuries of the anterior skull base usually occur during war or warlike situations ; however , in the united states , > 100 americans die by suicide on an average day , and 50 of these suicides involve the use of firearms.1 the anterior skull base is the most common region of the skull base injured by a cranial missile .
most csf leaks can be broadly classified into traumatic ( most frequent ) , nontraumatic ( tumors ) , spontaneous , and iatrogenic.2 the clinical presentation usually is of unilateral clear rhinorrhea that can be continuous or persistent .
the patient can complain of a saltwater taste sensation ; fewer patients experience a sweet taste sensation .
also , the halo sign ( clear ring surrounding a central bloody spot on gauze ) can be present .
high - resolution computer tomography ( ct ) is a vital diagnostic and planning tool in patients with cranial and maxillofacial trauma .
ct cisternography , radionuclide cisternograms , magnetic resonance imaging ( mri ) , -2 transferrin , and intrathecal fluorescein are also part of the armament used in the diagnosis of csf leaks .
the goals of surgery in patients with gunshot wounds to the head are to evacuate a hematoma , achieve hemostasis , debride the wound , provide dural closure , and repair the skull base .
we present two cases of patients with csf leak after gunshot wound to the skull base .
a 16-year - old young man with a history of a self - inflicted gunshot wound with point of entry through the mouth with a 3-cm exit wound on top of the head .
( a ) noncontrast axial computed tomography consistent with a gunshot wound with entry point at the left parasagittal midline hard plate ( white arrow ) .
( b ) fracture of the inner table of both frontal sinuses with multiple fragments within the frontal sinuses and along the interhemispheric fissure ( white arrow ) .
( c ) the trajectory coursed cranially through the left nasal cavity , left ethmoid air cells , left frontal lobe , and exited through the left frontal bone .
( d ) posterior intracranial view shows missile trajectory entering through the skull base and exiting through the left frontal bone ( arrow ) .
the patient underwent endoscopic reduction and debridement of a frontal sinus encephalocele and csf leak repair .
the bone fragments were debrided as well as the brain tissue within the cavity . a large posterior table defect in the left frontal sinus
the brain tissue was covered with duragen ( integra lifescience corporation , plainsboro , new jersey , united states ) .
the mucosa of the frontal sinus was removed , and abdominal fat was packed to obliterate the cavity .
a mucosal graft was not feasible due to the location and extent of the defect .
to date the patient is without any complaints of clear rhinorrhea or a salty taste sensation .
nasal endoscopy shows a bilateral patent frontal sinus recess with no evidence of obstruction or drainage .
( a ) sagittal magnetic resonance t1 fluid - attenuated inversion recovery scan shows postoperative result of frontal sinus obliteration and frontal sinus encephalocele repair . bilateral frontal cortical and subcortical encephalomalacia from sequela from gunshot wound injury ( arrow , a and b ) .
( b ) residual pneumatization of the left frontal sinus ( arrowhead , a and b ) .
no evidence of frontal sinus mucocele formation . a 19-year - old female patient presented with a self - inflicted gunshot wound to the right frontal lobe with right intracerebellar hematoma . upon arrival
, neurosurgeons performed a first attempt to repair the frontal sinus floor with an inner table of bone flap .
the bullet involved the frontal sinus , the posterior ethmoid , nasal septum , right sphenoid sinus , and medial pterygoid plate with a major bullet fragment lodged into the right , at c2-c3 vertebral level , without lesions of the cervical spine .
( a ) coronal head computed tomography ( ct ) shows the skull base fracture ( arrow ) .
( b ) sagittal view of head ct shows bullet entry in the forehead through the anterior and posterior walls of the right frontal sinus ( arrow ) .
one month after discharge , the patient was complaining of right - sided clear rhinorrhea , with no salty taste sensation in her mouth .
postfrontal craniectomy ct was done , and the patient was scheduled for endoscopic csf leak repair ( fig .
right anterior ethmoidal air cells opacification ( arrowhead ) with fracture of ethmoid sinus roof ( arrow ) .
then 0.1 ml of preservative - free 10% fluorescein was mixed with 10 ml of csf and slowly injected intrathecally over 30 minutes .
the sites of the csf leak were identified at the ethmoid frontal junction anteriorly and in the posterior ethmoidal cells .
previous harvested abdominal fat was positioned at the site of the leaks , which resulted in cessation of the fluorescein - identified leak .
both grafts were supported with surgicel ( ethicon , inc . , somerville , new jersey , united states ) followed by duraseal ( confluent surgical , inc . , waltham , massachusetts , united states ) .
nexfoam ( hemostasis , saint paul , minnesota , united states ) were placed to further support the graft , and two merocels ( medtronic , mystic , connecticut , united states ) were placed in the right nasal cavity . to date there is no evidence of csf leak .
a 16-year - old young man with a history of a self - inflicted gunshot wound with point of entry through the mouth with a 3-cm exit wound on top of the head .
( a ) noncontrast axial computed tomography consistent with a gunshot wound with entry point at the left parasagittal midline hard plate ( white arrow ) .
( b ) fracture of the inner table of both frontal sinuses with multiple fragments within the frontal sinuses and along the interhemispheric fissure ( white arrow ) .
( c ) the trajectory coursed cranially through the left nasal cavity , left ethmoid air cells , left frontal lobe , and exited through the left frontal bone .
( d ) posterior intracranial view shows missile trajectory entering through the skull base and exiting through the left frontal bone ( arrow ) .
the patient underwent endoscopic reduction and debridement of a frontal sinus encephalocele and csf leak repair .
the bone fragments were debrided as well as the brain tissue within the cavity . a large posterior table defect in the left frontal sinus
the brain tissue was covered with duragen ( integra lifescience corporation , plainsboro , new jersey , united states ) .
the mucosa of the frontal sinus was removed , and abdominal fat was packed to obliterate the cavity .
a mucosal graft was not feasible due to the location and extent of the defect .
to date the patient is without any complaints of clear rhinorrhea or a salty taste sensation .
nasal endoscopy shows a bilateral patent frontal sinus recess with no evidence of obstruction or drainage .
( a ) sagittal magnetic resonance t1 fluid - attenuated inversion recovery scan shows postoperative result of frontal sinus obliteration and frontal sinus encephalocele repair . bilateral frontal cortical and subcortical encephalomalacia from sequela from gunshot wound injury ( arrow , a and b ) .
( b ) residual pneumatization of the left frontal sinus ( arrowhead , a and b ) .
a 19-year - old female patient presented with a self - inflicted gunshot wound to the right frontal lobe with right intracerebellar hematoma . upon arrival , neurosurgeons performed a first attempt to repair the frontal sinus floor with an inner table of bone flap .
the bullet involved the frontal sinus , the posterior ethmoid , nasal septum , right sphenoid sinus , and medial pterygoid plate with a major bullet fragment lodged into the right , at c2-c3 vertebral level , without lesions of the cervical spine .
( a ) coronal head computed tomography ( ct ) shows the skull base fracture ( arrow ) .
( b ) sagittal view of head ct shows bullet entry in the forehead through the anterior and posterior walls of the right frontal sinus ( arrow ) .
one month after discharge , the patient was complaining of right - sided clear rhinorrhea , with no salty taste sensation in her mouth .
postfrontal craniectomy ct was done , and the patient was scheduled for endoscopic csf leak repair ( fig .
right anterior ethmoidal air cells opacification ( arrowhead ) with fracture of ethmoid sinus roof ( arrow ) .
then 0.1 ml of preservative - free 10% fluorescein was mixed with 10 ml of csf and slowly injected intrathecally over 30 minutes .
the sites of the csf leak were identified at the ethmoid frontal junction anteriorly and in the posterior ethmoidal cells .
previous harvested abdominal fat was positioned at the site of the leaks , which resulted in cessation of the fluorescein - identified leak .
both grafts were supported with surgicel ( ethicon , inc . , somerville , new jersey , united states ) followed by duraseal ( confluent surgical , inc . , waltham , massachusetts , united states )
. nexfoam ( hemostasis , saint paul , minnesota , united states ) were placed to further support the graft , and two merocels ( medtronic , mystic , connecticut , united states ) were placed in the right nasal cavity . to date there is no evidence of csf leak .
csf is an ultrafiltrate of plasma produced by the choroid plexus that offers mechanical and immunologic protection for the brain .
a csf rhinorrhea is defined as a fistula between the dura and the skull base with csf discharge through the nose.3 about 70 to 80% of csf leaks are secondary to trauma and evident within the first 2 days , first week , or within the first 3 months.2
4 energy deposited along the missile trajectory shatters the bone and lacerates soft tissues , which makes it difficult to diagnose a csf leak upon arrival.5 also , the surrounding edema associated with the trauma can conceal these leaks momentarily , so csf leaks can be revealed after this edema subsides or necrosis of the surrounding tissues occurs .
the greatest concern with a csf leak is the potential for meningitis , with a generally accepted rate of 10%.6 approximately 35% of patients with recurrent meningitis have csf leaks secondary to trauma.2 a missile traversing the face creates a communication between air - filled mucus - secreting cavities and the subarachnoid spaces with wound contamination through the missile entry point from oropharyngeal commensal staphylococcus , gram - negative or gram - positive rods.7 a 2006 cochrane review8 concluded that no evidence indicates that prophylactic antibiotics reduce the risk of meningitis in patients with skull base fractures with active csf leak .
however , there are no data to apply this statement to patients with gunshot wounds to the head .
high - resolution ct is vital for the planning and prognosis of patients with a gunshot wound to the head ; it is also the preferred method to localize the site of a skull base fracture .
however , ct cisternography or mri may be required to diagnose csf rhinorrhea . in the presence of a skull base fracture on ct and a clinical csf leak ,
there is no need for a further confirmatory test . in cases where a confirmatory test is needed , the -2 transferrin assay is the test of choice because of its high sensitivity and specificity.4
9
intrathecal fluorescein has been used to confirm and intraoperatively localize csf leaks.2
4 the recommended dilution is 0.1 ml of 10% intravenous fluorescein in 10 ml of the patient 's own csf that is infused slowly over 30 minutes .
a yellow fluid leaking in the nose should be visualized in the vicinity of the defect , and the use of a blue - light filter makes the sensitivity even higher .
patients with csf leaks < 7 days have an 11% chance to develop meningitis versus 88% of those lasting > 7 days .
surgical treatment is indicated when they last > 1 or 2 weeks.10 patients with increased intracranial pressure , such as those who experience intracranial trauma , make hernias at points of weakness ; these patients have a less successful rate of csf leak closure and more risk of developing meningoencephalocele.4 nonetheless , the success rate of surgical closure is 95% for csf leaks associated with trauma.11
in patients with a gunshot wound to the head , neurosurgical intervention is usually required , so it is reasonable to repair an evident csf leak .
however , when intracranial trauma is present , the associated significant brain edema makes an early repair likely to fail because of elevated intracranial pressure . in agreement with other authors,12
13
we believe the use of a lumbar drain does not provide an additional benefit in the treatment of csf leaks associated with gunshot wounds to the head , especially because of the risk of overdrainage and the resultant pneumoencephalos .
endoscopic closure of csf leaks was first described by wigand in 1981 , and to date , it continues to be the preferred method of csf leak closure because of its high success rate ( 9097%).2
3
4
9
10
14 in cases of trauma , an open approach for repair of these lesions is still favored .
we present two cases where satisfactory endoscopic csf leak repair was performed after gunshot wound to the head .
the primary goal of the repair is to separate the intracranial from the extracranial spaces . in the cases
presented , an endoscopic repair was favored to minimize brain manipulation of an already severely injured brain .
cranial base repair with fat and/or mucosa is utilized in other instances and highly successful .
postoperative recommendations are 30 degrees of head elevation , bed rest , stool softeners , antiemetics , blood pressure management , and recommendations to refrain from sneezing , nose blowing , coughing , and valsalva maneuvers .
endoscopic closure of anterior skull base csf leaks is now recognized as the treatment of choice for most csf leaks . in those cases resulting from firearm injuries ,
treatment should be decided by the severity of neurologic deterioration throughout the emergency period and the existence or absence of associated intracranial lesions .
the risk of suppurative sequelae in patients with a missile trajectory though the skull base are high , especially when the sinuses have been compromised , so the timing for surgery should be decided with great care and with a multidisciplinary approach . in selected patients in whom
the primary concern is the repair of a csf leak and there is no need to address intracranial injuries , an endoscopic endonasal repair can be safe and effective .
Output:
| objectives to describe two cases of cerebrospinal fluid ( csf ) leak repair after gunshot wound to the head .
design retrospective review of two cases .
settings a large regional tertiary care facility .
participants two patients with gunshot wounds to the skull base .
main outcome measures preoperative and postoperative physical and radiologic findings .
results patients in this series underwent endoscopic surgery , debridement , and repair of csf leaks after gunshot wounds to the head . to date , the patients are without csf leak
.
conclusions endoscopic closure of anterior skull base csf leaks in patients with gunshot wounds can be safe and effective .
treatment should be decided by the severity of neurologic deterioration throughout the emergency period and the existence or absence of associated intracranial lesions .
timing for surgery should be decided with great care and with a multidisciplinary approach . |
PubmedSumm6821 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the non - invasive risk assessment of life - threatening ventricular arrhythmia is of great clinical importance , especially in the prevention of sudden cardiac death ( scd ) in patients after myocardial infarction ( mi ) .
although there currently exist many noninvasive parameters quantifying the depolarization and repolarization process in time and space domains , these parameters remain the subject of intensive study .
the ecg - based parameters calculated from the 12 standard leads or 3 orthogonal leads ( e.g. , prolonged qrs interval , prolonged qt interval , large qt dispersion , microvolt t - wave alternans , total cosine of mean angle between qrs complex and t wave ) are considered as predictors of scd [ 16 ] ; nonetheless , their effectiveness is still debated [ 612 ] .
beat - to - beat analysis of subsequent cardiac cycles has recently become a very promising tool for the identification of patients at risk for ventricular tachycardia ( vt ) .
there is a large body of evidence supporting the assumption that increased qt variability , low heart rate variability , and heart rate turbulence show good diagnostic value for ventricular tachycardia ( vt ) detection [ 1316 ] .
vt risk assessment in mi patients was also studied using advanced frequency and time - frequency analysis of high resolution ecg .
it was reported that parameters obtained by using the fast fourier transform and parametric modeling method with an autoregressive model , as well as wavelet transform , have good discriminative properties [ 1720 ] .
body surface potential mapping ( bspm ) offers a possibility for more precise study of temporal and spatial distributions of cardiac electrical activity in comparison to standard 12-lead electrocardiography .
one of the most often examined parameters calculated from bspms is the area under the qrst complex , which was also used to assess repolarization heterogeneity described by non - dipolar content of qrst integral maps [ 2125 ] .
however , the qrst integral map s ability to reveal repolarization dispersion has been questioned .
the search for reliable risk indices for ventricular arrhythmias is still one of the major remaining tasks in high resolution ecg mapping .
bspm might be studied using time - average technique or beat - to - beat analysis . in this preliminary study we focused on the time - average technique .
the values of depolarization and repolarization parameters for ventricular arrhythmia risk stratification were assessed by studying patients with chronic myocardial scar areas , with and without documented ventricular arrhythmias , as well as by comparing these 2 patient groups with a control group of volunteers with fully intact myocardium .
we proposed and preliminarily verified new , non - invasive markers of vt risk assessment based on analysis of high resolution body surface potential maps ( hr bspm ) .
the developed parameters reflect the abnormality in spatial distribution of the repolarization phase and its relation to changed spatial distribution of the depolarization phase in the group of mi patients with risk of vt .
the statistical values obtained for these new parameters were compared to already known parameters calculated in the same studied groups of mi patients and healthy volunteers . the effectiveness of implanted cardioverter - defibrillators ( icd ) to prevent scd in mi patients is already proven [ 6,2831 ] . however , highly effective identification of patients for icd therapy is still difficult , and the number of icds needed to achieve 1 year of patient survival is still un - satisfyingly high .
the proposed parameters could also assist in noninvasive identification of mi patients for icd therapy .
two groups of patients with remote myocardial infarction and a control group of healthy volunteers were studied .
the first group comprised 26 patients with documented risk of ventricular tachycardia , called the mi - vt patients group .
this group consisted of mainly secondary prevention patients with implanted cardioverter - defibrillator or qualified for icd therapy due to the risk of ventricular tachycardia .
the eligibility criteria to implant icd were : 1 ) documented episodes of ventricular tachycardia ( 21 pts ) , and 2 ) induced sustained monomorphic vt during programmed electrical stimulation ( 5 pts ) .
the second group consisted of 14 patients after myocardial infarction in whom any sustained or not - sustained ventricular tachycardia was stated , and is called the mi - non - vt patients group .
the control group consisted of 25 volunteers who had normal electrocardiograms , no history of cardiovascular disease , and to whom any medications were administered .
the study was approved by an institutional ethical review committee and the subjects gave informed consent .
active electrodes ( containing ag2cl contact sensors with preamplifiers ) were located around the torso ( figure 1 ) according to the ecg lead system proposed by sippensgroenewegen et al . .
the 64 unipolar ecgs were simultaneously recorded for 15 minutes with 4096 hz sampling frequency .
next , signals were amplified and converted into digital form with 24-bit amplitude resolution , sent through a fiber - optic transmitter to the computer , and stored on a hard disk for off - line processing .
the raw ecg data were filtered using low pass butterworth filter limiting frequency to 300 hz and decimate filter , decreasing sampling frequency to 1024 hz .
the reference ecg signal , known as wilson s central terminal ( wct ) , was subtracted at this preprocessing step .
then , ecg signals in each lead separately were averaged in time using a cross - correlation method . to receive a low noise level , both the number of averaged cycles ( usually ca . 100 cycles ) and the value of correlation coefficient ( usually 0.98 ) were fitted .
the level of noise was measured on the 20 ms isoelectric u - p interval , because , as we noticed , during pq interval , atrial repolarization is still present , which has also been confirmed by ihara et al . the obtained root mean square ( rms ) value of noise in averaged ecg signals was below 0.5 v . to detect ecg characteristic time instances ( onsets and offsets of both depolarization and repolarization waves ) , an algorithm proposed by acar , based on singular value decomposition ( svd ) , was applied . for each subject , a rectangular matrix m ( n , m ) , containing n averaged ecg leads signals , each of m samples length , was decomposed according to the following equation where u(m , m),v(n , n ) are the square , orthogonal matrices and is the diagonal matrix ( m , n ) of singular values .
next , the matrix s was obtained by projecting the matrix m down into the reduced space defined by only the first 3 left - singular vectors of the unitary matrix u. the rms signal was calculated using 3 vectors of the matrix s ( s1 , s2 , s3 ) , as shown in figure 2 .
the global ( common for all leads ) characteristic time instances of ecg curves were found for this rms signal , and then were searched in each lead separately .
initially , r - peak was marked as the maximum of the rms signal , and then t maximum was marked in relation to r - peak .
the p - wave beginning was calculated by inspecting the stationarity of the time relation between the vectors s1 and s2 in respectively defined time windows .
next , the onset of q - wave and the offset of s - wave were calculated from the difference of rms signal using the thresholding method
. the t - wave end was established as the minimum of rms signal in time window related to t wave maximum .
then , in each lead individually , the waves ends were established in relation to the global waves ends using the thresholding method for q onset , and p , s , t offsets and for p , r , t peaks .
finally , iso - amplitude maps were generated for various parameters described in the next section . to assess the risk of arrhythmia , 3 new bspm parameters were proposed .
the first parameter , called stt_qrst_corr , was based on the spatial relationship between the maps of stt and qrst integrals .
this parameter was defined as a spearman rank correlation coefficient between stt area and qrst area maps ( eq .
two sets of the data , stti and qrsti , were converted into the stti rankings qrsti and before calculating the spearman correlation coefficient between ranks where n is the subject number , i is the lead number , and m is the total number of leads .
the next 2 parameters , called stt_di and tsi_di , were proposed to quantify spatial changes in the repolarization phase .
departure index ( di ) was used to describe the changes between the group of healthy subjects and each individual subject of the entire studied population . a tsi parameter ( t wave shape index )
was defined as the ratio of stt integral and t - wave length : where tsin is the value of tsi parameter for subject n , v(t ) is the ecg amplitude in the time instant t , ton , toff is the onset and offset of t wave , respectively , and l(v ) is the length of t wave curve .
the tsi_di parameter was defined as the sum of absolute values of departure indices of tsi parameter calculated in each lead .
the formula describing the tsi_di parameter is as follows : where tsi_din is the value of tsi_di parameter for subject n ,
cstti is the mean value of tsi parameter calculated in the control group in the lead i , and (cstti ) is the standard deviation of tsi parameter calculated in control group in the lead i. the stt_di parameter was defined as the sum of absolute values of departure indices of stt integral calculated in each lead .
the formula describing stt_di parameter is as follows : where stt_di is the value of stt_di parameter for subject n ,
cstti , and ( cstti ) are adequately the mean value and the standard deviation of stt integrals calculated in the control group in lead i. the proposed parameters were compared to 6 well known arrhythmia indices : the qrs width , the qt interval , the dispersion of qt interval , the tpeak - tend interval , the averaged cosine of the angle between qrs complex , and the t - wave ( tcrt ) introduced by acar , as well as the non - dipolar content ( ndc ) of qrst integral maps considered as the repolarization inhomogeneity index .
the values of the following parameters : the qrs width , the qt interval , the dispersion of qt interval , and the tpeak - tend interval were calculated for each subject and each lead separately , then were averaged over all leads .
the tcrt gives information about the relation between propagation of depolarization and repolarization waves in myocardium .
first , 12-lead ecg signals are decomposed to minimum dimensional space by svd ( singular value decomposition ) .
tcrt is then computed as an averaged cosine between threshold vectors of qrs ( vectors above threshold value around r peak ) and the unit vector with the maximum t - wave energy .
the non - dipolar content was calculated using principal component analysis and karhunen - love transform , providing information about the multipolarity of qrst integral maps . for studied groups , the mean
values and standard deviations , as well as the 25 , the 50 ( median ) , and the 75 percentiles of all parameters , were calculated .
the statistical significance was assessed by means of non - parametric mann - whitney test , since the normal distribution of the values could not have been assumed .
the level of statistical significance was set at p0.05 . to assess the effectiveness of new parameters and to define the risk criteria of ventricular tachycardia for mi patients ,
the diagnostic criterion assessing vt risk in the mi patient group was calculated as a maximal value of the product of the specificity and the sensitivity .
two groups of patients with remote myocardial infarction and a control group of healthy volunteers were studied .
the first group comprised 26 patients with documented risk of ventricular tachycardia , called the mi - vt patients group .
this group consisted of mainly secondary prevention patients with implanted cardioverter - defibrillator or qualified for icd therapy due to the risk of ventricular tachycardia .
the eligibility criteria to implant icd were : 1 ) documented episodes of ventricular tachycardia ( 21 pts ) , and 2 ) induced sustained monomorphic vt during programmed electrical stimulation ( 5 pts ) .
the second group consisted of 14 patients after myocardial infarction in whom any sustained or not - sustained ventricular tachycardia was stated , and is called the mi - non - vt patients group .
the control group consisted of 25 volunteers who had normal electrocardiograms , no history of cardiovascular disease , and to whom any medications were administered .
the study was approved by an institutional ethical review committee and the subjects gave informed consent .
a high resolution multi - lead ecg system ( active two , biosemi b.v . , the netherlands ) with 64 surface electrodes was used for data acquisition .
active electrodes ( containing ag2cl contact sensors with preamplifiers ) were located around the torso ( figure 1 ) according to the ecg lead system proposed by sippensgroenewegen et al . .
the 64 unipolar ecgs were simultaneously recorded for 15 minutes with 4096 hz sampling frequency .
next , signals were amplified and converted into digital form with 24-bit amplitude resolution , sent through a fiber - optic transmitter to the computer , and stored on a hard disk for off - line processing .
the raw ecg data were filtered using low pass butterworth filter limiting frequency to 300 hz and decimate filter , decreasing sampling frequency to 1024 hz .
the reference ecg signal , known as wilson s central terminal ( wct ) , was subtracted at this preprocessing step .
then , ecg signals in each lead separately were averaged in time using a cross - correlation method . to receive a low noise level , both the number of averaged cycles ( usually ca . 100 cycles ) and
the level of noise was measured on the 20 ms isoelectric u - p interval , because , as we noticed , during pq interval , atrial repolarization is still present , which has also been confirmed by ihara et al .
the obtained root mean square ( rms ) value of noise in averaged ecg signals was below 0.5 v .
to detect ecg characteristic time instances ( onsets and offsets of both depolarization and repolarization waves ) , an algorithm proposed by acar , based on singular value decomposition ( svd ) , was applied . for each subject , a rectangular matrix m ( n
, m ) , containing n averaged ecg leads signals , each of m samples length , was decomposed according to the following equation where u(m , m),v(n , n ) are the square , orthogonal matrices and is the diagonal matrix ( m , n ) of singular values .
next , the matrix s was obtained by projecting the matrix m down into the reduced space defined by only the first 3 left - singular vectors of the unitary matrix u. the rms signal was calculated using 3 vectors of the matrix s ( s1 , s2 , s3 ) , as shown in figure 2 .
the global ( common for all leads ) characteristic time instances of ecg curves were found for this rms signal , and then were searched in each lead separately .
initially , r - peak was marked as the maximum of the rms signal , and then t maximum was marked in relation to r - peak .
the p - wave beginning was calculated by inspecting the stationarity of the time relation between the vectors s1 and s2 in respectively defined time windows .
next , the onset of q - wave and the offset of s - wave were calculated from the difference of rms signal using the thresholding method .
the t - wave end was established as the minimum of rms signal in time window related to t wave maximum .
then , in each lead individually , the waves ends were established in relation to the global waves ends using the thresholding method for q onset , and p , s , t offsets and for p , r , t peaks .
finally , iso - amplitude maps were generated for various parameters described in the next section .
to detect ecg characteristic time instances ( onsets and offsets of both depolarization and repolarization waves ) , an algorithm proposed by acar , based on singular value decomposition ( svd ) , was applied . for each subject , a rectangular matrix m ( n
, m ) , containing n averaged ecg leads signals , each of m samples length , was decomposed according to the following equation where u(m , m),v(n , n ) are the square , orthogonal matrices and is the diagonal matrix ( m , n ) of singular values .
next , the matrix s was obtained by projecting the matrix m down into the reduced space defined by only the first 3 left - singular vectors of the unitary matrix u. the rms signal was calculated using 3 vectors of the matrix s ( s1 , s2 , s3 ) , as shown in figure 2 .
the global ( common for all leads ) characteristic time instances of ecg curves were found for this rms signal , and then were searched in each lead separately .
initially , r - peak was marked as the maximum of the rms signal , and then t maximum was marked in relation to r - peak .
the p - wave beginning was calculated by inspecting the stationarity of the time relation between the vectors s1 and s2 in respectively defined time windows .
next , the onset of q - wave and the offset of s - wave were calculated from the difference of rms signal using the thresholding method .
the t - wave end was established as the minimum of rms signal in time window related to t wave maximum .
then , in each lead individually , the waves ends were established in relation to the global waves ends using the thresholding method for q onset , and p , s , t offsets and for p , r , t peaks .
finally , iso - amplitude maps were generated for various parameters described in the next section .
the first parameter , called stt_qrst_corr , was based on the spatial relationship between the maps of stt and qrst integrals .
this parameter was defined as a spearman rank correlation coefficient between stt area and qrst area maps ( eq .
two sets of the data , stti and qrsti , were converted into the stti rankings qrsti and before calculating the spearman correlation coefficient between ranks where n is the subject number , i is the lead number , and m is the total number of leads .
the next 2 parameters , called stt_di and tsi_di , were proposed to quantify spatial changes in the repolarization phase .
departure index ( di ) was used to describe the changes between the group of healthy subjects and each individual subject of the entire studied population .
a tsi parameter ( t wave shape index ) was defined as the ratio of stt integral and t - wave length : where tsin is the value of tsi parameter for subject n , v(t ) is the ecg amplitude in the time instant t , ton , toff is the onset and offset of t wave , respectively , and l(v ) is the length of t wave curve .
the tsi_di parameter was defined as the sum of absolute values of departure indices of tsi parameter calculated in each lead .
the formula describing the tsi_di parameter is as follows : where tsi_din is the value of tsi_di parameter for subject n ,
cstti is the mean value of tsi parameter calculated in the control group in the lead i , and (cstti ) is the standard deviation of tsi parameter calculated in control group in the lead i. the stt_di parameter was defined as the sum of absolute values of departure indices of stt integral calculated in each lead .
the formula describing stt_di parameter is as follows : where stt_di is the value of stt_di parameter for subject n ,
cstti , and ( cstti ) are adequately the mean value and the standard deviation of stt integrals calculated in the control group in lead i. the proposed parameters were compared to 6 well known arrhythmia indices : the qrs width , the qt interval , the dispersion of qt interval , the tpeak - tend interval , the averaged cosine of the angle between qrs complex , and the t - wave ( tcrt ) introduced by acar , as well as the non - dipolar content ( ndc ) of qrst integral maps considered as the repolarization inhomogeneity index .
the values of the following parameters : the qrs width , the qt interval , the dispersion of qt interval , and the tpeak - tend interval were calculated for each subject and each lead separately , then were averaged over all leads .
the tcrt gives information about the relation between propagation of depolarization and repolarization waves in myocardium .
first , 12-lead ecg signals are decomposed to minimum dimensional space by svd ( singular value decomposition ) .
tcrt is then computed as an averaged cosine between threshold vectors of qrs ( vectors above threshold value around r peak ) and the unit vector with the maximum t - wave energy .
the non - dipolar content was calculated using principal component analysis and karhunen - love transform , providing information about the multipolarity of qrst integral maps .
for studied groups , the mean values and standard deviations , as well as the 25 , the 50 ( median ) , and the 75 percentiles of all parameters , were calculated .
the statistical significance was assessed by means of non - parametric mann - whitney test , since the normal distribution of the values could not have been assumed .
the level of statistical significance was set at p0.05 . to assess the effectiveness of new parameters and to define the risk criteria of ventricular tachycardia for mi patients ,
the diagnostic criterion assessing vt risk in the mi patient group was calculated as a maximal value of the product of the specificity and the sensitivity .
basic statistical data ( the mean and the standard deviation values of all examined parameters in the 3 studied groups , as well as statistical differences ( p value ) between the groups calculated by mann - whitney tests ) are summarized in table 2 .
statistical differences were calculated between mi - vt and mi - non - vt patients group , as well as between the mi non - vt patients group and the control group .
the statistical data of 3 proposed parameters : stt_di , tsi_di and stt_qrst_corr are also presented graphically in figure 3 . besides the mean and the standard deviation , values of the 25 , the 50 ( median ) and
the best results of the mann - whitney test in a discrimination between mi patients groups with and without the ventricular tachycardia were obtained using stt_di parameter ( p<0.01 ) , qt interval ( p<0.02 ) , tsi_di parameter ( p<0.0.3 ) , qrs width ( p<0.03 ) and stt_qrst_corr parameter ( p=0.05 ) .
the differences were not statistically significant for : tcrt parameter ( p<0.06 ) , tpeak - tend interval ( p<0.09 ) , qt interval dispersion ( p<0.33 ) and for ndc of qrst integral maps ( p<0.68 ) .
the obtained results indicate , however , that for tcrt parameter and tpeak - tend interval , differences are very close to the limit of significance level ( p=0.05 ) and might be statistically significant in a larger database of mi patients .
the differences between the control group and mi - non - vt patients group were not statistically significant for the following parameters : tpeak - tend interval , tcrt parameter and qt dispersion .
the differences between the control group and mi - non - vt patients group were statistically significant for the remaining parameters ( table 2 ) .
for statistically significant parameters in discrimination between mi patients groups with and without vt , sensitivity and specificity were calculated , and diagnostic criteria were proposed .
the obtained results are presented in table 3 . for 3 proposed parameters , sensitivity , specificity and diagnostic criteria
the highest value of sensitivity was found for stt_di parameter ( 0.77 ) , and the highest value of specificity for tsi_di ( 0.79 ) .
stt_qrst_corr parameter , qrs width and qt interval had the same values of sensitivity ( 0.73 ) and specificity ( 0.71 ) .
the calculated diagnostic criteria concerning the risk of vt amounted to : 1.4 for stt_di parameter , 2.1 for tsi_di parameter , 0.7 for stt_qrst_corr , 122 ms for qrs width and 459 ms for qt interval .
additionally , the sensitivities of the above mentioned parameters were also calculated for 14 patients from the mi - vt group , in whom the episodes of vt occurred during follow - up study ( table 4 ) .
the highest sensitivity showed ( 0.79 ) for stt_qrst_corr parameter and ( 0.71 ) for tcrt and stt_di parameters .
the ejection fraction value in those patients ranged from 15% to 65% . in 11 out of 14 mi - vt patients with episodes of vt during follow- up study , the value of ef was above 30% .
to identify mi patients at risk for ventricular tachycardia , 3 new parameters calculated from averaged hr bspm were proposed : stt_qrst_corr , stt_di , and tsi_di . for comparison , 6 parameters already used in vt risk assessment ( qrs interval , qt interval , qt interval dispersion , tmax - tend interval , tcrt parameter , and ndc of qrst integral maps ) were calculated .
two newly proposed parameters , tsi_di and stt_di , are directly connected to repolarization phase , and represent a measure of departure from the mean distribution of tsi parameter and stt integral in the control group .
departure maps were developed for easy recognition of abnormalities in the body surface potential maps and for representation of the location and extent of abnormal increase or decrease .
these maps are useful for assessment of myocardial infarction , ventricular hypertrophy , and myocardial ischemia . in our study ,
departure indices were used to show an aggregated increase in abnormal changes of re - polarization parameters distributions accompanying pathological changes of the cardiac muscle affected by infarction and at risk of vt .
both parameters were statistically significant in discrimination between mi patients with and without documented risk of vt .
thus , the stt_di and tsi_di parameters could be sensitive markers based on repolarization spatial abnormality .
the third parameter , stt_qrst_corr , was also statistically significant in discrimination between mi patients with and without vt .
the stt_qrst_corr parameter might be connected with the changes in shape and duration of the action potential of ischemic cells .
the qrst integrals are considered to reveal local repolarization process independent of activation sequence . in the healthy cardiac muscle , the recovery process , which is influenced by both activation sequence and local repolarization , is dominated by local repolarization due to fast spread of activation , where the purkinje system plays the key role . therefore , in the control group ,
the stt integral and qrst integral maps are highly correlated . on the other hand , geselowitz has shown that spatial variations of the qrst integral ( ventricular gradient ) are related to the local spatial variation of the action potential area . in ischemic cells , an increase in resting potential , a decrease in peak amplitude , an increase in the rise time of the upstroke , and a change in its duration , cause the change in the action potential area that influences the qrst area .
this is probably because the correlation coefficient between stt and qrst integral maps decreases in pathological changes of the myocardium .
the depolarization process , which constitutes the shape of action potential as well as the repolarization process , is no longer as fast , and activation sequence is no longer as ordered due to the presence of ischemic , structurally impaired , or dead cells within cardiac muscle .
we concluded that for diseased cardiac muscle , the qrst maps reveal not only local repolarization , but also pathological depolarization variations in cardiac muscle affected by ischemia , the structurally impaired transition area from normal to scar tissue , and , especially , by scars from myocardial infarction itself .
statistically significant results were obtained with 2 commonly used temporal indices : qrs duration and qt interval ( influenced distinctly by qrs interval , except for long qt syndrome ) .
the third temporal parameter , tpeak - tend interval , was not statistically significant in the studied groups separation , but its values increased in both mi patient groups in comparison to the control group .
these 2 parameters might have been statistically significant if studied in a larger database . in our study ,
dispersion of repolarization phase expressed by dispersion of qt interval and non - dipolar content of qrst integral maps ( ndc ) were not statistically significant in discrimination between mi patients groups with and without vt .
the dispersion of qt interval is still the subject of debate regarding its ability to supply reliable information on the repolarization heterogeneity of cardiac muscle .
however , the discrimination between the healthy group and mi patients without vt was statistically significant . the results obtained using ndc parameter were also statistically significant in discrimination between the control group and the mi patients group without vt risk , which reveals its ability to quantify multipolarity in qrst maps in cardiac muscles affected by pathological changes .
first , due to the limited number of studied mi patients , the results should be considered as preliminary , requiring further analysis in a larger number of more precisely selected mi patients groups , especially those who are recommended for primary prevention by icd implementation ( i.e. , with the ef below or equal to 30% . secondly , averaging ecg time - series prolonged the analysis process , which had to be done offline . however , in this study a precise assessment of the ends of ecg waves was crucial for qt dispersion calculation as well as for all temporal parameters such as qt interval , qrs width and tpeak - tend interval .
the new parameters proposed in this work are less sensitive to time interval identification and might be used in on - line analysis and even calculated from a single selected heart beat with a low signal - to - noise ratio .
many studies have shown that pathological changes in beat - to - beat variability of subsequent cardiac cycles could be connected with increased risk of arrhythmia .
vulnerability to arrhythmia can be linked with dynamic changes in qt interval , rr interval variability ( hrv ) , heart rate turbulence ( hrt ) , or t - wave alternans ( twa ) .
the analysis of beat - to - beat variability of proposed bspm parameters is an important issue needing future research .
the obtained results indicate that the risk of arrhythmia increases with abnormal disturbances of both depolarization and repolarization processes .
the best indices of the threat of ventricular tachycardia were : 1 ) the depolarization and repolarization prolongation expressed by qrs interval and qt interval , 2 ) the changed relation between depolarization and repolarization phases described by stt_qrst_corr , and 3 ) spatial changes in repolarization phase expressed by stt_di and tsi_di parameters .
thus , the proposed new parameters might be applied for risk stratification of cardiac arrhythmia .
however , this preliminary study requires further analysis in a larger number of more precisely selected mi patients groups , especially patients who are recommended for primary prevention by icd therapy .
Output:
| summarybackgroundthe effective screening of myocardial infarction ( mi ) patients threatened by ventricular tachycardia ( vt ) is an important issue in clinical practice , especially in the process of implantable cardioverter - defibrillator ( icd ) therapy recommendation .
this study proposes new parameters describing depolarization and repolarization inhomogeneity in high resolution body surface potential maps ( hr bspm ) to identify mi patients threatened by vt.material/methodshigh resolution ecgs were recorded from 64 surface leads .
time - averaged hr bspms were used .
several parameters for arrhythmia risk assessment were calculated in 2 groups of mi patients : those with and without documented vt . additionally , a control group of healthy subjects was studied . to assess the risk of vt ,
the following parameters were proposed : correlation coefficient between stt and qrst integral maps ( stt_qrst_corr ) , departure index of absolute value of stt integral map ( stt_di ) , and departure index of absolute value of t - wave shape index ( tsi_di ) .
these new parameters were compared to known parameters : qrs width , qt interval , qt dispersion , tpeak - tend interval , total cosines between qrs complex and t wave , and non - dipolar content of qrst integral maps.resultsstt_di , tsi_di , stt_qrst_corr , qrs width , and qt interval parameters were statistically significant ( p0.05 ) in arrhythmia risk assessment .
the highest sensitivity was found for the stt_di parameter ( 0.77 ) and the highest specificity for tsi_di ( 0.79).conclusionsarrhythmia risk is demonstrated by both abnormal spatial distribution of the repolarization phase and changed relationship between depolarization and repolarization phases , as well as their prolongation .
the proposed new parameters might be applied for risk stratification of cardiac arrhythmia . |
PubmedSumm6822 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: hyaluronic acid ( ha ) is a linear polymer of glucuronic acid and n - acetylglucosamine disaccharide .
the main function of ha includes tissue healing including activation and moderation of the inflammatory responses , promotion of cell proliferation , migration , and angiogenesis .
ha is a hygroscopic macromolecule and its solutions are highly osmotic . in the oral mucosa , this property enables to control of tissue hydration during periods of inflammatory process or response to tissue injury resulting in ulcer formation .
high - molecular - weight ha [ figure 1 ] acts as an anti - inflammatory molecule and has been shown to be beneficial in supporting gingival health .
it is the most abundant high - molecular - weight glycosaminoglycan ( gag ) in the extracellular matrix of soft periodontal tissues .
studies indicate that ha exhibits beneficial anti - inflammatory and antibacterial activity in the treatment of gingivitis and periodontitis .
topically , ha has been used as a 0.2% solution for the treatment of recurrent aphthous ulcers in clinical trials .
ha is commercially available as sodium hyaluronatein combination with polyvinylpyrrolidone ( pvp ) and glycyrrhetinic acid .
the combination was launched as gelclair sachets ( sinclair pharma , uk ltd ) in 2002 and received us food and drug administration ( us fda ) approval for management of oral mucositis associated with chemotherapy .
pvp , an important constituent of this preparation , has remarkable properties such as good chemical and biological inertness , very low toxicity , high media compatibility , and crosslinkable flexibility , which gives stability to the formulation .
topical ha 0.2% or pvp - sh gel forms a protective coating around the oral cavity to shield exposed or sensitized nerve endings from overstimulation [ figure 2 ] .
each of the ingredients in pvp - sh performs a specific role , as listed here:- topical hyaluronic acid ( ha ) forms a barrier film on exposed nerve endings
polyvinylpyrrolidone it is a hydrophilic polymer with muco - adherent and film - forming properties , which enhances tissue hydration.hyaluronic acid ( as sodium hyaluronate ) it coats the oral mucosa , enhances tissue hydration , and accelerates healing.glycyrrhetinic acid it is a breakdown product of glycyrrhizin , the active component of licorice and has anti - inflammatory properties that aid in ulcer healing .
polyvinylpyrrolidone it is a hydrophilic polymer with muco - adherent and film - forming properties , which enhances tissue hydration .
hyaluronic acid ( as sodium hyaluronate ) it coats the oral mucosa , enhances tissue hydration , and accelerates healing .
it is a breakdown product of glycyrrhizin , the active component of licorice and has anti - inflammatory properties that aid in ulcer healing .
oral mucositisrecurrent and generalized aphthous oral ulcersulcers due to drug reactionsulcers following the use of dental amalgam as a restorative materialulcers due to orthodontic brackets and wiresulcers due to ill - fitting denturesulcers due to diseases as lichen planus , behcet 's diseasetraumatic ulcersulcers due to radiotherapy / chemotherapyxerostomia , sjogren 's syndromepost - vaporization of oral lesions with co2 laser
recurrent and generalized aphthous oral ulcers ulcers due to drug reactions ulcers following the use of dental amalgam as a restorative material ulcers due to orthodontic brackets and wires ulcers due to ill - fitting dentures ulcers due to diseases as lichen planus , behcet 's disease ulcers due to radiotherapy / chemotherapy xerostomia , sjogren 's syndrome post - vaporization of oral lesions with co2 laser
the entire contents of the single - dose pvp - sh sachet are dissolved in 40 ml or two tablespoons of water .
the mixture is stirred and used immediately as an oral rinse for at least a minute or as long as possible to coat the tongue , palate , throat , buccal mucosa and all oral tissue thoroughly , and then spit out . depending on the discomfort caused by oral ulcers ,
pvp - sh gel can be used at least three times per day or as needed .
it is advised not to eat or drink for at least one hour following use . in children under the age of 6 years who may be unable to rinse or gargle ,
nolan et al , evaluated the efficacy of a topical ha preparation ( 0.2% ) in the management of recurrent aphthous in 120 patients in a randomized , placebo - controlled , double - blind trial .
patients treated with topical ha recorded few ulcers on day 5 of the investigation than those treated with placebo ( p < 0.001 ) . also , the occurrence of new ulcers was lower in the ha - treated group on day 4 when compared with placebo - treated group ( p = 0.047 ) .
lee et al , tested the efficacy of topical 0.2% ha gel on recurrent oral ulcers in 33 patients with recurrent aphthous ulceration or behcet 's disease .
the patients were asked to use topical 0.2% ha gel twice daily for 2 weeks .
the subjective parameters investigated s included number of ulcers , healing period and visual analogue scale ( vas ) for pain .
the objective assessment included number of ulcers , maximal area of ulcer , and inflammatory signs , which were inspected by a physician .
after 2 weeks , a subjective reduction in the number of ulcers was observed in 72.7% of the patients .
a decrease in the ulcer healing period was observed in 72.7% of the patients , and 75.8% experienced improvement in vas for pain .
objective inspection of the ulcers revealed a reduction in the number of ulcers in 57.6% of the patients , and a decrease in the area of 78.8% of the ulcers was seen . among the inflammatory signs , swelling and local heat showed significant improvement after treatment .
ha 0.2% or pvp - sh gel offers advantages over topical steroids in that it is safe to be used in all patients including infants and pregnant women , in whom there may be reluctance to use steroids .
it can be used in all grades of oral ulceration [ table 1 ] . who grading of oral mucositis
the only contraindication is known history of allergy or hypersensitivity to ha or any of the ingredients in the pvp - sh gel .
Output:
| hyaluronic acid is a hygroscopic macromolecule formed by the polymerisation of glucuronic acid and n - acetylglucosamine disaccharide .
it is a primary component of the extracellular matrix in various body tissues .
ihe use of topical hyaluronic acid in the treatment of oral ulcers has been recently reported .
this article reviews the mechanism of action , indications and efficacy of topical hyaluronic acid gel in the management of oral ulcers . |
PubmedSumm6823 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: retaining patients with human immunodeficiency virus ( hiv ) in medical care after initiation of effective antiretroviral therapy ( art ) is essential for successful hiv treatment .
once patients are initiating art , high levels of adherence to treatment are required to achieve sustained hiv suppression and to reduce risk of drug resistance .
in addition to monitoring adherence to medication , regular clinical follow - up visits are crucial for scheduled laboratory tests , monitoring drug toxicity , timely immunization and prophylaxis for opportunistic infections ( ois ) , and to diagnose and treat new ois that may occur and other comorbidities ( 12345 ) .
multiple studies indicate that poor retention in care is associated with higher rate of art failure and worse survival ( 678910111213 ) .
the identification of risk factors for poor retention in care is of paramount importance to develop targeted interventions to improve optimal individual and public health outcomes and cost effectiveness . some risk factors , including younger age , female sex , racial or ethnic minority status , low socioeconomic status , no usual source of health care , less advanced hiv disease , fewer non - hiv - related comorbidities , and greater unmet psychosocial needs ,
these risk factors are influenced by several factors , such as demographic , disease severity , psychosocial , and ancillary services use factors , and may be variable among different countries .
the objective of this study was to determine the risk factors for suboptimal retention in care among hiv infected adults receiving art in korea .
a retrospective cohort study was conducted to assess the risk factors associated with suboptimal retention in care among hiv - infected patients receiving art .
the characteristics of this cohort and details of the methodology have been previously described ( 11 ) .
briefly , pusan national university hospital is a 1,220 bed , university - affiliated teaching hospital and provides hiv care for hiv infected patients in the southeastern area of korea , in close collaboration with the local public health centers ( phcs ) in this area .
the study included hiv infected patients aged 18 years and older who started art at the study hospital between 2002 and 2008 .
patients who had been started on art in other hospitals before they referred to the study hospital were excluded .
patients who died or were transferred to other hospitals within 1 year after art initiation were also excluded .
first , based on the follow - up status of patients to the study hospital as of 5 years after art initiation , each patient was initially classified as remained in care , dead at the study hospital , transfer - out to other hospitals , or lost . and then , we traced the patients initially categorized as lost to ascertain their survival status in collaboration with local phcs .
the observation periods were measured from the date of art initiation to the earliest of the following dates : 5 years if the patients was still alive during 5 years after start of art regardless of whether or not they remained in care , the date of death if the patients died within 5 years after art initiation , the date of the last follow - up visit if the patients were transferred out to other health facility within 5 years after starting art .
retention in care was measured by hospital visit constancy ( hvc ) during the observation period after initiating art ( 271415 ) . the observation period after start of art
was broken down into 3-month periods , and the number of 3-month periods in which patients had at least 1 hospital visit for hiv care was examined .
hvc was calculated by using the equation hvc = ( numbers of 3-month periods with 1 completed hospital visit ) / ( total numbers of 3-month periods during the observational periods of interest ) 100 .
medical subspecialty appointment except hiv care visit was excluded , but urgent care visit for hiv care was included .
aids - defining illness and clinical categories were defined by the 1993 centers for disease control and prevention ( cdc ) classification criteria ( 16 ) .
non - hiv related comorbidity was assessed with charlson comorbidity index ( cci ) ( 17 ) .
we excluded aids as a co - morbidity ( 18 ) . to determine the predictable factors of poor retention in care , we compared the demographic , psychosocial , and clinical characteristics between the patients with 100% hvc and the patients with 50% hvc , by using multiple logistic regression analysis .
categorical variables were compared using pearson s chi - square test or fisher s exact test , whereas non - categorical variables were tested with the mann - whitney u - test or kruskal wallis test .
all variables with p < 0.25 in univariate analysis were assessed in multivariate models using stepwise backward election .
the statistical analyses were conducted using ibm spss statistics version 22 ( ibm , armonk , ny , usa ) .
this study protocol was approved by the institutional review board of pusan national university hospital ( irb no .
a retrospective cohort study was conducted to assess the risk factors associated with suboptimal retention in care among hiv - infected patients receiving art .
the characteristics of this cohort and details of the methodology have been previously described ( 11 ) .
briefly , pusan national university hospital is a 1,220 bed , university - affiliated teaching hospital and provides hiv care for hiv infected patients in the southeastern area of korea , in close collaboration with the local public health centers ( phcs ) in this area .
the study included hiv infected patients aged 18 years and older who started art at the study hospital between 2002 and 2008 .
patients who had been started on art in other hospitals before they referred to the study hospital were excluded .
patients who died or were transferred to other hospitals within 1 year after art initiation were also excluded .
first , based on the follow - up status of patients to the study hospital as of 5 years after art initiation , each patient was initially classified as remained in care , dead at the study hospital , transfer - out to other hospitals , or lost . and then , we traced the patients initially categorized as lost to ascertain their survival status in collaboration with local phcs .
the observation periods were measured from the date of art initiation to the earliest of the following dates : 5 years if the patients was still alive during 5 years after start of art regardless of whether or not they remained in care , the date of death if the patients died within 5 years after art initiation , the date of the last follow - up visit if the patients were transferred out to other health facility within 5 years after starting art .
retention in care was measured by hospital visit constancy ( hvc ) during the observation period after initiating art ( 271415 ) . the observation period after start of art
was broken down into 3-month periods , and the number of 3-month periods in which patients had at least 1 hospital visit for hiv care was examined .
hvc was calculated by using the equation hvc = ( numbers of 3-month periods with 1 completed hospital visit ) / ( total numbers of 3-month periods during the observational periods of interest ) 100 .
medical subspecialty appointment except hiv care visit was excluded , but urgent care visit for hiv care was included .
aids - defining illness and clinical categories were defined by the 1993 centers for disease control and prevention ( cdc ) classification criteria ( 16 ) .
non - hiv related comorbidity was assessed with charlson comorbidity index ( cci ) ( 17 ) .
we excluded aids as a co - morbidity ( 18 ) . to determine the predictable factors of poor retention in care , we compared the demographic , psychosocial , and clinical characteristics between the patients with 100% hvc and the patients with 50% hvc , by using multiple logistic regression analysis .
categorical variables were compared using pearson s chi - square test or fisher s exact test , whereas non - categorical variables were tested with the mann - whitney u - test or kruskal wallis test .
logistic regression analysis was used to determine risk factors for poor retention in care . all variables with p
the statistical analyses were conducted using ibm spss statistics version 22 ( ibm , armonk , ny , usa ) .
this study protocol was approved by the institutional review board of pusan national university hospital ( irb no .
between 2002 and 2008 , a total of 328 patients were first prescribed art in the study hospital . of these ,
32 patients ( 9.8% ) who had taken art before visiting the study hospital were excluded from the analysis .
we excluded 14 patients ( 4.3% ) who were transferred out to other hospitals within 1 year after art initiation and 33 patients ( 10.1% ) who died within 1 year after art initiation .
two patients ( 0.6% ) were unable to be traced after loss to follow - up ( ltfu ) and were also excluded from the analysis .
as of 5 years after art initiation , 179 patients ( 72.5% ) remained in care in the study hospital , 20 patients ( 8.1% ) were transferred out to other hospitals , 9 patients ( 3.6% ) died in the study hospital , and 39 patients ( 15.8% ) were lost .
of the 39 patients initially categorized as lost , after tracing , 8 patients ( 20.5% ) were known to have died and 31 patients ( 79.5% ) were alive .
the median age of patients was 42 years [ interquartile range ( iqr ) 36 - 50 ] and 85.8% were male .
median cd4 lymphocyte count was 130 cells/l ( iqr 44 - 249 ) and 123 ( 48.8% ) were in cdc clinical category b or c. the baseline characteristics of the study population and a comparison by hvc are presented in table 1 .
data are number ( % ) of patients , unless otherwise indicated . excluding aids as a co - morbidity .
hiv , human immunodeficiency virus ; iqr , interquartile range ; art , anti - retroviral therapy ; idu , injection drug user ; pi , protease inhibitor ; nnrti , non - nucleotide reverse transcriptase inhibitor . among the included 247 patients , 166 patients ( 67.2% ) was regular clinic attendance ( hvc 100% ) , whereas 81 patients ( 32.8% ) had various durations of ltfu at some points in their observation periods
of these 81 , 48 patients ( 59.3% ) had 51 - 99% hvc and 33 patients ( 40.7% ) had hvc 50% .
overall , 32 of 81(39.5% ) were lost to follow - up within 6 months after art initiation . among the 81 patients who were lost to follow - up , 63 ( 77.8% ) returned to care ,
however , 46 of 63 ( 73% ) were lost to follow - up again .
of the 46 patients who were lost to follow - up again after return to care , 20 ( 43.5% ) did not return to care . among the 81 patients who were lost to follow - up , 30 ( 37% )
when we compared 166 patients ( 67.2% ) with hvc 100% with 33 patients ( 13.4% ) with hvc 50% , age at start of art 30 years ( odds ratio [ or ] , 4.70 vs. > 50 ; 95% confidence interval [ ci ] , 1.35 - 16.41 , p = 0.015 ) , no non - hiv related comorbidity ( or , 3.25 vs. cci 1 ; 95% ci , 0.19 - 8.87 , p = 0.021 ) , cd4 cell count > 300 cells/l at art initiation ( or , 3.42 vs. 200 ; 95% ci , 1.32 - 8.877 , p = 0.011 ) , cdc clinical category b ( or , 3.29 vs. c ; 95% ci , 1.07 - 10.16 , p = 0.038 ) or a ( or , 4.05 vs. c ; 95% ci , 1.15 - 14.27 , p = 0.030 ) , duration from hiv diagnosis to art initiation 1 - 5 years ( or , 2.64 vs. < 1 ; 95% ci , 1.09 - 6.41 , p = 0.031 ) , use of single class of art during observational period nonnucleoside reverse transcriptase inhibitors ( nnrtis ) ( or , 3.29 versus switch to another class of art ; 95% ci , 1.07 - 10.16 , p = 0.038 ) or protease inhibitor ( pis ) ( or , 4.05 vs. switch to another class of art ; 95% ci , 1.15 - 14.27 , p = 0.030 ) were associated with a higher risk of poor retention in care ( hvc 50% ) in univariate analysis ( table 2 ) . excluding aids as a co - morbidity .
hr , hazard ratio ; ahr , adjusted hazard ratio ; ci , confidence interval ; hiv , human immunodeficiency virus ; art , anti - retroviral therapy ; idu , injection drug user ; pi , protease inhibitor ; nnrti , non - nucleotide reverse transcriptase inhibitor . in multivariate analysis ,
age at start of art 30 years ( or , 4.08 vs. > 50 ; 95% ci , 1.10 - 15.15 , p = 0.036 ] , no non - hiv related comorbidity ( or , 2.94 vs. cci 1 ; 95% ci , 1.02 - 8.49 , p = 0.046 ) , cd4 cell count > 300 cells/l at art initiation ( or , 3.58 ; 95% ci , 1.33 - 9.65 , p = 0.012 ) were significant predictable factors of poor retention in care ( hvc 50% ) during up to 5-year observational period after art initiation ( table 2 ) .
in this study , we evaluated the factors predicting poor retention in care after initiating art in a retrospective cohort . identifying which patients are at greatest risk for not being retained is important to develop targeted interventions to improve optimal individual clinical outcomes and potential public health benefit ( 1 ) . at present
, there is no gold standard for assessing retention in care and selection of the most appropriate measurement method is challenging ( 315 ) .
the length of the follow - up periods as well as differences in healthcare systems and characteristics of the study populations are likely to influence the estimates . in our study , almost one - third of patients ( 32.8% ) had ltfu at some points in up to 5-year observation periods .
the pattern of healthcare usage and duration of ltfu of these patients were considerably variable .
about three fourths of patients ( 77.8% ) were returned to care , however , about three fourths of patients ( 73% ) were lost to follow - up again .
overall , approximately half of patients ( 46.9% ) did not return after varying duration of ltfu , and more than one third of patients ( 37% ) had a cyclical pattern of being in and out of care at irregular intervals .
this heterogeneity in pattern of ltfu makes it difficult to compare regular users with sporadic users or nonengagers as dichotomous variables ( 119 ) . in a recent study
, we evaluated the mortality rate and risk factors for death in 327 hiv infected patients initiating art during 1998 - 2005 in a tertiary hospital of korea ( 11 ) . among patients who survived more than 12 months after starting art , patients with 50% hvc were about 13 times more likely to die than those who attended hospital regularly during a 5-year observation period . in the present study
, we measured retention in care by hvc during the 5-year observation period after art initiation ( 271415 ) and compared regular users with hvc 100% with sporadic users or nonengagers with hvc 50% ( 119 ) .
although this measure is less detailed to assess retention in care than appointment adherence , it is known to be preferable for research for longer observation periods , particularly relevant for patients starting art , and is better accounts for ltfu ( 15 ) . in this study
, we included urgent care visit for hiv care to measure the retention because patients who returned after ltfu were frequently hospitalized via urgent care , and thereafter successfully retained in care if they survived ( 11 ) .
the main strength of this study is the 5-year observation period and active tracing the patients who are ltfu .
the risk of ltfu was highest during the first 6 months after initiating art ( 39.5% ) .
more than half of patients ( 59.3% ) were lost to follow - up within 1 year after starting art .
our study also revealed that younger patients ( 30 years ) , those who had higher cd4 cell counts ( > 300 cells/l ) , and those who had no non - hiv related comorbidity were less likely to be retained after starting art .
younger patients appear to be more difficult to retain in long - term follow - up , probably due to a youthful sense of invulnerability , feeling healthier , or lifestyle issues , such as work or school , that prevent them from maintaining regular scheduled visits ( 2021 ) .
in addition , patients with higher cd4 cell counts and without medical comorbidity are more likely to be lost to follow - up after starting art , perhaps because they did not feel sick enough to be motivated to visit the hospital regularly ( 22223 ) . in this study ,
other sociodemographic and clinical characteristics reported by other studies were not associated with poor retention in care . of note , we did not find that the association between economic factor and poor retention .
this finding can be explained by the fact that all medical cost for hiv care including antiretroviral drugs was provided free of charge by the government through medical aid or national health insurance program in korea .
the effect of injecting drug on poor retention in care was also not significant in our analysis , possibly because of low prevalence of hiv infection among injecting drug users in korea ( 2425 ) .
in particular , detailed socio - economic status such as occupation , which was one of important variable , was not analyzed .
second , our study was conducted at a single center in the southeastern area of korea , and the numbers of patients were relatively small , therefore our findings may not be generalized to other region of the country .
although most patients got a refill prescription during routine follow - up visit after starting art , patients can be retained in care , but not necessarily adhere to treatment ( 35 ) . however , it was unable to assess the adherence of included patients precisely because our study was performed relatively and for a long time .
. the missed visit within an interval of interest could not be measured , and retention could be overestimated ( 215 ) . in conclusion , we found that almost one - third of patients had ltfu at some points in up to 5-year observation periods .
the pattern of healthcare usage and duration of ltfu of these patients were considerably variable .
more than half of patients were lost to follow - up within 1 year after starting art .
age at start of art 30 years , no non - hiv related comorbidity , cd4 cell count > 300 cells/l at art initiation were risk factors predicting poor retention in care among hiv - infected patients receiving antiretroviral therapy in korea .
these results suggest that effective strategies for retaining the patients in care after starting art in the long - term perspective are needed , particularly with special attention to these risk groups , focusing on the early period after art initiation .
Output:
| poor retention in care ( ric ) is associated with higher antiretroviral therapy ( art ) failure and worse survival . identifying high risk patients for poor ric
is important for targeted intervention .
a retrospective cohort study was conducted at a tertiary care hospital in korea .
hiv - infected patients initiating art during 2002 - 2008 were included .
5 year - ric was measured by hospital visit constancy ( hvc ) at 5 years after initiating art . among
247 enrolled patients , 179 ( 72.5% ) remained in care , 20 ( 8.1% ) were transferred to other hospitals , 9 ( 3.6% ) died and 39 ( 15.8% ) were lost to follow - up .
we compared the demographic , psychosocial , and clinical characteristics between the groups with 100% hvc ( n = 166 , 67.2% ) and 50% hvc
( n = 33 , 13.4% ) . in multivariable analysis , art - starting age 30 years ( odds ratio [ or ] 4.08 vs. > 50 ; 95% confidence interval [ ci ] 1.10 - 15.15 , p = 0.036 ) , no non - hiv related comorbidity ( or 2.94 vs. comorbidity 1 ; 95% ci 1.02 - 8.49 , p = 0.046 ) , baseline cd4 cell count > 300 cells/l ( or 3.58 vs. 200 ; 95% ci 1.33 - 9.65 , p = 0.012 ) were significant predictable factors of poor ric .
hiv / aids care - givers should pay attention to young patients with higher baseline cd4 cell counts and no non - hiv related comorbidity . |
PubmedSumm6824 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: postpartum hemorrhage ( pph ) is a life - threatening obstetric emergency that occurs after caesarean section ( cs ) or normal vaginal delivery ( nvd ) .
it may be defined as 500 ml hemorrhage after vaginal or 1000 ml hemorrhage after cs delivery [ 13 ] .
pph is one of the most common obstetric maternal complications and is among the three most common etiologies of maternal death worldwide .
its incidence is increasing and it affects 15% of all deliveries [ 5 , 6 ] .
atony is the main cause of pph and is responsible for about 80% of pphs .
oxytocin infusion , single dose of methylergometrine , and then carboprost tromethamine are used in 15-to-20-minute intervals in atony .
misoprostol , which is a prostaglandin e1 analog , is an inexpensive drug and can be absorbed by the following routes of administration : vaginal , rectal , or oral ( sublingual or buccal absorption ) [ 8 , 9 ] .
gastrointestinal symptoms ( nausea , vomiting , and diarrhea ) and fever are the most common adverse effects of misoprostol , which often are mild and self - limited [ 1012 ] .
several studies have shown that misoprostol is more effective than oxytocin and methylergometrine in the treatment of pph [ 13 , 14 ] . although misoprostol can be used as first - line therapy in the treatment of pph where oxytocin is not available , other studies
have not confirmed that misoprostol is more effective than oxytocin in the prevention of pph .
the aim of this study was therefore to compare the efficacy and safety of oral misoprostol and intravenous oxytocin in the prevention of pph .
this double - blind randomized controlled trial was undertaken at shariati hospital , the only obstetrics and gynecology educational hospital in bandar abbas .
bandar abbas is the capital and the main city of hormozgan province , located in southern iran .
the study was approved by the research committee of hormozgan university of medical sciences ( hums ) and is registered with clinicaltrials.gov ( clinicaltrials.gov identifier : nct01863706 ) .
the required sample size was calculated to be at least 175 patients in each study group ( based on weighting pads ) considering the standard deviation of 100 gr for hemorrhage in each group for detecting a 30 gr difference between two groups ( = 0.05 ; = 0.20 ) .
the inclusion criteria were women with singleton pregnancy with cephalic presentation who had nvd spontaneously or by induction .
the exclusion criteria were placenta previa ( based on ultrasound sonography in the third trimester ) , placental abruption , coagulation problems , previous cs , macrosomia ( defined as estimated fetal weight above 4000 gr based on ultrasound sonography ) , polyhydramnios ( defined as amniotic fluid index more than 24 cm ) , and uncontrolled asthma .
women were randomly assigned to one of two groups with a 1 : 1 allocation using simple randomization with computerized random numbers : 20 iu oxytocin in 1000 ml ringer 's solution at a rate of 600 ml / hr plus placebo misoprostol tablet ( group 1 : routine management for prevention of pph ) or 400 g oral misoprostol as the alternative active management of the third stage of labour plus placebo oxytocin in 1000 ml ringer 's solution at a rate of 600 ml / hr for prevention of pph ( group 2 ) . for blinding the study identical
appearing solutions and tablets corresponding to the two pharmacological groups were prepared by the pharmacy and kept in the fridge until required . a blood sample was obtained before delivery and 24 hours after delivery .
in addition , the quantity of blood loss was calculated by weighing the pads utilised after nvd . to calculate this , the pads which were used after nvd were weighed before usage and after usage ( after absorbance of blood ) . by this method we obtained the blood loss amount in grams .
also , vital signs and drug - adverse effects were recorded using a standard checklist .
the primary outcome was hemorrhage ( quantified blood loss ) within 1 hour of delivery ; the secondary outcomes were hematocrit ( hct ) and hemoglobin ( hb ) 24 hours after delivery , hemodynamic instability within 24 hours after delivery , and drug - adverse effects , including fever ( 38c ) , chills ( reported by the patient ) , diarrhea , nausea , vomiting , and hypotension .
data was analysed using spss 16 software and chi - square and independent samples t - test analysis .
four hundred pregnant women were included in the study . the mean age of the study participants was 25.86 5.79 years .
there were not significant differences in the gestational age , birth weight and past perineal tear in the groups .
there was no significant difference in amount of hemorrhage , hb , hct , hb decrease , or hct decrease between the two groups .
the rate of need for additional oxytocin was higher in group 1 , but the rate of adverse effects was higher in group 2 .
in this study we compared the safety and efficacy of misoprostol and oxytocin in the prevention of pph .
our analysis showed that there was no statistically significant difference in the baseline characteristics in the two groups .
our study showed a significant decrease in hemorrhage when misoprostol was used to prevent pph compared to oxytocin treatment .
this finding is compatible with the finding of the study by lokugamage et al . who reported the superiority of misoprostol over syntometrine in managing pph .
they used intramuscular syntometrine ( sandoz pharmaceuticals ) ( ampoule = 5 iu oxytocin and 500 mcg ergometrine maleate ) plus syntocinon ( sandoz pharmaceuticals ) ( 10 iu oxytocin diluted in 500 ml normal saline ) intravenous infusion versus 800 mcg misoprostol rectally .
further , the current study examined the use of misoprostol for the prevention of pph , but lokugamage et al .
other studies have shown better efficacy for misoprostol in comparison to methylergometrine in the prevention of pph .
the differences in the results of our study compared with other similar studies which have used oxytocin intravenously or intramuscularly may be explained by the rate of oxytocin which is given to the patients .
we used 20 iu oxytocin in 1000 ml ringer 's solution at a rate of 600 ml / hr . widmar et al . reported different results .
they reported no significant difference between 600 mcg misoprostol sublingually and a placebo in patients who were under routine treatment for uterine contraction .
their results are different from our study because they studied the efficacy of misoprostol in oxytocin - resistant pph .
similar findings are reported in the studies by winikoff et al . and blum et al . .
they found no significant difference between using sublingual 800 mcg misoprostol and 40 iu intravenous oxytocin for pph [ 15 , 17 ] .
both studies were conducted for the treatment of pph and the outcome was stopping bleeding more than 300 ml within 20 minutes after delivery . in our study
there was no significant difference between hb and hct or hb and hct decrease between the two groups 24 hours after treatment .
other studies have reported lower hct decrease by using misoprostol in comparison to ergometrine . in our study
there was additional use of oxytocin in group 1 . in a study by haque et al .
, 94% of the patients had no need for additional oxytocin and only 6% of the patients had moderate hemorrhage and additional oxytocin was added .
also 2% of the patients in the oxytocin group in this study needed additional oxytocin .
the fever rate was higher in the misoprostol group in our study , but there was no significant difference between the two groups in chills and gastrointestinal symptoms .
in our study , 0.5 and 2% of the patients in the oxytocin and the misoprostol groups needed blood transfusions , which was no statistically significant difference .
reported no cases of transfusion need in their studies [ 18 , 19 ] . in this study
therefore no patient received transfusion before measuring the hb and hct decrease ( within the first hour of the treatment ) .
multicentre studies with higher sample sizes and meta - analysis studies are still needed to obtain the optimal treatment strategies in the prevention of pph .
our study suggests that the use of misoprostol is more effective for decreasing the amount of blood loss , thereby avoiding a pph , and is associated with mild and self - limiting side effects .
misoprostol is cost effective and easily administered and therefore may be considered for use in low resource areas when oxytocin is unavailable .
Output:
| postpartum hemorrhage ( pph ) is the commonest cause of maternal death worldwide .
studies suggest that the use of misoprostol may be beneficial in clinical settings where oxytocin is unavailable .
the aim of this study was to compare the safety and efficacy of oxytocin and misoprostol when used in the prevention of pph . in a double - blind randomized controlled trial ,
400 pregnant women who had a vaginal delivery were assigned into two groups : to receive either 20 iu of oxytocin in 1000 ml ringer 's solution and two placebo tablets or 400 mcg oral misoprostol ( as two tablets ) and 2 ml normal saline in 1000 ml ringer 's solution .
the quantity of blood loss was higher in the oxytocin group in comparison to the misoprostol group .
there was no significant difference in the decrease in hematocrit and hemoglobin between the two groups .
although there was no significant difference in the need for transfusions between the two groups , the patients in the oxytocin group had greater need for additional oxytocin .
results from this study indicate that it may be considered as an alternative for oxytocin in low resource clinical settings .
this study is registered with clinicaltrials.gov nct01863706 . |
PubmedSumm6825 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: satisfactory bonding to enamel can be achieved using the acid - etching technique , but dentine bonding is more difficult to achieve due to the wet tubular structure , permeability properties , and organic composition of dentinal substrate .
recently there has been increasing interest in the incorporation of fillers into dentine adhesive systems , but the importance of filler particles is somewhat controversial [ 4 , 5 ] . these fillers may include from conventional glass or silica fillers to nanometer - sized aerosil silica .
recently , some researchers have incorporated nanoclay filler particles and hydroxyapatite nanorod fillers in dental adhesives to improve their properties [ 79 ] .
fillers have been added to some adhesive systems to improve bond strength by reinforcing the hybrid zone and reduce polymerizing shrinkage [ 10 , 11 ] .
however , increased filler loading increases viscosity of bonding system and may reduce its flow .
if the addition of fillers prevents the adhesive from adapting optimally to the etched enamel and dentine surface and exposed collagen fibers , a suitable hybrid layer may not form , compromising bond strength and marginal integrity .
inclusion of fillers in dentine adhesives increases their viscosity that tends to prevent overthinning of unfilled adhesive layers , thereby preventing incomplete polymerization caused by oxygen inhibition .
they may also provide stress relief capacities against shrinkage stresses generated during polymerization of resin - based restorative materials , in a way that is similar to the use of resin composite liners and flowable composites . this intermediate layer that acts as an elastic buffer must have adequate properties to withstand the stresses of the oral environment , so the perceived advantages of filled adhesives as stress buffers remain unpredictable . the optimum filler level for maximum increase in bond strength
they will include the size , shape , content of filler particles , and the surface properties of the fillers ( hydrophilic versus hydrophobic ) .
the purpose of the current study was to compare shear bond strengths of three filled and one unfilled adhesive systems to enamel and dentine .
the null hypothesis was that shear bond strength of filled and unfilled adhesive systems to enamel and dentine was not different .
forty - eight extracted noncarious human mandibular molars , which had been stored for less than four weeks in 0.2% thymol , were selected and cleaned .
the teeth were randomly assigned to two enamel and dentine groups , with 24 teeth in each group . in dentine group ,
superficial dentine was exposed by removing the buccal and lingual enamel using diamond bur ( 852.fg.010 , jota , switzerland ) under running water as coolant .
then the teeth were mounted in self - curing acrylic resin ( flash acrylic , yates motloid , chicago , il , usa ) to a level 1 mm below the cej of every tooth .
buccal and lingual surfaces of teeth in enamel and dentine groups were randomly selected for application of each bonding system used in this study . before application of dentine bonding systems ,
enamel and dentine surfaces were polished by 600 grit silicone paper under running water to create standard smear layer on each tooth surface .
after the preparation of tooth surfaces , adhesive systems were applied to surfaces according to their manufacturer 's instructions .
the adhesive systems and the resin composite used in the present study and their compositions are listed in table 1 .
translucent plastic cylinders ( 3 mm in diameter and 2 mm in length ) were filled with filtek z100 light cure resin composite ( 3 m espe dental products , st .
paul , mn , usa ) and bonded to enamel and dentine surfaces and irradiated with blue phase led curing light ( ivoclar vivadent , schaan , liechtenstein ) for 40 seconds .
the specimens were then stored in deionized water at 37c and plastic cylinders removed after an hour using a feather blade .
twenty four hours after bonding , shear bond strengths were determined with a universal testing machine ( dartec , series tlclo , england ) using a knife - edged loading head just contacting the interface of the enamel / dentine and resin composite column at a cross - head speed of 1 mm / min .
two - way anova was used to statistically analyze the differences in shear bond strength values between all the test groups .
one - way anova along with tukey hsd post hoc test was used to statistically analyze the differences between bond strength values of different adhesive systems in either enamel or dentine groups .
t - test was used for pair - wise comparisons when indicated . a 5% level of significance
another 8 specimens , 4 for dentine and 4 for enamel , were used for scanning electron microscopy ( sem ) examination of resin enamel / dentine interfaces .
after preparation of buccal or lingual surface of each tooth in the same manner as the bonding procedure for adhesive systems , filtek z100 resin composite was placed in buccal or lingual tooth surface in 1 mm thickness and cured for 40 seconds .
then teeth were sectioned perpendicular to the bonded interface ( buccolingually ) using a low - speed isomet saw ( buehler diamond wafering blade 15 hc , buehler , usa ) under running water as coolant obtaining 16 interface sections .
each interface was finished with a 1000 grit silicon carbide paper under water and polished with 6 , 3 , 1 , and 0.25 m diamond paste using a polish cloth under water .
the interface sections were rinsed between the polishing steps with water and debris and paste removed ultrasonically for 5 min . for inspection of resin tags in dentine interfaces , dentine samples were etched with 6 n / hcl for 30 seconds and then rinsed .
samples were immersed in 2.5% nahclo for 10 minutes to remove collagen fibers and other organic parts of dentine . after rinsing ,
all samples were placed in dry environment for 24 hours , and then each section was sputter coated with gold ( bal - tec , sputter coater , netherlands ) and observed by sem ( xl 30 , philips , netherlands ) .
shear bond strength value of each specimen and the mean and standard deviation value of each group are shown in tables 2 and 3 , respectively .
two - way anova revealed significant differences of shear bond strength values between enamel and dentine groups ( p < 0.001 ) .
maximum and minimum shear bond strength values in enamel groups were found in prime & bond nt ( pbnt ) ( 22.74 4.45 mpa ) and clearfil se bond ( cseb ) ( 18.84 4.31 mpa ) groups , respectively .
one - way anova revealed no significant differences in shear bond strength values between adhesive systems in enamel ( p = 0.127 ) , but shear bond strength values were significantly different in dentine group ( p < 0.001 ) .
maximum and minimum of shear bond strength values in dentine group were observed in cseb ( 18.19 4.43 mpa ) and single bond ( sb ) ( 9.53 2.02 mpa ) groups , respectively .
tukey hsd post hoc test ( table 4 ) revealed no significant differences between shear bond strength values of pbnt and optibond solo plus ( obsp ) , but there were significant differences between pbnt , obsp , and cseb with sb .
t - test showed that there were significant differences between shear bond strength values of pbnt , obsp , and sb for enamel and dentine ( p < 0.001 for all 3 adhesives ) , but , for cseb , shear bond strength values were not significantly different for enamel and dentine ( p = 0.719 ) . scanning electron micrographs of enamel / adhesive or dentine / adhesive interfaces are shown in figure 1 to figure 11 .
for all adhesive systems tested in this study , the enamel / adhesive interfaces showed good adaptation and gaps / artifacts were not found in theme ( figures 1 , 2 , 3 , and 4 ) .
the two filled etch - and - rinse adhesive systems , obsp and pbnt , showed relatively thicker adhesive resin layer ( ar ) and hybrid layer ( hl ) compared to the unfilled etch - and - rinse adhesive system sb and the filled self - etch adhesive system , cseb .
gaps / artifacts were observed in dentinal areas of resin / dentine interfaces of etch - and - rinse adhesive systems ( figures 5 , 6 , 7 , 8 , and 9 ) , but cseb self - etch adhesive samples did not reveal any gaps at the resin / dentine interface ( figures 10 and 11 )
it is difficult to evaluate the effect of fillers in dentine adhesives with dissimilar resin composition .
filled adhesives were expected to act as an intermediate shock - absorbing elastic layer between resin composite and tooth surface , thus increasing the bond strength .
several studies evaluated comparisons between commercially available filled and unfilled adhesives . however , the advantages of these adhesives as stress buffers remain unpredictable [ 17 , 20 ] . filler type , size , shape , surface characteristics , and interaction with
a number of studies have investigated the bonding ability of adhesive systems to either enamel , dentine , or both .
most clinically prepared cavities are complex in design and include not only areas of exposed enamel and superficial dentine , but also deep dentinal areas . since many different adhesive systems are on the market today , it is desirable to use adhesive systems that produce high uniform bond strengths to all of these dental hard tissues . in the present study three commercial etch - and - rinse adhesive systems ( pbnt , obsp and sb ) and one self - etch adhesive system ( cseb ) were evaluated . among these adhesive systems only sb was unfilled .
enamel adhesion by means of phosphoric acid etching has become an accepted technique in restorative dentistry . while traditionally 3040% phosphoric acids have generally been used in etch - and - rinse adhesive systems ,
the mild aggressiveness of these acidic monomers could result in minor modifications and less enamel loss , which , in turn , could affect resin adaptation
. therefore enamel bond strength of etch - and - rinse adhesive systems is expected to be superior to that of self - etching adhesives [ 24 , 25 ] .
the higher bond strengths for acid - etched enamel can be explained by the more microretentive enamel surface obtained when enamel is etched with phosphoric acid as compared to when enamel is etched by the self - etch adhesives .
several authors have reported that mild self - etch adhesives demineralized enamel shallowly , resulting in a very thin microretentive pattern without formation of distinct macro- and microresin tags . while self - etching adhesives show shallow etching patterns , in several studies , their bond strengths to enamel
were found to be similar to etch - and - rinse adhesive systems [ 27 , 28 ] .
one another study reported that only cseb , which includes 10-mdp(10-methacryloxydecyl dihydrogen phosphate ) functional monomers in its composition , achieves high enamel bond strength , which was similar to the etch - and - rinse systems .
the self - etch adhesive in this study belongs to the category of mild self - etch adhesives with ph of approximately 2 .
although in the present study cseb produced lower bond strengths than three other etch - and - rinse adhesives in enamel , but the differences were not significant .
additionally , sb which does not have fillers in its composition revealed nearly the same bond strength in comparison to other filled etch - and - rinse systems and superior to the filled self - etch adhesive system tested in this study , so it seems that presence of filler in adhesive systems tested did not significantly affect the bond strengths of adhesives to enamel . on the other hand ,
the formation of micro- and macroretentive characteristics in enamel with phosphoric acid etching and/or chemical reaction to hydroxyapatite with functional monomers such as 10-mdp seem to be more important factors for bonding to enamel than presence or absence of fillers in adhesive compositions .
dentine is known to be a less - favorable substrate than enamel for resin bonding due to its high organic content and the presence of fluid and the odontoblastic process in dentine tubules [ 30 , 31 ] . for adhesive materials with aggressive etching effects
this would mean the absence of an effective chemical interaction and hence inadequate hybridization with dentine .
consequently , the bond strength to dentine would undergo a significant loss especially after storage for a long time due to hydrolysis of collagen fibrils .
however , two - step self - etching materials such as cseb are unlike bonding systems that have a separate , aggressive acid - etching step .
cseb is received and perceived as one of the most reliable adhesive systems and has been chosen as the reference bonding system in numerous studies [ 3335 ] . with cseb which is a two - step self - etching system , etching and penetration of the primer monomers occur simultaneously .
some researchers have highly lauded such two - step self - etching systems for their simultaneous monomer penetration and complete impregnation of the collagen network which leads to the formation of a homogenous and void - free interfacial zone that improves the quality of the hybrid layer and contributes to long - term sealing of the dentine surface [ 37 , 38 ] .
long - term clinical evaluation of cseb suggested that more aggressive etching was not essential for the overall clinical performance of the restorations .
in fact , mild acid etching enables the bonding substrate to maintain a higher mineral content for chemical interactions .
in addition , mild acid etching of dentine has the advantage of the occlusion of the dentinal tubules and consecutively decreasing dentine permeability and fluid movement , which may otherwise lead to hydrolytic degradation and failure of the bond . according to the manufacturer ,
susceptibility of resin components to hydrolysis has been identified as a cause for decreased bond strength .
it has been suggested that outstanding hydrolytic stability of mdp and its additional chemical interaction with the enamel and dentine contributed to superior bonding to enamel and dentine .
mdp has a special molecular structure that enables chemical interaction with residual hydroxyapatite after etching , and the produced chemical salt also exhibits hydrolytic stability .
in the current study it was found that , for dentine , cseb had significantly higher bond strengths than other adhesive systems tested .
its good performance on dentine can be explained by its specific and adapted composition and the use of the functional monomer 10-mdp , which has been shown to exhibit highly chemical interaction capacity to hydroxyapatite .
significantly lower bond strengths of etch - and - rinse adhesive systems to dentine may be attributed to suboptimally infiltration of the demineralized collagen network and subsequent poor adaptation of the bonding resin to the collagen fibrils . among the remaining three etch - and - rinse adhesive systems tested in the present study , sb which does not have filler in its composition showed significantly lower bond strength to dentine .
the presence of fillers may produce a sufficiently thick resin film that stabilizes the hybrid layer and provide an elastic buffer zone that compensates for shrinkage stress during polymerization .
miyazaki et al . reported that a 10% filler content in adhesives was necessary to increase bond strength .
for dentine , filled adhesives used in this study ( cseb , obsp , and pbnt ) revealed significantly higher bond strength than sb which was an unfilled adhesive system , but the differences between the bond strengths of pbnt and obsp were not significant .
it seems that , for bonding to dentine , filled adhesives are more effective than unfilled adhesives and also two - step self - etching adhesives perform more effectively than etch - and - rinse adhesive systems .
bond durability of cseb is ensured by the presence of mdp functional monomers and filler particles and formation of relatively thicker layer that serve as an elastic buffer zone during polymerization of resin composite .
finally , since the adhesives used in this study contained different solvents , it is possible that the solvent ( water , ethanol or acetone ) produces a significant effect on the viscosity of the adhesive which affects its ability to adapt to the dentine surface effectively , which in turn could influence bond strength .
if it was possible to use adhesive systems with similar compositions and different filler contents , the results could have been interpreted more reliably . as the hybrid layer
is visualized under sem , which is only possible by sectioning the resin dentine / enamel interfaces , it is possible that even a slight inclination of the cutting direction makes the hybrid layer appear thicker .
gaps / artifacts were observed in dentinal areas of adhesive / dentine interfaces , indicating that dentine bonding is likely to be influenced by more factors than enamel .
the observed gap in these areas may have originated from or may have been increased by air drying and desiccating the specimens for sem observation . however , since such gaps or cracks were not evident only in self - etch adhesive system cseb , and since all specimens were treated in the same manner , they may have been attributed to poorly polymerized hybrid / adhesive layers .
numerous resin tags ( t ) and lateral tags indicated that the smear layer was sufficiently dissolved by the phosphoric acid etching of etch - and - rinse adhesive systems .
resin tags were not seen in scanning electron micrographs of cseb sections which may be due to parallel path of section to the dentinal tubules .
according to the results and limitations of the present study , it can be concluded the following .
etch - and - rinse dentine bonding systems produce reliable bonding to enamel whether they include fillers in their composition or not.two-step self - etch adhesives are more effective than etch - and - rinse systems in bonding to dentine .
etch - and - rinse dentine bonding systems produce reliable bonding to enamel whether they include fillers in their composition or not .
two - step self - etch adhesives are more effective than etch - and - rinse systems in bonding to dentine .
Output:
| in this laboratory study shear bond strengths of three filled and one unfilled adhesive systems to enamel and dentine were compared .
forty - eight extracted intact noncarious human mandibular molars were randomly assigned to two groups of 24 one for bonding to enamel and the other for bonding to dentine .
buccal and lingual surfaces of each tooth were randomly assigned for application of each one of filled ( prime & bond nt ( pbnt ) , optibond solo plus ( obsp ) , and clearfil se bond ( cseb ) ) and unfilled ( single bond ( sb ) ) adhesive systems ( n = 12 ) . a universal resin composite was placed into the translucent plastic cylinders ( 3 mm in diameter and 2 mm in length ) and seated against the enamel and dentine surfaces and polymerized for 40 seconds . shear bond strength was determined using a universal testing machine , and the results were statistically analyzed using two - way anova , one - way anova , t - test , and tukey hsd post hoc test with a 5% level of significance.there were no statistically significant differences in bond strength between the adhesive systems in enamel , but cseb and sb exhibited significantly higher and lower bond strength to dentine , respectively , than the other tested adhesive systems while there were no statistically significant differences between pbnt and obsp . |
PubmedSumm6826 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: between 1960 and 1981 , the national cancer institute ( nci ) and the u.s .
department of agriculture ( usda ) collaborated on a plant screening program that collected and tested 115,000 extracts from 15,000 species of plants to identify naturally occurring compounds with anticancer activity .
samples from a single pacific yew tree , taxus brevifolia , were obtained by usda botanist arthur barclay on the last day of his expedition in 1962 .
after his return , crude extracts from bark , twigs , needles , and fruit were tested , and bark extract was found to be cytotoxic .
mansukh wani and monroe wall , working under contract with the nci at the research triangle institute ( research triangle park , nc ) , received t. brevifolia samples in 1964 . by 1967
, they had isolated and identified the active ingredient from the bark of t. brevifolia and named it taxol , based on its species of origin and the presence of hydroxyl groups ( perdue and hartwell , 1969 ; wall and wani , 1995 ) . in 1971
, they published the structure of taxol ( wani et al . , 1971 ) , and it entered the nci drug development program ( table 1 ) .
walsh and goodman ( 2002a ) .
wall and wani ( 1995 ) .
taxol showed mixed results in preclinical trials and was not uniformly considered the most promising plant product .
the insolubility of taxol in water necessitated its formulation with polyethoxylated castor oil , which can cause severe anaphylactic reactions and further dampened enthusiasm .
however , by 1978 taxol had shown efficacy in a subset of mouse tumor models , including p388 leukemia ( fuchs and johnson , 1978 ) , and it entered clinical trials in 1984 ( walsh and goodman , 2002a ; tuma , 2003 ; table 1 ) .
several clinical trials were delayed because of a shortage of taxol , the only source of which at the time was the slow - growing t. brevifolia . despite the scarcity ,
a clinical study on ovarian cancer proceeded and eventually concluded that 30% of patients with advanced ovarian cancer responded to taxol therapy ( mcguire et al . , 1989 ) .
high demand for taxol resulted in severe depletion of t. brevifolia , since removing the bark killed the trees . in 1990 , the department of the interior was petitioned to include t. brevifolia on the list of endangered species , and the pacific yew act was passed in 1992 to safeguard the tree ( walsh and goodman , 1999 ) . in 1988 , it was estimated that the cost of manufacturing taxol from the existing t. brevifolia was 10 times the budget available for the project at the nci , and environmental concerns regarding the long - term prospects for t. brevifolia were growing . owing to the limited accessibility of taxol , as well as
its unique structure and cytotoxic potential , at least 30 laboratories worldwide competed to develop a total synthesis .
however , because of the complexity of the molecule , these efforts were not successful until 1994 ( holton et al .
ultimately , several methods for total synthesis were developed , all of which require roughly 40 steps of reactions , and a more practical , semisynthetic protocol became the standard approach for production .
however , in 1989 , no immediate solution for obtaining large quantities of taxol was apparent , and the nci made the decision to transfer taxol to a pharmaceutical company for commercialization .
the request for applications received four responses , and bristol - myers squibb ( bms ) was selected in 1991 . in 1992
, bms trademarked the name taxol and created the new generic name paclitaxel ( walsh and goodman , 1999 , 2002a , b ; table 1 ) .
this occurred despite the fact that the term taxol had been used in > 600 manuscripts published over the course of 20 years .
congressional hearings were held in 1991 and 1993 regarding the transition of taxol to taxol and paclitaxel ( table 1 ) .
the hearings questioned granting bms a monopoly on a natural resource , as well as the higher price that was charged for drugs , like taxol , that were identified and developed with federal funding rather than private money .
the subcommittee staff concluded that the agreements between nci and bms were not sufficient to fully protect the public interest
( united states congress , house committee on small business , subcommittee on regulation , business opportunities , and energy , 1992 ) .
taxol is the most profitable chemotherapy drug in history , and the only drug in clinical use identified by the plant screening program ( walsh and goodman , 1999 , 2002a , b ) .
in 1977 , the nci sent samples of paclitaxel ( still referred to as taxol at that point ) to susan horwitz at albert einstein college of medicine ( new york , ny ) . in 1979
paclitaxel reduces the critical concentration of purified tubulin subunits necessary for polymerization into microtubules in vitro and increases the percentage of tubulin subunits that assemble .
furthermore , microtubules polymerized in the presence of paclitaxel are protected from the disassembly normally induced by cold or calcium treatment ( schiff et al . , 1979 ) .
these effects were in stark contrast to previously identified microtubule poisons , including colchicine and vinca alkaloids , which prevent microtubule polymerization ( malawista and bensch , 1967 ; bensch and malawista , 1968 ; de brabander et al .
similar to its effects on purified tubulin , paclitaxel promotes microtubule polymerization and stabilization in living cells , where it is capable of antagonizing the effects of colchicine and vinca alkaloids ( schiff and horwitz , 1980 ; de brabander et al . , 1981 ) .
phenotypically , paclitaxel treatment arrests a diverse array of cell types in mitosis , in both animal tumor models and cell culture ( fuchs and johnson , 1978 ; schiff and horwitz , 1980 ; milas et al . , 1995 ; jordan and wilson , 2004 ; orth et al . , 2008 ) .
a large majority of reports indicate that paclitaxel - arrested cells are in metaphase and contain near - normal , bipolar spindles .
canonical images of paclitaxel treatment show cells with chromosomes aligned at the cell equator , although in some cases one or a few chromosomes have been reported to remain misaligned ( jordan et al . , 1993 , 1996 ;
a small number of studies have reported that certain concentrations of paclitaxel induce multipolar spindles ( chen and horwitz , 2002 ; hornick et al .
however , until recently , there was no evidence to suggest that these effects were clinically relevant .
the dominant perception , by far , has been that the antitumor effects of paclitaxel occur due to its ability to arrest cells in metaphase on bipolar spindles .
paclitaxel - induced mitotic arrest occurs due to activation of the mitotic checkpoint ( also known as the spindle assembly checkpoint ) , the major cell cycle control mechanism acting during mitosis to prevent chromosome missegregation .
the mitotic checkpoint delays separation of the chromosomes , which enter mitosis as replicated pairs of sister chromatids , until each pair has made stable attachments to both poles of the mitotic spindle .
chromatids connect to spindle microtubules through their kinetochores , protein complexes that assemble on centromeric regions of dna .
unattached kinetochores , which have not made stable attachments to microtubules , activate a signal transduction cascade that delays mitotic progression by inhibiting the anaphase - promoting complex / cyclosome ( kops et al . , 2005 ;
paclitaxel treatment arrests cells in mitosis due to the presence of a small number of unattached kinetochores ( waters et al . , 1998 ) .
in addition to its utility in cancer therapy , paclitaxel is also widely used in cell biology . in untreated cells , bipolar attachment of sister chromatids places kinetochores under tension , which helps stabilize the interactions between kinetochores and spindle microtubules .
paclitaxel treatment reduces the tension on kinetochores that maintain bipolar attachment ( waters et al . , 1998 ) , and is a useful tool both for arresting cells in mitosis and for dissecting the contributions of tension versus attachment in satisfying the mitotic checkpoint ( maresca and salmon , 2010 ) .
a pubmed search for paclitaxel ( or taxol ) returns 25,000 articles . despite this vast literature , until recently , the clinically relevant concentration for use in cell culture studies has been unclear .
first , paclitaxel is dosed at various levels and on different schedules , depending on the disease and the chemotherapy regimen selected .
second , the concentration of paclitaxel in the plasma changes over time as the drug is cleared , primarily by the liver .
third , paclitaxel accumulates intracellularly in cancer cell lines by 50- to > 1000-fold , depending on cell type and the concentration added ( jordan et al . , 1993 , 1996 ; yvon et al . , 1999 ) .
therefore the concentration of paclitaxel is almost certainly higher in the tumor than in the plasma , where it is typically measured , but there is no linear calculation to predict the fold concentration .
fourth , intratumoral measurements require a biopsy after initiation of therapy , which is not readily accessible outside of a clinical trial . in the absence of data establishing the intratumoral concentration of paclitaxel
, it was reasonable to infer that its antitumor effects were due to mitotic arrest .
mitotic arrest results in either death during mitosis or an abnormal exit from mitosis , without chromosome segregation or cytokinesis , to form a tetraploid g1 cell ; this exit is known as mitotic slippage . after slippage ,
a functional mitotic checkpoint has been reported by numerous groups to be required for efficient cell killing in response to mitotic arrest .
in contrast , cells in which the mitotic checkpoint is weakened have also been reported to be sensitive to paclitaxel .
still other studies have found that the state of the mitotic checkpoint does not affect this sensitivity ( rieder and maiato , 2004 ; weaver and cleveland , 2005 ; yamada and gorbsky , 2006 ; ryan et al . , 2012 ) .
some have hypothesized that a weakened mitotic checkpoint confers only short - term resistance to mitotic arrest ( janssen et al . , 2009 ) , whereas others have proposed that activation of the mitotic checkpoint followed by mitotic slippage results in optimal cell killing ( tao et al . , 2005 ) .
one popular hypothesis was that the duration of mitotic arrest is predictive of cell death , with cells that arrest longer being more likely to die .
however , multiple studies observing individual cells have now shown that the length of time a cell spends in mitosis can not predict whether it will survive ( gascoigne and taylor , 2008 ; orth et al . , 2008 ; shi et al . , 2008 ) .
the difficulty of predicting sensitivity to mitotic arrest was further demonstrated in a study using nontransformed , chromosomally stable cells .
time - lapse microscopy was used to identify sister cells that resulted from a normal bipolar division without chromosome missegregation .
unexpectedly , the fates of the sister cells in response to mitotic arrest were completely unrelated .
if one cell died from mitosis , its sister was no more likely to die from mitosis than it was to slip into interphase ( and either die or survive ) .
thus cell fate in response to mitotic arrest is stochastic and not determined genetically ( gascoigne and taylor , 2008 ) .
the predominant hypothesis for the past several decades has been that paclitaxel kills tumor cells as a consequence of mitotic arrest .
however , despite significant effects on mitosis that are sufficient to cause cell death , it has been suggested that paclitaxel causes death in tumors through effects on interphase cells .
this proposal is largely based on the idea that the mitotic index in tumors is not sufficient to explain the efficacy of paclitaxel .
human tumors have a slow doubling time , and calculations that predict mitotic index based on tumor doubling rates , without accounting for cell death , suggest that an insufficient number of cells pass through mitosis in the presence of paclitaxel to account for tumor shrinkage rates ( komlodi - pasztor et al . , 2011 , 2012 ;
however , cell death has been observed in a wide array of untreated patient tumors , and directly measured proliferative rates are much higher than those estimated based on tumor doubling rates ( kerr and searle , 1972 ; kerr et al . , 1972 ;
in addition , paclitaxel is retained in tumors for > 5 d ( mori et al . , 2006 ;
2009 ) , permitting an extended window of time for cells to undergo one or more rounds of division in the presence of drug .
mechanistically , it is unclear how paclitaxel might enact cell death in interphase without having affected a prior mitosis .
it has been hypothesized that paclitaxel may interfere with cell signaling , trafficking , and microtubule - mediated transport ( herbst and khuri , 2003 ; komlodi - pasztor et al . , 2011 ) .
however , in cell culture , clinically relevant levels of paclitaxel do not cause death in interphase cells that have not previously undergone mitosis in the context of drug ( janssen et al . , 2013 ; zasadil et al . ,
observed using intravital microscopy , the mitotic index after treatment with doses of paclitaxel expected to cause mitotic arrest was quite low ( orth et al . , 2011 ; janssen et al . ,
2013 ) , leading to the suggestion that the microenvironment allows paclitaxel to exhibit interphase effects not observed in culture .
to better mimic the antineoplastic effects of paclitaxel in cell culture , we first collaborated with our physician colleagues to design a clinical trial to measure the intratumoral concentration of paclitaxel in primary breast tumors ( zasadil et al . , 2014 ) . to remove as many confounding variables as possible , patients who had not received prior therapy and
did not require concurrent therapy were enrolled . at 20 h after the initiation of the first dose of 175 mg / m paclitaxel
the 20-h time point was selected because the mitotic index of breast cancer cells in culture is increased 15-fold between 16 and 32 h after paclitaxel administration , and we therefore predicted that mitotic arrest would be evident at this time point . to assess whether tumors responded ,
measurements were obtained by ultrasound and/or mammogram before treatment and after four standard cycles of paclitaxel .
as predicted by prior cell culture experiments , the intratumoral concentration of paclitaxel ( 19 m ) was higher than the plasma concentration ( 80280 nm ) in all patients .
however , contrary to expectations based on cell culture data , mitotic arrest was neither necessary nor sufficient for tumor shrinkage in response to paclitaxel ( zasadil et al . , 2014 ) .
as a second step in determining the appropriate dose of paclitaxel with which to treat our cultured cells , we determined the extent to which the drug was concentrated in breast cancer cell lines .
, 1993 , 1996 ; yvon et al . , 1999 ) , we found that paclitaxel accumulated to a differing extent in distinct cell lines .
high - performance liquid chromatography analysis determined that treatment with low nanomolar concentrations of paclitaxel ( 510 nm for mda - mb-231 and 1050 nm for cal51 ) resulted in clinically relevant intracellular concentrations of 19 m . of interest , whereas higher concentrations of drug cause a robust mitotic arrest in these breast cancer cell lines , clinically relevant concentrations do not .
importantly , a majority of mitotic cells in patient tumors treated with paclitaxel also exhibit multipolar spindles .
after a brief delay , cultured cells in clinically relevant concentrations of paclitaxel proceed through mitosis on multipolar spindles and often segregate their chromosomes in three , four , or five different directions
. however , a portion of the cytokinetic furrows usually fail , and most divisions in paclitaxel produce two or three daughter cells ( figure 1 ; zasadil et al . , 2014 ) . clinically relevant concentrations of paclitaxel
cells entering mitosis in the presence of concentrations of paclitaxel equivalent to those in human breast tumors form abnormal spindles that contain additional spindle poles . rather than mounting a long - term mitotic arrest , these cells enter anaphase and divide their chromosomes in multiple directions
. however , a portion of the cytokinetic furrows often fail , and two or three daughter cells are usually produced .
the resultant daughter cells are aneuploid , and a portion of these die ( red x ) , presumably due to loss of one or more essential chromosomes .
because paclitaxel causes mitotic arrest at concentrations typically used in culture , and was believed to do so in human tumors , numerous other drugs that induce mitotic arrest without affecting microtubule dynamics have entered clinical trials .
these include inhibitors of aurora a , cenp - e , eg5/ksp , and plk1 .
the expectation for these drugs was that they would have the efficacy of paclitaxel without one of its major dose - limiting toxicities peripheral neuropathy .
peripheral neuropathy after paclitaxel therapy is presumed to result from impaired transport along the longest axons in the body , although data for this are scarce , and some chemotherapy drugs that do not affect microtubules , such as cisplatin , cause the same symptoms . disappointingly , despite causing an accumulation of mitotic figures , the new classes of antimitotic drugs have yet to match the efficacy of paclitaxel ( chakravarty et al .
this may be because the cytotoxic effect of paclitaxel in patient tumors is induction of multipolar divisions rather than mitotic arrest .
these have identified a diverse array of candidates , including proteasome subunits , cyclin g1 , and solute carrier genes ( rouzier et al . , 2005 ;
, 2007 ; pusztai et al . , 2009 ; juul et al . , 2010 ; wertz et al . , 2011 ; njiaju et al . , 2012 ; russell et al . ,
however , these discoveries have not yet led to a validated biomarker that predicts which patients will benefit from paclitaxel therapy .
this may be due , at least in part , to an emphasis on higher concentrations of drug that cause mitotic arrest and rapid cell death .
it is hoped that recognition of the clinically relevant mechanism of paclitaxel will facilitate identification of a biomarker capable of predicting which patients will benefit from its use .
it is not surprising that the rapid , dramatic effects of higher paclitaxel concentrations on mitosis and cell death were originally believed to be responsible for its efficacy in cancer therapy .
unfortunately , the barriers to acquisition of patient samples by basic scientists substantially delayed the finding that lower concentrations , which are slower to evoke cell death , are clinically relevant .
however , newly available data demonstrate that , rather than causing mitotic arrest , intratumoral concentrations of paclitaxel cause cell death due to chromosome missegregation on multipolar spindles .
it is hoped that , in addition to expediting identification of a predictive biomarker for paclitaxel treatment , this insight will also encourage collaboration between basic scientists and clinicians .
Output:
| taxol ( generic name paclitaxel ) is a microtubule - stabilizing drug that is approved by the food and drug administration for the treatment of ovarian , breast , and lung cancer , as well as kaposi 's sarcoma .
it is used off - label to treat gastroesophageal , endometrial , cervical , prostate , and head and neck cancers , in addition to sarcoma , lymphoma , and leukemia .
paclitaxel has long been recognized to induce mitotic arrest , which leads to cell death in a subset of the arrested population .
however , recent evidence demonstrates that intratumoral concentrations of paclitaxel are too low to cause mitotic arrest and result in multipolar divisions instead .
it is hoped that this insight can now be used to develop a biomarker to identify the 50% of patients that will benefit from paclitaxel therapy . here
i discuss the history of paclitaxel and our recently evolved understanding of its mechanism of action . |
PubmedSumm6827 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: aspirin - exacerbated respiratory disease ( aerd ) is a syndrome characterized by chronic hyperplastic rhinosinusitis , nasal polyposis , asthma , and aspirin sensitivity , as described in 1922 by szczeklik et al .
[ 1 , 2 ] . the prevalence of aerd is variable ; stevenson and szczeklik reported in 2006 that aerd occurs in 3% of adult patients with asthma in the united states , with the onset of symptoms during the third decade of life , and that it is more common in women than in men , with approximately 70% versus 30% in europe and 57% versus 43% in the usa .
the mechanisms underlying aspirin intolerance are not fully defined , with current research focusing on cyclooxygenase 1 ( cox-1 ) inhibition by aspirin and other nsaids diverting arachidonic acid metabolism from cox pathways to the lipoxygenase ( lo ) pathway .
this leads to increased synthesis of the cysteinyl - leukotrienes ( lt ) , ltc4 , ltd4 , and lte4 , resulting in bronchoconstriction , mucus hypersecretion , and possibly the development of polyps and urticaria .
the biological plausibility of this hypothesis fact has led to the search for polymorphisms in genes responsible for lt synthesis , to explore associations between these polymorphisms and local tissue levels of the proteins .
other factors such as polymorphisms in the genes for proinflammatory cytokines including tnf , il1b , il6 , and il8 are involved in chronic inflammatory and autoimmune diseases .
interleukin 1 ( il-1 ) is a cytokine associated with inflammatory responses and found in two forms , il-1 ( produced by the il1a gene ) and il-1 ( il1b ) , with both genes located on chromosome 2 .
il-1 is expressed in nasal polyps , nasal epithelium , macrophages , activated t lymphocytes , and monocytes ; its expression is regulated by adhesion molecules , and others inflammatory cytokines .
il1b polymorphisms have been associated with inflammatory bowel disease and gastric cancer among other diseases .
recently , genetic polymorphisms in proinflammatory cytokines such as il-1 have been recognized as key players in the pathogenesis of asthma .
similarly , il-8 has been implicated in the asthmatic inflammatory process , and genetic variation in this cytokine has been associated with both the susceptibility and the severity of this disease . in the present study
, we have investigated the frequencies of polymorphisms in the genes encoding these two cytokines in aerd patients .
patients with aspirin - exacerbated respiratory disease ( aerd ) ( n = 78 ) and aspirin - tolerant asthma ( ata ) ( n = 135 ) were recruited from the allergy and otolaryngology departments at the instituto nacional de enfermedades respiratorias ( iner ) . healthy control subjects ( hcs )
all participants underwent simple spirometry , inhaled methacholine challenge , and nasal challenge with lysine - aspirin ( l - asa ) according to international guidelines to determine the degree of bronchial hyperresponsiveness and confirm aerd diagnosis .
the aerd group had positive l - asa and methacholine challenges , the asthmatic group had positive methacholine challenge , but negative l - asa challenge , and the healthy control subjects were volunteers with negative l - asa and methacholine challenges .
a positive l - asa challenge was defined as a decrease of at least 40% in total nasal airflow after l - asa application compared with baseline measures ; methacholine challenge was considered positive with a decrease of at least 20% in forced expiratory volume in one second ( fev1 ) compared with baseline fev1 after the administration of different concentrations of methacholine ( beginning with 0.03 mg / ml , increasing gradually the concentration twice every 2 minutes until the concentration of 32 mg / ml ) ; in case it does not have it , it is considered negative .
the study was approved by the science and bioethics committees of iner , and all participants gave their informed consent [ 8 , 9 ] .
patients and healthy control subjects had ancestry of at least two generations born in mexico and were thus considered to be mexican mestizo in descent [ 10 , 11 ] .
peripheral blood was drawn by venipuncture , and genomic dna was obtained using the commercial bdtract dna isolation kit ( maxim biotech , san francisco , calif , usa ) .
the dna was quantified by absorption of ultraviolet light at 260 nm wavelength using an actgene spectrophotometer ( actgene , inc .
we selected two polymorphisms in two genes related to chronic inflammation : rs16944 in il1b and rs4073 in il8 .
allelic discrimination of snps rs16944 ( il1b ) and rs4073 ( il8 ) was performed by real - time pcr ( rt - pcr ) on a 7300 real time pcr system ( applied biosystems , calif , usa ) using taqman commercial probes ( applied biosystems , usa ) for each of the polymorphisms mentioned above and followed the cycling program : preread 50c , 1 minute ; absolute quantitation : 50c , 2 minutes , 1 cycle ; 95c , 10 minutes , 1 cycle ; 95c , 15 seconds , 60c 1 min , 40 cycles ; postread 50c , 1 minute .
the results were assessed taking into account the allelic discrimination and absolute quantitation in all samples ; additionally , we included four contamination controls per plate ( nontemplate controls ) .
the fluorescence signal detectors used were vic which was assigned to the b allele and fam assigned to the a allele for both snps .
statistical analysis was performed between groups of cases ( aerd and ata ) versus the healthy control subjects by test with 3 2 tables , using spss ( v. 15.0 ) software for windows , to identify the difference between the allele and genotype frequencies of each polymorphism evaluated .
in addition , odds ratios and 95% confidence intervals were calculated with epi - info ( v. 6.04 ) software .
we performed a genetic association study of the il8 ( rs4073 ) and il1b ( rs16944 ) gene polymorphisms in the three groups .
genetic data for the snps included in this study are shown in table 1 ; minor allele frequency ( maf ) of the polymorphisms tested in healthy control subjects had a similar distribution to that reported in international databases ( table 1 ) .
gene frequencies for each genotype within the three subject groups are shown in table 3 .
the frequency of genotypes aa , at , and tt of the il8 rs4073 snp was not statistically significant and different between the three studied groups .
analysis of gg and ga genotypes of the il1b ( rs16944 ) snp for aerd and ata patients versus the healthy control subjects showed nonstatistically significant associations .
interestingly , the aa genotype showed increased frequency in the aerd patients when compared to the ata group ( gf = 0.19 versus 0.07 ) ; this association was statistically significant ( p = 0.018 , or 2.98 , and ci 1.177.82 ) ( tables 3 and 4 ) and was not found when aerd or ata groups were compared to healthy control subjects .
there is no difference in aa versus ag + gg using contrast of healthy control subjects versus aerd patients ( data not shown ) .
the airways of aspirin - sensitive patients are characterized by chronic inflammation with cell infiltration even when they are not exposed to aspirin or other nsaids .
in addition to alterations in the metabolism of arachidonic acid , several proinflammatory cytokines have been associated with aerd .
the role of il-1 , however , has not been investigated previously . here , we report that aerd patients show an increased frequency of the il1b-511 polymorphism ( rs16944 aa genotype ) compared to aspirin - tolerant asthmatics .
interleukin-1 has been reported to be involved in the genesis of both asthma [ 13 , 14 ] and chronic rhinosinusitis with nasal polyposis in a turkish population .
most studies have attempted to establish the association of polymorphisms in the il1b promoter gene , mainly at positions-511 g / a ( rs16944 ) and -31 c / t .
for example , park et al . , in 2004 , did not find any association between these polymorphisms and either asthma or atopy in a korean population . in 2007 , erbek et al .
described a susceptibility for developing nasal polyps associated with the il1b-511 polymorphism ( rs16944 ) , but mfuna endam et al .
, in 2010 , failed to reproduce this finding in canadian patients with chronic rhinosinusitis . in 2003 , allen et al .
did not find any association with il1 gene polymorphisms in asthmatic families ( n = 244 ) , but they reported an association with the dna microsatellite d2s308 in these asthma families ( p = 0.00001 ) . in parallel ,
karajalein et al . evaluated 245 patients with asthma and nasal polyposis and did not find any association between the polymorphism il1b-511 c / t and nasal polyps .
evidence for the role of il-1 in pulmonary immune responses has been gathered in murine models of allergic asthma using il-1r1-deficient [ il-1r1 ( / ) ] mice ; changes observed in these mice include significant reduction of pulmonary eosinophilic inflammation , diminished goblet cell hyperplasia , and reduction of cell recruitment to the lungs , as compared to control balb / c mice .
however , there are no studies linking gene promoter polymorphisms and levels of expression of the cytokine in the lung microenvironment . in the present study
, we have demonstrated that the frequency of the il1b-511 polymorphism ( rs16944 aa genotype ) is three - fold higher in aerd ( 19.2% ) than in ata patients ( 7.4% ) , suggesting that patients carrying this polymorphism may exhibit genetic susceptibility to develop aerd .
findings on the biological functionality of the rs16944 polymorphism have not been consistent across studies .
the aa genotype has been associated with higher gastric mucosal levels of il-1 in bacterial infections , while mononuclear cells from subjects with the gg genotype showed an increased release of il-1 after stimulation with lipopolysaccharide .
recent studies suggest that the functional role of rs16944 may depend on il1b promoter region haplotypes including rs16944 [ 2326 ] .
although the findings are inconsistent , these previous studies suggest that rs16944 could affect the expression levels of il-1. our report is the first demonstration of the involvement of il1b polymorphism in aerd .
the sample size is relatively small , particularly in the aerd group , which may limit the statistical power , so it would be desirable to replicate our findings in an independent population .
future studies must investigate whether this cytokine is released in the airways of aerd patients and whether its levels relate to genetic polymorphisms in the il1b gene .
interleukin-8 has been implicated in asthma and found in high concentrations in bronchoalveolar lavage fluid of patients with acute asthma exacerbations .
in fact , polymorphic il8 alleles ( 251 t and 781c ) have been associated with asthma in a european population [ 7 , 27 ] , but not in asthmatics of korean origin ; the differences could be explained by the different ethnic populations studied . in contrast , korean asthmatics were found to show four nonsynonymous amino acid substitutions in the il-8 receptor a ( il8ra ) and an association of one synonymous variation in il8rb . in the present study ,
we did not find a significant difference in the rs4073 a / t between the aerd group and ata patients .
Output:
| aspirin exacerbated respiratory disease ( aerd ) is characterized by chronic hyperplastic rhinosinusitis , nasal polyposis , asthma , and aspirin sensitivity .
the mechanisms which produce these manifestations of intolerance are not fully defined , current research focuses on cyclooxygenase 1 ( cox-1 ) inhibition , metabolism of arachidonic acid , and the cox pathway to the lipoxygenase ( lo ) route , inducing increased synthesis of leukotrienes ( lt ) .
the biological plausibility of this model has led to the search for polymorphisms in genes responsible for proinflammatory cytokines synthesis , such as il1b and il8 .
we performed a genetic association study between il8 - 251 ( rs4073 ) and il1b-511 ( rs16944 ) polymorphisms in aerd , aspirin - tolerant asthma ( ata ) , and healthy control subjects . using allelic discrimination by real - time pcr
, we found statistically nonsignificant associations between aerd , ata , and healthy control subjects for the gg and ga genotypes of il1b ( rs16944 ) .
interestingly , the aa genotype showed an increased frequency in the aerd patients versus the ata group ( gf = 0.19 versus 0.07 , p = 0.018 , or 2.98 , and 95% ci 1.177.82 ) .
this is the first observation that il1b polymorphisms are involved in aerd .
thus , future studies must investigate whether interleukin-1 is released in the airways of aerd patients and whether it relates to genetic polymorphisms in the il1b gene . |
PubmedSumm6828 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: calcifying epithelial odontogenic tumor ( ceot ) , a rare odontogenic neoplasm arising from odontogenic epithelium was first identified by thoma and goldman .
it was not until 1955 , however , that ceot was recognized as a separate entity by pindborg .
fifty - two percent of ceot are associated with a tooth impacted and/or displaced by the tumor .
the tumor can be divided into two clinico - topographic variants : intraosseous ( central ) and extraosseous ( peripheral ) with an incidence of 94% and 6% , respectively .
the intraosseous tumors , when present have a predilection for the mandible more than maxilla with a ratio of 2:1 in the premolar and molar region .
extraosseous tumors are often located in the anterior region of the jaws and involve the gingiva . the most common clinical manifestation of ceot , when detectable , is a localized swelling of the involved jaw .
pain or paresthesia may or may not be a feature depending upon the size of the tumor , the growth pattern , or its anatomic location and proximity to neurovascular structures .
radiographically , ceot is characterized as a unilocular or multilocular radiolucent lesion that often exhibits a mixed radiopaque - radiolucent pattern .
the mixed pattern is due to areas of scattered flecks of calcification in the central radiolucency .
the histological criteria listed by franklin and pindborg for the diagnosis of ceot are sheets of polyhedral epithelial cells that have well defined border and often show prominent intercellular bridges .
mitotic figures are rarely seen . a characteristic feature seen within the sheets of epithelial cells are circular areas filled with a homogenous substance resembling amyloid - like material , which stains positively with congo red .
some of these cells are also filled by calcified material in the form of concentric leisgang 's rings , which are pathognomic of this tumor .
the tumor cells bear close resemblance to the cells of stratum intermedium of enamel organ and dental lamina remnants , based on its anatomic distribution in the jaw .
three such variants reported in the literature are the noncalcifying ceot with langerhans cells , the ceot displaying cementum - like and bone - like material , and the clear cell ceot.[914 ] the clear cell ceot variant is more aggressive with a higher recurrence rate ( 22% ) and is often associated with cortical perforation .
there are six reported cases in the literature so far.[1722 ] this report describes the seventh case of ceot in this anatomically uncommon location .
a 52-year - old male patient presented with a swelling over the right cheek area since 18 months . on clinical examination , a solitary well defined swelling measuring 321.5 cm extending from the distal surface of right maxillary canine to retromolar area of the hard palate was seen .
the swelling was firm in consistency and the overlying mucosa was normal [ figure 1 ] .
an expansile well - defined swelling involving the right hard palate and extending toward the anterior border of the soft palate on the radiographic examination , the occlusal radiograph showed complete obliteration of the sinus .
panoramic view showed radiolucent and radiopaque lesion involving the right alveolus and the maxillary sinus with erosion of lateral wall and floor of the sinus .
multiple foci of radiopacity simulating flecks of calcifications were seen giving it a snow - driven appearance .
computed tomography ( ct ) scan showed the right maxillary sinus involvement and demonstrated mixed radiolucent and radiopaque areas .
the lesion extended toward the lateral wall of the nose [ figures 2a and b ] .
it showed clusters of epithelial cells with uniform basophilic centrally placed nuclei intermixed with rbcs and inflammatory cells .
epithelial cells were polyhedral in shape with well - defined borders having pale eosinophilic cytoplasm .
few cells showed nuclear and cellular pleomorphism [ figures 3 and 4 ] . a provisional diagnosis of ceot was made and for further confirmation an incisional biopsy was performed .
( a ) computed tomography ( ct ) scan showing a large tumor involving the right maxillary sinus , demonstrating mixed radiolucent and radiopaque areas encroaching the orbital floor ( b ) computed tomography ( ct ) scan demonstrating a massive radiopacities within the maxillary sinus causing erosion of the lateral wall of the nose fnac showing epithelial cells in clusters with uniform basophilic central nuclei .
( magnification 40 ; hematoxylin and eosin stain ) fnac showing polyhedral cells with distinct cells borders nuclei and pale eosinophilic cytoplasm .
( magnification 40 ; hematoxylin and eosin stain ) the histopathological sections revealed varying sizes of epithelial islands surrounded by hemorrhagic areas in a fibrous connective tissue stroma .
[ figure 5 ] areas of clear cells having vacuolated cytoplasm were identified within the epithelial islands [ figure 6 ] .
as clear cell variant of ceot was diagnosed , which being aggressive in nature , a hemimaxillectomy using le fort i surgical approach was performed .
( magnification 40 ; hematoxylin and eosin stain ) photomicrograph showing significant areas of clear cells with vacuolated cytoplasm amidst polyhedral epithelial cells .
ceot has been reported under a variety of different terms such as adamantoblastoma ,
unusual ameloblastoma , and cystic complex odontoma . ceot or pindborg tumor accounts for less than 3% of all the odontogenic tumors .
the tumor frequently affects adults with equal distribution between men and women in an age range of 2060 years , with a peak of incidence between 40 and 60 years .
ceot is generally , considered as a benign tumor of odontogenic origin . in few cases ,
the tumor has been described as being locally aggressive , invading the surrounding soft tissues and bone marrow .
intraosseous ceot affects the mandible twice as often as does the maxilla and it predominates in the premolar / molar region of the mandible , although other sites may also be involved .
extension of the tumor into the maxillary sinus is a rarity with only six cases been reported in the literature [ table 1].[1722 ] the present report speaks about first case in an indian patient .
the age range in all reported cases was between second and third decade , whereas the present case was in the fifth decade .
some of these cases showed an association with unerupted teeth[1721 ] while other cases , including the present one , showed no association with an impacted teeth .
the ceot typically presents as a painless asymptomatic expansile mass , along with an extra oral swelling of the cheek .
four of the reported cases showed clinical signs of nasal obstruction.[1720 ] and two cases also reported epistaxis and proptosis . the current case presented with an expansile swelling of the palate and extraoral swelling on the cheek .
reported cases of ceot occurring in maxillary sinus radiographically , ceot exhibits a unilocular or multilocular radiolucency with diffuse radiopacities within .
the ct and magnetic resonance imaging ( mri ) features are more specific , with ct showing a well - defined area of soft tissue alteration with scattered high - density foci .
the expansile nature of the lesion produces cortical thinning , no bone destruction and no soft tissue invasion .
mri image are reported to be low signal intensity on t1-weighted and high signal intensity on t2-weighted image .
the report of the current case showed complete obliteration of the right maxillary sinus with erosion of lateral wall and floor of the sinus .
multiple foci of radiopacity were seen in the lesion , giving a snow - driven appearance .
fine needle aspiration cytology ( fnac ) , as a diagnostic tool , has been sparingly used and reported in the literature of ceot so far .
the report of cytological smears are characterized by clusters , sheets and rare isolated pleomorphic cells of squamoid type ; blocks of amorphous material encircled by fibroblast and occasional calcifications .
the cytological smear of the present case revealed clusters of epithelial cells with basophilic nuclei and well defined borders .
the histopathological findings classically seen in a ceot comprises of polyhedral cells arranged in sheets having prominent intercellular bridges along with calcified and noncalcified amyloid substance .
sheets of classic polyhedral epithelium with abundant eosinophilic cytoplasm may alternate with zones of epithelium characterized by large cells with clear , foamy cytoplasm , and distinct cell borders .
yamaguchi et al . believed that the clear tumor cells represent a feature of cyto - differentiation rather than a simple degenerative phenomenon .
the present case revealed clear cell changes in the epithelial tumor cells characterized by vacuolated cytoplasm .
few areas of cellular pleomorphism and mild degree of variability in nuclear size were seen .
other variants of ceot with findings of cementum - like and bone - like material , langerhan 's cells have also been identified in the stroma.[912 ] the treatment of ceot in the past has been varied , ranging from simple enucleation or curettage to hemimandibulectomy or hemimaxillectomy .
the method of treatments will depend on size , anatomic location of the tumor , histopathological findings , patient age , health status , and consideration of reconstruction methods following surgical procedure .
the le fort i osteotomy and its modifications , is a well reported surgical approach for access to the nasopharynx , base of the skull and upper cervical spine .
it is also described as a method for surgical access to the mid - face and maxillary antrum .
the tumor in the current case extended from alveolar process to the right maxillary sinus and was treated by hemimaxillectomy using le fort i surgical approach .
franklin and pindborg reported recurrence rate of 14% , which was mostly attributed to inadequate treatment . the current case was followed up for 3 year with no evidence of recurrence .
the lesions in the maxilla are usually aggressive and require extensive surgeries as they grow rapidly when compared to the mandibular cases and invasion into surrounding vital structures also affects the morbidity of these patients .
this case report describes the seventh known case of ceot invading the maxillary sinus , which complicates the treatment planning further .
resection with tumor - free accurate margins is the preferred treatment choice . since ceot with clear cell changes
are known to recur more frequently , a life - long follow - up of these patients is mandatory .
Output:
| calcifying epithelial odontogenic tumor ( ceot ) is a rare benign odontogenic neoplasm of the jaws , accounting for less than 3% of all odontogenic tumors .
it rarely extends into the maxillary sinus . till date , six cases involving maxillary sinus have been reported . in this paper , we report the seventh case of a 52-year - old male with ceot in maxilla extending from distal surface of the right maxillary canine to retromolar area and involving maxillary sinus with no association with impacted teeth .
the diagnosis was confirmed by aspiration cytology and histologically , the tumor was composed of sheets of epithelial cells , with areas of clear cell changes .
the presence of clear cells in the histological sections , accounts for the aggressive nature of the tumor simulating the clinical appearance .
prevention of recurrence can be achieved by radical resection . |
PubmedSumm6829 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: an elderly woman with a history of high blood pressure and hypercholesterolemia was admitted to the emergency room for suspected stroke due to abruptly starting vertigo , blurred vision and difficulties in speech .
neurological examination within 3 h from the symptom onset revealed high blood pressure ( 206/130 mm hg ) , dysarthria and impaired right hand coordination .
twelve hours after symptoms onset , the patient could not speak or swallow but was able to move all extremities .
the patient was intubated because of breathing difficulties and co2 retention . at 24 h ,
the patient could not open her eyes , here pupils were dilated , and there were no spontaneous respiration or movements . yet
a brain mri revealed an old hemorrhage in the pons , and csf findings were normal .
nerve conduction study findings showed that motor amplitudes were negligible , but sensory responses were preserved . in electromyography of the finger
1 ) was observed , but no increment was found in repeated nerve stimulation ( rns ) .
serum , gastric fluid and stool samples were taken , and botulinum antitoxin was given 3 days after symptom onset . despite all treatment efforts , the patient died 13 days after admission to the hospital due to septic shock and multiorgan failure .
three days after the arrival of the first patient , a previously healthy 29-year - old woman was admitted to the emergency room for suspected stroke .
it was soon found that the patient was a relative of patient 1 , and that they had eaten the same food .
although she received the antitoxin treatment the same evening , her neurological symptoms deteriorated during the first 2 days .
she needed assisted ventilation for 3 weeks , although other symptoms were resolved within 1 week .
those olives were strongly positive for botulinum neurotoxin type b , and the gastric content and fecal samples of both patients tested by multiplex pcr were positive for clostridium botulinum type b. in addition , the serum of patient 1 was weakly positive for botulinum neurotoxin .
botulinum toxin binds irreversibly to presynaptic plates of the neuromuscular junction causing dysfunction of voluntary muscles , inner organs and the autonomic nervous system .
in addition , the toxin may modify the inhibition in the central nervous system , possibly due to altered afferent input from the muscle spindles .
botulinum antitoxin neutralizes only the circulating toxin and should thus be administrated as soon as possible before completing the laboratory tests .
the diagnosis must therefore be based on clinical findings ; bulbar palsy with descending paralysis is the most typical finding .
especially the combination of bilateral drooping of the eye lids , absent gag reflex and respiratory failure with relatively well preserved limb forces and a clear mental status are suggestive of botulism and , more uncommonly , of other possible diagnoses like brainstem ischemia or polyradiculitis .
botulism diagnosis is further supported by normal mri and csf findings . according to the literature , as a sign of presynaptic transmission defect , high - frequency rns shows often an incremental motor response in botulism patients .
however , no increment was observed in our two cases , possibly due to largely destroyed endplates .
neurological symptoms may develop acutely in food - borne botulism and may therefore be misinterpreted as brainstem ischemia .
Output:
| botulism is a muscle - paralyzing disease caused by neurotoxins ( types a
g ) produced by the bacteria clostridium botulinum . symptoms of food - borne botulism most commonly appear 1236 h after eating contaminated food , but the earliest neurological symptoms may in some cases start abruptly . here , we report the cases of two patients with food - borne botulism who were admitted to the neurological emergency room as candidates for intravenous thrombolysis for acute stroke . |
PubmedSumm6830 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the discovery of coagulation factor xiii ( fxiii ) dates back to 1940s when a serum factor was found to make the fibrin clot insoluble in concentrated urea solution .
in 1960 , a case report demonstrated that the severe bleeding of a patient was due to the deficiency of fibrin stabilizing factor .
soon after this clinical finding , such fibrin stabilizing factor was formally termed fxiii in 1963 .
fxiii is a transglutaminase ( tg ) that circulates in tetrameric form ( fxiii - a2b2 ) , consisting of two a subunits ( fxiii - a ) and two b subunits ( fxiii - b ) .
the a subunit , as the pro - tg , is made up of 732 amino acids with a molecular mass of 83,000 .
fxiii - a comprised five domains : the n - terminal activation peptide ( ap - fxiii ) ( amino acids 137 ) , -sandwich ( 38184 ) , catalytic core ( 185515 ) , -barrel 1 ( 516628 ) , and -barrel 2 ( 629731 ) .
fxiii - b is a glycoprotein consisting of 641 amino acids ; its molecular mass is 80,000 .
it is a typical mosaic protein consisting of 10 short tandem repeats , called sushi domains .
fxiii - b serves as a carrier protein and is essential for the stabilizing of fxiii - a .
it accelerates cross - linking of fibrin by promoting the formation of a ternary complex between proenzyme fxiii , prosubstrate fibrinogen , and activator thrombin .
the catalytic site of fxiii - a2 is cys314 , which is normally occluded by ap - fxiii .
initiated by thrombin , ap - fxiii is cleaved and plasma fxiii - a2b2 is converted to fxiiia2 b2 .
after further disassociation of fxiii - b2 as a result of conformational change after ca binding , fxiii is finally transformed into activated fxiii ( fxiiia ) [ figure 1 ] .
fxiii - a is mainly formed by cells originated from the bone marrow . in plasma ,
all fxiii - a exists in a complexed form of fxiii - a2b2 . while the free form , fxiii - a2 is only found intracellularly , mainly in platelets , megakaryocytes , monocytes , and macrophages .
fxiii - b , synthesized by the hepatocyte , presents both as free form of fxiii - b and a complexed form of fxiii - a2b2 in the plasma .
( b ) after the initial conversion of fibrinogen into soluble fibrin by thrombin , fxiiia cross - links gln and lys residues of fibrins , which further leads to the formation of insoluble fibrin network .
ap - fxiii : activation peptide factor xiii ; fxiii : factor xiii ; fxiiia : activated factor xiii ; gln : glutamine ; lys : lysine . as a tg
the substrates of fxiii add up to more than 140 , including fibrinogen , fibronectin , and vitronectin .
the whole complement system , including c3 , c4b , c5a , can be cross - linked and immobilized by fxiii ; hence , a pro - inflammatory environment is created , providing a suitable microenvironment for cellular growth .
interaction between these proteins and signal molecules on the cellular surface may activate signal pathways .
fxiii is transformed to activated fxiii by thrombin with the help of ca and catalyzes cross - linking of fibrin , converted from fibrinogen by activated thrombin [ figure 1 ] .
fibrin cross - linking is a highly specific acyl transfer reaction consisting of two steps : ( 1 ) glutamine of the substrate forms a binary complex with the active site cysteine of the enzyme through the thioester linkage , accompanied by ammonia release ; ( 2 ) the acyl group of the binary complex is transferred to the acyl acceptor amine and form an isopeptide , releasing the enzyme at the same time .
fibrin included two -chains , two -chains , and two -chains , linked by the disulfide bond . fxiiia cross - links fibrin chains , during which -chain dimers and -chain polymers are formed .
-chain dimer formation between lysine of one -chain and glutamine of the other -chain is fast , followed by the formation of -polymers .
-chain multimers from progressive cross - linking of -chain dimers , accompanied by cross - linking between -chain and -chain , further stabilize the fibrin clot .
2-antiplasmin ( a2 at ) is one of the substrates of fxiii that can be cross - linked to fibrin , further strengthening its antifibrinolytic ability
. other substrates of fxiii include plasminogen activator inhibitor 2 , plasminogen , and thrombin activatable fibrinolysis inhibitor , whose roles in fibrinolysis and thrombosis remain to be studied .
fxiii deficiency is a rare type of disorder that often causes bleeding manifestations , sometimes life - threatening central nerve system ( cns ) bleeding .
a research of 190 patients with congenital fxiii deficiency revealed that major clinical manifestations include umbilical bleeding of neonates , deep soft tissue hematoma , prolonged wound bleeding , mucosal bleeding ( gum bleeding , epistaxis , prolonged menstrual bleeding ) , and cns bleeding .
patients may develop antibodies for fxiii - a or fxiii - b from autoimmune or neoplastic disease and usages of certain medications .
fxiii deficiency has been found in children with malignant disease including acute myeloid leukemia and acute lymphoblastic leukemia ( all ) , and solid tumor such as neuroblastoma , non - hodgkin lymphoma and disseminated alveolar rhabdomyosarcoma , with the presence of bleeding manifestations .
one research focused on pulmonary embolism ( pe ) demonstrated that patients with pe ( n = 71 ) have lower fxiii levels than patients without ( n = 4 9 ) .
similar results were observed in fibrinogen level , indicating that lower level of fxiii in patients with pe might be a result of consumption during clot formation .
studies have also shown that the role of fxiii in thrombosis may be affected by factors such as age and gender .
two studies with 955 and 278 patients , respectively , reported that increased fxiii plasma concentration was associated with increased incidence rate of myocardial infarction and peripheral artery disease in female patients .
inflammatory cells such as macrophages and neutrophils will migrate to the wounded area due to the chemotactic effect induced by cytokines .
angiogenesis then starts under the influence of growth factors such as vascular endothelial growth factor ( vegf ) , fibroblast growth factor , and transforming growth factor - g .
the newly synthesized small vessels , together with fibrin , will form the granulation tissue .
fxiii also plays an important part in the process . besides the significant role in the coagulation cascade , immobilized fxiiia in the tissue of the wound supports platelet adhesion through integrins ( iib3 and v3 ) on the surface of the platelet , a process independent of fxiiia tg activity , thus stabilizing the provisional matrix at the very early stage of wound healing .
bacteria are immobilized via cross - linking to fibrin fibers by the action of fxiii .
fxiii is also able to cross - link with many molecules such as fibronectin and vitronectin , which adheres to the integrin of inflammatory cells that would migrate to the wound later . as a result ,
adhesion of the inflammatory cells is enhanced , and integrin - related signal pathway is activated .
it is found that fibronectin plays a potential role in the activation of macrophage , and cross - linked vitronectin can inhibit apoptosis of neutrophils .
vegf receptor-2 ( vegfr-2 ) and v3 on the surface of vascular endothelial cells are both signal molecules in angiogenesis , which can be activated by fibronectin and vitronectin when cross - linked with fxiii .
the role of fxiii in wound healing is supported by research in both animal studies and clinical cases .
exposure to dextran sulfate sodium ( dss ) causes mucosa damage of colon in mice .
the colon damage of wild - type mice was found to recover better than fxiii mice after dss exposure .
a research study including 31 patients of crohn 's disease ( cd ) reported that plasma fxiii level was lower in patients with active cd than patients in remission , indicating fxiii consumption during the healing of damaged colons .
another study including 249 patients of ulcerative colitis showed that plasma fxiiia was lower in more severe patients ( measured by clinical activity index , endoscopic and histologic scores ) .
immunohistochemistry also reported fxiii localization in extracellular matrix of damaged mucosa , a strong evidence of fxiii participating in wound healing process .
researchers have found abnormal fxiii expression level or activity in patients with leukemia and solid tumors .
the cellular form of fxiii ( fxiii - a2 ) is present mainly in platelets , megakaryocytes , monocytes , and macrophages .
it was found that fxiii - a2 expression level of tumor cells was significantly elevated in patients with acute myelomonocytic leukemia ( aml - m4 ) and acute monocytic leukemia ( aml - m5 ) .
abnormal fxiii activity has been found in patients with solid tumors . a research including 28 patients of nonsmall cell lung cancer ( nsclc ) found that fxiii activity level of patients in advanced - stage is higher than that of patients in early - stage and healthy controls , indicating that fxiii activity level could be potentially used as a marker of advanced nsclc .
vairaktaris et al . analyzed 130 patients of oral squamous cell carcinoma and 135 healthy controls and found that l allele was associated with higher oral cancer risk .
it was observed that patients with ll homozygotes had a 3-fold higher risk for oral cancer , while in vl , the risk was 2-fold higher .
fibrins are found in neoplastic tissues , as well as many tumor - associated macrophages ( tams ) which express fxiii - a2 .
fxiii - a2 released from damaged tams was involved in the stabilization of fibrin network which facilitated tumor growth .
fxiii was found to be involved in tumor metastasis in the research of mice by limiting natural killer cell - mediated clearance of micrometastatic tumor cell
. however , the role of fxiii in tumorigenesis is still unclear , and the relationship between fxiii and leukemia and solid tumors needs to be further elucidated .
bone remodeling is a life - long process , involving osteoclasts that resorb bone and osteoblasts that form new bone tissues .
bone extracellular matrix is essential in the process by facilitating cell attachment , cell differentiation , and bone mineralization .
researches in mice have reported the activation of fxiii - a gene in osteocytes of long bones ( femur ) and flat bones ( calvaria and mandible ) .
a 37,000 protein expressed in bone and was confirmed to be the active product of fxiii - a after posttranslational proteolytic processing .
the protein was able to stabilize the interaction of microtubules with the plasma membrane , making it possible for the secretion of exosomes which contain collagen and fibronectin , both of which were predominant composition of bone extracellular matrix .
collagen and fibronectin secreted outside the cell could form stable interaction with osteonectin and osteopontin , catalyzed by tg .
the deposition of ca and collagen would decrease after suppression of tg activation , indicating the important role tg played in the mineralization and collagen deposition of bone extracellular matrix .
however , other researches have observed mineralization and collagen deposition of extracellular matrix in tg2 and fxiii - a knockout mice . another protein of 37,000 , with similar function to the active product of fxiii - a mentioned above , has been found .
it is reasonable to believe that other kinds of protein may also be involved in bone remodeling .
a systemic review by sharief and kadir found 127 ( 66% ) miscarriages in 192 pregnancies of 63 women with congenital fxiii deficiency .
for those without prophylactic therapy , as high as 91% of 136 pregnancies resulted in miscarriage .
fxiii - a is present in normal uterus , implantation tissues , and placenta in normal pregnant women , but missing in women of congenital fxiii deficiency .
extravillous cytotrophoblasts formed the cytotrophoblastic shell which stabilized the interaction between embryo and decidua of uterus .
it was reported that fxiii - a was missing in the placenta in woman with fxiii deficiency , leading to insufficient formation of the cytotrophoblastic shell .
the cross - linking between proteins such as fibrin and fibronectin was also important for the attachment of placenta to uterus .
however , a research including 536 cases reported that the plasma level of fxiii could not predict recurrent miscarriage .
one potential explanation is that fxiii in plasma is not equal to that in placenta tissues while the latter is the key to pregnancy loss .
fxiii has been treated as merely a coagulation factor for a long time by the medical community .
recent studies have shown that fxiii , with the essence of tg , is involved in many more processes besides coagulation such as wound healing , bone extracellular matrix stabilization , and the interaction between embryo and decidua of uterus , as well as some rare processes [ table 1 ] .
the expression and activity level of fxiii also changes in leukemia and solid tumors , but its underline mechanism is still unknown and more research is needed .
Output:
| objective : to provide a comprehensive literature review on roles of coagulation factor xiii ( fxiii ) in coagulation , wound healing , neoplasm , bone metabolism , and pregnancy.data sources : all articles in pubmed with key words coagulation factor xiii , wound , leukemia , tumor , bone , and pregnancy with published date from 2001 to 2016 were included in the study .
frequently cited publications before 2000 were also included.study selection : we reviewed the role of fxiii in biologic processes as documented in clinical , animal , and in vitro studies.results:fxiii , a member of the transglutaminase ( tg ) family , plays key roles in various biological processes . besides its well - known function in coagulation ,
the cross - linking of small molecules catalyzed by fxiii has been found in studies to help promote wound healing , improve bone metabolism , and prevent miscarriages .
the study has also shown that fxiii concentration level differs in the blood of patients with leukemia and solid tumors and offers promises as a diagnostic indicator.conclusions:fxiii has many more biologic functions besides being known as coagulation factor .
the tg activity of fxiii contributes to several processes , including wound healing , bone extracellular matrix stabilization , and the interaction between embryo and decidua of uterus .
further research is needed to elucidate the link between fxiii and leukemia and solid tumors . |
PubmedSumm6831 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: trimetazidine is well established in stable coronary artery diseasepreliminary evidence suggests that trimetazidine might be an effective drug in diabetic and non - diabetic patients with chronic heart failure and in those with peripheral artery diseasetrimetazidine has been generally well tolerated in clinical trials but some recently reported adverse drug reactions require careful evaluation in studies with longer follow - up
trimetazidine is a cytoprotective drug that normalizes metabolic disturbances in low - flow ischemia via several not yet fully understood
the best known trimetazidine mechanism of action is its capacity to inhibit -oxidation of free fatty acid ( ffa ) .
when oxygen is in low supply , the oxidative processes of ffa and glucose are disrupted paradoxically leading to an increased rate of ffa -oxidation associated with even greater oxygen consumption while glucose metabolism decreases , which results in lactate accumulation and , in extreme cases , development of metabolic acidosis [ 1 , 2 ] . by selectively inhibiting the enzyme
long - chain 3-ketoacyl coenzyme a thiolase ( lc 3-kat ) , which is the final enzyme in the ffa -oxidation pathway , trimetazidine increases the metabolic rate of glucose .
trimetazidine also increases pyruvate dehydrogenase activity , which starts restoring homeostasis between glucose oxidation and glycolysis , imbalanced during ischaemia [ 13 ] .
this results in decreased oxygen consumption during adenosine-5-triphosphate ( atp ) synthesis , hydrogen ion production , limited increase of intracellular acidosis , and reduced calcium ion accumulation [ 1 , 3 , 4 ] . correcting energy insufficiency leads to reduced accumulation of sodium in cardiomyocyte cytoplasm , decreased formation of reactive oxygen species ( ros ) , and reduced neutrophil infiltration [ 5 , 6 ] .
another trimetazidine mechanism of action that may be important for cardiovascular disease patients , including subjects with chronic heart failure ( chf ) , is its direct inhibition of cardiac fibrosis .
this mechanism may be promoted by the connective tissue growth factor ( ctgf ) , which has been confirmed in an experimental model in rats with valvular hf . in comparison with placebo ( physiological saline ) ,
trimetazidine reduced collagen accumulation , ctgf expression in cardiac fibroblasts , nicotinamide adenine dinucleotide phosphate - oxidase ( nadph oxidase ) levels , and ros production .
the phenomenon of trimetazidine effects on endothelin 1 ( et-1 ) metabolism and release by non - selective blockade of et-1 receptors has also been observed ( still undocumented in clinical studies ) ( table 1 ) .table 1the main cytoprotective mechanisms of trimetazidineffa breakdown inhibition and glucose breakdown stimulationreduction in the amount of oxygen necessary for atp productionreduction in the cellular accumulation of lactic acid and h
reduction in the cellular accumulation of na and ca
reduction in atp losses for maintaining ion homeostasisreduction of adverse effects of overloading cells with calciumanti - radical effectreduction of granulocyte infiltration to the ischaemic and reperfused area of the myocardiumcardiomyocyte apoptosis inhibitionadapted and modified from banach
atp adenosine-5-triphosphate , ffa free fatty acid the main cytoprotective mechanisms of trimetazidine adapted and modified from banach
atp adenosine-5-triphosphate , ffa free fatty acid another trimetazidine mechanism of action , particularly relevant in acute myocardial ischemia , is an improved mechanical resistance of the sarcolemma [ 11 , 12 ] . during reperfusion following an acute ischaemic episode ,
the sarcolemma is subjected to significant reoxygenation - induced mechanical stress due to tissue oedema .
increased sarcolemmal resistance of living cells in the reperfused zone reduces the area of myocardial infarction - related necrosis , which protects myocardial cells against apoptosis [ 11 , 12 ] .
trimetazidine may also restore mitochondrial function , impaired following ischaemia , since the trimetazidine binding site to the mitochondrial membrane has been identified .
this confirms anti - ischaemic properties of the drug ( table 1 ) [ 13 , 14 ] .
many patients with angina pectoris do not receive adequate antianginal therapy because of haemodynamic intolerance or chronotropic incompetence .
trimetazidine as an additional therapy may represent an optional treatment to be used in association with first - line antianginal drugs , especially in those patients for whom optimal control of symptoms can not be achieved with other antianginal drugs .
the trimetazidine in poland ( trimpol)-ii study , which was the continuation of the trimpol - i study , the study by sellier and broustet and the most recent the vasco ( efficacy of trimetazidine on functional capacity in symptomatic patients with stable exertional angina ) study were the studies providing evidence generated in support of trimetazidine as an add - on to beta - blockers in symptomatic patients with angina pectoris .
two other studies by manchanda and krishnaswami [ 19 , 20 ] and manchanda [ 19 , 20 ] supported the efficacy of trimetazidine as an additional therapy to calcium channel blockers . in the double - blind , placebo - controlled trimpol - ii study , trimetazidine 60 mg / day was added to metoprolol ( 50 mg bid ) for 12 weeks in a group of 426 patients with stable angina pectoris .
the authors observed a significant improvement in the trimetazidine group ( as compared with placebo ) for the following parameters : total exercise duration ( + 20.1 s , p = 0.023 ) , total workload ( + 0.54 metabolic equivalents [ mets ] , p = 0.001 ) , time to 1-mm st - segment depression ( + 33.4 s , p = 0.003 ) , time to onset of angina ( + 33.9 s , p < 0.001 ) , angina attacks / week ( 0.73 , p = 0.014 ) , and the necessity of short - acting nitrates administration per week ( 0.63 , p = 0.032 ) .
the trimpol - ii study showed that trimetazidine added to metoprolol significantly improved exercise capacity and exercise - induced myocardial ischaemia .
the efficacy was also confirmed in patients at maximal dose of metoprolol and in patients with recurrent angina . in another important double - blind , placebo - controlled study ,
sellier and broustet evaluated the efficacy of trimetazidine modified release ( mr ) 70 mg / day in a group of 223 patients with angina pectoris who were insufficiently controlled with 50 mg / day of atenolol after 2 months of therapy .
after 8 weeks , the authors observed a significant increase in the time to 1-mm st - segment depression in exercise tests ( + 34.4 s , p = 0.03 ) in the trimetazidine group in comparison with the placebo group .
finally , the above - mentioned vasco study was the largest randomized controlled study conducted with trimetazidine .
the patients with stable angina receiving 50 mg of atenolol were randomized to the addition of trimetazidine mr 70 or 140 mg or placebo for a 12-week period . in the cohort of all chronic stable angina patients ,
both doses of trimetazidine significantly increased ted ( p = 0.0044 and p = 0.0338 for trimetazidine 140 mg / day and trimetazidine 70 mg / day , respectively ) .
a greater ted improvement was observed in trimetazidine 140 mg / day than in trimetazidine 70 mg / day , although the difference was not significant . amongst patients with limiting angina during exercise test ,
both doses of trimetazidine significantly improved both time to 1-mm st - segment depression and ted .
the role of trimetazidine in angina pectoris patients was also analysed in the meta - analyses . in 2003 ,
marzilli and klein published the first meta - analysis of 12 trials including 868 patients .
trimetazidine was found to significantly increase exercise duration to 1-mm st - segment depression on the exercise test , and to reduce weekly episodes of angina , both as monotherapy and as add - on therapy .
ciapponi et al . conducted a meta - analysis of 23 trials with 1,378 patients with stable angina .
the authors showed that trimetazidine reduced the number of weekly angina attacks ( p < 0.0001 ) and weekly nitroglycerine tablet consumption ( p < 0.0001 ) and improved exercise time to 1-mm segment depression on the exercise test ( p = 0.0002 ) , compared with placebo . in the largest meta - analysis conducted on the effects of trimetazidine in stable angina pectoris patients , danchin et al . evaluated 218 trials with a total 19,028 patients , including the results of the vasco trial .
trimetazidine significantly improved exercise tolerance , weekly angina episodes , and use of short - acting nitrates when compared with placebo . finally , for the comparison of trimetazidine with other antianginal agents without an effect on heart rate , network meta - analyses were performed . in these analyses ,
trimetazidine had similar anti - ischemic effects to dihydropyridines , long - acting nitrates , nicorandil , and ranolazine , both as monotherapy and as add - on therapy .
the findings of this robust meta - analysis strongly supported the indication of trimetazidine as an effective agent for the management of stable angina .
these results also provided strong arguments for the position of trimetazidine in the current guidelines for the management of patients with stable angina ( see below ) .
trimetazidine has a rather well documented effect on improving the left ventricular systolic and diastolic function , although properly designed and controlled large clinical trials with sufficient follow - up are still scant [ 17 , 25 , 26 ] .
a number of available reports have also demonstrated clinical improvement in patients based on various parameters improved exercise tolerance , improved quality of life , or reduced new york heart association ( nyha ) hf class [ 2528 ] .
. showed that 6-month therapy with trimetazidine at 20 mg three times a day in patients with nyha class iii / iv resulted in improved left ventricular ejection fraction ( lvef ) by 9 % measured via radioactive isotope method , with simultaneous lvef reduction by 16 % demonstrated in the placebo group ( p = 0.018 ) .
an experimental hf model additionally demonstrated that 12-week treatment with trimetazidine reduced the levels of the atrial natriuretic peptide ( anp ) , another biomarker of hf , admittedly not measured in clinical practice .
assessed the effect of adding trimetazidine ( n = 20 ) or placebo ( n = 27 ) to conventional treatment in chf patients followed for a mean period of 13 months .
the trimetazidine group showed improvement in the nyha hf class ( p < 0.0001 ) , left ventricular end - diastolic volume ( lvedv ) ( from 98 36 to 81 27 ml ; p = 0.04 ) and lvef ( from 36 7 to 43 10 % ; p = 0.002 ) . meanwhile , the placebo group showed deterioration of these parameters , with increased left ventricular end - systolic volume ( lvesv ) ( from 142 43 to 156 63 ml ; p = 0.20 ) and lvedv ( from 86 34 to 104 52 ml ; p = 0.10 ) as well as reduced lvef ( from 38 7 to 34 7 % ; p = 0.02 ) . as emphasized by the authors , despite the small number of subjects enrolled in the study , the results suggest a beneficial effect of trimetazidine treatment ;
that is , inhibition of the natural course of chf that involves gradual deterioration of cardiac function on conventional therapy alone . in a subsequent study involving 50 patients with ischaemic cardiomyopathy , 25 patients were assigned to receive conventional treatment plus trimetazidine , while the remaining 25 patients constituted the control group .
after a 6-month follow - up , both groups achieved an insignificant reduction in nyha class .
the group receiving trimetazidine demonstrated a considerable reduction in brain natriuretic peptide ( bnp ) levels ( 135 22 vs 252 44 pg / ml ; p < 0.001 ) and cardiac troponin t ( ctnt ) ( p < 0.001 ) , while the control group showed increased plasma bnp levels ( 288 46 vs 239 59 pg / ml ; p < 0.02 ) , with no significant changes in ctnt levels .
trimetazidine administration also resulted in a significant improvement in exercise tolerance assessed with a 6-min walk test ( 6mwt ) ( p < 0.01 ) ; however , it was not associated with a significant improvement in lv systolic function ( with lvef values : 28 4 % , 29 5 % , and 32 5 % , at baseline , after 1 month and 6 months , respectively ) .
similar results were achieved by sisakian et al . , who achieved even more promising results of trimetazidine use in patients with ischaemic cardiomyopathy .
a total of 82 patients were included in that study , with 42 patients ( study group ) receiving 35 mg trimetazidine twice a day for 3 months on top of their conventional treatment , and the remaining 42 patients constituting the control group .
exercise test - based physical capacity improved by 30 20.7 m ( from 215 17.5 to 245 20.7 m ) in the trimetazidine group , versus 2.0 18.85 m ( from 208.2 12.4 to 210.2 14.2 m ) in the control group ( p < 0.001 ) .
an echocardiographic examination in the trimetazidine group showed improved lv systolic function ( lvef ) by a mean of 3.5 6.72 % ( to 38.0 4.8 % from the baseline value of 34.5 3.8 % ) , with the improvement in the control group of only 0.8 8.06 % ( to 33.2 5.8 % from the baseline value of 32.4 5.6 % ) ( p = 0.05 ) .
. additionally demonstrated the effect of trimetazidine in essentially improved endothelium - dependent lv relaxation , assessed on the basis of reduced levels of plasma malondialdehyde ( mda ) ( from 3.98 0.69 to 2.15 0.59 mmol / l ) and lipid hydroperoxides ( loohs ) ( from 3.72 0.9 to 2.06 0.6 mmol / l ) in comparison with the placebo group ( p < 0.001 for both ) , which constitutes some evidence for antioxidative properties of the drug .
however , it was also very limited due to the small number of included patients .
a total of 12 patients were included in the trimetazidine group and seven patients from the control group received placebo . in comparison with the placebo group ,
the trimetazidine group demonstrated a greater improvement in lvef ( from 30.9 8.5 to 34.8 12 % ;
p = 0.027 ) ; moreover , interestingly , an 11 % increase in high - density lipoprotein ( hdl ) levels and reduced insulin resistance reflected in lower blood glucose ( p = 0.047 ) and blood insulin levels ( p = 0.031 ) . however , the power of that study was insufficient to discuss any possible effects of trimetazidine on the reduction of inflammatory processes or oxidative stress , and thus , on any changes in hdl functionality either [ 3840 ] . in another study by fragasso
patients with lv systolic dysfunction ( n = 44 ) were randomized to receive either conventional treatment ( n = 19 ) or conventional therapy plus trimetazidine ( n = 25 ) . at 3 months of follow - up ,
trimetazidine administration versus conventional treatment alone showed improved lvef ( from 35 8 to 42 11 % and from 35 7 to 36 6 % , respectively ; p = 0.02 ) , reduced nyha class ( p = 0.0001 ) and improved quality of life ( p < 0.0001 ) .
the use of trimetazidine also led to a reduced rate of energy expenditure ( from 1,677 264 to 1,580 263 kcal / day ; p = 0.038 ) . of note ,
the available data indicate that trimetazidine treatment may be particularly important in patients with chf and concomitant diabetes mellitus [ 42 , 43 ] . similarly to the data presented in the paper by tuunanen et al .
, fragasso et al . demonstrated , by analysing 16 diabetic patients with ischaemic cardiomyopathy , that the use of trimetazidine 20 mg three times a day led to a significant reduction in fasting blood glucose compared with placebo after a 6- and 12-month follow - up ( 121 30 vs 136 40 mg / dl , respectively ; p = 0.02 and 125 36 mg / dl vs 140 43 mg / dl ; p = 0.19 ) with a simultaneous reduction in insulin resistance
indeed , swedish investigators demonstrated that the use of trimetazidine for over 1 month in diabetic patients with chf nyha class ii or iii failed to show superiority over conventional treatment .
moreover , there were no statistically significant differences between trimetazidine and placebo groups in terms of exercise tolerance or lv function ( lvef assessment via tissue doppler imaging at rest and on exertion showed only a slight change in favour of the study group ) .
despite being a randomized , double - blind , controlled study , like most of the earlier trimetazidine studies , it included only a very small group of patients ( n = 20 ) , hence the authors statement should be treated with caution .
the authors emphasized the benefits of trimetazidine in terms of improved lv systolic function in patients with diabetes and ischaemic chf .
the paper demonstrated that the use of trimetazidine resulted in improved lvef both in the diabetic ( n = 14 ) and non - diabetic ( n = 37 ) patients at 3 months of follow - up ; however , the improvement of lv systolic function was significantly greater in the group with abnormal glucose metabolism ( p < 0.001 ) .
the study consistently demonstrated beneficial effects of the drug , particularly in this group of patients .
nonetheless , there is still a question around the mechanism of action of trimetazidine that improves carbohydrate metabolism .
a very interesting suggestion was presented by a group of chinese authors who believe that the use of trimetazidine at an early stage of abnormal glucose metabolism in the form of impaired glucose tolerance or even at the pre - diabetes stage may prevent diabetic cardiomyopathy .
this results from the fact that patients with abnormal glucose metabolism have significantly reduced glucose and lactate metabolism as well as increased fatty acid -oxidation [ 45 , 46 ] .
the use of trimetazidine at early stages of the disease could contribute to glucose metabolism normalization , and the drug itself could no longer be considered only in chf treatment but also in diabetic cardiomyopathy prevention .
another important aspect is the effect of trimetazidine treatment on electrocardiographic changes in chf patients and the associated reduction in electrophysiological risk factors of atrial and ventricular arrhythmias , including sudden cardiac death ( scd ) [ 4749 ] .
adding trimetazidine 20 mg three times a day to conventional hf treatment for 3 months in a group of 30 patients resulted in improved ambulatory 24-hour ekg parameters , such as the standard deviation of normal - to - normal r - r intervals ( sdnn ) ( 97.3 40.1 to 110.5 29.2 ms ; p = 0.049 ) and standard deviation of the averages of normal - to - normal r r intervals ( sdann ) ( 80.5 29.0 to 98.3 30.5 ms ; p = 0.008 ) . moreover , improved lv systolic function ( increase in lvef from 33.5 5.1 to 42.5 5.8 % ; p < 0.001 ) and an increase in sdnn correlated with the increase in lvef . in another study of the same authors
, they presented the effect of 6-months treatment with trimetazidine at 20 mg three times a day in chf patients ( n = 36 ) on the p - wave duration and dispersion predictors of atrial fibrillation , which is a factor increasing postoperative mortality in patients undergoing coronary artery bypass grafting ( cabg ) .
the authors demonstrated that added to conventional treatment , trimetazidine results in reduced p - wave duration ( from 106.7 15.8 to 102.2 11.5 ms ; p = 0.006 ) and dispersion ( from 57.2 15.4 to 48.9 10.1 ms ; p < 0.001 ) , with a decrease in left atrial size ( from 41.5 6.7 to 40.3 6.1 mm ; p < 0.001 ) and improved lvef ( from 32.7 6.5 to 37.2 5.5 % ; p = 0.036 ) .
described the effect of trimetazidine on the corrected qt ( qtc ) interval duration in patients with ischaemic chf .
this study included a total of 42 hf patients with nyha class ii and iii , with 20 patients receiving the conventional treatment and 22 subjects receiving an additional 35 mg of trimetazidine two times a day . at baseline ,
the groups did not differ significantly in terms of the qtc intervals ( p = 0.62 ) ; however , after 1 month of treatment , a statistically significant qtc interval reduction was observed only in the trimetazidine group ( 404 36 ms ; p = 0.0002 ) .
cera et al . studied the effects of trimetazidine on the change in qtc duration in chf patients .
the qtc interval was significantly reduced in both groups , qt peak increased only in the control group , tpeak tend dispersion ( tp te d ) decreased only in patients receiving trimetazidine .
based on chf aetiology , tp te d reduction was found to be statistically significant only in patients with underlying ischaemic chf ( 65.00 27.14
vs 36.67 11.55 ms ; p = 0.001 ) .
the authors emphasize that the trimetazidine mechanism of action responsible for this phenomenon is still unknown ; nonetheless , they indicate the possible benefits of trimetazidine in this group of patients , such as a decreased incidence of ventricular arrhythmias .
none of the previous studies answered the question most burning to physicians whether trimetazidine reduces overall mortality in chf patients ; that is , whether it is a drug that may prolong survival .
a post hoc analysis of the villa pinidabruzzo trimetazidine trial showed that , in comparison with conventional therapy alone , the addition of trimetazidine significantly reduced the hospitalization rate due to hf exacerbation ( by 47 % ; p = 0.002 ) and overall mortality ( by 56 % ; p = 0.0047 ) at month 48 of follow - up .
moreover , the trimetazidine group demonstrated improvement in lvef ( p < 0.001 at month 48 of follow - up ) , increased exercise tolerance and reduction in nyha hf class .
however , the study was based on a small group of 61 patients and , therefore , was not powered enough to allow these results to be reliable . in 2011 ,
gao et al . published a meta - analysis which covered 17 randomized studies from the period between 1966 and may 2010 , including a total of 955 patients with chf . in comparison with placebo , trimetazidine administration
was associated with increased exercise tolerance ( weighted mean difference [ wmd ] 30.26 s ; p < 0.01 ) , nyha class reduction ( wmd 0.41 ; p < 0.01 ) , improved lvef in ischaemic hf ( wmd 7.37 % ; p < 0.01 ) and non - ischaemic hf patients ( wmd 8.72 % ; p < 0.01 ) .
moreover , the use of trimetazidine in the group of chf patients reduced the rate of cv events and hospitalizations ( rr 0.42 , 95 % ci 0.300.58 , p < 0.00001 ) , and most importantly , reduction in overall mortality was demonstrated ( rr 0.29 , 95 % ci 0.170.49 , p < 0.00001 ) ( table 2 ) . it must be emphasized that the studies included in that meta - analysis were insufficiently powered to assess the effect of trimetazidine on pre - determined endpoints , and therefore , the results of this meta - analysis must not be considered as decisive .
one year later , zhang et al . presented another meta - analysis on the use of trimetazidine in chf patients .
this time , 16 randomized studies were evaluated , with 884 patients in the study group . like the earlier meta - analysis , this one demonstrated that the use of trimetazidine was associated with improved lvef ( wmd 6.46 % , p < 0.0001 ) , increased exercise tolerance ( wmd 63.75 s , p < 0.0001 ) , reduced nyha class ( wmd 0.57 ; p = 0.0003 ) , decreased lvesv ( wmd 6.67 mm , p < 0.0001 ) and lvedv ( wmd 6.05 mm , p < 0.0001 ) , lowered bnp levels ( wmd 203.40 pg / ml , p = 0.0002 ) , and reduced the rate of cv hospitalization ( rr 0.43 , p = 0.03 ) .
however , no reduction in overall mortality was observed ( rr 0.47 , p = 0.27 ) ( table 2 ) .
this meta - analysis had similar limitations to those of the analysis conducted by gao et al . .
very recently , in march 2013 , fragasso et al . published the results of a large , multicentre , retrospective study , including 669 chf patients ( including 362 patients receiving trimetazidine ) .
a follow - up of 38.76 15.66 months in the trimetazidine group and 40.17 15.53 months in the group receiving conventional therapy alone demonstrated that the addition of trimetazidine versus conventional therapy alone is associated with reduced cv hospitalization rate ( adjusted hazard ratio [ hr ] 0.524 , 95 % ci 0.3520.781 , p = 0.001 ) , cv mortality ( hr 0.072 , 95 % ci 0.0190.268 , p = 0.0001 ) , as well as overall mortality ( hr 0.102 , 95 % ci 0.0460.227 , p = 0.0001 ) ( table 2 ) .table 2major studies with trimetazidine use in chf patientsauthorsyearmaterials and methodsresultsgao et al .
201117 randomized studies from the period between 1966 and may 2010 ; 955 chf patientsin comparison with placebo , the use of trimetazidine results in: increased exercise tolerance ( wmd 30.26 s , p < 0.01), reduced nyha class ( wmd 0.41 , p < 0.01), improved lvef in ischaemic hf ( wmd 7.37 % , p < 0.01 ) and non - ischaemic hf patients ( wmd 8.72 % , p < 0.01), reduced rate of cardiovascular events and hospitalizations ( rr 0.42 , 95 % ci 0.300.58 , p < 0.00001), reduced overall mortality ( rr 0.29 , 95 % ci 0.170.49 , p < 0.00001)zhang et al .
201216 randomized studies ; 884 chf patientstrimetazidine treatment results in: improved ejection fraction ( wmd 6.46 % , p < 0.0001), increased exercise tolerance ( wmd 63.75 s , p < 0.0001), reduced nyha class ( wmd 0.57 , p = 0.0003), decreased lvesv ( wmd 6.67 mm ; p < 0.0001 ) and lvedv ( wmd 6.05 mm , p < 0.0001), lowered bnp levels ( wmd 203.40 pg / ml , p = 0.0002), reduced rate of cardiovascular hospitalization ( rr 0.43 , p = 0.03 ) trimetazidine continues to have no effect on overall mortality ( rr 0.47 , p = 0.27)fragasso et al .
follow - up period : 38.76 15.66 months in the trimetazidine group and 40.17 15.53 months in conventional therapy alone groupaddition of trimetazidine in comparison with the conventional treatment alone is associated with: reduced rate of cardiovascular hospitalization ( adjusted hr 0.524 , 95 % ci 0.3520.781 , p = 0.001), reduced cardiovascular mortality ( hr 0.072 , 95 % ci 0.0190.268 ,
p = 0.0001), reduced overall mortality ( hr 0.102 , 95 % ci 0.0460.227 , p = 0.0001 )
bnp brain natriuretic peptide , chf cardiovascular heart disease , hf heart failure , lvedv left ventricular end - diastolic volume , lvef left ventricular ejection fraction , lvesv left ventricular end - systolic volume , nyha new york heart association , wmd weighted mean difference major studies with trimetazidine use in chf patients
bnp brain natriuretic peptide , chf cardiovascular heart disease , hf heart failure , lvedv left ventricular end - diastolic volume , lvef left ventricular ejection fraction , lvesv left ventricular end - systolic volume , nyha new york heart association , wmd weighted mean difference despite these important results presenting trimetazidine efficacy in chf patients , we can not recommend using trimetazidine in this group of patients as a result of the significant limitations connected with these studies meta - analyses based on unpowered studies and the retrospective character of the analysis by fragasso et al . a well designed , randomized clinical study , placebo - controlled , with well selected endpoints , appropriate patient group , and follow - up duration is still needed to possibly recommend the use of trimetazidine in hf patients .
the benefits of using trimetazidine in peripheral artery disease have not been well documented and are based on individual studies .
several studies have reported a beneficial effect of this drug on extending the intermittent claudication distance [ 5658 ] .
one such study published in 2003 described anti - ischaemic effects of trimetazidine both via coronary vessels ( reduced rate of ischaemic attacks ) , and peripheral vessels ( expressed exactly in the extended distance of intermittent claudication ) .
the same effect was described by other authors in 2006 ; they observed a longer pain - free walking distance during an exercise test on ranolazine treatment .
, 100 patients with intermittent claudication randomized to receive trimetazidine or placebo with a subsequent 3-month follow - up were included . during the study ,
the patients exercised regularly , and the assessment was based on measuring the length of maximal walking distance ( mwd ) and the assessment of ankle - brachial index ( abi ) , which were measured at baseline and after 3 months of treatment . in a comparison of the trimetazidine and placebo groups , the groups did not differ at baseline or at 3 months of follow - up in terms of abi ( 0.83 0.04 vs 0.85 0.03 ) , while the value of mwd at 3 months of treatment was decisively greater in the group receiving trimetazidine ( 23 vs 14 % , p < 0.0001 ) .
however , the study was based on a relatively small group of patients ( although larger than in the previous reports ) and the follow - up period was insufficient to unequivocally confirm beneficial effects of trimetazidine in this group of patients . on the other hand , however , that study was the stepping stone to further trials on a larger group of patients , with a longer follow - up , to finally evaluate the potential role of trimetazidine in patients with atherosclerotic lesions in peripheral arteries . among other interesting studies on peripheral arteries ,
one noteworthy trial was conducted on an animal model , which demonstrated a protective effect of trimetazidine on retinal cells during ischaemia .
the authors showed that the thickness of the overall retina from the outer to the inner limiting membrane and outer retinal layers was significantly greater after 15 and 30 days of reperfusion in those rats that were treated with trimetazidine before the retinal ischaemia incident , induced by increasing intraocular pressure to 160 mmhg for 60 minutes .
moreover , there has been a recent study suggesting , based on experiments in diabetic rats , that the use of trimetazidine may decrease the intima - media ratio ( imr ) in the carotid artery after only 4 weeks of treatment , and this effect was dose - dependent . in comparison with the control group , trimetazidine at 20 mg / kg / day caused a greater imr reduction than at 10 mg / kg / day ( p = 0.046 and p = 0.002 , respectively ) .
moreover , trimetazidine was demonstrated to reduce the incidence of restenosis , via reduced smooth muscle cell proliferation and enhanced rate of endothelialization following a carotid artery injury due to balloon expansion during angioplasty , with the proliferation index of 34.2 4.1 % in the control group , 29.4 2.0 % in the trimetazidine 10 mg group , and 15.4 3.2 % in the trimetazidine 20 mg group ( p < 0.01 ) .
based on these limited data , trimetazidine still can not be recommended or any conclusion drawn as to its effectiveness in the treatment of peripheral artery disease . nonetheless , these results are promising and they offer hope that some patients with peripheral artery disease could also benefit from this drug ; however , this requires conducting further , large , and carefully designed studies .
trimetazidine has been generally very well tolerated in clinical trials and usually only isolated cases of adverse events ( adrs adverse drug reactions ) were observed during trimetazidine treatment ( mainly gastrointestinal disturbances , vomiting , nausea ) .
some other very rare and reversible adverse effects have also been described , such as thrombocytopenia , agranulocytosis and liver dysfunction .
most of them were not considered to be directly related to trimetazidine . however , some recently reported adrs require careful evaluation in longer follow - up .
the main identified trimetazidine - induced serious adr is connected to parkinson syndrome and related symptoms ( tremor ) . according to available data
, trimetazidine may worsen previously diagnosed parkinson s disease and gait disorders in some patients . in the study of mart mass et al .
, in 56 of the 130 patients who were treated with trimetazidine ( 43 % ) , an adverse effect on motor function was detected that had been induced or aggravated by one of the withdrawn drugs .
drug - induced parkinsonism was detected in 20 of these patients ( 10 patients were being treated with trimetazidine only , while the remaining 10 were simultaneously receiving other drugs potentially capable of inducing parkinsonism ) .
treatment with trimetazidine worsened previously diagnosed parkinson s disease in 12 patients , and gait disorders coupled with disequilibrium was observed in 15 patients .
the risk related to parkinson syndrome that has been identified in the postmarketing setting and in literature is based on positive dechallenge of parkinson symptoms after the withdrawal of trimetazidine only , positive rechallenge , essentially higher co - prescription of antiparkinson drugs in trimetazidine group compared with control group and significantly higher number of patients that begin antiparkinson drugs after the introduction of trimetazidine compared with control group .
it is worth emphasizing that extrapyramidal symptoms reported in patients receiving trimetazidine have a very low prevalence ( incidence of 0.36/100,000 person - years ) and are generally reversible after trimetazidine withdrawal . according to the european medicines agency ( ema ) ,
if trimetazidine - related parkinsonian symptoms persist more than 4 months after drug discontinuation , a neurologist s opinion should be sought .
parkinsonian symptoms ( tremor , akinesia , hypertonia ) should be regularly investigated , especially in elderly patients on trimetazidine .
patients receiving the treatment over a very long time , mainly in cardiology indications , aged more than 75 years old are from the group at the highest risk of this complication occurrence .
they may have increased trimetazidine exposure due to age - related decrease in renal function . in patients with severe renal impairment ( creatinine clearance < 30 ml / min ) , trimetazidine should not be used .
the european society of cardiology ( esc ) guidelines of 2013 take into consideration the possibility of using trimetazidine as treatment for stable coronary artery disease however , this is a iib recommendation .
the current recommendations do not consider this treatment in other cardiovascular diseases , such as chf , acute coronary syndromes [ 65 , 66 ] , or peripheral artery disease .
the most documented effect of trimetazidine has been in stable coronary artery disease , which has been demonstrated by inclusion of this drug into the recommendations , as well as in both diabetic and ischaemic chf , which still requires confirmation in large clinical studies .
there are still no answers to key questions as to the role of this drug in selected cardiovascular conditions as well as whether this drug can reduce mortality in any group of patients with cardiovascular disease [ 6872 ] .
Output:
| trimetazidine is a cytoprotective drug whose cardiovascular effectiveness , especially in patients with stable ischemic heart disease , has been the source of much controversy in recent years ; some have gone so far as to treat the medication as a
placebo drug whose new side effects , such as parkinsonian symptoms , outweigh its benefits .
this article is an attempt to present the recent key studies , including meta - analyses , on the use of trimetazidine in chronic heart failure , also in patients with diabetes mellitus and arrhythmia , as well as in peripheral artery disease .
this paper also includes the most recent european society of cardiology guidelines , including those of 2013 , on the use of trimetazidine in cardiovascular disease . |
PubmedSumm6832 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the major histocompatibility complex class i chain related a ( mica ) and micb molecules are ligands of nkg2d receptors on natural killer ( nk ) cells , gamma / delta t cells , nkt cells , and cd8a t cells , and mediate antitumor immune responses by stimulating innate and adaptive immune surveillance [ 13 ] .
several polymorphisms have been reported for mica and micb coding and noncoding sequences , located within the mhc class i region close to the tumor necrosis factor gene [ 4 , 5 ] . the mica - tm microsatellite polymorphism is present in exon 5 with eight alleles ( a4 , a5 , a5.1 , a6 , a7 , a8 , a9 , and a10 ) , while the micb gene contains a microsatellite polymorphism named c1_2_a in intron 1 comprising 16 alleles [ 6 , 7 ] .
different mica molecules were reported to vary in their affinities to soluble nkg2d receptors , which may influence antitumor immune responses [ 5 , 8 ] .
recent studies have shown increased serum levels of soluble mica molecules in patients with various malignancies with a correlation to advanced tumor stages . circulating tumor - derived soluble mica molecules
induce downregulation of nkg2d receptors on natural killer cells and thereby decrease responsiveness of tumor - antigen - specific effector t cells .
the mechanism of t and nk cell silencing by down regulation of nkgd cells induced by soluble ligands or chronic exposure to cell surface bound ligands may represent an important mechanism for tumor cells to escape host antitumor immune responses .
some reports have indicated associations of specific mica alleles with epithelial tumors of the nasopharynx and gastric mucosa , with hematopoetic neoplasia and with chronic inflammatory and autoimmune disorders [ 1115 ] .
the allele and genotype frequencies of mica - tm and micb c1_2_a microsatellite polymorphisms in patients with colorectal cancer and a possible immunogenetic predisposition for the development of colorectal cancer or tumor progression have not yet been investigated .
we have therefore analyzed the mica - tm and micb c1_2_a polymorphisms in samples of normal colon mucosa and tumor tissue from colorectal cancer patients in comparison to a cohort of healthy controls and investigated possible correlations to tumor characteristics and disease progression .
2002 according to the principles of oncologic surgery , and tumors were classified according to tnm / uicc criteria following histopathological examination .
mean age was 67.4 10.9 years ( range , 3488 years ) , 52.5% of the patients were male and 47.5% female .
eleven patients with clinical evidence for hereditary nonpolyposis colon cancer according to bethesda criteria were analyzed separately for microsatellite instability to investigate a possible correlation of the dna replication error pathway with alterations in host antitumor immunity .
primary tumors were localized in the colon ( n = 54 ) and rectum ( n = 25 ) .
twenty - three patients had uicc stage iv tumors with distant metastasis localized in the liver ( n = 12 ) , lungs ( n = 6 ) , peritoneum ( n = 4 ) , or at multiple sites ( n = 4 ) . results of lymph node involvement ( n - classification ) were included in the study , when at least 12 lymph nodes were removed and histopathologically examined .
frequencies of mica - tm and micb c1_2_a polymorphisms in colorectal cancer patients were compared to a previously analyzed cohort of healthy controls ( n = 306 ) .
the study was approved by the local ethics committee , and patients ' informed consent was obtained .
postoperative follow - up was performed according to the recommendations of the munich cancer center and prospectively documented in an institutional data base .
follow - up intervals were initially every 6 months for 2 years , then yearly for up to the sixth year and at 2-year intervals for up to 10 years , including clinical examination , determination of carcinoembryonic antigen levels , upper abdomen sonography , abdominal ct scan , and total colonoscopy .
rectoscopy was performed in patients with rectal cancer or with an anastomosis below 12 cm as measured from the anocutanous line .
only patients with complete histopathological examination according to the tnm / uicc criteria and prospective follow - up were considered for analysis of survival times .
mean follow - up sd was 56.2 36.3 months ( range , 1106 months ) .
mica - tm and micb c1_2_a polymorphisms were genotyped in genomic dna isolated from normal colonic mucosa and colorectal tumor tissue , respectively .
allele frequencies of mica - tm and micb c1_2_a polymorphisms were compared to a group of 306 healthy control persons , analyzed previously ( mean age , 62.8 11.8 years ; sampling period jan .
the mica - tm polymorphism was analyzed by polymerase chain reaction ( pcr ) amplification with the primers 5-cagagtcattggcagaca-3 ( 5-fam - labeled ) and 5-ttcttcttacaacaacggac-3. the pcr products were separated by electrophoresis on denaturating 6% 0.3-mm polyacrylamide gels in the alfexpress sequencer ( amersham pharmacia , uppsala , sweden ) .
the segregation of the mica - tm alleles was controlled in 20 hla - a , b , dr - typed families .
as internal standards , a 73-bp pcr product from the transforming growth factor receptor ii and alfexpress sizer 150 for micb c1_2_a were used , respectively .
micb c1_2_a alleles of interest , including the gold standards , were sequenced either directly as pcr products or after subcloning into the vector pcr2.1 ( invitrogen ) . for sequence analysis of micb c1_2_a microsatellite
, alleles were amplified with the primers 5-ccatagtgttttccattgcaggc-3 and 5-agccatgagaagctatgtgggg-3. the pcr products were purified using a qia quick pcr purification kit ( qiagen , hilden , germany ) and were sequenced using the abi prism dye terminator cycle sequencing kit on an abi 373 dna sequencer .
analysis of tumor microsatellite instability ( min ) was performed using the microsatellite markers bat26 , bat40 , tgfbr2(a)10 , bax(g)8 , and the dinucleotide repeat mfd15 ( d17s250 ) , with modifications according to the meeting report of the national cancer institute workshop on microsatellite instability .
tumors exhibiting instability at 01 loci analyzed were considered as presenting low min and at 2 loci as high microsatellite instability ( min - h ) .
tumor dna was screened for kras mutations in codon 12 ( glycine , ggt ) by primer - mediated restriction fragment length polymorphism ( rflp ) analysis .
the primers used were actgaatataaacttgtggtagttggacct and tcatgaaaatggtcagagaa , the underlined base within the forward primer introduces a bstn i restriction site in the amplified wild - type sequence .
the colon carcinoma cell line sw480 carrying a homozygous val mutation at codon 12 was used as a positive control for rflp analysis .
additionally , all tumor dna samples displaying mutated kras sequences at codon 12 in rflp analysis were further analyzed by sequencing in order to confirm to results of rflp analysis and to determine which mutation was present . for sequence analysis ,
haplotype gene frequencies were determined by gene counting assuming homozygosity , if at a given locus only one allele could be identified .
correlations to histopathological parameters were performed comparing mica - tm and micb c1_2_a alleles with tumor invasion , lymph node involvement , presence of distant metastasis , and uicc stages .
statistical significance for the two - point associations was tested by chi - square calculation in the 2 2 table and pearsons coefficient , fisher 's exact test ( two - sided ) or phi coefficient was used , when appropriate .
meier curves , and the log rank test was used for statistical analysis and comparison of different variables . for multivariate analysis , cox regression analysis was performed using the wald test for comparison of variables .
2002 according to the principles of oncologic surgery , and tumors were classified according to tnm / uicc criteria following histopathological examination .
mean age was 67.4 10.9 years ( range , 3488 years ) , 52.5% of the patients were male and 47.5% female .
eleven patients with clinical evidence for hereditary nonpolyposis colon cancer according to bethesda criteria were analyzed separately for microsatellite instability to investigate a possible correlation of the dna replication error pathway with alterations in host antitumor immunity .
primary tumors were localized in the colon ( n = 54 ) and rectum ( n = 25 ) .
twenty - three patients had uicc stage iv tumors with distant metastasis localized in the liver ( n = 12 ) , lungs ( n = 6 ) , peritoneum ( n = 4 ) , or at multiple sites ( n = 4 ) . results of lymph node involvement ( n - classification ) were included in the study , when at least 12 lymph nodes were removed and histopathologically examined .
frequencies of mica - tm and micb c1_2_a polymorphisms in colorectal cancer patients were compared to a previously analyzed cohort of healthy controls ( n = 306 ) .
the study was approved by the local ethics committee , and patients ' informed consent was obtained .
postoperative follow - up was performed according to the recommendations of the munich cancer center and prospectively documented in an institutional data base .
follow - up intervals were initially every 6 months for 2 years , then yearly for up to the sixth year and at 2-year intervals for up to 10 years , including clinical examination , determination of carcinoembryonic antigen levels , upper abdomen sonography , abdominal ct scan , and total colonoscopy .
rectoscopy was performed in patients with rectal cancer or with an anastomosis below 12 cm as measured from the anocutanous line .
only patients with complete histopathological examination according to the tnm / uicc criteria and prospective follow - up were considered for analysis of survival times .
mean follow - up sd was 56.2 36.3 months ( range , 1106 months ) .
mica - tm and micb c1_2_a polymorphisms were genotyped in genomic dna isolated from normal colonic mucosa and colorectal tumor tissue , respectively .
allele frequencies of mica - tm and micb c1_2_a polymorphisms were compared to a group of 306 healthy control persons , analyzed previously ( mean age , 62.8 11.8 years ; sampling period jan .
the mica - tm polymorphism was analyzed by polymerase chain reaction ( pcr ) amplification with the primers 5-cagagtcattggcagaca-3 ( 5-fam - labeled ) and 5-ttcttcttacaacaacggac-3. the pcr products were separated by electrophoresis on denaturating 6% 0.3-mm polyacrylamide gels in the alfexpress sequencer ( amersham pharmacia , uppsala , sweden ) .
the segregation of the mica - tm alleles was controlled in 20 hla - a , b , dr - typed families .
as internal standards , a 73-bp pcr product from the transforming growth factor receptor ii and alfexpress sizer 150 for micb c1_2_a were used , respectively .
micb c1_2_a alleles of interest , including the gold standards , were sequenced either directly as pcr products or after subcloning into the vector pcr2.1 ( invitrogen ) . for sequence analysis of micb c1_2_a microsatellite
, alleles were amplified with the primers 5-ccatagtgttttccattgcaggc-3 and 5-agccatgagaagctatgtgggg-3. the pcr products were purified using a qia quick pcr purification kit ( qiagen , hilden , germany ) and were sequenced using the abi prism dye terminator cycle sequencing kit on an abi 373 dna sequencer .
analysis of tumor microsatellite instability ( min ) was performed using the microsatellite markers bat26 , bat40 , tgfbr2(a)10 , bax(g)8 , and the dinucleotide repeat mfd15 ( d17s250 ) , with modifications according to the meeting report of the national cancer institute workshop on microsatellite instability .
tumors exhibiting instability at 01 loci analyzed were considered as presenting low min and at 2 loci as high microsatellite instability ( min - h ) .
tumor dna was screened for kras mutations in codon 12 ( glycine , ggt ) by primer - mediated restriction fragment length polymorphism ( rflp ) analysis .
the primers used were actgaatataaacttgtggtagttggacct and tcatgaaaatggtcagagaa , the underlined base within the forward primer introduces a bstn i restriction site in the amplified wild - type sequence .
the colon carcinoma cell line sw480 carrying a homozygous val mutation at codon 12 was used as a positive control for rflp analysis .
additionally , all tumor dna samples displaying mutated kras sequences at codon 12 in rflp analysis were further analyzed by sequencing in order to confirm to results of rflp analysis and to determine which mutation was present . for sequence analysis
haplotype gene frequencies were determined by gene counting assuming homozygosity , if at a given locus only one allele could be identified .
correlations to histopathological parameters were performed comparing mica - tm and micb c1_2_a alleles with tumor invasion , lymph node involvement , presence of distant metastasis , and uicc stages . statistical significance for the two - point associations
was tested by chi - square calculation in the 2 2 table and pearsons coefficient , fisher 's exact test ( two - sided ) or phi coefficient was used , when appropriate .
meier curves , and the log rank test was used for statistical analysis and comparison of different variables . for multivariate analysis , cox regression analysis was performed using the wald test for comparison of variables .
allele frequencies of mica - tm and micb c1_2_a in colorectal cancer patients did not differ compared to a cohort of healthy control individuals ( table i ) .
homozygosity was most frequently observed in colorectal cancer patients for the mica - tm a5.1 allele ( n = 13 ; 16.4% of all patients ) and for the micb c1_2_a ca15 allele ( n = 4 ; 5.1% of all patients ) .
nonsignificant trends were observed in our cohort regarding an increased micb c1_2_a ca15 allele frequency ( 19.2% vs 10.5% ) and a reduced ca17 allele frequency ( 11.4% vs 20.3% ) in comparison to the control group .
table iallele frequencies ( in % ) of microsatellites mica - tm and micb c1_2_a in colorectal cancer patients and control persons colorectal cancer patients ( n = 79)controls ( n = 306)mica - tm allele a411.911.7 a510.613.6 a5.143.137.0 a621.922.4 a912.515.3micb c1_2_a allele ca1416.618.5 ca1519.210.5 ca16n.d.0.2 ca1711.420.3 ca188.37.2 ca193.1.1.1 ca203.74.1 ca218.08.9 ca224.37.2 ca235.65.9 ca2414.810.9 ca254.83.9 ca26n.d.0.8 ca27n.d.0.5allele frequencies of control persons were reported in n.d .
not detected in our patients ' cohort allele frequencies ( in % ) of microsatellites mica - tm and micb c1_2_a in colorectal cancer patients and control persons allele frequencies of control persons were reported in n.d .
not detected in our patients ' cohort mica - tm and micb c1_2_a alleles were investigated for possible correlation to various tumor - associated variables , including tumor invasion , lymph node involvement , presence of distant metastasis , uicc stages , microsatellite instability , and detection of kras mutations ( codon 12 ) . as shown in table ii , the mica - tm a4 allele was associated with the presence of distant metastasis ( p = 0.023 ) .
the presence of the mica - tm a5 allele showed an inverse association to lymph node involvement ( p = 0.015 ) , presence of distant metastasis ( p = 0.048 ) , and advanced uicc stages ( p = 0.003 ) .
the analysis of micb c1_2_a alleles showed an association of the ca14 allele with the presence of distant metastasis ( p = 0.045 ) and of the ca21 allele with advanced uicc stages ( p = 0.047 ) .
table iicomparison of mica - tm allele frequencies with tumor - associated clinicopathological parameterstumor classificationmica - tm allelea4a5a5.1a6a9tumor invasion t1/23/173/1712/177/173/17 t3/411/448/4432/4418/4411/44lymph node involvement n09/5111/5139/5120/5111/51 n1 - 35/100/106/105/103/10distant metastasis m08/4712/4735/4717/4711/47 m110/231/2314/2311/233/23uicc stages uicc i / ii4/3010/3022/3011/305/30 uicc iii / iv14/392/3926/3917/399/39p < 0.05p < 0.023p < 0.048p < 0.02 comparison of mica - tm allele frequencies with tumor - associated clinicopathological parameters a trend for an increased frequency of the micb c1_2_a ca21 allele was observed in patients with colorectal tumors showing high microsatellite instability as defined by different lengths of pcr products in more than two markers ( p = 0.047 ; table iii ) .
mutations in the kras oncogene were detected in 17 colorectal cancer samples ( 20.9% ) .
the kras codon 12 mutation in tumor dna samples were determined by sequencing the pcr - generated fragment , and the following mutations ( 12c : n = 3 ; 12d : n = 4 ; 12 v : n = 7 ; 12 s : n = 2 ) were detected .
no correlation of mica - tm alleles with the presence of kras mutations was seen in the investigated colorectal cancer patients . for micb
c1_2_a alleles , only a trend toward an association with kras mutations was observed for the ca 23 allele ( p = 0.087 )
.
table iiimica - tm and micb c1_2_a polymorphisms in colorectal cancer patients with regard to tumor microsatellite stability or kras codon 12 mutationsmica - tm / micb c1_2_atumor - related parametersallele frequenciesmin ( n = 17)min - h ( n = 10)kras mutations ( n = 17)mica - tm allele a46/214/214/21 a53/143/143/14 a5.110/567/569/56 a66/323/329/32 a94/162/165/16micb c1_2_a allele ca147/243/243/24 ca154/283/284/28 ca16n.d.n.d.n.d
. ca172/171/173/17 ca182/111/113/11 ca191/51/51/5 ca201/60/61/6 ca215/134/13 * 4/13 ca222/71/73/7 ca231/90/94/9 ca244/244/244/24 ca251/60/63/6 ca26n.d.n.d.n.d .
ca27n.d.n.d.n.d.microsatellite instability ( min ) was defined as altered lengths of pcr products typing five defined mono- and dinucleotide repeat markers .
tumor min was considered when at least one repeat locus showed altered length and high microsatellite instability ( min - h ) when two or more microsatellite markers showed tumor dna replication errors . for analysis ,
only mica - tm and micb c1_2_a allele frequencies > 5% were considered*p = 0.047 mica - tm and micb c1_2_a polymorphisms in colorectal cancer patients with regard to tumor microsatellite stability or kras codon 12 mutations microsatellite instability ( min ) was defined as altered lengths of pcr products typing five defined mono- and dinucleotide repeat markers .
tumor min was considered when at least one repeat locus showed altered length and high microsatellite instability ( min - h ) when two or more microsatellite markers showed tumor dna replication errors .
for analysis , only mica - tm and micb c1_2_a allele frequencies > 5% were considered overall survival was analyzed in 61 patients with sporadic colorectal carcinomas , followed and documented prospectively in an institutional data base .
tumor - related postoperative survival was 86.0 4.4 months for patients following complete tumor resection ( r0-status ; n = 45 ) and 29.8 8.4 months for patients with tumor infiltrated resection margins or remaining distant metastasis ( n = 25 ; p < 0.001 ) .
survival in the study cohort was related to classical parameters of tumor progression like lymph node involvement ( p = 0.005 ) and uicc stages ( p = 0.001 ) according to univariate analysis , as shown in table iv .
further analysis indicated significantly shorter survival times in patients positive for the mica - tm a4 allele ( negative vs positive , 80.6 vs 51.9 months ; p = 0.015 , fig . 1 ) .
estimated 5-year survival times were 75% and 43% for mica - tm a4 negative and positive patients , respectively .
multivariate analysis using the cox regression model after exclusion of the variable metastatic disease indicated that presence of mica - tm a4 allele ( hr , 2.71 ; 95% ci , 1.136.49 ; p = 0.025 ) and the tumor - related nodal status ( hr , 3.99 ; 95% ci , 1.619.86 ; p
table ivsurvival of colorectal cancer patientstumor - related parameterssurvival times ( mean sd ; months)(95% confidence interval)p valuetumor invasion t1/2 ( n = 13)85.0 9.6(66.2103.9)0.113 t3/4 ( n = 48)69.0 6.0(57.180.8)lymph node involvement n0 ( n = 34)88.8 5.4(78.199.4)0.005 n1 ( n = 18)65.3 8.9(47.782.8 ) n2 ( n = 9)25.9 5.2(6.944.9)uicc stages uicc i / ii ( n = 30)93.9 4.8(84.4103.4 ) uicc iii / iv ( n = 31)52.7 7.3(38.367.0)<0.001a4 no ( n = 47)80.6 5.6(69.791.6 ) yes (
n = 14)51.9 10.9(30.573.2)0.015a5 no ( n = 47)56.0 6.1(56.080.2 ) yes ( n = 14)87.4 6.3(75.099.7)0.074a5.1 no ( n = 19)65.2 9.8(45.984.5 ) yes ( n = 42)75.2 5.7(63.986.6)0.257a9 no (
n = 48)75.9 5.5(65.086.8 ) yes ( n = 13)59.5 10.6(38.780.3)0.106ca24 no ( n = 42)66.7 6.1(54.778.7 ) yes ( n = 19)84.3 8.6(67.4101.3)0.108microsatellite instability ( 1 marker ) no (
n = 54)71.7 5.7(60.483.0 ) yes ( n = 7)82.2 9.5(63.6100.9)0.410kras codon 12 mutations no ( n = 44)78.7 6.0(66.990.4 ) yes (
n = 17)58.7 9.5(40.077.5)0.093univariate analysis of tumor - related survival times of patients with indicated clinicopathological parameters and selected mica - tm ( a4 , a5 , a5.1 , a9 ) and micb c1_2_a ( ca24 ) alleles in patients with colorectal cancer ( n = 61 ) .
kaplan meier analysis and the log rank test were used for comparisons and statistical evaluationfig .
kaplan meier analysis of tumor - related survival times in association with mica - tm a4 allele in patients with colorectal cancer .
short vertical lines indicate censored observations for comparison of patients without ( n = 46 ) and with mica - tm a4 allele ( n = 15 , p = 0.015 ) survival of colorectal cancer patients univariate analysis of tumor - related survival times of patients with indicated clinicopathological parameters and selected mica - tm ( a4 , a5 , a5.1 , a9 ) and micb c1_2_a ( ca24 ) alleles in patients with colorectal cancer ( n = 61 ) .
meier analysis and the log rank test were used for comparisons and statistical evaluation survival analysis in relation to mica - tm a4 allele haplotype .
kaplan meier analysis of tumor - related survival times in association with mica - tm a4 allele in patients with colorectal cancer .
short vertical lines indicate censored observations for comparison of patients without ( n = 46 ) and with mica - tm a4 allele ( n = 15 , p = 0.015 ) we have further analyzed survival times in patients with microsatellite stable tumors ( n = 54 ) . as shown in fig .
2 , prognostic relevance of mica - tm a4 was even more evident in microsatellite stable tumors ( p = 0.006 ) in comparison to the other known prognostic variables such as lymph node involvement ( p = 0.001 ) and uicc classification ( p < 0.001 , table
, mica - tm a9 was associated with reduced survival times ( p = 0.034 ) in microsatellite stable colorectal cancer patients , while the mica - tm a5 was inversely associated with a better prognosis ( p = 0.042 ) , providing evidence for a tumor suppressive effect of the mica - tm a5 allele ( table v ) .
further combined analysis of colorectal cancer patients with mica - tm alleles positive for either a4 or a9 vs patients negative for both a4 and a9 alleles had markedly reduced survival times , as shown in fig .
3 ( p < 0.001 ) , with an estimated 5-year survival of 36% vs 85% , respectively . multivariate analysis by cox regression with inclusion of the variables mica - tm a4 , a5 , a9 , lymph node involvement , uicc stages , metastatic disease , and mica - tm a4 or a9 positive indicated that metastatic disease ( hr , 4.43 ; 95% ci , 1.6611.81 ; p = 0.003 ) , lymph node involvement ( hr , 3.27 ; 95% ci , 1.149.30 ; p = 0.026 ) and mica - tm a4 or a9 positive ( hr , 4.02 ; 95% ci , 1.2912.56 ; p
= 0.016 ) were of independent prognostic relevance in patients with microsatellite stable colorectal tumors .
kaplan meier analysis of tumor - related survival times in association with mica - tm a4 allele in patients with microsatellite stable colorectal cancer .
vertical lines indicate censored observations for comparison of patients without ( n = 42 ) and with mica - tm a4 allele ( n = 12 , p = 0.006 ) . the estimated 5-year survival rate was 72% vs 38% , respectivelytable vsurvival of patients with microsatellite stable colorectal cancertumor - related parameterssurvival times ( mean sd ; months)(95% confidence interval)p valuetumor invasion t1/2 ( n = 12)81.8 11.4(59.5104.2)0.209 t3/4 ( n = 42)67.4 5.8(54.580.3)lymph node involvement n negative ( n = 28)89.9 6.0(78.1101.7)0.001 n positive ( n = 26)48.6 7.9(33.164.1)uicc stages uicc i / ii ( n = 24)96.7 4.9(87.0106.4)<0.001 uicc iii /
( n = 38)86.7 5.4(76.097.4)<0.001 m1 ( n = 16)38.0 9.5(19.465.7)a4 no ( n = 42)79.1 6.0(67.291.0)0.006 yes ( n = 12)46.4 12.1(22.570.3)a5 no ( n = 42)65.3 6.6(52.478.3)0.042 yes ( n = 12)88.4 7.1(74.3102.5)a5.1 no ( n = 16)62.7 10.89(41.484.1)0.236 yes ( n = 38)73.3 6.3(60.985.8)a9 no ( n = 43)75.7 6.0(63.887.6)0.034 yes ( n = 11)51.4 10.9(30.072.8)ca24 no ( n = 37)64.8 6.6(51.777.9)0.156 yes ( n = 11)81.9 9.5(63.2100.6)kras codon 12 mutations no ( n = 39)77.2 6.5(64.490.0)0.121 yes (
n = 15)54.5 10.5(33.975.1)univariate analysis of tumor - related survival times of patients with microsatellite stable ( min negative ) colorectal cancer and selected mica - tm ( a4 , a5 , a5,1 , a9 ) and micb c1_2_a ( ca24 )
alleles in association with indicated clinicopathological parameters ( n = 54 ) . kaplan
meier analysis and the log rank test were used for comparisons and statistical evaluationfig .
3mica - tm a4 or a9 haplotype in microsatellite stable colorectal cancer patients . kaplan
meier analysis of tumor - related survival times in association with mica - tm a4 or a9 alleles in patients with microsatellite stable colorectal cancer .
vertical lines indicate censored observations for comparison of patients either positive for mica - tm a4 or a9 alleles ( n = 23 ) in comparison to patients without mica - tm a4 and a9 alleles ( n = 31 , p 0.001 ) mica - tm a4 allele detection in microsatellite stable colorectal cancer patients .
kaplan meier analysis of tumor - related survival times in association with mica - tm a4 allele in patients with microsatellite stable colorectal cancer .
vertical lines indicate censored observations for comparison of patients without ( n = 42 ) and with mica - tm a4 allele ( n = 12 , p = 0.006 ) .
the estimated 5-year survival rate was 72% vs 38% , respectively survival of patients with microsatellite stable colorectal cancer univariate analysis of tumor - related survival times of patients with microsatellite stable ( min negative ) colorectal cancer and selected mica - tm ( a4 , a5 , a5,1 , a9 ) and micb c1_2_a ( ca24 ) alleles in association with indicated clinicopathological parameters ( n = 54 ) .
meier analysis and the log rank test were used for comparisons and statistical evaluation mica - tm a4 or a9 haplotype in microsatellite stable colorectal cancer patients .
meier analysis of tumor - related survival times in association with mica - tm a4 or a9 alleles in patients with microsatellite stable colorectal cancer .
vertical lines indicate censored observations for comparison of patients either positive for mica - tm a4 or a9 alleles ( n = 23 ) in comparison to patients without mica - tm a4 and a9 alleles ( n = 31 , p 0.001 )
allele frequencies of mica - tm and micb c1_2_a in colorectal cancer patients did not differ compared to a cohort of healthy control individuals ( table i ) .
homozygosity was most frequently observed in colorectal cancer patients for the mica - tm a5.1 allele ( n = 13 ; 16.4% of all patients ) and for the micb c1_2_a ca15 allele ( n = 4 ; 5.1% of all patients ) .
nonsignificant trends were observed in our cohort regarding an increased micb c1_2_a ca15 allele frequency ( 19.2% vs 10.5% ) and a reduced ca17 allele frequency ( 11.4% vs 20.3% ) in comparison to the control group .
table iallele frequencies ( in % ) of microsatellites mica - tm and micb c1_2_a in colorectal cancer patients and control persons colorectal cancer patients ( n = 79)controls ( n = 306)mica - tm allele a411.911.7 a510.613.6 a5.143.137.0 a621.922.4 a912.515.3micb c1_2_a allele ca1416.618.5 ca1519.210.5 ca16n.d.0.2 ca1711.420.3 ca188.37.2 ca193.1.1.1 ca203.74.1 ca218.08.9 ca224.37.2 ca235.65.9 ca2414.810.9 ca254.83.9 ca26n.d.0.8 ca27n.d.0.5allele frequencies of control persons were reported in n.d .
not detected in our patients ' cohort allele frequencies ( in % ) of microsatellites mica - tm and micb c1_2_a in colorectal cancer patients and control persons allele frequencies of control persons were reported in n.d .
mica - tm and micb c1_2_a alleles were investigated for possible correlation to various tumor - associated variables , including tumor invasion , lymph node involvement , presence of distant metastasis , uicc stages , microsatellite instability , and detection of kras mutations ( codon 12 ) .
as shown in table ii , the mica - tm a4 allele was associated with the presence of distant metastasis ( p = 0.023 ) .
the presence of the mica - tm a5 allele showed an inverse association to lymph node involvement ( p = 0.015 ) , presence of distant metastasis ( p = 0.048 ) , and advanced uicc stages ( p = 0.003 ) .
the analysis of micb c1_2_a alleles showed an association of the ca14 allele with the presence of distant metastasis ( p = 0.045 ) and of the ca21 allele with advanced uicc stages ( p = 0.047 ) .
table iicomparison of mica - tm allele frequencies with tumor - associated clinicopathological parameterstumor classificationmica - tm allelea4a5a5.1a6a9tumor invasion t1/23/173/1712/177/173/17 t3/411/448/4432/4418/4411/44lymph node involvement n09/5111/5139/5120/5111/51 n1 - 35/100/106/105/103/10distant metastasis m08/4712/4735/4717/4711/47 m110/231/2314/2311/233/23uicc stages uicc
i / ii4/3010/3022/3011/305/30 uicc iii / iv14/392/3926/3917/399/39p < 0.05p < 0.023p < 0.048p < 0.02 comparison of mica - tm allele frequencies with tumor - associated clinicopathological parameters
a trend for an increased frequency of the micb c1_2_a ca21 allele was observed in patients with colorectal tumors showing high microsatellite instability as defined by different lengths of pcr products in more than two markers ( p = 0.047 ; table iii ) .
mutations in the kras oncogene were detected in 17 colorectal cancer samples ( 20.9% ) .
the kras codon 12 mutation in tumor dna samples were determined by sequencing the pcr - generated fragment , and the following mutations ( 12c : n = 3 ; 12d : n = 4 ; 12 v : n = 7 ; 12 s : n = 2 ) were detected .
no correlation of mica - tm alleles with the presence of kras mutations was seen in the investigated colorectal cancer patients . for micb
c1_2_a alleles , only a trend toward an association with kras mutations was observed for the ca 23 allele ( p = 0.087 ) .
table iiimica - tm and micb c1_2_a polymorphisms in colorectal cancer patients with regard to tumor microsatellite stability or kras codon 12 mutationsmica - tm / micb c1_2_atumor - related parametersallele frequenciesmin ( n = 17)min - h ( n = 10)kras mutations ( n = 17)mica - tm allele a46/214/214/21 a53/143/143/14 a5.110/567/569/56 a66/323/329/32 a94/162/165/16micb c1_2_a allele ca147/243/243/24 ca154/283/284/28 ca16n.d.n.d.n.d .
ca172/171/173/17 ca182/111/113/11 ca191/51/51/5 ca201/60/61/6 ca215/134/13 * 4/13 ca222/71/73/7 ca231/90/94/9 ca244/244/244/24 ca251/60/63/6 ca26n.d.n.d.n.d . ca27n.d.n.d.n.d.microsatellite instability ( min ) was defined as altered lengths of pcr products typing five defined mono- and dinucleotide repeat markers .
tumor min was considered when at least one repeat locus showed altered length and high microsatellite instability ( min - h ) when two or more microsatellite markers showed tumor dna replication errors . for analysis ,
only mica - tm and micb c1_2_a allele frequencies > 5% were considered*p = 0.047 mica - tm and micb c1_2_a polymorphisms in colorectal cancer patients with regard to tumor microsatellite stability or kras codon 12 mutations microsatellite instability ( min ) was defined as altered lengths of pcr products typing five defined mono- and dinucleotide repeat markers .
tumor min was considered when at least one repeat locus showed altered length and high microsatellite instability ( min - h ) when two or more microsatellite markers showed tumor dna replication errors . for analysis , only mica - tm and micb c1_2_a allele frequencies > 5% were considered
overall survival was analyzed in 61 patients with sporadic colorectal carcinomas , followed and documented prospectively in an institutional data base .
tumor - related postoperative survival was 86.0 4.4 months for patients following complete tumor resection ( r0-status ; n = 45 ) and 29.8 8.4 months for patients with tumor infiltrated resection margins or remaining distant metastasis ( n = 25 ; p < 0.001 ) .
survival in the study cohort was related to classical parameters of tumor progression like lymph node involvement ( p = 0.005 ) and uicc stages ( p = 0.001 ) according to univariate analysis , as shown in table iv .
further analysis indicated significantly shorter survival times in patients positive for the mica - tm a4 allele ( negative vs positive , 80.6 vs 51.9 months ; p = 0.015 , fig . 1 ) .
estimated 5-year survival times were 75% and 43% for mica - tm a4 negative and positive patients , respectively .
multivariate analysis using the cox regression model after exclusion of the variable metastatic disease indicated that presence of mica - tm a4 allele ( hr , 2.71 ; 95% ci , 1.136.49 ; p = 0.025 ) and the tumor - related nodal status ( hr , 3.99 ; 95% ci , 1.619.86 ; p
table ivsurvival of colorectal cancer patientstumor - related parameterssurvival times ( mean sd ; months)(95% confidence interval)p valuetumor invasion t1/2 ( n = 13)85.0 9.6(66.2103.9)0.113 t3/4 ( n = 48)69.0 6.0(57.180.8)lymph node involvement n0 ( n = 34)88.8 5.4(78.199.4)0.005 n1 ( n = 18)65.3 8.9(47.782.8 ) n2 ( n = 9)25.9 5.2(6.944.9)uicc stages uicc i / ii ( n = 30)93.9 4.8(84.4103.4 ) uicc iii / iv ( n = 31)52.7 7.3(38.367.0)<0.001a4 no (
n = 47)80.6 5.6(69.791.6 ) yes ( n = 14)51.9 10.9(30.573.2)0.015a5 no ( n = 47)56.0 6.1(56.080.2 ) yes ( n = 14)87.4 6.3(75.099.7)0.074a5.1 no ( n = 19)65.2 9.8(45.984.5 ) yes ( n = 42)75.2 5.7(63.986.6)0.257a9 no (
n = 48)75.9 5.5(65.086.8 ) yes ( n = 13)59.5 10.6(38.780.3)0.106ca24 no ( n = 42)66.7 6.1(54.778.7 ) yes ( n = 19)84.3 8.6(67.4101.3)0.108microsatellite instability ( 1 marker ) no ( n = 54)71.7 5.7(60.483.0 ) yes ( n = 7)82.2 9.5(63.6100.9)0.410kras codon 12 mutations no ( n = 44)78.7 6.0(66.990.4 ) yes ( n = 17)58.7 9.5(40.077.5)0.093univariate analysis of tumor - related survival times of patients with indicated clinicopathological parameters and selected mica - tm ( a4 , a5 , a5.1 , a9 ) and micb c1_2_a ( ca24 ) alleles in patients with colorectal cancer ( n = 61 ) . kaplan
meier analysis and the log rank test were used for comparisons and statistical evaluationfig .
meier analysis of tumor - related survival times in association with mica - tm a4 allele in patients with colorectal cancer .
short vertical lines indicate censored observations for comparison of patients without ( n = 46 ) and with mica - tm a4 allele ( n = 15 , p = 0.015 ) survival of colorectal cancer patients univariate analysis of tumor - related survival times of patients with indicated clinicopathological parameters and selected mica - tm ( a4 , a5 , a5.1 , a9 ) and micb c1_2_a ( ca24 ) alleles in patients with colorectal cancer ( n = 61 ) .
kaplan meier analysis and the log rank test were used for comparisons and statistical evaluation survival analysis in relation to mica - tm a4 allele haplotype . kaplan meier analysis of tumor - related survival times in association with mica - tm a4 allele in patients with colorectal cancer .
short vertical lines indicate censored observations for comparison of patients without ( n = 46 ) and with mica - tm a4 allele (
we have further analyzed survival times in patients with microsatellite stable tumors ( n = 54 ) . as shown in fig
. 2 , prognostic relevance of mica - tm a4 was even more evident in microsatellite stable tumors ( p = 0.006 ) in comparison to the other known prognostic variables such as lymph node involvement ( p = 0.001 ) and uicc classification ( p < 0.001 , table
, mica - tm a9 was associated with reduced survival times ( p = 0.034 ) in microsatellite stable colorectal cancer patients , while the mica - tm a5 was inversely associated with a better prognosis ( p = 0.042 ) , providing evidence for a tumor suppressive effect of the mica - tm a5 allele ( table v ) .
further combined analysis of colorectal cancer patients with mica - tm alleles positive for either a4 or a9 vs patients negative for both a4 and a9 alleles had markedly reduced survival times , as shown in fig . 3 ( p < 0.001 ) , with an estimated 5-year survival of 36% vs 85% , respectively .
multivariate analysis by cox regression with inclusion of the variables mica - tm a4 , a5 , a9 , lymph node involvement , uicc stages , metastatic disease , and mica - tm a4 or a9 positive indicated that metastatic disease ( hr , 4.43 ; 95% ci , 1.6611.81 ; p = 0.003 ) , lymph node involvement ( hr , 3.27 ; 95% ci , 1.149.30 ; p = 0.026 ) and mica - tm a4 or a9 positive ( hr , 4.02 ; 95% ci , 1.2912.56 ; p
= 0.016 ) were of independent prognostic relevance in patients with microsatellite stable colorectal tumors .
kaplan meier analysis of tumor - related survival times in association with mica - tm a4 allele in patients with microsatellite stable colorectal cancer .
vertical lines indicate censored observations for comparison of patients without ( n = 42 ) and with mica - tm a4 allele ( n = 12 , p = 0.006 ) .
the estimated 5-year survival rate was 72% vs 38% , respectivelytable vsurvival of patients with microsatellite stable colorectal cancertumor - related parameterssurvival times ( mean sd ; months)(95% confidence interval)p valuetumor invasion t1/2 ( n = 12)81.8 11.4(59.5104.2)0.209 t3/4 ( n = 42)67.4 5.8(54.580.3)lymph node involvement n negative ( n = 28)89.9 6.0(78.1101.7)0.001 n positive ( n = 26)48.6 7.9(33.164.1)uicc stages uicc i / ii ( n = 24)96.7 4.9(87.0106.4)<0.001
uicc iii / iv ( n = 30)50.8 7.3(36.465.23)distant metastasis m0 ( n = 38)86.7 5.4(76.097.4)<0.001 m1 ( n = 16)38.0 9.5(19.465.7)a4 no ( n = 42)79.1 6.0(67.291.0)0.006 yes ( n = 12)46.4 12.1(22.570.3)a5 no ( n = 42)65.3 6.6(52.478.3)0.042 yes
( n = 12)88.4 7.1(74.3102.5)a5.1 no ( n = 16)62.7 10.89(41.484.1)0.236 yes ( n = 38)73.3 6.3(60.985.8)a9 no ( n = 43)75.7 6.0(63.887.6)0.034 yes ( n = 11)51.4 10.9(30.072.8)ca24 no ( n = 37)64.8 6.6(51.777.9)0.156 yes ( n = 11)81.9 9.5(63.2100.6)kras codon 12 mutations no ( n = 39)77.2 6.5(64.490.0)0.121 yes ( n = 15)54.5 10.5(33.975.1)univariate analysis of tumor - related survival times of patients with microsatellite stable ( min negative ) colorectal cancer and selected mica - tm ( a4 , a5 , a5,1 , a9 ) and micb c1_2_a ( ca24 ) alleles in association with indicated clinicopathological parameters ( n = 54 ) .
meier analysis and the log rank test were used for comparisons and statistical evaluationfig .
3mica - tm a4 or a9 haplotype in microsatellite stable colorectal cancer patients . kaplan
meier analysis of tumor - related survival times in association with mica - tm a4 or a9 alleles in patients with microsatellite stable colorectal cancer .
vertical lines indicate censored observations for comparison of patients either positive for mica - tm a4 or a9 alleles ( n = 23 ) in comparison to patients without mica - tm a4 and a9 alleles ( n = 31 , p 0.001 ) mica - tm a4 allele detection in microsatellite stable colorectal cancer patients .
meier analysis of tumor - related survival times in association with mica - tm a4 allele in patients with microsatellite stable colorectal cancer .
vertical lines indicate censored observations for comparison of patients without ( n = 42 ) and with mica - tm a4 allele ( n = 12 , p = 0.006 ) .
the estimated 5-year survival rate was 72% vs 38% , respectively survival of patients with microsatellite stable colorectal cancer univariate analysis of tumor - related survival times of patients with microsatellite stable ( min negative ) colorectal cancer and selected mica - tm ( a4 , a5 , a5,1 , a9 ) and micb c1_2_a ( ca24 ) alleles in association with indicated clinicopathological parameters ( n = 54 ) .
meier analysis and the log rank test were used for comparisons and statistical evaluation mica - tm a4 or a9 haplotype in microsatellite stable colorectal cancer patients .
kaplan meier analysis of tumor - related survival times in association with mica - tm a4 or a9 alleles in patients with microsatellite stable colorectal cancer .
vertical lines indicate censored observations for comparison of patients either positive for mica - tm a4 or a9 alleles ( n = 23 ) in comparison to patients without mica - tm a4 and a9 alleles ( n = 31 , p 0.001 )
the nk group 2 , member d -nkg2d protein , is an activating cell surface receptor expressed on nk cells and on some t - cell subsets [ 19 , 20 ] .
ligands of human nkg2d include mica , micb , ul-16-binding proteins , and letal and are expressed on several tumors , especially on epithelium - derived cancer cells .
ligand binding of mica and micb to the nkg2d receptor mediates innate antitumor response by stimulation of nk cells and gamma delta t cells and may modulate cd8a t - cell responses [ 21 , 22 ] . it was shown that tumor cells expressing high levels of mica and nkg2d ligands were rejected by nk cells and cd8 alpha / beta t cells and stimulated antitumor activity in a mouse model [ 23 , 24 ] .
analysis of the structure of the nkg2d - mica complex by protein expression , crystallization , and crystallography showed the interaction of a nkg2d homodimer with a single mica monomer either at the alpha 1 or alpha 2 domain forming a relatively stable interaction , more stable than other t - cell receptor ligand or other nk cell surface receptor ligand complexes .
have shown an increased tumor antigen cross - presentation and priming of antitumor cd8 and cd4 t - cell responses by loading of dendritic cells with mica antibodies following coculture with various tumor cells .
recent studies investigating mrna expression on various benign and malignant tissues and samples from patients with autoimmune diseases have shown a more widely distribution of mica and micb expression independent of malignancies or inflammation with the only exception for the central nervous system .
so far , it remains unclear whether a different genomic composition of mica alleles might alter the ligand affinity of mica alleles to nkg2d receptors and thereby modulate the host antitumor response . in our study
, we observed a significant association of mica - tm a4 allele with advanced tumor progression and reduced tumor - related survival times .
in contrast , patients with the mica - tm a5 allele had a remarkably low rate of tumor lymph node invasion and less distant metastases .
furthermore , in microsatellite stable tumors , genomic mica - tm a4 and a9 alleles were related to advanced tumor progression and shorter tumor - related survival , while the mica - tm a5 allele was again found to have a tumor suppressive effect .
these findings first indicate a host imminent predisposition with an altered tumor immune surveillance probably mediated by a differential composition of host mica - tm alleles in patients with colorectal cancer . at present , the there is no evidence that the mica - tm microsatellite polymorphism directly affects nkg2d interaction or shedding of mica molecules .
interestingly , the mica - tm a4 and a9 alleles share methionine , m , at amino acid position 129 , whereas the a5 alleles always code for valine , v , at this position ( imgt / hla database ) .
the mica - tm alleles 5.1 and 6 do not form a haplogroup with this polymorphic residue and can possess either m or v at amino acid position 129 .
steinle et al . have shown that mica v129 is associated with reduced affinity for nkg2d , whereas m129 confers high nkg2d binding affinity to nkg2d receptors involving the amino acid position m129 might be responsible for the described association with advanced tumor progression and reduced tumor - related survival time .
thus , shedded mica m129 might more powerfully impair nk and cd8 t - cell responses in vivo and/or downregulate nkg2d expression on effector cells .
but , surface mica m129 might also directly control its pronounced downregulation upon interaction with a strong - affinity mica protein . in other epithelial tumors ,
lo et al . have described an association of the mica - tm a9 allele with gastric cancer and a less schirrous phenotype .
the relevance of the nkg2d - ligand immune response in gastric cancer is further supported by osaki et al . describing a decreased nkg2d expression on cd8 + t cell in patients with gastric cancer .
have shown a reduced staining of mica on the surface of lung cancer samples . in addition , the authors demonstrated in an experimental human lung cancer therapy model that an upregulation of mica expression in lung cancer cells by adenoviral transfection of expression plasmids was able to reestablish the previously decreased nk cell - mediated antitumor immunity . in thyroid carcinomas ,
mica and micb expression was detected by immunohistochemistry on most tumor samples and on thyroid cancer cell lines with a correlation of their sensitivity to killing by nkg2d - positive nk cells .
transient transfection of mutant braf and kras oncogenes led to increased mica and micb expression in thyroid cancer cells .
as shown in our analysis , we only observed a trend for an association of the micb c1_2_a ca23 allele ( p = 0.087 ) with the detection of kras mutations in colorectal cancer samples .
differential expression of mica molecules locally present at the surface of tumor cells might additionally regulate local tumor immune interactions .
we therefore can not rule out that alterations of mica or micb at the level of transcription or protein synthesis might result in different levels of mica and micb protein expression on the surface of tumor cells .
therefore , the investigation of mica and micb alleles at protein expression level on the individual tumor samples will be of further interest . several studies using immunohistochemistry
have shown a reduced expression of mica at the protein level on tumor cells [ 27 , 29 ] .
it is unclear whether the reduction in mica protein expression on tumor cells is caused by reduced mica synthesis or is the result of an increased shedding of mica molecules in cancer patients .
the factors involved in shedding of soluble mica molecules from tumor cells are only poorly understood .
it is assumed that metalloproteinases are involved in proteolytic cleavage of soluble mica molecules from the surface of tumor cells , leading to inactivation of nkg2d mediated antitumor response .
interestingly , the authors also report an association of mica levels with advanced staged of tumor progression especially in patients with gastrointestinal renal , prostate , and breast cancer with highest levels in patients with metastatic disease .
it is assumed that the reduction of mica expression by release and shedding from the cell surface would potentially reduce the immunogenetic signals of tumor cells becoming less detectable for nk and t cells .
these findings further support the concept that the nkg2d / ligand system seems to play an important role in the immune surveillance of tumor cells .
however , it remains to be determined if any of the described mica alleles might be related to differential shedding of soluble mica molecules and thereby influence antitumor immunity and tumor progression .
elevated antibodies against mica were recently described in tumor patients and in recipients of renal and heart transplants with differential responses to immune therapy or an increased rejection rate associated with a reduced graft survival [ 3234 ] .
it is assumed that mica antibodies are able to opsonize cancer cells for presentation to dendritic cells and induce tumor cell lysis through complement fixation .
in addition , genetic modifications of human t cells with chimeric nkg2d receptors might further increase innate antitumor response . in summary , these findings might indicate a host innate immunogenetic antitumor surveillance associated with advanced colorectal tumor progression and reduced tumor - related survival based on the presence of specific mica - tm alleles involved in nkg2d - receptor activation .
Output:
| purposethe major histocompatibility complex class i related a ( mica ) and micb molecules are ligands of nkg2d receptors on natural killer cells , gamma / delta t cells , and cd8a t cells that mediate host antitumor immune response .
the role of mica - tm and micb c1_2_a alleles in patients with colorectal cancer has not yet been investigated.methodswe have analyzed the mica - tm and micb c1_2_a polymorphisms in colorectal cancer patients ( n = 79 ) by polymerase chain reaction amplification , subsequent electrophoresis , and sequencing in comparison to a previously analyzed cohort of healthy controls ( n = 306 ) .
allele frequencies obtained for mica - tm and micb c1_2_a were compared to histopathological data regarding tumor invasion , disease progression , microsatellite instability , and the presence of kras mutations ( codon 12 ) and analyzed for possible impact on tumor - related survival ( n = 61).resultsallele frequencies of mica - tm and micb c1_2_a polymorphisms were not different in patients with colorectal cancer in comparison to normal controls . in colorectal cancer patients ,
mica - tm a4 allele was directly and mica - tm a5 allele was inversely associated with lymph node involvement and advanced uicc stages .
tumor - related survival in colorectal cancer patients was significantly reduced in the presence of the mica - tm a4 allele ( p = 0.015 ) . in patients with microsatellite stable tumors ,
survival was reduced in association with the mica - tm a4 allele ( p = 0.006 ) and mica - tm a9 allele ( p = 0.034 ) , but increased in patients showing the mica - tm a5 allele ( p = 0.042).conclusionsspecific mica - tm alleles seem to influence tumor progression and midterm survival of patients with colorectal cancer , indicating an important role of host innate immune predisposition involving nkg2d mediated antitumor response . |
PubmedSumm6833 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a high number of patients survived from cerebrovascular accident ( cva ) suffer from sensory , motor , cognitive , and emotional disturbances causing limitations in daily functional activities ( 1 ) .
a new approach for the treatment of stroke patients has been developed by observing and imitating the movement of the mirror neurons .
mirror neurons are a group of gray matter neural cells stimulated by the observation of an activity , which enables the observer to imitate the movement ( 2 ) . in humans ,
morphological voxel - based analysis demonstrates differences in brain volumes by functional magnetic resonance imaging ( fmri ) .
also empathic actions indicate that adult women have a significantly larger volume of gray matter in the pars opercularis and frontal - parietal lobes compared to males .
females have a higher volume of gray matter in the right infra - frontal sinus groove , infra - parietal lobe , and internal anterior brain cortex ( 2 , 4 - 6 ) ( figure 1 ) ( 2 ) .
electroencephalography ( eeg ) evidence also supports sex differences with regard to empathy for pain ( 7 ) .
the gray matter regions showing significant sexual dimorphism were rendered onto the averaged horizontal images of the whole sample ( n-24 ) ( voxel threshold : uncorrected p < 0.001 ) .
the gray matter regions that are larger in females than males are presented in red to yellow .
conversely , the gray matter regions that are larger in males are presented in blue to green .
the z - coordinate for each coronal slice in the mni space is given in mm .
r : right . for interpretation of the references to color in this figure legend ,
observation of the movement triggers the mirror neuron system to recognize and imitate it ( 8) .
mirror neurons can effectively help memory formation and motor learning following observation of a movement .
superior performance of women in empathy , emotional interpersonal communications , and emotional recognition compared to men indicates neuroanatomical sex differences and explains greater activity of this system in females ( 2 ) .
observation and imitation of movement are expected to have superior efficacy in women with neural injury and this higher efficacy may be used for functional recovery of female hemiparetic patients .
this is a new research field and there are too many papers about it . the purpose of this study was to assess whether gender differences in neuroanatomy of the human mirror neuron system has any impact on functional recovery of patients with ischemic hemiparesis
this single - blind clinical trial was conducted on 24 ischemic hemiparetic patients ( 12 males and 12 females ) who had a cortical thromboembolic ischemic lesion around the middle meningeal artery during 2013 - 2014 .
all patients had first ischemic hemiparesis without previous experience of treatment with the action observation . on arrival ,
all patients were examined by a neurologist . if patients were eligible for the study they were enrolled .
the subjects were randomly assigned to 2 groups of 12 men and women . to detect the sample size ,
a pilot study was done on 3 patients in each group . according to the results , regarding an effect size of 0.85 in response variable with an error probability of 5% , and a power of 90% , by using anova sample size formulation ( 10 ) and g*power software ( 11 ) ,
the inclusion criteria were having history of cva within the past 3 - 6 months , age range of 40 - 65 years , normal level of consciousness , normal field of vision and visual power , spasticity between + 1 - 2 ( according to the modified ashworth scale ) , and bmi < 30
the exclusion criteria were having wernicke s aphasia , cardiac or respiratory diseases , history of neural surgery , mental disorder , neglect in the right hemisphere , depression , high psychological stress , and advanced osteoarthritis in lower extremities .
candidates were divided into 4 groups in a single - blind fashion as follows : women watching the functional movies ( group 1 ) , control women ( group 2 ) , men watching the functional movies ( group 3 ) and control men ( group 4 ) .
all experiments on human subjects were conducted in accordance with the declaration of helsinki and all procedures were carried out with the adequate understanding and written consent of the subjects .
the study protocol was approved in the ethics committee of shahid beheshti university of medical sciences ( ec/75/h/341 , date : march 1 , 2013 ) .
the rehabilitation treatment consisted of twelve 60-minutes sessions ( 15 minutes of watching a functional movie and 45 minutes of routine physiotherapy ) for groups watching the functional movies ( groups 1 and 3 ) and twelve 45-minutes sessions ( only routine rehabilitation program without watching the functional movie ) for control groups ( groups 2 and 4 ) every other day .
routine physiotherapy of patients in all groups included use of infrared light for lower extremities for 5 minutes , use of electrical current ( functional faradic stimulation ) on quadriceps and tibialis anterior in the hemiparetic side for 10 minutes ( 5 minutes for quadriceps and 5 minutes for tibialis anterior ) and different exercises ( floor exercises on mattress , supplemental and reinforcement exercises for lower extremities , balance exercises and weighing on limbs and functional exercises on lower extremities ) for 30 minutes .
patients in groups 1 and 3 were seated in front of a 25-inch monitor at 2 m distance and watched the functional movie . after watching
a total of 29 silent video clips ( to stimulate only the visual sensation ) of movements routinely used for physiotherapy of hemiparetic patients were shown to groups 1 and 3 in the form of separate 1-minute clips with 5 repetitions ( figure 2 ) .
clips started with the simplest to the most difficult movements and 3 clips were shown per session .
the process of showing the movies was based on the patient s ability and started with simple movements towards more difficult and complex ones .
demographic data including age , sex , height , weight , bmi , duration of affliction , and affected side were collected using a questionnaire .
visual acuity was measured by the snellen chart ( the patient was placed at a distance of 6 m , while putting his hands on his eyes , trying to see the letters on the chart and determine their direction .
it was determined on the basis of the patient 's visual power ) and visual field was assessed by manually visual field test ( visual field test is a quick and basic method of measuring the visual field that can detect dysfunction in central and peripheral vision ) .
ideally , when the patient covers his or her right eye , the examiner covers his or her left eye , and vice versa .
the examiner will then move his or her hand out of the patient 's visual field and then bring it back in .
the examiner usually uses a slowly wagging finger or a hat pin for this action .
power of muscles was scored using manual muscle testing as described by kendall in 9 different degrees from -2 ( poor ) to + 4 ( good ) ( 13 ) .
intensity of spasticity was assessed using modified ashworth scale ( in 5 scales of 1 , indicative of minimum spasticity to 4 , indicative of maximum spasticity ) .
objective assessment of patient mobility was done using the following tests : standard test of timed up and go ( tug ) ( time that a person takes to rise from a chair , walk 3 m , turn around , walk back to the chair , and sit down ) , six - minute walk ( smw ) ( the maximum distance walked over 6 minutes ) , barthel index ( bi ) checking the patient s independence in conducting the daily activities and personal care ( a numerical scale scoring the quality of conducting 10 functions : 0 indicates completely dependent and 10 indicates completely independent with a maximum score of 100 and minimum score of 0 ) , and berg balance scale ( bbs ) comprising 14 different skills to assess the patient s balance and function while performing them . with regard to bbs ,
each skill is scored from 0 to 4 ( total score of 56 ) based on the time required to maintain a specific position or complete a task .
a total score of 56 indicates that the patient is capable of independently performing all tasks .
low scores ( 36 - 45 ) indicate that the patient is not capable of performing the skill independently during the required time and is at relative risk of fall and injury .
scores lower than 36 indicate that the patient is fully dependent and is at high risk of fall and injury .
the study did not use special equipment ( just using standard techniques and tests listed ) .
all statistical analyses were performed using spss , version 16.0 ( spss inc , chicago , il , usa ) . considering the normal distribution of data , confirmed by the kolmogorov - smirnov test , parametric tests were used for data analysis .
pre- and post - intervention values in each group were compared using paired t test .
after calculation of the changes in each variable in all groups , results were analyzed using anova and tukey test with 95% confidence interval ( ci ) and significance level of 0.05 .
this single - blind clinical trial was conducted on 24 ischemic hemiparetic patients ( 12 males and 12 females ) who had a cortical thromboembolic ischemic lesion around the middle meningeal artery during 2013 - 2014 .
all patients had first ischemic hemiparesis without previous experience of treatment with the action observation . on arrival ,
all patients were examined by a neurologist . if patients were eligible for the study they were enrolled .
the subjects were randomly assigned to 2 groups of 12 men and women . to detect the sample size ,
a pilot study was done on 3 patients in each group . according to the results , regarding an effect size of 0.85 in response variable with an error probability of 5% , and a power of 90% , by using anova sample size formulation ( 10 ) and g*power software ( 11 ) ,
the inclusion criteria were having history of cva within the past 3 - 6 months , age range of 40 - 65 years , normal level of consciousness , normal field of vision and visual power , spasticity between + 1 - 2 ( according to the modified ashworth scale ) , and bmi < 30
the exclusion criteria were having wernicke s aphasia , cardiac or respiratory diseases , history of neural surgery , mental disorder , neglect in the right hemisphere , depression , high psychological stress , and advanced osteoarthritis in lower extremities .
candidates were divided into 4 groups in a single - blind fashion as follows : women watching the functional movies ( group 1 ) , control women ( group 2 ) , men watching the functional movies ( group 3 ) and control men ( group 4 ) .
all experiments on human subjects were conducted in accordance with the declaration of helsinki and all procedures were carried out with the adequate understanding and written consent of the subjects .
the study protocol was approved in the ethics committee of shahid beheshti university of medical sciences ( ec/75/h/341 , date : march 1 , 2013 ) .
the rehabilitation treatment consisted of twelve 60-minutes sessions ( 15 minutes of watching a functional movie and 45 minutes of routine physiotherapy ) for groups watching the functional movies ( groups 1 and 3 ) and twelve 45-minutes sessions ( only routine rehabilitation program without watching the functional movie ) for control groups ( groups 2 and 4 ) every other day .
routine physiotherapy of patients in all groups included use of infrared light for lower extremities for 5 minutes , use of electrical current ( functional faradic stimulation ) on quadriceps and tibialis anterior in the hemiparetic side for 10 minutes ( 5 minutes for quadriceps and 5 minutes for tibialis anterior ) and different exercises ( floor exercises on mattress , supplemental and reinforcement exercises for lower extremities , balance exercises and weighing on limbs and functional exercises on lower extremities ) for 30 minutes .
patients in groups 1 and 3 were seated in front of a 25-inch monitor at 2 m distance and watched the functional movie . after watching , they tried to imitate the same movements on the movie .
a total of 29 silent video clips ( to stimulate only the visual sensation ) of movements routinely used for physiotherapy of hemiparetic patients were shown to groups 1 and 3 in the form of separate 1-minute clips with 5 repetitions ( figure 2 ) .
clips started with the simplest to the most difficult movements and 3 clips were shown per session .
the process of showing the movies was based on the patient s ability and started with simple movements towards more difficult and complex ones .
demographic data including age , sex , height , weight , bmi , duration of affliction , and affected side were collected using a questionnaire .
visual acuity was measured by the snellen chart ( the patient was placed at a distance of 6 m , while putting his hands on his eyes , trying to see the letters on the chart and determine their direction .
it was determined on the basis of the patient 's visual power ) and visual field was assessed by manually visual field test ( visual field test is a quick and basic method of measuring the visual field that can detect dysfunction in central and peripheral vision ) .
ideally , when the patient covers his or her right eye , the examiner covers his or her left eye , and vice versa .
the examiner will then move his or her hand out of the patient 's visual field and then bring it back in .
the examiner usually uses a slowly wagging finger or a hat pin for this action .
power of muscles was scored using manual muscle testing as described by kendall in 9 different degrees from -2 ( poor ) to + 4 ( good ) ( 13 ) .
intensity of spasticity was assessed using modified ashworth scale ( in 5 scales of 1 , indicative of minimum spasticity to 4 , indicative of maximum spasticity ) .
objective assessment of patient mobility was done using the following tests : standard test of timed up and go ( tug ) ( time that a person takes to rise from a chair , walk 3 m , turn around , walk back to the chair , and sit down ) , six - minute walk ( smw ) ( the maximum distance walked over 6 minutes ) , barthel index ( bi ) checking the patient s independence in conducting the daily activities and personal care ( a numerical scale scoring the quality of conducting 10 functions : 0 indicates completely dependent and 10 indicates completely independent with a maximum score of 100 and minimum score of 0 ) , and berg balance scale ( bbs ) comprising 14 different skills to assess the patient s balance and function while performing them . with regard to bbs , each skill is scored from 0 to 4 ( total score of 56 ) based on the time required to maintain a specific position or complete a task .
a total score of 56 indicates that the patient is capable of independently performing all tasks .
low scores ( 36 - 45 ) indicate that the patient is not capable of performing the skill independently during the required time and is at relative risk of fall and injury .
scores lower than 36 indicate that the patient is fully dependent and is at high risk of fall and injury .
the study did not use special equipment ( just using standard techniques and tests listed ) .
all statistical analyses were performed using spss , version 16.0 ( spss inc , chicago , il , usa ) . considering the normal distribution of data , confirmed by the kolmogorov - smirnov test , parametric tests were used for data analysis .
pre- and post - intervention values in each group were compared using paired t test .
after calculation of the changes in each variable in all groups , results were analyzed using anova and tukey test with 95% confidence interval ( ci ) and significance level of 0.05 .
at baseline , patients were matched in terms of demographic information ( age , sex , height , weight , bmi , duration of affliction , and affected side ) and had no significant difference with respect to these variables ( p > 0.05 for all variables ) ( table 1 ) .
data are reported as mean sd . according to anova , functional activities ( tug , smw , bi , bbs ) of all groups were similar at baseline with no significant differences ( table 2 ) .
data are reported as mean sd . abbreviations : bbs , berg balance scale ; bi , barthel index ; smw , six - minute walk ; and tug , timed up and go .
the changes in values before and after the intervention for all functional activities ( tug , smw , bi , bbs ) in each group were significant and showed improvement after the treatment .
the highest degree of change and improvement occurred in groups watching the functional movies ( 1 and 3 ) ( p = 0.0001 ) . among 4 groups ,
females ( 1 and 2 ) showed greater improvement than males at the same intervention group ( 3 and 4 ) ( p = 0.0003 ) .
the change in each variable was significant ( p < 0.0001 for tug , p < 0.0001 for smw , p = 0.0001 for bi , and p = 0.0003 for bbs ) .
changes in women watching the functional movies ( group 1 ) were significantly greater than other groups ( p < 0.0001 ) ( table 3 ) .
anova revealed significant improvement in all functional activities ( tug , smw , bi , bbs ) after the intervention ( table 3 ) .
neural rehabilitation requires repetition of exercises , conduction of active movements by the paralyzed limb , and positive effects of neural plasticity ( 14 ) .
experimental evidence shows that activity of motor cortex enhances the process of neuroplasticity and improves motor disturbances ( 15 ) . a combination of observing targeted daily activities and physical practice seems to be more effective than physical rehabilitation alone ( 16 ) .
comparison of values before and after the intervention in the current study showed significant improvement and indicated that physiotherapy exercises regardless of gender differences of mirror neurons or viewing a functional movie , improved muscle power and functional activities of patients with cva . based on the literature
, the main factors affecting muscle power include active and dynamic exercises ( 17 ) ; intense , repetitive , targeted activities ( 14 ) ; facilitation of the observation and imitation of movements and mobilization of all related functional mechanisms ( previously acquired skills , the power to predict and perceive the learned dynamic movements , using intermediary feedback as a side mechanism , further activation of cortical system , and mobilization of function in the respective muscle ) ( 3 ) ; muscle contractures ( 18 ) ; use of existing defective pattern ( to increase muscle power and endurance ) ( 12 ) ; and improvement of proprioceptive disorders ( 12 ) , weighing , and balance ( 19 , 20 ) , which all of them were also observed in this study .
the time required to do tug decreased in all groups ( 22.7 2 second before and 19.9 1 second after the intervention ) .
stated that longer tug time in patients was due to shorter steps , less number of steps per minute , and difficulty in standing up or sitting down on the chair ( 21 ) .
in general , the decreased time required for tug in patients with cva reported in other studies may be due to physiotherapy along with targeted repetitive exercise ( 14 ) , improvement in the function of plantar flexor , hip flexor and extensor ( 22 ) , as well as increase in muscle power and endurance ( 17 , 18 ) , and improvement in weighing , balance , and posture of walking ( 23 ) ; which were also observed in the present study .
smw was also improved in all patients ( 120.3 17 m before and 146 15 m after the intervention ) .
dickstein stated that speed of walking was a main parameter related to walking after cva and the final speed after the completion of intervention is an important parameter for social activities ( 24 ) .
the improvement in patients was probably due to interventions , which increased the power and contractures of muscles ( 17 , 18 ) ; improved walking function ( 18 ) ; as well as physiotherapy along with targeted repetitive exercises ; improvement in neuromuscular coordination in walking ( 14 ) , ability to use the existing defective pattern ( due to increased muscle power and endurance ) ( 17 , 18 ) , asymmetric muscle tone in extremities ( 25 ) , proprioception ( 12 ) , weighing , balance ( 19 , 20 ) , and balance indexes ( 20 ) , improvement in the function of plantar flexor and hip flexor and extensor ( 22 ) , in the posture control ( 19 ) , longer steps and increased number of steps per minutes ( 21 ) ; and the facilitation of observation and imitation of movement , especially in women with its effect on neuroplasticity and motor rehabilitation ; which all confirm our findings .
bi indicated improved independence in functional activities ( mean score of 74.2 1.7 out of 100 before and 84.8 1.5 after the intervention ) .
lost skills in patients with cva can be acquired again via continuous , intense , targeted instruction , an effective motor response , having a normal neuromuscular system , adequate muscle strength , adequate trunk stability for balance , and use of extremities , flexibility , adequate proprioception , and positive effects of neural plasticity .
evidence shows that mobilization of motor cortex occurs whenever doing a motor activity , mental exercise , or watching a movement .
this enhances plasticity and improves motor disturbances ( 15 ) . a combination of observing targeted daily activities and physical practice seems to be more effective than physical rehabilitation alone .
( 16 ) , increased activity of mirror neurons indicates that recovery of patients depends on reactivation of motor skills as the result of observation of movement .
another study reported that improvement in bi in patients with cva was attributed to spontaneous recovery of the condition , increase in power and tolerance of muscles , improvement in balance and increase in independence of patients in daily activities ( 26 ) . improved muscle power , balance , stability indices and independence in personal activities
bbs significantly improved in all groups in the current study ( 47.2 1.35 before and 50.9 1.7 after the intervention ) .
cva damages the sensory and motor pathways and causes motor and balance impairment in the affected side ; which is the main cause of disability following cva .
patients with cva have less stability and balance and are at higher risk of falling and injury ( 27 ) . impaired posture control ( 19 , 23 ) , neuromuscular coordination ( 14 ) , coordination between nerve segments ; hyperreflexia or spasticity ; unilateral weakness and impaired proprioception ( 28 ) ; motor and sensory changes ( presence of abnormal sensation ) ; and lack of synchronization in movement ( 29 ) are responsible for imbalance .
improvement in motor and communication skills ( via plasticity ) ; intense , targeted treatments ( active and repetitive daily exercise of paralyzed limbs ) ( 14 ) ; quick reorganization of injured nerves ( 14 ) ; activation of brain changes in sensory and motor systems ( 30 ) ; earlier initiation of movements and exercises at the affected side and use of healthy limbs ( to stimulate the affected side ) ( 31 ) ; early , intense physical activity ( increased tolerance of patients to postural alterations and decreased alterations ) ( 32 ) ; and progressive long - term exercises ( improved muscle power , positive effect on perception and muscle contractures and function of walking ) ( 17 , 18 ) are methods to improve impaired balance in these patients . improving the motor function and balance
the greatest improvement in the current study was observed in groups watching the functional movies ( 1 and 3 ) ( p = 0.0001 ) . among all groups ,
the improvement in all variables was significant in all groups ( p < 0.0001 for tug , p < 0.0001 for smw ,
changes in group 1 variables ( women watching functional movies ) were significantly greater than those variables in other groups ( p < 0.0001 ) . considering the similarity of physiotherapy exercises in all 4 groups , significant changes in the degree of improvement were probably due to watching the functional movies and its effect on plasticity and motor rehabilitation .
observation and imitation of targeted movements and mobilization of functional mechanisms ( previously acquired skills , prediction and perception of dynamic movement , their coordination , use of interstitial feedback as a side functional mechanism , further activation of cortical system , and mobilization of function in respective muscles ) can activate premotor cortex when watching simple activities and change synaptic attachments and form new pathways for motor rehabilitation ( 3 ) .
study of the functional activity in patients watching the movement reveals increased activity of bilateral anterior premotor cortex , bilateral temporal superior groove , supplementary motor area , and supramarginal groove resulting in the coordination of observation and conduction of movement in mirror neuron system .
improved motor function of patients is related to activation of the physiological network of motor areas that have a history of previous movements and instructed activities ( 3 ) .
activity of mirror neuron system in women is greater than men ( 2 , 3 ) .
percentage of change in functional activities in groups 1 and 2 was expected to be higher than those in groups 3 and 4 . on the other hand , it has been demonstrated that a rehabilitation program comprising a combination of movement observation and intense repetitive exercise has resulted in significant motor improvement in the affected limb .
however , such improvement was not observed in any control group ( 3 ) , which is in accord with the results of the current study . in conclusion
, we showed that gender differences in neuroanatomy of mirror neuron system affect functional improvement in hemiparetic patients .
this effect is more significant in women and it appears that women have higher chance of recovery , especially those watching functional movies .
variability of inclusion and exclusion criteria and difficulty of finding patients were among the limitations of this study .
this study was conducted on outpatients whom at least 3 months had passed from their cva .
thus , these results may not be generalizable to hospitalized patients with a history of recent cva ( less than 3 months ) .
furthermore , this study was conducted on ischemic cva patients and the results may not be generalized to those with hemorrhagic cva .
we could not assess patients in the long run ( 25 - 30 sessions ) to evaluate long - term efficacy of treatment .
a follow up at 3 or 6 months could not be done due to difficulty in accessing patients .
finally , other neurophysiological tests ( electromyography ( emg ) , electroencephalography ( eeg ) , functional magnetic resonance imaging ( fmri ) , transcranial magnetic stimulation ( tms ) , positron emission tomography ( pet ) ) could not be done due to limited equipment .
this research was conducted in a new field inspired by previous basic research results , and tries to establish a link between theoretical research and applied clinical research .
we used a new approach in the treatment of patients with ischemic stroke , and published an article with this approach .
variability of inclusion and exclusion criteria and difficulty of finding patients were among the limitations of this study .
this study was conducted on outpatients whom at least 3 months had passed from their cva . thus , these results may not be generalizable to hospitalized patients with a history of recent cva ( less than 3 months ) .
furthermore , this study was conducted on ischemic cva patients and the results may not be generalized to those with hemorrhagic cva .
we could not assess patients in the long run ( 25 - 30 sessions ) to evaluate long - term efficacy of treatment .
a follow up at 3 or 6 months could not be done due to difficulty in accessing patients .
finally , other neurophysiological tests ( electromyography ( emg ) , electroencephalography ( eeg ) , functional magnetic resonance imaging ( fmri ) , transcranial magnetic stimulation ( tms ) , positron emission tomography ( pet ) ) could not be done due to limited equipment .
this research was conducted in a new field inspired by previous basic research results , and tries to establish a link between theoretical research and applied clinical research .
we used a new approach in the treatment of patients with ischemic stroke , and published an article with this approach .
Output:
| background : considering the higher activity of mirror neuron system in females , they frequently have better performance in empathy , interpersonal sensitivity , and emotional recognition compared to males.objectives:the purpose of this study was to assess whether gender difference in neuroanatomy of the human mirror neuron system has any impact on functional recovery of ischemic hemiparetic patients.patients and methods : this single - blind clinical trial was conducted on 24 patients with cerebrovascular accident ( cva ) in the age range of 45 - 60 years , referring at a rehabilitation center in tehran , iran , during 2013 - 2014 .
sampling method was stratified random sampling .
the subjects were assigned to 2 groups of 12 males and 12 females .
then , each group was randomly divided into 2 groups ( totally 4 groups , n = 6 for each group ) : women watching functional movies , control women , men watching functional movies , and control men .
movies were shown to patients and then , they were evaluated by timed up and go ( tug ) , six - minute walk test ( smw ) , barthel index ( bi ) , and berg balance scale ( bbs).results : comparison of all variables related to functional activities of all groups before and after watching movies revealed significant differences .
the highest percentage of change and improvement was observed in groups 1 and 3 watching the functional movies ( p = 0.0001 ) .
percentage of improvement in women of groups 1 and 2 was higher than men in groups 3 and 4 ( p = 0.0003 ) .
the changes in group of females watching the functional movies ( group 1 ) were significantly greater than in other groups ( p < 0.0001).conclusions : the sex differences in the neuroanatomy of the human mirror neuron system affect functional recovery of patients with hemiparesis .
the improvement in studied women was found to be significantly greater than studied men .
the results indicate a higher chance of recovery among hemiparetic women , especially those watching functional movies . |
PubmedSumm6834 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: selenium is the 34th element on the periodic table and has chemical properties resembling those of sulfur ( 1 ) .
it is an essential micronutrient for animals and microorganisms , , used in the synthesis of the seleno - amino acids selenocysteine and selenomethionine ( 2,3 ) and also plays an essential dietary role in humans due to its ability to form the enzyme glutathioine peroxidase which is involved in fat metabolism ( 4 ) .
however , exposure to higher concentrations of selenium is toxic ( 1 ) . high intake of selenium in humans can lead to respiratory distress , liver and kidney necrosis and cell death .
chemical detoxification of polluted sites can be expensive and often results in secondary effects in the environment ( 5 ) .
agricultural drainage , industrial effluents and sewage sludge are major sources of various toxic forms of selenium ( 6 ) . on
average most soils contain between 0.012 mg se / kg while seleniferous soils may have as much as 5 mg se / kg .
natural waters generally have se concentrations < 0.01 mg / l but agricultural drainage waters often have se concentrations of 140 to 1400 mg / l ( 7 ) .
selenium occurs naturally in four oxidation states , i.e. , selenate ( + vi ) , selenite ( + iv ) , elemental selenium ( 0 ) , selenide ( ii ) , and organic selenium ( ii ) , and it is known that prokaryotes play a major role in its oxidation and reduction ( 1 , 8) .
bioremediation is the application of biological systems to the clean - up of organic and inorganic pollution , with bacteria and fungi ( 9 ) .
apparently , microbes that can reduce selenate and selenite are not restricted to any particular group / subgroup of prokaryotes and examples are found throughout the bacterial and archaeal domains ( 10 )
. bacterial reduction of selenate to elemental selenium is an important biogeochemical process in an aquatic environment . in this system
, selenate can be used in microbial respiration or dissimilatory selenate reduction , as a terminal electron acceptor for growth and metabolism ( 11 ) .
the optimization of biological remediation processes depends on an understanding of the biology involved and , if bacterial inoculation is needed , the identification and characterization of microorganisms that can best carry out the desired remediation .
the aim of this research was an attempt to isolate and characterize microorganism capable of transforming toxic seo42- via seo32- to non - toxic elemental selenium and to investigate its ability in selenite removal from contaminated sites .
sodium selenate anhydrous was obtained from alfaesar ( germany ) and sodium sulfide and thionine dye were bought from merck ( darmstadt , germany ) .
the stock solutions were prepared in distilled water and maintained at 4 c following sterilization by microbiological filter ( 0.22 m ) .
totally , 30 bacterial strains were isolated using the enrichment culture technique at 34 c in a shaking incubator ( 150 rpm ) and ph 7.0 for 48 h in lb broth ( luria bertani broth ) supplemented with 10 mm sodium selenate under aerobic conditions .
red colonies , indicating reduction of selenate , were re - streaked on lb agar without selenate to confirm that the colour was not due to pigmentation .
filter sterile 10 mm sodium salts of selenate were added to the lb medium after autoclaving ( 12 , 13 ) . among the strains isolated , the strain named qw4 showed the highest tolerance toward this sodium selenate and was selected as a model strain for further experiments . in order to determine mics ,
the strains were grown in lb agar medium supplemented with sodium selenate at increasing concentrations ( 100800 mm ) and incubated at 34 c , for 72 h. each plate was prepared in triplicates ( 13 , 14 ) .
morphological characterization such as colony and cell morphology , gram - reaction , motility and other identification tests were performed as described by ghosh et al .
physiological and biochemical tests were carried out according to the standard protocols described by smibert and krieg ( 1994 ) and ventosa ( 2004 ) ( 16 , 17 ) . to determine the optimum temperature and ph for the growth of the strain
, the cultures were incubated at a temperature range of 1550 c with intervals of 5 c and ph values of 510.5 .
ph values below and above 6 were adjusted by sodium acetate and tris - hcl buffer , respectively . also , growth of the strain was evaluated at different % nacl values ( 030 % nacl ) ( 13 , 18 ) .
isolated strain was screened for susceptibility to a panel of 15 antibiotics discs ( padtan teb , iran ) viz : penicillin ( p10 ) , ampicillin ( am10 ) , cephalothin ( cf30 ) , cefazolin ( cz30 ) , streptomycin ( s10 ) , gentamicin ( gm10 ) , chloramphenical ( c30 ) , tetracycline ( t10 ) , erythromycin ( e15 ) , trimethoprim sulfamethoxazol ( sxt ) , nalidixic acid ( na30 ) , ciprofloxacin ( cp5 ) , vancomycin ( v30 ) and polymyxin b ( pb300 ) ( 18 ) .
cells were cultured in 100 ml erlenmeyer flasks containing 25 ml of lb broth supplemented with 1000 g / ml sodium selenate .
the basal medium ( lb broth + sodium selenate ) was inoculated with 1% of 1.5 10 cfu / ml of the bacterial suspensions and incubated aerobically at 35 c and ph value of 7 on a shaking incubator ( 150 rpm ) for 2 days .
the cells were centrifuged at 10000 rpm for 10 minutes and the supernatants were used to determine the residual sodium selenate through slightly modified kinetic spectrophotometric method based on the catalytic role of selenite in reducing thionine dye by sulfide ions ( 13 , 19 ) .
for the measurement of se sorption , selenate was first reduced to selenite by mixing with concentrated hcl ( 2:1 , by vol . ) in a screw capped tube in a 90 c water bath for 1 h ( 20 ) and assay was followed as above .
capacity of selenate removal by the strain was evaluated at different ph values ( 510.5 ) and temperatures ( 1540 c ) and on a shaking incubator ( 50200 rpm ) in basal medium supplemented with 1000 g / ml sodium selenate . to evaluate the effect of initial selenium concentration , selenate removal
was monitored in basal medium supplemented with varying concentration of sodium selenate ( 2002000 g / ml ) .
genomic dna of the isolate was extracted with a genomic dna extraction kit ( cinnagene ) by following the manufacturer s recommended procedure .
the 16s rrna gene was amplified using the universal primers 8f ( 5-agagtttgatymtggctcag-3 ) and 1541r ( 5-aaggaggtgatccagccgca-3 ) .
the amplification was done by initial denaturation at 95 c for 5 minutes ; subsequent denaturation at 95 c for 1 minute ; annealing at 66.6 c for 1 minute ; extension at 72 c for 1 minute and final extension at 72 c for 10 minutes .
the pcr product was directly double - strand sequenced by seqlab laboratory ( germany ) .
the analysis of dna sequences and homology searches were completed using the blast algorithm for the comparison of the nucleotide query sequence against a nucleotide sequence database .
phylogenetic tree was inferred using the neighbor - joining method as implemented in the software .
sodium selenate anhydrous was obtained from alfaesar ( germany ) and sodium sulfide and thionine dye were bought from merck ( darmstadt , germany ) .
the stock solutions were prepared in distilled water and maintained at 4 c following sterilization by microbiological filter ( 0.22 m ) .
totally , 30 bacterial strains were isolated using the enrichment culture technique at 34 c in a shaking incubator ( 150 rpm ) and ph 7.0 for 48 h in lb broth ( luria bertani broth ) supplemented with 10 mm sodium selenate under aerobic conditions .
red colonies , indicating reduction of selenate , were re - streaked on lb agar without selenate to confirm that the colour was not due to pigmentation .
filter sterile 10 mm sodium salts of selenate were added to the lb medium after autoclaving ( 12 , 13 ) . among the strains isolated , the strain named qw4 showed the highest tolerance toward this sodium selenate and was selected as a model strain for further experiments .
in order to determine mics , the strains were grown in lb agar medium supplemented with sodium selenate at increasing concentrations ( 100800 mm ) and incubated at 34 c , for 72 h. each plate was prepared in triplicates ( 13 , 14 ) .
morphological characterization such as colony and cell morphology , gram - reaction , motility and other identification tests were performed as described by ghosh et al . , ( 2006 ) ( 15 ) .
physiological and biochemical tests were carried out according to the standard protocols described by smibert and krieg ( 1994 ) and ventosa ( 2004 ) ( 16 , 17 ) . to determine the optimum temperature and ph for the growth of the strain
, the cultures were incubated at a temperature range of 1550 c with intervals of 5 c and ph values of 510.5 .
ph values below and above 6 were adjusted by sodium acetate and tris - hcl buffer , respectively . also , growth of the strain was evaluated at different % nacl values ( 030 % nacl ) ( 13 , 18 ) .
isolated strain was screened for susceptibility to a panel of 15 antibiotics discs ( padtan teb , iran ) viz : penicillin ( p10 ) , ampicillin ( am10 ) , cephalothin ( cf30 ) , cefazolin ( cz30 ) , streptomycin ( s10 ) , gentamicin ( gm10 ) , chloramphenical ( c30 ) , tetracycline ( t10 ) , erythromycin ( e15 ) , trimethoprim sulfamethoxazol ( sxt ) , nalidixic acid ( na30 ) , ciprofloxacin ( cp5 ) , vancomycin ( v30 ) and polymyxin b ( pb300 ) ( 18 ) .
cells were cultured in 100 ml erlenmeyer flasks containing 25 ml of lb broth supplemented with 1000 g / ml sodium selenate .
the basal medium ( lb broth + sodium selenate ) was inoculated with 1% of 1.5 10 cfu / ml of the bacterial suspensions and incubated aerobically at 35 c and ph value of 7 on a shaking incubator ( 150 rpm ) for 2 days .
the cells were centrifuged at 10000 rpm for 10 minutes and the supernatants were used to determine the residual sodium selenate through slightly modified kinetic spectrophotometric method based on the catalytic role of selenite in reducing thionine dye by sulfide ions ( 13 , 19 ) . for the measurement of se sorption
, selenate was first reduced to selenite by mixing with concentrated hcl ( 2:1 , by vol . ) in a screw capped tube in a 90 c water bath for 1 h ( 20 ) and assay was followed as above .
capacity of selenate removal by the strain was evaluated at different ph values ( 510.5 ) and temperatures ( 1540 c ) and on a shaking incubator ( 50200 rpm ) in basal medium supplemented with 1000 g / ml sodium selenate . to evaluate the effect of initial selenium concentration , selenate removal
was monitored in basal medium supplemented with varying concentration of sodium selenate ( 2002000 g / ml ) .
genomic dna of the isolate was extracted with a genomic dna extraction kit ( cinnagene ) by following the manufacturer s recommended procedure .
the 16s rrna gene was amplified using the universal primers 8f ( 5-agagtttgatymtggctcag-3 ) and 1541r ( 5-aaggaggtgatccagccgca-3 ) .
the amplification was done by initial denaturation at 95 c for 5 minutes ; subsequent denaturation at 95 c for 1 minute ; annealing at 66.6 c for 1 minute ; extension at 72 c for 1 minute and final extension at 72 c for 10 minutes .
the pcr product was directly double - strand sequenced by seqlab laboratory ( germany ) .
the analysis of dna sequences and homology searches were completed using the blast algorithm for the comparison of the nucleotide query sequence against a nucleotide sequence database .
phylogenetic tree was inferred using the neighbor - joining method as implemented in the software .
among the 30 strains of bacteria isolated from industrial wastewaters in iran , one strain was selected for further study .
the resistance of strain qw4 was associated with reduction of selenate to selenium and the formation of the red elemental selenium precipitate in the medium .
strain qw4 was shown to be a gram - negative , motile , strictly aerobic rod , catalase - positive and nonoxidase .
the strain qw4 could grow in a range of temperatures ( 1550 c ) , ph conditions ( 510.5 ) and % nacl range ( 030% ) .
however , optimum growth was seen at 35 c , ph 7.0 and 3% nacl .
table 1 , shows some characteristics of strain qw4 . according to morphological , physiological and biochemical characterizations of the strain and in comparison to other studies ,
also , antibiotic resistance patterns of strain qw4 as selected strain is shown in table 2 .
r : resistance , i : intermediate , s : susceptible to confirm the identity of the isolate , pcr amplification , sequencing of the 16s rrna gene were completed . the phylogenetic tree ( fig .
1 ) constructed by the neighbor - joining method indicated that the isolate qw4 was part of the cluster within the proteus genus . among the described species , the closest relative of isolate qw4 was proteus hauseri ( fr733709 - 1 ) .
neighbor - joining tree showing the phylogenetic position of proteus hauseri strain qw4 among members of rod gram - negative bacteria .
strain qw4 , which showed the maximum resistance to sodium selenate , was selected for removal of selenate from contaminated environments .
the effects of various environmental parameters in removing sodium selenate from culture medium by the strain were evaluated using sodium sulfide - thionine as an indicator .
the strain also showed the reduction ability of selenate after 2 days in comparison with the control ( a medium without the strain ) .
the maximum selenate removal in lb broth medium with a concentration of 1000 g / ml sodium selenate was determined to be 100% after 2 days . different concentrations effect of selenate on their removal by strain qw4 in lb broth medium ( temperature = 35 c , ph = 7.2 0.2 , rpm = 150 ) .
reduction was monitored after 24 , 48 , 72 , 96 , 120 , 144 h. as shown in figs . 3 , 4 and 5 , ph , temperature and rpm had significant effects on sodium selenate removal and the maximum removal occurred at ph value of 7.0 , 35 c and 150 rpm .
at higher and lower ph , temperature and rpm , the amount of sodium selenate removal was less .
the reduced removal capacities at ph value of 7 , temperature of 35 c and shaking incubator of 150 rpm were 60.2% , 42.1% and 60.3% , respectively .
effect of ph values on selenate removal by strain qw4 in lb broth medium containing 1000 g / ml selenate after 24 h ( temperature = 35 c , rpm = 150 ) .
temperature effect on selenate removal by strain qw4 in lb broth medium containing 1000 g / ml selenate after 24 h ( ph = 7 , rpm = 150 ) . shaking incubator effect on selenate removal by strain qw4 in lb broth medium containing 1000
g / ml selenate after 24 h ( t = 35 c , ph = 7 ) .
among the 30 strains of bacteria isolated from industrial wastewaters in iran , one strain was selected for further study .
the resistance of strain qw4 was associated with reduction of selenate to selenium and the formation of the red elemental selenium precipitate in the medium .
strain qw4 was shown to be a gram - negative , motile , strictly aerobic rod , catalase - positive and nonoxidase .
the strain qw4 could grow in a range of temperatures ( 1550 c ) , ph conditions ( 510.5 ) and % nacl range ( 030% ) .
however , optimum growth was seen at 35 c , ph 7.0 and 3% nacl .
table 1 , shows some characteristics of strain qw4 . according to morphological , physiological and biochemical characterizations of the strain and in comparison to other studies ,
also , antibiotic resistance patterns of strain qw4 as selected strain is shown in table 2 .
r : resistance , i : intermediate , s : susceptible to confirm the identity of the isolate , pcr amplification , sequencing of the 16s rrna gene were completed . the phylogenetic tree ( fig .
1 ) constructed by the neighbor - joining method indicated that the isolate qw4 was part of the cluster within the proteus genus . among the described species , the closest relative of isolate qw4 was proteus hauseri ( fr733709 - 1 ) .
neighbor - joining tree showing the phylogenetic position of proteus hauseri strain qw4 among members of rod gram - negative bacteria .
strain qw4 , which showed the maximum resistance to sodium selenate , was selected for removal of selenate from contaminated environments .
the effects of various environmental parameters in removing sodium selenate from culture medium by the strain were evaluated using sodium sulfide - thionine as an indicator .
the strain also showed the reduction ability of selenate after 2 days in comparison with the control ( a medium without the strain ) .
2 . typically , the maximum selenate removal in lb broth medium with a concentration of 1000 g / ml sodium selenate was determined to be 100% after 2 days
. different concentrations effect of selenate on their removal by strain qw4 in lb broth medium ( temperature = 35 c , ph = 7.2 0.2 , rpm = 150 ) .
reduction was monitored after 24 , 48 , 72 , 96 , 120 , 144 h. as shown in figs . 3 , 4 and 5 , ph , temperature and rpm had significant effects on sodium selenate removal and the maximum removal occurred at ph value of 7.0 , 35 c and 150 rpm .
at higher and lower ph , temperature and rpm , the amount of sodium selenate removal was less .
the reduced removal capacities at ph value of 7 , temperature of 35 c and shaking incubator of 150 rpm were 60.2% , 42.1% and 60.3% , respectively .
effect of ph values on selenate removal by strain qw4 in lb broth medium containing 1000 g / ml selenate after 24 h ( temperature = 35 c , rpm = 150 ) .
temperature effect on selenate removal by strain qw4 in lb broth medium containing 1000 g / ml selenate after 24 h ( ph = 7 , rpm = 150 ) . shaking incubator effect on selenate removal by strain qw4 in lb broth medium containing 1000
g / ml selenate after 24 h ( t = 35 c , ph = 7 ) .
human activities have been contaminating the environment with toxic heavy metals and metalloids over the past 200 years and , consequently , have resulted in severe disturbance of ecological balance in most ecosystems ( 6 ) .
biodiversity of microorganisms harboring this capability attracts attention of researchers to look for novel microorganisms , elucidate new pathways or specific enzymes with superior oxyanion - metabolizing activity or different substrate specificity ( 11 ) .
thus , introduction of a newly isolated bacterial strain and characterization of its oxyanion - processing capabilities were considered the goal of this research .
we isolated 30 strains from various industrial waste - waters in iran and evaluated their resistance patterns to sodium selenate .
strain qw4 showed the maximum mic ( equal to 760 mm ) , which was much higher than that previously reported for bacillus sp .
in fact , strain qw4 showed maximum oxyanion reduction and resistance ability for the first time in this research .
based on a partial 16s rrna sequence , it was determined that strain qw4 was phylogentically related to the proteus genus .
the isolated bacteria were pink to red when supplemented with selenate which was due to the accumulation of elemental selenium .
hunter et al . , ( 2009 ) also observed red colonies indicating the formation of elemental red selenium as a reduction product of selenate in pseudomonas sp .
the genetically modified bacteria carry a plasmid containing genes conferring resistance to the antibiotics as well as resistance to toxic oxyanions of selenium ( 23 ) .
strain qw4 showed resistance to penicillin , ampicillin , cephalothin , cefazolin , tetracycline , erythromycin , vancomycin and polymyxin b as well as resistance to selenate .
our results imply that heavy metal pollution may contribute to increased antibiotic resistance through indirect selection .
the biological methods and the effects of different environmental parameters were used to demonstrate the removal of sodium selenate by strain qw4 . in 2003 ,
watts et al . reported that enterobacter cloacae sld1a-1 is able to remove 94.5% of 127 mm selenate at 37 c , ph 8 and 180 rpm ( 10 ) . in 2006
g / l selenate removed during 9 days at 35 c and ph 7 by siddique et al .
the results obtained showed that under the following conditions a maximum removal of sodium selenate in the supernatant from 1000 g / ml to 0 occurred after 2 days : ph 7.0 , 100 temperature 35 c and 150 rpm . generally , there was a good correlation between the optimal ph , temperature and rpm for growth and removal of selenate by strain qw4 .
conventional chemicals methods for removing toxic oxyanions are expensive and require high energy or large quantities of chemical reagents , while microbial reduction of these toxic oxyanions is cost effective and supports green technology .
transformation of selenate to elemental selenium could offer an important mechanism for the removal of toxic selenate from polluted environments .
strain qw4 was resistant to high concentrations of selenate and also , it reduced selenate to red elemental selenium under aerobic conditions . therefore , this strain could be a good candidate for bioremediation of highly polluted effluents from industrial operations .
Output:
| background and objective : selenium is essential for biological systems at low concentrations and toxic at higher levels .
heavy metals and metalloids such as selenium are major contaminants in 40% of hazardous waste sites . thus , bioremediation has been considered as an effective means of cleaning up of selenium - contaminated sites.materials and methods : in this study , 30 strains were isolated from wastewater samples collected from selenium - contaminated sites in qom , iran using the enrichment culture technique .
one bacterial strain designated qw4 , identified as
proteus hauseri
by morphological , biochemical and 16s rrna gene sequencing was studied for its ability to tolerate different concentrations of sodium selenate ( 100800 mm ) .
also , the disk diffusion method was performed to determine resistance to some antibioticsresults : strain qw4 showed maximum minimum inhibitory concentration ( mic ) to selenate ( 760 mm ) .
the maximum selenate removal was exhibited at 35 c , while the removal activity reduced by 30.7% and 37% at 25 c and 40 c , respectively .
the optimum ph and shaking incubator for removal activity was shown to be 7.0 and 150 rpm , with 60.2% and 60.3% , respectively .
this bacterial strain was resistant to some antibiotics.conclusion:the concentration of toxic sodium selenate ( 1000 g / ml ) in the supernatant of the bacterial culture medium decreased by 100% after 2 days and the color of the medium changed to red due to the formation of less toxic elemental selenium .
also , our results imply that heavy metal pollution may contribute to increased antibiotic resistance through indirect selection . |
PubmedSumm6835 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the descemet 's stripping automated endothelial keratoplasty ( dsaek ) procedure is primarily used to treat corneal endothelial dystrophies , and more recently to treat endothelial failure in previous penetrating keratoplasty .
descemet 's membrane and endothelium are removed through a small incision and replaced with donor tissue , which adheres to the recipient 's inner corneal stroma .
the advantages of the dsaek procedure when compared with the traditional penetrating keratoplasty ( pk ) technique have been previously described in the literature [ 1 , 38 ] .
the major postoperative complication of the dsaek procedure is dislocation of the donor tissue from the corneal transplant bed , which has been reported to happen in 427% of patients [ 1 , 5 , 7 , 9 , 10 ] .
donor detachments are most likely attributed to surgeon error or a lack of donor tissue viability . in ontario , procured donor tissue is sent to the eye bank of canada before being shipped to the transplanting surgeons for implantation .
a period of time , typically hours , passes between the death of the donor and enucleation of the eye , and between enucleation and processing .
the tissue then spends a period of days in storage at the eye bank before implantation in the recipient eye .
currently all dsaek donor tissue is prepared by individual surgeons in ontario at the site and time of transplantation , as precut dsaek tissue is not available .
it is our hypothesis that a greater period of time spent in storage prior to processing results in a greater loss of tissue viability and concordantly leads to a higher rate of detachment .
additionally , it is hypothesized that a higher endothelial cell count indicates better tissue function and results in a lower detachment rate
. the primary aim of our investigation is to determine whether these factors play a predictive role in tissue detachment in one surgeon 's practice .
data on donor tissue and procedure outcome were collected through a retrospective chart review of all patients in one academic surgeon 's practice at hotel dieu hospital in kingston , ontario .
the investigation included all of the senior author 's dsaek patients from april 1 , 2007 until march 30 , 2010 .
for all procedures the surgeon cut the donor tissue minutes prior to implantation in the patient .
no major problems occurred in preparing the tissue that might have contributed to dsaek button detachment .
four venting incisions were used in all patients , and interface fluid was drained via these incisions in all patients until no further fluid could be drained .
all patients had a complete fill of air in their anterior chambers for 15 minutes after the drainage of fluid from the venting incisions , and about 50% of the air was removed just prior to concluding each case , to ensure no papillary block developed .
all patients were kept in the recovery area , lying flat for 1 hour postoperatively .
all patients were routine cases undergoing dsaek for fuchs ' endothelial dystrophy or pseudophakic bullous keratopathy .
data on length of time between donor death and tissue procurement , procurement and processing , and time spent in storage were taken from the eye bank reports that accompany the donor tissue .
a total of 71 procedures were performed during the period of study , with 10 resulting in postoperative tissue detachment .
duration of time spent between enucleation , processing , and implantation , as well as endothelial cell count for the detachment and nondetachment groups are summarized in table 1 .
the time spent in each phase of processing was compared between the detachment and nondetachment group using a paired student 's t - test .
this showed no statistically significant difference between the two groups , with the p values reported in table 1 .
endothelial cell counts of the two groups were similarly compared using a paired student 's t - test , again showing no statistically significant difference between the 2 groups .
as demonstrated by our results , there was no statistically significant difference in the storage and processing times between the detachment and nondetachment groups .
this suggests that slight variations in donor tissue processing and storage times do not result in a higher incidence of dsaek graft dislocation .
this of course would apply only to this surgeon 's practice , but may warrant further investigation .
also , it would only include intraoperatively prepared donor tissue and not precut tissue , prepared by the eye bank .
however , dapena et al . described success with a range of ages of precut tissue , suggesting that this result may apply to precut tissue as well .
they did not , however , make a direct comparison between a population of successful implantations and graft failures .
additionally , the use of surgeon - cut tissue has not been shown to have a different incidence of graft dislocation as compared to precut tissue [ 11 , 12 ] .
endothelial cell count was also found not to be significantly different between the two groups , within the population of donor tissue available from the eye bank .
contrary to our initial expectation , the average cell count was actually slightly higher in the detachment group than in the nondetachment group , though this did not reach statistical significance .
the main limitation to this study is its limited scope , including only the practice of one surgeon .
neither length of processing time nor endothelial cell count appears to be significant predictors of graft dislocation in dsaek procedures in one surgeon 's practice .
this suggests that in kingston , all donor tissue from the eye bank being cut by the surgeon at the time of surgery has an equal chance of being successfully implanted , with the determinant of procedural success lying in the technique of the attending surgeon . a future direction for
study could include various surgeons looking at their dislocation rates to see if this is the case in general , or that it was an isolated finding in one surgeon 's practice .
Output:
| purpose . to determine whether the rate of graft detachment in patients undergoing the dsaek procedure is influenced by the time elapsed between donor death and tissue implantation
. methods . data on procedure outcome and donor tissue for patients undergoing the dsaek procedure were reviewed .
data on time elapsed between harvest , processing , storage , and implantation of the tissue , as well as donor tissue endothelial cell count were obtained from reports made available from the eye bank of canada .
the adverse outcome of interest was graft detachment .
results .
71 cases were reviewed , with 14% resulting in detachment .
the following time periods were compared between detachment and nondetachment groups : donor death to enucleation ; enucleation to processing ; duration of storage at the eye bank to implantation .
no statistically significant differences were found ( student 's t - test , p > 0.05 ) .
endothelial cell counts of donor tissue were compared between the two groups , and no statistically significant difference was found ( student 's t - test , p > 0.05 ) . conclusion .
the range of processing times and endothelial cell counts in donor tissue available from the eye bank did not predict a change in the rate of graft dislocation in one surgeon 's practice . |
PubmedSumm6836 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: following the approval of the study by institutional ethics committee , informed consent was obtained and 40 patients classified as american society of anesthesiologists physical status ( asa ) i ii scheduled for ent procedures were enrolled in this prospective study .
the surgical procedures involved were septoplasty , polypectomy , endoscopic sinus surgery , rhinoplasty , nasal reconstructive surgery , or a combination thereof .
the surgeries were not performed by the same surgeon ; however , the surgeons who performed the surgeries had close seniorities .
patients aged 18 - 65 , who did not receive any sedative or analgesic drugs for 24 hours before surgery , and patients who were not significantly hypertensive ( diastolic blood pressure 100 mmhg ) or hypotensive ( systolic blood pressure 100 mmhg ) , or who did not present any previous signs of bradyar - rhythmic heart disorders were included in the study .
patients were randomly allocated into two groups according to computer generated group numbers as tci group or des group corresponding to administration either propofol / remifentanil tci ( tci group ; n = 20 ) or an inhalational anesthetic regimen using desflurane / remifentanil ( des group ; n = 20 ) . before the operation
, patients were taught to evaluate their pain according to a numeric rating scale ( nrs ) on an 10 point pain scale , where 0 corresponds to no pain while 10 means worst possible pain .
standard monitoring included electrocardiogram , non - invasive blood pressure , pulse oximetry ( spo2 ) and end - tidal carbon dioxide ( etco2 ) .
the quatro sensor electrodes were placed on foreheads and bis values were displayed using an aspect electroencephalogram monitor ( a-2000 bis xp platform ; aspect medical systems , newton , usa ) .
muscle relaxation was monitored with a train - of - four nerve stimulator ( tof watch sx ; organon , ireland ) .
measurements obtained peroperatively that is , one minute after the induction ( beginning of propofol infusion ) ; when loss of consciousness ( loc ) was confirmed through loss of eyelid reflex and verbal contact ; the 1 and 5 minutes after tracheal intubation ; 1 , 5 and 10 minutes after incision ; and then with 10 minute intervals and at tracheal extubation , were recorded .
the records of patients were also followed up and kept at the post - anesthesia care unit ( pacu ) .
on arrival in the operating room , the baseline values for bis , heart rate ( hr ) , mean arterial pressure ( map ) , and spo2 were obtained , and an intravenous catheter was placed . before induction of anesthesia , patients were given 5 ml kg intravenous isotonic solution and then breathed 100% oxygen for 5 minutes .
propofol and remifentanil were administered with a tci device ( orchestra base primea , fresenius kabi , france ) . syringes of 1% propofol ( 10 mg / ml ) and remifentanil ( 50 g / ml ) were simultaneously loaded on the device and connected to the patient 's intravenous catheter using a three - way stopcock . the pharmacokinetic models of schnider et al17 and minto et al1819 were both used .
general anesthesia was induced with 3 ng ml and 4 g ml effect site concentrations ( ce ) of remifentanil and propofol , respectively .
these drug doses were determined by a previous study.20 after loc , the tof monitor was switched on and tracheal intubation was facilitated with rocuronium bromide 0.6 mg kg .
all patients were ventilated with a fresh gas flow of 4 l min of oxygen ( 50% ) and air ( 50% ) mixture to maintain etco2 between 30 and 35 mmhg ( drger , julian plus , germany ) .
after intubation , for maintenance of hypnosis , while propofol infusion was continued in the tci group , it was ceased in the des group and desflurane with an initial delivered fraction of 6% was administered . during the surgery , while the propofol target concentration was adjusted in increments of 0.5 l ( increased or decreased ) , inspired fraction of desflurane was adjusted in increments of 1% volume ( increased or decreased ) in order to keep bis value at 50 10.21 muscle relaxation was supplemented if required ( with the aim of maintaining at least one twitch using the train - of - four monitor ) with 0.05 mg kg rocuronium bromide .
hypotension ( a decrease in map of more than 20% of the baseline value ) was treated first with fluid administration , and then with a small bolus of ephedrine .
if the patient did not respond to this treatment , the level of tci remifentanil was decreased or the infusion was discontinued completely . however , if hypertension occurred when the bis value was between 40 and 60 the level of tci remifentanil was increased . at the end of surgery
, all anesthetics were discontinued without tapering and the lungs were ventilated with 100% oxygen at a fresh gas flow of 6 l min .
the patients were extubated when adequate spontaneous ventilation and response to verbal command were established .
the duration of anesthesia was defined as the period from the start of anesthesia induction to the discontinuation of all the anesthetic drugs .
surgery time was defined as the period from the start of the surgery to the end of the surgery .
emergence from anesthesia was assessed as the time from the end of operation until the time of orientation ( recalling name and date of birth ) . during the emergence time , times of returning to spontaneous ventilation , eye opening , tracheal extubation , responding to verbal commands ( such as hand squeezing ) , and orientation were recorded .
thereafter , the patients were directly transferred to the pacu , where further follow - up was done by an independent , blinded observer , who was unaware of anesthesia regimen administered .
post - anesthesia recovery was scored for pacu discharge eligibility using the aldrete recovery scoring ( ars ) .
criterion for discharge from pacu was defined as ars greater than 9 . during the observation period in the pacu ,
hemodynamic parameters were recorded as well as side effects such as postoperative nausea and vomiting ( ponv ) .
patients were asked every 5 min until discharge from pacu to indicate pain experience on the nrs .
postoperative pain greater than 3 on the nrs and shivering was treated with intramuscular 1 mg kg meperidine , and also emesis was treated with intravenous 10 mg metoclopramide .
the patients were visited in the clinic postoperatively and asked whether they had any problems regarding pain and anesthetic management , and whether they experienced recall of intra - operative events .
twenty patients per treatment group were necessary to detect a reduction of 15% in the mean levels of the characteristics of emergence from anesthesia with a level of significance of p values < 0.05 and a statistical power of 0.90 .
data were expressed as mean standard deviation ( mean sd ) or n ( % ) where appropriate .
the chi - square or the fisher 's exact test was used to compare categorical data .
a p value less than 0.05 was used as a critical value to assess whether the obtained p values were significant .
the analyses were done on a personal computer using spss version 14 statistical software for windows ( spss inc . ,
twenty patients per treatment group were necessary to detect a reduction of 15% in the mean levels of the characteristics of emergence from anesthesia with a level of significance of p values < 0.05 and a statistical power of 0.90 .
data were expressed as mean standard deviation ( mean sd ) or n ( % ) where appropriate .
the chi - square or the fisher 's exact test was used to compare categorical data . a p value less than 0.05 was used as a critical value to assess whether the obtained p values were significant .
the analyses were done on a personal computer using spss version 14 statistical software for windows ( spss inc . , chicago , il , usa ) .
twenty patients per treatment group were necessary to detect a reduction of 15% in the mean levels of the characteristics of emergence from anesthesia with a level of significance of p values < 0.05 and a statistical power of 0.90 .
data were expressed as mean standard deviation ( mean sd ) or n ( % ) where appropriate .
the chi - square or the fisher 's exact test was used to compare categorical data . a p value less than 0.05 was used as a critical value to assess whether the obtained p values were significant .
the analyses were done on a personal computer using spss version 14 statistical software for windows ( spss inc . , chicago , il , usa ) .
duration of anesthesia and surgical intervention , and the time required for loc were similar between the two groups ( table 2 ) .
patients demographic characteristics ( mean sd ) characteristics of anesthesia management ( mean sd ) during the follow - up period ( figure 1 ) , there were statistically significant differences between the groups with regard to general mean values of map ( p < 0.001 ) .
after induction of anesthesia , map decreased in both groups . in the 1 minute of intubation , there was a slight increase in map in both groups ; and until the 30 minute , map values were between 70 - 80 mmhg parallel to each other in both groups .
the increase in map steadily continued and at the 30 , 60 , 70 , 80 , 90 , and 120 minutes , the increase in the tci group was significantly more than it was in the des group ( p < 0.05 ) . at extubation
mean arterial pressure values of tci and des groups ( mean sd ) c : control ; ind : induction ; loc : loss of consciousness ; int : intubation ; inc : incision ; ext : extubation * p < 0.5 versus the des group there were statistically significant differences between the groups with regard to general mean values of hr ( p < 0.01 ) ( figure 2 ) . before intubation , hr values decreased insignificantly from the baseline .
however , at the 1 minute after the intubation , the values for both groups increased insignificantly . in the following periods
, there was still a trend towards lower hr values which were significantly lower 1 , 5 , 10 , 20 , 30 and 40 minutes after incision in the des group than in the tci group .
at extubation , hr values were higher than the baseline values in the des group whereas hr values were lower than the baseline values in the tci group , that is , there was a significant difference between the two groups ( p < 0.05 ) . in general , hr values were observed to be within normal limits .
heart rate values of tci and des groups ( mean sd ) c : control ; ind : induction ; loc : loss of consciousness ; int : intubation ; inc : incision ; ext : extubation * p < 0.5 versus the des group the total doses of anesthetics given are shown in table 2 .
the differences in remifentanil consumption occurred due to the difference in the duration of anesthesia .
need for increase or decrease in the remifentanil rate was not required for any of the patients .
the surgical procedures involved in our study were septoplasty , polypectomy , endoscopic sinus surgery , rhinoplasty , nasal reconstructive surgery , or a combination thereof .
there was no significant difference between the two groups in the time of emergence from anesthesia ( spontaneous ventilation , eye opening , response to commands , extubation and orientation ) ( table 3 ) . in the pacu
, there was no significant difference between the two groups in terms of the ars . during the first 30-minute follow - up in the pacu ( figure 3 )
, 2 patients ( 10% ) in the tci group , and 3 patients ( 15% ) in the des group suffered from nausea .
in addition , again in this 30-minute period , 5 patients ( 25% ) in tci group and 6 patients ( 30% ) in des group stated that they had pain ( nrs > 3 ) .
however , when all the patients were taken into consideration , mean of nrs value was 3 .
there was no significant difference between the groups regarding the incidence of ponv and requirement for analgesia .
besides , none of the patients who were visited in the clinic postoperatively stated that they had any problems with regard to pain and anesthetic management .
again , during postoperative visits , no postoperative recall of intra - operative events was observed .
characteristics of emergence from anesthesia ( mean sd ) aldrette recovery scoring ( ars ) of tci and des groups ( figure 3 is not mentioned in the text , remove it or mention it )
remifentanil may be useful in ent surgery because of the clinical advantages of remifentanil such as the rapid onset and offset with a context - sensitive half - time of only 3 - 5 minutes irrespective of the duration of infusion.2223 furthermore , remifentanil is the most preferred opioid for use in conjunction with propofol based tci anesthesia . on the other hand , intravenous propofol , currently used for the induction and maintenance of anesthesia ,
has a favorable pharmacokinetic profile for use with the tci system.2426 newer volatile anesthetics such as desflurane have a low blood - gas solubility coefficient , allowing for rapid induction of and rapid recovery from anesthesia similar to propofol.27 one of the problems of many studies is that the depth of anesthesia is determined according to weaker criteria instead of using bis monitoring for guiding administration of anesthesia . when intravenous and inhalation anesthetics are compared , it is not obvious that the doses used are equianesthetic . to ensure comparable depths of anesthesia , the anesthesiologist has to rely on clinical indicators such as blood pressure , heart rate and autonomic signs to titrate the maintenance of anesthetics.416 bispectral index was successful in reducing average anesthetic agent consumption and accelerating recovery , and was proved to be useful for measuring the depth of anesthesia.1115 an index value less than 60
was correlated with loc and loss of recall in 95% of patients.21 the present study was designed to compare the effects of a bis guided tci propofol / remifentanil with desflurane / remifentanil anesthesia regimens . in none of the patients in either group did postoperative recall of intraoperative events occur .
. the importance of rapid emergence may be quick transfer from the operation room , less work load on the recovery room staff , or even direct transfer from the operation room to phase ii recovery , resulting in cost savings .
the focus of our investigation was the early postanesthetic period where we sought for a fast return to normal recognition and an adequate orientation before discharge from pacu .
we found that recovery times were similar with both inhalational and tci anesthesia in the ent surgical population .
as mentioned above , to our knowledge , there are no published reports comparing desflurane and propofol tci anesthesia in combination with remifentanil tci under bis guidance . however , when propofol and desflurane anesthesia regimens were compared , various results with regard to recovery profile were obtained .
a systematic analysis of the literature comparing postoperative recovery after propofol , isoflurane , desflurane , and sevoflurane based anesthesia in adults demonstrated that early recovery was faster in the desflurane groups.5 in another remifentanil based study with desflurane or propofol for laparoscopic cholecystectomy , no differences were demonstrated between the two anesthetic regimens regarding early emergence from anesthesia.4 in one of the studies where tci was used , as the case is in our study , inhalation anesthesia with desflurane or sevoflurane was compared with propofol delivered by the tci technique . for this patient group ,
use of inhalation anesthesia shortened emergence times compared to tci with propofol with equal peroperative patient conditions.6 again in another study where the tci technique was used , inhalation anesthesia with desflurane and tci with propofol anesthetic regimens were compared and no significant difference was observed between the two studies in terms of recovery profiles.7 propofol administered by tci proved to provide cardiovascular stability and ensure smooth induction and fast stability.2829 in a study where desflurane in combination with etomidate induction was compared to target and manually controlled infusion with propofol anesthetic regimens , desflurane was found to ensure better hemodynamic stability in comparison to manually controlled infusion of propofol and propofol tci was found to reduce this difference.10 again in another remifentanil based study with desflurane or propofol , no major differences were demonstrated between the two anesthetic regimens regarding cardiovascular variables.4 in our study , in general , map and hr values were observed to be within normal limits and we did not detect any evidence of sympathetic stimulation such as tachycardia or hypertension in either group .
we would expect tachycardia and hypertension to occur especially in des groups as these are among the adverse effects of desflurane.21 however , in our study the general mean values of map and hr for tci group were significantly higher than des group , which is attributed to the combination of desflurane with remifentanil tci under bis guidance .
in fact , the hemodynamic response to remifentanil appeared to be similar to that to other opioids ; that is , a decrease in heart rate and blood pressure may occur.30 nevertheless , in the present study , the use of tci technique prevented the occurrence of severe bradycardia and hypotension as well as chest wall rigidity after bolus injections of remifentanil , even during induction of anesthesia .
the primary selection of ent surgery was of interest in the design of this study because it is associated with a higher risk of ponv .
the prevalence of ponv for ent surgery was around 20% in the desflurane group , consistent with recent reports describing the frequency of ponv in all surgeries to be 20 - 30%.31 whereas in our study , during the first 30-minute followup in the pacu , 10% of patients in the tci group and 15% of patients in the des group suffered from nausea .
although our patients underwent ent surgeries , the ponv rate was found to be lower than it was expected , and this low rate can be explained by monitoring of depth of anesthesia with bis index during the surgery . when considered in terms of postoperative pain , in 25% of patients in the tci group and 30% of patients in the des group ,
however , when all the patients were taken into consideration , mean of nrs value was 3 in both groups . during postoperative patient visits ,
none of the patients in either group had any complaints regarding pain and anesthetic management .
this study can be criticized for the fact that the anesthesiologists were aware of the anesthetic drugs being administered , and that the protocol design did not permit a double - blind comparison of the maintenance anesthetic techniques .
however , surgical procedures were identical and all of the patients were managed by the same experienced surgeons and anesthesiologists .
a further improvement in emergence might have been achieved by tapering the amount of remifentanil and of the concomitant hypnotic components down towards the end of surgery instead of continuing with unchanged doses until the end of the wound closure .
however , it has been proved that tci administration of opioids offers better control of emergence , and the application of remifentanil by means of tci may give a more objective assessment of recovery with its short half life .
another criticism of this study design relates to the lack of investigator blinded in the assessments of early recovery status .
however , investigator bias was minimized by using only objective endpoints and by blinding the recovery room nursing staff .
the recovery endpoints were evaluated in a blinded fashion by trained individuals who were not involved in the anesthetic administration .
we concluded that bis guided combinations of remifentanil tci with either propofol tci or desflurane anesthetic regimens are both suitable for patients undergoing ent surgery , providing rapid smooth induction of anesthesia , intraoperative hemodynamic stability and a fast emergence from anesthesia , and with no difference in terms of adverse effects .
additionally , the lower blood pressure in the remifentanil tci with desflurane anesthetic regimens may be a significant advantage in those procedures where a low blood pressure contributes to the reduction of bleeding .
am and dc carried out the design and coordinated the study , participated in most of the experiments and prepared the manuscript .
gik and dta provided assistance in the design of the study , coordinated and carried out all experiments and participated in manuscript preparation .
Output:
| background : our objective was to examine the clinical properties of two anesthetic regimens , propofol target - controlled infusion ( tci ) , or desflurane using remifentanil tci under bispectral index ( bis ) guidance during ear , nose , and throat ( ent ) procedures.methods:forty consenting patients who scheduled for ent procedures were prospectively studied and were included in one of the two groups : tci group or desflurane ( des ) group .
general anesthesia was induced with 3 ng ml-1 and 4 g ml-1 effect site concentrations ( ce ) of remifentanil and propofol , respectively , with tci system .
after intubation , while propofol infusion was continued in the tci group , it was ceased in the des group and desflurane with an initial delivered fraction of 6% was administered .
the ce of propofol infusion and inspired fraction of desflurane was adjusted in order to keep bis as 50 10.results:general mean values of mean arterial pressure ( map ) and heart rate ( hr ) for the tci group was significantly higher than des group ( 89.3 mmhg and 72.4 bpm vs. 77.1 mmhg and 69.5 bpm ) .
early emergence from anesthesia did not significantly differ between the groups .
the rate of patients aldrete score ( ars ) to reach 10 was found to be 100% at the 15th min in both groups.conclusions:bispectral index guided combinations of remifentanil tci either with propofol tci or desflurane anesthetic regimens are both suitable for patients undergoing ent surgery . the lower blood pressure in the remifentanil tci with desflurane anesthetic regimens may be a significant advantage . |
PubmedSumm6837 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: common skin tumors like basal- and squamous - cell carcinoma present a serious problem in modern medicine .
it is confirmed that a variety of biological consequences such as increases in skin cancer or cataract may result from the increased uv exposure due to ozone depletion and atmospheric ozone hole .
uv radiation may also be produced by artificial sources , for example by quartz lamps frequently used in tanning parlors .
carcinogenesis of skin tumors is very often associated with chronic exposure to uv radiation , and frequent sunburns in childhood may lead to skin cancer in later age .
uv - a and uv - b radiation are responsible for photoaging , an accelerated aging of skin .
photoaging is characterized by loss of skin elasticity , roughness , deep wrinkles and pigmentations .
one of the most common malignant skin tumors is basal cell carcinoma ( bcc ) .
bcc most commonly occurs in middle - aged and elderly persons ( 5070 years old ) , mainly in caucasians who were exposed to sunlight radiation .
one of the most important biological features is low degree of malignancy and low rate of local growth ; however , over time it may contribute to local destruction of surrounding tissues , resulting in deep ulcerations .
bcc is mainly located on the skin exposed to uv light , especially on the head , neck and limbs .
these lesions more often recur after incomplete surgical treatment , but generally bcc has a good prognosis .
surgery , cryosurgery , electrodissection and co2 laser therapy are typical treatment methods [ 48 ] .
photodynamic therapy ( pdt ) comprises 2 main agents : light and a specific chemical compound called a photosensitizer .
photosensitizers have a high affinity to malignant cells and after absorption of energy from light they shift into an excited state .
a photosensitizer in the excited state causes photochemical reactions that lead to necrosis and apoptosis in pathological tissues . for many years pdt
was used to detect and to treat different lesions located in the skin and mucosa [ 913 ] .
photosensitizers show a high affinity to rapidly proliferating cells such as atypical and cancer cells . in the present study we used levulan as a natural precursor of porphyrins , which is metabolized in vivo into protoporphyrin ix ( pp ix ) .
since 1990 , aminolevulinic acid ( ala ) as a precursor of protoporphyrin ix was frequently used in local pdt . at present ,
ala is successfully applied in treatment of basal cell carcinoma , squamous cell carcinoma ( scc ) , solar keratosis , and urothelial cancer of the urinary bladder [ 1416 ] .
tau - like receptors of dendritic cells and macrophages under the influence of imiquimod respond with secretion of cytokines and chemokines such as interferon ( inf- , inf- ) , tnf- , and interleukins ( il-1 , il6 , and il-8 ) .
moreover , imiquimod stimulates langerhans cells to present antigens of transformed cells to lymphocytes t in regional lymph nodes . using natural mechanisms of the immune system
, aldara is approved for treating condyloma of the genital organs , solar keratosis and superficial form of basal cell carcinoma ( bcc ) .
uniquely , imiquimod abolishes immunosuppressive phenomena generated by exogenous factors that allow precancerous and cancerous lesions to propagate .
since the uses of imiquimod and pdt separately are well documented , we decided to combine both methods .
the aim of our study was to evaluate the effectiveness of local photodynamic therapy supplemented with topical application of aldara in treatment of basal cell carcinoma .
thirty - four patients ages 50 to 68 years were enrolled into the trial and underwent pdt treatment .
all these cases were previously treated using routine methods ( cryosurgery , laser therapy or surgical excision ) without satisfactory results .
lesions were located on the skin of the face ( nose , nasolabial sulcus , cheek , suborbital region ) with common bcc features : small , pearl - like nodules , with medium diameter of 0.5 cm , sometimes with erosions on the surface , with bleeding upon rubbing .
some lesions were located in the scar left after previous surgical treatment . a double - blind , placebo - controlled group was used .
patients were divided into 2 random groups : 10 patients were subjected to local pdt and placebo ( eucerin as vehicle cream ) , and 24 patients were subjected to pdt and imiquimod .
lesions after levulan application were protected from direct light exposure using an occlusion dressing which was removed before irradiation .
total time of irradiation was 30 minutes ( 215 minutes ) , wavelength was 63520 nm and total energy dose was 100 j / cm .
imiquimod ( aldara ) was topically applied in 24 patients 72 hours after irradiation and then applied again twice a week before sleep for 5 weeks .
ten patients received placebo ( vehicle only ) , which was applied in the same manner as imiquimod .
photodynamic diagnosis ( pdd ) was used to detect and visualize suspicious sites ( including cancer lesions ) that were not seen during the routine examination using white light .
it comprised local application of precursor , which , after an uptake by cancer cells and irradiation at 405 nm wavelength , emitted red fluorescence .
lesions after application of precursor were covered using occlusion dressing and after 2 hours irradiated for 34 minutes .
, cancer sites emitted red fluorescence and the tumor borders were found to spread beyond the area seen in the white light .
the size of lesions was estimated during routine examination in white light and during the pdd session .
the result of white light examination is shown in figure 1 , and the effect of the pdd session is shown in figure 2 . the size of lesion during the pdd session was found to be larger and more irregular than during the white light examination .
most patients during and after pdt complained of erythema and edema that persisted for several days .
patients complained of increasing symptoms such as burning sensation , itching , painful and large edema , and strong irritation of skin , with erosions , after each application of imiquimod .
our study reveals that combination of pdt and aldara may increase adverse effects of pdt , such as burning and edema .
due to previously mentioned reasons , 4 patients had to apply imiquimod only once a week .
these adverse effects disappeared after completion of therapy with imiquimod , and treated sites scabbed .
local adverse effects typical for imiquimod in the group of patients treated with pdt and placebo were not observed .
results of treatment are shown in table 1 . in the group of patients who were treated using pdt and placebo , 6 patients ( 60% )
bcc located on the nose increased after 6 months in 2 patients and recurrent tumor in the scar left after previous surgical excision was observed in 1 patient ( table 1 ) . in the group of patients
treated with pdt and imiquimod , 18 lesions ( 75% ) totally disappeared , and 6 lesions significantly diminished . in 1 patient small foci of previously excised bcc developed again in the scar after 10 months from the first control examination .
there is ample evidence supporting the dangers of uv radiation , especially within the context of skin cancer . the popularity of sunbathing and tanning parlors , and chronic sun exposure associated with professional activity results in an increase in a high morbidity rate of skin cancer in middle - aged people .
localization of lesions in the exposed parts of the body , especially on the face , is an important esthetic problem .
patients who are still professionally active expect to receive dermatology treatment that gives the best cosmetic effects .
the main method of skin cancer therapy for decades was surgical excision , very often associated with skin graft transplantation .
c02 laser and cryosurgery were added to the arsenal of methods used against skin cancer in recent years , but each of these methods leaves scarring .
unfortunately , skin cancers are very often irregular in shape and invade beyond the tumor borders that are clearly visible in routine examination .
this irregular shape and difficulties in complete removal of a lesion using standard methods may result in frequent recurrences .
surgical excision usually requires a margin 3 to 10 mm wide , but using dermoscopy - guided surgery this may be reduced to 2 mm .
. moreover , bccs located on the nose and around the orbit are usually more aggressive than tumors located in other sites .
therefore , it is very important to find an effective therapy that also yields good cosmetic effects .
pdt , as a local treatment method , was used for many years with success in cases of skin precancerous lesions and skin cancers .
levulan - based pdt ( levulan - pdt ) enables destruction of pathological lesions which are too small to be visible on routine examination .
pdt is also responsible for destruction of vessels and induction of immunological response against cancer cells .
one of many advantages of pdt is the lack of significant adverse effects ( besides burning and edema during pdt and within the next 24 hours ) .
other advantages are the possibility of repeating and healing without scarring and ease of use . a clear disadvantage of levulan - pdt is weak penetration of levulan into skin .
the other indication for application of levulan - pdt is a superficial lesion on the skin , such as solar keratosis .
our study showed that pdd enables estimation of the true shape of a lesion and allows the microfoci of the tumor to be found .
aldara is often used in dermatological lesions , such as warts , condyloma of reproductive organs and the superficial form of bcc or scc [ 2124 ] .
due to its effects on immunological memory , imiquimod may protect patients against recurrences of lesions , and it is used as an additional agent in cases of incomplete surgical excision .
other studies indicated that pdt in treatment of superficial bcc is effective in 7697% of cases [ 2830 ] .
pdt is generally more effective in treating superficial bcc than nodular bcc . in cases of the nodular form of bcc ,
co2 laser surgery and pdt appear to play a synergistic role in the treatment of that lesion . in this study
the bcc in that localization shows more aggressive growth with recurrences , therefore our previous efforts in bcc eradication resulted in only 60% complete responses .
this combined therapy enables induction of local natural immunological mechanisms . the 75% success rate obtained in the group treated with pdt and
moreover , the synergistic effect of aldara on immunological response cells seems to decrease the number of bcc recurrences ( 1 recurrence after 10 months and 1 after 15 months ; see table 1 ) .
the combination of local pdt and imiquimod results in higher efficiency of bcc treatment in cases of previous unsuccessful treatment such as surgery , cryosurgery and laser therapy .
there is one more important benefit from combined therapy the high level of acceptance by treated patients .
lack of adverse effects after pdt and very good cosmetic outcomes positively influence the psychological condition of a patient .
patients confirmed their readiness to undergo repeated therapy in case of any recurrence , but they refused other treatment methods , such as routine surgical excision . at present , dermatological patients are younger than in the past and physical appearance is very important for such young people . in our opinion
the combination of pdt with local immunomodulator seems to be an effective method of treatment in such group of patients .
although this is a preliminary report , the presented modification of pdt seems to be reasonable and promising in treating basal - cell carcinoma .
Output:
| summarybackgroundcommon skin tumors like basal- and squamous - cell carcinoma present a serious problem in modern medicine .
exposure to ultraviolet solar radiation is the main cause of these lesions . since application of aldara and pdt
separately is well documented , we decided to use both methods together.the aim of our study was to evaluate the effectiveness of local photodynamic therapy supplemented with topical application of aldara in basal - cell carcinoma.material/methodsthirty-four patients ages 50 to 68 years were enrolled to the trial and underwent pdt treatment .
each case of bcc was histopathologically confirmed .
ten patients were subjected to local levulan-pdt and placebo ( eucerin as vehicle cream ) , and 24 patients were subjected to levulan-pdt and imiquimod .
photodynamic diagnosis ( pdd ) was used to detect and visualize suspicious foci ( including cancer lesions).resultsin the group of patients who were treated using levulan-pdt and placebo , 6 patients ( 60% ) were totally cured and 4 lesions ( 40% ) significantly decreased in size . in the group of patients treated with levulan-pdt and imiquimod ,
18 lesions totally disappeared ( 75% ) , 6 lesions significantly diminished , and in 1 patient small foci of previously excised bcc developed again in scar tissue 10 month after the first control examination.conclusionscure was achieved without any scarring and with very good cosmetic effects .
although this is the preliminary report , the presented modification of pdt seems to be reasonable and promising in treating basal - cell carcinoma . |
PubmedSumm6838 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: over fourteen years ago , the concept of gray and green was first introduced by wright and lund as representing new awareness and call for increased scholarships at the intersection of environmental issues and the aging process [ 24 ] .
an important dimension of that original article was to bring more attention to the role of the natural environment in contrast to the built environment in relation to successful aging .
this review paper revisits the concept of gray and green with a fresh perspective using selected examples from the literature on the specific role of gardens and gardening as it enhances the aging experience .
although the examination of the horticultural and human experience has been previously examined , especially in the context of well - being and social development [ 6 , 7 ] and in the lives of the elderly , this review paper offers a more contemporary perspective on the increasing number of publications since the early 1990s that have addressed gardening , gardens , and aging , particularly since the emergence of the gray and green publication in the year 2000 .
gardening is one of the most popular home - based leisure activities in the us and represents a significant and salient activity in the lives of older adults [ 915 ] .
the national gardening association claimed that 80% of us households tended to plants , which represented an increase of 65% from the year 1996 .
the 55- to 64-year - old age group was the cohort that spent the most on horticultural products and services and this trend will most likely continue with aging baby - boomers [ 16 , 17 ] .
some have proposed that there is an increased return to the small - scale farming approach as a new calling in life for many aging individuals .
this trend is supported by the growing interest in the organic food movement for both environmental and health - conscious ideals .
however , it is proposed in this paper that gardening may represent a facet of a much deeper gerontological connection between the natural environment , well - being , legacy , sense of meaning , and interpersonal connections to community and larger social structures .
the functional allure of gardens and gardening in the later years is the result of multiple factors : historical , aesthetic , cultural , generational , psychological , and physiological factors .
it is the premise of this paper that there is much more to the nexus of gardening and aging than a favorite pastime , hobby , or a task aligned with passive drudgery .
for example , in the book , gardening for a lifetime : how to garden wiser as you grow older , the author eddison believes gardening can become a joy - filled activity in later life even with the onset of comorbidities and chronic conditions associated with advancing age , if the gardener considers adopting wise alternatives to high maintenance practices in the garden .
gardening and gardens represent an important facet of the gray and green concept where the interaction with horticulture and landscaping is a holistic experience for a mind - body - spirit connection .
this interactive connection is further highlighted by representative books such as patricia cassidy 's the age proof garden and the illustrated practical guide to gardening for seniors : how to maintain your outside space with ease into retirement and beyond , where the focus is on gardening and the aging experience , but as an adaptive process that understands and appreciates the benefits of gardening , but with adjustments in maintenance and goals in the older adult 's garden . in this paper , we review contemporary articles demonstrating the multidisciplinarity of gardening and the aging process .
first , we will focus on the beneficial psychological effects resulting from the cultivation of caring , including personal contentment and artistic expression . to do this
, we will reference contemporary editions of classic texts to explore the still - relevant implications of historical gardening themes and allegories .
we will also discuss aging painters , writers , and filmmakers to demonstrate how the theme of gardening permeates the aging experience in various expressions of human adaptation , creativity , and existential significance even in the face of challenge and loss .
second , we will focus on stewardship and how gardening increases health , community awareness , and represents a connection with future generations .
most importantly , we advocate the premise that gardens and gardening represent an important bridge to connect the aging experience to the natural world where stewardship , caring , and well - being are realized . on the surface
snow 's two cultures and a separation between the humanities and science , but we will clarify a symbiotic relationship between the two disciplines in our conclusion .
the literature was systematically reviewed for relevant and peer - reviewed journals , books , and book chapters as well as contemporary annotated releases of classic and modern literature such as thoreau 's walden and virgil 's georgics .
relevant books were identified through published scholarly journal book reviews , published journal article references , and google scholar and through the amazon.com search tool . to generate a list of selected articles ( as of january 12 , 2014 ) for the paper ,
searches were done in four electronic databases : psychinfo , pubmed , proquest , and scopus .
the tactical goal was to use psychinfo , pubmed , proquest , and scopus as the databases to conduct searches in the literature and establish a convergence of relevant publications from multiple database search tools .
the review was primarily grounded in a scopus query algorithm to establish corroboration of relevant publications and to generate analytics for the primary search terms ( gardening and aging).scopus is a large abstract and citation database of research literature and web sources representing 50 million records , 21,000 titles , and 5,000 publishers .
the search using scopus was conducted through a university system ( retrieved january 12 , 2014 ) and it is considered to have a robust index and coverage of publications .
the scopus search for ( gardening and aging ) in all fields in journals articles published or in press and limited to a date range from 1990 to present resulted in 492 document results and the analytics revealed a modest increase in the total number of documents for this query by year since 1990 to the search in january 12 , 2014 . when using the limiter article title , abstract , keywords
( i.e. , title - abs - key ) default in the query , the search resulted in 66 document results .
a thorough examination was conducted of the 66 documents retrieved from scopus and then articles were selected for relevancy and content affinity to the main themes of this paper .
for many people , the word garden can evoke varied emotions and leaps of cognitive associations . according to the oxford english dictionary ( oed ) ,
garden can be approached and treated as a noun and defined as , a piece of ground adjoining a house , used for growing flowers , fruits , or vegetables , and as a modifier such that , gardens can represent ornamental grounds laid out for public enjoyment and recreation . .
the oed also recognizes that one can become an active participant by working in a garden as a gardener ( noun ) , by having gardened ( verb ) .
these distinctions serve as a basis for the reader to consider the intersection of the aging process with gardens and gardening , which can be active and passive , functional and aesthetic , and subjective and objective .
for example , the term , garden may signify many things that have little to do with cultivating vegetables and flowers and instead , as example , focus on landscaping as gardening with nature . or some may immediately think of an entertainment / sports venue ( e.g. , madison square garden ) ; a biblical setting ( e.g. , the garden of eden ) or some historical wonder of the world ( e.g. , the hanging gardens of babylon ) ; or pieces of literature such as the garden of forking paths by jorge luis borges or the film the constant gardener directed by fernando meirelles ( based on the novel by john le carre ) ; or exotic paintings like the garden of earthly delights by hieronymus bosch . for others , garden may represent the butchart gardens in greater victoria on vancouver island , canada , or zen rock garden of the ryoanji temple in kyoto , japan [ 2325 ] . in the sociological domain ,
gardens have served as a focal point for assessing collectivist and bureaucratic cultures in context of the urban gardening movement , and more recently as a practice to engage in the illicit cultivation of someone else 's land known as
victory gardens in the 1940s and with contemporary television , perhaps the pbs series , the victory garden .
but for many people , a garden can simply be a plot of soil as close as your backyard and as modest as raised box with a few marigolds and tomato plants
. thus , as ross [ 2839 ] has noted , trying to pinpoint an exact definition of gardens is daunting given the kaleidoscopic variations of gardens across many cultures and geographies .
for example , pizzoni has advocated that gardens can be thought of as a place set aside for multiple uses such associated with horticulture and the cultivation of plants for food and medicinal herbs but it can also be seen as an expression of ornamental , religious and even political purposes(see also [ 12 , 3140 ] for further discussion ) . in this paper
, we will advance a similar understanding of gardens and gardening and the aging experience but broaden the horizon such that health and well - being can be derived as a benefit , and this includes the psychological expression in our main premise : to be generative , to cultivate , to care is both utilitarian and sacred and finds its joyful expression in the reverential duty in the garden . the word garden may conjure memories of warm , fertile dirt in your hands , the smell of blossoms , the sound of bees collecting pollen , or the beautiful , flourishing sight of what humans and nature can accomplish together .
gardens are experienced through the senses , and therefore , the psychological assimilation of a garden and all it may represent is highly personal .
it is no wonder , then , that a deep personal understanding of life results from such communion with nature and may translate into the expression of self through art .
for example , the interrelationship between painting and the use of garden as motif or actual object for inspiration represents an important , intense , and intimate thread in the history of art and reinforces the sensory connection between human and garden .
there is perhaps the most spectacular and enigmatic work of hieronymus bosch and his haunting imagery associated with the triptych , garden of earthly delights .
the garden of earthly delights was painted around the years 1503 and 1504 when bosch was about 50 years of age , although he lived well into the mid - sixties of life .
garden of earthly delights is the middle panel of the triptych and captures sinful pleasures in a garden - like setting where naked figures parade about and into pools of water which can bring to mind primeval fountains of youth .
compared to the panel paradise which depicts a more balanced ecosystem of sorts , the middle panel is awash in people , and the garden appears to be magically self - sustaining with little human activity involved in maintenance or cultivating its rich resources for all . and indeed , there are no children to be found in this arcadian landscape and everyone appears to be ageless .
this is a presentation of a carefree world where the garden serves as a symbolic utopia and humankind resides in paradise untouched by the fall .
of course , it is the other panel , hell , which exacts the most hallucinatory experience and presentation of nightmarish figures .
eliot 's waste land , as a reminder of where there are repercussions for engaging careless activities that did not take into account the stewardship clause when residing in the garden of eden .
we reap what we sow , but in this case the fall may represent itself when all was spent in the present and little effort was taken to cultivate for the next season , or the next generation , thus leading to the hellish demise of humanity . in direct contrast is the work of claude monet , who is considered as one of the founders of style of painting known as french impressionism , lived a remarkable eighty - six years of life that spanned across two centuries ( from 1840 to 1926 ) .
monet proved to be extremely productive with creating some of his most famous paintings into his later years and along with other many other painters ( e.g. , henri matisse , rembrandt , and georgia o'keefe ) he has been the subject of research examining creative and artistic style and productivity into the second half of life [ 4246 ] .
many people are certainly aware of the vast array of monet 's work and many can also readily identify the unique style and composition of his paintings , such that , for example , when examining water lilies with rich textures or admiring irises with saturated colors , we come to think that those flowering plants are virtually synonymous with his portfolio of art .
but then again many people may not know that those paintings were created based on the living landscape of his own home and garden located in giverny , france .
monet was both painter and gardener and he spent the last 43 years of his long life with his close - knit family by cultivating his passion for creating color with flowering plants on a one - hectare ( 2.5 acre ) garden site and then capturing the dynamic and fluid presence of those plants onto his canvas with brushwork and oils .
but his garden would also be a healing and therapeutic oasis that helped him cope and adjust to the loss of his second wife and his son jean .
my most important work of art is my garden . from 1908 and at the age of 68
, monet focused his artistic work almost entirely on depicting his garden and was then commissioned by the state to create a remarkable large format series of paintings of water - lilies ( grandes decorations ) , his tour de force , that formed an enveloping circle that was to reside in a specially constructed pavilion in the muse de l orangerie , which was an extension to the louvre [ 47 , 48 ] . around the age of 74 ,
monet only painted summer subjects in his garden and during the winter months he worked in his studios retouching his works and finishing his canvases , but he was then diagnosed with a cataract in his right eye and eventually would come to affect both eyes . despite his visual impairments , monet proclaimed in 1920 ,
i 'm extremely busy with my garden ; it 's such a joy to me , and on fine days like those we 've had recently i am in raptures at the wonders of nature .
monet continued to paint but his deteriorating eyesight caused him severe problems in distinguished colors for many of his final years . while there have been many theoretical arguments about whether the change in monet 's paintings of his garden was due to late style or specifically due to limitations in his vision , marmor used medical knowledge and computer simulation to investigate the impact of visual disabilities on perception .
marmor demonstrated how monet ( and the painter degas ) had their perceptions of their preferred scenes or subjects changed due to disease , which affected their style of painting [ 5153 ] . and for monet , the loss of color perception due to his complications with cataracts was a major problem ( see [ 45 , 53 , 54 ] ) . as marmor pointed out , monet used his beloved garden landscape to capture the nuances of color and light , but his cataracts severely changed and challenged the marvelous qualities of color in his works ( p. 1769 ) .
even though different eye pathologies cause different visual limitations , we now know how low vision can affect both the physical and mental well - being of older adults and the ability to function in a variety of activities of daily living ( adls ) and instrumental activities of daily living ( iadls ) [ 55 , 56 ] . despite these challenges , monet stayed connected with the enchantment of his garden space , and his paintings , especially of the water lilies , were his sense of legacy to the world that to care and cultivate the beautiful is to embrace a larger cosmic sense of nature .
another part of his legacy is his ability to engage this belief while facing physical limitations and obstacles .
the conjunction of gardening and art is substantial and includes mediums from painting to literature to film .
readers are encouraged to review the literary companion publication of simonds , marranca 's anthology , and garmey 's edited book for an introduction and extensive review in this form of art . for a more contemporary nonfiction perspective , arthur hellyer 's your garden week by week , jamaica kincaid 's my garden ( book ) , diane ackerman 's cultivating delight : a natural history of my garden , michael pollan 's second nature : a gardener 's education , caroline holme 's new shoots , old tips , barbara kingsolver 's animal , vegetable , miracle : a year of food life , and robert fenton 's critical review in the new york review of books are highly recommended . when it comes to dedication to gardening
, many people will think of one of the best - selling american nonfiction classics , walden by thoreau [ 66 , 67 ] .
but while thoreau had the ability to capture the art and beauty of being connected to the soil , his stay at walden was relatively short , a two - year experiment into his late twenties , and then he left to pursue other travels . if one wanted to find a more constant gardener , across the entire life course and into the retirement years , we could better discuss thomas jefferson , governor of virginia and vice - president and president of the united states , who was also an avid gardener .
we are fortunate to read of his observations and activities in gardening in a publication titled , the garden book , which he began in 1776 and continued until the autumn of 1824 , two years before his death at the age of 83 .
the garden book is a remarkable account of jefferson 's meticulous note taking on his botanical interests and indicated a devotion to the culture of the earth . at the age of 68 years old , in a letter to a charles willson peale written in 1811 , thomas jefferson remarked that , but though an old man , i am but a young gardener . and the theme of gardening continues as both therapeutic activity and metaphor for life itself in the works of hans christian andersen ; the garden became an allegory for his lifework writing folk tales ( fairy tales ) , which had more significance with the world of adulthood than for children .
the folk tale , the gardener and the gentry was written toward the end of his career and two years before his death in 1872 . the use of gardening as a metaphor and allegory continues in the works of noted writers such as frances hodgson burnett 's the secret garden , charles baudelaire 's les fleurs du mal and eliot 's imagery of the rose - garden in the four quartets carries a multilayered meaning of spirituality and the loss of paradise within the cycles of life and death .
the four quartets were written over a span of several years ( 19351942 ) and in the last quarter of eliot 's life . in burnt norton
the rose - garden conveys memories and mythology of time passing with human existence ( mere moments ) compared to the history of humanity , civilization , and all that has gone before .
we find it correlative that carl jung was using a similar theme to address his understanding of his own life in his book memories , dreams , reflections ( 1989 ) . in 1957 , at eighty - one years of age , jung began to work with aniela jaffe to complete this major work before he died in 1961 .
the enlightening passage is from the prologue and is both vegetative and seminal in its garden metaphor by picturing life individually and collectively as sustaining and regenerative over the ages ( see also ) .when we think of the unending growth and decay of life and civilizations , we can not escape the impression of absolute nullity .
yet i have never lost a sense of something that lives and endures underneath the eternal flux .
when we think of the unending growth and decay of life and civilizations , we can not escape the impression of absolute nullity .
yet i have never lost a sense of something that lives and endures underneath the eternal flux .
although jung 's use of the rhizome metaphor supports the philosophical impression of life as continuous and unending , despite the relentless seasons and centuries of time , gardens are also very much transitory and impermanent . and
so while gardens can be perceived as being artistic , they may not necessarily represent the outcome that matches the hippocratic dictum , life is short , art is long
( ars longa , vita brevis ) in the sense that a garden is cultivated and cared for in an effort to outlast its caretaker , while on the other hand , gardens exist to reenchant the present [ 75 , 76 ] .
yet , one long - lasting medium for the expression of art is through the vehicle of film . here
we will examine the crossroads of the use of garden imagery ( symbolic and realistic ) in relation to the aging experience and focus on two exemplars : wild strawberries and dreams .
wild strawberries is the 1957 film by bergman that depicts the story of the aged dr .
erikson has provided a comprehensive analysis , based on his own theoretical interpretation , of bergman 's film and it is here that erikson sees the emergent virtue of care as a necessary strength for the life cycle as well as the cycle of generations ( p. 7 ) .
borg and marianne ( his daughter ) and borg 's son evald reflect the core issues of generativity such that it is borg who must confront his own rejectivity and the resulting lack of care and interest in his own family and many others around him ( see also ) .
the turning point for isak borg , and obviously the primary inspiration for the title of the film , is when dr .
borg leaves the main highway ( his journey of life ) and drives down a side road to revisit an old summer home ( a chance for reminiscence and remembrance out of the rigid pattern of living in rote predictability ) .
borg remembers a specific location that would serve as catalyst for a reawakening much like the proustian madeleine , but in this case , it is a strawberry patch near the summer home . and
it is here that we find a richly layered symbolism that involves the magical transformation of the landscape surrounding the home into blooming plants and trees and lush greenery . even though the film is in black and white
, one can almost imagine that large yard as colorful as monet 's gardens at giverny .
the wild strawberries that grow along the side of the yard are the triggering mechanism to transport borg back through time and allow him to revisit his own young adulthood in relation to sara , his first love . in this film ,
the bounty of the earth in the form of wild strawberries is richly symbolic of the decisions made and the missed opportunities at forming intimate relationships ( with sara ) and the resulting isolation and aloofness that made him think of himself as a living corpse .
erikson offers his analysis of the arcadian scene,one senses that this whole earthy scene , beyond its precious gaiety and its symbolic reference to defloration , points to something primeval , some garden , long forfeited by isak ( p. 8) .
one senses that this whole earthy scene , beyond its precious gaiety and its symbolic reference to defloration , points to something primeval , some garden , long forfeited by isak ( p. 8) . at least from erikson 's perspective , that small patch of botanical life , the wild strawberries , is at once symbolic of the epigenetic pathway and a crossroads through adulthood and into the commitments of mature caring within mid and later life .
this theme shall become an important factor to consider when we examine the role of stewardship as a dimension of the gray and green concept for the aging experience .
kurosawa , at the age of 80 , directed and then released the film , dreams , in 1990 ( his 28th film ) , which featured several portrayals of kurosawa 's own dreams experienced over the course of his life .
the first and last episodes of dreams feature two processions that symbolize the opening and closing of the life cycle : a wedding and a funeral .
the film also captures luminous sequences of botanical wonderment and rural scenes of wheat fields ( crows ) with van gogh ( who also loved gardens ; see ) at work painting his landscapes and other segments that portrayed the ruins of ecological disasters and the break with nature .
the last segment , the village of the watermills of the film is especially significant which captures a lush farm with blooming flowers , lush green grass , and crystal clear rivers that drive the watermills in a wheel - like fashion .
it is a paradisiacal place : a village where modern technology has not invaded people 's lives and they live in harmony with nature .
the kurosawa surrogate ( the younger man ) , while walking through the village , encounters a 103-year - old man , who is working on a smaller water wheel structure .
the older man communicates the necessity of treating the land with respect and articulates the perils if it being mistreated .
the symbolic depth of the old man imparting wisdom ( a representation of eriksonian generativity ) to the younger man is a critical link in the message of the segment which highlights that working in harmony with the land helps to create a natural cycle of living , and dying .
the watermills turn with the river of water , which provides nourishment for the plants and the flowers , which in turn the villagers use to celebrate the wheel of life , and death . at the end of the film ,
we are left watching a slow moving river current with undulating clusters of long swirling stands of lush aquatic plants swaying with the flow of water that reflects multiple colors on its surface , blues , greens , and the liquid silver of indirect sunlight . much like a monet oil painting , water lilies , and his japanese bridge over his pond .
these artists demonstrate the ability to engage and connect despite challenges an ideal for any aging adult
. however , the process of disengagement seems to contradict the presence of this ability as the individual retreats into himself , and rather than being a constant gardener , he becomes isolated and trapped in his memory and his past .
an example of this is grey gardens , a documentary so fascinating that it has been translated into a broadway musical and an hbo film . with the title of grey gardens ( 1976 )
such a film would appear to be the perfect connecting point for examining aging issues ( grey ) and gardens .
but the film is less about gardening in the later years ( per se ) and more about what was once cared for in relationships with people , home , and landscape in the past has instead fallen into a state of neglect due to the disconnect with cultivating what is alive in the present .
grey gardens is actually the name of the decaying estate that belongs to edith bouvier beale ( big edie ) age 79 and her daughter edie ( or little edie ) in her fifties , both frozen in time and place , in an east hampton home that is graying along with them . in the early 1970s ,
their 28-room mansion was found to be a health hazard and mother and daughter were threatened with eviction .
the film opens up with little edie telling the maysles about what used to be in terms of the beautiful and exotic gardens that once was . throughout the film ,
there are shots of the house surrounded by thickets of vegetation , a landscape gone wild , that makes it appear deserted , forlorn , and enveloped in an ivy - snarled ruin . in grey gardens there
actually is a man who is introduced as the gardener at the beginning of the film , but it is clear that the intruding jungle of vegetation is overwhelming to him . as the mother and daughter live in the past , the present landscape is removed from care and attention and nature encroaches and erodes the house .
after years of neglect , raccoons move into the attic , ivy presses through window seals , and cats continue to reproduce and turn every room into a new wing of a sprawling litter box .
the two women cook , eat , and spend most of their time in the bedroom the two of them share , warming canned goods on a hotplate near big edi 's bed .
decay envelops what was once lush , beautiful , and a welcoming example of cooperation between nature and human interaction .
harrison succinctly stated the connection between the need for constant gardening in the face of our obligations to the here and now , if we are not able to keep our garden , if we are not able to take care of our mortal world , heaven and salvation are vain ( p. 11 ) .
gardening , then , is not just a hobby or a task meant to keep one physically active or to keep the mind occupied .
it is the cooperation between nature and humanity , fine - tuned through experience and nurturing .
wisdom may be gained in the privacy of one 's own mind , but it 's true worth manifests as wisdom is shared .
the artistic examples referenced here are not just means of self - expression , they are bridges from individual understanding to community stewardship and care .
the proper starting point for this discussion of art bridging personal wisdom and community should be with virgil 's georgics .
virgil ( 70 bce-19 bce ) wrote the poem georgics ( the word georgics refers to primarily to farming ) during the 30s bce and this would put virgil at just over 40 years of age , and relatively speaking , at the peak of his senior status in the understanding of the life course at that time but perhaps not senectus yet .
georgics is a didactic and very much a template and design for interacting with the land and being attentive to what ferry noted as virgil 's ability to engage the
ecstatic and tender celebrations of the very life in things , and more importantly how these celebrations interact with human existence ( see also ) . in the georgics , one can appreciate virgil 's attentiveness to the cycles of seasons , and the cycle of birth and death , and the inevitable unfolding of sickness and aging .
virgil 's georgics emphasizes that through care of the land , we begin to care for each other , and from there follow the arts and cultural blossoming and the resulting harvesting of another kind : poetry , art , music , sculptures , law , and ethics . in the fourth
georgic , virgil writes of an old man who is at work on his small patch of land that was at one time not fertile enough to be plowed by oxen , but with his dedicated attention it has been transformed .
the lines in this vignette are less didactic and more poetic in the sheer strength of the action and sensuality by use of vivid descriptions of the labor that is needed for all the seasons .
quint has proposed in his review of the new translations of georgics by and lembke that , the old gardener thus carries some of the poem 's political hopes as well as its ethical message . from a life of turmoil
, he has settled into quiet usefulness and contentment , tamed by work and hardship , and even makes a thing of beauty in his flower garden , an analogue to the poem itself ( p. 35 ) .
an overarching theme throughout the georgics is the didactic lesson of as you sow , so shall you reap .
the lesson is that progress towards happiness and well - being is highly dependent on the service that you have rendered to the land , kith and kin , to neighbors and to community . and
thus , gardening serves as the cornerstone of civilization - that is , to care , constantly .
harrison has succinctly woven these themes together by stating , the true gardener is always the constant gardener
the constant gardener cares for and nurtures nature , community , and future generations to come .
gardens not only provide rejuvenation of plant life and the aging individual , but also inject life and vitality into the community . here
, we examine two prime examples of the gray and green concept where the green effect of gardens and gardening can instill the potential for stewardship toward not only one 's backyard , but toward a much larger sphere of environmental concern and care directed outward in the form of legacy , community , and welfare for future generations .
gardens and gardening can also provide a direct benefit through the restorative impact of either interacting with and in the garden as a physical activity or that the presence of a garden itself as a sensory experience can enhance well - being and health .
if the lesson from the georgics is that community begins in the backyard , it is no wonder that thoughts turn to residential landscaping and lawn care while thinking of communities and gardens .
lawn care has been the most prevalent form of gardening nationwide . however , this dimension has been going through its own transformation and redefinition as many more people are looking to redefine the lawn into a more environmental friendly and regionally appropriate recreational and social site for families , including the expansion of gardens [ 35 , 91 ] .
brown and jameton have indicated that there are numerous benefits for the increase and support of gardening : food security and nutritional health ( home grown produce has the potential to offset the cost of purchasing food ) , positive effects on physical health ( as exercise ) , and overall community improvement ( to enhance social capital ; it can serve as a community organizing tool to combat poverty and provide a collective response to blighted city neighborhoods ) and as a way of raising consciousness about environmental stewardship .
brown and jameton also suggest various community - based policy recommendations to encourage urban garden activities because , urban gardening raises our public awareness of the need to safeguard our environment , and especially our urban soils , from future pollution , erosion , and neglect
for example , they found significant differences among older adults by marital status , education , and health status in terms of motivational categories .
similarly , wang and glicksman reported that low - income minority older adults expressed several motivations and benefits of community gardening .
for example , wang and glicksman identified nine themes of why older adults chose to participate in gardening : mental health benefits , the end product ( fruits and vegetables ) , continuation of a past life , something to do / responsibility , beauty and connection to growth , connecting with others , physical health , learning something new , and helping each other out .
fnge and ivanoff also discovered mixed results with gardening in men and women aged 8089 in sweden .
fnge and ivanoff indicated that while gardens provided opportunities to go outdoors and offered a meditative space for older adults , having a garden to take care of could be a
in contrast , pettigrew and roberts have proposed in their study that gardening had served as an effective way for older adults to ameliorate the experience of loneliness and feelings of emotional isolation .
gardening was also identified as a mechanism to help facilitate self - reconstruction through spatiotemporally establishing biographical continuity between older chinese immigrants in their new lives in new zealand .
we also know that gardening can serve as a bridge - building activity for enhancing intergenerational cooperation in community settings [ 96100 ] and that it can represent a form of legacy in older adults and serve as a mechanism to engage in successful aging . the phrase
successful aging recollects monet and his ability to continue producing art despite his failing eyesight .
the aging process requires adaptation and the ability to approach tasks in a different , more sustainable way .
there are research findings to indicate gardening as an activity to enhance the physical and emotional well - being for older adults who reside in home and community - based dwellings .
for example , infantino found that the gardening experience had sustained older women in their cognitive and spiritual development .
. found that horticultural projects ( consisting of 12 weeks of interactive gardening classes ) were instrumental in increasing a sense of psychological well - being in racial and culturally diverse groups .
they also found that gardening helped to instill a deeper sense of legacy and spirituality and a deeper relationship with the earth and nature in the older participants .
quandt et al . explored the nutritional role of food sharing among a diverse set of older rural adults and also highlighted the social meaning in such activities as well .
similarly , milligan et al . found that older adults benefited from gardening in communal allotments as it helped to overcome social isolation and contributed to the development of social networks .
an additional benefit of affective restoration from stress was found among adults ( mean age 57.6 ) in an experimental study comparing gardening to indoor reading .
the authors noted that gardening may permit people to enjoy the restorative effects of nature on a regular basis . in another related study , hawkins et al
. discovered that allotment gardeners appreciated doing gardening activity as well as
being at the allotment landscape for affording a wide range of benefits to their health and being , specifically in stress reduction .
gardening as an activity to improve the quality of life for older adults has generated a substantial number of publications that address gardening as a physical activity for older adults that may facilitate healthy aging [ 14 , 15 , 110112 ] and as an intervention with indoor gardening and horticultural therapy for institutional populations [ 15 , 113129 ] .
the intersection of gray and green is also reflected in the paradigmatic shift of the eden alternative in managing long - term care facilities [ 130 , 131 ] .
for example , lee and kim found that indoor gardening was found to be effective for improving several dimensions of sleep patterns , decreasing agitation , and improving cognition functioning of dementia patients ( see also ) .
there are also significant publications on outdoor gardening activities for people who live in geriatric care settings , specifically for persons with dementia , and the importance of patient - specific gardens for the restorative effects of nature .
goto et al . concluded that organized gardens can positively affect both mood and cardiac physiology of elderly individuals .
gardening has also been identified as a potential activity to incorporate into fall prevention programs as gardeners reported significantly better balance and gait speed and had fewer chronic conditions and functional limitations than nongardeners .
however , both kwak et al . and larner have also suggested that many cognitive abilities may be required for successful gardening and horticultural activities and that if gardening is being considered as a component for intervention and therapy for dementia patients , an individual approach that is customized to abilities and deficits and the various symptoms may be required . in valliant 's monumental study of aging and well - being , aging well , he ended with a chapter titled , positive aging : a reprise , and in that section there was the creative metaphor that captured the nuances of growing older as akin to gardening or , more precisely , the lessons learned in being a gardener could serve as a positive role model for finding fulfillment in later life . among the many positive attributes , valliant proposed that gardening is an activity that encourages a therapeutic slowness [ 142 , 143 ] and brings with it the additional benefit of creating opportunities for introspection and reflection ( that you should stop and smell the roses ) and that it encourages and facilitates the overarching eriksonian concept of care : a hallmark and defining positive attribute of the aging process .
we are reminded of shakespeare 's lament , sweet flowers are slow and weeds make haste which all but exudes the wisdom of living a long and cultivating the rewards of a life well - lived and cared for .
valliant also proclaimed that gardeners are very much in the spirit of generativity and symbolically working ( i.e. , being concerned and having responsibility ) ; the soil is embedded with the meaning of rebirth and regeneration , stewardship , and the essence of cultivating for the next cycle of life . and with this kind of care , there is the potential for the legacy of caritas , a vita activa , and a vocation of care transmitted through the generations .
thus , as valliant succinctly states it , there is a kind of immortality about gardens , at least until next spring and the spring after that ( p. 309 ) .
not only does valliant make reference to cicero and the ancient roman tradition of viniculture as an honorable activity for aging , he revisits the famous line from voltaire 's candide where after many journeys , hardships and mishaps and a great deal of theorizing , candide instructs pangloss , we should cultivate our gardens .
that pithy philosophical statement was crafted by candide and inspired from an earlier encounter with an old man who was sitting outside his house minding his own business and taking in the day and enjoying the fruits of his labor .
this encounter sounds very familiar to a similar story of the old man previously mentioned in virgil 's georgics.in voltaire 's novel , the old man knew little of worldly affairs and events but graciously offered candide , pangloss and martin a sumptuous meal of exotic fruits and nuts that were grown on his farm .
candide assumed the old man must have some vast and magnificent estate , but the old man said ,
i have only twenty acres and i cultivate them with my children ; and my work keeps at bay three great evils : boredom , vice and need .
candide thought it to be a far better existence compared to anything else they had encountered as history unfolded not too kindly in all of their travels and experiences .
perhaps it is best to summarize the findings of the importance of gardening in the lives of older adults by highlighting the work of bhatti who found that the presence of and the interaction with gardens can have a major significance in the ( re)creation of home in later life .
in addition to the benefits of physical activity [ 1315 , 110 , 147 ] there is the added dimension of what the garden symbolizes psychologically as a meaningful reason for existence , or as one older adult expressed it , when i 'm in the garden i can create my own paradise . here , we have come full circle .
we began with the sensory qualities of gardens and gardening and the personal spirit - mind - body benefits to cooperation between man and nature .
personal well - being often translates into artistic expression , whether it is through painting , literature , film , or the act of gardening itself .
this artistic expression benefits communities and creates a legacy for the aging adult while providing physical and mental health benefits .
the give - and - take between nature and individual , individual and community , and community and nature is ongoing and rejuvenating .
science and the humanities continue in a symbiotic relationship just as nature and human beings do , and this cooperation is vital to the well - being of aging individuals and of every human being at any stage of life .
we should cultivate our gardens , but what is it exactly about gardens and gardening that would supply meaningful significance to the life course , and particularly to the aging process ? what is the connection between gardening and care and well - being ?
the analysis of the scientific validity of the health benefits of gardening for older adults has been aptly analyzed by wang and macmillan and they correctly conclude that there is a need for larger - scale studies using probability samples and combined methodologies to develop a more comprehensive understanding of the nuances with gardening and the aging experience . while the systematic review of wang and macmillan focused on the merits of gardening in the domain of connections to family and community and cultures , we would submit that the additional connection to the natural environment the gray and green concept is worthy of sustained investigation as well , especially as it relates to larger macrodynamics of legacy , sustainability , generativity , and intergenerational support and caring [ 148 , 149 ] .
the purpose of this paper was to review several multidisciplinary nodes of gardening and the aging experience and to examine two specific issues : ( a ) gardening as a significant activity to engage the cultivation of caring across the life course , and ( b ) as a way to enhance the notion of stewardship in supporting environmental health in the context of home and community based settings .
based on the review of the selected literature and the examination of various multidisciplinary perspectives , we can propose that gardens and gardening represent multidimensional phenomena in the lives of many older adults and it is much more than a physical activity in a designated space where time and energy are exerted for cultivating fruits and vegetables .
gardens and gardening can also represent an intimate connection with life itself through caring and being a steward for living organisms that also reciprocate with nourishment , aesthetics , and existential meaning in the context of senescence .
as roszak has noted , the added dimension of environmental connection and awareness into the experience of the aging process could serve as a template for a new elder culture and a sustainable future .
in addition , there are the beneficial therapeutic interactions with gardens as healing spaces , as in the example of great - granny 's garden ( oslo , norway ) , which not only is represented as a living archive for botanicals , but also serves as a sensory garden for persons with dementia .
this captures an excellent concept for both conservational activities and supporting the therapeutic goal of the positive attributes of a garden space for older adults with cognitive impairments
. there is much to discuss within a synopsis of these themes , but one link to appreciate is the connection back to valliant 's synthesis of his research findings that point to gardening as including , but much more than , activity of physical effort , and rather , it takes on the gravity of a philosophy of life , a weltanschauung , a raison d'tre , and much more .
valliant indicated that instead of the all - elusive high expectations of happiness to be sought for in later life , the concept that might instead be a better fit given the realism of the aging process in terms of challenges and promise is a joy in life .
the experience of a joyful attention to life ( and a life ) that is cultivated in gardening is very much akin to a meditative practice and helps to create a new kind of homecoming that allows one to become native to a place where there is a deeper connection to seasons of growth , and decline [ 153 , 154 ] . to many , the garden exemplifies a new agrarian standard that integrates the many realms of the great garden that is a seamless gateway between many realms of nature including trees , streams , pastures and it helps to instill a redirecting of mindful care . before you might think that the topic of gardening is exclusively an opportunity for those who are geographically located in rural areas or along the exurban fringes , and thus beyond the reach for urban and inner city dwellers , consider the following example . in the low - income residential neighborhood geographically located in the bronx ( new york ) known as tremont , there exists a community garden that recently celebrated its 37th anniversary . and
it is here that the residents of tremont find a sense of belonging even while surrounded in a world of concrete .
tina kelley wrote a story for the new york times on the tremont community garden and said that the gardens are oases , where a collective spirit and a sense of community grow from the topsoil .
the president of the community garden is elizabeth butler ( age 77 ) and she said that the garden is like a refuge ,
if i could n't come here , it would be rough i can not stay in the house .
another garden member , a retired nurse , said the garden is site for celebrating birthdays and as a place for memorial services as well .
they were like deeply part of the garden , like a soul thing , while another community member said of the garden ,
but listen to how harrison has interpreted notre jardin from voltaire 's story ,
notre jardin is never a garden of merely private concerns into which one escapes from the real
; it is that plot of soil on the earth , within the self , or amid the social collective , where the cultural , ethical , and civic virtues that save reality from its own worst impulses are cultivated .
it may be difficult to imagine this much ado about a patch of soil , some seeds , watering , and having a strong back and a weak mind
that something has resonated with many older adults throughout history and is today still both a viable and contemplative activity that is both elemental and transcendental .
that something is related to the core virtue of the mature and responsible adult in mid and later life : the ethical basis of care [ 144 , 145 ] .
the caring for the garden ( local ) is then extended into the caring of something beyond the home and community and outward into social and cultural levels ( global ) .
this is exactly the link that collins discovered in her study of community dwelling older adults who were transformed into
keepers of the earth through the activities of a gardening life and as a result , environmental stewardship was facilitated .
it is our conclusion , that the ultimate expression of why the act of cultivating is so compelling in the later years of life is connected with stanley kunitz who spent a lifetime ( over a hundred years ) reflecting on the importance of gardens through poetry . in the book ,
the wild braid , the nexus of cultivation , caring , and the life course are poignantly discovered , i think of gardening as an extension of one 's own being , something as deeply personal and intimate as writing a poem .
the difference is that the garden is alive and it is created to endure just the way a human being comes into the world and lives , suffers , enjoys , and is mortal .
the lifespan of a flowering plant can be so short , so abbreviated by the changing of the seasons , it seems a compressed parable of human existence ( p. 14 ) .
i think of gardening as an extension of one 's own being , something as deeply personal and intimate as writing a poem .
the difference is that the garden is alive and it is created to endure just the way a human being comes into the world and lives , suffers , enjoys , and is mortal .
the lifespan of a flowering plant can be so short , so abbreviated by the changing of the seasons , it seems a compressed parable of human existence ( p. 14 ) . the opportunity to consider the benefits of gardening in the aging process as including a viable connection to outcomes relating to stewardship and care and as a part of the process of older adults being engaged with natural contexts beyond the physical and built environment is also the possibility of further investigating the gray and green phenomena as an important dimension in well - being and optimal aging in mid and later life [ 1 , 3 , 4 , 93 , 148 , 160162 ] . to be generative , to cultivate , to care is both utilitarian and sacred and finds its joyful expression in the reverential duty in the garden .
Output:
| over fourteen years ago , the concept of gray and green was first introduced by wright and lund ( 2000 ) to represent a new awareness and a call for increased scholarship at the intersection of environmental issues and the aging process .
this review paper revisits that concept with a fresh perspective on the specific role of gardens and gardening in the aging experience .
as example , gardening is one of the most popular home - based leisure activities in the us and represents an important activity in the lives of older adults in a variety of residential settings . yet
, there has been a lack of any comprehensive and multidisciplinary ( science and humanities ) examination of the nexus between gardening and the aging experience , and in particular with research connections to stewardship and caring . in this paper , we review contemporary articles demonstrating the multidisciplinarity of gardening and the aging process .
first , we will focus on the beneficial psychological effects resulting from the cultivation of caring , including personal contentment and artistic expression .
second , we will focus on stewardship and how gardening increases health , community awareness , and a connection to future generations . on the surface , this may demonstrate a separation between the humanities and science , but we will clarify a symbiotic relationship between the two disciplines in our conclusion . |
PubmedSumm6839 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: botallo 's duct is a blood vessel that connects the pulmonary artery to the aorta during fetal development , and our knowledge of the pathophysiology of this duct is increasing steadily.1 clinically , patent da ( ductus arteriosus ) is often used synonymously with persistent da ' , and both are frequently abbreviated as pda ' even though they differ in morphology and therapeutic implications.2,3 the term
patent da is an umbrella term that is used for all situations in which the da is either physiologically or pathologically open . in this review
pda ' to refer to patent ductus arteriosus . a patent ductus arteriosus ( pda ) is a physiologic shunt in healthy full - term and preterm infants that tipically presents during the first three days of life.4 pda in preterm infants may have clinical consequences depending on the degree of left - to - right shunting .
the increase in pulmonary blood flow in premature infants may lead to pulmonary edema , loss of lung compliance , and deterioration of the respiratory status , which ultimately lead to chronic lung disease ( cld ) and an increased morbidity and mortality.5 a shunting of blood between the aorta and pulmonary artery , which is favored by the postnatal decrease in pulmonary vascular resistance,6 causes the hemodynamic and clinical consequences of pda .
the shunt also modifies the distribution of blood to the lungs and other organs and may contribute to an increased risk of serious and prolonged neonatal respiratory distress , intraventricular hemorrhage ( ivh ) , necrotizing enterocolitis ( nec ) , bronchopulmonary dysplasia ( bpd ) , and death.7,8 the incidence of pda in full - term neonates has been estimated to be 57 per 100,000 live births,3 whereas persistence of the duct occurs in approximately one - third of premature neonates with a birth weight between 501 and 1,500 grams.9 in neonates weighing less than 1,000 g , it has been reported that 55% develop a symptomatic pda requiring pharmacological treatment.10,11 the spontaneous closure of a pda takes place between the second and sixth day of life in 34% of extremely low birth weight ( elbw ) neonates12 and within the first year of life in the majority of very low birth weight ( vlbw ) neonates .
the ensuing vascular response , which is mediated by potassium channels , voltage - gated calcium channels , mitochondria - derived reactive oxygen species , and endothelin 1 , depends on the gestational age .
platelets are recruited to the luminal surface of the da during closure and are hypothesized to promote the thrombotic sealing of the constricted da.13 it has been estimated that 60% to 70% of preterm infants
less than 28 gestational weeks receive medical or surgical therapy for a pda , usually with the intention to prevent respiratory decompensation , heart failure , ivh / brain injury , bpd , nec , and death.14,15 the natural history of pda in premature infants remains unknown , and its management is highly controversial .
the following four strategies are most often used in the treatment of pda : 1 ) symptomatic treatment when the duct is deemed hemodynamically relevant by clinical or ultrasonographic evaluation;16 2 ) targeted treatment of ducts echocardiographically detected in the first 24 hours of life but before a significant left - right shunt has developed;17 3 ) conservative management with only ventilation adjustments and fluid restriction ; 4 ) a prophylactic approach , which medically or surgically treats all neonates at risk for pda in the first 24 hours of life.18 despite numerous studies , some controversies regarding pda prevention remains .
the prophylactic use of indomethacin , whether the da is patent or not , is the best - studied regimen .
the timing of this approach is important ( it is given very early , within the first 24 hours ) because its effectiveness clearly decreases with increasing postnatal age ; however , this treatment involves the risks associated with exposing infants to drugs that they might not need .
importantly , prophylactic trials can examine the association between pda and the incidence of ivh or pulmonary hemorrhage , which typically occurs within the first moments of life , whereas symptomatic trials can not examine this relationship .
conversely , symptomatic trials can examine the relationship between pda and nec , which occurs later in postnatal life , whereas prophylactic trials would be unlikely to do so.19,20 in this paper , we will only address the prophylactic approach for pda management .
indomethacin is used prophylactically to close the pda before hemodynamic distress occurs , which has been associated with an increased morbidity and mortality , without the need for screening or echocardiographic surveillance .
this approach exposes a large number of neonates , in whom the duct would close spontaneously , to a pharmacologic treatment that is not without risk .
intravenous indomethacin , a non - selective cyclooxygenase inhibitor , is the standard pharmacological treatment for pda in preterm neonates and has a reported effectiveness of 6680%.21 - 23 since the 1980s , several risk - benefit studies have been conducted to evaluate the intravenous administration of indomethacin for prophylactic treatment of pda .
the first small , controlled , randomized trials suggested that early prophylaxis ( i.e. , within the first 24 hours ) with indomethacin reduced the incidence of serious ivh .
interestingly , a significant increase in the use of indomethacin prophylaxis occurred after the ment et al .
trial was published ; however , a significant decrease in the use of indomethacin prophylaxis followed the tipp trial.24 in 1994 , ment et al.25 was the first to publish a prospective , randomized , placebo - controlled trial to investigate whether low - dose indomethacin ( 0.1 mg / kg intravenously at 6 to 12 postnatal hours and every 24 hours for two more doses ) would lower the incidence and severity of ivh .
the authors enrolled 431 neonates with a birth weight of 600 to 1,250 g and no evidence of ivh at 6 to 11 hours of age .
serial cranial ultrasounds and echocardiograms were performed . within the first five days , 25 ( 12% ) indomethacin - treated and 40 ( 18% ) placebo - treated neonates developed ivh ( p = 0.03 , trend test ) .
however , only one indomethacin - treated patient experienced grade 4 ivh versus 10 placebo - treated neonates ( p = 0.01 ) . in 2001 , schmidt26 published the results of another large - scale , controlled , randomized trial , the trial of indomethacin prophylaxis in preterm ( tipp ) , that evaluated the long - term effects of indomethacin on motor , sensory and cognitive outcomes . in this study , 1,202 elbw infants ( 500999 g ) were randomly assigned to receive either indomethacin ( 0.1 mg per kilogram of body weight ) or placebo intravenously once daily for three days soon after birth .
the primary outcomes investigated were death , cerebral palsy , cognitive delay , deafness , and blindness at a corrected age of 18 months .
the secondary long - term outcomes were hydrocephalus necessitating placement of a shunt , seizure disorder , and microcephaly within the same time frame .
secondary short - term outcomes were pda , pulmonary hemorrhage , chronic lung disease , ultrasonographic evidence of intracranial abnormalities , necrotizing enterocolitis , and retinopathy . of the 574 infants with primary outcome data who received indomethacin prophylaxis , 271 ( 47% ) died or survived with impairments , as compared with
261 of the 569 infants ( 46% ) assigned to placebo ( odds ratio , 1.1 ; 95 percent confidence interval , 0.8 to 1.4 ; p = 0.61 ) .
indomethacin reduced the incidence of pda ( 24% vs. 50% in the placebo group ; odds ratio , 0.3 ; p<0.001 ) and severe pvh and ivh ( 9% , vs. 13% in the placebo group ; odds ratio , 0.6 ; p = 0.02 ) .
no other outcomes were altered by the prophylactic administration of indomethacin . however , indomethacin prophylaxis increased the need for supplemental oxygen from day 3 to at least day 7 of life .
indomethacin also decreased the urine volume during the first four days of life and reduced weight loss by the end of the first week .
these papers concluded that in elbw infants , indomethacin prophylaxis does not improve the survival rate without neurosensory impairment at 18 months , despite the fact that it reduces the frequency of pda ( nnt 4 ) and severe pvh and ivh .
the reduction in ivh can be explained by the maturation of the cerebral vascular basement membrane , improvement in cerebrovascular self - regulation and anti - inflammatory effects.27,28 more recent data detailing reduced germinal matrix hemorrhaging via inhibition of angiogenesis indirectly support this hypothesis.29 in a follow - up to the tipp study , 999 elbw were given indomethacin prophylaxis .
the treatment did not prevent bpd , although it reduced the frequency of pda.30 the frequency of cld was higher , which may be associated with the reduced weight loss , the greater need for oxygen and perhaps the increase in extracellular liquid at the pulmonary level .
reducing the frequency of pda may be important for those children requiring surgical closure , although twenty prophylactic treatments with indomethacin are required to avoid surgical treatment . in another follow - up to the tipp study that was continued up to 18 months of life , prophylactic
indomethacin reduced the rate of early serious pulmonary hemorrhage because of its effects on pda . however , prophylactic indomethacin was less effective in preventing serious pulmonary hemorrhages that occur after the first week of life.31 currently , the main limitations of the tipp trial are methodological concerns , such as the use of composite outcomes and a lack of statistical power .
another important study was published by vohr.32 their cohort consisted of 328 vlbw ( birth weight of 6001,250 g ) infants who were enrolled in a low - dose , prophylactic indomethacin prevention trial and ivh negative at six postnatal hours .
the cohort was divided into the following four subgroups for analysis : indomethacin plus ivh , indomethacin without ivh , saline plus ivh , and saline without ivh .
children in both ivh groups had more cerebral palsy and hearing impairment as well as lower daily living skills scores , iq scores , and vocabulary , reading and mathematics achievement test scores .
logistic regression analyses showed that grade 3 to 4 ivh , periventricular leukomalacia and/or ventriculomegaly , male gender , maternal education , and the language spoken at home contributed to the outcomes .
the authors concluded that although biological factors contribute significantly to school - related outcomes in vlbw survivors , social and environmental factors are also important contributors .
cordero et al.33 compared the clinical responses of elbw infants to indomethacin prophylaxis to that of other infants who were managed with indomethacin or surgical treatment only after a symptomatic pda was detected .
the study was a retrospective cohort investigation of 167 elbw infants who received indomethacin prophylaxis ( study ) and 167 elbw infants treated after detecting a symptomatic pda ( control ) who were matched by year of birth ( 1999 to 2006 ) , birth weight , gestational age ( ga ) and gender .
indomethacin prophylaxis did not show any advantages over early treatment for managing a symptomatic pda in elbw infants .
the incidence of ivh was the same in the newborns receiving indomethacin prophylaxis and those in the control group .
the use of indomethacin to prevent pda has been demonstrated to reduce the incidence of a symptomatic duct , the need for surgical closure and the occurrence of pulmonary hemorrhage.34,35 however , whether this reduction is significant has been controversial.36 a recent meta - analysis of 19 studies in cochrane ( involving 2,872 preterm infants ) that also included the trials by ment and schmidt discussed above , confirmed that prophylactic indomethacin has short - term benefits for preterm infants , including a reduction in the incidence of symptomatic pda , the need for surgical pda ligation , and severe ivh .
however , there was no evidence of its effect on mortality or neurodevelopment.5 four neonates must be treated to close one da ( i.e. , four is the number needed to treat ) and twenty to avoid ivh .
the same number 20 is needed to avoid surgical closure and pulmonary hemorrhage , and 25 are required to avoid a periventricular leukomalacia .
unfortunately , there was no effect on mortality or the long - term neurological outcomes .
however , prophylactic indomethacin does not reduce the incidence of pneumothorax , the duration of ventilation , the duration of oxygen therapy or the incidence of cld ( at 28 days or 36 weeks ) .
cld , brain injury and rop were predictive factors of late death or neurosensory impairment in the follow - up to the tipp study.37 there are recent data on the long - term alterations that are observed at school age in preterm children who were treated with indomethacin or saline.38,39 at 12 years of age , those children who had received indomethacin prophylaxis had an increased amount of gray matter in the left inferior parietal lobe , which is responsible for phonologic processes .
males had better phonological scores than saline - treated males.40 again , newborns given indomethacin prophylaxis had greater parenchyma in the left lingual lobe at 8 years , but there was no effect on reading .
finally , newborns given indomethacin prophylaxis at birth had better connectivity between specific areas of the two hemispheres ( from the right ba 40 and ba 44 - 45 to the left ba 22 ) .
however , indomethacin did not affect the intellectual function of children who were born preterm.41,42 the only major side effect of indomethacin reported in the 2010 cochrane review was the increased incidence of oliguria , but it was not associated with any documented kidney damage . in the same review , no differences in the incidence of nec or excessive bleeding were demonstrated .
however , there were several side effects following the use of indomethacin demonstrated that raise serious concerns , including a reduction in cerebral blood flow,27,43,44 the volume of blood delivered to the brain and the release of brain tissue oxygen;45 oliguria and transitory kidney insufficiency;46 , necrotizing enterocolitis ; isolated intestinal perforation ; and gastrointestinal hemorrhage.21,47 it is important to note that administering furosemide before each indomethacin dose resulted in a significant increase in the serum creatinine level and hyponatremia without increasing urine output.48 although most of the included studies were high quality , the drug dosage varied from one study to another , and the patient population was not homogeneous in terms of weight or gestational age . some studies included case histories that occurred before the use of prenatal steroids or endotracheal surfactants was widespread .
furthermore , in each study , some patients in the control group were contaminated ( crossed - over ) because they had received indomethacin outside the limits of the study.5 interestingly , some authors found that the timing of the first dose of indomethacin was significantly associated with the closure rate and that early administration reduced the need for surgical ligation . up to 85.2% of das
closed if the first dose of indomethacin was administered within 24 hours of birth ; however , this rate decreased to 48.1% when treatment was started 72 hours or later after birth .
the corresponding rates for surgical ligation were 3.7% and 25.9% , respectively.49 in conclusion , various clinical trials have demonstrated the effectiveness of indomethacin prophylaxis in closing botallo 's duct , but none have answered the fundamental question of whether the prophylactic closure improved the outcome .
prophylaxis does not appear to influence the development of cld , septicemia , rop or mortality .
although prophylaxis is associated with a reduction in serious ivhs , an important predictor of long - term neurological outcome , why prophylaxis does not influence long - term neuromotor outcomes is not known . in an observational study ,
a longer duration of indomethacin exposure was associated with less white matter injury in infants delivered before 28 weeks of gestation.50 in a study by madan,51 29% of 881 elbw patients received indomethacin prophylaxis within the first 24 hours of life .
the authors found that prophylaxis had no effect on outcomes except for a borderline increase in nec frequency in those subjects who received prophylaxis and indomethacin therapy . in a recent study ,
the indomethacin prophylaxis was directed by echocardiography.52 recently , the prophylactic administration of indomethacin in extremely premature infants ( i.e. , those born between 23 and 24 weeks of gestation ) decreased the incidence of symptomatic pda without increasing the incidence of adverse effects.53 in a study conducted in asia , the incidence of ivh and other episodes of bleeding were significantly higher than in the controls , and the study was stopped early.54 lower platelet counts have been associated with a higher failure rate of indomethacin - induced pda closure in human newborns , which is pertinent to clinical practice.55 additionally , administering cortisol to immature fetal lambs in utero results in a ductus that responds to oxygen and prostaglandin inhibition similar to that of a mature fetus , which explains the decreased incidence of pda in preterm humans who are born to mothers who received antenatal corticosteroids.56,14 two commentary articles in the journal of pediatrics emphasized that the consequences of treatment for pda , including the pharmacological side effects and surgery , might be more harmful to the infant than the pda itself.57,19 moreover , there has been concern about the use of nsaids and their long - term renal effects in elbw infants .
in fact , elbw infants treated with nsaids and aminoglycosides have been found to have a renal volume less than the 10th percentile at 7 years of age in 40% of cases , which is associated with 1 microglobinuria.58 recently , evans has adopted a new , targeted refinement of prophylactic indomethacin , which consists of giving indomethacin for early post - natal duct constriction assessed echocardiographically .
the author has also cited the ongoing australian detect trial , which includes infants born before 29 weeks of gestation who , before being treated ( within the first 12 hours and , ideally , in the first 6 hours ) , were examined using an echocardiogram to assess the duct diameter . in this trial ,
preliminary experimental and clinical studies60,61 have shown that ibuprofen , another cyclooxygenase inhibitor , effectively closes the pda without reducing the blood flow to the brain 45,62 or influencing circulation in the intestines63 or kidneys.64 van overmeire performed a randomized , placebo - controlled trial to determine whether ibuprofen could reduce class iii and iv ivh in patients with a gestational age of 24 to 30 weeks .
this study showed that a significant reduction in the incidence of pda ( 16% ) was associated with a lack of differences in the primary outcome of serious ivh ( ibuprofen does not reduce the frequency of ivh ) .
additionally , a lack of differences was not seen in any secondary outcomes , including mortality , pvl , combined cld outcomes or death at 36 weeks . in those receiving prophylaxis
, there was a significant increase in oliguria or an increase in creatinine when compared with the group that did not receive prophylactic treatment.65 a recent meta - analysis66 of prophylactic ibuprofen for pda showed a reduced incidence of pda , a reduced need for symptomatic treatment with cyclooxygenase inhibitors and a reduced need for surgical ligation .
no advantage in the short - term outcomes was demonstrated ; no statistically significant difference in the mortality or the incidence of bpd , nec , gastrointestinal hemorrhage , intestinal perforation , or rop was demonstrated between the ibuprofen - treated and placebo groups . there was a statistically significant negative effect on kidney function . in the control group ,
based on the current clinical data , there are no benefits and possibly some harm with both the early use of ibuprofen as either prophylaxis or treatment in the first 24 hours of life17,66 ( e.g. , pulmonary hypertension)67 - 69 and prolonged courses of indomethacin ( e.g. , nec).16 ibuprofen therapy for pda closure in preterm baboon neonates was not associated with any increased risk of neuropathology or alterations in brain growth and development.70 treatment with ibuprofen is safer than indomethacin because there is a decreased risk of renal failure , thrombocytopenia , and hyponatremia with ibuprofen.71 renal safety should be emphasized because this is a major consideration in choosing ibuprofen instead of indomethacin for early treatment .
there is sufficient evidence to suggest that ibuprofen , at the currently proposed dosing regimen , has an efficacy similar to that of indomethacin but is better tolerated by the neonatal kidney when used to treat established pda.72 this finding has been also observed in animals . in suckling rats , indomethacin suppressed pge2 and cox-2 expression and increased pgf2 expression , whereas ibuprofen increased cox-2 and angiotensin ii expression .
although both nsaids suppressed 6-ketopgf1 and txb2 expression in suckling rats , the effect was sustained in weanling rats with indomethacin .
thus , indomethacin exhibits more potent suppressive effects on the expression of renal cox-2 and vasodilator prostanoids , which are important regulators of renal development and function .
these long - term , sustained effects may partly explain why indomethacin has more severe adverse renal effects than ibuprofen when administered early in postnatal life.73 based on our personal experience,75 - 80 although ibuprofen is less nephrotoxic than indomethacin , it may still have adverse renal effects , even when administrated orally.73 these negative renal effects are only partially compensated by the protection against oxidative stress.81 a recent paper by vieux has confirmed our findings.82 they found that ibuprofen - induced oligo - anuria is not associated with a change in aqp2 activity and that ibuprofen does not affect aqp2 activity during the first month of life in very preterm neonates.83 this is in apparent contrast with the findings from a long - term renal follow - up of premature infants with and without perinatal indomethacin exposure . in an older study,84
perinatal indomethacin did not affect long - term renal growth , morphology or function in children born before completing 33 weeks of gestation .
however , in this study , the duration of umbilical artery catheterization , furosemide treatment and assisted ventilation were associated with the later renal structural and functional anomalies .
similar results have been obtained by other investigators.85 therefore , prophylaxis unnecessarily exposes infants to a drug with worrisome renal side effects without conferring any significant short - term benefits .
the prophylactic group underwent ductal ligation within 24 hours of life following a pre - specified protocol , whereas the control group received standard care without indomethacin.86 whereas prophylactic surgical ligation of the pda did not decrease mortality or bpd in elbw infants , the incidence of stage ii and iii nec was significantly reduced . based on the current evidence , high rate of spontaneous closure , availability of effective safe medical therapies , and potential short- and long - term complications of surgical ligation ,
the use of prophylactic surgical ligation is not indicated.87 recently , a re - examination of this controlled trial by the authors found that prophylactic ligation significantly increased the incidence of bpd ( defined as a need for supplemental oxygen at 36 weeks postmenstrual age ) and the incidence of mechanical ventilation at 36 weeks .
these findings suggest that although surgical prophylactic ductus ligation eliminates the pda , it may contribute to the problem it is trying to prevent .
experimental studies have been initiated to answer this question.88 recently , in a study examining premature baboons versus baboons with a persistent pda , ibuprofen treatment had no effect on the expression of genes that regulate pulmonary inflammation but did increase the expression of alpha - enac , the transepithelial sodium channel that is critical for alveolar water clearance . although ligation eliminates the pda , it does not improve pulmonary mechanics or increase the alveolar surface area .
in contrast with no intervention , pda ligation resulted in a significant increase in the expression of genes associated with pulmonary inflammation ( e.g. , cox-2 , tnf - alpha , and cd14 ) and a significant decrease in alpha - enac expression .
the authors speculated that these changes may decrease the rate of alveolar fluid clearance and contribute to the lack of improvement in pulmonary mechanics following pda ligation.89 the last report from the tipp study reported that surgical closure of a pda reduced mortality to an almost significant extent .
however , neurosensory impairment was also significantly increased by 18 months of age , as were retinopathy of prematurity and bpd.90 these findings are also supported by others.91 furthermore , it has been shown that there is a general association between any surgery in the neonatal period and neurosensory impairment at five years of age , indicating that surgery and anesthesia might be independent risk factors in vlbw infants.92 bratlid recently confirmed that the surgical closure of a patent da in a small premature infant is associated with neurosensory impairment.93 the following adverse events have been reported to be associated with the surgical closure of pda : recurrent laryngeal nerve damage , chylothorax ( thoracic duct injury ) , pneumothorax , a period of left ventricular dysfunction immediately after ligation , and the development of scoliosis.94 - 98 moreover , pda ligation is sometimes associated with impaired left ventricular systolic performance , which is most likely attributable to altered loading conditions .
neonates weighing 1,000 g or less are at an increased risk of impaired left ventricular systolic performance , which is probably due to maturational differences.99 finally , it has very recently been confirmed that ligation in preterm neonates has a considerable risk .
moreover , severe complications and post - operative morbidity have been reported.100 in conclusion , the current evidence does not support the use of prophylactic surgical ligation of das in preterm infants.101 however , it is vital for clinicians to understand the fluid and cardiovascular changes that occur at birth and during pda management to gain a better appreciation of the pathologic processes that may influence the clinical course of an affected infant.102
it has been hypothesized that genetic factors play a significant role in the pathophysiology of pda.103 a retrospective study ( 19912006 ) from two centers was performed using zygosity data from premature twins born at 36 weeks of gestational age and surviving beyond 36 weeks of postmenstrual age .
data from 333 dizygotic twin pairs and 99 monozygotic twin pairs from two centers ( yale university and the university of connecticut ) were obtained .
the conclusion was that preterm pda is highly familial.103,104 while this is the first study that formally isolated and quantified the overall heritability , other studies have addressed the problem . in a candidate gene study of 141 lbw newborns ,
allele of the estrogen receptor gene pvuii pp polymorphism were at a lower risk for pda but with a wide ci ( or : 0.24 , 95% ci : 0.050.97 ) . in another candidate gene study of 153 lbw newborns ,
bokodi et al.106 showed that carriers of the interferon gamma ( + 874 ) t allele were protected against pda ( or : 0.43 , 95% ci : 0.190.97 ) with a similarly wide ci .
because approximately 30% of infants with pda do not respond to pharmacologic treatments for closure , some authors have investigated whether single nucleotide polymorphisms ( snps ) in genes that regulate smooth muscle contraction , xenobiotic detoxification , inflammation or other processes are markers for the persistent patency of the da .
initially , 377 snps from 130 genes of interest were evaluated in dna samples collected from 204 infants with a gestational age of less than 32 weeks .
snps in the ap-2 beta ( tfap2b ) and tnf receptor - associated factor 1 ( traf1 ) genes remained significant , both with p - values of 0.005 .
these data support a genetic contribution to the risk of pda in preterm infants.107 genetic polymorphisms in the cytochrome p450 ( cyp ) family of enzymes can contribute to the pharmacokinetic ( pk ) variability of drugs . pk variability is observed as a bimodal distribution of extensive metabolizers ( ems ) and poor metabolizers ( pms ) . pk variability may also exist between individuals genotyped as homozygous ems and heterozygous ems .
this can have implications for drug dosing and the drug response ( e.g. , the risk of therapeutic failure or drug toxicity ) , especially for nsaids.108 however , cyp2c8 and 2c9 polymorphisms do not appear to be involved in the response of preterm infants to ibuprofen therapy for pda and can not be used to optimize the ductal closure rate by modulating the ibuprofen - dosing strategy.109 in contrast , this study reported the role of ethnicity in the interindividual variability of the response to ibuprofen and subsequent pda closure in preterm infants .
interethnic differences in the neonatal pda clinical course should be further explored and correlated to ibuprofen pharmacokinetics.109 additionally , recent studies have reported that three independent risk factors ( immature gestation , the absence of antenatal glucocorticoid exposure , and the presence of the rs2817399(a ) allele of the gene , tfap2b ) are associated with das that fail to close with prostaglandin inhibition .
furthermore , these risk factors affected a common set of genes that increase the risk of persistent pda after birth . in a study examining the ductus in term , preterm , and glucocorticoid - treated preterm baboon fetuses , it was found that both immature birth and the absence of antenatal glucocorticoids decreased the rna expression of the calcium- and potassium - channel genes involved in oxygen - induced constriction and phosphodiesterase genes , which modulate camp / cgmp signaling .
furthermore , in a study in which ductus obtained from second trimester human pregnancies were genotyped for tfap2b polymorphisms , when present , the rs2817399(a ) allele was also associated with the decreased expression of calcium- and potassium - channel genes .
in contrast , alleles of two other tfap2b polymorphisms , rs2817419(g ) and rs2635727(t ) , were not correlated with the incidence of pda after birth and had no effect on rna expression .
three calcium- and potassium - channel genes ( cacna1g / alpha1 g , cacnb 2/cal - beta2 , and kcna2/kv1.2 ) were similarly affected by each of the risk factors associated with pda .
the authors speculated that these channels may play a significant role in closing the preterm ductus following prostaglandin inhibition and may be potential targets for future pharmacologic manipulations.110 therefore , knowing the genes responsible for maintaining the balance between patency and closure and the related epigenetic factors is an important step toward developing pharmacogenetic strategies tailored to individual genomes . a better understanding of the genetic background of this developmental process can help develop new strategies to manipulate the da in premature infants , neonates with duct - dependent cardiac anomalies , and patients with syndromic and non - syndromic pda.104 the practical message is that , if these data are true , we must individualize nsaid treatment and prophylaxis.112 metabolomics may provide the answer to this question.112,113 in fact , a metabolic signature for pda in preterm infants has been identified using an nmr - based metabolomic analysis of urine.113 by collecting the first urine at birth , it is possible to anticipate the persistence of pda at day 4 .
there has been much debate in recent years as to when a pda is pathologic and when closure is indicated .
there is a pressing need to better understand the benefits and risks of all pda treatments.114 - 122 currently , it is unclear whether and when a conservative , pharmacologic or surgical approach for pda closure may be advantageous,13 and this is also the opinion of the authors.118,119 based on the current literature , we can offer some suggestions regarding prophylaxis .
al faleh , who supports the prophylactic use of indomethacin , has recently hypothesized that the results of the tipp study were influenced by fluid overload and pulmonary edema . in his opinion
, fluid restriction might decrease the rate of bpd in elbw infants who receive indomethacin prophylaxis.120 prophylaxis with ibuprofen can not be recommended , as it does not prevent ivh ; it is important to avoid ibuprofen in infants in whom the da may spontaneously close .
routine prophylaxis with indomethacin can not be recommended for the prevention of long - term morbidities and mortality , especially in centers where severe ivh is comparable to the national average and surgical complications are minimal.120 table 1 presents ten reasons for definitively abandoning pda prophylaxis . in conclusion , because they expose a significant number of preterm infants who will never develop pda ( 4060% ) to potential severe , drug - related complications , all types of pda prophylaxis , including indomethacin , can not be considered a
standard of care ' until their long - term efficacy is proven in clinical trials .
Output:
| although the prophylactic administration of indomethacin in extremely low - birth weight infants reduces the frequency of patent ductus arteriosus and severe intraventricular hemorrhage , it does not appear to provide any long - term benefit in terms of survival without neurosensory and cognitive outcomes .
considering the increased drug - induced reduction in renal , intestinal , and cerebral blood flow , the use of prophylaxis can not be routinely recommended in preterm neonates .
however , a better understanding of the genetic background of each infant may allow for individualized prophylaxis using nsaids and metabolomics . |
PubmedSumm6840 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: with approval from the oregon state university animal care and use committee ( animal care and use proposal no .
4329 ) , blood samples were collected from 92 horses being evaluated for medical conditions ( e.g. , anorexia , weight loss , lameness , administration of endoparasiticides and ectoparasiticides ) or before elective surgery ( e.g. , castration , wound repair ) at the clinic in mrida from august 28 through september 4 , 2013 .
( a. phagocytophilum and a. platys ) , b. burgdorferi sensu stricto , and ehrlichia spp .
( e.canis , e. chaffeensis , and e. ewingii ) by using the elisa - based assay snap 4dxplus ( idexx laboratories , inc . ,
westbrook , me , usa ) according to the manufacturer s instructions ( 9 ) .
the assay does not use a host species specific conjugate and can therefore be used in research to screen mammals other than dogs . according to assay results , 51 ( 55% ) horse serum samples
the 51 ehrlichia spp.reactive serum samples were subsequently stored at 28c for up to 1 week during transport to the united states . for pcr testing , samples were shipped ( us department of agriculture import permit no .
13846 ) to the intracellular pathogens research laboratory , center for comparative medicine and translational research , north carolina state university , college of veterinary medicine .
dna extraction from 200 l of edta - anticoagulated whole blood was performed by using a qiasymphony dna mini kit ( qiagen , valencia , ca , usa ; catalog no .
previously described pcrs were used to amplify a 420-bp fragment of the 16s rrna gene , a 620-bp fragment of the groel gene , and a 300-bp fragment of the ehrlichia spp .
a larger , 600-bp , fragment of the sodb gene was amplified from 1 sample that was positive by pcr by using the following unpublished primers : sodbehrl600-f 5-atgtttactttacctgaacttccatatc-3 and sodbehrl600-r 5-atctttgagctgcaaaatcccaatt-3. positive ( anaplasma or ehrlichia spp . plasmid dna ) and negative ( rnase - free molecular - grade water and a dna extraction control consisting of uninfected canine genomic dna ) controls were used for each assay .
( research triangle park , nc , usa ) , and alignments were compared with those of genbank sequences by using alignx software ( vector nti advance version 11.5 ; invitrogen , carlsbad , ca , usa ) .
of the 51 samples tested by 16s rdna pcr , the rdna amplicon sequences were identical for 4 ( 8% ) .
* sequences for partial 16s rrna , groel , and sodb genes are compared with genbank database sequences from ehrlichia ruminantium , e. canis , e. chaffeensis , e. ewingii , anaplasma marginale , a. phagocytophilum , and neorickettsia risticii .
genbank sequence accession numbers for 16s rrna , groel , and sodb for ehrlichia sp . from horses in nicaragua are kj434178 , kj434179 , and kj434180 , respectively .
according to serologic , pcr amplification , and dna sequencing results , tick - infested horses in mrida , nicaragua , might be infected with a potentially novel ehrlichia species .
initial serologic screening with the rapid elisa indicated that exposure to > 1 ehrlichia species is common among horses in nicaragua ( 55% ) .
for dogs , snap 4dxplus results can be positive after exposure to e. canis , e. chaffeensis , e. ewingii , and potentially e. muris and panola mountain ehrlichiae ( 2,3,6 ) . before this study , equine exposure to a. phagocytophilum ( previous designation e. equi ) in nicaragua
was considered more likely because equine exposure has occurred in guatemala ; this rickettsial organism is pathogenic for cats , dogs , horses , and humans ( 12 ) .
however , in north america , a. phagocytophilum is transmitted by i. scapularis and i. pacificus ticks , which have not been reported in nicaragua . in future studies of horses in nicaragua , ticks will be collected for identification . in guatemala ,
r. microplus and a. cajennense ticks were the predominant species found on cattle , whereas d. nitens and a. cajennense ticks were most commonly found on horses ( 12 ) .
of note , in guatemala , tick infestation levels were substantially higher and body condition scores lower for horses than for cattle .
also , cattle were exposed to an agent with serologic cross - reactivity and close genetic relatedness to e. ruminantium .
the partial 16s rdna sequences obtained from these horses most likely represent a novel species of ehrlichia .
this conclusion is further supported by sequence analysis of 2 protein - coding genes , sodb and groel . partial sequences from sodb and groel genes demonstrated similarity to ehrlichia spp .
sequences found in genbank , but they were not 100% identical to any sequences deposited to date .
recommend that gene homology for organisms of identical species and genus be 99.8% and 98.1% , respectively ( 13 ) .
although identical species are typically defined as being > 99% identical with a reference sequence , the percentage identity needed to define a separate species is debated , ranging from 97% to 99.5% ( 14 ) .
calculation of values can be based on alignment methods , reference databases , and number of basepairs in the sequence .
recommend that for novel species identification and rickettsiae classification , protein - coding genes should be used , specifically the 4 protein - coding genes glta , ompa , ompb , and gene d in addition to the 16s rrna gene . to date , 16s rdna sequences or whole - genome sequencing have been used to classify ehrlichia species and strains . collectively , and as depicted in the figure ( in which phylogenetic alignment trees for all 3 genes tested in this study were constructed by using reference sequences from representative members of the genera anaplasma , ehrlichia , and neorickettsia ) , the genetic findings in this study support infection of horses in nicaragua with a novel ehrlichia species .
to confirm this possibility , future efforts will focus on cell culture isolation of the ehrlichia organism from horses in nicaragua .
phylogenetic trees of ehrlichia sp . from horses in nicaragua and selected bacterial species ( genbank accession numbers for reference sequences in parenthesis ) based on partial sequences from genes coding for 16srrna ( a ) , groel ( b ) , and sodb ( c ) .
sequences were aligned by using muscle version 3.7 ( http://www.ebi.ac.uk/tools/msa/muscle/ ) , and alignments were refined by using gblocks version 0.91b ( http://www.idtdna.com/gblocks.com ) .
phylogenetic trees were constructed by using phyml version 3.0 alrt ( http://code.google.com/p/phyml/ ) under the hky85 model , and the resulting trees were rendered by using treedyn version 198.3 ( http://www.treedyn.org/ ) .
scale bars indicate number of substitutions per site , and the numbers in the branches represent percentage support of the node .
at least 4 ehrlichia species have been implicated as being pathogenic for canids and humans ( 13 ) .
thus , future studies should also determine whether dogs , other animals , and humans in nicaragua are exposed to and infected with this potentially novel ehrlichia species .
Output:
| ehrlichia sp . dna was amplified from 4 ehrlichia - seroreactive horses from mrida , nicaragua .
sequencing of 16s rdna , sodb , and groel genes indicated that the bacterium is most likely a novel ehrlichia species .
the tick vector and the potential for canine and human infection remain unknown . |
PubmedSumm6841 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the data on the expression levels of human genes were taken from the gene expression atlas ( 35 ) .
the uniform platform for all tissues was affymetrix u95a . only probes that presented the characterized genes ( i.e. those with links to the refseq database ) were used , with signals from probes on the chip corresponding to the same gene being averaged ( with total of 7708 genes ) .
only data for normal tissues were used , samples and replicates representing the same tissue were averaged ( with total of 32 tissues ) . as was recommended ,
a gene was regarded as expressed if its signal level exceeded a conservative threshold of 200 arbitrary units ( 35 ) .
it should also be noted that there is a strong correlation ( spearman r = 0.89 ,
p < 10 ) between the expression breadth ( number of tissues where a given gene is expressed ) and the expression level averaged over all tissues studied ( 34 ) .
the intronic sequences were found for 6874 genes , and the intergenic sequences ( both upstream and downstream ones ) , for 5104 genes . in the case of alternative splicing variants , the longest coding sequence was taken .
the average length and gc content of upstream and downstream intergenic sequences were taken as the corresponding values of the intergenic spacer for a given gene .
the nucleosome formation potential of nucleotide sequences was determined using the method by levitsky and co - workers ( 3739 ) , constructed and verified on the basis of large experimental datasets of nucleosome positioning sequences ( 4042 ) .
the nucleosome formation potential was averaged over each sequence length ; for introns , exons and intergenic spacers it was also weight - averaged for each gene .
the nucleosome formation potential shows a negative correlation with gc content ( figure 1 ) , which is in accordance with the expectations from the physical properties of dna helix associated with gc content ( 16 ) .
it was previously reported that gc content of both intronic and intergenic sequences should be included as covariate into multifactor statistical analyses for the correlation between the gene nest proportion and expression breadth to disappear completely ( 34 ) .
this fact was interpreted in the sense that either both intronic and intergenic gc content taken together better reflects the isochore affiliation of a given gene ( i.e. the regional effect ) or that the local variation of gc content among intronic and intergenic sequences is also an important property of the gene nest. the negative correlation between nucleosome formation potential and gc content ( figure 1 ) suggests that the combined impact of both intergenic and intronic gc content on the expression breadth is a local effect related to nucleosome formation .
introns of broadly expressed genes show a lower nucleosome formation potential compared with introns of tissue - specific genes ( figure 2 ) .
intergenic spacers show a similar picture ( not shown in figure 2 because they mostly overlap with introns ) .
exons show a similar trend with introns ' ( and intergenic spacers ' ) reduction of nucleosome formation potential with increasing gene expression breadth
. however , their mean potential is lower than potential of introns and intergenic spacers for all gene expression groups ( figure 2 ) . in the intergenic spacers , the nucleosome formation potential drops similarly to introns with the increase of gc content , whereas in exons it drops significantly faster ( confer slopes in figure 1 ) .
it is noteworthy that in the gc - poor sequences , exons have a similar or even a higher nucleosome formation potential compared with noncoding dna , but the picture is reversing with the elevation of gc content ( figure 1 ) . in genes located in the heavy isochores [ i.e. with gc content above 50% ( 1 ) ] , exons have a higher gc content than introns by 5% ( absolute percentage ) ( 16 ) .
therefore , judging by the data shown in figure 1 , introns seem to be the main source of nucleosome formation potential in the genes of heavy isochores . a greater scatter of exon points compared with noncoding sequences ( figure 1 ) can be explained by the shorter length of exons ( and thus , higher statistical noise ) and/or by exons ' informational load that may interfere with requirements of nucleosome formation .
the nucleosome formation potential correlates positively with intronic and intergenic sequence lengths ( for log - transformed lengths : for introns , r = 0.39 , p < 10 ; for intergenic spacers , r = 0.43 , p < 10 ) .
( for exons , the partial correlation between nucleosome formation potential and sequence length independently of gc content was not significant . ) in turn , the negative correlation between nucleosome formation potential and gc content is partially independent of sequence length ( figure 3b ) .
these facts indicate that both the gc content and the length of introns and intergenic spacers are related to chromatin condensation in the human genome .
it was previously reported that nucleosome formation potential is higher in introns compared with exons ; however , no statistical analysis was made , and the authors ' histograms of nucleosome formation potential for introns and exons mostly overlapped [ figure 1a in ( 38 ) ] .
this overlap is probably due to a large number of gc - poor introns and exons in the authors ' dataset .
it was also found ( on a limited dataset of 200 genes ) that nucleosome formation potential is higher in the promoter regions of tissue - specific genes compared with the promoters of housekeeping genes ( 37 ) .
the data presented here show that the same is true not only for the promoters but also for the bulk of noncoding dna , which suggests its involvement in chromatin - mediated suppression of tissue - specific genes .
it is now well recognized that epigenetic mechanisms , operating on the large domains rather than on individual promoters , are used in maintaining and stably transmitting chromatin states through the cell cycle ( 43,44 ) .
a high local concentration of nucleosomes is necessary for the higher - order chromatin condensation , which is a distinct level of transcriptional regulation ( 44,45 ) .
the present data also help explain why gc content rises near gene transcription start site [ figure 1a in ( 46 ) ] .
the elevation of gc content is associated with the reduction of nucleosome formation potential that should facilitate the binding of transcription factors ( after the higher levels of chromatin condensation are unfolded ) .
it was long argued that noncoding dna might be necessary for correct chromatin structure because exons are under strong selection pressure for informational content ( 38,4749 ) .
it was even shown in several cases that after experimentally removing the introns , genes lose the ability to form nucleosomes ( 50,51 ) .
the present data suggest that both the length and the gc content of noncoding dna ( and thus the isochoric structure ) in the human genome can be relevant to chromatin - mediated suppression of tissue - specific genes .
it should be noted that the existence of the isochores in the genomes of warm - blooded vertebrates , which was initially discovered using the cscl density gradient ultracentrifugation , was questioned after the completion of the human genome ( 52 ) .
however , the statistical test for isochoric structure used in ( 52 ) was criticized , and the later works confirmed the existence of isochores ( 5355 ) . while too complicated tests may be prone to unexpected errors and interpretation problems , even a simple analysis of intron exon contrasts demonstrated that notwithstanding a high global compositional heterogeneity , genomes of warm - blooded vertebrates show an unusual local homogeneity : the mean absolute intron exon difference in gc content is more than 2-fold lower in them than in the genomes of other organisms [ figure 1a in ( 56 ) ] .
the greater length of mammal introns compared with introns of other studied organisms makes this small intron - exon contrast even more unusual .
buffering role , damping the effect of solvent fluctuations on the nuclear machinery ( 57 ) .
recently , it was shown in comparison of two closely related amphibian species differing in genome size that chromatin condensation was steadier and its reaction to changes in solvent composition ( caused by elevated extracellular salinity ) was more inertial in the species with the larger genome , which is in agreement with the
the ability of dna to act as a buffer to control the concentration ( more exactly , the activity ) of dna - binding proteins was even used for the development of experimental methods for the investigation of histone dna interactions [ reviewed in ( 59 ) ] .
it is also possible that there can be local buffering in regard to a given locus .
a large amount of noncoding dna within and around a tissue - specific gene may furnish high local histone concentration and thus secure suppression of transcriptional noise .
[ transcriptional background noise is believed to be a great threat to cellular function as the number of genes increases during evolution ( 60,61 ) . ]
the role of dna in providing high local concentration of sequence - specific dna - tropic proteins is discussed in ( 62 ) .
( a ) exons ( intercept = 4.6 0.1 , slope = 0.08 0.00 , r = 0.75 , p < 10 ) .
( b ) introns ( intercept = 2.3 0.0 , slope = 0.02 0.00 , r = 0.78 , p < 10 ) .
( c ) intergenic spacers ( intercept = 2.4 0.0 , slope = 0.03 0.00 , r = 0.73 , p < 10 ) .
dashed lines , confidence limits ; dotted lines , prediction limits , both for p = 0.95 ; and a.u .
the nucleosome formation potential in human exons ( squares ) and introns ( circles ) of genes expressed in a different number of tissues ( anova and kruskal wallis , in both cases p < 10 ) .
the data for intergenic spacers are not shown because they mostly overlap with introns ; a.u .
( a ) regression on ( log - transformed ) sequence length at fixed gc - content ( partial r = 0.23 , p < 10 ; for introns , the picture was similar , partial r = 0.14 , p < 10 ) .
( b ) regression on gc - content at fixed sequence length ( r = 0.68 , p < 10 ; for introns , partial r = 0.74 , p < 10 ) . dashed lines , confidence limits ; dotted lines , prediction limits , both for p = 0.95 ; and nfp , nucleosome formation potential .
Output:
| the nucleosome formation potential of introns , intergenic spacers and exons of human genes is shown here to negatively correlate with among - tissues breadth of gene expression .
the nucleosome formation potential is also found to negatively correlate with the gc content of genomic sequences ; the slope of regression line is steeper in exons compared with noncoding dna ( introns and intergenic spacers ) .
the correlation with gc content is independent of sequence length ; in turn , the nucleosome formation potential of introns and intergenic spacers positively ( albeit weakly ) correlates with sequence length independently of gc content .
these findings help explain the functional significance of the isochores ( regions differing in gc content ) in the human genome as a result of optimization of genomic structure for epigenetic complexity and support the notion that noncoding dna is important for orderly chromatin condensation and chromatin - mediated suppression of tissue - specific genes . |
PubmedSumm6842 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: hypertrophic cardiomyopathy ( hcm ) is a common inherited cardiac disorder which is estimated to occur in one out of 500 patients within the general population .
an autosomal dominant mutation is found in approximately 5060% of cases , most frequently in genes that code for sarcomeric proteins .
these mutations often lead to thickening of the left ventricular ( lv ) wall , myocyte disarray , and cardiac fibrosis .
important clinical consequences of hcm are heart failure and potentially life - threatening ventricular arrhythmias .
hcm is the most common cause of sudden cardiac death ( scd ) under the age of 35 years , especially in young athletes .
about one sixth of the cases of scd occur during or immediately after moderate to severe physical activity [ 4 , 5 ] . because of the phenotypic heterogeneity of hcm it is important to find predictors and mechanisms that can explain scd , particularly in relation to exercise [ 6 , 7 ] .
the precise mechanism of underlying arrhythmias remains unknown and it is currently unsettled whether scd is triggered by pro - arrhythmic changes in hypertrophied cardiac myocytes themselves or rather by changes in the myocardial structure due to myocardial fibrosis [ 811 ] . since scd in hcm patients is often related to exercise and to fibrosis , we sought to determine the prevalence of ventricular arrhythmias during exercise - ecg testing in a population of proven carriers of an hcm causing mutation and relate this to fibrosis as determined with cardiac magnetic resonance imaging ( cmr ) .
a cohort of 31 genetically proven hcm mutation carriers ( probands and family members ) were seen between march 2004 and february 2008 in the maastricht university medical center , the netherlands .
we included all carriers , symptomatic and asymptomatic , where both a cmr and exercise test were available for analysis . patients were examined with a clinical 1.5 t gyroscan intera mri scanner ( philips medical systems , best , the netherlands ) equipped with a dedicated five - element phased array surface coil and cardiac software .
ecg - gated multi - slice multi - phase images were acquired for functional analysis during multiple breath holds using a steady - state free precession sequence ( slice thickness 6 mm , slice gap 4 mm , repetition time / echo time 3.8/1.9 ms , flip angle 50 , field of view 350 mm , matrix 256 256 , 2225 phases per cardiac cycle ) in vertical long - axis ( vla ) , horizontal long - axis ( hla ) , lv outflow tract ( lvot ) view and contiguous short - axis ( sax ) slices covering the entire left ventricle .
ten minutes after 0.2 mmol / kg intravenous contrast administration ( gadolinium - dtpa , magnevist , schering , berlin , germany ) a look - locker ( ll ) sequence was applied in sax orientation to determine the inversion time to optimally null lv myocardium for the subsequent scan . immediately after the ll scan , late gadolinium enhancement ( lge ) multislice images were obtained using a 3d inversion - recovery gradient - echo sequence , covering the entire lv in the hla , vla and sax orientation .
cmr images were analysed with commercially available software ( caas mrv 3.0 , pie medical imaging bv , maastricht , the netherlands ) .
endocardial and epicardial contours were manually traced in end - diastolic and end - systolic phases on sax cine images to determine end - diastolic volume and end - systolic volume , ejection fraction and lv end - diastolic ( lved ) mass . where appropriate lved was indexed to body surface area . the maximal end - diastolic lv wall thickness ( lvedwt(max ) )
on the lge images , the presence and localisation of fibrosis ( i.e. hyperenhancement ) was assessed by two independent observers who were blinded to the clinical and exercise ecg results . any discrepancy in analysis between the two readers
these areas of fibrosis were subsequently quantified in sax orientation using a signal intensity ( si ) cut - off of at least 5 sd above the si of remote and adequately
the extent of fibrosis was expressed as percent of lv mass and on a segmental basis according to the american heart association ( aha ) 17 segment model [ 12 , 13 ] .
because measurements of the apex were often unreliable , this segment ( segment 17 ) was excluded from further analysis .
in addition , the most basal slice having circumferential myocardial muscle at both the end - diastolic and end - systolic phase was selected as the base of the left ventricle to prevent including the lvot in the measurements . based on the mean extent of fibrosis per patient ,
each segment was classified as either having a high ( more than or equal to ) or low ( less than the mean ) extent of fibrosis .
all patients underwent a symptom - limited treadmill exercise test according to the bruce protocol .
exercise related ventricular arrhythmias ( erva ) were defined as ventricular premature beats ( vpbs ) , ventricular tachycardia ( vt 3 beats and frequency 100 beats / min ) and ventricular fibrillation ( vf ) , occurring during exercise and the post - exercise recovery period . regarding these vpbs ,
the number , morphology , bigeminy and time of occurrence during the exercise test were analysed .
the origin of erva was determined according to the diagram in fig . 1 based on the aha 17 segment model by an experienced cardiac electrophysiologist blinded to the clinical and cmr data
. patients were categorised into two groups , according to presence or absence of erva . within each patient
the origin of erva was compared with the site of fibrosis within the 17 segment model ( fig . 2 ) .
localisation within the left ventricle : according to the aha 17 segment model of the left ventricle .
neg negative , pos positive , rbbb right bundle branch block , rv right ventriclefig .
late gadolinium enhanced ( lge ) short axis image ( a ) showing fibrosis in the basal anteroseptal segment ( arrow ) . in this patient , a ventricular premature beat originated from the corresponding segment or nearby this segment in the right ventricular outflow tract ( b ) analysis method to determine the origin of ventricular arrhythmias .
localisation within the left ventricle : according to the aha 17 segment model of the left ventricle .
neg negative , pos positive , rbbb right bundle branch block , rv right ventricle example of exercise related arrhythmias and fibrosis in one patient .
late gadolinium enhanced ( lge ) short axis image ( a ) showing fibrosis in the basal anteroseptal segment ( arrow ) . in this patient , a ventricular premature beat originated from the corresponding segment or nearby this segment in the right ventricular outflow tract ( b ) data are expressed as mean sd .
clinical and demographic characteristics of the erva and non - erva groups were compared using the mann - whitney u test for continuous variables , and the test for categorised variables expressed as proportions ( or fisher s exact test for subgroups containing 5 observations ) . the spss software version 12.0 ( spss inc . ,
a cohort of 31 genetically proven hcm mutation carriers ( probands and family members ) were seen between march 2004 and february 2008 in the maastricht university medical center , the netherlands .
we included all carriers , symptomatic and asymptomatic , where both a cmr and exercise test were available for analysis .
patients were examined with a clinical 1.5 t gyroscan intera mri scanner ( philips medical systems , best , the netherlands ) equipped with a dedicated five - element phased array surface coil and cardiac software .
ecg - gated multi - slice multi - phase images were acquired for functional analysis during multiple breath holds using a steady - state free precession sequence ( slice thickness 6 mm , slice gap 4 mm , repetition time / echo time 3.8/1.9 ms , flip angle 50 , field of view 350 mm , matrix 256 256 , 2225 phases per cardiac cycle ) in vertical long - axis ( vla ) , horizontal long - axis ( hla ) , lv outflow tract ( lvot ) view and contiguous short - axis ( sax ) slices covering the entire left ventricle .
ten minutes after 0.2 mmol / kg intravenous contrast administration ( gadolinium - dtpa , magnevist , schering , berlin , germany ) a look - locker ( ll ) sequence was applied in sax orientation to determine the inversion time to optimally
immediately after the ll scan , late gadolinium enhancement ( lge ) multislice images were obtained using a 3d inversion - recovery gradient - echo sequence , covering the entire lv in the hla , vla and sax orientation .
cmr images were analysed with commercially available software ( caas mrv 3.0 , pie medical imaging bv , maastricht , the netherlands ) .
endocardial and epicardial contours were manually traced in end - diastolic and end - systolic phases on sax cine images to determine end - diastolic volume and end - systolic volume , ejection fraction and lv end - diastolic ( lved ) mass . where appropriate lved was indexed to body surface area . the maximal end - diastolic lv wall thickness ( lvedwt(max ) )
on the lge images , the presence and localisation of fibrosis ( i.e. hyperenhancement ) was assessed by two independent observers who were blinded to the clinical and exercise ecg results . any discrepancy in analysis between the two readers
these areas of fibrosis were subsequently quantified in sax orientation using a signal intensity ( si ) cut - off of at least 5 sd above the si of remote and adequately
the extent of fibrosis was expressed as percent of lv mass and on a segmental basis according to the american heart association ( aha ) 17 segment model [ 12 , 13 ] .
because measurements of the apex were often unreliable , this segment ( segment 17 ) was excluded from further analysis .
in addition , the most basal slice having circumferential myocardial muscle at both the end - diastolic and end - systolic phase was selected as the base of the left ventricle to prevent including the lvot in the measurements . based on the mean extent of fibrosis per patient ,
each segment was classified as either having a high ( more than or equal to ) or low ( less than the mean ) extent of fibrosis .
cmr images were analysed with commercially available software ( caas mrv 3.0 , pie medical imaging bv , maastricht , the netherlands ) .
endocardial and epicardial contours were manually traced in end - diastolic and end - systolic phases on sax cine images to determine end - diastolic volume and end - systolic volume , ejection fraction and lv end - diastolic ( lved ) mass . where appropriate lved was indexed to body surface area . the maximal end - diastolic lv wall thickness ( lvedwt(max ) )
on the lge images , the presence and localisation of fibrosis ( i.e. hyperenhancement ) was assessed by two independent observers who were blinded to the clinical and exercise ecg results . any discrepancy in analysis between the two readers
these areas of fibrosis were subsequently quantified in sax orientation using a signal intensity ( si ) cut - off of at least 5 sd above the si of remote and adequately
the extent of fibrosis was expressed as percent of lv mass and on a segmental basis according to the american heart association ( aha ) 17 segment model [ 12 , 13 ] . because measurements of the apex were often unreliable , this segment ( segment 17 )
in addition , the most basal slice having circumferential myocardial muscle at both the end - diastolic and end - systolic phase was selected as the base of the left ventricle to prevent including the lvot in the measurements .
based on the mean extent of fibrosis per patient , each segment was classified as either having a high ( more than or equal to ) or low ( less than the mean ) extent of fibrosis .
all patients underwent a symptom - limited treadmill exercise test according to the bruce protocol .
exercise related ventricular arrhythmias ( erva ) were defined as ventricular premature beats ( vpbs ) , ventricular tachycardia ( vt 3 beats and frequency 100 beats / min ) and ventricular fibrillation ( vf ) , occurring during exercise and the post - exercise recovery period . regarding these vpbs
, the number , morphology , bigeminy and time of occurrence during the exercise test were analysed .
the origin of erva was determined according to the diagram in fig . 1 based on the aha 17 segment model by an experienced cardiac electrophysiologist blinded to the clinical and cmr data .
patients were categorised into two groups , according to presence or absence of erva . within each patient
the origin of erva was compared with the site of fibrosis within the 17 segment model ( fig . 2 ) .
localisation within the left ventricle : according to the aha 17 segment model of the left ventricle .
neg negative , pos positive , rbbb right bundle branch block , rv right ventriclefig .
late gadolinium enhanced ( lge ) short axis image ( a ) showing fibrosis in the basal anteroseptal segment ( arrow ) . in this patient , a ventricular premature beat originated from the corresponding segment or nearby this segment in the right ventricular outflow tract ( b ) analysis method to determine the origin of ventricular arrhythmias .
localisation within the left ventricle : according to the aha 17 segment model of the left ventricle .
neg negative , pos positive , rbbb right bundle branch block , rv right ventricle example of exercise related arrhythmias and fibrosis in one patient .
late gadolinium enhanced ( lge ) short axis image ( a ) showing fibrosis in the basal anteroseptal segment ( arrow ) . in this patient , a ventricular premature beat originated from the corresponding segment or nearby this segment in the right ventricular outflow tract ( b )
the origin of erva was determined according to the diagram in fig . 1 based on the aha 17 segment model by an experienced cardiac electrophysiologist blinded to the clinical and cmr data .
patients were categorised into two groups , according to presence or absence of erva . within each patient
the origin of erva was compared with the site of fibrosis within the 17 segment model ( fig . 2 ) .
localisation within the left ventricle : according to the aha 17 segment model of the left ventricle .
neg negative , pos positive , rbbb right bundle branch block , rv right ventriclefig .
late gadolinium enhanced ( lge ) short axis image ( a ) showing fibrosis in the basal anteroseptal segment ( arrow ) . in this patient , a ventricular premature beat originated from the corresponding segment or nearby this segment in the right ventricular outflow tract ( b ) analysis method to determine the origin of ventricular arrhythmias .
localisation within the left ventricle : according to the aha 17 segment model of the left ventricle .
neg negative , pos positive , rbbb right bundle branch block , rv right ventricle example of exercise related arrhythmias and fibrosis in one patient .
late gadolinium enhanced ( lge ) short axis image ( a ) showing fibrosis in the basal anteroseptal segment ( arrow ) . in this patient , a ventricular premature beat originated from the corresponding segment or nearby this segment in the right ventricular outflow tract ( b )
data are expressed as mean sd . clinical and demographic characteristics of the erva and non - erva groups
were compared using the mann - whitney u test for continuous variables , and the test for categorised variables expressed as proportions ( or fisher s exact test for subgroups containing 5 observations ) .
the spss software version 12.0 ( spss inc . , chicago , illinois ) was used for all analyses .
thirty - one patients were studied with a mean age of 38 13 years ( range 16 to 65 years ) and of whom 20 were male ( 65% ) .
these patients carried five different mutated genes , one patient carried a double - heterozygous mutation .
mean lved mass and lvef were 76 23 g / m and 67 5% respectively .
lvedwt(max ) was 20 7 mm ( range 9 to 32 mm ) .
twenty - three ( 74% ) patients had an lvedwt(max ) of 15 mm .
erva ( vpbs but not vt or vf ) occurred in 7 ( 23% ) patients .
table 1study patients and subgroups according to exercise related ventricular arrhythmiascharacteristicsall patients ( n = 31)erva statusp valueerva ( + ) ( n = 7)erva ( ) ( n = 24)age ( years)38 1337 638 15nsmale gender , n ( % ) 20 ( 65)5 ( 71)15 ( 63)nsmore than 1 scd risk factor , n ( % ) 21 ( 68)7 ( 100)14 ( 28)0.04mutations , n ( % ) ns myh712 ( 37 ) 2 ( 29)10 ( 40 ) mybpc37 ( 23)4 ( 57)3 ( 13 ) tpm19 ( 29)1 ( 14)8 ( 33 ) myl22 ( 7)0 ( 0)2 ( 8) csrp32 ( 5 ) 0 ( 0)2 ( 6 ) nt - probnp , pmol / l70 5687 5362 57nscmr lvef , % 67 569 367 6ns lvmi , g / m76 2395 3371 17ns
7ns fibrosis , n ( % ) 21 ( 68)7 ( 100)14 ( 58)0.04 extent of fibrosis , % 5 48 43.4
3.60.02exercise test , n ( % ) vt / vf0 ( 0)00 vpbs7 ( 27)70 bigeminy and couplet1 ( 3)10 -blocker therapy9 ( 29)3 ( 43)6 ( 25)nscmr cardiac magnetic resonance imaging , csrp3 cysteine and glycine - rich protein 3 , erva exercise related ventricular arrhythmias , lv left ventricle , lvedwt(max ) maximal end - diastolic left ventricle wall thickness , lvef left ventricle ejection fraction , lvmi left ventricle mass index , mybpc3 myosin binding protein c , myh7 myosin heavy chain 7 , myl2 myosin light chain 2 , ns not significant , scd sudden cardiac death , tpm1 alpha tropomyosin 1 , vf ventricular fibrillation , vpb ventricular premature beat , vt ventricular tachycardiathe p values reflect the comparison of patients with erva vs. those without ervaone patient carried double heterozygous gene mutations study patients and subgroups according to exercise related ventricular arrhythmias cmr cardiac magnetic resonance imaging , csrp3 cysteine and glycine - rich protein 3 , erva exercise related ventricular arrhythmias , lv left ventricle , lvedwt(max ) maximal end - diastolic left ventricle wall thickness , lvef left ventricle ejection fraction , lvmi left ventricle mass index , mybpc3 myosin binding protein c , myh7 myosin heavy chain 7 , myl2 myosin light chain 2 , ns not significant , scd sudden cardiac death , tpm1 alpha tropomyosin 1 , vf ventricular fibrillation , vpb ventricular premature beat , vt ventricular tachycardia the p values reflect the comparison of patients with erva vs. those without erva one patient carried double heterozygous gene mutations all patients with erva had myocardial fibrosis on cmr , whereas fibrosis was only observed in 58% of the patients without erva ( 100% vs. 58% , p = 0.04 ) . in patients with erva ,
the extent of fibrosis was significantly larger than in patients without erva ( 8 4% vs. 3 3% ,
the lvedwt(max ) and nt - probnp levels did not significantly differ between patients with and without erva ( 23 7 mm vs. 19 7 mm , p = 0.2 and 87 53 pmol / l vs. 62 57 pmol / l , p = 0.3 , respectively ) .
no significant differences in concomitant -blocker therapy , gender , age or mutated gene were found between patients with and without erva .
all patients with erva had one or more risk factors for scd ( 100% vs. 58% , p = 0.04 ) ( table 2 ) .
there was no significant difference in the presence of fibrosis between the carriers of the different gene mutations ( p = 0.7 ) .
table 2relation between the number of risk factors for sudden cardiac death and the presence of exercise related ventricular arrhythmiasnumber of risk factorserva ( + ) ( n = 7)erva ( ) ( n = 24)0 , n ( % ) 0 ( 0)10 ( 42)1 , n ( % ) 5
( 71)11 ( 46)2 , n ( % ) 1 ( 14)2 ( 8)3 , n ( % ) 0 ( 0)1 ( 4)4 , n ( % ) 1 ( 14)0 ( 0)erva exercise related ventricular arrhythmias relation between the number of risk factors for sudden cardiac death and the presence of exercise related ventricular arrhythmias erva exercise related ventricular arrhythmias in four patients erva originated from the same segment , as the segment with a high extent of fibrosis ( table 3 ) . in the remaining three patients
the erva were derived from segments immediately adjacent to segments with a high extent of fibrosis .
table 3relation between the origin of exercise related ventricular arrhythmias and the localisation of left ventricular fibrosispatientorigin of the vasegment with a high extent of fibrosisrelation between origin of the va and the segments of fibrosis122 , 4 , 8 , 10same segment215/162 , 8 , 10adjacent segment382 , 3 , 9 , 10adjacent segment481 , 2 , 4 , 8,same segment510/111 , 2 , 8 , 10same segment6141 , 2 , 7 , 8 , 10 , 12adjacent segment710/113 , 4 , 5 , 10 , 11 , 12,14same segmentva ventricular arrhythmiasaccording to fig .
1according to the aha 17 segment model of the left ventricle relation between the origin of exercise related ventricular arrhythmias and the localisation of left ventricular fibrosis va ventricular arrhythmias according to the aha 17 segment model of the left ventricle there was no significant difference between the extent of fibrosis of patients with only erva during exercise and patients with erva during recovery ( 10 3% vs. 7 7% , p = 0.7 ) and there was no significant difference between the extent of fibrosis of patients with one erva and patients with more than one erva ( 8 7% vs. 10 3% , p = 0.9 ) .
in four patients erva originated from the same segment , as the segment with a high extent of fibrosis ( table 3 ) . in the remaining three patients
the erva were derived from segments immediately adjacent to segments with a high extent of fibrosis .
table 3relation between the origin of exercise related ventricular arrhythmias and the localisation of left ventricular fibrosispatientorigin of the vasegment with a high extent of fibrosisrelation between origin of the va and the segments of fibrosis122 , 4 , 8 , 10same segment215/162 , 8 , 10adjacent segment382 , 3 , 9 , 10adjacent segment481 , 2 , 4 , 8,same segment510/111 , 2 , 8 , 10same segment6141 , 2 , 7 , 8 , 10 , 12adjacent segment710/113 , 4 , 5 , 10 , 11 , 12,14same segmentva ventricular arrhythmiasaccording to fig .
1according to the aha 17 segment model of the left ventricle relation between the origin of exercise related ventricular arrhythmias and the localisation of left ventricular fibrosis va ventricular arrhythmias according to the aha 17 segment model of the left ventricle there was no significant difference between the extent of fibrosis of patients with only erva during exercise and patients with erva during recovery ( 10 3% vs. 7 7% , p = 0.7 ) and there was no significant difference between the extent of fibrosis of patients with one erva and patients with more than one erva ( 8 7% vs. 10 3% , p = 0.9 ) .
widespread genetic testing identifies large numbers of carriers of mutations that cause hcm ; these carriers often have no or few symptoms .
exercise is considered an important risk factor of scd in these subjects , but the precise risk of exercise in mutation carriers is not fully defined .
the purpose of our study was to investigate the relation between fibrosis and erva in a population of hcm mutation carriers .
interestingly , we found that erva exclusively occurred in patients who demonstrated fibrosis on cmr , and that these arrhythmias originated from areas of fibrosis or regions directly adjacent to these areas .
patients with erva had significantly more fibrosis on cmr as compared with patients without erva .
in addition , all patients with erva also had one or more risk factors for scd .
erva were not related to age , gender , ejection fraction , nt - probnp levels , lvedwt(max ) or treatment with -blockers .
our study suggests that erva is a marker of arrhythmogenic cardiac fibrosis as represented by their spatial relationship as well as the higher load of late enhancement on gadolinium - enhanced cmr in arrhythmogenic areas .
earlier studies also suggested a relation between ventricular arrhythmias and myocardial fibrosis in patients with hcm [ 10 , 16 , 17 ] . in these studies
the prevalence of late enhancement was between 41% and 79% , which is similar to our study .
in contrast to these studies , we considered erva rather than spontaneous arrhythmias or arrhythmias on ambulatory monitors . besides that we used a population of proven carriers of pathogenic hcm mutations . in 2003 , moon et al .
described that hcm patients with 2 risk factors for scd including nonsustained ventricular tachycardia on holter monitoring showed a greater extent of fibrosis .
showed that vpbs on holter monitoring are related to the presence of fibrosis , but not to the extent of fibrosis .
. showed that patients with vt had a significantly higher extent of fibrosis , which is in line with our present findings .
two other dutch studies have already described the importance of cardiological evaluation for asymptomatic carriers of hcm causing mutations .
christiaans at al . described a population of 235 asymptomatic mutation carriers with a mutation in myosin binding protein c ( mybpc3 ) ; after first cardiological evaluation almost one - quarter were diagnosed with hcm and more than one - tenth of the carriers were at risk for scd .
michels et al . found an even higher number of asymptomatic mutation carriers who received the diagnosis hcm .
they also described the presence of scd risk factors in carriers with and without hcm . in the same line , ho et al .
the current risk stratification used for hcm identifies a number of high - risk patients for scd , but unfortunately still a substantial number of hcm patients die suddenly .
fibrosis as detected by cmr is increasingly recognised as a risk factor for scd in hcm , but routine screening is not yet advised [ 9 , 15 , 16 , 21 , 22 ] .
our data lend further support to the idea that myocardial fibrosis in hcm is related to erva .
however , this study can not answer whether these erva are related to more life - threatening ventricular arrhythmias . in population - based cohorts with coronary heart disease , vpbs
do predict an increased risk of death , but vpbs that were found during the recovery phase appeared to be an even better predictor of an increased risk of death compared with vpbs during exercise [ 2325 ] .
there are important limitations to this retrospective study that need to be taken into account .
most importantly , the fact that the registry was undertaken by a referral centre may have resulted in a referral bias towards more severely affected patients .
moreover , it can not be excluded that there was a selection bias towards the selection of patients with both a cmr and exercise test .
this study is limited by its size , and lack of follow - up . as a result , it can not answer the question whether erva should also be considered as a marker of high risk of scd in the hcm population , as it is in patients with coronary artery disease .
however , it may provide the necessary initial observation to fuel a larger study into the predictive role of erva and to validate our findings .
the erva that were observed originated either from a segment with a high extent of fibrosis or from a segment directly adjacent to this .
this imprecision may be explained by the fact that the analysis of the origins of the vpbs is an approximation provided by 12-channel ecg readings , but also by the fact that the exit point is at the edge of the fibrosis area and not necessarily in the area itself .
in addition , electrocardiographic and anatomical orientation by cmr are not fully congruent and may lead to imprecision of the origin of the vpb and the localisation of fibrosis .
a substantial proportion of carriers of an hcm causing mutation may show erva which in turn is associated with a significantly higher extent of ventricular fibrosis . in addition , there was a significant spatial relationship between erva and fibrosis supporting the notion that increased fibrosis is arrhythmogenic and possibly related to increased mortality .
future studies are needed to address whether increased late enhancement on cmr represents an increased risk of scd in hcm mutation carriers .
Output:
| aimshypertrophic cardiomyopathy ( hcm ) is a frequent cause of sudden cardiac death ( scd ) due to exercise - related ventricular arrhythmias ( erva ) ; however the pathological substrate is uncertain .
the aim was to determine the prevalence of erva and their relation with fibrosis as determined by cardiac magnetic resonance imaging ( cmr ) in carriers of an hcm causing mutation.methodswe studied the prevalence and origin of erva and related these with fibrosis on cmr in a population of 31 hcm mutation carriers.resultserva occurred in seven patients ( 23% ) who all showed evidence of fibrosis ( 100% erva(+ ) vs. 58% erva(- ) , p = 0.04 ) .
no ventricular tachycardia or ventricular fibrillation occurred . in patients with erva ,
the extent of fibrosis was significantly larger ( 8 4% vs. 3 4% , p = 0.02 ) .
erva originated from areas with a high extent of fibrosis or regions directly adjacent to these areas.conclusionserva in hcm mutation carriers arose from the area of fibrosis detected by cmr ; erva seems closely related to cardiac fibrosis .
fibrosis as detected by cmr should be evaluated as an additional risk factor to further delineate risk of scd in carriers of an hcm causing mutation . |
PubmedSumm6843 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: genomics has the potential to provide an in depth understanding of the genetics , biochemistry , physiology , and pathogenesis of a microorganism .
furthermore comparative genomics , functional genomics , and related technologies , are helping to unravel the molecular basis of the pathogenesis , evolution , and phenotypic differences among different species , strains , or clones and to uncover potential virulence genes .
knowledge of the genomes provides the basis for the application of new powerful approaches for the understanding of the biology of the organisms studied .
although legionella are mainly environmental bacteria , several species are pathogenic to humans , in particular legionella pneumophila ( fraser et al . , 1977 ; mcdade et al . , 1977 ) and legionella longbeachae ( mckinney et al . , 1981 ) .
legionnaires disease has emerged in the second half of the twentieth century partly due to human alterations of the environment .
the development of artificial water systems in the last decades like air conditioning systems , cooling towers , showers , and other aerosolizing devices has allowed legionella to gain access to the human respiratory system . when inhaled in contaminated aerosols
, pathogenic legionella can reach the alveoli of the lung where they are subsequently engulfed by macrophages .
in contrast to most bacteria , which are destroyed , some legionella species can multiply within the phagosome and eventually kill the macrophage , resulting in a severe , often fatal pneumonia called legionellosis or legionnaires disease ( mortality rate of 520% ; up to 50% in nosocomial infections ; steinert et al .
, 2002 ; marrie , 2008 ; whiley and bentham , 2011 ) . to replicate
intracellularly l. pneumophila manipulates host cellular processes using bacterial proteins that are delivered into the cytosolic compartment of the host cell by a specialized type iv secretion system called dot / icm .
the proteins delivered by the dot / icm system target host factors implicated in controlling membrane transport in eukaryotic cells , which enables l. pneumophila to create an endoplasmic reticulum - like vacuole that supports intracellular replication in both protozoan and mammalian host cells ( for a review see hubber and roy , 2010 ) .
an interesting epidemiological observation is , that among the over 50 legionella species described today , strains belonging to the species l. pneumophila are responsible for over 90% of the legionellosis cases worldwide and strains belonging to the species l. longbeachae are responsible for about 5% of human legionellosis cases worldwide ( yu et al . , 2002 ) .
surprisingly , this distribution is very different in australia and new zealand where l. pneumophila accounts for only 45.7% of the cases but
furthermore , among the strains causing legionnaires disease , l. pneumophila serogroup 1 ( sg1 ) alone is responsible for over 85% of cases ( yu et al . , 2002 ; doleans et al . , 2004 ) despite the description of 15 different sg within this species .
in addition , the characterization of over 400 different l. pneumophila sg1 strains has shown that only a minority among these is responsible for causing most of the human disease ( edelstein and metlay , 2009 ) .
some of these clones are distributed worldwide like l. pneumophila strain paris ( cazalet et al . , 2008 )
others have a more restricted geographical distribution , like the recently described endemic clone , prevalent in ontario , canada ( tijet et al . , 2010 ) . for the species l. longbeachae two serogroups are described to date ( bibb et al . , 1981 ; mckinney et al . , 1981 ) .
l. longbeachae sg1 is predominant in human disease as it causes up to 95% of the cases of legionellosis worldwide and most outbreaks and sporadic cases in australia ( anonymous , 1997 ; montanaro - punzengruber et al . , 1999 ) .
the two main human pathogenic legionella species , l. pneumophila and l. longbeachae cause the same disease and symptoms in humans ( amodeo et al . ,
2009 ) , however , there exist major differences between both species in niche adaptation and host susceptibility .
they are found in different environmental niches , as l. pneumophila is mainly found in natural and artificial water circuits and l. longbeachae is principally found in soil and therefore associated with gardening and use of potting compost ( oconnor et al . , 2007 ) .
however , although less common , the isolation of l. pneumophila from potting soil in europe has also been reported ( casati et al . , 2009 ; velonakis et al . ,
human infection due to l. longbeachae is particularly common in australia but cases have been documented also in other countries like the usa , japan , spain , england , or germany ( mmwr , 2000 ; garcia et al . , 2004 ; kubota et al .
as described for other legionella species , person to person transmission of l. longbeachae has not been documented , however , the primary transmission mode seems to be inhalation of dust from contaminated compost or soil that contains the organism ( steele et al .
furthermore , for l. pneumophila a biphasic life cycle was observed in vitro and in vivo as exponential phase bacteria do not express virulence factors and are unable to replicate intracellularly .
the ability of l. pneumophila to replicate intracellularly is triggered at the post - exponential phase by a complex regulatory cascade ( molofsky and swanson , 2004 ; sahr et al . , 2009 ) .
in contrast , less is known on the l. longbeachae intracellular life cycle and its virulence factors .
it was recently shown that unlike l. pneumophila the ability of l. longbeachae to replicate intracellularly is independent of the bacterial growth phase ( asare and abu kwaik , 2007 ) and that phagosome biogenesis is different .
like l. pneumophila , the l. longbeachae phagosome is surrounded by endoplasmic reticulum and does not mature to a phagolysosome ; however it acquires early and late endosomal markers ( asare and abu kwaik , 2007 ) .
another interesting difference between these two species is their ability to colonize the lungs of mice . while only a / j mice are permissive for replication of l. pneumophila , a / j , c57bl/6 , and balb / c mice are all permissive for replication of l. longbeachae ( asare et al .
resistance of c57bl/6 and balb / c mice to l. pneumophila has been attributed to polymorphisms in nod - like receptor apoptosis inhibitory protein 5 ( naip5 ) allele that recognizes the c - terminus of flagellin ( wright et al . , 2003 ; molofsky et al . , 2006 ; ren et al . , 2006 ; lightfield et al . ,
the current model is that l. pneumophila replication is restricted due to flagellin dependent caspase-1 activation through naip5-ipaf and early macrophage cell death by pyroptosis .
however , although depletion or inhibition of caspase-1 activity leads to decreased targeting of bacteria to lysosomes , the mechanism of caspase-1-dependent restriction of l. pneumophila replication in macrophages and in vivo is not fully understood ( schuelein et al .
, 2011 ) . in the last years , six genomes of different l. pneumophila strains ( paris , lens , philadelphia , corby , alcoy , and 130b ( cazalet et al . , 2004 ; chien et al . , 2004 ; steinert et al .
furthermore , the sequencing and analysis of four genomes of l. longbeachae have been carried out recently ( cazalet et al . , 2010 ) .
l. longbeachae strain nsw150 of sg1 isolated in australia from a patient was sequenced completely , and for the remaining three strains ( atcc33462 , sg1 isolated from a human lung , c-4e7 and 98072 , both of sg2 isolated from patients ) a draft genome sequence was reported . a fifth l. longbeachae strain ( d-4968 of sg1 , isolated in the us from a patient )
was recently sequenced and the analysis of the genome sequences assembled into 89 contigs was reported ( kozak et al . , 2010 ) . here
we will describe what we learned from the analysis and comparison of the sequenced legionella strains .
we will discuss their general characteristics and then highlight the specific features or common traits with respect to the different ecological niches and the differences in host susceptibility of these two legionella species .
emphasis will be put on putative virulence and legionella life cycle related functions . in the last part
legionella pneumophila and l. longbeachae each have a single , circular chromosome with a size of 3.33.5 mega bases ( mb ) for l. pneumophila and 3.94.1 mb for l. longbeachae .
for both the average g + c content is 38% ( tables 1 ) . the l. pneumophila strains paris and lens each contain different plasmids , 131.9 kb and 59.8 kb in size , respectively .
the l. longbeachae strains nsw10 and d-4986 carry highly similar plasmids of about 70 kb and dna identity of 99% , strains c-4e7 and 98072 also contain each a highly similar plasmid of 133.8 kb in size .
thus similar plasmids circulate among l. longbeachae strains , but they seem to be different from those found in l. pneumophila .
updated annotation ; cds , coding sequence ; data from plasmids in parenthesis ; the 130b sequence is not a manually corrected and finished assembly , thus the high number of specific genes might be due to not corrected sequencing errors ; nd , not determined ; * n50 contig size , calculated by ordering all contig sizes and adding the lengths ( starting from the longest contig ) until the summed length exceeds 50% of the total length of all contigs ( half of all bases reside in a contiguous sequence of the given size or more ) ; snp , single nucleotide polymorphism ; * * for snp detection ; not determined .
a total of 3000 and 3500 protein - encoding genes are predicted in the l. pneumophila and l. longbeachae genomes , respectively .
no function could be predicted for about 40% of these genes and about 20% are unique to the genus legionella .
comparative analysis of the genome structure of the l. pneumophila genomes showed high colinearity , with only few translocations , duplications , deletions , or inversions ( figures 1a , b ) and identified between 6 and 11% of genes as specific to each l. pneumophila strain .
principally , the genomes contain three large plasticity zones , where the synteny is disrupted : a 260-kb inversion in strain lens with respect to strains paris and philadelphia-1 , a 130-kb fragment which is inserted in a different genomic location in strains paris and philadelphia-1 and the about 50 kb chromosomal region carrying the lvh type iv secretion system , previously described in strain philadelphia-1 ( segal et al . , 1999 ) .
furthermore , deletions and insertions of several smaller regions were identified in each strain , as well as regions with variable gene content .
in contrast , comparison of the completed chromosome sequences of l. pneumophila and l. longbeachae shows that the two legionella species have a significantly different genome organization ( figure 1c ) .
moreover only about 65% of the l. longbeachae genes are orthologous to l. pneumophila genes , whereas about 34% of all genes are specific to l. longbeachae with respect to l. pneumophila paris , lens , philadelphia , and corby ( defined by less than 30% amino acid identity over 80% of the length of the smallest protein ) .
synteny plot of the chromosomes of l. pneumophila strains paris , lens , corby , and l. longbeachae nsw150 .
( a ) synteny plot of the chromosomes of strains l. pneumophila paris and corby ( b ) and strains l. pneumophila paris and lens and ( c ) strains l. pneumophila paris and l. longbeachae nsw150 .
genome - wide synteny is disrupted by a 260 kb inversion ( blue ) and a 130 kb plasticity zone between strain l. pneumophila paris and lens .
analysis of single nucleotide polymorphisms ( snp ) revealed a very low snp number of less than 0.4% among the four l. longbeachae genomes , which is significantly lower than the polymorphism of about 2% between l. pneumophila sg1 strains paris and philadelphia ( table 1 ) .
comparison of the two l. longbeachae sg1 genomes ( nsw150 , atcc33462 ) identified 1611 snps of which 1426 are located in only seven chromosomal regions mainly encoding putative mobile elements , whereas the remaining 185 snps were evenly distributed around the chromosome
. a similar number of about 1900 snps were identified when comparing strains nsw150 to strain d-4968 ( table 1 ) .
in contrast , the snp number between two strains of different sg was higher , with about 16000 snps present between sg1 and sg2 strains ( table 1 ) .
this low snp number and relatively homogeneous distribution of the snps around the chromosome suggest recent expansion for the species l. longbeachae ( cazalet et al . , 2010 ) .
the sequences and their analysis are accessible at http://genolist.pasteur.fr / legiolist/. to investigate the phylogenetic relationship among the l. pneumophila and l. longbeachae strains we here used the nucleotide sequence of recn ( recombination and repair protein - encoding gene ) aligned based on the protein alignment .
based on an analysis of 32 protein - encoding genes widely distributed among bacterial genomes , recn was described as the gene with the greatest potential for predicting genome relatedness at the genus or subgenus level ( zeigler , 2003 ) .
as depicted in figure 2 , the phylogenetic relationship among the four l. pneumophila strains is very high , and l. longbeachae is clearly more distant .
phylogenetic tree showing the relationship of the sequenced l. pneumophila and l. longbeachae strains based on the recn sequence .
the tree was constructed using the recn sequences of each genome and the neighbor joining method in mega .
l. longbeachae is indicated without strain designation , as the recn sequence of all sequenced strains is identical and thus only one representative strain is indicated on the tree .
the capacity of pathogens like legionella to infect eukaryotic cells is intimately linked to the ability to manipulate host cell functions to establish an intracellular niche for their replication .
essential for the ability of legionella to subvert host functions are its different secretion systems .
the two major ones , known to be involved in virulence of l. pneumophila are the dot / icm type iv secretion system ( t4bss ) and the lsp type ii secretion system ( t2ss ; marra et al . , 1992 ; berger and isberg , 1993 ; rossier and cianciotto , 2001 ) . for l.
pneumophila type ii protein secretion is critical for infection of amebae , macrophages and mice .
analyses of the l. longbeachae genome sequences showed , that it contains all genes to encode a functional lsp type ii secretion machinery ( cazalet et al .
, 2010 ; kozak et al . , 2010 ) . several studies , including the analysis of the l. pneumophila type ii secretome indicated that l. pneumophila encodes at least 25 type ii secreted substrates ( debroy et al . , 2006
although this experimentally defined repertoire of type ii secretion - dependent proteins is the largest known in bacteria , it may contain even more than 60 proteins as 35 additional proteins with a signal sequence were identified by in silico analyses ( cianciotto , 2009 ) .
a search for homologs of these substrates in the l. longbeachae genome sequences revealed that 9 ( 36% ) of the 25 type ii secretion system substrates described for l. pneumophila are absent from l. longbeachae ( table 2 ) .
for example the phospholipase c encoded by plca and the chia - encoded chitinase , which was shown to promote l. pneumophila persistence in the lungs of a / j mice are not present in l. longbeachae ( debroy et al . , 2006 ) .
thus over a third of the t2ss substrates seem to differ between l. pneumophila and l. longbeachae , a feature probably related to the different ecological niches occupied , but also to different virulence properties in the hosts .
substrates in this list are according to cianciotto ( 2009 ) ; * strain 130b is not a finished sequence and not manually curated .
thus absence of a substrate can also be due to gaps in the sequence ; means not present ; nsw means l. longbeachae nsw150 .
indispensible for replication of l. pneumophila in the eukaryotic host cells is the dot / icm t4ss ( nagai and kubori , 2011 ) , which translocate a large repertoire of bacterial effectors into the host cell .
these effectors modulate multiple host cell processes and in particular , redirect trafficking of the l. pneumophila phagosome and mediate its conversion into an er - derived organelle competent for intracellular bacterial replication ( shin and roy , 2008 ; cianciotto , 2009 ) .
the dot / icm system is conserved in l. longbeachae with a similar gene organization and protein identities of 4792% with respect to l. pneumophila ( figure 3 ) .
this is similar to what has been reported previously for other legionella species ( morozova et al . , 2004 ) .
the only major differences identified are that in l. longbeachae the icmr gene is replaced by the ligb gene , however , the encoded proteins have been shown to perform similar functions ( feldman and segal , 2004 ; feldman et al . , 2005 ) and that the dotg / icme protein of l. longbeachae ( 1525 aa ) is 477 amino acids larger than that of l. pneumophila ( 1048 aa ; cazalet et al . , 2010 ) .
dotg of l. pneumophila is part of the core transmembrane complex of the secretion system and is composed of three domains : a transmembrane n - terminal domain , a central region composed of 42 repeats of 10 amino acid and a c - terminal region homologous to virb10 . in contrast , the central region of l. longbeachae dotg is composed of approximately 90 repeats . among the many virb10 homologs present in bacteria , the coxiella dotg and the helicobacter pylori cag7 are the only ones , which also have multiple repeats of 10 aa ( segal et al . , 2005 ) .
it will be challenging to understand the impact of this modification on the function of the type iv secretion system .
a l. longbeachae t4ss mutant obtained by deleting the dota gene is strongly attenuated for intracellular growth in acanthamoeba castellanii and human macrophages ( cazalet et al . , 2010 , and unpublished data ) , is outcompeted by the wild type strain 24 and 72 h after infection of lungs of a / j mice and is also dramatically attenuated for replication in lungs of a / j mice upon single infections ( cazalet et al . , 2010 ) .
thus , similar to what is seen for l. pneumophila , the dot / icm t4ss of l. longbeachae is also central for its pathogenesis and the capacity to replicate in eukaryotic host cells .
alignment of the chromosomal regions of l. pneumophila and l. longbeachae coding the dot / icm type 4 secretion system genes .
the comparison shows that all genes are highly conserved ( 4792% identity ) between l. pneumophila paris and l. longbeachae .
red arrows , genes conserved between l. pneumophila and l. longbeachae ( > 47% identity ) ; black arrows , l. pneumophila specific genes compared to l. longbeachae ( < 35% identity ) ; blue arrows , genes conserved between l. pneumophila and l. longbeachae but located in different places of the genome ; green arrows , l. longbeachae specific genes compared to l. pneumophila .
n - terminal and c - terminal parts of dotg are highly conserved while the central part composed of repeated sequences differs between l. pneumophila and l. longbeachae .
this t4ss is crucial for intracellular replication for legionella as it secretes an exceptionally large number of proteins into the host cell . using different methods ,
275 substrates have been shown to be translocated in the host cell in a dot / icm t4ss dependent manner ( campodonico et al . , 2005 ; de felipe et al .
, 2005 , 2008 ; shohdy et al . , 2005 ; burstein et al . , 2009 ;
table 3 shows the distribution of the 275 dot / icm substrates identified in l. pneumophila strain philadelphia and their distribution in the six l. pneumophila and five l. longbeachae genomes sequenced .
their conservation among different l. pneumophila strains is very high , as over 80% of the substrates are present in all l. pneumophila strains analyzed here .
in contrast , the search for homologs of these l. pneumophila dot / icm substrates in l. longbeachae showed that even more pronounced differences are present than in the repertoire of type ii secreted substrates .
only 98 of these 275 l. pneumophila dot / icm substrates have homologs in the l. longbeachae genomes ( table 3 )
. however , the repertoire of l. longbeachae substrates seems also to be quite large , as a search for proteins that encode eukaryotic like domains and contain the secretion signal described by nagai et al .
( 2008 ) predicted 51 putative dot / icm substrates specific for l. longbeachae nsw150 ( cazalet et al .
, 2010 ) indicating that at least over 140 proteins might be secreted by the dot / icm t4ss of l. longbeachae .
a similar number of l. longbeachae specific putative eukaryotic like proteins and effectors was predicted for strain d-4968 ( kozak et al . , 2010 ) .
examples of effector proteins conserved between the two species are ralf , vipa , vipf , sidc , side , sidj , ylfa lepa , and lepb , which contribute to trafficking or recruitment and retention of vesicles to l. pneumophila ( nagai et al .
, 2002 ; chen et al . , 2004 ; luo and isberg , 2004 ; campodonico et al . , 2005 ; shohdy et al .
it is interesting to note that homologs of sidm / drra and sidd are absent from l. longbeachae but a homolog of lepb is present . for l. pneumophila
it was shown that sidm / drra , sidd , and lepb act in cooperation to manipulate rab1 activity in the host cell .
drra / sidm possesses three domains , an n - terminal amp - transfer domain ( at ) , a nucleotide exchange factor ( gef ) domain in the central part and a phosphatidylinositol-4-phosphate binding domain ( p4 m ) in its c - terminal part .
after association of drra / sidm with the membrane of the legionella - containing vacuole ( lcv ) via p4 m ( brombacher et al . , 2009 ) , it recruits rab1 via the gef domain and catalyzes the gdp gtp exchange ( ingmundson et al .
rab1 is then adenylated by the at domain leading to inhibition of gap - catalyzed rab1-deactivation ( mller et al . , 2010 ) .
recently it was shown that sidd deampylates rab1 and enables lepb to bind rab1 to promote its gtp gdp exchange ( neunuebel et al . , 2011 ; tan and luo , 2011 ) .
one might assume that other proteins of l. longbeachae not yet identified may perform the functions of drra / sidm and sidd .
another interesting observation is , that all except four of the effector proteins of l. pneumophila that are conserved in l. longbeachae are also conserved in all sequenced l. pneumophila genomes ( table 3 ) .
distribution of 275 dot / icm substrates identified in strain l. pneumophila philadelphia in the 5 sequenced l. pneumophila and 5 sequenced l. longbeachae strains .
( 2011 ) ; at = atcc33462 ; * pseudogene , + ? or ? strains 130b , c-4e7 and 98072 are not a finished sequence and not manually curated . thus absence of a substrate can also be due to gaps in the sequence ; shaded in gray , substrates conserved in all l. pneumophila and l. longbeachae genomes .
taken together the t2ss lsp and the t4ss dot / icm are highly conserved between l. pneumophila and l. longbeachae . however , more than a third of the known l. pneumophila type ii- and over 70% of type iv - dependent substrates differ between both species .
these species specific , secreted effectors might be implicated in the different niche adaptations and host susceptibilities .
most interestingly , of the 98 l. pneumophila substrates conserved in l. longbeachae 87 are also present in all l. pneumophila strains sequenced to date . thus , these 87 dot / icm substrates might be essential for intracellular replication of legionella and represent a minimal toolkit for intracellular replication that has been acquired before the divergence of the two species .
the l. pneumophila genome sequence analysis has revealed that many of the predicted or experimentally verified dot / icm secreted substrates are proteins similar to eukaryotic proteins or contain motifs mainly or only found in eukaryotic proteins ( cazalet et al . , 2004 ; de felipe et al . , 2005 ) .
thus comparative genomics suggested that l. pneumophila encodes specific virulence factors that have evolved during its evolution with eukaryotic host cells such as fresh - water ameba ( cazalet et al . , 2004 ) .
the protein - motifs predominantly found in eukaryotes , which were identified in the l. pneumophila genomes are ankyrin repeats , sel1 ( tpr ) , set domain , sec7 , serine threonine kinase domains ( stpk ) , u - box , and f - box motifs .
examples for eukaryotic like proteins of l. pneumophila are two secreted apyrases , a sphingosine-1-phosphate lyase and sphingosine kinase , eukaryotic like glycoamylase , cytokinin oxidase , zinc metalloprotease , or an rna binding precursor ( cazalet et al . , 2004 ; de felipe et al . , 2005 ; bruggemann et al . ,
2006 ) . function prediction based on similarity searches suggested that many of these proteins are implicated in modulating host cell functions to the pathogens advantage ( cazalet et al . , 2004 ) .
, it was shown that l. pneumophila is able to interfere with the host ubiquitination pathway .
the l. pneumophila u - box containing protein lubx was shown to be a secreted effector of the dot / icm secretion system that mediates polyubiquitination of a host kinase clk1 ( kubori et al . , 2008 ) . recently
, lubx was described as the first example of an effector protein , which targets and regulates another effector within host cells , as it functions as an e3 ubiquitin ligase that hijacks the host proteasome to specifically target the bacterial effector protein sidh for degradation .
delayed delivery of lubx to the host cytoplasm leads to the shutdown of sidh within the host cells at later stages of infection .
this demonstrates a sophisticated level of co - evolution between eukaryotic cells and l. pneumophila involving an effector that functions as a key regulator to temporally coordinate the function of a cognate effector protein ( kubori et al . , 2010 ;
furthermore , ankb / lpp2028 , one of the three f - box proteins of l. pneumophila , was shown to be a t4ss effector that is implicated in virulence of l. pneumophila and in recruiting ubiquitinated proteins to the lcv ( al - khodor et al . , 2008 ; price et al .
a second example is the apyrases ( lpg1905 and lpg0971 ) encoded in the l. pneumophila genomes .
lpg1905 is a novel prokaryotic ecto - ntpdase , similar to cd39/ntpdase1 , which is characterized by the presence of five apyrase - conserved regions and enhances the replication of l. pneumophila in eukaryotic cells ( sansom et al . , 2007 ) .
apart from atp and adp , lpg1905 also cleaves gtp and gdp with similar efficiency to atp and adp , respectively ( sansom et al . , 2008 ) .
a third example is a l. pneumophila homolog of the highly conserved eukaryotic enzyme sphingosine-1-phosphate lyase ( spl ) . in eukaryotes
, spl is an enzyme that catalyzes the irreversible cleavage of sphingosine-1-phosphate ( s1p ) .
s1p is implicated in various physiological processes like cell survival , apoptosis , proliferation , migration , differentiation , platelet aggregation , angiogenesis , lymphocyte trafficking and development .
despite the fact that the function of the l. pneumophila spl remains actually unknown , the hypothesis is that it plays a role in autophagy and/or apoptosis ( cazalet et al .
recently it has been shown that the l. pneumophila spl is a secreted effector of the dot / icm t4ss , that it is able to complement the sphingosine - sensitive phenotype of saccharomyces cerevisiae .
moreover , l. pneumophila spl co - localizes to the host cell mitochondria ( degtyar et al . , 2009 ) .
taken together , the many different functional studies undertaken based on the results of the genome sequence analyses deciphering the roles of the eukaryotic like proteins have clearly established that they are secreted virulence factors that are involved in host cell adhesion , formation of the lcv , modulation of host cell functions , induction of apoptosis and egress of legionella ( nora et al . , 2009 ; hubber and roy , 2010 ) .
most of these effector proteins are expressed at different stages of the intracellular life cycle of l. pneumophila ( bruggemann et al . , 2006 ) and are delivered to the host cell by the dot / icm t4ss .
as expected , eukaryotic like proteins and proteins encoding domains mainly found in eukaryotic proteins are also present in the l. longbeachae genomes .
however , between the two species a considerable diversity in the repertoire of these proteins exists . for example spl , lubx , the three l. pneumophila f - box proteins , and the homolog of one ( lpg1905 ) of the two apyrases are missing in all sequenced l. longbeachae genomes .
in contrast a glycoamylase ( herrmann et al . , 2011 ) and an uridine kinase homolog are present also in l. longbeachae ( cazalet et al . , 2010 ;
however , other proteins encoded by the l. longbeachae genome contain u - box and f - box domains and might therefore fulfill similar functions .
thus , although the specific proteins may not be conserved , the eukaryotic like protein protein interaction domains found in l. pneumophila are also present in l. longbeachae .
the differences in trafficking between l. longbeachae and l. pneumophila mentioned above might be related to specific effectors encoded by l. longbeachae .
a search for such specific putative effectors of l. longbeachae identified several proteins that might contribute to these differences like a family of ras - related small gtpases ( cazalet et al .
these proteins may be involved in vesicular trafficking and thus may account at least partly for the specificities of the l. longbeachae life cycle .
l. pneumophila is also known to exploit monophosphorylated host phosphoinositides ( pi ) to anchor the effector proteins sidc , sidm / drra , lpne , and lida to the membrane of the replication vacuole ( machner and isberg , 2006 ; murata et al .
, 2006 ; weber et al . , 2006 , 2009 ; newton et al . , 2007 ;
l. longbeachae may employ an additional strategy to interfere with the host pi as a homolog of the mammalian pi metabolizing enzyme phosphatidylinositol-4-phosphate 5-kinase was identified in its genome .
one could speculate that this protein allows direct modulation of the host cell pi levels .
interestingly , although 23 of the 29 ankyrin proteins identified in the l. pneumophila strains are absent from the l. longbeachae genome , l. longbeachae encodes a total of 23 specific ankyrin repeat proteins ( table 3 ) .
for example , l. pneumophila ankx / ankn that was shown to interfere with microtubule - dependent vesicular transport is missing in l. longbeachae ( pan et al . , 2008 ) .
ttl catalyzes the atp - dependent post - translational addition of a tyrosine to the carboxy terminal end of detyrosinated alpha - tubulin .
although the exact physiological function of alpha - tubulin has so far not been established , it has been linked to altered microtubule structure and function ( eiserich et al . , 1999 ) .
legionella longbeachae is the first bacterial genome encoding a protein containing an src homology 2 ( sh2 ) domain .
. furthermore , l. longbeachae encodes two proteins with pentatricopeptide repeat ( ppr ) domains .
this family seems to be greatly expanded in plants , where they appear to play essential roles in organellar rna metabolism ( lurin et al .
, 2004 ; nakamura et al . , 2004 ; schmitz - linneweber and small , 2008 ) .
only 12 bacterial ppr domain proteins have been identified to date , all encoded by two species , the plant pathogens ralstonia solanacearum and the facultative photosynthetic bacterium rhodobacter sphaeroides .
thus , genome analysis revealed a particular feature of the legionella genomes , the presence of many eukaryotic like proteins and protein domains , some of which are common to the two legionella species , others which are specific and may thus account for the species specific features in intracellular trafficking and niche adaptation in the environment .
despite the presence of many different species of legionella in aquatic reservoirs , the vast majority of human disease is caused by a single serogroup ( sg ) of a single species , namely l. pneumophila sg1 , which is responsible for about 84% of all cases worldwide ( yu et al . , 2002 ) .
lipopolysaccharide ( lps ) is the basis for the classification of serogroups but it is also a major immunodominant antigen of l. pneumophila and l. longbeachae .
interestingly , it has also been shown that membrane vesicles shed by virulent l. pneumophila containing lps are sufficient to inhibit phagosome
results obtained from large - scale genome comparisons of l. pneumophila suggested that lps of sg1 itself might be implicated in the predominance of sg1 strains in human disease compared to other serogroups of l. pneumophila and other legionella species ( cazalet et al . , 2008 ) .
a comparative search for lps coding regions in the genome of l. longbeachae nsw 150 identified two gene clusters encoding proteins that could be involved in production of lipopolysaccharide ( lps ) and/or capsule . neither shared homology with the l. pneumophila lps biosynthesis gene cluster suggesting considerable differences in this major immunodominant antigen between the two legionella species .
however , homologs of l. pneumophila lipida biosynthesis genes ( lpxa , lpxb , lpxd , and waam ) are present .
electron microscopy also demonstrated that , in contrast to l. pneumophila , l. longbeachae produces a capsule - like structure , suggesting that one of the aforementioned gene cluster encodes lps and the other the capsule ( cazalet et al . , 2010 ) . as mentioned in the introduction ,
only a / j mice are permissive for replication of l. pneumophila , in contrast a / j , c57bl/6 , and balb / c mice are all permissive for replication of l. longbeachae . in c57bl/6 mice cytosolic
flagellin of l. pneumophila triggers naip5-dependent caspase-1 activation and subsequent proinflammatory cell death by pyroptosis rendering them resistant to infection ( diez et al .
, 2003 ; wright et al . , 2003 ; molofsky et al . , 2006 ; ren et al . , 2006 ; zamboni et al . , 2006 ; lamkanfi et al . , 2007 ;
l. longbeachae does not carry any flagellar biosynthesis genes except the sigma factor flia , the regulator flen , the two - component system fler / fles and the flagellar basal body rod modification protein flgd ( cazalet et al .
analysis of the genome sequences of strains l. longbeachae d-4968 , atcc33642 , 98072 , and c-4e7 as well as a pcr - based screening of 50 l. longbeachae isolates belonging to both serogroups by kozak et al .
( 2010 ) did not detect flagellar genes in any isolate confirming that l. longbeachae , in contrast to l. pneumophila does not synthesize flagella .
interestingly , all genes bordering flagellar gene clusters are conserved between l. longbeachae and l. pneumophila , suggesting deletion of these regions from the l. longbeachae genome .
this result suggests , that l. longbeachae fails to activate caspase-1 due to the lack of flagellin , which may also partly explain the differences in mouse susceptibility to l. pneumophila and l. longbeachae infection .
quite interestingly , although l. longbeachae does not encode flagella , it encodes a putative chemotaxis system .
chemotaxis enables bacteria to find favorable conditions by migrating toward higher concentrations of attractants . in many bacteria , the chemotactic response
is mediated by a two - component signal transduction pathway , comprising a histidine kinase chea and a response regulator chey .
homologs of this regulatory system are present in the l. longbeachae genomes sequenced ( cazalet et al . , 2010 ;
furthermore , two homologs of the adaptor protein chew that associate with chea or cytoplasmic chemosensory receptors are present .
the chea phosphoryl group is subsequently transferred to chey , which then diffuses away to the flagellum where it modulates motor rotation . adaptation to continuous stimulation is mediated by a methyltransferase cher .
together , these proteins represent an evolutionarily conserved core of the chemotaxis pathway , common to many bacteria and archea ( kentner and sourjik , 2006 ; hazelbauer et al . , 2008 ) .
homologs of all these proteins are present in the l. longbeachae genomes ( cazalet et al . , 2010 ; kozak et al . , 2010 ) and a similar chemotaxis system is present in legionella drancourtii llap12 ( la scola et al . , 2004 ) but it is absent from l. pneumophila .
the flanking genomic regions are highly conserved among l. longbeachae and all l. pneumophila strains sequenced , suggesting that l. pneumophila , although it encodes flagella has lost the chemotaxis system encoding genes by deletion events .
l. longbeachae encodes a capsule - like structure , synthesizes a very different lps , does not synthesize flagella but encodes a chemotaxis system .
these differences in surface structures seem to be due to deletion events leading to the loss of flagella in l. longbeachae and the loss of chemotaxis in l. pneumophila leading in part to the adaptation to their different main niches , soil , and water .
however , legionella have co - evolved with fresh - water protozoa allowing the adaptation to eukaryotic cells .
the idea that protozoa are training grounds for intracellular pathogens was born with the finding by rowbotham ( 1980 ) that legionella has the ability to multiply intracellularly .
this lead to a new percept in microbiology : bacteria parasitize protozoa and can utilize the same process to infect humans .
indeed , the long co - evolution of legionella with protozoa is reflected in its genome by the presence of eukaryotic like genes , many of which are clearly virulence factors used by l. pneumophila to subvert host functions .
these genes may have been acquired either through horizontal gene transfer ( hgt ) from the host cells ( e.g. , aquatic protozoa ) or from bacteria or may have evolved by convergent evolution .
recently it has been reported that l. drancourtii a relative of l. pneumophila has acquired a sterol reductase gene from the acanthamoeba polyphaga mimivirus genome , a virus that grows in ameba ( moliner et al . , 2009 ) .
thus , the acquisition of some of the eukaryotic like genes of l. pneumophila by hgt from protozoa is plausible .
ralf was the first gene suggested to have been acquired by l. pneumophila from eukaryotes by hgt , as ralf carries a eukaryotic sec 7 domain ( nagai et al . , 2002 ) .
in order to study the evolutionary origin of eukaryotic l. pneumophila genes , we have undertaken a phylogenetic analysis of the eukaryote - like sphingosine-1-phosphate lyase of l. pneumophila that is encoded by lpp2128 described earlier .
the phylogenetic analyses shown in figure 4 revealed that it was most likely acquired from a eukaryotic organism early during legionella evolution ( degtyar et al . , 2009 ; nora et al . , 2009 ) as the lpp2128 protein sequence of l. pneumophila clearly falls into the eukaryotic clade of spl sequences .
phylogenetic tree of a multiple sequence comparison of sphingosine - phosphate lyase proteins present in eukaryotic and prokaryotic genomes .
the red lines indicate the l. pneumophila sequences that are embedded in the eukaryotic clade .
we then tested the hypothesis that l. longbeachae might have acquired genes also from plants , which is conceivable as it is found in soil .
we thus undertook here a phylogenetic analysis similar to that described above for the l. longbeachae protein llo2643 that contains ppr repeats , a protein family typically present in plants .
a blast search in the database revealed that homologs of llo2643 are only found in eukaryotes , in particular in plants and algae .
this rare presence in bacteria is suggestive of a horizontal transfer event from eukaryotes to these bacteria .
the fact that the bacterial proteins group together may also be due to a phenomenon of long branch attraction .
thus , the llo2643 protein of l. longbeachae appears closer to plant proteins than prokaryotic ones .
once more plant proteins , perhaps from algae , will be in the database , it might become possible to evaluate whether l. longbeachae indeed acquired genes from plants .
the red lines indicate the l. longbeachae sequences that are close to sequences derived from plant genomes .
legionella is not the only prokaryote whose genome shows an enrichment of proteins with eukaryotic domains .
amoebophilus asiaticus a gram - negative , obligate intracellular ameba symbiont belonging to the bacteroidetes , which has been discovered within an ameba isolated from lake sediment ( schmitz - esser et al . , 2008 )
( 2010 ) show that the genome of this organism also encodes an arsenal of proteins with eukaryotic domains . to further investigate the distribution of these protein domains in other bacteria
the authors have undertaken an enrichment analysis comparing the fraction of all functional protein domains among 514 bacterial proteomes ( schmitz - esser et al . , 2010 ) .
this showed that the genomes of bacteria for which the replication in ameba has been demonstrated were enriched in protein domains that are predominantly found in eukaryotic proteins .
interestingly , the domains potentially involved in host cell interaction described above , such as ank repeats , lrr , sel1 repeats , and f- and u - box domains , are among the most highly enriched domains in proteomes of ameba - associated bacteria . bacteria that can exploit amebae as hosts thus share a set of eukaryotic domains important for host cell interaction despite their different lifestyles and their large phylogenetic diversity .
this suggests that bacteria thriving within ameba use similar mechanisms for host cell interaction to facilitate survival in the host cell . due to the phylogenetic diversity of these bacteria
, it is most likely that these traits were acquired independently during evolutionary early interaction with ancient protozoa .
legionella pneumophila and l. longbeachae are two human pathogens that are able to modulate , manipulate , and subvert many eukaryotic host cell functions to their advantage , in order to enter , replicate , and evade protozoa or human alveolar macrophages during disease . in the last years
genome analyses , as well as comparative and functional genomics have demonstrated that genome plasticity plays a major role in differences in host cell exploitation and niche adaptation of legionella .
the genomes of these environmental pathogens are shaped by hgt between eukaryotes and prokaryotes , allowing them to mimic host cell functions and to exploit host cell pathways .
genome plasticity and hgt lead in each strain and species to a different repertoire of secreted effectors that may allow subtle adaptations to , e.g. , different protozoan hosts .
plasmids can be exchanged among strains and phages and deletions of surface structures like flagella or chemotaxis systems has taken place .
thus genome plasticity is major mechanism by which legionella may adapt to different niches and hosts .
access to genomic data has revealed many potential virulence factors of l. pneumophila and l. longbeachae as well as metabolic capacities of these bacteria .
the increasing information in the genomic database will allow a better identification of the origin and similarity of eukaryotic like proteins or eukaryotic protein domains and other virulence factors .
new eukaryotic genomes like that of the natural host of legionella , a. castellanii are in progress .
these additional data will allow studying possible transfer events of genes from the eukaryotic host to legionella more in depth .
taken together , the progressive increase of information on legionella as well as on protozoa will allow more complete comparative and phylogenetic studies to shed light on the evolution of virulence in legionella .
however , much work remains to be done to translate the basic findings from genomics research into improved understanding of the biology of this organism .
manipulation of host - epigenetic information and investigating host susceptibility to disease will be another .
in particular development of high throughput techniques for comparative and functional genomics as well as more and more powerful imaging techniques will accelerate the pace of knowledge acquisition .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
Output:
| although best known for its ability to cause severe pneumonia in people whose immune defenses are weakened , legionella pneumophila and legionella longbeachae are two species of a large genus of bacteria that are ubiquitous in nature , where they parasitize protozoa .
adaptation to the host environment and exploitation of host cell functions are critical for the success of these intracellular pathogens .
the establishment and publication of the complete genome sequences of l. pneumophila and l. longbeachae isolates paved the way for major breakthroughs in understanding the biology of these organisms . in this review we present the knowledge gained from the analyses and comparison of the complete genome sequences of different l. pneumophila and l. longbeachae strains .
emphasis is given on putative virulence and legionella life cycle related functions , such as the identification of an extended array of eukaryotic like proteins , many of which have been shown to modulate host cell functions to the pathogen s advantage .
surprisingly , many of the eukaryotic domain proteins identified in l. pneumophila as well as many substrates of the dot / icm type iv secretion system essential for intracellular replication are different between these two species , although they cause the same disease .
finally , evolutionary aspects regarding the eukaryotic like proteins in legionella are discussed . |
PubmedSumm6844 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the kynurenine pathway is the main route for tryptophan metabolism , and kynurenic acid ( kyna ) is one of the biologically active metabolites in this pathway .
physiologically , the normal plasma kyna concentration ranges between 25 and 60 nmol / l [ 14 ] . several pathologic conditions such as inflammation , sepsis and septic shock , stroke and cerebral ischaemia , alzheimer s disease , multiple sclerosis , epilepsy , and depression affect plasma kyna concentrations [ 14,6,7 ] .
an increase in the plasma kyna concentration has also been observed following thoracic and cardiovascular surgery .
however , the effect of carotid surgery on plasma kyna concentration has not been documented .
carotid surgery is an evidence - based treatment for the prevention of carotid - related cerebrovascular complications .
unfortunately , carotid endarterectomy ( cea ) or carotid angioplasty stenting ( cas ) may disturb cerebral circulation , leading to various cerebral injuries , including carotid surgery - related stroke .
these pathologies elevate mortality , morbidity , and hospital costs and significantly impair quality of life .
moreover , rapid improvement of cerebral circulation and increases in oxygen supply may disturb brain function and affect the kynurenine pathway .
the aim of the present study was to analyze the changes in plasma kyna concentrations in patients undergoing carotid surgery .
the study was approved by the committee for bioethics at the medical university of lublin , and written informed consent was obtained from all patients .
patients scheduled for elective carotid surgery due to stenosis were included in this study . computed tomography angiography and color duplex ultrasound examination were used to determine the severity of carotid stenosis .
patients who received routine shunting or required general anaesthesia were excluded from analysis . according to the society of vascular surgery , cea is performed in all symptomatic patients with carotid stenosis of 50% to 90% and asymptomatic patients with stenosis of 60% to 99% .
moreover , cea was performed in patients older than 70 years with long lesion ( greater than 15 mm ) , preocclusive stenosis , or lipid - rich plaques .
carotid angioplasty stenting should be reserved for symptomatic patients with stenosis of 50% to 99% at high risk for cea for anatomic or medical reasons or for patients with severe uncorrectable coronary artery diseases , chronic heart failures , or / and chronic obstructive pulmonary diseases .
a stenosis was classified as symptomatic if the patients were treated for transient ischemic attack ( tia ) , stroke , a cerebrovascular ischemic event or ocular ischemic symptoms within 1 year before surgery and if the event was confirmed by computed tomography or / and magnetic resonance imaging and neurological examination . on the day before surgery ,
all patients were pre - medicated with a single 2 mg oral dose of estazolam ( estazolam , polfa , pl ) . before the induction of anaesthesia ,
the arterial pressure was measured directly in an arterial artery , and the arterial catheter was inserted under local anesthesia just before induction of anesthesia .
the choice of anesthesia depended on the type of surgery : regional anesthesia was performed in patients scheduled for cea , and local anesthesia was performed in cas patients . for regional anesthesia ,
the deep and superficial cervical plexus were blocked using 0.5% bupivacaine hydrochloride ( bupivacaine , polfa , pl ) at the dose of 5 mg and 2% lidocaine hydrochloride ( xylocaine , polafa , pl ) at the dose of 10 mg .
the local anesthesia was performed using 0.5% bupivacaine hydrochloride at the dose of 12 mg injected subcutaneously . in all patients , dual anti - platelet treatment with acetylsalicylic acid ( aspirin , bayer de ) at the daily dose of 75 mg and clopidogrel ( pharmathen s.a . , gr ) at the daily dose of 75 mg was initiated at least 3 days before the procedure .
cea was performed through a longitudinal arteriotomy , running from the carotid bifurcation to the anterolateral surface of the internal carotid artery ( ica ) .
access to the common carotid artery was achieved with a 7-fr 80-cm - long sheath .
the carotid lesions were crossed with a 0.014 filter epd guide wire ( abbott vascular , usa ) .
the filter epd deployment was performed in a non - tortuous distal internal carotid artery ( ica ) segment .
the lesions received stents with tapered x - act abbott stent system components ( abbott vascular , usa ) .
additional dilation of the lesion with balloon angioplasty was performed if angiographic residual stenosis after stent placement was more than 30% .
plasma kyna concentrations were measured at 5 time points : 1 ) before anaesthesia and surgery ( baseline value ) , 2 ) 1 h after surgery , 3 ) 6 h after surgery ( in the evening after surgery ) , 4 ) on the morning of postoperative day 1 , and 5 ) on the morning of postoperative day 2 . the white blood cell ( wbc ) count was measured at time points 1 , 4 , and 5 . the neutrophils / lymphocyte ratio ( nlr )
was used as a marker of inflammation severity and was measured at time points 1 , 4 , and 5 . to examine kyna levels , blood samples were collected from the radial artery and immediately centrifuged ( 2500 r / min ) .
the resulting supernatant was applied to a cation - exchange resin ( dowex 50 w+ , sigma ) .
the eluted kyna was subjected to hplc ( hewlett packard 1050 hplc system : esa catecholamine hr-30 , 3 m , c18 reverse - phase column ) and quantified fluorometrically ( hewlett packard 1046a fluorescence detector : excitation 344 nm , emission 398 nm ) .
patients were assigned to one of three groups based on the type of carotid surgery : patients with unstable carotid plaque treated by cea under regional anaesthesia ( ucp - cea ) , patients with stable carotid plaque treated with cea under regional anaesthesia ( scp - cea ) and patients treated with cas under local anaesthesia ( cas ) .
categorical variables were compared using the and fisher exact tests , and the yates correction was applied .
the unpaired student s t - test was used to analyze variables with a normal distribution .
non - parametric data were statistically analyzed using the wilcoxon signed - rank test and the kruskal - wallis anova test for initial detection of differences .
the power of all statistical tests was determined by g*power software ( 1 ) .
on the day before surgery , all patients were pre - medicated with a single 2 mg oral dose of estazolam ( estazolam , polfa , pl ) . before the induction of anaesthesia ,
the arterial pressure was measured directly in an arterial artery , and the arterial catheter was inserted under local anesthesia just before induction of anesthesia .
the choice of anesthesia depended on the type of surgery : regional anesthesia was performed in patients scheduled for cea , and local anesthesia was performed in cas patients . for regional anesthesia ,
the deep and superficial cervical plexus were blocked using 0.5% bupivacaine hydrochloride ( bupivacaine , polfa , pl ) at the dose of 5 mg and 2% lidocaine hydrochloride ( xylocaine , polafa , pl ) at the dose of 10 mg .
the local anesthesia was performed using 0.5% bupivacaine hydrochloride at the dose of 12 mg injected subcutaneously .
in all patients , dual anti - platelet treatment with acetylsalicylic acid ( aspirin , bayer de ) at the daily dose of 75 mg and clopidogrel ( pharmathen s.a . , gr ) at the daily dose of 75 mg was initiated at least 3 days before the procedure .
cea was performed through a longitudinal arteriotomy , running from the carotid bifurcation to the anterolateral surface of the internal carotid artery ( ica ) .
access to the common carotid artery was achieved with a 7-fr 80-cm - long sheath .
the carotid lesions were crossed with a 0.014 filter epd guide wire ( abbott vascular , usa ) .
the filter epd deployment was performed in a non - tortuous distal internal carotid artery ( ica ) segment .
the lesions received stents with tapered x - act abbott stent system components ( abbott vascular , usa ) .
additional dilation of the lesion with balloon angioplasty was performed if angiographic residual stenosis after stent placement was more than 30% .
plasma kyna concentrations were measured at 5 time points : 1 ) before anaesthesia and surgery ( baseline value ) , 2 ) 1 h after surgery , 3 ) 6 h after surgery ( in the evening after surgery ) , 4 ) on the morning of postoperative day 1 , and 5 ) on the morning of postoperative day 2 . the white blood cell ( wbc ) count was measured at time points 1 , 4 , and 5 . the neutrophils / lymphocyte ratio ( nlr )
was used as a marker of inflammation severity and was measured at time points 1 , 4 , and 5 . to examine kyna levels ,
blood samples were collected from the radial artery and immediately centrifuged ( 2500 r / min ) .
the resulting supernatant was applied to a cation - exchange resin ( dowex 50 w+ , sigma ) .
the eluted kyna was subjected to hplc ( hewlett packard 1050 hplc system : esa catecholamine hr-30 , 3 m , c18 reverse - phase column ) and quantified fluorometrically ( hewlett packard 1046a fluorescence detector : excitation 344 nm , emission 398 nm ) .
patients were assigned to one of three groups based on the type of carotid surgery : patients with unstable carotid plaque treated by cea under regional anaesthesia ( ucp - cea ) , patients with stable carotid plaque treated with cea under regional anaesthesia ( scp - cea ) and patients treated with cas under local anaesthesia ( cas ) .
categorical variables were compared using the and fisher exact tests , and the yates correction was applied .
the unpaired student s t - test was used to analyze variables with a normal distribution .
non - parametric data were statistically analyzed using the wilcoxon signed - rank test and the kruskal - wallis anova test for initial detection of differences .
the power of all statistical tests was determined by g*power software ( 1 ) .
forty adult patients ( 10 female and 30 male ) aged 5586 years were examined in this study .
there were 26 patients ( 65% ) treated for right internal carotid artery stenosis ( ricas ) .
there were 26 patients ( 65% ) treated with cea ( 19 patients treated for ricas and 7 patients treated for left internal carotid artery stenosis ( licas ) ) and 14 patients ( 35% ) treated with cas ( 8 patients treated for ricas and 6 patients treated for licas ) .
the mean duration of surgeries was 5814 min in the cea group ( 6016 min in ucp - cea group and 5713 min in scp - cea group ) and 6017 min in the cas group .
patients were treated with carotid duplex ultrasound examination at postoperative day 30 , and none showed evidence of stent thrombosis or / and restenosis . an uncomplicated postoperative period was noted in 32 patients ( 80% ) .
postoperative neurological disorders were observed in 8 patients on the first and/or second postoperative day .
there were 2 strokes in the ucp - cea group and 2 in the cas group ( 17.6% ) .
there was 1 tia in the ucp - cea group , 2 in the scp - cea group , and 1 in the cas group .
one of the stroke patients in the ucp - cea group died on postoperative day 10 .
the median baseline value of plasma kyna concentration was significantly higher in cea patients with unstable carotid plaque with inflammation than in cea patients with stable carotid plaque before surgery ( figure 1 ) .
the median value of plasma kyna concentration did not differ significantly between the scp - cea group and the cas group ( figure 2 ) . in patients treated with cas ,
the plasma kyna concentration increased at time point 4 in patients with unstable carotid plaque undergoing cea , whereas in patients with stable carotid plaque , the kyna concentration increased at time point 5 ( figure 2 ) .
plasma kyna concentrations were significantly higher in the ucp - cea group than in the scp - cea group at time points 1 and 4 . moreover , the kyna concentrations were higher in ucp - cea group than in the cas group at all postoperative time points .
there were no differences between the scp - cea group and the cas group ( figure 2 ) . in patients with postoperative neurological disorders ,
the plasma kyna concentrations were significantly higher than in patients with an uncomplicated postoperative period from time points 2 to 5 ( table 1 ) .
the nlr was significantly higher in the ucp - cea group than in the cas group before surgery ( p<0.01 ) .
the wbc count weakly correlated with the plasma kyna concentration in the scp - cea group ( p<0.01 , r=0.51 ) .
there was a strong positive correlation between nlr and plasma kyna concentration in patients with postoperative neurological disorders ( p<0.001 , r=0.79 ) .
in this study the effect of anesthesia and surgery on plasma kyna content in patients undergoing cea and cas was studied .
the data show that the baseline value of plasma kyna concentrations determined before surgery were higher in patients with unstable carotid plaque undergoing cea than in patients with stable carotid plaque undergoing cea and patients undergoing cas .
independent of the baseline kyna level , the concentration increased during the postoperative period in all studied groups .
the plasma kyna concentration increased on the first postoperative day in patients with unstable carotid plaque undergoing cea and in patients undergoing cas .
however , for patients with stable carotid plaque undergoing cea , the kyna increase was noted on the second postoperative day .
higher plasma kyna concentrations were observed at all studied time points in patients with unstable carotid plaque undergoing cea compared to patients with stable carotid plaque undergoing cea and cas patients .
the baseline plasma kyna concentration was significantly higher in patients with unstable carotid plaque treated with cea .
an increase in the plasma kyna concentration was documented during inflammation , sepsis and septic shock , and hiv-1 infection .
elevated kyna content was also noted locally in patients with tick - borne encephalitis and other infections of the central nervous system .
interestingly , the content of kyna in synovial fluid is lower in inflammatory rheumatoid arthritis and spondyloarthropathies compared to non - inflammatory osteoarthritis .
local inflammation can not be excluded as a main reason for higher plasma kyna concentration in unstable carotid plaque detected in cea patients .
the higher nlr in the ucp - cea group observed in our study may confirm this assumption .
several authors showed significantly higher concentrations of tumor necrosis factor alpha ( tnf- ) , interferon gamma ( ifn- ) , and interleukin 17 ( il-17 ) in unstable carotid plaques with local inflammation than in uncomplicated plaques .
several cytokines , particularly interferon alpha ( ifn- ) , ifn- , il-1 , il-12 , il-18 , and tnf- , induced indoleamine 2,3-dioxygenase ( ido ) activity [ 2426 ] .
it is reasonable that elevated cytokine levels stimulate ido activity and substantially increase tryptophan catabolites , including kyna .
therefore , we can conclude that the elevated plasma kyna concentration in the ucp - cea patients may result from plaque inflammation .
it is possible that perioperative changes in plasma kyna concentration may result from anesthesia ( per se ) in addition to surgery .
thus , this is the first study documenting the changes in plasma kyna concentration in patients undergoing elective carotid surgery under local anesthesia .
it is known that both anesthetics used in this study block sodium / potassium pumps and inhibit neuronal membrane permeability to sodium .
previous experimental studies demonstrated that a decrease in the concentration of sodium significantly increased kyna production , whereas high potassium inhibited this process in brain slices , but not in liver and kidney tissues [ 2729 ] .
our results showed that kyna changes did not differ in patients undergoing local or regional anesthesia . the lack of changes in kyna content at 1 and 6 h after surgery suggests that local anesthetics did not significantly affect plasma levels of this compound . based on our results , an increased level of kyna resulting from a surgery - related inflammatory response
the effect of surgery on plasma kyna concentration has been poorly documented , but it can be assumed that a significant increase in plasma proinflammatory cytokines following the surgical procedures implemented may increase the activity of ido and enhance production of kynurenine metabolites .
this hypothesis is in accordance with our previous study , which demonstrated a significant increase in plasma kyna concentration following cardiac surgery .
, increases in wbc and nlr were observed in all studied groups during the postoperative period .
this result supports the possibility that increased kyna levels are partially related to the surgery - related inflammatory response .
manipulation of the carotid artery during revascularization may result in gaseous and/or atheroembolization , leading to silent or symptomatic cerebral embolization .
cerebral microembolization was observed in 100% of patients undergoing cas and in 99% in patients undergoing cea .
the new ischemic events were detected in up to 17% of patients undergoing cea and in 1554% of patients undergoing cas .
hyper - acute brain ischemia causes an increase in plasma kyna concentration . a persistent increase in plasma kyna concentration may result from stroke - related inflammation
however , an increase in the plasma kyna concentration corresponds with neither stroke volume and final outcome nor stroke - related neuroinflammation .
circulating neutrophils adhere to vessel walls and migrate into injured tissues within 6 to 24 h after ischemia onset , and the number of cells corresponds to the severity of stroke and poor neurologic outcome .
based on these observations , nlr has been proposed as a sensitive marker of inflammation following cerebral ischemia .
. showed that an increase in nlr was associated with an increase in plasma kyna concentration . in their stroke study ,
they observed an elevated kyna concentration at day 7 , whereas nlr decreased after 72 h of treatment .
our findings demonstrating that changes in plasma kyna concentrations are related to neurologic outcome are consistent with the study by brouns et al . .
moreover , we found a strong correlation between nlr and plasma kyna concentration in patients with different postoperative neurological disorders
. therefore , we propose plasma kyna concentration as a marker of inflammation in carotid surgery patients with postoperative neurologic disorders .
accumulated data suggest that increased kyna concentration in the brain plays a crucial role in development of different psychiatric or neurologic diseases such as schizophrenia , bipolar disorders , or hiv encephalopathy [ 4346 ] .
increased kyna concentrations are an unfavorable factor activating glial cells in patients with multiple sclerosis .
the analysis of postoperative neurological disorders has highlighted impairment in neuropsychological outcome in patients after carotid surgery .
kyna is a broad - spectrum antagonist of the ionotropic glutamate receptor and 7 nicotinic receptor and provides neuroprotective activity .
inhibition of n - methyl - d - aspartate ( nmda ) receptors decreases the over - excitation of glutamatergic transmission , which can affect many physiological and pathological processes [ 3,4951 ] .
an increase in plasma kyna concentration is associated with oxidative stress and corresponds to stroke volume . moreover
, prolonged increases in the kyna concentration can predict a fatal outcome after brain ischemia .
a significant postoperative increase in plasma kyna concentration may result from perioperative symptomatic brain ischemia , and the highest plasma kyna concentration was observed in a stroke patient who died on postoperative day 10 ( data not shown ) . despite the promise of the novel findings of our study , a few limitations should be discussed .
second , we did not analyze the changes in plasma kyna concentration according to preoperative metabolic diseases .
several authors presented a significant impact of metabolic disorders on kyna production [ 5254 ] .
changes in perioperative plasma kyna concentration might have resulted from degree of carotid stenosis and general atherosclerosis .
higher carotid stenosis causes greater disorders in cerebral circulation and severe general atherosclerosis increases risk of postoperative cerebral ischemia .
hence , a multitude of factors that may affect plasma kyna concentration in the perioperative period indicate than our research on this topic should be continued .
in conclusion , we demonstrated for the first time that in patients with an unstable carotid plaque , the plasma kyna concentration was higher than in patients with stable carotid plaque .
moreover , this observation suggests that determination of kyna levels may be considered as a marker of inflammation in atherosclerosis .
we found that in all studied groups an increase in plasma kyna content was observed after surgery and this effect did not depend on anesthesia .
thus , our results suggest that monitoring changes in plasma kyna concentration can indicate neurologic outcome in patients undergoing cs .
Output:
| backgroundan increase in plasma kynurenic acid ( kyna ) concentration has been observed following surgery , inflammation , and cerebral pathologies .
the aim of the present study was to analyze the changes in plasma kyna concentration in patients undergoing carotid surgery ( cs).material / methodsadult patients undergoing elective carotid endarterectomy ( cea ) or carotid angioplasty with stent placement ( cas ) were studied .
plasma kyna concentrations were analyzed before surgery and at 4 time points after cs .
the amount of inflammation was measured as neutrophil - lymphocyte ratio ( nlr).resultsforty patients ( 10 female and 30 male ) aged 5586 years of age were evaluated in this study . in patients with unstable carotid plaque ,
the plasma kyna concentration was higher than in patients with stable carotid plaque .
moreover , the nlr was significantly higher in patients with unstable carotid plaque undergoing cea than in patients undergoing cas .
plasma kyna concentration increased after surgery in patients undergoing cea and cas .
there was a strong correlation between plasma kyna concentration and nlr in patients with postoperative neurological disorders.conclusionscs increases plasma kyna concentration , and changes in plasma kyna concentration can indicate neurologic outcomes in patients undergoing cs . |
PubmedSumm6845 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the presentation of vasculitis is highly variable , with more severe cases resulting in hemorrhage , ischemia , or other complications depending on the degree of inflammation and to what extent the vascular architecture is compromised . for cutaneous vasculitis , up to 20% of cases are drug - induced with histology demonstrating leukocytoclastic vasculitis ( lcv ) .
the classic presentation of cutaneous vasculitis is palpable purpura , but ranges from erythematous lesions to deep ulcers or digital gangrene .
the identification of drug - induced lcv is critical since withdrawal of the offending agent can be life - saving .
we describe a case of levofloxacin - associated lcv and review the pertinent literature involving the association of fluoroquinolones with cutaneous vasculitis .
a 64-year old man presented for evaluation of a painful , erythematous , and violaceous rash on his left leg that had developed over the previous 24 h. the day before presentation , the patient had completed a 5-day - course of levofloxacin 500 mg twice daily for a presumed respiratory infection .
the patient had a history of severe varicose veins in his lower extremities which had led to chronic lower extremity edema after undergoing elective vein removal procedures .
other past medical history included benign prostatic hypertrophy , erectile dysfunction , and a distant history of left great toe osteomyelitis .
medications included felodipine 5 mg daily , hydrochlorothiazide 25 mg daily , terazosin 1 mg daily , vardenafil 5 mg as needed , and the recently prescribed levofloxacin .
patient 's vital signs on presentation were body temperature 96.8f , pulse 63/min , respiratory rate 18/min , blood pressure 155/95 mmhg , and pulse oximetry 98% on room air .
numerous purpuric papules coalescing into large plaques were present on the medial and anterior distal left leg with dark purple coloration centrally and non - blanching erythema around the periphery of the lesions .
there was an approximately 2 cm in diameter coalesced plaque of palpable purpura on the proximal left lateral leg with a few small bullae centrally as well as scattered purpuric papules on the left thigh . on the dorsum of the left foot there were numerous petechiae that were becoming confluent .
laboratory analysis revealed white blood cell count ( wbc ) 8.1610/l ( normal range 3.49.810/l ) with 71% neutrophils ( normal range 4173% ) , 20% lymphocytes ( 1846% ) , and 1% eosinophils ( 03.2% ) .
hemoglobin and hematocrit were 14.1 g / dl ( 1418 g / dl ) and 42.2% ( 4152% ) , respectively , while platelet count was 296x10/l ( 14236210/l ) .
since cutaneous vasculitis was suspected , based on clinical appearance of palpable purpura , diagnostic testing was carried out to determine the etiology .
complement levels were normal and other tests for potential causes of vasculitis were also negative , including ana , rheumatoid factor , anti - streptolysin - o , c - anca , p - anca , and testing for hepatitis b and c. serum protein electrophoresis demonstrated a normal electrophoresis pattern .
a punch biopsy was performed ( figure 1 ) and was consistent with leukocytoclastic vasculitis . upon review of the patient 's recent medications ,
after the patient confirmed that he was no longer taking levofloxacin , he was prescribed a 7-day course of prednisone 60 mg daily followed by a 14-day taper .
a 2-week course of clindamycin was also given for possible cellulitis due to bacterial super - infection of the area involving lcv .
fluoroquinolones were avoided due to suspicion of levofloxacininduced vasculitis and a concern for a potential cross - reaction among other agents in the same drug class . at follow up one month after his initial presentation , the patient had significant improvement in his lower extremity lesions .
in the area of his left lower extremity with the greatest skin involvement , a large but shallow ulceration remained and was treated with local wound care .
figure 1skin biopsy of left lower extremity with hematoxylin and eosin staining under a ) low and b ) high power demonstrating a predominant neutrophilic infiltration , presence of eosinophils , and the formation of subepidermal bullae consistent with leukocytoclastic vasculitis .
skin biopsy of left lower extremity with hematoxylin and eosin staining under a ) low and b ) high power demonstrating a predominant neutrophilic infiltration , presence of eosinophils , and the formation of subepidermal bullae consistent with leukocytoclastic vasculitis .
after evaluation of the patient 's clinical history and physical examination findings , a drug - induced cutaneous vasculitis was suspected and later confirmed by biopsy . the interval between the first exposure to the drug and the initial onset of symptoms can range between hours and years , with onset occurring following an increased dose or re - challenge . in cases of drug - induced hypersensitivity vasculitis ,
re - challenge is not recommended due to the potential of recurrence with increased severity .
evaluation of a patient with suspected cutaneous vasculitis should include history , physical examination , and laboratory and histological evaluations .
the first step in classifying the lesion is based on caliber of the vessels involved ( small , medium , or large ) by performing a skin biopsy .
since neutrophils are replaced by lymphocytes and macrophages within 48 h after the appearance of a lesion , early biopsy is of highest diagnostic yield .
direct immunoflourescence confirms and further classifies the presence of vasculitis by identifying specific immunoglobulins . in drug - induced vasculitis , the offending drug can be hard to identify , and further laboratory tests can be helpful .
an anca testing is positive in some cases of drug induced vasculitis , including propylthiouracil , hydralazine , allopurinol , minocycline , penicillamine , and phenytoin which may induce systemic vasculitis syndromes with a life - threatening visceral involvement .
our patient was not prescribed any of the above agents and anca testing was negative . according to the naranjo adverse drug reaction probability scale with a score of 6 , levofloxacin was a probable cause of lcv in our case as the adverse event occurred after the suspected drug was administered , improved after discontinuation with addition of steroids , was proven by biopsy to be lcv , and no other alternative causes for the reaction were identified .
levofloxacin is a commonly prescribed antibiotic and is indicated for a number of infections , including community acquired and nosocomial pneumonia , uncomplicated or complicated urinary tract infections and pyelonephritis , acute bacterial sinusitis , acute or chronic bronchitis , as well as skin and skin structure infections .
adverse events commonly associated with fluoroquinolones as a class include : gastrointestinal and cns toxicity , ekg abnormalities including qt prolongation , dysglycemia , phototoxicity , tendon and joint disorders , hyper - sensitivity reactions , and hepatotoxicity .
while some structural components are clearly associated with adverse reactions , such as phototoxicity with the addition of chlorine or fluorine at the 8-position , and cns effects which are seen more commonly with the unsubstituted 7-piperazine derivatives , others do not appear to have any obvious structural associations including qt prolongation and tendon rupture .
in previous studies , ciprofloxacin , ofloxacin , levofloxacin , moxifloxacin and gatifloxacin have been associated with torsades de pointes .
however , the development of torsades de pointes is likely influenced by multiple risk factors in a patient already at risk .
all reported cases of fluoroquinolone - associated lcv in the literature involve ciprofloxacin , ofloxacin , and levofloxacin ( table 1 ) .
ciprofloxacin is distinguished by a cyclopropyl group at position 1 of the molecule and has other structural differences compared to ofloxacin and levofloxacin . while ciprofloxacin has an unsubstituted piperazine ring and levofloxacin and ofloxacin have a 4-methyl piperazine at position 7 , there is great variability at position 7 in other fluoroquinolones . despite some similarities in structure , the association of lcv with ciprofloxacin , ofloxacin and levofloxacin may also be attributed to their predominant use in clinical practice .
table 1prior case reports of fluoroquinolone - associated vasculitis.fluoroquinolone ( fq)dosetime to symptom onsetother medicationsclinical diagnosis or biopsy provenfinal diagnosistreatmentyear publishedciprofloxacin500 mg po bid3 daysnoneskin biopsyperivascular mononuclear - cell infiltratewithdrawal of fq1989ciprofloxacin500 po mg / day4 dayscephradineskin biopsylcvwithdrawal of fq1992ciprofloxacinunknown10 daysdiureticclinical diagnosishaemorrhagic vasculitisnone1992ciprofloxacin500 mg po bid4 daysfluoxetineclinical diagnosiscutaneous vasculitiswithdrawal of fq ; fluoxetine continued1997ciprofloxacinunknown10 daysnoneclinical diagnosis ; subsequent renal biopsycutaneous vasculitiswithdrawal of fq ; prednisone2007ciprofloxacinunknown7 daysrifampinclinical diagnosisdrug - induced vasculitiswithdrawal of fq ; rifampin given without recurrence2009ciprofloxacinunknown8 daysflucloxacillinclinical diagnosisdrug hypersensitivitywithdrawal of fq ; flucloxacillin continued2009ofloxacin200 mg po bid1 daynoneskin biopsy and mast cell degranulation test for ofloxacinleukocytoclastic angiitiswithdrawal of fq ; prednisone1989ofloxacin200 mg po bid5 daysbumetanide , spirinolactone 2 weeks priorskin biopsyvasculitisunknown1989ofloxacin200 mg po bid3 daysaspirin , digoxinskin biopsyleukocytoclastic vasculitiswithdrawal of fq ; prednisolone1995ofloxacin200 mg po bid3 daysnoneskin biopsyleukocytoclastic angiitiswithdrawal of fq1996levofloxacin500 mg po daily3 daysnoneclinical diagnosisnephrotoxicity and purpurawithdrawal of fq ; prednisone2002levofloxacin500 mg po daily5 daysazithromycine , piperacilline- tazobactamclinical diagnosislcvwithdrawal of fq ; prednisone2006levofloxacinunknown3 daysrifampinskin biopsylcvwithdrawal of fq and rifampin changed to rifampicin2009levofloxacin500 mg po bid5 daysnoneskin biopsylcvwithdrawal of fq ; prednisonecurrent case
for all reported cases in the literature , the duration of fluoroquinolone therapy was 4 - 10 days .
many were clinically diagnosed without histological confirmation , but they reveal a theme of recovery following withdrawal of the agent as seen in our case .
cutaneous vasculitis may be limited to skin which offers a better prognosis , but can involve other organs with small - vessels including the kidney , as has been reported in one case report involving ciprofloxacin and another involving levofloxacin . in comparison to previous reports of levofloxacin - induced vasculitis ,
our case had several additional elements that may have contributed to the patient 's risk of developing lcv . following review of medical records ,
the patient had previously been prescribed 2 courses of ciprofloxacin , eight months and five years prior to his course of levofloxacin , with no reported adverse effects .
it is not known whether previous courses of ciprofloxacin could have been sensitizing events for later development of lcv upon challenge with levofloxacin .
levofloxacin was noted as an allergy in the patient 's medical record and the patient was counseled to avoid fluoroquinolones in the future .
consistent with previous case reports involving ciprofloxacin and ofloxacin , levofloxacin was a probable cause of lcv in our patient according to the naranjo adverse drug reaction probability scale . as in previous case reports , our patient had a full recovery with prednisone treatment and withdrawal of levofloxacin .
recognition of drug - induced vasculitis is critical as lcv can be life - threatening without discontinuation of the offending agent .
review of current literature shows that lcv has been associated with fluoroquinolones including ciprofloxacin , ofloxacin , and levofloxacin , but has yet to be reported in association with other agents in the fluoroquinolone class .
Output:
| many cases of cutaneous vasculitis are drug - induced with histology revealing leukocytoclastic vasculitis ( lcv ) .
we present a case of levofloxacin - associated lcv successfully treated with prednisone and cessation of the offending drug .
although case reports describe a link between lcv and older fluoroquinolones , such as ciprofloxacin and ofloxacin , recent reports have implicated the newer fluoroquinolone levofloxacin .
recognition of fluoroquinolone - induced cutaneous vasculitis is important as continuation or re - exposure of the offending agent may have life - threatening consequences . |
PubmedSumm6846 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: fragment screening has become an increasingly
important technique in early stage drug discovery . occupying the chemical space that is commonly described
by the rule - of - three ( ro3 ) criteria of physicochemical
properties , fragment - like molecules are
smaller in size than lead - like and drug - like molecules used in conventional
high - throughput screening ( hts ) .
screening of fragment - sized molecules
aims to sample a greater coverage of chemical diversity using a smaller
collection of compounds , at the same time
providing better hits as starting points for optimization into chemical
leads .
typical fragment screening
libraries contain compounds that originated either from commercial
sources or proprietary synthetic chemical intermediates . while these
fragments may mostly conform to the ro3 physicochemical properties
criteria , the chemical space they represent may not entirely project
to the lead - like or drug - like chemical spaces that are relevant to
medicinal chemistry . to ensure appropriate sampling of chemical space
in fragment screening , it is essential to understand the current coverage
of known medicinal chemistry space by commercial fragments . using
chembl as an open - access medicinal chemistry
repository , we investigated the overlap between the fragment - like
chemical space of exemplified medicinal chemistry substructures generated
from chembl and that of fragments available from commercial vendors
listed in the emolecules database .
the
distribution of biologically active medicinal chemistry compounds
was also analyzed , and property trends that differentiate active from
inactive compounds were identified . based upon these results ,
we make
recommendations on the composition of fragment screening libraries
to enhance sampling of the chemical space in fragment screening that
is enriched in biologically relevant compounds .
all compounds annotated as small molecules
in chembl and with a minimum of one ring
( 1.01 million unique compounds ) were used in this study .
although
only 46080 compounds from chembl conformed to the fragment - like ro3
criteria ( considering all physicochemical property criteria , apart from topological polar surface area for
which no limit was applied in this study ) , all small molecules in the chembl database were fragmented to capture
all substructures that are within the sampling space of ro3-compliant
commercial fragments . for that purpose ,
each compound was subjected
to two independent segmentation algorithms to obtain substructures
represented by a level 1 scaffold and
multiple ring segments .
level 1 scaffolds
generated from the scaffold tree algorithm represent the majority of molecules using a two - ring substructure ,
either in the form of a fused ring system or two linked monocycles .
the only exception is for substituted monocyclic compounds for which
the level 1 scaffold is identical to the entire molecule and therefore
contains only one ring .
the ring segmentation
algorithm generates ring systems with directly attached polar functional
groups .
the former method retains linkers
in the molecular scaffold , whereas the latter method describes functional
groups relevant for molecular recognition .
.
however , level 1 scaffolds that contained only one substituted monocycle
were disregarded because such scaffolds were identical to their parent
molecules with all substitutions retained .
for example , all compounds
comprising substituted phenyl rings would be independently represented ,
rendering the data set too granular .
nonetheless , substructures containing
appropriate functionalities capable of molecular recognition on substituted
monocyclic rings were captured using the ring segmentation algorithm .
although the filtered out substructures are relevant
to medicinal chemistry space , they are beyond the sampling space of
ro3-compliant commercial fragments that constitute many typical fragment
screening libraries and were hence not included in this study . in
total
, 72880 level 1 scaffolds and 46163 ring segments were filtered
out due to violation of at least one of the ro3 criteria . in particular
, almost 44000
of the filtered level 1 scaffolds were substituted monocycles that
contained over three rotatable bonds from various substituents . finally ,
substructures with unwanted functionalities such as reactive , metabolically
labile groups or toxicophores were also excluded .
this led to a collection of 13922 unique level 1 scaffolds
and 14738 unique ring segments in the chembl data set ( figure 1 ) .
rule - of - three ( ro3 )
compliance , unwanted functionalities and substituted monocycle filter ; ro3 compliance and unwanted functionalities
filter ; unwanted functionalities and
substituted monocycle filter ; unwanted
functionalities filter .
the commercial fragments data set was compiled by first applying
the ro3 filter criteria to the emolecules database containing 5.2
million commercially available compounds to include only compounds that represent the chemical space commonly
sampled in typical fragment screening libraries .
substructures of
224575 ro3-compliant commercial fragments were generated using the
aforementioned segmentation algorithms .
the resultant level 1 scaffold
substructures were subjected to both the unwanted functionalities
and substituted monocycles filters , whereas only the unwanted functionalities
filters were applied to the ring segment substructures .
the final
commercial fragments data set contained 11862 unique level 1 scaffolds
and 11257 unique ring segments ( figure 1 ) . to understand
the sampling of exemplified medicinal chemistry space using commercial
fragments , the overlap between the substructures generated from both
data sets
, there are 27077 unique substructures
derived from chembl and 21228 unique substructures derived from ro3-compliant
commercial fragments ( figure 1 ) .
only 10067
( 26% of all the 38238 substructures , the same number of total substructures applies to all subsequent percentage comparisons in this paragraph )
substructures are common in both data sets ( region a , figure 2a ) .
the overlap increased when nonidentical but
chemically similar substructures were included . using molecular fingerprints
analogous to the daylight fingerprints ( epfp_7 ) , 4346 substructures
( 11% , region c ) derived from chembl compounds had one of their nearest
neighbors in the commercial fragments data set above a 0.85 tanimoto
similarity cutoff , a threshold at which any molecular pairs above
this similarity can be considered chemically similar .
the remaining 12664 substructures from chembl ( 33% , region
b ) had low similarity to any commercial fragment substructures .
in
an analogous comparison , 4073 substructures ( 11% , region d ) derived
from ro3-compliant commercial fragments had a chemically similar substructure
in chembl as one of their nearest neighbors .
the remaining 7088 substructures
( 19% , region e ) had low similarity to any chembl substructures ( figure 2a ) .
venn diagrams illustrating the overlap between substructures
derived from chembl small molecules ( blue ) and commercial fragments
( yellow ) .
the subsets of substructures that have one of the nearest
neighbors above a 0.85 tanimoto similarity cutoff ( epfp_7 ) in the
counterpart data set are represented by purple and orange circles .
( a ) all chembl substructures versus all commercial fragment substructures ;
( b ) only substructures derived from bioactive parent chembl compounds
versus all commercial fragment substructures .
the subset of commercial
fragment substructures below the 0.85 tanimoto cutoff that only appeared
in nonactive parent chembl compounds is represented by the red circle .
next , the same analysis was applied
to evaluate a subset of the substructures of the chembl data set .
this time , only substructures that are derived from biologically active
chembl compounds ( 358240 unique compounds , of which 12018 are ro3-compliant )
were considered .
these were defined as the parent compounds annotated
with ki , kd , ic50 , or ec50 10 m .
this subset ,
containing 16518 substructures , was compared to those derived from
ro3-compliant commercial fragments ( figure 2b ) .
only 6965 substructures ( 23% of all the 30781 substructures ,
the same number of total substructures applies to all subsequent percentage
comparisons in this paragraph ) are common to both data sets ( region
a ) . when extending the overlap by including chemically similar substructures ,
2435 substructures ( 8% , region c ) from bioactive chembl compounds
had similar nearest neighbors in commercial fragments .
over 7000 bioactive
chembl substructures ( 23% , region b ) had no similar substructures
in commercial fragments .
vice versa , 14263 substructures of the commercial
fragment set did not overlap with the chembl bioactive set ( regions
d , e and f ) .
4053 of these substructures ( 13% , region d ) had a chemically
similar substructure in chembl as one of their nearest neighbors .
a further 2146 of these substructures ( 7% , region f ) did not resemble
ro3-compliant chembl substructures derived from bioactive compounds , but were present in nonactive parent compounds in chembl ( previously
in region a of figure 2a ) . after establishing
the overlap between the data sets ,
the chemical space occupied by
the generated substructures was further evaluated . using 16 descriptors
to characterize the physicochemical properties and molecular complexity
of the generated substructures ( table 1 ) , principal
component analysis ( pca )
according to the 2d pca
plot ( figure 3a ) , the substructures derived
from chembl compounds and those derived from ro3-compliant commercial
fragments occupy the same areas of chemical space .
subsequently , the
distribution of substructures derived from commercially available
fragments within the chemical space was analyzed ( figure 3c ) .
the density plot indicated that the highest
representation of these substructures is in quadrants one and four ,
corresponding to chemical space with increasing molecular size and
aromaticity respectively , whereas quadrants two and three , corresponding
to chemical space with increasing three - dimensionality and polarity
respectively , have lower representation .
this distribution remains
similar when only the substructures that are identical to , or chemically
similar to , bioactive chembl substructures ( 11018 substructures , regions
a and d in figure 2b ) were considered ( figure 3d ) .
categorical descriptors with discrete unit values
were normalized relative to the number of heavy atoms , unless stated
otherwise .
finally , the
overlap between the chembl substructures derived from bioactive compounds
and those that only appeared in inactive compounds was compared ( figures 3e to 3j ) .
the chemical space
covered by both subsets is largely similar ( figure 3e ) .
however , the distribution of these substructures is uneven
in chemical space ( figures 3f , 3 g , and 3h ) .
the density plots indicate
that quadrants one and four of the 2d pca plot , corresponding to chemical
space with increasing molecular size and aromaticity , respectively ,
have the highest representation , whereas quadrants two and three ,
corresponding to chemical space with increasing three - dimensionality
and polarity respectively , have lower occupancy .
this distribution
remains similar when the substructures that are derived from bioactive
compounds and those only from inactive compounds were separately analyzed
( figures 3 g and 3h ,
respectively ) . to further elucidate the differences between
the biologically active and inactive substructures ,
the difference
and enrichment plots of the 2d pca plot in figure 3e were generated by dividing the scoring plot into cells of
size 0.25 0.25 .
the difference plot ( figure 3i ) shows the difference between the normalized occupancy of
biologically active and inactive substructures within each cell .
the
region of chemical space having the highest positive difference is
in quadrant four that corresponds to increasing aromaticity , whereas
there are more cells with negative difference observed in quadrant
one that corresponds to increasing substructure size .
the enrichment
plot ( figure 3j ) shows the ratio of the normalized
occupancy of bioactive substructures to all substructures within each
cell , with the average ratio at 0.52 .
quadrants two and three , characterizing
substructures with increasing three - dimensionality and polarity respectively ,
appear to have more cells with ratios higher than average compared
to quadrants one and four .
quadrants
are counted clockwise with the first quadrant in the top right corner .
( a ) scoring plot with ellipses showing the 95% confidence intervals
of the distributions of substructures derived from chembl compounds
( red ) , ro3-compliant commercial fragments ( blue ) , and those common
to both data sets ( region a in figure 2a ) ( cyan ) .
( c ) density plot of the distribution
of all substructures from commercial fragments .
the ellipse ( same
for figures ( d ) , ( f ) , ( g ) , and ( h ) ) corresponds to a confidence level
of 95% of hotelling s t distribution
of the entire chemical space analyzed .
( d ) density plot of the distribution
of commercial fragments that are identical to , or considered chemically
similar to , bioactive chembl substructures ( regions a and d in figure 2b ) .
( e ) scoring plot with ellipses showing the 95%
confidence intervals of the distributions of substructures derived
from biologically active chembl compounds ( red ) and those only from
inactive compounds ( blue ) .
( g ) density plot of the distribution of biologically active chembl
substructures in ( e ) .
( h ) density plot of the distribution of biologically
inactive chembl substructures in ( e ) .
( i ) difference plot of ( e ) between
the normalized occupancy of biologically active and inactive substructures
within each cell .
( j ) enrichment plot of ( e ) showing the ratio of
the normalized occupancy of biologically active substructures to all
substructures within each cell .
the application of fragment screening in
hit discovery aims to efficiently sample the lead - like and drug - like
chemical space using a small collection of compounds .
while many typical
fragment libraries contain commercial fragments that mostly conform
to the ro3 physicochemical properties criteria , the chemical space
these fragments represents may not entirely project to the lead - like
and drug - like chemical space that are relevant to medicinal chemistry .
by generating substructures from chembl compounds and ro3-compliant
commercial fragments and analyzing the overlap between the two data
sets , the chemical space coverage in fragment screening collections
derived from commercial fragments
the overlap
analyses ( figure 2b ) indicate that the number
of identical substructures derived from bioactive chembl compounds
and commercial fragments ( region a ) only accounts for less than 25%
of all the 30781 substructures present .
even when chembl substructures
similar to commercial fragments ( region c ) are included , more than
7000 substructures ( over 40% of the 16518 substructures derived from
bioactive chembl compounds , region
almost half of the substructures derived from bioactive
medicinal chemistry compounds are not covered using currently available
commercial fragments .
chemical syntheses of the substructures that
are unique to chembl ( region b ) would be the most exhaustive way to
improve the sampling of known bioactive medicinal chemistry space
in fragment screening libraries , even though such compounds may be
synthetically challenging ( see figures 4 and s1 for exemplars of substructures in region b
of figure 2b that frequently appear in bioactive
parent chembl compounds ) .
alternatively , we recommend the design of
fragment screening libraries should initially and pragmatically focus
on exemplifying the substructures that occur in both the chembl set
and the commercially available fragment set ( region a ) , or those that
occur in commercially available fragments and are similar to substructures
derived from bioactive molecules in chembl ( region d ) .
these substructures
represent compounds that have reported bioactivity in the primary
literature or resemble closely bioactive substructures derived from
chembl .
hence , including these compounds in fragment screening libraries
will ensure appropriate coverage of chemical space relevant to known
bioactive medicinal chemistry series in fragment screens .
this is
useful in particular when financial constraints may limit the number
of compounds purchased for a fragment screening library , since these
compounds can offer a higher confidence of discovering hit matter
given the literature precedence of the represented substructures .
however , these substructures may have already been extensively studied
and gaining intellectual property rights from these substructures
may prove challenging .
exemplars of frequently occurring substructures derived
from bioactive chembl compounds that have low similarity to commercial
fragments ( region b of the venn diagram in figure 2b ) .
when considering expanding
fragment screening libraries , compounds represented by substructures
in commercial fragments that have low similarity to those derived
from bioactive chembl compounds ( regions e and f , figure 2b ) may become useful to expand the chemical space
sampling .
represented by almost 50% of the 21228 substructures derived
from commercial fragments , these compounds either have not been subjected
to any biochemical or cell assay , or their assay results were not
reported in the primary literature ( region e ) , whereas compounds represented
by substructures in region f have thus far only resulted in inactive
compounds in the primary literature . although these substructures
have not been demonstrated to display any biological activity , they
could offer less explored scaffolds that have a better potential in
gaining intellectual property rights should hit matter be discovered
( see figure 5 for exemplars of substructures
in region e of figure 2b ) . in addition , when
screening against emerging target classes , the relevant chemical space
may not be well - defined and could be different from that which already
has extensive coverage in medicinal chemistry literature . therefore
,
these compounds with low similarity to currently known medicinal chemistry
space can be useful in offering more diverse fragment screening libraries .
exemplars
of substructures derived from ro3-compliant commercial fragments that
have low similarity to bioactive chembl compounds ( region e of the
venn diagram in figure 2b ) . using 2d pca , the chemical space described by 16
descriptors illustrates uneven distributions of the substructures
generated , even though the substructures derived from chembl compounds
and those derived from ro3-compliant commercial fragments occupy a
largely similar chemical space ( figures 3a , 3c , and 3f ) . in agreement
with previous results ,
substructures
with increasing aromaticity have the highest representation in commercial
fragment substructures ( quadrant four , figures 3c and 3d ) .
the lowest representation in commercial
fragment substructures corresponds to chemical space with increasing
polarity ( quadrant three , figures 3c and 3d ) .
we speculate that one possible reason for the
low representation of polar compounds could be attributed to less
robust procedures in the chemical synthesis or purification of polar
compounds .
this implies that , when designing fragment screening libraries ,
focusing on the substructures in the commercial fragments set common
to , or those have high similarity to , the bioactive chembl substructures
( regions a and d , respectively , figures 2b
and 3d ) as we recommend here , the coverage
of polar substructures relevant to known bioactive medicinal chemistry
space could remain low .
figure 6 shows exemplars
of polar substructures with low similarity to commercial fragments
( region b of the venn diagram in figure 2b ) .
given that among the polar substructures , those derived from active
compounds are enriched over those derived from inactive compounds
( quadrant three , figure 3j ) , it is desirable
to increase the sampling of polar chemical space . with limited availability
from commercial vendors , we recommend that fragments containing polar
substructures should be of a high priority when devoting synthetic
resources to create new fragments since this will complement commercial
fragment coverage to improve the chemical space sampling of fragment
screens .
exemplars of polar substructures derived from bioactive chembl compounds
that have low similarity to commercial fragments ( region b of the
venn diagram in figure 2b ) .
the distributions of substructures derived from
bioactive chembl compounds and those derived from inactive compounds
are both uneven .
although these two subsets from chembl cover a largely
similar chemical space ( figure 3e ) , the difference
and enrichment plots demonstrate the uneven distributions of the two
subsets across the chemical space ( figures 3i and 3j ) . according to the enrichment plot
( figure 3j ) , the chemical space corresponding
to increasing three - dimensionality , and
also regions with increasing
polarity , display higher - than - average enrichments of biologically
active substructures ( respectively quadrants two and three , figure 3j ) .
such observation suggests that substructures
with increasing three - dimensionality and/or increasing polarity could
more likely deliver biologically active compounds , supporting recent
literature recommendations for improving fragment sampling in three - dimensional
space .
however , it should be noted that the population of
substructures within many of these enriched cells is evidently lower
than the average population ( see density plot in figure 3f ) .
therefore , the enrichment for bioactive compounds within
these cells might be overestimated given the low number of substructures
present .
improved sampling of substructures with increasing three - dimensionality
and/or increasing polarity will be required to provide a better understanding
of the true enrichment of substructures within this chemical space .
the coverage of known medicinal chemistry space by commercial fragments
was evaluated to elucidate the sampling of chemical space in fragment
screening .
this analysis points to strategies which enrich representation
of substructures relevant to medicinal chemistry and to promote appropriate
sampling of chemical space .
the analysis of substructures generated
from chembl compounds and ro3-compliant commercial fragments suggests
that the overlap between the two data sets is low . to ensure initial
confidence in discovering hit matter using commercial fragments ,
a
subset of the commercial fragment substructures constituting 11000
substructures ( regions a and d in figure 2b )
that have close similarity to bioactive compounds in known medicinal
chemistry space should be used since these substructures have literature
precedence to exhibit biological activity . when expanding screening
libraries to include more diverse screening compounds , the remaining
commercial fragment substructures ( regions e and f in figure 2b ) that have low similarity to known medicinal chemistry
compounds may offer novel hits that have better potential to gain
intellectual property rights in addition to those similar to known
bioactive substructures . applying such strategies to the design of
new fragment screening libraries using commercial fragments
would
maximize the opportunity to discover fragment hits . when further
analyzing the distribution of the substructures in chemical space
using 2d pca , the chemical space characterizing substructures with
increasing three - dimensionality and/or increasing polarity apparently
display higher - than - average enrichments for bioactive substructures ,
indicating that compounds with these substructures might be more likely
to display biological activity .
however , given the limited coverage
of polar substructures by commercial fragments , the most effective
way to enhance the sampling of polar chemical space in fragment screening
is to synthesize new fragments containing these substructures .
together
with the improvement of fragment sampling in three - dimensional space
that has already been initiated in various academic organizations , the true enrichment of polar and/or three - dimensional substructures
for bioactive compounds can be more thoroughly assessed .
the ring segments for individual compound were generated
by defining substructures as a ring system plus any polar functional
groups directly attached to a ring system .
polar functional groups were specified as nitrogen , oxygen , or sulfur
atoms directly attached to the ring system , carbonyl groups , or double
or triple bonded carbon atoms .
polar functional groups linking two
ring systems were retained in both ring segment substructures .
a mix
of pattern matching and rules , implemented in a python script using
the oechem toolkit ( openeye scientific software ) , was used to extract
the ring segments .
the 16 descriptors
were calculated using pipeline pilot professional client 8.0 ( accelrys ,
inc . ) applying the definitions in the software , unless stated otherwise .
all categorical descriptors with discrete unit values were normalized
relative to the number of heavy atoms , unless stated otherwise .
a heteroatom was defined as the elements s , o , or n. an unsaturated
bond was defined as a bond with a bond order greater than one .
an
sp - hybridized carbon atom was defined as any carbon atom
which has an atom hybridization of sp according to pipeline
pilot calculations .
the fraction of sp - hybridized carbon
atoms ( fsp3c ) was normalized relative to the total number of carbon
atoms in the same molecule .
all fingerprint
density descriptors were defined as the ratio between the number of
bits in the corresponding fingerprint generated and the number of
heavy atoms . for pmisum and pbf ,
one single 3d conformer was
generated for each individual substructure using corina ( molecular
networks gmbh ) .
the principal moment of inertia ( pmi ) was then calculated
using pipeline pilot and the sum obtained after normalizing the pmi
to the longest vector .
the 2d - pca plots were generated
using simca - p+ 13.0.0.0 ( umetrics ) .
the descriptor matrix was normalized
to unit variance before carrying out pca using the pca - x option under
standard settings .
the number of principal components was based on
automatic cross - validation within the software .
the difference and
enrichment plots were calculated using pipeline pilot 8.0 ( accelrys ,
inc . ) .
the difference is defined as that between the normalized occupancy
of biologically active substructures ( activen ) and the normalized occupancy of inactive
substructures ( inactiven ) within each cell .
the enrichment is defined as the ratio of activen to the sum of activen and inactiven .
Output:
| analyzing
the chemical space coverage in commercial fragment screening collections
revealed the overlap between bioactive medicinal chemistry substructures
and rule - of - three compliant fragments is only 25% .
we recommend
including these fragments in fragment screening libraries to maximize
confidence in discovering hit matter within known bioactive chemical
space , while incorporation of nonoverlapping substructures could offer
novel hits in screening libraries .
using principal component analysis ,
polar and three - dimensional substructures display a higher - than - average
enrichment of bioactive compounds , indicating increasing representation
of these substructures may be beneficial in fragment screening . |
PubmedSumm6847 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: low back pain ( lbp ) is a major public health problem all over the industrial countries and is one of the leading causes for sick leave and disability .
in addition , it was recommended that fitness programs and advice to stay active can reduce pain , improve function , and can prevent lbp becoming chronic .
the call center industry is one of the most expansive labor market sectors these days . in thailand
, there are an increasing number of telephone operators at the call centers day - by - day due to the economic growth of the country .
there was a high proportion of call - center operators reported musculoskeletal symptoms , and the call - center operators were exposed to working conditions that indicated an increased risk of developing musculoskeletal disorders .
nevertheless , there is few literature regarding health and working conditions among call - center operators .
hence , this study was designed with the aim of investigating the physical activity levels and incidence of lbp among call - center operators working as telephone operators .
participants in this study were call - center operators who were working as telephone operators at the company for at least 6 month .
operators were excluded if they had fracture , scoliosis , musculoskeletal disease , or injuries within 6 months prior to this study .
the questionnaire consisted of three parts ;
part i : demographic characteristics and job characteristics of the call - center operatorspart ii : level of physical activity and exercise intensity .
the levels of physical activity were assessed in at five levels ; never , 12 times / week , 34 times / week , and 56 times / week every day .
the operational term physical activity was as a personal training exercise or physically exercises beside from work .
in addition , based on the time spent on each exercise , the exercise intensity was assessed at 3 levels ; light , moderate , and highpart iii : a standardized nordic questionnaire for analyzing musculoskeletal discomfort in different body regions .
the pain intensity was classified into three levels as mild ( pain scale 3 ) , moderate ( pain scale ranged from 46 ) , and severe level ( pain scale 7 ) .
part i : demographic characteristics and job characteristics of the call - center operators part ii : level of physical activity and exercise intensity .
the levels of physical activity were assessed in at five levels ; never , 12 times / week , 34 times / week , and 56 times / week every day .
the operational term physical activity was as a personal training exercise or physically exercises beside from work .
in addition , based on the time spent on each exercise , the exercise intensity was assessed at 3 levels ; light , moderate , and high part iii : a standardized nordic questionnaire for analyzing musculoskeletal discomfort in different body regions .
the pain intensity was classified into three levels as mild ( pain scale 3 ) , moderate ( pain scale ranged from 46 ) , and severe level ( pain scale 7 ) . frequency distribution with percentages was done on all variables .
the relationships between lbp and possible confounding factors ( nominal level categorical variables ) were computed with spearman 's correlation .
participants in this study were call - center operators who were working as telephone operators at the company for at least 6 month .
operators were excluded if they had fracture , scoliosis , musculoskeletal disease , or injuries within 6 months prior to this study .
the questionnaire consisted of three parts ;
part i : demographic characteristics and job characteristics of the call - center operatorspart ii : level of physical activity and exercise intensity .
the levels of physical activity were assessed in at five levels ; never , 12 times / week , 34 times / week , and 56 times / week every day .
the operational term physical activity was as a personal training exercise or physically exercises beside from work .
in addition , based on the time spent on each exercise , the exercise intensity was assessed at 3 levels ; light , moderate , and highpart iii : a standardized nordic questionnaire for analyzing musculoskeletal discomfort in different body regions .
the pain intensity was classified into three levels as mild ( pain scale 3 ) , moderate ( pain scale ranged from 46 ) , and severe level ( pain scale 7 ) .
part i : demographic characteristics and job characteristics of the call - center operators part ii : level of physical activity and exercise intensity .
the levels of physical activity were assessed in at five levels ; never , 12 times / week , 34 times / week , and 56 times / week every day .
the operational term physical activity was as a personal training exercise or physically exercises beside from work .
in addition , based on the time spent on each exercise , the exercise intensity was assessed at 3 levels ; light , moderate , and high part iii : a standardized nordic questionnaire for analyzing musculoskeletal discomfort in different body regions .
the pain intensity was classified into three levels as mild ( pain scale 3 ) , moderate ( pain scale ranged from 46 ) , and severe level ( pain scale 7 ) .
the relationships between lbp and possible confounding factors ( nominal level categorical variables ) were computed with spearman 's correlation .
anthropometrical data for participants in this study were age 27.8 3.1 years , height 159.97 6.26 cm , weight 52.89 12.89 kg , females 86.7% ( n = 91 ) , and males 13.3% ( n = 14 ) .
most of them ( 95% ) never had experience as telephone operator prior to this job .
the call - center operators had sedentary workstyle ; most of the time they were sitting in front of the computers at their desk in a confined space and wearing headsets , answering the phone calls , and searching the telephone number for the clients .
they worked at least 6 days / week , with an average of 8 hours / day .
sixty - one percent worked over time with an average of 2 h / day .
most of them had to receive calls ranged from 500600 calls / person / day , and spent time on each calls approximately 45 seconds .
majority of participants had low level of personal training physical activity ; 40% of the participants had never exercised , 34.3% exercised 12 times / week , only 10.4% of the participants exercised everyday [ figure 1 ] . however , most who did physical exercise spent less than 30 min / time [ figure 2 ] .
based on the time spent on each exercise , their exercise intensity was classified to low ( 49.2% ) , moderate ( 46% ) level , and high ( 4.8% ) level [ figure 3 ] .
level of physical activity in times per week time spent per exercise of participants who exercised level of exercise intensity of participants who exercised the overall self - reported prevalence of lbp was 65.7% ( n = 69 ) .
figure 4 shows that majority of lbp operators reported high level of lbp pain severity ( score 7 on a 10-pont pain numerical rating scale [ figure 4 ] .
level of low back pain severity of participants there was significant correlation between low level of physical activity and low back pain , we observed that spearman 's correlation coefficient , rs , was 0.9 , which is statistically significant ( p = 0.001 ) .
in addition , 58.1% of participants stated that their low back pain caused by their job characteristic .
remarkably , there was 62.9% of them reported that lbp was aggravated by sitting during a 6-hour working shift .
furthermore , there were correlation between working period , and working space with the occurrence of low back pain ( p < 0.05 ) .
anthropometrical data for participants in this study were age 27.8 3.1 years , height 159.97 6.26 cm , weight 52.89 12.89 kg , females 86.7% ( n = 91 ) , and males 13.3% ( n = 14 ) .
most of them ( 95% ) never had experience as telephone operator prior to this job .
the call - center operators had sedentary workstyle ; most of the time they were sitting in front of the computers at their desk in a confined space and wearing headsets , answering the phone calls , and searching the telephone number for the clients .
they worked at least 6 days / week , with an average of 8 hours / day .
sixty - one percent worked over time with an average of 2 h / day .
most of them had to receive calls ranged from 500600 calls / person / day , and spent time on each calls approximately 45 seconds .
majority of participants had low level of personal training physical activity ; 40% of the participants had never exercised , 34.3% exercised 12 times / week , only 10.4% of the participants exercised everyday [ figure 1 ] .
however , most who did physical exercise spent less than 30 min / time [ figure 2 ] .
based on the time spent on each exercise , their exercise intensity was classified to low ( 49.2% ) , moderate ( 46% ) level , and high ( 4.8% ) level [ figure 3 ] .
level of physical activity in times per week time spent per exercise of participants who exercised level of exercise intensity of participants who exercised
the overall self - reported prevalence of lbp was 65.7% ( n = 69 ) .
figure 4 shows that majority of lbp operators reported high level of lbp pain severity ( score 7 on a 10-pont pain numerical rating scale [ figure 4 ] .
there was significant correlation between low level of physical activity and low back pain , we observed that spearman 's correlation coefficient , rs , was 0.9 , which is statistically significant ( p = 0.001 ) .
in addition , 58.1% of participants stated that their low back pain caused by their job characteristic .
remarkably , there was 62.9% of them reported that lbp was aggravated by sitting during a 6-hour working shift .
furthermore , there were correlation between working period , and working space with the occurrence of low back pain ( p < 0.05 ) .
the main findings in this study were that a majority of the call - center operators reported low level of physical activity , there was a prevalence of lbp at 65.7% , and there was significant association between lbp and low level of physical activity , job characteristics , and work space .
the prevalence of lbp in call - center operators in this study was 65.7% , which is found to be high as in those who work as office workers .
it was suggested that work - related factors were associated with the occurrence of musculoskeletal symptoms . as seen in this present study
, there were association between lbp and work factor , i.e. , sitting continuous for long periods of working hours and working in a confined space . in the present study , the participants working as telephone operators and spent long continuous time sitting in front of the computer than other sedentary job .
this result agreed with the study on call - center operators working condition in sweden .
a hypothesis has been proposed that low level of physical activity may be a risk factor in experiencing lbp .
the fact that in the present study we found the same results as the recommended one .
the report of us department of health and human services ( 1996 ) suggested that significant health benefits can be obtained by including a moderate amount of physical activity ( e.g. , 30 minutes of brisk walking or raking leaves , 15 minutes of running , or 45 minutes of playing volleyball ) on most , if not all , days of the week .
recently , it was suggested that strenuous physical activity at least once a week is protective for incidence of lbp .
therefore , through a modest increase in daily physical activity , the call - center operators can improve their health and quality of life .
the validity of the concept of lbp is difficult to establish because of the subjectivity of pain .
however , goodman and mcgrath claimed that any measure of pain which is not based on self - report will likely yield inaccurate results .
thus , the questions on lbp were fairly good , in that we investigated the severity and frequency of pain .
further , the current physical activity itself is important in the evaluation of the impact of activity level on lbp . therefore , the present study asked the operators him / herself about their lbp , and physical activity level .
strengths of this study are the use of a randomized sample , validated questionnaire , and high response rate ( 70% ) .
it is , however , a first study in thailand , these results may be not representative for all call - center operators .
further research in this area should focus upon a broader approach when investigating adolescent lbp associated with physical activity , including type of activities performed , technical skill , and body awareness through long - term , clinical , cross - sectional studies .
the majority of operators in this study had low level of physical activity and suffered from lbp .
the incidence of low back pain was associated to their level of physical activity and work factors .
Output:
| background : call - center operators are exposed to working conditions that indicate an increased risk of developing musculoskeletal disorders . nevertheless , there are few studies regarding health and working condition in call - center operators .
thus , this study was designed to investigate the physical activity levels and prevalence of low back pain ( lbp ) in thai call - center operators.materials and methods : a self - reported questionnaire was distributed to 150 operators at a call center to identify the physical activity levels , prevalence of lbp , personal characteristics , and associated work factors.results:the questionnaire response rate was 70% ( n = 105 ) .
the participants ' age was 27.8 3.1 years , height was 159.97 6.26 cm , weight was 52.89 12.89 kg , and females 86.7% ( n = 91 ) , and males 13.3% ( n = 14 ) .
participants worked at least 6 days every week , with an average of 8 hours each day .
sixty - one percent of them worked over time with an average 2 h / day .
forty percent of the participants had no exercise ; 34.3% exercised 12 times / week .
those who did physical exercise spent less than 30 min / time .
the overall self - reported prevalence of lbp was 65.7% , and they reported high severity of lbp for 42.9% .
all participants reported that their lbp as recurring , and 62.9% reported that lbp was aggravating by sitting during working hours.conclusion:the call - center operators had a sedentary work style .
the majority of operators in this study had low level of physical activity and suffered from low back pain .
the prevalence of low back pain was associated to their level of physical activity and work factors . |
PubmedSumm6848 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: traumatic spinal cord injury ( sci ) often leads to serious neurological sequelae and medical complications .
the secondary damage following sci is induced by multiple pathophysiological mechanisms , including vascular perturbation , metabolic failure , ionic dysregulation , and celluar excitotoxicity7,10 ) .
these mechanisms increase blood - spinal cord barrier permeability , tissue edema , free radical formation , peroxidation of lipid membranes , cytokines release , and inflammation .
a few investigations were introduced in order to minimize secondary damage using electrical stimulation , aminoacids , and drugs3,14,15,18 ) .
electrostimulation of sacral nerve roots is currently being used with promising results as a treatment for a wide spectrum of voiding dysfunctions . also , some investigators reported additional effects of the sacral nerve stimulation such as change of spasticity and spasm , increased motility of intestinal tract and defecation , and improvement of leg motor in experimental and clinical studies3,6,13,17 ) .
prior investigators revealed that one patient with a long history of progressive spinal multiple sclerosis was able to stand and transfer , but not walking , before the sacral nerve stimulation6 ) .
another paraplegic patient was showed improvement of motor power slowly , and after 2 years the patient could stand as confident as before6 ) .
the purpose of this study was to evaluate neuroprotective effect of sacral neuromodulation in rat thoracic spinal cord injury model in histological and functional aspects .
twenty - one sprague dawley of 6 months old female , weighing 200 to 250 gm , were randomly divided into 3 groups : a normal control group ( ctl , n=7 ) , sci with sham stimulation group ( sci , n=7 ) , and sci with electrical stimulation ( sci+es , n=7 ) .
the sci group included rats that were injured with electrodes implanted but did not receive stimulation .
the sci+es group included rats that received electrical stimulation at the s2 or s3 nerve root using needle electrode .
rats in the sci and sci+es groups were kept in separate cages under the same living conditions for a week before receiving scis .
the animals were anesthetized with an intramuscular injection of zoletil 15 mg and xylazine 3 mg . under general anesthesia
after routine disinfection , a surgical incision was made through the skin , subcutaneous tissue , and the t8 - 12 vertebral lamina to the spinal canal ( fig .
severe grade scis were induced in rats using an new york university - multicenter animal spinal cord injury study impactor .
the impact height of 25 mm was considered for severe cord injury based on a prior investigation1 ) . at the s1 - 3 level , a surgical incision was made through the skin , subcutaneous tissue , and the s2 - 3 vertebral lamina ( fig .
needle electrodes ( 0.527 g ) were implanted at bilateral s2 or s3 neural foramina .
wounds were cleaned and sutured with wires inserted through the subcutaneous tissue extruding from the neck .
the sci+es group received electrical stimulation 7 days after sci with the following protocol : stimulation time 30 minutes ; pulse duration , 0.1 ms ; and frequency , 20 hz .
post - injury motor behavior is assessed by the basso , beattie , and bresnahan ( bbb ) locomotor scale method4,5 ) .
the scale ( 0 - 21 ) represents sequential recovery stages and categorizes combinations of rat joint movement , hindlimb movements , stepping , forelimb and hindlimb coordination , trunk position and stability , paw placement , and tail position .
the spinal cord was dissected and embedded in formalin solution , cut into 5 m - thick axial sections , and stained with hematoxylin and eosin ( h&e ) and luxol fast blue to identify structural defects , motor neuron cell injury and myelin loss .
motor neuron cells were counted in the anterior horns of 1 - 2 mm rostral from the epicenter . only complete neuronal cells with a clearly defined cell body and nucleus
twenty - one sprague dawley of 6 months old female , weighing 200 to 250 gm , were randomly divided into 3 groups : a normal control group ( ctl , n=7 ) , sci with sham stimulation group ( sci , n=7 ) , and sci with electrical stimulation ( sci+es , n=7 ) .
the sci group included rats that were injured with electrodes implanted but did not receive stimulation .
the sci+es group included rats that received electrical stimulation at the s2 or s3 nerve root using needle electrode .
rats in the sci and sci+es groups were kept in separate cages under the same living conditions for a week before receiving scis .
the animals were anesthetized with an intramuscular injection of zoletil 15 mg and xylazine 3 mg . under general anesthesia
after routine disinfection , a surgical incision was made through the skin , subcutaneous tissue , and the t8 - 12 vertebral lamina to the spinal canal ( fig .
severe grade scis were induced in rats using an new york university - multicenter animal spinal cord injury study impactor .
the impact height of 25 mm was considered for severe cord injury based on a prior investigation1 ) . at the s1 - 3 level
, a surgical incision was made through the skin , subcutaneous tissue , and the s2 - 3 vertebral lamina ( fig .
needle electrodes ( 0.527 g ) were implanted at bilateral s2 or s3 neural foramina .
wounds were cleaned and sutured with wires inserted through the subcutaneous tissue extruding from the neck .
the sci+es group received electrical stimulation 7 days after sci with the following protocol : stimulation time 30 minutes ; pulse duration , 0.1 ms ; and frequency , 20 hz . epidural low frequency electric stimulation was applied 30 minutes per day for 4 weeks .
post - injury motor behavior is assessed by the basso , beattie , and bresnahan ( bbb ) locomotor scale method4,5 ) .
the scale ( 0 - 21 ) represents sequential recovery stages and categorizes combinations of rat joint movement , hindlimb movements , stepping , forelimb and hindlimb coordination , trunk position and stability , paw placement , and tail position .
the spinal cord was dissected and embedded in formalin solution , cut into 5 m - thick axial sections , and stained with hematoxylin and eosin ( h&e ) and luxol fast blue to identify structural defects , motor neuron cell injury and myelin loss .
motor neuron cells were counted in the anterior horns of 1 - 2 mm rostral from the epicenter . only complete neuronal cells with a clearly defined cell body and nucleus were counted .
the sci group tissue obtained 4 weeks after trauma revealed diffuse hemorrhage , widespread edema , and focal necrosis in both gray - matter and white - matter ( fig .
the traumatized spinal cord was infiltrated with polymorphonuclear leucocytes , erythrocytes , and macrophages in h&e staining .
the number of anterior horn cell was 12.35.7 cells / high power field ( hpf ) in the ctl group , 7.84.9 cells / hpf in the sci group , and 6.95.5 cells / hpf in the sci+es group , respectively . between sci and sci+es group ,
a significant loss of myelin in the white matter was also observed in the sci and sci+es groups compared with the ctl group ( fig .
3 ) . cavitation and demyelinization of the nerve fibers usually has no significant difference between the sci group and the sci+es group . in only 2 specimens of the sci group ,
the open field locomotor scores ( bbb test ) of the corresponding groups are presented in fig .
4 . before the injury , all rats showed normal function on the bbb score .
as demonstrated , all traumatized rats exhibited a severe bbb score at 1 day after sci . at day 1 of sci , the bbb scores of the sci and the es group were 3.01.0 and 2.71.0 , respectively .
they improved significantly at days 3 , 7 , and 14 after sci ( 3 days : 6.41.5 and 6.21.3 , 7 days : 12.50.8 and 13.31.0 , and 14 days : 14.30.5 and 14.50.3 ) .
the animals did improve over time but there was no significant different at any point in time between sci and sci+es groups .
the sci group tissue obtained 4 weeks after trauma revealed diffuse hemorrhage , widespread edema , and focal necrosis in both gray - matter and white - matter ( fig .
the traumatized spinal cord was infiltrated with polymorphonuclear leucocytes , erythrocytes , and macrophages in h&e staining .
the number of anterior horn cell was 12.35.7 cells / high power field ( hpf ) in the ctl group , 7.84.9 cells / hpf in the sci group , and 6.95.5 cells / hpf in the sci+es group , respectively . between sci and sci+es group ,
a significant loss of myelin in the white matter was also observed in the sci and sci+es groups compared with the ctl group ( fig .
3 ) . cavitation and demyelinization of the nerve fibers usually has no significant difference between the sci group and the sci+es group . in only 2 specimens of the sci group ,
the open field locomotor scores ( bbb test ) of the corresponding groups are presented in fig .
4 . before the injury , all rats showed normal function on the bbb score .
as demonstrated , all traumatized rats exhibited a severe bbb score at 1 day after sci . at day 1 of sci , the bbb scores of the sci and the es group were 3.01.0 and 2.71.0 , respectively .
the difference between two groups was not significant . during subsequent scoring periods , bbb scores increased and plateaued around 14 days after sci .
they improved significantly at days 3 , 7 , and 14 after sci ( 3 days : 6.41.5 and 6.21.3 , 7 days : 12.50.8 and 13.31.0 , and 14 days : 14.30.5 and 14.50.3 ) .
the animals did improve over time but there was no significant different at any point in time between sci and sci+es groups .
electrical stimulation has been reported to show neurobiological effects , such as relieving pain in the region of head and face and restoring movement and function in individuals with spinal cord injury6,9 ) .
it has also been indicated that electrical stimulation can directly exert effects on regenerating neural tissues observed under a well - controlled experimental environment9 ) .
several investigators have reported that a low - frequency electrical stimulation is a promise approach to accelerate nerve regeneration after injury2,12 ) .
there are some studies on neuroprotective effects of sacral nerve stimulation in the sci patients2,3,6,11,17 ) .
the additional effect of sacral neuromodulation was improvement of neurogenic bladder , intestinal motility , penile erection , pain discrimination , and motor power of leg6 ) .
however , the current study showed that sacral neuromodulation to rat injured thoracic spinal cord did not prevent sci - induced myelin loss and cavitation .
the number of anterior horn cell of the sci and sci+es groups did not show significant differences .
moreover , no significant differences at any point in time between the sci and sci+es groups were found in terms of locomotor function as assessed by the bbb test .
our hypothesis was that sacral neuromodulation might prevent loss of myelin and promote regeneration of myelinated fiber .
several investigators have reported that a low - frequency electrical stimulation is a promise approach to accelerate nerve regeneration after injury2,12 ) . however
, a high frequency of electrical stimulation may increase failure of nerve regeneration16 ) . hence
, these results can not exclude potential beneficial effects of sacral nerve stimulation in other models of sci with different treatment protocols , the disappointing outcomes in this study were limited by the treatment protocol .
in a rat thoracic spinal cord contusional model , we observed that sacral neuromodulation does not prevent sci - induced myelin loss and cavitation .
further experimental and clinical studies are needed to shed light on the therapeutic potentials of sacral neuromodulation and to determine the most effective protocol of stimulation .
Output:
| objectivethe purpose of this study is to evaluate neuroprotective effect of sacral neuromodulation in rat spinal cord injury ( sci ) model in the histological and functional aspects.methodstwenty-one female sprague dawley rats were randomly divided into 3 groups : the normal control group ( ctl , n=7 ) , the sci with sham stimulation group ( sci , n=7 ) , and the sci with electrical stimulation ( sci+es , n=7 ) .
spinal cord was injured by dropping an impactor from 25 mm height .
sacral nerve electrical stimulation was performed by the following protocol : pulse duration , 0.1 ms ; frequency , 20 hz ; stimulation time , 30 minutes ; and stimulation duration , 4 weeks .
both locomotor function and histological examination were evaluated as scheduled.resultsthe number of anterior horn cell was 12.35.7 cells / high power field ( hpf ) in the ctl group , 7.84.9 cells / hpf in the sci group , and 6.95.5 cells / hpf in the sci+es group , respectively .
both the sci and the sci+es groups showed severe loss of anterior horn cells and myelin fibers compared with the ctl group .
cavitation and demyelinization of the nerve fibers has no significant difference between the sci group and the sci+es group .
cavitation of dorsal column was more evident in only two rats of sci group than the sci+es group .
the locomotor function of all rats improved over time but there was no significant difference at any point in time between the sci and the sci+es group.conclusionin a rat thoracic spinal cord contusion model , we observed that sacral neuromodulation did not prevent sci - induced myelin loss and apoptosis . |
PubmedSumm6849 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: during the past 35 years , health technology assessment ( hta ) has been utilized in industrialized countries such as usa , canada and europe .
a wonderful transformation has occurred in health decision in various countries such as sweden , spain , france , england , and italy .
however hta is a new context in developing countries , and expanding rapidly ( 14 ) .
health sector s decision and policy makers rely on comprehensive scientific evidence in order to make decisions . over the past few decades
, a rising trend has been observed in these countries towards more efficient allocation of healthcare technologies under given budget constraints .
thereby , htas have turned out to be a recognized decision- and prioritization tool ( 5 , 6 ) .
world health organization ( who ) has paid special attention to the hta during the past 2 decades .
utilizing htas is similarly expanding in developing countries , as the hta organizations have been formed in malaysia , philippine , thailand , china , and pakistan .
briefly , most of the countries such as iran , that follow up their health sector reform program , have paid special attention to the topic of hta and to selecting as well as using the proper technology within the framework of political strategic and health sector management ( 7 ) .
the aim of this study was to investigate the administrative process and function of hta office in iran .
the area of iran is 1648195sq - km which makes it the 17 largest country in the world .
iran s gdp at ( ppp ) per capita was 9200 , 9800 and 11700 us$ in 2005 , 2006 , and 2007 respectively ( 8) also life expectancy for both sexes in 2002 , was 68.9 yr ( 9 ) .
rahbar says : the right of all citizens to health care is embodied in the constitution of iran which recognizes the rights of all citizens to health as well as an equitable distribution of health services based on ideology principles . in practice , this has resulted in a strong focus on basic public health financed through the public budget and delivered to all iranians through a public primary health care delivery system run by moh , while secondary- and tertiary- level curative care is financed and sometimes directly provided through the compulsory social security organization ( sso ) for formal sector employees and their dependants , the armed forces medical services organization for members of the military and their dependants , and the medical services insurance organization ( msio ) for government employees , rural households , the self - employed , and < < others > > ( e.g. , student ) ( 10 ) .
the ministry of health ( moh ) is responsible for planning , monitoring , and supervision of health related activities for the public and private sectors in iran .
the president of a medical university is the highest health authority in the province who reports to the minister of health and medical education .
the president of the medical university is in charge of public health , health care provision in public facilities and medical education .
and they mainly focus on secondary and tertiary health care in urban areas ( 8) . the ministry of health has six deputies that are mentioned as follows :
deputy of hygiene , deputy of curative affairs , deputy of education , deputy of research and technology , deputy of development in management and resources deputy of curative affairs , deputy of research and technology , deputy of development in management and resources the hta office is under supervision of technology assessment , standardization and tariffs within the deputy of curative affairs .
hta has been started since october 2007 in health deputy of moh as a secretariat , in health economics group which has been defined in the center of network development and health promotion . following changes in the organizational structure of moh in 2010 , the deputy for health
, hta was categorized as hta office under supervision of health technology assessment , standardization and tariffs office in curative affairs department within the moh .
the objectives of this office , which are planned to be achieved by 2012 , can be listed as follows :
institutionalization of evidence - based decision making in moh.creating an localization for structural hta in health system of iransetting up training courses in order to educate capable manpower to full up the capacity of the universities.establishment of a new field in hta subject in medical universities for phd degree.international communication about hta through national website and possible participation in international congress.creating and settling formal centers to accomplish health technology assessment plans in the medical universities of the country such as knowledge management units ( kmu).building capacity in terms of perusing health technology assessment in medical university of the country through different approaches such as : establishing a hta site for communication to other hta sites.coordinating with welfare ministry for health insurance issues.developing decision making on the basis of evidence in all levels of health management system.planning and ordering the assigned projects of health technology assessment for drugs and medical equipment.attracting collaborations of the related organizations and departments such as iran medical equipment department and so on .
institutionalization of evidence - based decision making in moh . creating an localization for structural hta in health system of iran setting up training courses in order to educate capable manpower to full up the capacity of the universities .
international communication about hta through national website and possible participation in international congress . creating and settling formal centers to accomplish health technology assessment plans in the medical universities of the country such as knowledge management units ( kmu ) .
building capacity in terms of perusing health technology assessment in medical university of the country through different approaches such as : establishing a hta site for communication to other hta sites . coordinating with welfare ministry for health insurance issues . developing decision making on the basis of evidence in all levels of health management system .
planning and ordering the assigned projects of health technology assessment for drugs and medical equipment .
attracting collaborations of the related organizations and departments such as iran medical equipment department and so on . in countries such as canada , england and spain , where health systems are mainly supplied by general section of hta , the governmental institutes or the organizations with preferably governmental budget of hta have been formed , and their main concentration is on the costly technologies . in some countries such as italy and usa where private sectors manage the remarkable part of services and the governmental system does not have scientific and executive management powers in proportion to the volume of service and technologic expenses , academic and independent institutes have been established in order to appraise technologies and to increase budget allocated to effectiveness services . in iran ,
expenses of performing hta projects are supplied by the governmental budget ( from the budget of department of medical equipments ) .
prioritizing the purposes of the appraisal : in order to decide on projects that have to be selected , we need to take into consideration seven following specifications : incidence of diseases fluctuation rates in healthcare administration applicability of results ordering projects to researchers , this has been done by national institute for health research ( nihr ) since april 2010 . before this time
now , 12 hta projects on medical equipment and over 8 pharmaceutical medicines are performed in hta office ( table 1 ) . submitting the results to the ministers and politicians in order to make the final decision .
3 ) equalizing the criteria for performing health technology assessment among conductors of health technology appraisal projects in various research centers ( 11 ) .
4 ) setting up training courses in order to educate capable manpower to full up the capacity of the universities .
5 ) establishment of a new field in hta subject in medical universities for msc degree .
this committee is formed by professors of medical universities of the country who are specialists in the field of hta .
the task of quality appraisal of hta final reports are commissioned to this committee and the scientific review of result is also commissioned to the technical advisory committee that is the subcommittee .
7 ) prioritizing the assigned projects . 8) placing orders of the prioritized projects to research centers .
11 ) studying the situation of health technology assessment in the world countries . 13 ) collecting and submitting proposals regarding the structure of health technology assessment secretariat to the honored minister .
14 ) coordinating with general department of medical equipment regarding the nonexistence of the necessary authority for importing medical equipments of new capital to the country without performing health technology assessment .
15 ) create a formal structure for hta in deputy of curative affaire within moh .
16 ) participation in singapore international technology assessment conference and workshop 17 ) participation in brazil international technology assessment conference in 2010 .
the area of iran is 1648195sq - km which makes it the 17 largest country in the world .
iran s gdp at ( ppp ) per capita was 9200 , 9800 and 11700 us$ in 2005 , 2006 , and 2007 respectively ( 8) also life expectancy for both sexes in 2002 , was 68.9 yr ( 9 ) .
rahbar says : the right of all citizens to health care is embodied in the constitution of iran which recognizes the rights of all citizens to health as well as an equitable distribution of health services based on ideology principles . in practice , this has resulted in a strong focus on basic public health financed through the public budget and delivered to all iranians through a public primary health care delivery system run by moh , while secondary- and tertiary- level curative care is financed and sometimes directly provided through the compulsory social security organization ( sso ) for formal sector employees and their dependants , the armed forces medical services organization for members of the military and their dependants , and the medical services insurance organization ( msio ) for government employees , rural households , the self - employed , and < < others > > ( e.g. , student ) ( 10 ) .
the ministry of health ( moh ) is responsible for planning , monitoring , and supervision of health related activities for the public and private sectors in iran .
the president of a medical university is the highest health authority in the province who reports to the minister of health and medical education .
the president of the medical university is in charge of public health , health care provision in public facilities and medical education .
they mainly focus on secondary and tertiary health care in urban areas ( 8) . the ministry of health has six deputies that are mentioned as follows :
deputy of hygiene , deputy of curative affairs , deputy of education , deputy of research and technology , deputy of development in management and resources deputy of curative affairs , deputy of research and technology , deputy of development in management and resources the hta office is under supervision of technology assessment , standardization and tariffs within the deputy of curative affairs .
hta has been started since october 2007 in health deputy of moh as a secretariat , in health economics group which has been defined in the center of network development and health promotion . following changes in the organizational structure of moh in 2010 , the deputy for health
after this restructuring , hta was categorized as hta office under supervision of health technology assessment , standardization and tariffs office in curative affairs department within the moh .
the objectives of this office , which are planned to be achieved by 2012 , can be listed as follows :
institutionalization of evidence - based decision making in moh.creating an localization for structural hta in health system of iransetting up training courses in order to educate capable manpower to full up the capacity of the universities.establishment of a new field in hta subject in medical universities for phd degree.international communication about hta through national website and possible participation in international congress.creating and settling formal centers to accomplish health technology assessment plans in the medical universities of the country such as knowledge management units ( kmu).building capacity in terms of perusing health technology assessment in medical university of the country through different approaches such as : establishing a hta site for communication to other hta sites.coordinating with welfare ministry for health insurance issues.developing decision making on the basis of evidence in all levels of health management system.planning and ordering the assigned projects of health technology assessment for drugs and medical equipment.attracting collaborations of the related organizations and departments such as iran medical equipment department and so on .
institutionalization of evidence - based decision making in moh . creating an localization for structural hta in health system of iran setting up training courses in order to educate capable manpower to full up the capacity of the universities .
international communication about hta through national website and possible participation in international congress . creating and settling formal centers to accomplish health technology assessment plans in the medical universities of the country such as knowledge management units ( kmu ) .
building capacity in terms of perusing health technology assessment in medical university of the country through different approaches such as : establishing a hta site for communication to other hta sites . coordinating with welfare ministry for health insurance issues . developing decision making on the basis of evidence in all levels of health management system .
planning and ordering the assigned projects of health technology assessment for drugs and medical equipment . attracting collaborations of the related organizations and departments such as iran medical equipment department and so on .
in countries such as canada , england and spain , where health systems are mainly supplied by general section of hta , the governmental institutes or the organizations with preferably governmental budget of hta have been formed , and their main concentration is on the costly technologies . in some countries such as italy and usa where private sectors manage the remarkable part of services and the governmental system does not have scientific and executive management powers in proportion to the volume of service and technologic expenses , academic and independent institutes have been established in order to appraise technologies and to increase budget allocated to effectiveness services . in iran ,
expenses of performing hta projects are supplied by the governmental budget ( from the budget of department of medical equipments ) .
prioritizing the purposes of the appraisal : in order to decide on projects that have to be selected , we need to take into consideration seven following specifications : incidence of diseases fluctuation rates in healthcare administration applicability of results ordering projects to researchers , this has been done by national institute for health research ( nihr ) since april 2010 . before this time , hta secretariat took on this responsibility .
now , 12 hta projects on medical equipment and over 8 pharmaceutical medicines are performed in hta office ( table 1 ) . submitting the results to the ministers and politicians in order to make the final decision .
3 ) equalizing the criteria for performing health technology assessment among conductors of health technology appraisal projects in various research centers ( 11 ) .
4 ) setting up training courses in order to educate capable manpower to full up the capacity of the universities .
5 ) establishment of a new field in hta subject in medical universities for msc degree .
this committee is formed by professors of medical universities of the country who are specialists in the field of hta .
the task of quality appraisal of hta final reports are commissioned to this committee and the scientific review of result is also commissioned to the technical advisory committee that is the subcommittee .
7 ) prioritizing the assigned projects . 8) placing orders of the prioritized projects to research centers .
13 ) collecting and submitting proposals regarding the structure of health technology assessment secretariat to the honored minister . 14 ) coordinating with general department of medical equipment regarding the nonexistence of the necessary authority for importing medical equipments of new capital to the country without performing health technology assessment . 14 )
. 16 ) participation in singapore international technology assessment conference and workshop 17 ) participation in brazil international technology assessment conference in 2010 .
3 ) equalizing the criteria for performing health technology assessment among conductors of health technology appraisal projects in various research centers ( 11 ) .
4 ) setting up training courses in order to educate capable manpower to full up the capacity of the universities .
5 ) establishment of a new field in hta subject in medical universities for msc degree .
this committee is formed by professors of medical universities of the country who are specialists in the field of hta .
the task of quality appraisal of hta final reports are commissioned to this committee and the scientific review of result is also commissioned to the technical advisory committee that is the subcommittee .
7 ) prioritizing the assigned projects . 8) placing orders of the prioritized projects to research centers .
13 ) collecting and submitting proposals regarding the structure of health technology assessment secretariat to the honored minister .
14 ) coordinating with general department of medical equipment regarding the nonexistence of the necessary authority for importing medical equipments of new capital to the country without performing health technology assessment .
15 ) create a formal structure for hta in deputy of curative affaire within moh .
16 ) participation in singapore international technology assessment conference and workshop 17 ) participation in brazil international technology assessment conference in 2010 .
since evidence based on decision making including hta provides minimum adverse impacts on the system , policy makers should strongly support this field .
so far , deputy of curative affairs at moh made its decision on the necessity of these assessments and results of these projects has informed decision makers at moh which helped establishing of hta for all of decision makers and health politicians .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .
Output:
| background : to provide an overview of the development of health technology assessment ( hta ) in iran since 2007 , and to facilitate further development of hta and its integration into policy making.methods:data of this study were collected through key documents ( e.g. literature , laws , and other official documentation ) and analyzed by experts of opinion in form of qualitative methods.results:health technology assessment entered to the political agenda in iran only in 2007 with a strong impetus of an evidence - based medicine movement with the bellow objectives : institutionalization of evidence - based decision making in ministry of health , creating an localization for structural hta in health system of iran , setting up training courses in order to educate capable manpower to full up the capacity of the universities , establishment of a new field in hta subject in medical universities for msc and phd degree , international communication about hta through national website and possible participation in international congress.conclusion:hta has been established in the healthcare system of iran but what is needed is a clear political will to push forward the objectives of hta in iran . similar to other countries , advance the regulation on the adoption of new health technologies to improve not only technical or allocate efficiency , but also health equity . |
PubmedSumm6850 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: stress is a normal physical response to events that make a person feel threatened or upset their balance in some way . when danger is sensed whether it s real or imagined the body s defenses kick into high gear in a rapid , automatic process known as the fight - or - flight reaction , or the stress response .
as anyone who has faced a work deadline or competed in a sport can attest , stress mobilizes the body to respond , thereby improving performance . yet too much stress or chronic stress
the global burden of disease study predicted major depression to become the second leading cause of disability by 2020 .
lifetime prevalence was estimated to be approximately 17% in the united states , with similar rates being reported on the european level.1 major depressive disorders ( mdd ) displays a variety of psychopathological symptoms and diverse clinical manifestations , with depressed mood and/or a loss of interest or pleasure , as core symptoms .
additional symptoms encompass changes to weight , appetite , sleep , psychomotor , as well as thinking disturbances that include excessive worrying , guilt , and possibly suicidal ideation.2 modulating the brain s reward and motivation circuits , governed primarily by dopamine ( a monoamine neurotransmitter ) , has therefore become one of the most attractive targets for treating depressive disorders.3 the neurotransmitter dopamine was first identified as a potential neurotransmitter in the brain in the late 1950s by carlsson.4 dopamine plays a key role in the regulation of various physiological functions of a normal brain , including reward , locomotion , behavior , learning , and emotion .
one is located in the arcuate nucleus of the hypothalamic median eminence and is involved in neuroendocrine regulation .
the other is located in the ventral mesencephalon and projects to the forebrain.5 dopamine exerts its effects on neurons through five known subtypes of dopamine receptors , which are grouped into two classes d1-like ( d1 , d5 ) and d2-like ( d2 , d3 , d4 ) .
all five subtypes of dopamine receptors ( d1r - d5r ) belonging to the g - protein coupled receptor ( gpcr ) superfamily have been cloned , through which dopamine transduces its various effects .
d1 receptors couple to the adenylate cyclase stimulatory g protein gs and increase camp levels , thereby activating a camp - dependent protein kinase ( pka ) .
this enzyme transfers a phosphate group from adenosine triphosphate to several specific protein substrates , modifying their properties in many ways .
d2 receptors on the other hand are coupled to heterotrimeric g proteins gi / o , which decrease camp levels and alter the permeability of different ion channels .
while d1 and d2 receptors have opposite effects at the molecular level , they often have a synergistic action.5 neurons in the midbrain project their axons to the striatum and release dopamine , which modulates camp production by activating d1 and d2 receptors expressed by striatal neurons .
striatal neurons also receive input from neurons located the cortex that release the excitatory neurotransmitter glutamate .
this results in stimulation of ampa ( 2-amino-3-(3-hydroxy-5-methyl - isoxazol-4-yl ) propanoic acid ) and nmda ( n - methyl - d - aspartic acid or n - methyl - d - aspartate ) ligand - gated ion channels and increases the intracellular concentration of ca , leading to activation of signaling pathways dependent upon this second messenger . among the downstream effectors of camp and ca are darpp-32 ( a dopamine- and camp - regulated phosphoprotein with a molecular mass of 32 kda ) and rcs ( a regulator of calmodulin signaling ) , both of which integrate signals from both of these second messengers.6 although there exist numerous hints toward a neurobiological understanding of depression,7 the epigenetic perspective may add new insights into the gene - environment interaction ( g e ) , findings that were shown to be applicable to depression .
caspi et al8 were the first to suggest that it might be applicable to depression .
they showed that childhood maltreatment and later stressful life events predicted the onset of depressive symptoms only in genetically predisposed individuals with a short ( s ) allele of the serotonin transporter promoter polymorphism ( 5-httlpr ) , while the long allele carriers were more resilient to depression after adverse life events .
moreover , incidences of childhood maltreatment were found to be predictive for adult depression only among short allele carriers .
in 1942 , ch waddington was the first to describe epigenetics when genetics was still flourishing .
waddington referred to epigenetics as an amalgam of genetics and epigenesis , related epigenetics to embryonic development , and put forward the idea that the epigenetics is not entirely due to the program encoded in dna , but also depends on environmental influences.9 literally the prefix epi means over or above ; therfore , epigenetics is the science of control above genetics .
it refers to a variety of processes that affect gene expression independent of actual dna sequence .
epigenetic information provides instruction on how , where , and when genetic information will be used .
besides the sequence of nucleobases in the genome , gene expression in different types of cells and tissues is modulated by two major mechanisms that are currently crucial for the understanding of epigenetics in psychiatric disorders .
, methyl groups are added to the dna , which normally takes place at the cytosine bases.10 methylation is involved in both initiation of transcription and silencing of genes , depending on the type of methylation and the gene that is methylated.10 repression caused by dna methylation can happen directly or elaborately .
the direct way is when the methyl groups inhibit the transcription factors from binding to the promoter region .
the elaborate way represses dna expression with the use of other chromatin modifying factors , which bind to methylated cpgs.11 the methylation of promoter cytosines in repetitive dinucleotide sequences of cytosines and guanines ( cpg ) allows further methyl - cpg binding proteins , like methyl cpg - binding protein 2 ( mecp2 ) , to bind and repress expression of the gene.12 the second mechanism is histone modifications .
typically , a nucleosome is composed of two copies of each of the four core histones , h2a , h2b , h3 and h4 , with 146 base pairs of dna wrapped around to form an octamer .
histone modifications are changes in the properties of the histones , such as charge , shape13 and size.14 the state of the chromatin is by and large controlled by covalent modifications of histone tails .
the major modifications are acetylation , phosphorylation , methylation and ubiquitylation,15 which affect the net charge , shape or other properties of the histones.13 histone acetylation involves the attachment of an acetyl group from acetyl - coa to the -amino group of the specific lysine ( k ) side chains15 and is carried out by the enzyme histone acetyltransferase ( hat).16 the reverse , deacetylation , catalyzed by histone deacetylases ( hdac),16 removes the acetyl groups .
another form of histone modification is phosphorylation , which influences processes such as transcription , dna repair , apoptosis and chromatin condensation.17 histone methylation is catalyzed by the histone methyltransferases ( hmts ) , which transfer a methyl group from the methyl donor s - adenosyl - l - methionine ( sam ) to the residues .
depending on the residue getting methylated , histone methylation can either enhance or repress transcriptional expression .
there are also other types of epigenetic mechanisms , including rna - based mechanisms and polycomb proteinmediated chromatin remodeling.5,18 however , these are yet to be characterized in the brain and are thus of less relevance to this review .
although the cause of depression is multifaceted , it is generally agreed upon that psychological stress leads to depression by influencing the metabolism of the monoamine neurotransmitter system .
the monoamine hypothesis , describing deficiency or imbalance of the monoamine systems as a cause , has been a central topic of research.1921 this hypothesis was generated and supported by the fact that most antidepressants share the property of acutely modifying the serotonin or noradrenaline levels at the synapse.2225 however , treatment with 5-ht / ne reuptake inhibitors or monoamaine oxidase inhibitors elicited poor therapeutic effects on more than 30% of depressed patients with a number of residual symptoms associated with dopaminergic malfunction , including loss of motivation , attention , and pleasure .
thus , a dopaminergic dysfunction subtype of depression was proposed clinically and it was suggested that the dopaminergic system might play a crucial role in the pathogenesis of depression ; however , the exact molecular mechanism remains unclear.26 the prostate apoptosis response-4 ( par-4 ) protein is expressed in striatal neurons along with drd2 and interacts with drd2 in neural cells .
interestingly , an autopsy study of patients with major depression revealed a 67% decrease in par-4 expression in postmortem temporal cortex ; knockout of par-4 gene led to depression - like behavior in mice.26 in the issue of cell ( volume 122 , issue 2 ) , park et al27 and beaulieu et al28 reveal interactions of d2 receptors with two new and unexpected signaling pathway components . in their study , park and colleagues
demonstrate that the proapoptotic protein par-4 ( prostate apoptosis response 4 ) interacts with the third intracellular loop of the long isoform of human d2 receptor ( d2i3 ) .
furthermore , this interaction , which involves the leucine zipper domain of par-4 , is essential for gi / o mediated inhibition of camp activity .
the region of the d2 receptor that interacts with par-4 contains a calmodulin binding domain and ca - activated calmodulin competes with par-4 for this site .
this discovery is important , as the authors demonstrate that gi / o - dependent d2 regulation of gene expression dictated by the transcription factor creb depends on equilibrium between binding of par-4 and binding of calmodulin to the d2 receptor .
increases in the intracellular ca concentration , possibly in response to activation of the d2 receptor , could result in displacement of par-4 and uncoupling of the d2 receptor from gi / o , thereby providing negative feedback on d2 mediated camp attenuation .
it has been reported previously that calmodulin binding to d2i3 negatively regulates d2dr by interfering with the coupling of the gi - protein in a non - competitive manner.29 maternal deprivation or chronic mild stress increases the level of ca influx in striatum of mouse model.26 increased concentration of ca interferes with the interaction of par-4 with d2i3 , indicating displacement of par-4 from d2i3 .
thus , an equilibrium shift from the par-4/d2dr interaction to the calmodulin / d2dr interaction by augmented ca concentrations results in a downregulation of d2dr efficacy .
this in turn relieves the inhibitory tone on dopamine - mediated camp signaling.30 on the other hand , disruption of the par-4/d2dr interaction may facilitate calmodulin / d2dr complex formation upon ca and hence an upregulation of dopamine - camp - creb ( camp - responsive element binding protein ) signaling .
camp - responsive element binding protein ( creb ) is a downstream transcription factor whose activity is regulated by the camp - pka signaling pathway .
creb associate with the histone acetyltransferase ( hat ) creb - binding protein ( cbp ) .
cbp , in turn , acetylates nearby histones and thereby promotes transcriptional activation ( epigenetical modification ) .
thus , this signaling pathway may serve as a critical point for increased dopamine concentration , which may in turn contribute to the increased intensity of depression - like behaviors in the multiple behavioral paradigms tested in patients with depression.31
although there is much work to do , epigenetics and the epigenome deserve consideration for investigation to analyze the linkages between chronic stress and onset of depression .
epigenetics may have the potential to understand the underlying molecular processes of g e , with both hopeful benefits for future personalized diagnostics and therapies for depression and other psychiatric disorders . in this review we tried to present maternal separation and chronic stress effects on epigenetics and dopamine signaling , in the case of depression .
while we do not claim that other neurotransmitters or signaling mechanisms are not involved on the onset of depression , calmodulin - mediated downregulation of d2 receptor efficacy is relatively specific.29 work is now needed to investigate other brain regions that have been implicated in depression and its treatment .
additionally , there is a need to investigate the involvement of other genes in mediating the long - term effects of stress .
understanding the mechanisms by which such changes are brought about would not only advance our knowledge of the basic neurobiology of this illness , but might also provide new therapeutic avenues for depression .
Output:
| because of the complex causal factors leading to depression , epigenetics is of considerable interest for the understanding effect of stress in depression .
dopamine is a key neurotransmitter important in many physiological functions , including motor control , mood , and the reward pathway .
these factors lead many drugs to target dopamine receptors in treating depressive disorders . in this review ,
we try to portray how chronic stress as an epigenetic factor changes the gene regulation pattern by interrupting dopamine signaling mechanism . |
PubmedSumm6851 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: more than a billion people around the world are overweight , and approximately 300 million are obese.1 obesity is considered an important independent risk factor for the development of cardiovascular disease ( cvd)24 and mortality.5 several pathophysiological mechanisms may explain the strong association between obesity and the risk of developing cvd , including autonomic dysfunction , which , due to a reduced cardiac vagal tone ( cvt),6 can alone be an important risk factor for cvd7 , 8 and mortality.9 studies have shown that obesity , evaluated by simple indicators such as body mass index ( bmi ) ( weight / height2 ) , fat regional indicators or total body fat ( i.e. , waist circumference and sum of skinfolds , respectively ) , is associated with a reduced cvt.1014 for example , freeman et al .
a study of obese subjects by chen et al.13 demonstrated a better association between cvt and indicators of central obesity ( i.e. , waist circumference ) as compared to total indicators of obesity , such as bmi . in theory , it is possible that some degree of cvt reduction can anticipate the appearance of clinical signs and symptoms of certain diseases .
as such , cvt may function as a pre - clinical sign that can be potentially useful for clinical decision making .
although current evidence supports the hypothesis that cvt varies inversely with indicators of obesity,15 , 16 an analysis of cvt in healthy adult men who are not obese but are within the upper limits of normality for some selected and unfavorable anthropometric characteristics ( uac ) , such as being overweight , having an increased waist circumference and presenting a predominantly endomorphic somatotype , has not yet been carried out .
therefore , our aim was to determine if there are differences in cvt values in non - obese healthy , adult men ( bmi < 30 kg / m ) with and without uac and to relate cvt to select anthropometric measurements .
data from 1688 consecutive detailed medical - functional evaluations between 2004 and 2008 were reviewed , and 118 evaluations were found to meet all of the following inclusion criteria : a ) male gender ; b ) aged 20 to 77-years - old ; c ) healthy ( absence of known clinical relevant diseases and no regular use of medications , except for vitamins ; d ) bmi < 30 kg / m ; and e ) having completed a truly maximal cardiopulmonary exercise test .
evaluation of the subjects included clinical examination , anthropometric assessment ( body height and weight , sum of six skinfolds , waist circumference and somatotype ) , 4-second exercise test ( 4set)17 ( for cvt estimation ) and a maximal cardiopulmonary exercise test ( cpet).18 all procedures were carried out by the same physician .
evaluations were performed at the request of the individuals , most commonly by referral from their primary care physicians .
these apparently healthy individuals seek our advice , in most cases , to assess their current physical condition and to get subsides in order to increase regular exercise and/or in adopting a healthier lifestyle .
these individuals have a high possibility of being truly healthy , not only due to the absence of known diseases as assessed by their physicians but also by denying regular use of relevant medications .
furthermore , no pathological findings were detected after a detailed clinical evaluation , which included a maximal cpet , which was performed to exclude myocardial ischemia and to identify appropriate heart rate target zones for aerobic exercise prescription . before the procedures , all subjects read and signed a specific informed consent form previously approved by the institutional research committee .
body weight was measured with an electronic scale to the nearest 0.01 kg , and height was measured to the nearest 0.1 cm using a fixed stadiometer .
we obtained skinfolds measurements at six body sites ( triceps , subscapular , suprailiac , abdomen , thigh and medial calf ) by a caliper ( skyndex ii , usa ) read to the nearest 0.1 mm .
circumference measurements , to the nearest 0.1 cm , of waist , calf , relaxed and the flexed / contracted right arm , were taken with a metallic and flexible tape ( gullick , usa ) .
humeral and femoral bone diameters were obtained by using an adapted sliding caliper ( mitutoyo , japan ) and were measured to the nearest 0.01 mm . as previously stated , all anthropometric measurements were obtained by a single and experienced physician following isak standards.19 the total anthropometric characteristics were evaluated in three ways .
the bmi was obtained from the ratio of body mass ( kg ) to squared height ( m ) .
total fat was estimated by adding the values of six skinfolds from the triceps , subscapular , suprailiac , abdomen , thigh and the medial calf sites in mm .
we determine the heath - carter somatotype anthropometric method20,21 allowing a more comprehensive body composition analysis by the evaluation of three components : a ) the endomorphy , which represents relative fat , b ) the mesomorphy , which represents relative skeletal and muscular development and c ) the ectomorphy , which reflects the relative linearity = [ 2.42 ( ( height ( cm)/2.54)/(weight ( kg)/0.4536)1/3 ) 28.58].22 regional ac was evaluated by two approaches : a ) peripheral central index ( pci ) , obtained from the ratio of the sum of central and peripheral skinfolds , where the central sum is obtained by adding abdominal , suprailiac and subscapular skinfold values , while the peripheral sum is achieved by adding triceps , thigh and medial calf skinfold values ; and b ) waist circumference , measured at the umbilical scar level and parallel to the floor . for the purpose of our study , the results at upper extreme ( lower extreme for ectomorphy ) of distribution for each one of anthropometric characteristics above described were labeled as uac .
further details are provided under statistical analysis subsection . to assess the cvt , the rapid initial heart rate transient ( i.e. , rest - exercise transition ) , represented by the cardiac vagal index ( cvi ) ,
briefly , the 4set consists in unloaded pedaling as fast as possible on a cycle ergometer from the 5 to the 8 second of a 12-s maximal inspiratory apnea . for testing ,
the subject remains seated on the cycle ergometer and , after the heart rate ( hr ) stabilizes , four verbal commands guide the actions that are to be sequentially performed , at 4-s intervals , as follows : 1 ) fast maximal inspiration , primarily through the mouth ; 2 ) pedaling as fast as possible ; 3 ) sudden cessation of pedaling ; and 4 ) expiration . during the 4set ,
the cvi was calculated from the ratio between two ecg specific r - r intervals ( with 10-ms resolution ) were identified and measured : the longest r - r interval ( rrb ) ( i.e. either the interval obtained immediately before the onset of exercise or the first one after the onset of exercise ) and the shortest r - r interval ( rrc ) during the 4-s exercise ( generally , the last one ) .
the cvi was calculated from the ratio between the rrb and rrc interval.17,18 two 4set maneuvers were performed and the highest ratio between the rrb and rrc intervals which are representative of the cvi , a dimensionless measurement , used for further analysis . following the 4set , a cpet was performed - leg cycle ergometer in 96% of the tests - with direct collection and analysis of expired gases ( vo2000 , medgraphics , usa ) according to an individualized ramp protocol , aimed to last between 8 and 12 minutes.23 , 24 the subjects were verbally encouraged to exercise until they reached volitional fatigue ( i.e. , exhaustion ) , regardless of the maximal heart rate achieved or any other ventilatory criteria .
one lead ecg ( cc5 or cm5 ) was continuously monitored from rest until at least 5 min post - exercise.18 , 25 auscultatory blood pressure measurements were also obtained at each minute during exercise and recovery .
, the samples were divided into quintiles for acs , as follows : a ) bmi ; b ) total sum of six skinfolds ; c ) pci ; d ) waist circumference ; and e ) somatotype components ( endomorph , mesomorph and ectomorph ) .
after that , paired one - tailed t - tests were used to compare the extreme quintiles lower and higher uac values . in the second approach ,
the association between each one of the acs and the cvi was determined by pearson product - moment correlation .
additionally , a one - way anova was carried out for comparing age of subjects of the five quintiles for each one of the acs analyzed .
all calculations were performed using spss software ( version 17 , spss , chicago ) .
body weight was measured with an electronic scale to the nearest 0.01 kg , and height was measured to the nearest 0.1 cm using a fixed stadiometer .
we obtained skinfolds measurements at six body sites ( triceps , subscapular , suprailiac , abdomen , thigh and medial calf ) by a caliper ( skyndex ii , usa ) read to the nearest 0.1 mm .
circumference measurements , to the nearest 0.1 cm , of waist , calf , relaxed and the flexed / contracted right arm , were taken with a metallic and flexible tape ( gullick , usa ) .
humeral and femoral bone diameters were obtained by using an adapted sliding caliper ( mitutoyo , japan ) and were measured to the nearest 0.01 mm . as previously stated , all anthropometric measurements were obtained by a single and experienced physician following isak standards.19
the bmi was obtained from the ratio of body mass ( kg ) to squared height ( m ) .
total fat was estimated by adding the values of six skinfolds from the triceps , subscapular , suprailiac , abdomen , thigh and the medial calf sites in mm .
we determine the heath - carter somatotype anthropometric method20,21 allowing a more comprehensive body composition analysis by the evaluation of three components : a ) the endomorphy , which represents relative fat , b ) the mesomorphy , which represents relative skeletal and muscular development and c ) the ectomorphy , which reflects the relative linearity = [ 2.42 ( ( height ( cm)/2.54)/(weight ( kg)/0.4536)1/3 ) 28.58].22 regional ac was evaluated by two approaches : a ) peripheral central index ( pci ) , obtained from the ratio of the sum of central and peripheral skinfolds , where the central sum is obtained by adding abdominal , suprailiac and subscapular skinfold values , while the peripheral sum is achieved by adding triceps , thigh and medial calf skinfold values ; and b ) waist circumference , measured at the umbilical scar level and parallel to the floor . for the purpose of our study , the results at upper extreme ( lower extreme for ectomorphy ) of distribution for each one of anthropometric characteristics above described were labeled as uac .
the bmi was obtained from the ratio of body mass ( kg ) to squared height ( m ) .
total fat was estimated by adding the values of six skinfolds from the triceps , subscapular , suprailiac , abdomen , thigh and the medial calf sites in mm .
we determine the heath - carter somatotype anthropometric method20,21 allowing a more comprehensive body composition analysis by the evaluation of three components : a ) the endomorphy , which represents relative fat , b ) the mesomorphy , which represents relative skeletal and muscular development and c ) the ectomorphy , which reflects the relative linearity = [ 2.42 ( ( height ( cm)/2.54)/(weight ( kg)/0.4536)1/3 ) 28.58].22
regional ac was evaluated by two approaches : a ) peripheral central index ( pci ) , obtained from the ratio of the sum of central and peripheral skinfolds , where the central sum is obtained by adding abdominal , suprailiac and subscapular skinfold values , while the peripheral sum is achieved by adding triceps , thigh and medial calf skinfold values ; and b ) waist circumference , measured at the umbilical scar level and parallel to the floor .
for the purpose of our study , the results at upper extreme ( lower extreme for ectomorphy ) of distribution for each one of anthropometric characteristics above described were labeled as uac .
to assess the cvt , the rapid initial heart rate transient ( i.e. , rest - exercise transition ) , represented by the cardiac vagal index ( cvi ) , was determined by the 4set protocol .
briefly , the 4set consists in unloaded pedaling as fast as possible on a cycle ergometer from the 5 to the 8 second of a 12-s maximal inspiratory apnea . for testing
, the subject remains seated on the cycle ergometer and , after the heart rate ( hr ) stabilizes , four verbal commands guide the actions that are to be sequentially performed , at 4-s intervals , as follows : 1 ) fast maximal inspiration , primarily through the mouth ; 2 ) pedaling as fast as possible ; 3 ) sudden cessation of pedaling ; and 4 ) expiration . during the 4set ,
the cvi was calculated from the ratio between two ecg specific r - r intervals ( with 10-ms resolution ) were identified and measured : the longest r - r interval ( rrb ) ( i.e. either the interval obtained immediately before the onset of exercise or the first one after the onset of exercise ) and the shortest r - r interval ( rrc ) during the 4-s exercise ( generally , the last one ) .
the cvi was calculated from the ratio between the rrb and rrc interval.17,18 two 4set maneuvers were performed and the highest ratio between the rrb and rrc intervals which are representative of the cvi , a dimensionless measurement , used for further analysis .
following the 4set , a cpet was performed - leg cycle ergometer in 96% of the tests - with direct collection and analysis of expired gases ( vo2000 , medgraphics , usa ) according to an individualized ramp protocol , aimed to last between 8 and 12 minutes.23 , 24 the subjects were verbally encouraged to exercise until they reached volitional fatigue ( i.e. , exhaustion ) , regardless of the maximal heart rate achieved or any other ventilatory criteria .
one lead ecg ( cc5 or cm5 ) was continuously monitored from rest until at least 5 min post - exercise.18 , 25 auscultatory blood pressure measurements were also obtained at each minute during exercise and recovery .
, the samples were divided into quintiles for acs , as follows : a ) bmi ; b ) total sum of six skinfolds ; c ) pci ; d ) waist circumference ; and e ) somatotype components ( endomorph , mesomorph and ectomorph ) .
after that , paired one - tailed t - tests were used to compare the extreme quintiles lower and higher uac values . in the second approach ,
the association between each one of the acs and the cvi was determined by pearson product - moment correlation .
additionally , a one - way anova was carried out for comparing age of subjects of the five quintiles for each one of the acs analyzed .
all calculations were performed using spss software ( version 17 , spss , chicago ) .
demographic descriptive statistical data are presented in table 1 and physiological testing data are shown in table 2 .
table 3 displays the quintile cut - off values for each one of the selected ac .
no significant differences were found for age among the quintiles for all acs variables assessed . with respect to the regional ac ,
waist circumference showed a trend similar to the total body fat indicators described above , with the first quintile of individuals showing higher cvt values as compared to those in the fifth quintile ( 1.77 vs. 1.46 , p<0.001 ) ( figure 2 ) . on the other hand ,
no differences were observed in the cvt concerning the pci of extreme quintiles ( 1.58 vs. 1.53 , p=0.284 ) . moving to somatotype analysis , cvt differences were found for the individuals in the extreme quintiles for the endomorphy ( 1.77 vs. 1.56 , p=0.023 ) , with the more endomorphic individuals showing lower cvi values .
the more linear individuals , as represented by the fifth quintile of ectomorphy showed greater cvi values as compared with those with a more rounded body shape ( 1.78 vs. 1.55 , p=0.013 ) . on the other hand , evaluation of the cvt for the mesomorphy , failed to show any difference between the extreme quintiles ( 1.60 vs. 1.60 , p=1.000 ) .
, we found that uac results , except for mesomorphy , are related to cvt , represented by the cvi , with correlation coefficients ( table 4 ) ranging , in module , between 0.2 and 0.3 ( p<0.05 ) .
since endomorphy and ectomorphy tend to be inversely related , the r values of these variables with cvt also follow the same pattern .
this study suggested that non - obese and healthy adult men , as considered by not having any relevant clinical diagnosis and not been in regular use of medications , but who already have uac , present a significantly lower cvt when compared with a comparable group of individuals without these characteristics .
however , it is important to emphasize that although these individuals present a reduction in cvt , they are still within the normal range of cvi values ( 1,2 to 1,9 , based on unpublished results based in a sample of more than 1,800 4sets carried out in healthy adults in the last 20 years ) .
age could be a relevant intervenient variable , since most of the studies recognized a significant decrease in cvt with aging7 , however , in this particular study , aging is unlikely to have interfered since there was no difference among the five quintiles for this variable .
a peculiarity of this study is the rigid selection of individuals with a high possibility of being truly healthy , not only due to the absence of known diseases as assessed by their physicians but also by not reporting use of regular medical .
furthermore , no pathological findings were detected after all selected subjects have underwent a detailed clinical evaluation , which included an maximal cpet ( and exercise ecg).25 these findings are additionally supported by the facts that the mean value of the maximum hr during cpet was about 98% of the predicted - 210 minus ( 0.65 x age),26 and a maximum oxygen uptake that was considerably higher than expected for their age ( table 4 ) .
our results show that , using simple measurements for bmi , waist circumference , somatotype and the sum of skinfolds , we were able to prematurely identify healthy men who already tend to have a lower cvt , a clinically potential useful information , since a reduction in the cvt indicates an increased risk for cardiovascular morbidity7 and mortality.6 from a practical point - of - view , a preliminary clinical approach , it would be to consider those subjects in the unfavorable extreme quintile as more prone to have a relatively lower vagal tone and then the ones that most likely will benefit of an intervention , such as lifestyle management ( table 3 ) .
our results are in agreement with other studies that have found a lower cvt in individuals who present criteria for excess of body fat.13,14 some groups have reported that obesity and changes in weight can affect cardiovascular autonomic modulation.1114 , 27 for instance , chen et al.13 found an association between waist circumference and a reduced cvt , while the same was not observed for bmi .
these results may suggest that the fat distribution maybe more important for the reduction of cvt than overall or total body fat .
it is important to note that , in this study , the authors used a sample consisting of two groups of individuals with and without obesity and of both genders . in our study , while the cvi values of extreme quintiles for bmi , waist circumference and the total sum of skinfolds were significantly different , indicating that healthy men that are not obese already present a trend for a lower cvt , the fat distribution appeared to not be so relevant , at least by pci criteria .
indeed , the relationship of the pci with the cvi is probably best represented by an inverted u , with the 1 and 5 quintiles of the pci presenting a lower mean cvi .
the waist circumference , which is considered an important indicator of regional or local obesity and is associated with central fat,2,28 was the ac that presented the slightly higher correlation coefficient with the cvi ( r=0.30 , p=<0.001 ) ( table 3 ) and was also the ac with the greatest difference between the means of extreme quintiles for the cvi ( first - 1.77 vs. fifth - 1.46 , p<0.001 ) .
these results , even in non - obese healthy subjects , are very similar to those obtained in other studies that involved the measurement of waist circumference in individuals with decreased cvi.4,5,13 these results are relevant since abdominal obesity is considered a risk factor for the development of cvd4 , 29 and an anthropometric variable associated with cvd.5,28 this information is very practical in terms of its availability and its simplicity of implementation in the practice of health professionals .
when considering the details of body composition , which include distinguishing between the effects of fat and skeletal muscle on body weight , somatotype analysis may eliminate potential errors caused by the crude use of body weight in relation to height , as is done when determining the bmi.30 this is particularly relevant when we note that increases in mesomorphy ( based on limb girths subtracted from skinfolds , and measurements of bone diameters related to body height ) are not related to cvi .
nevertheless , perhaps by either considering a much less controlled sample in terms of inclusion criteria or due to the use of previous somatotype classification systems such as sheldon rather than heath - cater , these findings did not corroborate previous information available from years 1950 to 1960 gathered in an old review paper.31 our results demonstrate that healthy individuals with a more endomorphic somatotype have a lower cvt , which may suggest a greater predisposition for the development of cvd 31 and for mortality32 and , as found by olson et al.32 , in athletes and non - athletes , have lower life expectancy as compared to individuals with a predominantly mesomorphic and/or ectomorphic somatotype .
a possible limitation of our study was that we did not height - adjust the ac of our subjects . while this issue has been shown to be potentially relevant , according proportionality criteria,33 preliminary analysis applying these procedures were not effective in our sample , most likely because it is a very homogeneous sample with a mean height around 1.76 m. however , it is possible that the correction of proportionality become appropriated when using a less homogeneous sample with a height distribution different from the one used in our study .
for instance , for individuals that substantially differ in body height , there is a trend to also present large differences for other ac ( e.g. waist circumference ) , and then , a height correction should be appropriate .
another limitation is the lack of scientific data in our study that could explain the possible physiopathological mechanisms involved in the reduction in the cvt in non - obese healthy men .
future studies are necessary to confirm whether the lower cvt values observed in healthy men with uac would represent an increased rate of cardiovascular events or , if this trend for a cvt reduction could be reversed with the correction of uac by exercise and/or by a hypocaloric diet . in conclusion ,
as more attention is being dedicated to the prevention and determination of long - term prognosis , the findings of this study contribute by indicate that even in healthy adult men with adequate levels of aerobic condition , it is already possible to identify those with a tendency to present lower cvt values through the use of easily obtained anthropometric measurements . in a preventive scenario , these findings may contribute to the early identification of healthy individuals in need for a greater emphasis and more aggressive regulation of cardiovascular risk factors .
authors were supported by the brazilian national council for scientific and technological development cnpq .
Output:
| objectives : to determine if there are differences in cardiac vagal tone values in non - obese healthy , adult men with and without unfavorable anthropometric characteristics.introduction:it is well established that obesity reduces cardiac vagal tone . however , it remains unknown if decreases in cardiac vagal tone can be observed early in non - obese healthy , adult men presenting unfavorable anthropometric characteristics.methods:among 1688 individuals assessed between 2004 and 2008 , we selected 118 non - obese ( bmi < 30 kg / m2 ) , healthy men ( no known disease conditions or regular use of relevant medications ) , aged between 20 and 77 years old ( 42 12-years - old ) .
their evaluation included clinical examination , anthropometric assessment ( body height and weight , sum of six skinfolds , waist circumference and somatotype ) , a 4-second exercise test to estimate cardiac vagal tone and a maximal cardiopulmonary exercise test to exclude individuals with myocardial ischemia .
the same physician performed all procedures.results:a lower cardiac vagal tone was found for the individuals in the higher quintiles
unfavorable anthropometric characteristics - of bmi ( p=0.005 ) , sum of six skinfolds ( p=0.037 ) and waist circumference ( p<0.001 ) .
in addition , the more endomorphic individuals also presented a lower cardiac vagal tone ( p=0.023 ) , while an ectomorphic build was related to higher cardiac vagal tone values as estimated by the 4-second exercise test ( r=0.23 ; p=0.017).conclusions : non - obese and healthy adult men with unfavorable anthropometric characteristics tend to present lower cardiac vagal tone levels .
early identification of this trend by simple protocols that are non - invasive and risk - free , using select anthropometric characteristics , may be clinically useful in a global strategy to prevent cardiovascular disease . |
PubmedSumm6852 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: different minimally invasive approaches have been described in order to treat ureteropelvic junction obstruction ( upjo ) with several advantages that include reduced postoperative pain 1 , shorter convalescence and minimal disfigurement . among minimally invasive approaches ,
however , reported success rates vary around 15 - 20% lower than those for open pyeloplasty 2 , 3 , and it has also been associated with a higher risk of perioperative hemorrhage 4 . alternatively , laparoscopic pyeloplasty ( lp ) success rate matches that of open pyeloplasty 5 .
moreover , and unlike endourological procedures , the latter is not limited by high insertion , crossing vessels , large redundant pelvis and intrinsic obstruction .
once the benefits of laparoscopic pyeloplasty have been established for upjo treatment 6 , and bearing in mind that it is technically demanding and time consuming , we consider mandatory to develop a validated training program with the aim of mastering the necessary procedural maneuvers . in order to improve endoscopic suturing for laparoscopic pyeloplasty different training protocols
have been developed based on physical simulators , virtual simulators , animal models and cadavers , among others 7 .
we consider that , in an advanced stage of training , and before applying it to human patients , the lp technique should be performed in highly realistic scenarios , superior to the offered possibilities of physical or virtual simulation , for instance on an animal model of ureteral obstruction .
different methods have been described for the creation of upjo animal models 8 - 10 . in this study
we chose an easy to create and reproducible pelvic dilatation method , carried out by the most widely established minimally invasive approach ( laparoscopy ) , and also by a more recent up - to - date
the primary endpoint of this study was to compare different surgical approaches in an attempt to minimize complications and access - related injuries when creating an acute ureteral obstruction in a porcine model for training purposes .
concurrently , experienced urologists assessed the experimental model in terms of utility for laparoscopic pyeloplasty training .
this study protocol was conducted in accordance with the guide for the care and use of laboratory animals and approved by the institutional ethical committee for animal research .
the ureteral obstruction model was developed by placing a hem - o - lok ( teleflex medical , north carolina ) in the proximal third of the left ureter .
the subjects used in this study were randomly divided into groups , depending on the approach used to create the model : laparoscopic conventional surgery ( lap ) or single port ( lsp ) .
both groups were further divided in transperitoneal ( + t ) or retroperitoneal ( + r ) approaches .
perioperative analgesia included an intravenous injection of 1 mg / kg ketorolac and 1.5 mg / kg tramadol early in the surgery .
additionally , 4 mg / kg of carprofen were administered before the effects of anesthesia had passed and during five days after surgery .
postsurgical infection prophylaxis was carried out by injection of enrofloxacin ( 7 mg / kg , i m ) during five days postoperatively .
animals were placed in right lateral recumbency . in the laparoscopic groups ( lap+r and lap+t )
, the operating field was prepared as follows : the first trocar ( 10 mm , laparoscope port ) was placed in the axillary midline with an open technique ; for the transabdominal group , the whole muscular wall was dissected , while for the retroperitoneal group , the peritoneum was maintained intact .
then , the abdominal or retroperitoneal cavity was distended up to a 12 mmhg pressure .
later on , two more trocars were placed under visual control , 5 cm dorsal and 7 - 8 cm apart on both sides of the first trocar .
a 5 mm trocar was placed on the right side and a 10 mm trocar on the left side . in the single port groups ,
the abdominal or retroperitoneal cavity was accessed through a 2.5 - 3 cm incision at the axillary line at the level of the first lumbar vertebrae .
the sils port was correctly inserted once the muscular plane was divided and peritoneum ( retroperitoneal group ) or the abdominal cavity ( transperitoneal group ) was reached . the same surgical method for obstruction of the ureteropelvic junction
the lower pole of the kidney was dissected , and a 2 cm ureteral segment was isolated and clipped with hemo - o - lock. after adequate hemostasis , the retroperitoneal or abdominal cavity space was deflated without drain and the wound was closed in layers . as study parameters we registered serum creatinine and serum urea and operating times .
serum creatinine and serum urea levels were determined both preoperatively and 10 days after model creation . during model creation , the following procedural times were registered : access : from first skin incision to retroperitoneal or abdominal cavity distension . field preparation : from the introduction of the first instruments for the dissection of the ureter .
total surgical time : from first skin incision to last skin suture . in order to assess the degree of abdominal wall injury , an evaluation regarding tenderness to touch and local wound inflammation was performed during the early postoperative period ( 1 - 5 days after the surgery ) by the animal housing veterinary in charge .
all scores were registered on a 5-point scale , with higher scores related to a higher evidence of pain related behaviors .
ten days after surgery , the animals were randomly operated on by 9 urologists with a previous experience of 10 to 30 laparoscopic procedures , attending an advanced laparoscopic course organized at our center .
each urologist randomly operated on four animals , each from one study group , and performed the standard anderson - hynes dismembered pyeloplasty with two running sutures .
the questionnaire consisted of four general questions about its similarity with human ureteropelvic junction obstructions , particularly regarding reproducibility , trocar location , approach and maneuvers developed during surgery .
three additional questions were included for each operated model , regarding fibrosis around the ureter , ureteropelvic junction bleeding when dissected , and ureter adhesions , comparing each case to human patients .
questions were scored on a 1 - 5 scale , with 1 meaning no similarity and 5 reflecting the highest similarity with humans .
data were processed by the spss ( statistical package for the social sciences v.15 chicago ) .
data failed shapiro - wilk normality test , and consequently a kruskal - wallis test was performed to determine the significant differences between groups .
the ureteral obstruction model was developed by placing a hem - o - lok ( teleflex medical , north carolina ) in the proximal third of the left ureter .
the subjects used in this study were randomly divided into groups , depending on the approach used to create the model : laparoscopic conventional surgery ( lap ) or single port ( lsp ) .
both groups were further divided in transperitoneal ( + t ) or retroperitoneal ( + r ) approaches .
perioperative analgesia included an intravenous injection of 1 mg / kg ketorolac and 1.5 mg / kg tramadol early in the surgery .
additionally , 4 mg / kg of carprofen were administered before the effects of anesthesia had passed and during five days after surgery .
postsurgical infection prophylaxis was carried out by injection of enrofloxacin ( 7 mg / kg , i m ) during five days postoperatively . animals were placed in right lateral recumbency . in the laparoscopic groups ( lap+r and lap+t ) , the operating field was prepared as follows : the first trocar ( 10 mm , laparoscope port ) was placed in the axillary midline with an open technique ; for the transabdominal group , the whole muscular wall was dissected , while for the retroperitoneal group , the peritoneum was maintained intact .
then , the abdominal or retroperitoneal cavity was distended up to a 12 mmhg pressure .
later on , two more trocars were placed under visual control , 5 cm dorsal and 7 - 8 cm apart on both sides of the first trocar .
a 5 mm trocar was placed on the right side and a 10 mm trocar on the left side . in the single port groups ,
the abdominal or retroperitoneal cavity was accessed through a 2.5 - 3 cm incision at the axillary line at the level of the first lumbar vertebrae .
the sils port was correctly inserted once the muscular plane was divided and peritoneum ( retroperitoneal group ) or the abdominal cavity ( transperitoneal group ) was reached . the same surgical method for obstruction of the ureteropelvic junction
the lower pole of the kidney was dissected , and a 2 cm ureteral segment was isolated and clipped with hemo - o - lock. after adequate hemostasis , the retroperitoneal or abdominal cavity space was deflated without drain and the wound was closed in layers . as study parameters we registered serum creatinine and serum urea and operating times .
serum creatinine and serum urea levels were determined both preoperatively and 10 days after model creation . during model creation , the following procedural times were registered : access : from first skin incision to retroperitoneal or abdominal cavity distension .
field preparation : from the introduction of the first instruments for the dissection of the ureter .
total surgical time : from first skin incision to last skin suture . in order to assess the degree of abdominal wall injury , an evaluation regarding tenderness to touch and local wound inflammation was performed during the early postoperative period ( 1 - 5 days after the surgery ) by the animal housing veterinary in charge .
all scores were registered on a 5-point scale , with higher scores related to a higher evidence of pain related behaviors .
ten days after surgery , the animals were randomly operated on by 9 urologists with a previous experience of 10 to 30 laparoscopic procedures , attending an advanced laparoscopic course organized at our center .
each urologist randomly operated on four animals , each from one study group , and performed the standard anderson - hynes dismembered pyeloplasty with two running sutures .
the questionnaire consisted of four general questions about its similarity with human ureteropelvic junction obstructions , particularly regarding reproducibility , trocar location , approach and maneuvers developed during surgery .
three additional questions were included for each operated model , regarding fibrosis around the ureter , ureteropelvic junction bleeding when dissected , and ureter adhesions , comparing each case to human patients .
questions were scored on a 1 - 5 scale , with 1 meaning no similarity and 5 reflecting the highest similarity with humans .
data were processed by the spss ( statistical package for the social sciences v.15 chicago ) .
data failed shapiro - wilk normality test , and consequently a kruskal - wallis test was performed to determine the significant differences between groups .
no complications were found in any of the study groups . there were no intraoperative conversions to transabdominal or open surgery .
urea and creatinine plasma levels rose above the physiological level 10 days after ureter obstruction ( urea ( mg / dl ) : 25.44 8.23 vs. 32.62 14.47 , p=0.01 and creatinine ( mg / dl ) : 1.91 0.33 vs. 3.16 1.01 , p=0.001 )
. animals , however , were in good health condition and neither was found apathetic , inappetent nor showed any signs of pain requiring rescue analgesia . regarding abdominal wall injuries ,
inflammation was found to be slightly higher in the retroperitoneal single port group ( lsp+r : 0.73 0.75 , lap+t : 0.68 0.67 , lap+r : 0.67 0.62 , lsp+t : 0.64 0.71 , p=0.882 ) . on the other hand , tenderness to the touch
was significantly greater in both retroperitoneal approaches , with the highest score found in the laparoscopic group ( lsp+r : 0.78 0.63 vs. lap+r : 0.88 0.56 vs. lsp+t : 0.68 0.68 vs. lap+t : 0.49 0.60 , p=0.0001 ) .
total operative time was significantly longer in the lsp+r group ( 48.78 11.23 min , p=0.001 ) , followed by lsp+t ( 32.37 16.00 min ) and laparoscopic groups : lap+t ( 25.33 4.50 min ) and lap+r ( 24.75 8.84 min ) .
the most time - consuming procedural step was wound closure , except in the lsp+r group , in which the access and field preparation took longer than wound closure ( table 1 ) .
the time spent in creating access was similar for laparoscopic and lsp+t groups , and increased significantly for lsp+r group ( p=0.014 ) .
the time needed for incision closure was significantly decreased in the lap+r group , compared to the lsp groups , but not when compared with the lap+t group .
as for the ureteral obstruction training model , attendants assessed it with high scores ( above 4 over 5 ) in all general aspects ( reproducibility : 4.00 0.80 , port placement : 4.00 0.87 , approach : 4.140.85 and surgical maneuvers : 4.43 0.70 ) .
regarding particular aspects , the highest valued approaches in terms of fibrosis , adhesions , and bleeding were lap+t and lsp+r ( table 2 ) .
despite its greater technical difficulty and steep learning curve , laparoscopic pyeloplasty is often performed , and may eventually replace , open pyeloplasty and endourological techniques as the surgery of choice 6 .
although some methods have been described to avoid the need for or reduce the complexity of this procedural step ( mechanical suture 11 , laser welding or surgical adhesives 12 ) , the only effective method to reduce the lp learning curve is to use a robot 13 . however , its application is limited due to its high cost 14 , 15 . in order to master intracorporeal suture and
get the required skills and knowledge , the completion of a steep learning curve is necessary 5 . currently , there is no universal model accepted for training in laparoscopic surgery .
available training programs usually resort to physical and virtual simulators , as well as experimental animal models .
simulators enable basic laparoscopic skills development , such as hand - eye coordination , suturing and knot - tying abilities ; however , they are considered unrealistic , for they can not simulate bleeding or show tissue fibrosis , adhesions , etc .
this is why we agree with stolzenburg et al 16 , who consider that the use of experimental animals , respecting the three r 's ( reduce , refine and replace ) , is essential for training and adequate skills acquisition on advanced laparoscopic techniques prior to its application on human patients the benefits of using animals for advanced urological laparoscopy training have already been stated 17 , especially for radical prostatectomy 18 , 19 , and pyeloplasty 1 . the main objective in this study was to assess different minimally invasive surgical approaches for the development of ureteropelvic junction obstruction animal models , and its subsequent application for anderson - hynes lp training .
previously reported upjo models were used exclusively for research in therapeutic and diagnostic methods . as far as we know
zhang et al
7 reported the use of a healthy porcine animal model for laparoscopic pyeloplasty training by using a small intestine segment to simulate the enlarged renal pelvis . in our opinion , this model is perfect for enhancing intracorporeal suturing skills , whereas it is not as suitable as ours for dissection maneuvers , as it lacks fibrosis , adhesions , etc .
according to the consulted literature , the ureteral obstruction can be performed , among other methods , by ligature 10 , 20 , suture - ligature 12 , or electrical injury 9 .
these methods require an average 6 weeks for the development of the pathology , increasing overall costs of the model creation .
total obstruction of the ureter carried out with the application of an endoclip fully develops in 10 days , reducing the time lapse between model creation and surgical procedure , and consequently indirectly decreasing overall costs .
altogether , time spent to create the obstruction is also increased when intracorporeal suture is used . with this method ,
desai et al 20 reported a total operative time of approximately 60 minutes , which is higher when compared to the 25 minutes needed in our laparoscopic transabdominal group .
furthermore , chiu et al 12 reported an average of 16 minutes for the placement only of the suture - ligature .
although in our study the time spent for clip placement was not recorded , it was under five minutes in all cases .
until recently , laparoscopy and endoscopy were the only standard mis approaches . over the last years ,
new approaches have emerged , such as single port surgery and notes ( natural orifice transluminal endoscopic surgery ) .
these approaches have been developed in an attempt to reduce incision related complications , including hernia 21 , hemorrhage 22 , pain , and scaring .
although the only published reports rely on short term results , it seems that they provide comparable therapeutic outcomes 23 , lower morbidity , better aesthetic results , and reduced postoperative pain when compared with conventional laparoscopic surgery 24 . in order to assess which mis approach
is best , parameters registered in our study were all related to patient benefits : postoperative pain , intraoperative and postoperative complications , and total operation time . no complications were found in any of the groups .
retroperitoneal route has been proved to offer anesthetic advantages requiring a less marked trendelenburg position in lrp 25 , faster access to the ureteropelvic junction 26 and easier identification of the aberrant vessels 27 . on the other hand ,
problems derived from the retroperitoneal access are the same as the advantages of the transperitoneal approach : better operating field with improved organ vision and wider working space , which usually leads to improved operating times .
considering the latter , among retroperitoneal groups , lsp+r group had increased total surgical time as it took longer to establish access and carry out field preparation , compared with the rest of the groups .
we believe this difference in access times derives from the extra care taken not to open peritoneum .
furthermore , single incision group required more time in surgical field preparation , especially when positioned in retroperitoneum , due to movement limitation , loss of instrument triangulation and the parallel arrangement of instruments 24 . in 2004
cathelineau et al 25 , reported no differences in postoperative pain between the transperitoneal and the retroperitoneal lrp . in our study , tenderness to touch was less evident in transabdominal approaches in both laparoscopic and single port approaches .
according to desai et al 29 , this fact could be caused by the flank neuralgia syndrome due to injury or entrapment of the subcostal nerve .
on the other hand , when assessing retroperitoneal access , the single port group showed fewer signs of tenderness to touch than the laparoscopy group .
the opposite situation occurred when the transperitoneal access was assessed . for training model validation , urologists assessed the presence of adhesions as significantly lower in lap+r group , compared to the other groups . similarly , in lap+r , fibrosis obtained a significantly lower score compared to the lsp groups .
more specifically , fibrosis and bleeding of the lsp+r group was higher , showing that this approach generates a more intense reaction than through laparoscopy .
overall , bleeding was the lowest valued parameter for all groups , which was expected as it is easier to achieve correct hemostasis in a porcine model than in a human patient , due to different cell biology , blood supply , and tissue textures 30 .
one of the limitations of our model , compared to the aforementioned upjo models created by partial ureteral obstruction , is the lack of fulfillment of clinical considerations , as the pathophysiology differs greatly from such encountered in upjo under natural conditions in human patients .
we gave priority to an easy to create and fast to develop upjo model , and tried to achieve a model that fulfilled surgical anatomic criteria of the condition , aiming at its validation as training tool for the practice of laparoscopic anderson - hynes pyeloplasty . in conclusion
, we consider the use of experimental animal models essential for advanced laparoscopic surgery training .
however , we emphasize the need to use these animals under strict control , and only after basic laparoscopic skills have been mastered with physical or virtual simulators , or cadavers . above all , there should be a careful balance between acquisition of knowledge and new skills , and the potentially unnecessary harm to animals .
creating an upjo animal model by application of an endoclip to the ureter is easy , fast and reproducible , independently of the surgeon 's inherent laparoscopic skills .
the lsp+r constituted the highest scored approach in terms of anatomical similarity with human patients .
however , from our point of view , the former is not suitable for model creation , as it causes more pain and inflammation postoperatively , and requires longer operating times than the other minimally invasive alternatives .
all variables considered , the transabdominal laparoscopic approach is the best option for upjo model development .
it requires short operating times , causes less postoperative pain and achieves a good subjective assessment by urologists .
Output:
| this study aims firstly to assess the most adequate surgical approach for the creation of an ureteropelvic juntion obstruction ( upjo ) animal model , and secondly to validate this model for laparoscopic pyeloplasty training among urologists.thirty six large white pigs ( 28.295.48 kg ) were used .
the left ureteropelvic junction was occluded by means of an endoclip . according to the surgical approach for model creation
, pigs were randomized into : laparoscopic conventional surgery ( lap ) or single port surgery ( lsp ) .
each group was further divided into transperitoneal ( + t ) or retroperitoneal ( + r ) approach .
time needed for access , surgical field preparation , wound closure , and total surgical times were registered .
social behavior , tenderness to the touch and wound inflammation were evaluated in the early postoperative period .
after ten days , all animals underwent an anderson - hynes pyeloplasty carried out by 9 urologists , who subsequently assessed the model by means of a subjective validation questionnaire.total operative time was significantly greater in lsp+r ( p=0.001 ) .
tenderness to the touch was significantly increased in both retroperitoneal approaches , ( p=0.0001 ) .
surgeons rated the upjo porcine model for training on laparoscopic pyeloplasty with high or very high scores , all above 4 on a 1 - 5 point likert scale.our upjo animal model is useful for laparoscopic pyeloplasty training .
the model created by retroperitoneal single port approach presented the best score in the subjective evaluation , whereas , as a whole , transabdominal laparoscopic approach was preferred . |
PubmedSumm6853 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: pathogenic bacteria have caused serious diseases and a lot of mortality in many nations , especially in the developing countries .
these agents usually spread quickly , and the most susceptibilities to them have been assigned to the immunocompromised persons , pregnant mothers , children , and older individuals ( 1 ) . along with the progressive resistance of bacteria to the current antibiotics as a result of irregular antibiotic consumption in medicine , the health and general hygiene of people are strongly at risk , and , therefore , to avoid this threat , identification and utilizing novel anti - bacterial compounds are required ( 2 ) . in the recent years
, experimental researches have introduced some thiazole derivatives as the multi - therapeutic effect compounds including anti - cancer , anti - inflammatory , and inhibitor of the parasites like leishmania and the fungi such as candida ( 36 ) . moreover ,
the anti - bacterial effects of these compounds have been proven on a wide range of pathogens like bacillus subtilis , staphylococcus aureus , pseudomonas aeruginosa , and klebsiella aerogenes so that their potency and broad spectrum activity have promised the researchers to replace them with out - dated drugs to which the bacteria are resisting ( 7 ) . also regarding the imidazole derivatives ,
many properties such as the anti - fungal , anti - viral , anti - parasitic , and in - vitro inhibition of cancer cells have been demonstrated , and studying the anti - bacterial effects of these compounds has emphasized their power to inhibit the bacteria such as enterococcus faecalis , staphylococcus aureus , and pseudomonas aeruginosa ( 811 ) .
the potent and wide range anti - bacterial properties of the thiazole and imidazole derivatives have generally made the anti - bacterial test to be among the initial experiments that are studied after synthesizing these agents . in this study
, we evaluated the in - vitro anti - bacterial effects of two novel imidazole and one new thiazole derivatives , which have recently been synthesized in iran , against the bacterial pathogens that are often transferred to the human body by means of food , and cause disease .
1 ) was incorporated into a three - phase process , and its chemical structure was verified by monocrystal x - ray diffraction , h nmr , c nmr , and ir spectroscopic techniques , element decomposition technique , and spectrophotometry .
this synthesized derivative was then dissolved in dmso ( 8000 g / ml ) ( 12 ) .
12 ) . 6 : ( e)-2-(5-acetyl-4-methylthiazol-2-yl)-2-[benzo[d]thiazol-2(3h)-ylidene]acetonitrile steps for synthesis of 3a b imidazole derivatives ( derivatives from reference no . 13 ) .
3a : 2-(4-methylimidazolidin-2-ylidene ) malononitrile 3b : 2-(4,4-dimethylimidazolidin-2-ylidene ) malononitrile the 3a b imidazole derivatives were synthesized in a mono - phase process from malononitrile ( 10 mm , 1.7 g ) and 2a b diaminoalkanes ( 10 mm ) , and their chemical structures were confirmed by monocrystal x - ray diffraction , hnmr , cnmr , and ir spectroscopic techniques , element decomposition technique , and spectrophotometr y. these compounds were then dissolved in dmso ( 8000 g / ml ) ( 13 ) .
the tested bacteria were e. coli ( ptcc 1395 ) , s. dysenteriae ( ptcc 1188 ) , s. typhimurium ( ptcc 1596 ) , p. mirabilis ( ptcc 1076 ) , b. cereus ( ptcc 1665 ) , and l. monocytogenes ( ptcc 1297 ) ; they were obtained from the iranian research organization for science and technology ( irost ) .
each bacterium was cultured in a mueller - hinton agar medium , and incubated at 37 c for 24 h. henceforth , in a sterile medium and in a logarithmic growth phase , a concentration of 0.5 mcfarland ( 1.5 10 cfu / ml ) was obtained using a spectrophotometer and a standard mcfarland tube number 0.5 from each bacterium , which was assigned as the stock solution ( 14 ) .
the mic test was carried out in a sterile 96-well plate by broth microdilution as the clsi ( 15 ) standard .
first , 90 l of the muller - hinton broth medium ( merck , germany ) was added to each well .
then 100 l of the thiazole and imidazole derivatives ( in control groups , 100 l of penicillin and gentamycin antibiotics ( sigma ) with the primary concentration of 256 g / ml ) were added to the first well ( in which the concentration of derivatives was 4000 and concentration of antibiotics was 128 g / ml ) . after mixing , 100 l of this mixture
for a negative control , 100 l of the muller - hinton broth , 100 l of dmso , and 10 l of the bacterial suspension were added to the last well in each row .
the lucidity and turbidity in each well indicated the lack and existence of the bacterial growth , respectively .
the last well that did not show any turbidity by visual method was reported as mic ( 14 ) .
firstly , in the muller - hinton agar medium , the superficial bacterial culture was performed with a swab impregnated to the bacterial suspension .
then 20 l of the mic imidazole and thiazole derivatives obtained and also the antibiotics were shed on blank sterile disks .
after 24 h incubation at 37 c , the growth inhibition zone diameter was measured using a particular ruler .
the results of the growth inhibition zone diameter were provided as the average standard deviation , and for the aim of analyzing the data , the spss statistical software ( version 22 ) was used ( 14 ) .
1 ) was incorporated into a three - phase process , and its chemical structure was verified by monocrystal x - ray diffraction , h nmr , c nmr , and ir spectroscopic techniques , element decomposition technique , and spectrophotometry .
this synthesized derivative was then dissolved in dmso ( 8000 g / ml ) ( 12 ) .
12 ) . 6 : ( e)-2-(5-acetyl-4-methylthiazol-2-yl)-2-[benzo[d]thiazol-2(3h)-ylidene]acetonitrile steps for synthesis of 3a b imidazole derivatives ( derivatives from reference no . 13 ) .
3a : 2-(4-methylimidazolidin-2-ylidene ) malononitrile 3b : 2-(4,4-dimethylimidazolidin-2-ylidene ) malononitrile the 3a b imidazole derivatives were synthesized in a mono - phase process from malononitrile ( 10 mm , 1.7 g ) and 2a b diaminoalkanes ( 10 mm ) , and their chemical structures were confirmed by monocrystal x - ray diffraction , hnmr , cnmr , and ir spectroscopic techniques , element decomposition technique , and spectrophotometr y. these compounds were then dissolved in dmso ( 8000 g / ml ) ( 13 ) .
the tested bacteria were e. coli ( ptcc 1395 ) , s. dysenteriae ( ptcc 1188 ) , s. typhimurium ( ptcc 1596 ) , p. mirabilis ( ptcc 1076 ) , b. cereus ( ptcc 1665 ) , and l. monocytogenes ( ptcc 1297 ) ; they were obtained from the iranian research organization for science and technology ( irost ) .
each bacterium was cultured in a mueller - hinton agar medium , and incubated at 37 c for 24 h. henceforth , in a sterile medium and in a logarithmic growth phase , a concentration of 0.5 mcfarland ( 1.5 10 cfu / ml ) was obtained using a spectrophotometer and a standard mcfarland tube number 0.5 from each bacterium , which was assigned as the stock solution ( 14 ) .
the mic test was carried out in a sterile 96-well plate by broth microdilution as the clsi ( 15 ) standard .
first , 90 l of the muller - hinton broth medium ( merck , germany ) was added to each well .
then 100 l of the thiazole and imidazole derivatives ( in control groups , 100 l of penicillin and gentamycin antibiotics ( sigma ) with the primary concentration of 256 g / ml ) were added to the first well ( in which the concentration of derivatives was 4000 and concentration of antibiotics was 128 g / ml ) . after mixing ,
10 l of the bacterial suspension was added to each well . for a negative control , 100 l of the muller - hinton broth ,
100 l of dmso , and 10 l of the bacterial suspension were added to the last well in each row .
the lucidity and turbidity in each well indicated the lack and existence of the bacterial growth , respectively .
the last well that did not show any turbidity by visual method was reported as mic ( 14 ) .
firstly , in the muller - hinton agar medium , the superficial bacterial culture was performed with a swab impregnated to the bacterial suspension .
then 20 l of the mic imidazole and thiazole derivatives obtained and also the antibiotics were shed on blank sterile disks .
after 24 h incubation at 37 c , the growth inhibition zone diameter was measured using a particular ruler .
the results of the growth inhibition zone diameter were provided as the average standard deviation , and for the aim of analyzing the data , the spss statistical software ( version 22 ) was used ( 14 ) .
in this study , the anti - bacterial effects of the 3a b imidazole derivatives and compound 6 of thiazole were assessed for e. coli , s. dysenteriae , s. typhimurium , p. mirabilis , b. cereus , and l. monocytogenes by means of the growth inhibition zone diameter and mic measurements .
no inhibitory effect of the 3a b imidazole derivatives against all of the tested bacteria was observed , and only compound 6 of thiazole had an inhibitory effect against s. dysenteriae , p. mirabilis , and l. monocytogenes , among the tested bacteria .
the inhibitory effect of this compound was recorded with the mic values of 1000 , 125 , and 1000 g/ ml , and the zone diameter values of 9.3 0.1 , 15.6 0.2 , and 8.1 0.0 mm for p. mirabilis , s. dysenteriae , and l. monocytogenes , respectively . in the anti - biogram test
performed , the most and least susceptibilities were recorded for b. cereus to gentamicin with the mic value of 0.5 g / ml , and for e. coli to penicillinwith the mic value of 64 g / ml ( tables 1 and 2 ) .
mic values ( g / ml ) for effects of thiazole and imidazole derivatives and antibiotics on tested bacteria .
growth inhibition zone diameter values ( mm ) for effects of thiazole and imidazole derivatives and antibiotics on tested bacteria .
thiazole and imidazole derivatives with high potencies of anti - bacterial activity could be some novel compounds that are used as antibiotics , and in many countries , are in focus of research fields . according to the results obtained for this work , the 3a b compounds ( two imidazole derivatives ) lacked any inhibitory effect on the tested bacteria , whereas some of the imidazoline derivatives had the ability to inhibit pseudomonas and escherichia coli .
this difference in effect and inhibition potency of these substances is due to the presence of chlorine and phenyl compounds ( 15 ) . beside the lack of effects of the 3a b derivatives , experiments proved the power of methylnitroimidazole to inhibit the growth of the enterobacteriaceae family such as proteus vulgaris and proteus mirabilis , and this compound could release free radicals that harm bacteria and kill them ; this ability was not observed for the 3a b derivatives ( 16 ) .
compound 6 of thiazole could only inhibit s. dysenteriae , p. mirabilis , and l. monocytogenes among all the tested bacteria , and its inhibitory effect was much more on s. dysenteriae rather than p. mirabilis and l. monocytogenes .
in the recent studies , inhibition of the bacterial dna or enzymes has been proposed to be the influential mechanism for the inhibitory action of the thiazole derivatives .
inhibition of the bacterial enzyme eckasiii ( or fabh ) ( that is essential for the synthesis of fatty acids in gram negative and gram positive bacteria ) and the enzyme dna - gyrase ( that is needed to replicate the bacterial dna ) have been studied in some research works ( 17 , 18 ) .
noting that the quinolone - family antibiotics and the thiazole derivatives could inhibit the subunits a and b in dna - gyrase , respectively , is promising for the inhibition of the quinolone - resistant bacteria by the thiazole derivatives ( 18 ) .
an important feature in the structure of compound 6 of thiazole is the presence of benzothiazole , and researchers like maddila et al .
have paid attention to the anti - bacterial effects of the benzothiazole derivatives against escherichia coli ; the mic values in the range of 12.5200 g / ml have been evaluated for these compounds , suggesting that their possible potent activities are due to the presence of the chlorophenyl or pyrimidine ring in their structures ( 19 ) . in the experiment performed by patel et al .
the effects of the benzothiazole derivatives on escherichia coli , salmonella typhi , bacillus cereus , and shigella flexneri have been substantiated ; the chlorine and benzoimidazole connections are possibly involved in increasing the anti - bacterial effects of these substances ( 20 ) . in the study carried out by gilani et al .
the mic values in the range of 12.5200 g / ml have been reported , indicating the inhibitory effects of the benzothiazole derivatives against escherichia coli and staphylococcus aureus , in which the chlorine and chlorphenole connections are likely to be involved in increasing the anti - bacterial effects of these compounds ( 21 ) .
have shown the inhibitory effects of the benzothiazole derivatives bonded to cu and zn against staphylococcus aureus , escherichia coli , and bacillus subtilis , proving the potency of these benzothiazole derivatives by attaching to the dna molecules of the bacteria , inhibiting their activities ( 22 ) .
there has been a focus on the anti - bacterial activities of the thiazole derivatives in many research works , in which the growth inhibition zone diameter or mic or both have been measured . in this regard
in which they have shown the in - vitro anti - bacterial potency of the thiazole derivatives against bacillus subtilis , bacillus megaterium , escherichia coli , and pseudomonas aeruginosa by measuring the growth inhibition zone diameter ( 23 ) .
have proved the in - vitro potency of the thiazole derivatives to inhibit salmonella typhi , escherichia coli , klebsi - ella pneumoniae , vibrio cholera , and staphylococcus aureus by measuring the values for the growth inhibition zone diameter and mic ( 24 ) .
juspin et al . have carried out an experiment , in which the growth inhibition zone diameter and mic values were measured , and the in - vitro power of the thiazole derivatives to inhibit the activities of escherichia coli , pseudomonas aeruginosa , and staphylococcus aureus was confirmed ( 25 ) .
with respect to the inhibitory effect of the thiazole derivatives and their synergistic effect with other antibiotics , it is suggested to assess their therapeutic and toxic effect in laboratory animals , and is recommended to do more researches in order to better recognize these compounds and their possible functionality .
Output:
| background and objectives : bacterial resistance to antibiotics has motivated the researchers to evaluate the novel anti - bacterial compounds such as some thiazole and imidazole derivatives . thereby , in this work , we investigated the anti - bacterial effects of one new thiazole and two new imidazole derivatives on bacillus cereus , listeria monocytogenes , escherichia coli , salmonella typhimurium , proteus mirabilis and shigella dysenteriae.materials and methods : the thiazole and imidazole derivatives were dissolved in dmso .
the disk diffusion method was utilized to measure the growth inhibition zone diameter values , and the broth micro - dilution method was applied to determine the minimum inhibitory concentration ( mic ) values.results:the synthesized imidazole derivatives lacked any inhibitory effect against the tested bacteria . on the other hand , although the synthesized thiazole derivative showed no inhibitory effect against bacillus cereus , salmonella typhimurium , and escherichia coli , it inhibited the growth of proteus mirabilis , shigella dysenteriae , and listeria monocytogenes with the mic values of 1000 , 125 , and 1000 g / ml , respectively , and the growth inhibition zone diameter values of 9.3 0.1 , 15.6 0.2 , and 8.1 0.0 mm , respectively.conclusion:the anti - bacterial effect of the synthesized thiazole derivative on shigella dysenteriae , proteus mirabilis and listeria monocytogenes was proven . however , its inhibition effect against shigella dysenteriae was more than that against the others .
many in - vitro and in - vivo experiments are required to evaluate the effects of this compound on the bacteria and the human body . |
PubmedSumm6854 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: there is an increasing focus on the detection of preclinical dementia to optimize preventive and therapeutic strategies for this group of patients .
mild cognitive impairment ( mci ) is regarded as a risk factor or transitional state of dementia . to enable targeted interventions ,
it is of great importance to identify patients with mci who are at high risk of developing dementia .
hence , there is a widespread ambition for clinicians to differentiate precisely between mci and the early stages of dementia .
consequently , there is a high demand for good - quality clinical assessments of mci and early dementia , which is a challenge that has to be met in daily clinical practice .
many studies have explored the prevalence of mci and the rate of progression to dementia in different populations . the expected conversion rate is higher in clinical populations than in nonclinical ones .
accordingly , farias et al . found annual conversion rates of 13% in a clinical sample and 3% in a community sample . in a meta - analysis of clinical studies from 2009 , the annual progression rate from mci to dementia was estimated to be 9.6% for clinical populations , whereas a recent review reported that the conversion rate to alzheimer 's dementia ranged from 10.2 to 33.6% in different clinical cohorts .
the considerable differences in the estimates of the annual progression rate from mci to dementia reported previously show that there still is a need to explore the factors that affect the rate of progression from mci to dementia in different cohorts .
simple and easy - to - administer cognitive tests have become indispensable tools for the effective and reliable assessment of dementia .
correspondingly , the development of simple tools that would allow a more accurate differentiation between mci and early - stage dementia and the identification of subjects at high risk of developing dementia would be of great clinical value .
thus , the aims of this study were to investigate whether simple cognitive screening tests can predict the conversion from mci to dementia and to study the impact of different patient characteristics on the progression rate from mci to dementia in a clinical population .
in this retrospective study , we used data from the medical records of patients who had been referred to an outpatient psychogeriatric clinic because of memory problems or suspicion of dementia .
the sample consisted of patients who had been subjected to a comprehensive clinical assessment consisting of clinical interviews and cognitive tests and imaging , and were diagnosed with mci at baseline .
all patients attended follow - up assessments at the clinic one or several times over a period of 5 - 46 months . in most cases , a close relative or another informant who knew the patient well
was interviewed as part of the assessment , focusing on themes that were relevant for the diagnoses as well as checking and supplementing the clinical information given by the patient .
the diagnosis of dementia was established by a team consisting of psychiatrists , clinical psychologists and trained psychiatric nurses , and was in accordance with the classification of mental and behavioral disorders included in the tenth revision of the international statistical classification of diseases and related health problems ( icd-10 ) and with the guidelines from the national institute of neurological and communicative diseases and stroke / alzheimer 's disease and related disorders association ( nincds - adrda ) .
primary and secondary diagnoses of mental disorders were established according to the icd-10 criteria . diagnostic practice for
the mci diagnosis was in accordance with the criteria recommended by the working groups of winblad et al . and portet et al .
, e.g. , subjective memory complaint was not a necessary condition for this diagnosis , as in the mayo definition .
three cognitive assessment tools were used routinely to assess cognitive function . the mini - mental state examination ( mmse ) is a widely used 11-item cognitive screening instrument with a test score ranging from 0 to 30 , with a higher score denoting better cognitive functioning . the neurobehavioral cognitive status examination ( cognistat ) is a short cognitive test battery that was designed to provide a profile from different cognitive domains based on 10 subtests regarding orientation , attention , understanding of simple commands , repetition of sentences , naming , visuoconstruction , verbal memory , calculation , similarities / verbal abstraction , and everyday / concrete judgment .
the total score reflects the number of cognitive functions that are intact : a score within the normal range is scored 1 , whereas a lower score is denoted 0 , giving a total sum score that ranges from 0 to 10 .
the cutoff point is age corrected for subjects aged 65 - 74 and 75 - 84 years .
the clock drawing test ( cdt ) is a frequently used screening tool in which the subject is asked to draw a clock with correct numbers and pointers on it .
the cdt taps into a series of cognitive domains ( i.e. , verbal understanding , memory , spatial knowledge , abstract thinking , concentration , and visuoconstructive skills ) , including executive functions .
demographic data such as gender , age , number of years of education , marital / cohabitant status , life situation ( e.g. , housing and other household members ) , formal help ( e.g. , nurse and help with cleaning and hot meals ) , and other services ( e.g. , attending seniors ' centers ) were collected at baseline .
most of the patients had undergone one or more types of brain imaging : magnetic resonance imaging , computed axial tomography , or single - photon emission computer tomography .
pathological ( the latter when significant substance loss , infarct , clearly expanded ventricles , or chronic ischemia were observed ) .
no formal assessment tools had been used routinely to assess activities of daily living ( adl ) .
thus , the patient files were searched for relevant information regarding instrumental and personal adl functioning , and the explicit evaluations of adl by the clinicians were categorized as
not assessed. anticholinergic medication was recorded in accordance with the anticholinergic cognitive burden list ( acb - list ) , which was developed by the aging brain program at the indiana university center for aging research .
drugs with scores of 2 or 3 on the acb - list were labeled anticholinergic .
the study has been presented to the regional committee for medical research ethics in south - eastern norway and approved by the norwegian social science data service .
one group retained their mci diagnosis and was denoted the nonconverter ( nonc ) group , whereas the other group received a dementia diagnosis and was denoted the converter ( c ) group .
distributions of the predictive variables across the two diagnostic outcome categories were compared using the mann - whitney u test for continuous variables and pearson 's test for categorical variables .
the three cognitive tests and the significantly unbalanced covariates that showed associations with outcome variables at a significance level of p < 0.1 in a univariate analysis were entered as independent variables into the multivariate cox proportional hazards model , using diagnostic outcomes as the dependent variable .
time to conversion was defined as the time in months from baseline to the assessment that led to the diagnosis of dementia .
in this retrospective study , we used data from the medical records of patients who had been referred to an outpatient psychogeriatric clinic because of memory problems or suspicion of dementia .
the sample consisted of patients who had been subjected to a comprehensive clinical assessment consisting of clinical interviews and cognitive tests and imaging , and were diagnosed with mci at baseline .
all patients attended follow - up assessments at the clinic one or several times over a period of 5 - 46 months . in most cases , a close relative or another informant who knew the patient well
was interviewed as part of the assessment , focusing on themes that were relevant for the diagnoses as well as checking and supplementing the clinical information given by the patient .
the diagnosis of dementia was established by a team consisting of psychiatrists , clinical psychologists and trained psychiatric nurses , and was in accordance with the classification of mental and behavioral disorders included in the tenth revision of the international statistical classification of diseases and related health problems ( icd-10 ) and with the guidelines from the national institute of neurological and communicative diseases and stroke / alzheimer 's disease and related disorders association ( nincds - adrda ) . primary and secondary diagnoses of mental disorders were established according to the icd-10 criteria . diagnostic practice for
the mci diagnosis was in accordance with the criteria recommended by the working groups of winblad et al . and portet et al . ,
e.g. , subjective memory complaint was not a necessary condition for this diagnosis , as in the mayo definition .
three cognitive assessment tools were used routinely to assess cognitive function . the mini - mental state examination ( mmse ) is a widely used 11-item cognitive screening instrument with a test score ranging from 0 to 30 , with a higher score denoting better cognitive functioning . the neurobehavioral cognitive status examination ( cognistat ) is a short cognitive test battery that was designed to provide a profile from different cognitive domains based on 10 subtests regarding orientation , attention , understanding of simple commands , repetition of sentences , naming , visuoconstruction , verbal memory , calculation , similarities / verbal abstraction , and everyday / concrete judgment .
the total score reflects the number of cognitive functions that are intact : a score within the normal range is scored 1 , whereas a lower score is denoted 0 , giving a total sum score that ranges from 0 to 10 .
the cutoff point is age corrected for subjects aged 65 - 74 and 75 - 84 years .
the clock drawing test ( cdt ) is a frequently used screening tool in which the subject is asked to draw a clock with correct numbers and pointers on it .
the cdt taps into a series of cognitive domains ( i.e. , verbal understanding , memory , spatial knowledge , abstract thinking , concentration , and visuoconstructive skills ) , including executive functions .
demographic data such as gender , age , number of years of education , marital / cohabitant status , life situation ( e.g. , housing and other household members ) , formal help ( e.g. , nurse and help with cleaning and hot meals ) , and other services ( e.g. , attending seniors ' centers ) were collected at baseline .
most of the patients had undergone one or more types of brain imaging : magnetic resonance imaging , computed axial tomography , or single - photon emission computer tomography .
pathological ( the latter when significant substance loss , infarct , clearly expanded ventricles , or chronic ischemia were observed ) .
no formal assessment tools had been used routinely to assess activities of daily living ( adl ) .
thus , the patient files were searched for relevant information regarding instrumental and personal adl functioning , and the explicit evaluations of adl by the clinicians were categorized as
not assessed. anticholinergic medication was recorded in accordance with the anticholinergic cognitive burden list ( acb - list ) , which was developed by the aging brain program at the indiana university center for aging research .
drugs with scores of 2 or 3 on the acb - list were labeled anticholinergic .
the study has been presented to the regional committee for medical research ethics in south - eastern norway and approved by the norwegian social science data service .
one group retained their mci diagnosis and was denoted the nonconverter ( nonc ) group , whereas the other group received a dementia diagnosis and was denoted the converter ( c ) group .
distributions of the predictive variables across the two diagnostic outcome categories were compared using the mann - whitney u test for continuous variables and pearson 's test for categorical variables .
the three cognitive tests and the significantly unbalanced covariates that showed associations with outcome variables at a significance level of p < 0.1 in a univariate analysis were entered as independent variables into the multivariate cox proportional hazards model , using diagnostic outcomes as the dependent variable .
time to conversion was defined as the time in months from baseline to the assessment that led to the diagnosis of dementia .
ninety - three patients satisfied the inclusion criteria . among the 93 patients with a primary diagnosis of mci ,
3 were diagnosed with mood disorder and did not have mci at the first follow - up ; therefore , they were excluded from the study .
the remaining 90 patients comprised 60 females with a mean age of 75.5 years ( sd 7.0 ) and 30 males with a mean age of 69.4 years ( sd 7.9 ) who had been reassessed from one to seven times , with a median interval between the assessments of 8.0 months ( range 43.5 ) .
sixty - four of these individuals ( 49 females and 15 males ) developed dementia ( c group ) .
thirty - six ( 56.3% ) individuals in the c group were diagnosed with dementia of alzheimer 's type , 11 with vascular dementia , 7 with frontotemporal dementia , 3 with dementia associated with other diseases , and 7 with unspecified dementia .
twenty - six patients retained their mci diagnosis ( nonc group ) ( table 1 ) .
the median time from baseline to the dementia diagnosis was 12.0 months ( range 41.0 ) , and more than 50% of the total sample were diagnosed with dementia within 18 months .
the median time from the first assessment to the last follow - up in the nonc group was 17.5 months ( range 32.0 ) .
the time between the follow - ups varied between the subjects , and the nonc group was on average followed for a longer total period than the c group .
none of the dementia diagnoses was removed at later follow - ups . however , the type of dementia was changed in 2 patients : one from frontotemporal to unspecified dementia and the other one vice versa .
the characteristics of the two diagnostic subgroups in the study cohort are shown in table 1 .
the bivariate analysis showed that four variables were significantly associated with the diagnostic outcome : gender ( pearson 's test , p = 0.002 ) , marital status ( p = 0.027 ) , living situation ( living alone , p = 0.037 ) , and cdt ( mann - whitney u test , p = 0.045 , one - tailed ) .
the mean score was 6.0 ( sd 1.3 ) for the nonc and 5.1 ( sd 1.9 ) for the c group ( table 1 ) .
the correlation matrix revealed a very high correlation between marital status and living situation ( living alone ) .
the three cognitive screening tests were significantly correlated ( p < 0.05 ) , with the strongest correlation observed between the cdt and cognistat ( spearman 's rho = 59.2 , p = 0.001 ) .
univariate cox regressions were performed to determine unadjusted hazard ratios ( hrs ) for conversion to dementia .
low scores on the cdt ( hr 0.85 ; 95% ci 0.74 - 0.98 ) and the cognistat ( hr 0.78 ; 95% ci 0.65 - 0.93 ) were significantly associated with the relative risk of conversion to dementia , whereas the mmse score was not significantly associated with the diagnostic outcome variable .
in addition , age , gender and marital status were significantly associated with diagnostic outcome ( p < 0.1 ) in bivariate analyses ; therefore , they were included in the multivariate regression model to determine the adjusted hrs .
consequently , separate multivariate models were established for cdt and cognistat that included the variables age , gender , and marital status . when controlling for age , gender , and marital status , the association between a reduction in the total score on cognistat or the cdt and an increase in the risk of conversion to dementia remained significant ( cdt : hr = 0.85 ; 95% ci 0.73 - 0.97 ; cognistat : hr = 0.78 ; 95% ci 0.65 - 0.93 ) ( table 2 ) .
this study showed that a reduction in the sum scores on the simple cognitive tests cdt and cognistat was associated with an increased relative risk of conversion from mci to dementia .
thus , the cdt and the short cognitive test battery cognistat are significant predictors of diagnostic outcome and could be used to identify persons with mci that are at higher risk of developing dementia , whereas the general screening tool mmse showed no predictive value . although the mmse is a common dementia screening tool , it seems to lack the sensitivity required to assess mci and differentiate between patients at higher risk and those at moderate risk of conversion to dementia .
the present results are in accordance with the conclusions of the meta - analysis by mitchell who suggested that the mmse had a limited value in differentiating mci from healthy controls and modest rule - out accuracy .
cognistat is a selection of 10 tests that cover different aspects of cognitive functioning and impairment , whereas cdt is a very simple and less time - consuming tool .
hence , cognistat could be expected to have the highest sensitivity to differentiate between mci and early dementia and the strongest predictive value regarding the diagnostic outcome in this study . however , according to our findings , cdt exhibited a similar predictive strength as cognistat , and the results from the different statistical analyses were more consistent .
a likely explanation for this observation is that a successful result on the cdt depends on a series of different cognitive functions ; thus , the test results differentiate between degrees of impairment , even at an early stage . a review article published in 2008 by peters and
pinto concluded that the cdt was possibly a useful tool for identifying cognitive decline earlier than is possible using other traditional screening tests .
nevertheless , in a later publication , these authors recommended it as a possible predictive test for dementia .
a validation study of cognistat concluded that this tool has moderate validity in the detection of mci and mild dementia but that , on its own , it is not sufficient for diagnosing mci or mild dementia . although the present study showed that cdt and cognistat have predictive value in a clinical setting , the results should be interpreted in accordance with the previous literature , which suggests that the predictive strength is insufficient to justify using either of these two tests as a single predictive test ; rather , they should be applied in combination with other assessment tools .
the females included in the study population had a higher mean age than the males .
moreover , the progression rate from mci to dementia was significantly higher in the females than in the males .
this is in accordance with the hypothesis of petersen et al . who suggested that in females we see transition from normal cognition directly to dementia at a later age , but more abruptly than among males .
this hypothesis is further strengthened by the facts that our study cohort consisted mostly of females , that the total proportion of subjects who converted from mci to dementia was relatively high , and that the conversion took place rapidly .
moreover , as the time between assessments varied , it is possible that some patients would have received a dementia diagnosis even more rapidly if reassessed earlier , which eventually would render the risk ratio curve steeper . despite this possible underestimation
, our results suggested an annual rate that was similar to the higher rates published previously . to our knowledge , this is the first study on the progression rate from mci to dementia among norwegian outpatients .
the patients had undergone a comprehensive diagnostic assessment by a team of clinical specialists , and the study provided a new and clinically relevant contribution to knowledge regarding the assessment of mci patients and the prediction of conversion to dementia .
the high proportion of patients who converted from mci to dementia in our study might be explained by the characteristics of the study cohort , indicating that the selected clinical population might be at an extremely high risk of developing dementia .
another possible explanation is that the diagnostic decisions made at the first assessment might have been too conservative , resulting in a rapid dementia diagnosis later on .
however , the inclusion criteria were wide , and the cohort comprised all patients with mci who visited our clinic over a defined period . hence , the population used and results obtained reflect a naturalistic clinical setting .
there are obvious limitations to the retrospective design of this study . from the clinical records , it was not possible to assess whether there were any systematic differences between the final sample , which consisted of patients who were assessed twice or more times , and the possibly equally sized group of persons who were not subjected to a second assessment . furthermore , the follow - ups were at variable intervals , and the predictors in the survival analyses might be related to follow - up rather than conversion to dementia .
however , this seems less likely , as the more stable mci group ( nonc ) was on average followed for a longer total period than the c group , and the descriptive analysis also showed that the predictors separated the two diagnostic outcome groups .
unfortunately , adl and brain scan results were difficult to score from the reports , as no standardized scales were used .
to our knowledge , this is the first study on the progression rate from mci to dementia among norwegian outpatients .
the patients had undergone a comprehensive diagnostic assessment by a team of clinical specialists , and the study provided a new and clinically relevant contribution to knowledge regarding the assessment of mci patients and the prediction of conversion to dementia .
the high proportion of patients who converted from mci to dementia in our study might be explained by the characteristics of the study cohort , indicating that the selected clinical population might be at an extremely high risk of developing dementia .
another possible explanation is that the diagnostic decisions made at the first assessment might have been too conservative , resulting in a rapid dementia diagnosis later on .
however , the inclusion criteria were wide , and the cohort comprised all patients with mci who visited our clinic over a defined period . hence , the population used and results obtained reflect a naturalistic clinical setting .
there are obvious limitations to the retrospective design of this study . from the clinical records , it was not possible to assess whether there were any systematic differences between the final sample , which consisted of patients who were assessed twice or more times , and the possibly equally sized group of persons who were not subjected to a second assessment .
furthermore , the follow - ups were at variable intervals , and the predictors in the survival analyses might be related to follow - up rather than conversion to dementia .
however , this seems less likely , as the more stable mci group ( nonc ) was on average followed for a longer total period than the c group , and the descriptive analysis also showed that the predictors separated the two diagnostic outcome groups .
unfortunately , adl and brain scan results were difficult to score from the reports , as no standardized scales were used .
neither of these two tests is recommended as a single test ; rather , they should be used in combination with other tools for the prediction of individuals who are at higher risk of conversion from mci to dementia .
although both tests are easy to administer , the cdt , which is less time - consuming , should be preferred to cognistat for this purpose .
we found a relatively high rate of conversion from mci to dementia in our sample . in the descriptive analyses ,
female gender was associated with a higher conversion rate compared with male gender ; however , this was not confirmed in further analyses .
further research is required to establish which combinations of cdt or cognistat with other assessment tools should be recommended for the clinical assessment of mci and the identification of patients at higher risk of developing dementia .
Output:
| backgroundthe identification of patients with mild cognitive impairment ( mci ) who are at high risk of conversion to dementia is a challenging clinical task . aims : to investigate whether simple cognitive screening tests can predict the conversion from mci to dementia and to study the impact of different patient characteristics on the progression rate.methodsa retrospective , longitudinal study of 90 outpatients diagnosed with mci at a psychogeriatric clinic in norway was conducted .
baseline scores on the mini - mental state examination ( mmse ) , clock drawing test ( cdt ) , and neurobehavioral cognitive status examination ( cognistat ) were related to icd-10 diagnosis during 46 months .
the influence of demographic , life situational , and clinical data were analyzed.resultssixty-four patients were diagnosed with dementia , significantly more females ( 82% ) than males ( 50% ) ( p < 0.01 ) .
low scores on the cdt [ adjusted hazard ratio ( hr ) = 0.85 ; 95% ci 0.73 - 0.97 ; p = 0.020 ] and cognistat ( adjusted hr = 0.78 ; 95% ci 0.65 - 0.93 ; p = 0.007 ) significantly predicted the conversion from mci to dementia , whereas the mmse score did not.conclusionsa high proportion of patients converted from mci to dementia within 46 months , and females seem to be at higher risk .
cdt and cognistat significantly predicted the conversion from mci to dementia and are therefore considered appropriate tests in clinical practice . |
PubmedSumm6855 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: derives from the greek word
gelos ( laughter ) and was introduced in 1957 by daly
and mulder .
it is used to name seizures characterized by sudden laughter
attacks , out of social context , without any particular emotion like joy or
happiness . in 1971 ,
gascon and lombroso suggested as diagnostic criteria the presence of stereotyped
laughter episodes in the absence of external triggers that can be associated
with other epileptic manifestations , ictal or interictal discharges on the
electroencephalogram ( eeg ) , and absence of other conditions that could explain
the pathologic laughter .
the vast majority of gelastic epilepsy series reported
include only children , and they have found an association with hypothalamic
hamartomas , a lesion that therefore must be always ruled out in these patients .
however , other lesions and localizations have also been reported , mainly in
other adult patients , , . here
, we describe three patients with gelastic
seizures ( gs ) with no evidence of hypothalamic hamartomas .
a 35-year - old man with a history of neurocysticercosis was
treated with antiparasitic drugs as a teenager . since the age of 29 years , he had almost daily spells characterized by sudden
unmotivated laughter attacks which were described by his relatives since the
patient was not aware .
in addition , he had occasional seizures which started
with forced head version towards the right , followed by right upper and
lower limb jerks , and finally secondary generalization .
magnetic
resonance imaging ( mri ) showed upper right and inferior left mesial frontal
lobe nodular lesions , consistent with calcified neurocysticercosis
( fig .
five gs were
recorded on scalp video - eeg monitoring , all of them showing ictal patterns
arising from the left anterior temporal lobe ( fig .
positron emission tomography
( pet ) was performed , showing left mesial frontal and anterior temporal
hypometabolism ( fig .
invasive
recordings were performed with left frontal deep electrodes and foramen
ovale electrodes , and ictal and interictal activities arising from the left
mesial frontal region was demonstrated ( fig .
resection of the left frontal
pole , which included the lesion , was performed ( fig .
the patient has been seizure - free since the surgery ( 5 years of follow - up ) and under no medication for 3 years ( ilae class i ) . a 45-year - old man with epilepsy since the age of 14 years had seizures characterized by sudden laughter attacks ,
associated with feelings of joy and happiness , which lasted about 30 s , occasionally associated with disconnection followed by one
to two minutes of postictal confusion .
he had up to 5 episodes per day in
spite of multiple antiepileptic treatments ( carbamazepine , phenobarbital ,
levetiracetam , and topiramate ) .
2a ) ; surface eeg
recordings showed left frontotemporal interictal epileptiform discharges
( fig .
2b ) ; two
gelastic seizures with left frontotemporal ictal onset were recorded .
neuropsychological evaluation showed bilateral
mesial and anterior temporal alterations with predominance of the left
hemisphere .
the patient
remained seizure - free for a year , and seizures relapsed afterwards , with a
50% reduction compared to presurgical average ( ilae class iv ) .
old , he experienced brief laughter attacks , apparently unmotivated ,
that was perceived as strange behavior by his family .
gelastic epilepsy was
diagnosed , and the patient was placed on carbamazepine ; the treatment was
stopped after a seizure - free period of 6 years .
five years
after the medication withdrawal , he began again with episodes of unmotivated
laughter , with no emotional correlate , associated with disconnection .
carbamazepine was restarted with
complete control of the spells except during a few poor adherence
periods .
a 35-year - old man with a history of neurocysticercosis was
treated with antiparasitic drugs as a teenager . since the age of 29 years , he had almost daily spells characterized by sudden
unmotivated laughter attacks which were described by his relatives since the
patient was not aware .
in addition , he had occasional seizures which started
with forced head version towards the right , followed by right upper and
lower limb jerks , and finally secondary generalization .
magnetic
resonance imaging ( mri ) showed upper right and inferior left mesial frontal
lobe nodular lesions , consistent with calcified neurocysticercosis
( fig .
five gs were
recorded on scalp video - eeg monitoring , all of them showing ictal patterns
arising from the left anterior temporal lobe ( fig .
positron emission tomography
( pet ) was performed , showing left mesial frontal and anterior temporal
hypometabolism ( fig .
invasive
recordings were performed with left frontal deep electrodes and foramen
ovale electrodes , and ictal and interictal activities arising from the left
mesial frontal region was demonstrated ( fig .
resection of the left frontal
pole , which included the lesion , was performed ( fig .
the patient has been seizure - free since the surgery ( 5 years of follow - up ) and under no medication for 3 years ( ilae class i ) .
a 45-year - old man with epilepsy since the age of 14 years had seizures characterized by sudden laughter attacks ,
associated with feelings of joy and happiness , which lasted about 30 s , occasionally associated with disconnection followed by one
to two minutes of postictal confusion .
he had up to 5 episodes per day in
spite of multiple antiepileptic treatments ( carbamazepine , phenobarbital ,
levetiracetam , and topiramate ) .
2a ) ; surface eeg
recordings showed left frontotemporal interictal epileptiform discharges
( fig .
2b ) ; two
gelastic seizures with left frontotemporal ictal onset were recorded .
neuropsychological evaluation showed bilateral
mesial and anterior temporal alterations with predominance of the left
hemisphere .
the patient
remained seizure - free for a year , and seizures relapsed afterwards , with a
50% reduction compared to presurgical average ( ilae class iv ) .
a 42-year - old man had no relevant medical history . at 15
years old , he experienced brief laughter attacks , apparently unmotivated ,
that was perceived as strange behavior by his family .
gelastic epilepsy was
diagnosed , and the patient was placed on carbamazepine ; the treatment was
stopped after a seizure - free period of 6 years .
five years
after the medication withdrawal , he began again with episodes of unmotivated
laughter , with no emotional correlate , associated with disconnection .
carbamazepine was restarted with
complete control of the spells except during a few poor adherence
periods .
gelastic seizures are seen in less than 1% of all epilepsies
, and they are
mainly associated with hypothalamic hamartomas in children . usually , these
seizures begin during infancy , even in the neonatal period , with a progressive
course which may include other focal or generalized seizures .
invasive eeg recordings and electrical stimulation have
shown that gelastic seizures originated from the hypothalamic hamartomas ,
although they can arise from other lesions , like tumors , malformations of
cortical development , tuberous sclerosis , and postinfectious foci . to the best of our knowledge ,
this is the first report of neurocysticercosis related to gs . in patients who have gelastic seizures without an impairment of
consciousness
, laughter is described as unmotivated or emotion - free , which could
be interpreted as a dissociation between the motor and emotional components of
laughter , although the physiological basis of joy and laughter are not fully
understood .
one of
them had a lesion in the left superior mesial frontal region and experienced gs
not accompanied by joy .
ictal subdural recordings showed that the seizures began
in the left anterior cingulate gyrus .
the other two patients had complex partial
seizures originating from the temporal lobe ; in these cases , electrical
stimulation of the fusiform and parahippocampal gyri produced bursts of laughter
accompanied by a feeling of mirth .
the authors concluded that the anterior
cingulate region is involved in the motor aspects of laughter , while the basal
temporal cortex is involved in the processing of joy .
these findings are also
consistent with a case described by coria et al . in a patient who had a right lateral
basal temporal lesion and experienced joy associated with gelastic
seizures
intracranial
recordings and cortical electrical stimulation have shown involvement of the
mesial and lateral superior frontal , cingulate and orbitofrontal gyri
.
interestingly ,
in a case studied by chassagnon et al . with stereo - eeg , a nonlesional patient became
seizure - free after radiofrequency stimulation , resulting in two distinct lesions
in the left superior frontal and cingulate gyri . in our first patient ,
gs were associated with motor signs but
not with emotion , therefore suggesting a frontal lobe origin .
although the
surface eeg showed left anterior temporal ictal onset , both the mri and pet
showed left mesial frontal and anterior temporal changes .
invasive eeg
recordings localized the left mesial frontal lobe as the ictal onset area , which
was assumed to be the probable epileptogenic area , which was confirmed by the
good surgical outcome . in the second case , the structural and functional neuroimaging
and the surface eeg were consistent with a temporal origin of the seizures .
this
patient had , during the seizure , a sense of joy , similar to the cases reported
by iwasa et al .
which originated from the right or left mesial
our
patient initially reached seizure - freedom for a year , although a long - term
reduction of 50% compared to presurgical status was finally reached .
this was
probably due to an incomplete resection of a cortical dysplasia associated with
the hippocampal sclerosis .
unlike the previous cases , our last patient had unremarkable
imaging or eeg findings and responded well to antiepileptic drugs . although
there were no ictal recordings that could confirm the topographical origin of
the seizures , a hypothalamic onset is unlikely . since the patient has had
complete seizure control with antiepileptic drugs , further studies were not
indicated
although gelastic epilepsy has been associated with hypothalamic
hamartomas in children , other localizations , including frontal and temporal lobe
foci , are more frequent among adult patients , .
gelastic epilepsy is usually
refractory , and surgery may be a useful tool , as reported in two of our
cases .
Output:
| gelastic epilepsy or laughing seizures have been
historically related to children with hypothalamic hamartomas .
we report three
adult patients who had gelastic epilepsy , defined as the presence of seizures
with a prominent laugh component , including brain imaging , surface / invasive
electroencephalography , positron emission tomography , and medical / surgical
outcomes .
none of the patients had hamartoma or other hypothalamic lesion .
two
patients were classified as having refractory epilepsy ( one had biopsy - proven
neurocysticercosis and the other one hippocampal sclerosis and temporal cortical
dysplasia ) .
the third patient had no lesion on mri and had complete control with
carbamazepine .
both lesional patients underwent resective surgery , one with
complete seizure control and the other one with poor outcome .
although
hypothalamic hamartomas should always be ruled out in patients with gelastic
epilepsy , laughing seizures can also arise from frontal and temporal lobe foci ,
which can be surgically removed .
in addition , we present the first case of
gelastic epilepsy due to neurocysticercosis . |
PubmedSumm6856 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: healthy lifestyle is defined as all kinds of human activities that maintain , strengthen , and restore health .
health education is a complex process during which students are taught to care for their own health and the health of society .
its main objective is to propagate knowledge about health itself , provide counselling in relation to health - related risks , and promote a healthy lifestyle .
health promotion means raising individual and societal awareness concerning health and factors affecting health , as well as developing and strengthening health resources of the individual and the community . in poland , there are many alarming tendencies to neglect a healthy lifestyle .. the exact characteristics of attitudes toward smoking among school children was presented in a nationwide study done in the framework of the global youth tobacco survey [ 2 , 3 ] results showed that 64 % of boys and 53 % of girls aged 1315 years have smoked cigarettes ; 30 % of boys and 21 % of girls have tried smoking before the age of 10 years . furthermore , 25 % of boys and 21 % of girls admitted to smoking in the previous month .
this figure is approximate to those presented in other countries of the european union .
the diet of polish adolescents was observed to be excessively high in flour products , sweets , and animal fats and too low in fish , vegetables , fruit , and products containing probiotics .
the health behaviour in school - aged children ( hbsc ) study revealed a number of irregularities in the field of health behaviors among polish youth . in 2010 , 76 % of polish youth aged 1115 years had tried alcoholic beverages .
another worry is the teenager s eating habits : 6070 % of youth eat no vegetables or dark bread , 41 % have no milk , and 41 % candy and sweet drinks daily .
every sixth teenager goes to school without breakfast , and one in five do not eat a second breakfast at school . after heart and cardiovascular diseases
there are two main groups of factors related to the development of cancer : environmental and genetic .
it is estimated that ~70 % of malignant tumors are a consequence of harmful environmental factors . while it is not possible to change genetic determinants , it is possible to eliminate the adverse factors related to lifestyle by directing people s thinking toward a healthy lifestyle . to achieve the highest possible efficiency of such targeted actions ,
it is necessary that individuals acquire appropriate knowledge , which can be obtained by an adequate educational process .
therefore , health education and promotion play a fundamental role in promoting and implementing a healthy lifestyle .
the ultimate effect of health education should be reduction of overall morbidity . assuming that factors related to lifestyle are the cause of up to 70 % of cancers , it can be concluded that the main goal of health education in cancer prevention should be to promote a healthy lifestyle .
the effectiveness of such education could be measured by the percentage of people changing or expressing a readiness to change their lifestyle .
the main source of education is school , although the family home continues to influence the development of knowledge , as well as good and bad habits . in the preamble to the curriculum for schools
is the sentence : an important task of the school is also health education , carried out by the teachers of many subjects , which aims at developing students skills of caring for their own health and the health of other people .
this particularly significant statement makes health education of vital importance among the tasks of the contemporary school . according to the widely accepted approach
, health education should mean the conscious creation of projected opportunities for learning and facilitating behavioral changes . according to a report of the department of health promotion in cracow , juveniles themselves considered the following elements as the most important topics in health education : preparation for sexual activity , nutrition , physical activity , drug addiction , mental hygiene , disease prevention , and preparation for family life .
such an array of broadly expressed needs can be a sign of the lack of knowledge in the field of health care , and we showed that knowledge about cancer among adolescents was low , which is part of a trend reported in similar studies.[11 , 12 ] the success of health education results from the use of certain topics , resources , methods of action , and structural forms .
it seems that the best time to start health education is the age at which an individual can fully understand dangers resulting from the lack of health care and before health is permanently damaged .
for this reason , adolescents seem to be the most appropriate age group within which health - promoting education should start .
the prerequisite for effective acquisition of healthy habits by juveniles is the incorporation of health education into the educational process .
all educated individuals should acquire knowledge about health and the skills to care for it .
the aim of this study was to assess short- and long - term impact of health education on cancer prevention by adopting and preserving prohealth attitudes among students .
we hypothesized that education would improve such knowledge and , in turn , positively affect teen readiness to modify their lifestyle .
this study initially involved 307 second - year students of secondary schools with different profiles and varied by gender , place of residence , and type of parental and scholarly education .
the protocol and consent form were approved by the medical university of gdask and review boards of all participating institutions .
all participants provided informed consent ( table 1).table 1study group characteristics before educationcharacteristicnumber ( % of total)sex boys133 ( 43.6 % ) girls172 ( 56.4 % ) place of residence city186 ( 61 % ) village119 ( 39 % ) parental education father lower than average81 ( 26.56 % ) average115 ( 37.70 % ) higher than average109 ( 35.74 % ) mother lower than average99 ( 32.46 % ) average100 ( 32.79 % ) higher than average106 ( 34.75 % ) study group characteristics before education the first phase of the study analyzed health - promoting behaviors of the juveniles assessed and evaluated their knowledge about cancer , the role of screening tests in early cancer detection , and about cancer prevention .
study participants were divided into groups according to systematic sampling , with the interval k = 5 , which was based on results of the test on cancer knowledge ( 61 students in each group , comparable in terms of age , gender , and place of residence ) . in four of them ,
different teaching methods were employed , according to the classification of methods based on the concept of multilateral teaching .
method 1 ( assimilation of knowledge using simple methods ) : this involved conducting two 45-min lectures within one week and ending in a 15-min discussion .
method 2 ( assimilation of knowledge by using complex methods ) : this involved conducting two 45-min lectures within a week , supported by audiovisual means of communication ( powerpoint presentation with tables , pictures , and short film ) .
method 3 ( independent inquiry , learning by discovery ) was a task in which the young people were asked to write a short note on cancer prevention , which was evaluated by a clinical oncologist and discussed in the entire group .
method 4 ( valorization learning by experiencing ) was an interview with a patient suffering from a cancer that could have been prevented by lifestyle modification ( lung cancer ; early breast cancer ; 45-min interview week after week ) . the fifth group ( control group ) was not educated . in the second stage
an educational program based on previously obtained results was created ( model of a lecture lasting 70 min and covering : general knowledge about cancer , lifestyle impact on the development of cancer and knowledge about the possibilities of early detection of cancer ( ratio resulted from the knowledge of young people surveyed in different areas in the questionnaire before education ) .
general knowledge about cancer was presented : definition , types , oncogenesis stages , genetic predisposition , incidence and mortality statistics in poland and in world , diagnostic and therapeutic options .
the impact of lifestyle was discussed : the definition of a healthy lifestyle ; the role of prevention , a healthy lifestyle , smoking , alcohol consumption , diet , sun exposure , sexual behavior , self - examination , possibility of early cancer detection , the role of the gp , and screening for and early detection of cervical , breast , colorectal , and early symptoms of other cancers . on this basis , a multimedia presentation was prepared . in the next phase of the study , 2 and
12 months after the education , healthy behaviors and knowledge about cancer were assessed again , and results were compared with those obtained before education .
this allowed assessing whether education improved knowledge about cancer , its prevention , and the adoption of lifestyle changes to promote healthy behaviors .
we used a diagnostic survey consisting of two questionnaires : the first evaluated knowledge about cancer ; the second was a questionnaire , health behaviour inventory ( hbi ) .
given the frequency of particular behaviors indicated by the participants , we established the intensity of behaviors conducive to health and the intensity of the four categories of healthy behaviors : healthy eating habits , disease - preventing behaviors , health practices , and positive mental attitude .
statistical analysis included descriptive statistics such as arithmetic mean , standard deviation ( sd ) , and median . to test the study hypotheses , student s t test , chi - squared test , and analysis of variance ( anova )
the mean raw point value regarding knowledge about cancer before education was 64.9 , with a maximum of 136 .
eight weeks after completion of the education program , the mean value increased statistically significantly to 88.25 . a year after education completion ,
the mean value decreased to 80.49 but remained statistically significantly higher ( p < 0.01 ) than before education .
the 33 student s t tests performed on raw data before and 8 weeks after the education for response pairs ( n = 244 ) demonstrated a statistically significant increase in the level of knowledge in all three thematic groups analyzed ( p < 0.01 ) . a year after the education , a re - examination ( n = 234 ) demonstrated a statistically significant increase in the level of knowledge ( p < 0.01 ) .
eight weeks after education , each type of education brought a benefit , calculated as the average score at the survey after education , in relation to the score prior to education , and in relation to the control group ( table 2 ) . a year after the education ,
not every kind of education brought a benefit , calculated as the average score at the survey after the education , compared with the score before education and to the control group .
the biggest benefit was observed in the group educated using complex teaching means ( method 2 ) , the lowest in the group educated using the method of valorization ( method 4 ) ( fig . 1 ) .
in the groups educated with methods 1 and 2 , the effect of education remained after 1 year ) .
results obtained in method 2 were significantly better compared with all other groups ( p < 0.05 ; methods 1 , 3 , 4 ) , to the results before education ( p < 0.01 ) , and to the control group ( p < 0.01 ) . in the case of method 3 , the increased level of knowledge assessed 2 months after education was lower compared with the groups educated by method 1 or method 2 . more importantly , the effect of education that remained 1 year after education decreased by almost a half .
the worst results were obtained using method 4 , which 8 weeks after education obtained the lowest score of all groups ( 72.93 ) , although overall results were higher than in the control group . in the noneducated control group ,
the level of knowledge did not change : 1-year later , results remained lower than in the other groups.table 2results of oncological knowledge before and after education provided by four different methods and compared with controlsmethodknowledge of oncologybefore2 months after
p value*1 year after
p value*164.4395.46<0.0194.95<0.01264.67103.95<0.01100.2<0.01364.8880.69<0.0573.44>0.05465.1472.93>0.0565.60>0.05no education65.3768.05>0.0567.35>0.05
method 1 simple methods ; method 2 complex methods ; method 3 independent inquiry , learning by discovery ; method 4 valorization learning by experiencing ; no education control group*student s t testfig .
1growth in cancer knowledge in each group in relation to average results before education prograqm .
the most effective method of education was the complex method : line no 5 results of oncological knowledge before and after education provided by four different methods and compared with controls
method 1 simple methods ; method 2 complex methods ; method 3 independent inquiry , learning by discovery ; method 4 valorization learning by experiencing ; no education control group growth in cancer knowledge in each group in relation to average results before education prograqm .
. the most effective method of education was the complex method : line no 5 initially hbi scores were low . in a multivariate analysis
, we found a statistically significant difference in juvenile lifestyle between genders ( p < 0.01 ) : , with girls having the healthier .
there was no relationship between a youths lifestyles and mothers ( p = 0.55 ) , fathers ( p = 0.82 ) , or combined parental ( p = 0.72 ) education levels or place of residence ( p = 0.96 ) . similar to results regarding knowledge about cancer , we observed a trend ( p = 0.054 ) toward healthier lifestyle in the young people who attended the class with a biochemical profile component compared with other students .
the most important finding was a statistically significant relationship between respondents lifestyle and knowledge about cancer ( p < 0.01 ) : those with knowledge had a healthier lifestyle . eight weeks after cessation of the education program , the mean value for each question concerning healthy behavior was statistically significantly higher than before the education .
the 24 student s t tests for pairs of responses in four ranges performed on raw data before and after the education program showed an increase in the level of knowledge in all four analyzed areas . after their education ,
female adolescents still led healthier lifestyles compared with male study participants ( p < 0.01 ) .
however , no other earlier studied factors had statistically significant relationships with lifestyle , including the biochemical profile of the student class ( p = 0.078 ) .
after the education program , the positive relationship between knowledge about cancer and a healthier lifestyle was observed in all categories of lifestyle . each type of education brought a benefit , calculated as the average score at hbi after education , compared with the score before education and in relation to the control group . as was shown regarding
increased knowledge in oncology , the biggest benefit was found in the group educated with complex educational means . a year after education , the 24 student s t tests performed on raw data before and after education for pairs of responses in four ranges still showed an increase in knowledge levels in all the four analysed areas of the general hbi .
again , the healthiest lifestyle was found among female adolescents ( p < 0.01 ) , and no statistically significantly better lifestyle score was obtained by respondents attending the class with a biochemical profile ( p = 0.076 ) .
the correlation between lifestyle score and knowledge of cancer remained statistically significant ( p < 0.01 ) .
the biggest benefit was found in the group educated using complex means ( fig .
2).fig . 2increased results obtained in the health behavior inventory of youth in each group in relation to average results before education .
the most effective method was the complex method : line no 5 increased results obtained in the health behavior inventory of youth in each group in relation to average results before education .
the most effective method was the complex method : line no 5 each type of education provided a benefit , calculated as the average score in the hbi at 8 weeks after in relation to prior to education and to the control group ( table 3 ) .
one year after education , the statistically significant increase remained only in the methods 1 and 2 groups , with the greatest being in method 2 ( + 20.1 ) .
results in this group were significantly better than all other groups ( p < 0.05 ) compared with before education ( p < 0.01 ) and the control group ( p < 0.01 ) . in all categories , lifestyles improved .
a statistically significant improvement was also documented in students educated with method 1 compared with methods 3 and 4 and to controls .
all students achieved significantly better results 8 weeks and again 1 year after education ( p < 0.01 ) compared with before education and the control group ( p < 0.01 ) . in all categories , lifestyles became healthier .
those educated with method 3 showed a statistically significant increase in knowledge 8 weeks after compared with before the education program ( p < 0.01 ) .
however , the average score 1 year after education was not significantly different from before education and was significantly lower than methods 1 and 2 . a similar trend was observed in the method 4 group : mean score 8 weeks after was significantly higher than before education and in the control group ( p < 0.05 ) , ; the score 1 year after was similar to prior to education and was no different from the control group . in this group ,
lifestyle improved only in two categories : health practices and proper eating habits . in the control group hbi assessment
did not change ( table 3).table 3health behaviors before and after four methods of educationmethodindex of health behaviorbefore2 months after
p value*1 year after
p value*171.684.2<0.0182.98<0.01270.890.9<0.0190.4<0.01369.282.9<0.0170.98>0.05469.978.6<0.0169.9>0.05without education68.168.5>0.0566.56>0.05
method 1 simple methods ; method 2 complex methods ; method 3 independent inquiry , learning by discovery ; method 4 learning by experiencing ; no education control group*student s t test health behaviors before and after four methods of education
method 1 simple methods ; method 2 complex methods ; method 3 independent inquiry , learning by discovery ; method 4 learning by experiencing ; no education control group
the mean raw point value regarding knowledge about cancer before education was 64.9 , with a maximum of 136 .
eight weeks after completion of the education program , the mean value increased statistically significantly to 88.25 . a year after education completion ,
the mean value decreased to 80.49 but remained statistically significantly higher ( p < 0.01 ) than before education .
the 33 student s t tests performed on raw data before and 8 weeks after the education for response pairs ( n = 244 ) demonstrated a statistically significant increase in the level of knowledge in all three thematic groups analyzed ( p < 0.01 ) . a year after the education , a re - examination ( n = 234 ) demonstrated a statistically significant increase in the level of knowledge ( p < 0.01 ) .
eight weeks after education , each type of education brought a benefit , calculated as the average score at the survey after education , in relation to the score prior to education , and in relation to the control group ( table 2 ) . a year after the education ,
not every kind of education brought a benefit , calculated as the average score at the survey after the education , compared with the score before education and to the control group .
the biggest benefit was observed in the group educated using complex teaching means ( method 2 ) , the lowest in the group educated using the method of valorization ( method 4 ) ( fig . 1 ) .
in the groups educated with methods 1 and 2 , the effect of education remained after 1 year ) .
results obtained in method 2 were significantly better compared with all other groups ( p < 0.05 ; methods 1 , 3 , 4 ) , to the results before education ( p < 0.01 ) , and to the control group ( p < 0.01 ) . in the case of method 3 , the increased level of knowledge assessed 2 months after education was lower compared with the groups educated by method 1 or method 2 . more importantly , the effect of education that remained 1 year after education decreased by almost a half .
the worst results were obtained using method 4 , which 8 weeks after education obtained the lowest score of all groups ( 72.93 ) , although overall results were higher than in the control group . in the noneducated control group ,
the level of knowledge did not change : 1-year later , results remained lower than in the other groups.table 2results of oncological knowledge before and after education provided by four different methods and compared with controlsmethodknowledge of oncologybefore2 months after
p value*1 year after
p value*164.4395.46<0.0194.95<0.01264.67103.95<0.01100.2<0.01364.8880.69<0.0573.44>0.05465.1472.93>0.0565.60>0.05no education65.3768.05>0.0567.35>0.05
method 1 simple methods ; method 2 complex methods ; method 3 independent inquiry , learning by discovery ; method 4 valorization learning by experiencing ; no education control group*student s t testfig .
1growth in cancer knowledge in each group in relation to average results before education prograqm .
the most effective method of education was the complex method : line no 5 results of oncological knowledge before and after education provided by four different methods and compared with controls
method 1 simple methods ; method 2 complex methods ; method 3 independent inquiry , learning by discovery ; method 4 valorization learning by experiencing ; no education control group growth in cancer knowledge in each group in relation to average results before education prograqm .
. the most effective method of education was the complex method : line no 5
initially hbi scores were low . in a multivariate analysis , we found a statistically significant difference in juvenile lifestyle between genders ( p < 0.01 ) : , with girls having the healthier .
there was no relationship between a youths lifestyles and mothers ( p = 0.55 ) , fathers ( p = 0.82 ) , or combined parental ( p = 0.72 ) education levels or place of residence ( p = 0.96 ) . similar to results regarding knowledge about cancer , we observed a trend ( p = 0.054 ) toward healthier lifestyle in the young people who attended the class with a biochemical profile component compared with other students .
the most important finding was a statistically significant relationship between respondents lifestyle and knowledge about cancer ( p < 0.01 ) : those with knowledge had a healthier lifestyle . eight weeks after cessation of the education program , the mean value for each question concerning healthy behavior was statistically significantly higher than before the education .
the 24 student s t tests for pairs of responses in four ranges performed on raw data before and after the education program showed an increase in the level of knowledge in all four analyzed areas .
after their education , female adolescents still led healthier lifestyles compared with male study participants ( p < 0.01 ) .
however , no other earlier studied factors had statistically significant relationships with lifestyle , including the biochemical profile of the student class ( p = 0.078 ) .
after the education program , the positive relationship between knowledge about cancer and a healthier lifestyle was observed in all categories of lifestyle .
each type of education brought a benefit , calculated as the average score at hbi after education , compared with the score before education and in relation to the control group . as was shown regarding
increased knowledge in oncology , the biggest benefit was found in the group educated with complex educational means . a year after education , the 24 student s t tests performed on raw data before and after education for pairs of responses in four ranges still showed an increase in knowledge levels in all the four analysed areas of the general hbi .
again , the healthiest lifestyle was found among female adolescents ( p < 0.01 ) , and no statistically significantly better lifestyle score was obtained by respondents attending the class with a biochemical profile ( p = 0.076 ) . the correlation between lifestyle score and knowledge of cancer remained statistically significant ( p < 0.01 ) . however , those with higher knowledge about cancer had a healthier lifestyle . the biggest benefit was found in the group educated using complex means ( fig .
2).fig . 2increased results obtained in the health behavior inventory of youth in each group in relation to average results before education .
the most effective method was the complex method : line no 5 increased results obtained in the health behavior inventory of youth in each group in relation to average results before education .
the most effective method was the complex method : line no 5 each type of education provided a benefit , calculated as the average score in the hbi at 8 weeks after in relation to prior to education and to the control group ( table 3 ) .
one year after education , the statistically significant increase remained only in the methods 1 and 2 groups , with the greatest being in method 2 ( + 20.1 ) .
results in this group were significantly better than all other groups ( p < 0.05 ) compared with before education ( p < 0.01 ) and the control group ( p < 0.01 ) . in all categories ,
a statistically significant improvement was also documented in students educated with method 1 compared with methods 3 and 4 and to controls .
all students achieved significantly better results 8 weeks and again 1 year after education ( p < 0.01 ) compared with before education and the control group ( p < 0.01 ) . in all categories , lifestyles became healthier .
those educated with method 3 showed a statistically significant increase in knowledge 8 weeks after compared with before the education program ( p < 0.01 ) .
however , the average score 1 year after education was not significantly different from before education and was significantly lower than methods 1 and 2 .
a similar trend was observed in the method 4 group : mean score 8 weeks after was significantly higher than before education and in the control group ( p < 0.05 ) , ; the score 1 year after was similar to prior to education and was no different from the control group . in this group ,
lifestyle improved only in two categories : health practices and proper eating habits . in the control group hbi assessment
did not change ( table 3).table 3health behaviors before and after four methods of educationmethodindex of health behaviorbefore2 months after
p value*1 year after
p value*171.684.2<0.0182.98<0.01270.890.9<0.0190.4<0.01369.282.9<0.0170.98>0.05469.978.6<0.0169.9>0.05without education68.168.5>0.0566.56>0.05
method 1 simple methods ; method 2 complex methods ; method 3 independent inquiry , learning by discovery ; method 4 learning by experiencing ; no education control group*student s t test health behaviors before and after four methods of education
method 1 simple methods ; method 2 complex methods ; method 3 independent inquiry , learning by discovery ; method 4 learning by experiencing ; no education control group
the central hypothesis of this study was the assumption that education will improve knowledge of cancer prevention and , this in turn , will affect readiness to modify lifestyle .
second , it was assumed that the optimal age for health education is when an individual can fully understand the dangers resulting from the lack of health care and whose health has not yet been permanently damaged . therefore ,
secondary school youths were selected for the study as being in the formative period of their lives and being susceptible to lifestyle changes providing they consider them important .
this suggests the insufficient role of the existing forms of education in this field being carried out in high schools .
nevertheless , it should be emphasized that knowledge about the influence of lifestyle on cancer morbidity and mortality was statistically significantly higher than knowledge of the basic concepts surrounding cancer and cancer screening programs .
. it may be due to knowledge gleaned from parents , or more likely , the result of wide - ranging media attention in recent years providing information on and promoting healthy living , mostly financed by the european union ( eu ) .
discussion on the prohibition of smoking in public places in eu countries could also explain increasing awareness about the negative effects of smoking and its influence on the development of certain cancers .
a concern is that there seems to be a lack of knowledge of cancer prevention programs , which may be due to insufficient emphasis in schools on such knowledge .
the concern surrounding lack of knowledge among adolescents about cancer - prevention programs is twofold : according to predictions , the current adolescent generation will have an increased cancer morbitity and mortality rate than their ancestors , making their participation in prevention programs highly desirable .
second , and perhaps the most important for practicing oncologists , increased knowledge could improve cancer detection among parents of educated youth .
most parents are at an age where breast cancer morbidity peaks and colorectal and cervical cancer are diagnosed .
one would hope that educating students on cancer prevention and healthy lifestyle could become an effective way to inform parents , the potential recipients of prevention programs .
our study confirm the validity of the assumed hypothesis concerning the relationship between cancer education and lifestyle .
, we can say that adolescents are underinformed about healthy lifestyle habits and behaviors , which may in part be a result of lack of education on the subject . as expected , female participants had a higher level of knowledge about cancer , including the impact of lifestyle on cancer morbidity .
the level of knowledge of young people evaluated immediately after education was much higher than before . in all survey questions , average scores were generally significantly higher than before education . the most important finding is the fact that after education , every answer about healthy behavior achieved statistically significantly higher scores than before education , resulting in a healthier lifestyle in each range .
moreover , education was the most important factor influencing hbi survey results , and this effect was maintained after 1 year .
the effect of education was therefore permanent , and most importantly , so was the impact of education on creating healthy lifestyle . due to lack of standardized and verified methods of conducting health education , choosing
one study objective was to determine which method was the most effective for increasing participant s knowledge concerning cancer and lifestyle modification .
sustainability of lifestyle changes was positively influenced by method 2 , consisting of lecture application of complex teaching methods .
dale s cone of learning , which shows the average ability to recall information depends upon the educational method used .
there is no doubt that the key to a successful presentation is to focus on the audience and their needs , not only on information considered to be important and correct .
teachers emphasize that to pass knowledge well , first , gain the recipient s attention and interests . in times dominated by technology , it seems that the best possible way to achieve this objective is to involve the highest number of senses .
if one needs to emphasize the most important ideas , information should be displayed longer .
thus , in a multimedia presentation , lectures are supported by a presentation with slides , photos , and/or a short video .
it seems that the study reported here is the first evidence demonstrating the general rules of pedagogy in the field of health education .
the next best way in terms of effectiveness was method 1 , based on discussion and lecture using simple teaching means .
this is consistent with the general trend in education and the contemporary processes of transition from paternalistic to partnership education . relatively good but
short - lasting results were obtained using the independent investigation into knowledge . in view of results after 1 year
, however , it seems that this form of education does not create a long - term impact , is not memorable , and certainly should not take the single form .
surprisingly , a weak though statistically significant result 8 weeks after education was obtained with the valorization method .
one could , however , presume that this form of education will not increase proportionally all thematic areas of oncology and knowledge of all areas involved in a healthy lifestyle . that the effect was short lived confirms the hypothesis that the effect can be due only to fear of cancer . to summarize , our primary goal was to identify any statistically significant relationship between the lifestyles of the surveyed youth and their knowledge about cancer .
this proves the relationship between such knowledge and the readiness to adopt healthy attitudes and behaviors . in view of the general lack of knowledge about cancer among young people ,
as shown in this study , our work emphasizes the importance of developing prohealth education .
any kind of education positively influence the every individual s state of knowledge in the short term , but for the long term , only selected educational methods proved to be effective .
the most effective method of education was assimilation of knowledge , i.e. , discussion and lecture using complex teaching means .
based on results of this study , intend to conduct a pilot youth educational program in schools in a district in the province of pomerania , poland .
Output:
| reduction in the incidence of cancer can be achieved through appropriate health behaviors . we hypothesized that education would improve knowledge of cancer prevention , and this , in turn , will affect and individual s readiness to modify lifestyle .
the aim of this study was to assess the impact of cancer prevention education on adopting and preserving prohealth attitudes among high school students in poland .
research participants were 307 high school students varying by gender , place of residence , parents education , and type of school education .
participants were divided into five groups , of which four were educated using different methods according to classification methods based on the concept of multilateral learning .
the fifth ( control ) group was not educated .
the effects of education were assessed 1 month and 1 year after education .
general knowledge about cancer and healthy lifestyle level before education was low .
after education , both increased compared with the control group .
there was a clear relationship between level of knowledge and readiness to adopt and healthy attitudes and behavior .
the most effective method of education was a discussion and a lecture by means of teaching complex .
education significantly improved generally low knowledge about cancer and healthy lifestyle in high school students .
this indicates the urgent need to implement such educational programs . |
PubmedSumm6857 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: schizophrenia is a serious and neurodevelopmental disorder , which affects approximately 1% of the general population often - devastating effects such as psychological , social and financial skills .
schizophrenia can disturb memory , attention , thought and motivation of affected patients ( 1 ) .
twin concordance rates , family and adoption studies , genetic linkage and allelic association analyses revealed a strong genetic element contributing to schizophrenia ( 2 ) .
therefore , due to the high percentage of heredity involvement , over 1000 genes have been tested to assess such an association .
this makes schizophrenia one of the most studied disorders through a candidate gene approach ( 4 , 5 ) .
caveolins ( encoded by cav1 gene ) are multifunctional scaffolding and cholesterol binding proteins organizing other lipids and proteins in surface domains ; also they regulate various cellular functions such as lipid homeostasis , vesicular trafficking and signal transduction .
in fact , caveolin is extensively expressed in the nervous systems ( 7 - 11 ) . in cav1
knock - out mice , neurodegeneration and aging is more advanced than normal mice ( 12 , 13 ) . current analyses of genomic structural variations in patients with schizophrenia showed that caveolin-1 gene ( cav1 ) is disrupted by an insertion mutation , therefore the cav1 is identified as a rare structural variant correlated with schizophrenia ( 14 ) .
given the importance of this region in neurodegenerative diseases , any changes in this area of genome may result in illnesses such as schizophrenia .
cav1 is also known as an interacting partner of g - protein and its loss can cause destruction of neuronal signaling leading to signs of schizophrenia in susceptible persons ( 9 - 11 ) .
the purine rich complex at the 1.5 kb upper region of the human cav1 gene is composed of three tandem strs of ggaa , gaaa and ggaa motifs , which is conserved in different species as shown in table 1 ( 15 , 16 ) . a skew in the homozygous haplotype of this region in patients with multiple sclerosis ( ms ) and late onset alzheimer s disease ( ad ) has been reported versus controls .
twenty homozygous haplotypes have been identified in two neurodegenerative disorders increasing cav1 gene expression ( 17 ) .
in the current study , test and trails were conducted and observed , to obtain a correlation between the genome area and schizophrenia .
in this case - control study , 127 unrelated patients with schizophrenia were included ( diagnosed based on diagnostic and statistical manual of mental disorders , fourth edition , 1994 , dsm - iv ) .
patients with iq below 90 , major depression , bipolar disorder and abuse of amphetamine and cannabis were excluded .
samples were selected from 22 bahman hospital , a psychology special hospital of qazvin university of medical sciences ( qums ) , iran .
the 22 bahman hospitals is a referral psychology center , which has four sections with 100 beds .
patients were selected by a psychologist using consecutive sampling method from april 2012 to april 2013 . furthermore , 127 healthy subjects were selected as controls .
cases and controls were 51% males and 49% females and their mean age was 41.5 years .
an informed consent was obtained from all participants and the study was approved in the ethics committee ( ethic no ; 93.04.03 - 8890).the sample size was calculated according to this formula : f = 15% ( loss to follow - up ) , 1- = 95% , 1- = 80% , p0 = 0.18 , p1 = 0.35 all laboratory techniques were performed in molecular and cellular research center of qums .
the pcr primers were designed by primer three tools for amplifying upstream region of the cav1 gene .
pcr reactions were performed in 25 l volume , including 100 ng genomic dna , 10 pmol of each primer , 12.5 microliter mastermix ( takara ; japan ) and 10 microliters of distilled water .
pcr temperature profiles were initially denaturized at 95c for three minutes , 30 seconds at 95c , 30 seconds at 60c , 30 seconds at 72c , for 30 cycles , followed by five minutes final extension at 72c .
the produced fragments with 388 bp were detected on 10% polyacrylamide gel by electrophoresis and silver staining .
we looked for three tandem strs of ggaa , gaaa , and ggaa motifs in sequenced fragments .
the pcr primers were designed by primer three tools for amplifying upstream region of the cav1 gene .
pcr reactions were performed in 25 l volume , including 100 ng genomic dna , 10 pmol of each primer , 12.5 microliter mastermix ( takara ; japan ) and 10 microliters of distilled water .
pcr temperature profiles were initially denaturized at 95c for three minutes , 30 seconds at 95c , 30 seconds at 60c , 30 seconds at 72c , for 30 cycles , followed by five minutes final extension at 72c .
the produced fragments with 388 bp were detected on 10% polyacrylamide gel by electrophoresis and silver staining .
we looked for three tandem strs of ggaa , gaaa , and ggaa motifs in sequenced fragments .
all pcr products were sequenced to check this region . an example image of the sequences
we detected nine homozygotes in patients with schizophrenia and 15 homozygotes in the control subjects .
nine different types of homozygote haplotypes with different repeat numbers were detected in cases and controls .
some of homozygote haplotypes were detected in both patients and controls , but a number of haplotype lengths were found in cases and not observed in the controls and some of haplotype lengths were identified in controls and not observed in the cases .
these haplotypes contained 4 - 13 - 7 ( 110 bp ) , 5 - 10 - 8 ( 114 bp ) , 5 - 12 - 9 ( 118 bp ) and 6 - 13 - 8 ( 110bp ) ( table 3 ) , while haplotypes 4 - 12 - 7 ( 106 bp ) , 7 - 11 - 9 ( 118 bp ) , 11 - 12 - 6 ( 126 bp ) , 7 - 12 - 8 ( 124 bp ) and 11,10,8 ( 130 bp ) only existed in controls ( haplotypes 6 - 9 , table 3 ) .
only one haplotype was seen in cases only ( haplotype n. 4 , table 3 ) .
this figure shows tandem strs of ggaa , gaaa , ggaa motifs and haplotype length [ e.g. 126-bp ( 11 - 12 - 6 haplotype ) ] .
there are a number of reports about implicating purine complex of upstream cav1 human gene involvement in pathophysiology of neurodegenerative diseases such as multiple sclerosis ( ms ) and alzheimer 's disease ( ad ) ( 8 , 18 ) . according to existing information ,
this region is conserved across several species , and consists of ggaa , gaaa and ggaa motifs , transcription consensus sites for the ets and irf ( interferon regulatory factor ) family members .
the interaction between ets and irf family members has been shown in different studies ( 7 , 8) .
furthermore , inflammation plays a role in neurodegenerative diseases and several inflammatory transcription factors like stat4 and interferon regulatory factor ( irf ) .
in which , these factors bind to the cav1 upstream purine complex and regulate target genes ( 12 , 19 , 20 ) . some literatures categorized schizophrenia as a neurodegenerative disease ( 1 , 14 ) . to examine the hypothesis that purine complex of upstream cav1
may be related to pathogenesis of schizophrenia , we investigated this region in a group of patients with schizophrenia and compared the results with well - matched controls . in this research , homozygote haplotypes of ggaa , gaaa and ggaa motifs
chi square test showed that these haplotypes significantly related to object ( e.g. haplotype 4 , table 3 , p = 0.016 , p < 0.05 ) .
statistical analysis showed no significant association between these haplotypes and schizophrenia ( for example ; haplotype 6 , table 3 , p = 0.15 , 7 and 8 p = 0.25 , p > 0.05 ) .
these findings implied a significant correlation between schizophrenia and some haplotypes of this region of cav1 gene .
existence of some haplotypes and lack of another in cav1 upstream can suggest a significant correlation between schizophrenia and some haplotypes . to the best of our knowledge ,
this was the first study to assess the association between purine complex upstream region of human cav1 and schizophrenia disease .
Output:
| background : caveolin is a multifunctional and scaffolding membrane protein , which involves cholesterol trafficking to plasma lipid microdomain .
it organizes and targets synaptic parts of the neurotransmitter and neurotrophic receptor signaling pathways .
caveolins are encoded by cav-1 , 2 and 3 genes .
disruption of the cav1 would likely ruin the neuronal signaling , which leads to symptoms of schizophrenia in predisposed individuals.objectives:the upper area of cav-1 gene is highly conserved and can have a regulatory role in neurodegenerative diseases .
this study was designed to find out the possible association of polymorphisms of this area and schizophrenia.patients and methods : in a case - control study , 254 blood samples were obtained from 127 patients with schizophrenia and 127 well matched controls referred to 22 bahman hospital of qazvin university of medical sciences ( qums ) in qazvin province , iran , using simple random sampling method . after extracting dna , the upper region of the human cav1- gene was amplified by pcr in all collected samples .
the products were visualized by silver staining in 10% polyacrylamide gel and then sequenced.results:we detected nine homozygotes in patients and 15 in control subjects .
homozygosity was 7.08% and 11.8% in cases and control , respectively .
nine types homozygote haplotype were detected in upper region of the cav1 gene in cases and controls .
three haplotypes were common in cases and controls ; four haplotypes were seen in controls only and two in cases.conclusions:our findings implied a significant correlation between some haplotypes of upper region of cav1 gene and schizophrenia .
existence of some haplotypes and lack of another in cav1 upstream can suggest a significant correlation between schizophrenia and some haplotypes . |
PubmedSumm6858 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: aortoesophageal fistula is a rare , devastating and usually fatal condition which has multiple aetiological factors . the first report , in 1818 , described the death of a 28-year - old soldier who exsanguinated after ingesting a beef bone fragment .
a comprehensive review , published by hollander and quick , which included 500 cases of fistula , identified three major causes of aortoesophageal fistula , the main aetiologic factor being aortic disease with 54.2% of cases secondary to rupture of a descending thoracic aorta aneurysm into the oesophagus . foreign body ingestion ( 19.2% ) and advanced esophageal carcinoma ( 17.0% ) were the next commonest causes .
regardless of cause , the optimal management of the fistula remains controversial , and recent literature has focused on the role of endovascular techniques and open thoracic surgery .
however , high mortality from the condition usually results from massive uncontrolled haemorrhage prior to these interventions being possible .
although non - surgical measures to control the initial haemodynamic insult caused by haemorrhage have been described , this remains a relatively unexplored area of management .
a 47-year - old caucasian man with recently diagnosed advanced esophageal cancer attended the imaging department for an ultrasound scan . in the waiting area , the patient had a massive haematemesis and proceeded into a peri - arrest state .
tech , seoul , distributed by mtw , wesel , germany ) was inserted across the lesion .
ct confirmed an esophageal tumour in continuity with the right main bronchus with an associated right lung abscess .
an overlapping fully covered 12 18 alveolus aero stent ( alveolus , charlotte , n.c . ,
1 ) , presumably because the bronchial fistula had been adequately sealed with the stents , creating an undrained collection in the lung which subsequently fistulated through to the pleural cavity .
while awaiting a video - assisted thoracoscopic surgical procedure to drain and seal the abscess and empyema , he spontaneously drained the abscess by coughing up nearly 1 litre of pus in 24 h ; this led to a dramatic improvement in his clinical state and resolution of his chest x - ray changes .
a week before the ultrasound scan he experienced mid - thoracic pain and small episodes of haematemesis . when he collapsed , he was tachycardic ( heart rate 128 bpm ) with unrecordable blood pressure .
its clearance identified a large arterial bleeding point , just above the proximal end of the stent in the mid - esophagus ( fig .
a further 28 mm diameter niti - s covered esophageal stent ( taewong medical , seoul , korea ) was inserted to tamponade the bleeding point ( fig .
despite aggressive resuscitation with fluids and 8 units of blood , there was no improvement in his haemodynamic status until after stent deployment .
the patient was transferred to the intensive care unit where fresh bleeding continued to be aspirated from his nasogastric tube overnight .
a further 8 units of blood and 6 units of fresh frozen plasma were transfused to maintain his haemoglobin between 7 and 7.7 g / dl . with this
ct angiography was performed and demonstrated an aortoesophageal fistula at the level of the carina with ongoing bleeding into the mediastinum ( fig .
was inserted into the thoracic aorta distal to the origin of the left subclavian artery sealing the fistula .
he survived for 2 months at home , during which he was able to attend to his personal affairs , before dying of disseminated malignancy .
this case highlights the successful non - surgical management of a massive bleed caused by aortoesophageal fistula .
the esophageal stent acted as a means to tamponade and provided partial initial control of the bleeding point .
this allowed time for appropriate endovascular intervention in the form of a thoracic endoluminal stent device to further stabilise the haemodynamic status of the patient .
the challenge to recognise and treat successfully before the patient exsanguinates is probably why success stories for closure of aortoesophageal fistulas are few .
high clinical suspicion and recognition of warning symptoms such as mid - thoracic pain and sentinel arterial upper gastrointestinal haemorrhage is crucial .
transient self - limiting ' herald ' bleeds may precede fatal exsanguination by more than 24 h .
this ' window of opportunity ' allows early transfer to a specialist centre . high clinical suspicion and
first reported using an endoluminal stent graft for repair of abdominal aortic aneurysms , thoracic endovascular aortic repair ( tevar ) has become more common in the management of aortoesophageal fistula , with much of the literature focusing on endovascular and open surgical management .
a recently reported successful surgical approach advocated open transthoracic esophageal resection , cervical esophagectomy and gastrostomy .
the patient had developed a fistula secondary to previous tevar , so the authors could not decide the best approach to salvage the thoracic aorta .
although successful in stabilising the patient , this highly invasive approach may not be suitable for patients with advanced esophageal malignancy .
less invasive successful endovascular management of fistulas in patients with esophageal malignancy has been reported .
one report describes the use of a dacron prosthesis interposed into the descending thoracic aorta to restore aortic flow as successful endovascular intervention ; the same patient later underwent an esophagectomy for definitive treatment .
a separate report describes successful endovascular intervention to stabilise bleeding , although again this patient also went on to require further definitive gastrointestinal surgical management .
further reports [ 9 , 10 , 11 ] appear to suggest that although tevar is a useful method for achieving hemodynamic stability , for definitive long - term management the patient will require some form of open surgical intervention .
of course with advanced esophageal malignancy , patients may simply not be suitable for surgery , leaving tevar as their only option .
the problem with tevar remains that it does not prevent immediate exsanguination in patients admitted with fistula .
it was found in patients who underwent tevar that early esophageal repair appeared to improve survival .
literature on the successful esophageal management of the initial exsanguination remains limited , with the successful use of a sengstaken - blakemore tube prior to tevar being reported .
newer techniques have been emerging , such as the use of cyanoacrylate embolisation of the fistula followed by tevar .
the use of esophageal stenting as a means of controlling initial exsanguination remains a relatively unexplored area of management . in conclusion , with early recognition , esophageal stenting may have a role in the initial emergency control of bleeding due to aortoesophageal fistula , but clearly , immediate access to anaesthetic , interventional endoscopic and radiological services is mandatory .
Output:
| aortoesophageal fistulas are a rare but commonly fatal complication of esophageal cancer
. reports of successfully managed cases are few , with high mortality and morbidity usually resulting from failure to control the initial massive haemodynamic insult .
we report the case of a 47-year - old caucasian man with recently diagnosed advanced esophageal cancer who suffered an episode of massive haematemesis .
emergency gastroscopy revealed an arterial bleeding point in the proximal esophagus .
a self - expanding metal esophageal stent was placed to achieve initial partial haemostasis .
ct angiography confirmed an aortoesophageal fistula .
an endoluminal stent device was thus inserted within the thoracic aorta stabilising the bleeding point .
the patient subsequently made an uneventful recovery and was discharged on long - term antibiotics for palliative care .
he survived for 2 months at home before dying of disseminated malignancy .
the successful use of esophageal stenting as a means of achieving haemostasis , allowing time for endovascular intervention , is as yet a relatively unexplored area of management of this rare condition . |
PubmedSumm6859 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: different carbanionic nucleophiles can be reacted with -amido sulfones , affording a wide variety of amino derivatives [ 2 - 7 ] .
in addition , considerable research has been conducted on the reaction of nitrogen nucleophiles and ,-unsaturated carbonyls [ 8 - 11 ] .
heteronucleophiles as well as carbanionic reagents can react with -amido sulfones , thus giving the opportunity to prepare a large array of amino derivatives .
furthermore , a series of amino derivatives containing 1 , 3 , 4-oxadiazole ring were synthesized by the reaction of 1 , 3 , 4-oxadiazole-2-thiol with suitably substituted amines and formaldehyde in ethanol . based on these reports , we executed an inorganic base - mediated reaction of 5-subsititued phenyl-1 , 3 , 4-oxadiazole-2-thiols as the source of nitrogen nucleophiles with n - benzoyl--amido sulfones to produce n , n - aminals .
interestingly , the resulting compounds bearing a 1 , 3 , 4-oxadiazole ring are often associated with significant fungicidal and insecticidal activities [ 13 - 15 ] .
nevertheless , as of today , there has been no report on antiviral activities of n - substituted benzamides bearing 1,3,4-oxadiazol unit .
the synthetic route to the title n - substituted benzamides 5 is shown in scheme 1 . in order to prepare the key electrophilic component n - benzoyl--amido sulfones 4 for the final reaction , a three components reaction involving aromatic aldehyde , benzamide and sodium sulfonate was used by modifying the procedure reported by chemla .
the reaction was fast , free of any significant side products formation and the pure product was isolated in moderate yield through recrystallization .
the sulfones were characterized by h nmr , c nmr and ir spectral data . finally , reaction of nitrogen nucleophiles 3 with n - benzoyl--amido sulfones in the presence of basic catalyst koh in ch2cl2 at room temperature afforded the desired n - substituted benzamides 5 bearing 1,3,4-oxadiazol group [ additional file 1 ] .
the effect of different solvents and bases was studied at room temperature with a fixed reaction time of 24 h ( table 1 ) . under these conditions , dichloromethane ( ch2cl2 ) provided the product in higher yield compared to toluene , tetrahydrofuran ( thf ) or acetonitrile . amongst the various bases screened for the experiment , koh gave the best result and higher conversion was achieved when 1.2 equiv of koh was used instead of 1.0 equiv . under optimized conditions ,
the isolated yield of the n - substituted benzamides 5a reached as high as 70% when the reaction mixture was stirred for 24 h in ch2cl2 using 1.2 equiv of koh .
synthetic sequence to n - substituted benzamide analogues 5 containing 1,3,4-oxadiazole ring . effect of different solvents and bases for the synthesis of 5a unless otherwise noted , reactions were carried out with 0.5 mmol ( 1.0 equiv ) of 4a , 0.6 mmol ( 1.2 equiv ) of 3a in 5.0 ml solvent and 1 ml h2o using 0.6 mmol ( 1.2 equiv ) of basic catalyst at room temperature for 24 h. reaction was carried out with 0.5 mmol ( 1.0 equiv ) of koh at room temperature for 24 h. isolated yield after chromatographic purification .
the results of in vivo antiviral activity studies of the n - substituted benzamides 5a-5u against cmv are given in table 2 .
most of the compounds showed promising results in terms of curative bioactivities at 500 g / ml . the comparison of the antiviral activity of the products with commercial reference leads to the following conclusions : ( a ) the antiviral activity is affected by the type of the substituents present in the compound .
the compounds containing 2-fluorophenyl or 4-fluorophenyl group showed better anti - cmv activity compared with those derived from other groups .
in particular , n - substituted benzamides 5o ( r= o - f , r= p - cl ) and 5c ( r= p - f , r= m - cl ) displayed moderate curative rates ( 48.7% and 42.2% , respectively ) against cmv at the concentration of 500 g / ml . these values were comparable to the curative rate ( 53.4% ) shown by the commercial reference ningnanmycin , and superior to other compounds bearing different substituents .
compared with the compounds 5o and 5c bearing suitably substituted aryl substituents , the compounds bearing an unsubstituted phenyl ring , such as 5a and 5n , showed lower inhibitory activities .
( c ) the structural modification caused by changing the substituents ( rand r ) in the phenyl ring have a wide impact on anti - viral activity of the prepared compounds .
bioactivity of various compounds having the same substituents at different positions of the phenyl ring is various .
thus , amongst the compounds 5b , 5c , 5o and 5p containing the same substituents at different positions of the phenyl ring , the compound 5o carrying 4-chloro and 2-fluoro groups in their respective phenyl rings exhibited better bioactivity than others . although these compounds , in general , exhibited slightly lower activity in comparison with the commercial reference ningnanmycin at the concentration of 500 g / ml , some suitably substituted n - substituted benzamides bearing 1,3,4-oxadiazol moiety showed favourable antiviral activity in the preliminary studies .
subtle structural variation might lead to enhancement of activity and should be the direction of future research .
curative effect of the title compounds 5 against cmv in vivo all antiviral tests were carried out at the concentration of 500 g / ml .
the results of in vivo antiviral activity studies of the n - substituted benzamides 5a-5u against cmv are given in table 2 .
most of the compounds showed promising results in terms of curative bioactivities at 500 g / ml . the comparison of the antiviral activity of the products with commercial reference leads to the following conclusions : ( a ) the antiviral activity is affected by the type of the substituents present in the compound .
the compounds containing 2-fluorophenyl or 4-fluorophenyl group showed better anti - cmv activity compared with those derived from other groups .
in particular , n - substituted benzamides 5o ( r= o - f , r= p - cl ) and 5c ( r= p - f , r= m - cl ) displayed moderate curative rates ( 48.7% and 42.2% , respectively ) against cmv at the concentration of 500 g / ml .
these values were comparable to the curative rate ( 53.4% ) shown by the commercial reference ningnanmycin , and superior to other compounds bearing different substituents .
( b ) substituents have a certain influence on the activity . compared with the compounds
5o and 5c bearing suitably substituted aryl substituents , the compounds bearing an unsubstituted phenyl ring , such as 5a and 5n , showed lower inhibitory activities .
( c ) the structural modification caused by changing the substituents ( rand r ) in the phenyl ring have a wide impact on anti - viral activity of the prepared compounds .
bioactivity of various compounds having the same substituents at different positions of the phenyl ring is various .
thus , amongst the compounds 5b , 5c , 5o and 5p containing the same substituents at different positions of the phenyl ring , the compound 5o carrying 4-chloro and 2-fluoro groups in their respective phenyl rings exhibited better bioactivity than others . although these compounds , in general , exhibited slightly lower activity in comparison with the commercial reference ningnanmycin at the concentration of 500 g / ml , some suitably substituted n - substituted benzamides bearing 1,3,4-oxadiazol moiety showed favourable antiviral activity in the preliminary studies . subtle structural variation might lead to enhancement of activity and should be the direction of future research .
curative effect of the title compounds 5 against cmv in vivo all antiviral tests were carried out at the concentration of 500 g / ml .
the melting points of the products were determined on an xt-4 binocular microscope ( beijing tech instrument co. , china ) and were not corrected .
the ir spectra were recorded on a bruker vector 22 spectrometer in a kbr disk .
h nmr ( 500 mhz ) , c nmr ( 125 mhz ) and f nmr ( 470 mhz ) spectral analyses were performed on a jeol - ecx 500 nmr spectrometer at room temperature using tms as an internal standard and cdcl3 as the solvent .
intermediate 1 , intermediate 2 and 5-subsititued phenyl-1,3,4-oxadiazole-2-thiol 3 were prepared according to the reported methods and used without further purifications [ additional file 2 ] .
the leaves of nicotiana tabacum l. inoculated with cmv were selected and grinded in phosphate buffer and filtered through double - layer pledget .
the filtrate was centrifuged at 8000 g and the supernatant liquid was the crude extract of virus .
absorbance values were estimated at 260 nm using an ultraviolet spectro - photometer . tested compounds and 2% ningnanmycin aqua used as a reference antiviral agent were first dissolved in minimum volume of n , n - dimethylformamide ( dmf ) and then diluted with distilled water containing 1% tween 20 at 500 g / ml concentration .
crude extracts of cmv were dipped and inoculated with a brush on the whole leaves , which were previously scattered with silicon carbide .
the compound solution was smeared on the left side of leaves , and the solvent was smeared on the right side for control .
the inhibition rate of the compound was calculated according to the following formula ( av denotes average ) :
the melting points of the products were determined on an xt-4 binocular microscope ( beijing tech instrument co. , china ) and were not corrected .
the ir spectra were recorded on a bruker vector 22 spectrometer in a kbr disk .
h nmr ( 500 mhz ) , c nmr ( 125 mhz ) and f nmr ( 470 mhz ) spectral analyses were performed on a jeol - ecx 500 nmr spectrometer at room temperature using tms as an internal standard and cdcl3 as the solvent .
intermediate 1 , intermediate 2 and 5-subsititued phenyl-1,3,4-oxadiazole-2-thiol 3 were prepared according to the reported methods and used without further purifications [ additional file 2 ] .
the leaves of nicotiana tabacum l. inoculated with cmv were selected and grinded in phosphate buffer and filtered through double - layer pledget .
the filtrate was centrifuged at 8000 g and the supernatant liquid was the crude extract of virus .
tested compounds and 2% ningnanmycin aqua used as a reference antiviral agent were first dissolved in minimum volume of n , n - dimethylformamide ( dmf ) and then diluted with distilled water containing 1% tween 20 at 500 g / ml concentration .
crude extracts of cmv were dipped and inoculated with a brush on the whole leaves , which were previously scattered with silicon carbide .
the compound solution was smeared on the left side of leaves , and the solvent was smeared on the right side for control .
the inhibition rate of the compound was calculated according to the following formula ( av denotes average ) :
we have demonstrated a general and practical route for the synthesis of the n - substituted benzamides bearing 1,3,4-oxadiazol moiety in the presence of an inorganic base as the catalyst .
the reaction of 5-subsititued phenyl-1,3,4-oxadiazole-2-thiol which serves as the source of n - nucleophile with in situ generated protected imine from n - benzoyl--amido sulfones provides a ready access to a series of structurally diverse n , n - aminals .
the antiviral tests indicated that some of the synthesized compounds possessed of moderately high curative activity against cmv .
the structure of the target products needs to be optimized to enhance their antiviral activity .
further studies on mechanistic aspects , enantioselectivities and asymmetric variants of catalysts for this reaction are currently being investigated in our group .
the current study is an outcome of constructive discussion with bas , sy , lhj and dyh who offered necessary guidance to yj to carry out his synthesis and characterization experiments .
xw performed the antiviral tests ; hxq carried out the h nmr , c nmr and f nmr spectral analyses .
yield and elemental analyses data for title compounds 5a - u . which contains the table about structure , yield and elemental analyses data for title compounds 5a - u .
experimental details and data of title compounds 5a - u . which includes the experimental procedure , spectroscopic data of intermediate 3 , intermediate 4 , title compounds 5a - u , copies of h nmr and c nmr .
we gratefully acknowledge the generous financial support received from the national key project for basic research ( 2010cb126105 , 2010cb134504 ) and the national natural science foundation of china ( 20872021 ) .
Output:
| backgroundheteronucleophiles as well as carbanionic reagents can be used to react with -amido sulfones , thus giving the opportunity to prepare a large array of amino derivatives . since ,
novel 1,3,4-oxadiazole-2-thiol derivatives can serve as potent nucleophiles , we employed 5-subsititued phenyl-1,3,4-oxadiazole-2-thiols as the nucleophilic source of nitrogen in the reaction with -amido sulfones.resultsa series of n - substituted benzamides bearing 1,3,4-oxadiazol unit were prepared for the first time by the reaction of in situ generated protected imine from -amido sulfones with 5-subsititued phenyl-1,3,4-oxadiazole-2-thiols as the source of nitrogen nucleophile .
some of the synthesized products displayed favourable antiviral activity against cucumber mosaic virus ( cmv ) in preliminary antiviral activity tests .
the title compounds 5c , 5o and 5r revealed curative activity of 42.2% , 48.7% and 40.5% , respectively against cmv ( inhibitory rate ) compared to the commercial standard ningnanmycin ( 53.4% ) at 500 g / ml.conclusiona practical synthetic route to n - benzoyl--amido sulfones by the reaction of 5-subsititued phenyl-1,3,4-oxadiazole-2-thiols as the source of nitrogen nucleophiles with in situ generated protected imine from n - benzoyl--amido sulfones is presented .
the reaction catalyzed by an inorganic base has considerable significance to exploit the potential of -amido sulfones in organic synthesis . |
PubmedSumm6860 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: q fever is caused by the small gram - negative intracellular bacterium , coxiella burnetii .
it is rare and there are approximately 40 cases reported annually in the united states .
chronic q fever is also rare , occurring in < 5% of persons with acute infection and most commonly occurs as infective endocarditis ( ie ) or vascular infection .
we present a 52-year - old woman from michigan with chronic q fever presenting as prosthetic aortic valve infective endocarditis .
pcr testing for bacterial organisms performed on the explanted cardiac valve tissue confirmed the diagnosis of c. burnetii ie .
subsequent history identified consumption of raw milk from a shared cow in a local farm as the likely source of the pathogen .
a 52-year - old caucasian woman , who is an educator from kalamazoo , michigan , was referred to the cleveland clinic with a chief complaint of fever , chills , and progressive dyspnea on exertion of several months duration .
her fever , chills , and night sweats were more prominent in the last two weeks prior to evaluation .
she also complained of abdominal pain which had increased markedly in the last one month associated with nausea and non - bloody , non - bilious vomiting with reduced oral intake and involuntary weight loss of 25 pounds over this period .
she has rheumatoid arthritis ( ra ) and has been taking etanercept for the last 15 years .
she underwent an aortic valve replacement due to aortic regurgitation 12 years prior to presentation at our institution .
she denied exposure to sick contacts , invasive dental procedures , intravenous drug use , tick bites or recent travel .
she had a blood pressure of 104/57 mmhg and was tachycardic with a pulse rate of 135 bpm .
on cardiovascular exam , there was a 3/6 diastolic murmur appreciated in the left sternal area with the presence of normal s1 and s2 .
there was a well - healed median sternotomy scar from her prior open heart surgery . on abdominal examination ,
the spleen was palpable at 23 cm from the costal margin with tenderness to deep palpation in the left upper quadrant .
during the course of admission , laboratory tests showed a normocytic normochromic anemia with hemoglobin of 8.4 g / dl ( reference range 12.115.1 g / dl ) and a normal white blood cell count of 6.81 k/l ( reference range 4.511.0 k/l ) .
her splenomegaly was initially thought to be neoplastic or rheumatologic in etiology and thus she was referred for a bone marrow biopsy .
pathologic review of her bone marrow specimen revealed a hypercellular marrow but no clonal process or ring granulomas were identified .
a single blood culture ( one of the four ) was positive for growth of coagulase - negative staphylococcus .
this result prompted a transthoracic echocardiogram ( tte ) which was followed by a transesophageal echocardiogram ( tee ) given high clinical suspicion for ie .
these tests showed moderate ( 23 + ) prosthetic aortic regurgitation and an aortic root abscess .
she was started empirically on vancomycin and ceftriaxone and was scheduled for open heart surgery .
the patient underwent aortic valve and root replacement with a 22-mm aortic homograft on day 3 of admission .
pathologic examination of the surgical specimen showed abundant fibrinous exudate with mild inflammation , mostly macrophages .
a gomori 's methenamine silver stain demonstrated intracellular and extracellular small coccobacillary organisms ( fig .
1 ) , but no microorganisms were apparent on the gram and periodic acid - schiff stain .
16s rdna sequencing of the valves came back positive for c. burnetii on post - operative day 10 .
further retrospective history taking from the patient revealed that she had imbibed unpasteurized cow milk two years previously for a period of 2 months via cow sharing at a local farm in michigan . c. burnetii titers were consistent with chronic q fever ( high titers to igg phase 1 titers ) ( table 1 ) .
she was treated with oral doxycycline ( 100 mg orally twice daily ) and hydroxychloroquine ( 200 mg three times daily ) after checking for glucose-6-phosphate dehydrogenase deficiency . at six months
follow up , she has recovered with normal ophthalmologic evaluations ( to assess for retinal toxicity ) with plans to complete 18 months of treatment .
q fever is a zoonotic rickettsiosis caused by c. burnetii that is uncommon in the united states with approximately 40 cases reported annually .
it presents as an either acute or chronic infection and is manifested as a nonspecific flu - like illness in most patients .
the chronic form of infection presents as an endovascular infection causing endocarditis , mycotic aneurysm , or infected vascular graft .
15% of acute q fever and up to 6080% of chronic cases can develop endocarditis .
the largest documented outbreak of q fever occurred in the netherlands from 2007 to 2010 where more than 4000 cases were identified .
the etiology of this outbreak was felt to be increased contact between goat farms and high - population density areas .
aerosol transmission of bacteria from parturient animals and contact with bodily fluids of infected animals are the primary modes of transmission .
oral consumption of raw milk is considered a risk factor for transmission , but until recently was felt to play a minor role .
raw milk consumption has been associated with seroconversion but there was insufficient evidence of it causing clinical infection .
coxiella spores are extremely infectious and resistant to heat which emphasizes the need for pasteurization to effectively kill this species in milk products .
pasteurization for 30 min at 63 c ( 145 f ) or 15 s at 72 c ( 161 f ) can lead to eight decimal reductions in the number of coxiella spores .
a recent outbreak in michigan , where 5 cases were detected over a three month period in 2011 , has been reported where the only predisposing condition common to all infections was consumption of unpasteurized milk .
such consumption is common in farm workers , cow share owners , or those buying milk from bulk tanks . in a french study of 92 patients with chronic q fever between 1982 and 1990 ,
the risk factors for infection include immunosuppression ( 20.2% ) , preexisting heart or vascular conditions ( 88.4% ) and preexisting valvulopathy ( 88% ) .
prosthetic valves are associated with increased relative risk compared to the other factors for acquiring endocarditis amongst the chronic q fever patients .
tumor necrosis factor ( tnf ) plays an important role in the immune response against this pathogen .
experiments using an animal model consisting of knockout mice found that there was severe and fatal chronic q fever in severe combined immunodeficiency ( scid ) mice .
the artificial immunosuppression of mice in these studies have led to postulation that administration of tnf blockers may put patients at greater risk for chronic q fever .
one case has been reported of a ra patient on etanercept who did not have any acute phase of illness and was diagnosed after valve cultures obtained at the time of open heart surgery came back positive .
given its mechanism of tnf inhibition , cytokine production by the macrophages and lymphocytes is decreased .
since ra patients on immunotherapy are considered at increased risk of chronic infection , they need to be carefully monitored and counseled about decreasing risk of exposure .
the main symptoms of q fever endocarditis are fever , fatigue , weight loss , night sweats , and hepatosplenomegaly .
a study from france which included 92 patients with chronic q fever revealed anemia ( 60% of cases ) , increased erythrocyte sedimentation rate ( 100% of cases ) , and thrombocytopenia ( 50% of cases ) .
phase 1 is the virulent form with phase 2 being the avirulent form which is demonstrated by serial passage in cell culture or embryonated hen eggs .
only phase 1 organisms affect humans but antibodies are formed for both phases which are detected using serology .
development of antibodies only occurs to the phase 2 antigen in the acute form of infection .
chronic q fever is established if infection persists for more than 6 months and there is a presence of igg and iga to phase 1 and phase 2 antigens .
the presence of igg phase 1 titer > 1:800 along with iga phase 1 titer of > 1:25 is considered for the diagnosis of chronic disease .
hence the use of serologic titers in distinguishing the stage of disease or outcome is problematic .
shortcomings of serologic testing and culture as well as prolonged turn around times for these tests highlights the potential benefit of pcr on pathologic specimens , .
histologic examinations of infected cardiac valves show calcification , fibrosis , and typically pauci - inflammatory changes with very small or absent vegetations .
the usual medical treatment of chronic q fever is doxycycline and hydroxychloroquine for a period of 24 and 18 months in cases of prosthetic valve and native valve endocarditis , respectively .
hydroxychloroquine is lysosomotropic which increases the ph of the phagolysosomes , thus decreasing bacterial replication .
cotrimoxazole is an alternative used in pregnancy and for children below 8 years of age .
rifampicin , quinolones and macrolides are not as effective and there is limited evidence for their usage as alternative regimens .
treatment and serologic follow - up are controversial with most experts agreeing that monitoring for up to five years may be appropriate .
Output:
| chronic q fever caused by coxiella burnetii is uncommon in the united states and is most often associated with infective endocarditis .
we present a 52-year - old woman with a history of aortic valve replacement and rheumatoid arthritis treated with etanercept with chronic q fever manifesting as prosthetic valve infective endocarditis .
explanted valve tissue showed organisms confirmed to be c. burnetii by pcr ( polymerase chain reaction ) sequencing .
she subsequently reported consumption of unpasteurized cow milk which was the likely source of c. burnetii .
she continues to do well 6 months after valve replacement on oral doxycycline and hydroxychloroquine . |
PubmedSumm6861 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 69-year - old female presented with the complaints of headache and pain in the left eye of one month duration .
she was a known patient of unilateral pseudoexfoliation glaucoma , who underwent manual small incision cataract surgery with mitomycin c ( 0.2 mg / ml for 2 min ) augmented trabeculectomy in her left eye .
it was a single site combined surgery in the superior quadrant of the eye , with a fornix based conjunctival flap and a single releasable 10 - 0 nylon suture anchoring the scleral flap using a modified ( first bite in peripheral cornea ) kolker 's technique .
surgery was performed 3 years back and she lost to follow - up after 1 month of surgery . at present , she had no history of diminution of vision or trauma to the left eye and was not a diabetic .
anterior segment examination of the right eye showed pseudoexfoliation material on the pupillary ruff with posterior chamber intraocular lens in the bag and the left eye showed clear cornea with a releasable suture , a low noncystic bleb with an elevated area and congestion overlying it , normal anterior chamber with pseudoexfoliative material on the pupillary ruff and a posterior chamber intraocular lens in the bag [ fig . 1 ] .
the intraocular pressure was 12 mmhg in both eyes and fundus examination showed a cup disc ratio of 0.4 with healthy neuroretinal rim in the right eye and 0.9 with bipolar notch in the left eye and age related macular degeneration changes in both eyes .
the releasable suture in the left eye had mucus debris and the bleb showed collection of pus [ fig .
left eye photograph showing clear cornea , normal anterior chamber , pseudoexfoliative material on pupil and intraocular lens a collection in the bleb with releasable suture on gonioscopy , ostium was free and posterior segment examination showed no signs of vitritis .
nasolacrimal duct of both sides were free of infection and patient 's random blood sugar was within the normal limits .
the releasable suture was removed and inoculated in blood agar and the collection of pus was expressed out along the same suture tract [ fig . 3 ] .
the patient was started empirically on oral ciprofloxacin 500 mg twice daily for 5 days and topical 5% cefotaxime and 2% amikacin eye drops hourly .
bleb appearance following suture removal and pus expression the blood agar culture report revealed growth of pseudomonas aeruginosa sensitive to the above antibiotics and hence the patient was advised to continue the same medications . after a week , the patient was symptomatically better , but on examination , we noticed a small recollection of pus in the bleb area [ fig . 4 ] .
the collection was again expressed and inoculated in blood agar and the patient was continued on the same topical antibiotics .
after 3 days and her last review visit , her left eye best corrected visual acuity was 20/30 , the eye was quiet with a low bleb devoid of collection and ostium free of infection .
intraocular pressure was 10 mmhg and posterior segment continued to be free of infection .
a small recollection in the bleb
bleb infections following trabeculectomy are not uncommon and are associated with several risk factors such as bleb leak , thin walled bleb , presence of releasable suture , ocular adnexal infections , and the host compromised immune status . a study from a tertiary eye care hospital in south india revealed streptococcus species as the predominant isolate from blebitis associated with releasable sutures .
the gram - positive organisms like staphylococcus and streptococcus species were the most frequent organisms isolated from bleb associated infections followed by gram - negative organisms .
p. aeruginosa has been reported to cause bleb associated endophthalmitis with fulminant presenting features and poor visual outcomes . however ,
in our patient the infection was confined to the bleb with subtle signs and responded well to the antibiotics without any intraocular spread until the clearance of infection .
the use of mitomycin c in trabeculectomy to enhance bleb survival and filtration has led to an increase in the incidence of bleb associated infections .
releasable sutures were introduced as a means to titrate the intraocular pressure following surgery and its maximum effect is seen when removed within the first 3 postoperative weeks .
complications due to releasable sutures include windshield wiper keratopathy , corneal epithelial abrasions , failure to release the suture and more importantly the suture tract remaining as a potential source of infection .
the single releasable suture was not removed because the postoperative intraocular pressure was in target range and not for fear of complications such as bleb leak , shallow and flat anterior chamber , hypotony , and suprachoroidal hemorrhage .
combined trabeculectomy and manual small incision cataract surgery is a popular technique in our institution for managing cataract and glaucoma simultaneously since it offers an equally effective alternative to phacotrabeculectomy .
the procedure does not require expensive automated equipment and can be done with minimal of instrumentation . for such reasons patients in the lower socioeconomic status prefer this procedure over more advanced surgical technique .
this case report attempts to highlight the fact that regular follow - up should be emphasized to patients undergoing small incision cataract surgery with trabeculectomy , which can also be done by a local ophthalmologist if the patient is from afar .
we recommend that the releasable suture should be removed in all patients and if a decision is taken that removal of the suture is not required then the suture should at least be cut flush with the limbus , so that it retracts into the bleb and there is no track connecting the exterior of the eye to the filtering bleb .
a regular long - term postoperative follow - up is very crucial following trabeculectomy , as it plays a major role in bleb survival and in preventing or detecting its complications at the earliest .
Output:
| we report a case of blebitis that occurred 3 years later following a combined glaucoma and cataract surgery .
it was an atypical presentation , as patient had no classical fiery looking signs of blebitis despite the isolated organism being pseudomonas aeruginosa .
improvized surgical techniques like use of mitomycin c , releasable flap sutures though considered as part of the recommended procedure for better surgical outcomes , their role as potential risk factors for visually blinding complications like endophthalmitis are often overlooked .
this case report throws light on such risk factors for bleb associated infections and recommends removal or trimming of all releasable sutures and the need for a regular postoperative follow - up . |
PubmedSumm6862 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: sleep bruxism has characteristically been defined by the american academy of sleep medicine as an oral activity characterized by grinding or clenching of the teeth during sleep , usually associated with sleep arousals ' .
although numerous investigations stress the assumption of a central causation , such as neuropathophysiology and psychology , a detailed clarification regarding the aetiology of sleep bruxism is still lacking . to date , most authors correspond with the supposition of a multifactorial development of sleep bruxism . during a few years , explanatory models in the field of the dental profession , such as occlusal interferences or variances in the orofacial anatomy ,
are thought to be of inferior , possibly without any , relevance in the development of sleep bruxism activity .
for this reason , the perception in respect of the relationship between sleep bruxism and the stomatognathic system has changed .
consequently , sleep bruxism is supposed to be induced centrally , whereas the effects of this parafunctional activity are predominantly found in the stomatognathic system . undoubtedly , apart from associated effects , such as unpleasant muscle and tooth sensations , limitation of jaw movements , oral and facial pain , and headache ; tooth attrition , fractured cusps or entire teeth , shiny spots on restorations are well - known to be the most frequently occurring effects , in particular , on the dental hard tissue .
moreover , a possible association between bruxism and temporomandibular disorders ( tmds ) is supposed , but the available literature reveals heterogeneous data .
for some past time , by indicating a relationship between bruxism and posture , diverse studies draw the attention to a more extensive context . however , the authors of a recently published review come to the conclusion that a scientific prove to support a cause effect relationship is still missing . to gain information on the clinical interaction among sleep bruxism and several occlusal and functional parameters by using a more clinically feasible , but investigator - independent assessment tool for sleep bruxism diagnosis , in a recently published pilot study 16 occlusal and functional parameters were recorded and compared with those obtained from a non - sleep bruxism control group . by means of a retrospective study design ,
the diagnosis of sleep bruxism was performed using a specifically conceived computer - based analyzing method for the bruxcore bruxism - monitoring device that has previously evaluated regarding its ability to objectively differentiate between sleep bruxism subjects and an adequate non - sleep bruxism control group .
considering all variables tested , with an approximately 0.5 mm larger slide from centric occlusion ( co ) to maximum intercuspation ( mi ) in the sleep bruxism group , the results solely demonstrated a statistically significant group difference regarding the length of the slide from co to mi . in order to verify the results of the former pilot study , as a next step
a prospective controlled investigation including a larger sample size has been conducted using the clinical criteria of the american academy of sleep medicine for sleep bruxism diagnosis .
therefore , the aim of the present prospective study was to analyze the relationship between sleep bruxism and several functional and occlusal parameters .
the null hypothesis of this study was that there would be no differences among a sample of sleep bruxism subjects and a non - sleep bruxism control group regarding several functional and occlusal parameters .
the entire sample consisted of 91 subjects , of whom 58 were females and 33 were men with a mean age of 28.37 years ( standard deviation ( s.d . ) , 4.89 years ; age range , 2039 years ) .
they were all german native speakers and responded to announcements in local newspapers and placards on campus .
each participant was screened following a thorough dental examination . as applied in former investigations , the diagnosis of sleep bruxism
individuals who met the following criteria were included in the sleep bruxism group : healthy adults , aged between 20 and 40 years , sleeping partner reports of grinding sounds during the night in the last 6 months , and at least one of the following symptoms : self - report of muscle fatigue or tenderness on awakening , the presence of tooth wear to at least the magnitude of dentin exposure , and masseter hypertrophy upon voluntary forceful clenching .
exclusion criteria were : current dental treatment , severe psychological disorder and/or the use of antipsychotic psychotropic drugs , central nervous system and/or peripheral nervous system disorders , more than two missing molars ( excluding third molars ) , the presence of prosthesis or extensive prosthetic restorations and the presence of gross malocclusion .
healthy adults , from whom sleep bruxism could be excluded , represented the control group .
exclusion criteria were the same as for the sleep bruxism group as well as any signs and symptoms of sleep bruxism .
all subjects gave informed consent to the procedures approved by the institutional human subjects ethics committee ( heinrich - heine - university of duesseldorf ) . at first , each of the 91 participants had a thorough dental examination which was performed by one trained dentist of the department .
similar to the recently published pilot study which used the newly developed computer - based analyzing method for calculating abrasion on the bruxcore bruxism - monitoring device as measure for sleep bruxism activity , the following functional and occlusal parameters were clinically recorded by means of a digital calliper : vertical ( overbite ) and horizontal ( overjet ) overlap of the maxillary and mandibular right central incisors , maximum active mouth opening , maximum active right and left lateral movement of the mandible , maximum protrusive movement of the mandible , the presence of a slide from co to mi and , if present , the length of the slide from co to mi .
the recording of the slide has been performed as described previously . moreover , the resiliency of the left and right tmj , as well as the presence of lesions related to lip and/or cheek biting were determined .
furthermore , the angle 's classification of malocclusion , recorded on the right and the left side for the canines and for the first molars , as well as the anterior crowding in the mandible ( classified on a five - point scale : 0 , no crowding ; 1 , 13 mm of crowding ; 2 , 35 mm ; 3 , 57 mm ; 4 , > 7 mm ) were identified from dental study casts .
due to either missing canines or first molars in some patients , the sample size varied between 68 and 65 participants .
, armonk , ny , usa ) . normal distribution of the variables was verified by means of the kolmogorov smirnov test combined with the assessment of histograms .
the pearson chi - square test was applied to determine the significance of differences between two independent groups when data consisted of frequencies in qualitative variables .
if a normal distribution of the data was found , the independent samples student 's t - test was applied for the analysis of mean differences between both groups in quantitative variables . for all quantitative variables with lacking normal distribution ,
whitney u - test , the adequate statistical values are the mean ranks and the sum of ranks . however , to improve the comparability of the obtained results , data are presented as means and s.d .. for all statistical analyses , an -error probability level of p<0.05 was defined as the statistical significant level . to correct the observed significance level according to the number of comparisons made , bonferroni adjustment was applied . since
19 comparisons were performed including sociodemographic data , the bonferroni - adjusted probability level amounted to p<0.003 .
the entire sample consisted of 91 subjects , of whom 58 were females and 33 were men with a mean age of 28.37 years ( standard deviation ( s.d . ) , 4.89 years ; age range , 2039 years ) .
they were all german native speakers and responded to announcements in local newspapers and placards on campus .
each participant was screened following a thorough dental examination . as applied in former investigations , the diagnosis of sleep bruxism
individuals who met the following criteria were included in the sleep bruxism group : healthy adults , aged between 20 and 40 years , sleeping partner reports of grinding sounds during the night in the last 6 months , and at least one of the following symptoms : self - report of muscle fatigue or tenderness on awakening , the presence of tooth wear to at least the magnitude of dentin exposure , and masseter hypertrophy upon voluntary forceful clenching .
exclusion criteria were : current dental treatment , severe psychological disorder and/or the use of antipsychotic psychotropic drugs , central nervous system and/or peripheral nervous system disorders , more than two missing molars ( excluding third molars ) , the presence of prosthesis or extensive prosthetic restorations and the presence of gross malocclusion .
healthy adults , from whom sleep bruxism could be excluded , represented the control group .
exclusion criteria were the same as for the sleep bruxism group as well as any signs and symptoms of sleep bruxism .
all subjects gave informed consent to the procedures approved by the institutional human subjects ethics committee ( heinrich - heine - university of duesseldorf ) .
at first , each of the 91 participants had a thorough dental examination which was performed by one trained dentist of the department . similar to the recently published pilot study which used the newly developed computer - based analyzing method for calculating abrasion on the bruxcore bruxism - monitoring device as measure for sleep bruxism activity , the following functional and occlusal parameters were clinically recorded by means of a digital calliper : vertical ( overbite ) and horizontal ( overjet ) overlap of the maxillary and mandibular right central incisors , maximum active mouth opening , maximum active right and left lateral movement of the mandible , maximum protrusive movement of the mandible , the presence of a slide from co to mi and , if present , the length of the slide from co to mi .
the recording of the slide has been performed as described previously . moreover , the resiliency of the left and right tmj , as well as the presence of lesions related to lip and/or cheek biting were determined .
furthermore , the angle 's classification of malocclusion , recorded on the right and the left side for the canines and for the first molars , as well as the anterior crowding in the mandible ( classified on a five - point scale : 0 , no crowding ; 1 , 13 mm of crowding ; 2 , 35 mm ; 3 , 57 mm ; 4 , > 7 mm ) were identified from dental study casts . due to either missing canines or first molars in some patients , the sample size varied between 68 and 65 participants
statistical analyses were performed using the statistical software spss version 19.0 ( ibm corp . , armonk , ny , usa ) . normal distribution of the variables was verified by means of the kolmogorov
the pearson chi - square test was applied to determine the significance of differences between two independent groups when data consisted of frequencies in qualitative variables .
if a normal distribution of the data was found , the independent samples student 's t - test was applied for the analysis of mean differences between both groups in quantitative variables . for all quantitative variables with lacking normal distribution ,
whitney u - test , the adequate statistical values are the mean ranks and the sum of ranks . however , to improve the comparability of the obtained results , data are presented as means and s.d .. for all statistical analyses , an -error probability level of p<0.05 was defined as the statistical significant level . to correct the observed significance level
19 comparisons were performed including sociodemographic data , the bonferroni - adjusted probability level amounted to p<0.003 .
comparisons of the two groups showed no significant differences regarding age , gender and education ( table 1 ) . furthermore , in tables 2 and 3 , for the quantitative variables , the means and s.d . , or for the qualitative variables , the frequency distributions , are presented for the occlusal and functional variables , respectively .
similar to the aforementioned pilot study , with a mean slide of 0.77 mm ( s.d .
, 0.69 mm ) in the sleep bruxism group and a mean slide of 0.4 mm ( s.d . , 0.57 mm ) in the control group , the evaluation of the mean comparison between the two groups demonstrated a larger slide from co to mi in sleep bruxism subjects ( p=0.008 ) .
furthermore , considering the frequency distributions of the qualitative variables , the presence of a slide from co to mi ( p=0.008 ) , as well as the presence of lesions related to lip and/or cheek ( p=0.013 ) biting was more frequently observed in sleep bruxism subjects than in controls .
however , following bonferroni adjustment none of the 16 occlusal and functional variables differed significantly between sleep bruxism subjects and non - sleep bruxism controls .
the purpose of the present study was to verify the findings of a previous retrospective pilot study by means of a prospective controlled investigation including a larger sample size .
the main result of the present investigation was that considering the 16 occlusal and functional parameters evaluated , sleep bruxism subjects and controls do not differ significantly .
indeed , similar to the forecited retrospective investigation , the same 16 occlusal and functional parameters have been used in the present study . moreover ,
the values which have been recorded for these 16 variables in both studies move into a similar direction , however , following the bonferroni adjustment each of the obtained differences between the sleep bruxism group and the controls failed to reach the level of statistical significance . for this reason
, our hypothesis that there are no differences among a sample of sleep bruxism subjects and a non - sleep bruxism control group with respect to the occlusal and functional parameters evaluated could not be rejected .
when interpreting the underlying reasons for the observed discrepancies between the retrospective pilot study and the present prospective controlled investigation , methodological and statistical considerations need to be included , such as the prospective analysis of a larger sample size or the application of classical bonferroni correction . the kolmogorov
smirnov test revealed that the variable length of a slide from co to mi was not normally distributed .
were expected to be high . generally , it is a fact that if a likewise large sample is investigated the scattering will be reduced and , thus , this will strengthen the reliability of the test used in the present study . from a critical point of view , the probability is , therefore , comparatively high that the effect which has been recorded in the preceding pilot study was by chance .
comparisons of the present data with other previous investigations could not easily be performed due to diverse reasons .
for instance , different criteria or methods have been applied for sleep bruxism diagnosis and , accordingly , this resulted in different sample compositions .
moreover , diverse studies vary regarding the parameters that have been recorded . for example , one investigation included a group of treated bruxism subjects , untreated bruxism subjects , and subjects with tmds as well , whereas the details for sleep bruxism diagnosis have not been reported in detail .
the evaluation of this more inhomogeneous sample revealed that 100% of the participants had laterotrusive interferences , 78% had mediotrusive interferences and 95.4% showed premature contacts .
considering the before mentioned arguments , a comparison of this outcome with the present data could hardly be made . in another study ,
a clear description of the sample composition has been performed by using the polysomnographic criteria for sleep bruxism diagnosis . in this investigation , 26 occlusal and cephalometric measures have been evaluated in a sample of 10 sleep bruxism subjects and 10 controls . as result , none of the measures tested revealed a statistically significant difference between the two groups .
on the basis of their results , authors concluded that the orofacial morphology of sleep bruxism subjects does not differ from that of non - sleep bruxism subjects .
however , as the mentioned study had a retrospective design and , moreover , still included a sample size of 20 subjects , the authors point at its low statistical power .
taken these limitations into account , the authors emphasized the need to carry out further investigations in this field in terms of a larger sample and an experimental and prospective character . in this
context , attention should be drawn to the process of sleep bruxism diagnosis . undoubtedly ,
due to the good performance of the validity parameters , to date , the laboratory polysomnographic recordings represent the highest standard for sleep bruxism diagnosis , but they are concomitantly associated with disadvantages which include technical complexity , limited availability , and the fact that they are time - consuming and cost - intensive . similar to the abovementioned study ,
this is seen in comparatively small sample sizes of polysomnographic studies , which limits the applicability of this method , in particular , for clinical studies with larger sample sizes .
as addressed above , when comparing the outcome of the aforementioned retrospective study with the present data , it must be indicated that both investigations have evaluated partially different variables and have used different assessment methods for sleep bruxism diagnosis . notwithstanding these differences ,
both studies correspond with respect to the fact that none of the measures that have been recorded in the respective study revealed a statistically significant difference between sleep bruxism subjects and controls .
for this reason , the results obtained in the present investigation were found as a reference that the occlusal and functional parameters evaluated do not differ between sleep bruxism subjects and non - sleep bruxism subjects .
furthermore , as a possible consequence of myalgia due to sleep bruxism , a limitation of mouth opening and mandibular excursive movements in sleep bruxism subjects has also been reported . since none of the variables regarding the mandibular movement showed a significant difference between the sleep bruxism group and the non - sleep bruxism controls , on the basis of the data derived from the present investigation , these movement limitations
if the present data are interpreted including physiologic mean values of mandibular movement capacity , the values that have been recorded in both the sleep bruxism group , as well as in the control group were located within normal range . when interpreting the data of the present investigation , both the current knowledge on the development of sleep bruxism , as well as its possible effects ought to be taken into consideration .
the main result of the present prospective study was that regarding 16 functional and/or occlusal parameters sleep bruxism subjects did not differ significantly .
accordingly , this outcome supports the conclusion of previous authors that there is no proof for a role of dental occlusion and factors related to the anatomy of the orofacial skeleton in the aetiology of sleep bruxism .
moreover , as derived from the present results , the mandibular function does not appear to be involved too .
therefore , the authors of the present study may propose that the stomatognathic system , in particular , the dental occlusion should rather be viewed as a sort of effector organ of sleep bruxism activity which is most likely induced by a central causation . usually , sleep bruxism is not aggravated by pain symptoms , however , as derived from the available research , a possible association between bruxism and certain subgroups of tmds has been supposed .
for this reason , it has to be asked at what point a stomatognathic system decompensates and turns to a disorder which requires a therapy .
further , some recent studies among the relationship of sleep bruxism and posture give an initial hint that consequences of sleep bruxism may be also detectable in other peripheral areas of the whole body .
however , it should be pointed out that the last attempt requires further scientific evaluation to support a cause effect relation due to diverse reasons ( e.g. , partly reported by means of case reports and studies including only small sample sizes ) . in the same way as regarding the stomatognathic system
, one has to wonder among what circumstances further peripheral systems of the whole body decompensate and turn to a manifest disorder or reveal negative effects following to long - term sleep bruxism . considering these questions
, it appears advisable to turn one 's attention closer to the individual adaptive capacity which has an impact on both the stomatognathic system and other peripheral systems of the human body . for an improved summary
, these considerations were merged to a hypothetical model as illustrated in figure 1 . likewise to other medical disciplines
, this might offer the opportunity to a more sophisticated understanding why one subject with sleep bruxism will develop in addition to the immediate effects of sleep bruxism on the dental hard tissues a manifest tmd or , perhaps at a later date , further effects in other peripheral regions of the whole body and why another subject with sleep bruxism will not .
possible components which might influence the adaptive capacity are physiologic basics ( such as changes in motor unit recruitment patterns ) , psychological factors ( such as vulnerability , resiliency ) , and genetic factors ( such as predisposition ) .
with respect to the 16 occlusal and functional parameters evaluated , sleep bruxism subjects and controls did not differ significantly .
similar to the previous pilot study , a 0.4 mm larger slide from co to mi has been observed in the sleep bruxism group , but following to bonferroni adjustment this difference failed to reach the level of statistical significance . keeping in mind the available literature indicating a possible association between sleep bruxism and certain subgroups of tmds and a reference to possible effects of sleep bruxism on the posture , it has to be asked at what point a stomatognathic system or any other peripheral system of the whole body decompensates and turns to a disorder which requires a therapy . embracing the role of the adaptive capacity of the stomatognathic system as one part of the human body into future investigations , will contribute to a more sophisticated understanding of sleep bruxism and its most likely multifactorial nature .
Output:
| this study was conducted to verify the results of a preceding retrospective pilot study by means of a prospective controlled investigation including a larger sample size . therefore , the aim of this clinical investigation was to analyze the relationship between sleep bruxism and several functional and occlusal parameters .
the null hypothesis of this study was that there would be no differences among sleep bruxism subjects and non - sleep bruxism controls regarding several functional and occlusal parameters .
fifty - eight sleep bruxism subjects and 31 controls participated in this study .
the diagnosis sleep bruxism was based on clinical criteria of the american academy of sleep medicine .
sixteen functional and occlusal parameters were recorded clinically or from dental study casts .
similar to the recently published retrospective pilot study , with a mean slide of 0.77 mm ( s.d .
, 0.69 mm ) in the sleep bruxism group and a mean slide of 0.4 mm ( s.d
. , 0.57 mm ) in the control group , the evaluation of the mean comparison between the two groups demonstrated a larger slide from centric occlusion to maximum intercuspation in sleep bruxism subjects ( mann whitney u - test ; p=0.008 ) .
however , following bonferroni adjustment , none of the 16 occlusal and functional variables differed significantly between the sleep bruxism subjects and the non - sleep bruxism controls .
the present study shows that the occlusal and functional parameters evaluated do not differ between sleep bruxism subjects and non - sleep bruxism subjects .
however , as the literature reveals a possible association between bruxism and certain subgroups of temporomandibular disorders , it appears advisable to incorporate the individual adaptive capacity of the stomatognathic system into future investigations . |
PubmedSumm6863 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the incidence of acute hepatitis b ( hbv ) is largely reduced during the last 20 years as a result of the use of vaccination and routine blood donor screening 1 and , nowadays , in western countries , the risk of hbv infection is limited to sexual intercourses , intravenous drug users and , in a few cases , in patients undergoing dental therapy , acupuncture , piercing and tattooing 2 - 4 .
most symptomatic patients recover and treatment is not necessary ; when there are signs of severe liver failure , treatment is recommended in order to reduce the risk of progression to fulminant or subfulminant hepatitis and the need of emergency liver transplantation 5 .
a randomised controlled trial on standard interferon versus placebo shows greater hbs seroconversion in patients treated with 10 mu / tiw 6 . with regard to lamivudine , studies with a limited number of patients and case reports are encouraging 7 - 9 while the only randomised controlled study available does not show a significant clinical and biochemical improvement compared to placebo at a dose of 100 mg / daily 10 .
we report our experience on treatment with high dose lamivudine , in a series of 5 patients with severe acute hbv infection .
from november 2006 to march 2007 , 5 patients with acute hbv related hepatitis were admitted to our department : 4 patients were hbeag positive and 1 anti hbe positive .
the diagnosis was based on consistent clinical and virological findings ( medical history , jaundice , hypertransaminasemia , hbsag positivity , igm anti - hbc > 1.20 mu / ml and presence of serum hbv - dna by pcr ) and exclusion of other known causes of liver damage .
all patients underwent ultrasonography guided liver biopsy to confirm the diagnosis . the decision to treat
was based on the prolongation of inr together with increasing values of bilirubin and alt .
four patients received lamivudine 200 mg / daily until clearance of serum hbv - dna was reached and then 100 mg / daily until resolution ( clearance of hbsag and appearance of anti - hbs antibodies ) .
one patient received 100 mg / daily because of renal impairment ( creatinine clearance 32 ml / min ) .
patients were followed up for at least six months ( range : 6 - 11 months ) after the end of treatment .
the decision to treat was based on the prolongation of inr together with increasing values of bilirubin and alt .
four patients received lamivudine 200 mg / daily until clearance of serum hbv - dna was reached and then 100 mg / daily until resolution ( clearance of hbsag and appearance of anti - hbs antibodies ) .
one patient received 100 mg / daily because of renal impairment ( creatinine clearance 32 ml / min ) .
patients were followed up for at least six months ( range : 6 - 11 months ) after the end of treatment .
the median period of hospitalization was 13 days ( 12 - 15 ) and no patient had complications , both related to underlying disease or to therapy .
we observed a prompt decrease of alt ( -1399 iu / l in a week , -2120 iu / l in two weeks ) and serum bilirubin ( -15 mg in a week , -23.9 mg in two weeks ) .
the complete normalization of transaminases and bilirubinemia occurred on average after 5.5 weeks and 3 weeks , respectively .
all hbeag+ patients lost e - antigen and seroconverted to anti hbe ; they lost hbsag within six months from the start of treatment and 4/5 developed anti - hbs at a protective titre ( > 10 mu / ml ) .
we observed an average drop of hbv - dna of 1.58 logarithms in a week and 3.38 logarithms in two weeks .
all patients cleared hbv - dna ( evaluated by pcr ) in two months on average .
differently from previous studies , we have chosen to treat acute hepatitis b with a higher dose of lamivudine ( 200 mg / day instead of 100mg / day ) achieving a rapid viral clearance and clinical improvement .
all patients were discharged by the hospital , in spite of disease severity at presentation , within 13 days from the start of oral antiviral treatment . from our data , treatment with nucleoside analogues for severe and fulminant hepatitis b ( acute or exacerbation of a chronic infection ) is certainly indicated .
in fact , early antiviral treatment shortens and improves the symptomatic phase of infection and allows a ready clinical and biochemical improvement . on the other hand ,
when patients with end stage liver disease are treated with nucleoside analogues , the dramatic improvement of hepatic function often leads to withdrawal from the liver transplantation list . in our experience ,
, the development of a chronic infection , since all patients displayed undetectable hbv - dna and cleared hbsag
. severe or fulminant acute hepatitis b generally do not evolve to a chronic disease , since the immune response that causes liver damage also leads to the viral clearance . in this setting , with the use of nucleoside analogues we obtained a prompt hepatic biochemical and functional improvement and a strong suppression of viral replication , which probably enforced the ongoing process of recovery .
furthermore , we reduced the risk of fatal outcome which can occur in some of these patients . with the use of a double dose of lamivudine ( 200 mg / day ) we obtained a decrease of viral load even faster than observed in previous studies : in fact we observed an average decrease of serum hbv - dna of 3.38 log
iu / ml in the first two weeks of treatment , respect to 1 log decrease in one month reported by other authors 11 . to the best of our knowledge , only the studies of tillman et al . and by kumar et al .
from those studies two major results emerge : the number of responders ( hbv - dna negative ) is higher in the treated group compared to controls ( 91.6% against 71.6% ) .
even though not statistically significant , this figure outlines a trend and should not be underestimated .
furthermore , the number of adverse events ( death and transplantation ) was significantly lower in both studies in the treated groups ( 5.2% against 21.6% in controls ) .
the lack of a control group is certainly a limitation but according to recent guidelines treatment is indicated for patients with fulminant hepatitis b and those with protracted , severe acute hepatitis b ; therefore , a control group in this setting would likely not be judged ethical .
however , in light of our results and from data previously published , the only ethical choice in patients with severe and fulminant acute hepatitis b seems to be the treatment with oral antiviral drugs . on the basis of our results
we suggest that , with regard to lamivudine , a higher dose provides an effective and fast healing of severe acute hepatitis . despite the low genetic barrier of lamivudine , we chose it because at that time it was the drug with the fastest antiviral activity among those available .
it is conceivable that new available drugs for the treatment of hepatitis b ( i.e. entecavir and telbivudine ) might be even better in reaching a rapid decrease in viral load and a faster recovery in patients with fulminant or severe acute hepatitis .
Output:
| treatment for acute hepatitis b is recommended in order to reduce the risk of progression to fulminant hepatitis and the need of olt .
we report our experience on treatment with high dose lamivudine , in patients with severe acute hbv infection .
the diagnosis was based on clinical and virological findings and exclusion of other known causes of liver damage . the decision to treat
was based on the prolongation of inr together with increasing values of bilirubin and alt .
four patients received lamivudine 200 mg / daily until clearance of serum hbv - dna and then 100 mg / daily until clearance of hbsag and appearance of anti - hbs antibodies .
one patient received 100 mg / daily because of chronic renal impairment .
the median period of hospitalization was 13 days , and none of the patients had complications , related either to underlying disease or to therapy .
the complete normalization of serum transaminases and bilirubin occurred on average after 5.5 weeks and 3 weeks respectively .
all patients cleared serum hbv - dna within three months , lost hbeag and hbsag and seroconverted to anti - hbe ; four patients developed anti - hbs at a protective titre .
early antiviral treatment attenuates the clinical and biochemical impairment leading to fast healing and promoting complete recovery . |
PubmedSumm6864 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: expecting a negative outcome from an intervention may give rise to the very occurrence of that outcome .
this phenomenon , called the nocebo effect , can be induced by conditioning , verbal suggestion,1,2 or , as recently shown , by social observation ; with student samples , two studies independently showed that observing a person who experienced pain after a particular intervention could lead to nocebo hyperalgesia when the observer underwent the same procedure.3,4 in one of the studies , four groups observed a model who reported lower pain ratings when a green rather than a red light preceded a pseudo - electric shock , whereas two other groups observed no model.3 participants in all groups received electric shocks .
the aim of the study was to investigate socially induced placebo analgesia with the green light - coupled shocks ; however , when compared to the control groups without observation , a nocebo hyperalgesia to the red light - coupled electric shocks was induced . in the second study ,
female students watched a video model who rated pain as higher when an ointment was applied prior to the application of pressure pain.4 this also resulted in nocebo hyperalgesia in the observer .
very little is known about why some people respond to placebos while others do not;5 the same is true for nocebos . for socially induced nocebo hyperalgesia
, there was an effect of the model s sex ; observing a male model led to a stronger hyperalgesia regardless of the observer s sex.3 empathy might be a factor specifically related to socially induced nocebo hyperalgesia , as it might facilitate observational learning .
however , results thus far are inconsistent.3 studies concerning other factors influencing the nocebo response , as such , are rare .
personality variables , such as suggestibility , imaginative involvement , social desirability , and neuroticism , appear to be unrelated to verbally induced nocebo hyperalgesia.2 the cognitive emotional variables pain anxiety and somatosensory amplification showed no correlation with nocebo hyperalgesia , whereas pain catastrophizing did show a correlation : the stronger the tendency to catastrophize , the stronger the nocebo hyperalgesia.4 in the present study , we further investigated cognitive processing styles that may be related to the nocebo response .
the expectation of adverse somatosensory events,6 catastrophic misinterpretation , or overinterpretation of body sensations or physical symptoms7 and selective attention to bodily processes can affect the encoding of sensory information and impact symptom reports in general,8,9 and we hypothesize nocebo responses in particular .
in addition , hypochondriacal concerns may influence the nocebo response , as they correlated positively with the number of retrospective reports of vicarious learning experiences related to bodily symptoms during childhood , and the authors concluded that persons with hypochondriacal concerns learned about symptoms through social observation.10 the aim of the present study was to investigate further socially induced nocebo effects and possible moderators of the socially induced nocebo hyperalgesia , such as pain catastrophizing , somatic complaints , hypochondriacal concerns , and empathy , in a sample from the general population . in order to be terminologically unequivocal , we will distinguish between nocebo effect and nocebo response .
the term nocebo effect is reserved for statistically ascertained differences at the group level , whereas the term nocebo response refers to the difference resulting from subtracting the pain ratings without nocebo induction from the pain ratings with nocebo induction at an individual level .
the study was approved by the local ethics committee ( ethikkommission des instituts fr psychologie , georg - august - universitt gttingen , approval number 55 ) and was carried out in accordance with the declaration of helsinki.11 informed written consent was obtained prior to testing . since a deceptive information procedure was used , after the experiment , the participants were fully debriefed regarding the deceptive information and the necessity of using this procedure , and were given the opportunity to ask questions .
differences in pain sensitivity between healthy men and women have been replicated in numerous studies,12 which showed that experimenter sex influenced pain reports13,14 and that the sex of the model3 and participants15 influenced socially induced nocebo effects .
therefore , we kept these factors constant by employing a female model and including only women in our study . for the power analysis
, we used the effect size of partial =0.09 found for the interaction in our last paper as an approximation .
we converted it via g*power to the effect size f ( v)=0.31.16 a minimum total sample size of n=82 participants was required to detect an interaction effect of that size ( =0.05 and power = 0.80 ) . since
, in our last study , participants had to be excluded , we decided to recruit more participants than the minimum required .
a total of 109 healthy , right - handed women were randomly assigned to one of the two conditions .
twelve women were excluded after testing but before data analyses , as they reported suffering from depression ( four ) , anorexia nervosa ( one ) , anxiety disorders ( two ) , agoraphobia ( one ) , arthrosis ( one ) , chronic back pain ( one ) , fibromyalgia ( one ) , and craniomandibular dysfunction ( one ) .
the remaining 97 participants ( mean age nocebo condition [ nc ] 41.315.5 years , mean age control condition [ cc ] 44.715.5 years ) were included in the analysis .
a 22 mixed design with the between - factor condition ( nocebo / neutral ) and within - factor ointment application
all participants received pressure pain stimuli for 60 seconds per finger on the middle phalanx of the ring , middle , and index finger of each hand .
the order of stimulation of the fingers ( middle phalanx of index , middle , and ring finger ) , the starting hand ( right / left ) , the side of the ointment application ( left / right ) , and whether the person s first or second hand was treated with ointment were balanced between the groups . upon the participant s arrival at the laboratory , the experimenter drew a lot out of an envelope specifying these factors .
participants were contacted via the telephone and were sent a set of questionnaires ( symptom inventory , whiteley index [ wi ] , hospital anxiety and depression scale [ hads - d ] , see the measures section ) to fill out at home prior to coming to the laboratory .
upon arrival at the laboratory , participants read the information that the influence of nonverbal instruction in pain experiments would be tested . to this end
, they would be asked to watch a video in which the procedure was demonstrated by actions .
no information concerning the possible effect of the ointment was provided . to focus their attention on the video
, they received five questions about the video prior to viewing and were told that they would have to answer the questions after the video .
the conditions differed solely with regard to the model s pain ratings in the video the participants were shown ; in the nc , the model reported higher pain ratings after the application of an ointment , and in the cc , the model s ratings were low throughout ( see the video section ) .
after they viewed the video and answered the related questions , the participants underwent the same procedure as they observed in the video . depending on the randomization ,
section ) was applied on the middle phalanx of the index , middle , and ring finger of one hand and allowed to take effect for 60 seconds as shown in the video .
pressure pain was applied by a stationary pressure pain algometer ( see the materials section ) on the middle phalanx of the index , middle , and ring finger for 60 seconds on each of the three fingers of both hands . during the application , participants were asked to indicate the intensity of the pain verbally every 20 seconds on an eleven - point numerical rating scale with 0 indicating no pain at all and 10 indicating the worst pain imaginable .
after the pain application procedure , participants filled out the remaining questionnaires ( interpersonal reactivity index [ iri ] and pain catastrophizing scale [ pcs ] ) .
finally , they wrote down which questions they thought were being examined by the study and rated the credibility of the cover story .
an overview of the procedure is presented in figure 1 . to increase the credibility of the procedure , professional surroundings for the experiment were created ( health care products , disinfectant spray ) , and the experimenters wore white medical coats and gloves when applying the ointment .
the experimenters were trained and supervised by the first and senior authors ( ev and ab ) .
they were blind to the conditions and were only given code numbers of the videos to be shown .
the participants wore headphones while watching the video , so that only they could hear the pain ratings .
the group assignments were revealed to the experimenters only after the data from all participants had been collected .
the videos were recorded in the same room in which the subsequent experiment took place .
both videos showed a seated female model in her mid - forties and the hands of a female experimenter .
the videos were recorded from an angle behind the model so that the model s face was only partially visible ( figure 2 ) .
the videos lasted 10 minutes and 3 seconds each . in both videos , the experimenter told the model that pressure pain stimuli would be applied and explained the rating scale on which the pain intensity was to be rated .
the model rated the pain intensity verbally on the eleven - point numerical rating scale .
the model s ratings for the hand without ointment in both conditions ranged from 2 to 3 .
after all three fingers of the right hand had been stimulated , an ointment was applied to the model s left hand and allowed to take effect for 60 seconds .
then the application of pressure pain resumed . in the video for the nc , the model demonstrated an increase in pain after the ointment application by rating the pain for the hand with ointment from 5 to 7 .
in the video for the cc , the model demonstrated no effect of the ointment on the pain ratings .
the model s ratings for the hand with ointment were identical to those without the ointment , ie , ranging from 2 to 3 .
the videos were identical in facial expressions , body posture , and tone of voice . pain was induced by a stationary pressure pain algometer , which delivered constant pressure over a fixed period .
the algometer consisted of a lever with a weight , and a plunger with a surface area of 3 mm was located at the end .
an electric motor lowered the lever with the plunger onto the finger when a button was pressed , and the lever rose automatically after a predetermined period .
as a safety measure , the procedure could be stopped immediately by pushing a button . a weight of 300 g set at 8 cm was used , resulting in a total pressure of 0.92 mpa , which was applied for 60 seconds .
it contained the following ingredients : aqua , caprylic / capric triglyceride , glycerin , pentylene glycol , cocos nucifera , hydrogenated lecithin , vitellaria paradoxa , hydroxyethylcellulose , squalane , sodium carbomer , xanthan gum , carbomer , and ceramide 3 .
it was presented in a neutral container , similar to those used by dispensing chemists , and contained no perfume .
since the pain measures and empathy were directly related to our experimental design , we decided to collect these measures after the application of pain to avoid any speculations about the aim of our study . in order to reduce the time for the participants in our laboratory
, they were sent the other questionnaires ( not concerning the pain measures or empathy ) to fill in at home prior to the appointment .
the trait pain catastrophizing was measured with the german version of the pcs , which consisted of 13 items answered on a five - point scale ranging from 0 ( not at all ) to 4 ( all the time).17,18 a sum score ( min = 0 , max = 52 ) and scores for each of the three subscales were calculated .
( min = 0 , max = 16 ) described the inability to stop thoughts concerning pain .
( min = 0 , max = 12 ) reflected the tendency to exaggerate the threat value of pain stimuli . helplessness
( min = 0 , max = 24 ) described the inability to deal with pain .
unspecific somatic complaints were measured with the german symptom inventory ( beschwerdeliste , bl - r).19 the participants indicated the degree to which they suffered from each somatic symptom ( eg , constipation , insomnia , shortness of breath , or lack of energy ) on a four - point scale ranging from 0 ( not at all ) to 3 ( strongly ) .
there were two parallel versions : each consisted of 24 items ( min = 0 , max = 72 for each version ) . in order to improve reliability , we used both versions ( ie , 48 items ) and averaged the values . to measure
it consisted of 14 items that the participant indicated as present or not ( min = 0 , max = 14).20 the german version of the iri ( saarbrcker persnlichkeitsfragebogen ) was used to assess trait empathy.21,22 the questionnaire consisted of 16 items answered on a five - point scale ranging from 1 ( never ) to 5 ( always ) with the subscale empathic concern , perspective - taking , fantasy , and personal distress ( min = 4 , max = 20 , for each scale ) .
the global score ( min = 12 , max = 60 ) was calculated by summing the scales empathic concern
, perspective - taking , and fantasy.23 as control measures , depression and anxiety were assessed with the german version of the hads - d.24 the hads - d is a 14-item self - report scale designed to measure depression and anxiety symptoms in the previous week .
the items were answered on a four - point scale with item - specific response categories ( min = 0 , max = 21 for each scale ) .
in addition , participants were asked to rate the credibility of the cover story on a scale ranging from 0 ( not credible at all ) to 10 ( completely credible ) .
the following hypotheses were tested :
an interaction exists between condition and ointment application for the pain ratings.in the nc , pain ratings are higher with ointment than without ointment.the pain ratings with ointment are higher in the nc than in the cc.in the nc , positive correlations exist between the nocebo response and empathy , pain catastrophizing , unspecific somatic complaints , and hypochondriacal concerns .
an interaction exists between condition and ointment application for the pain ratings . in the nc ,
the pain ratings with ointment are higher in the nc than in the cc . in the nc
, positive correlations exist between the nocebo response and empathy , pain catastrophizing , unspecific somatic complaints , and hypochondriacal concerns .
differences regarding age , depression , anxiety , pain catastrophizing , unspecific somatic complaints , hypochondriacal concerns , and the credibility ratings between the participants in the two conditions were compared with independent t - tests .
prior tests showed that the assumptions for a 22 repeated measures analysis of variance ( anova ) were fulfilled : the data were normally distributed ( kolmogorov smirnov test ) and variances were homogeneous ( levene s test ) . in order to test the interaction hypothesis for the nocebo effect
, the mean pain intensity score for each hand was calculated , and a 22 repeated measures anova with between - subject factor condition ( nc / cc ) and within - subject factor application of ointment ( yes / no ) was computed .
planned contrasts were calculated using independent or paired t - tests as appropriate . as measures of effect sizes , and cohen s d were calculated . the nocebo response for each individual participant
was determined by the difference between the mean pain intensity ratings with and without ointment for that participant .
pearson correlations were computed for each condition for the nocebo response with empathy , pain catastrophizing , unspecific somatic complaints , and hypochondriacal concerns .
all analyses were carried out with statistica for windows software , version 10 ( statsoft inc . , tulsa , ok , usa ) .
the study was approved by the local ethics committee ( ethikkommission des instituts fr psychologie , georg - august - universitt gttingen , approval number 55 ) and was carried out in accordance with the declaration of helsinki.11 informed written consent was obtained prior to testing . since a deceptive information procedure was used , after the experiment , the participants were fully debriefed regarding the deceptive information and the necessity of using this procedure , and were given the opportunity to ask questions .
differences in pain sensitivity between healthy men and women have been replicated in numerous studies,12 which showed that experimenter sex influenced pain reports13,14 and that the sex of the model3 and participants15 influenced socially induced nocebo effects .
therefore , we kept these factors constant by employing a female model and including only women in our study . for the power analysis
, we used the effect size of partial =0.09 found for the interaction in our last paper as an approximation .
we converted it via g*power to the effect size f ( v)=0.31.16 a minimum total sample size of n=82 participants was required to detect an interaction effect of that size ( =0.05 and power = 0.80 ) . since , in our last study , participants had to be excluded , we decided to recruit more participants than the minimum required . a total of 109 healthy , right - handed women were randomly assigned to one of the two conditions .
twelve women were excluded after testing but before data analyses , as they reported suffering from depression ( four ) , anorexia nervosa ( one ) , anxiety disorders ( two ) , agoraphobia ( one ) , arthrosis ( one ) , chronic back pain ( one ) , fibromyalgia ( one ) , and craniomandibular dysfunction ( one ) .
the remaining 97 participants ( mean age nocebo condition [ nc ] 41.315.5 years , mean age control condition [ cc ] 44.715.5 years ) were included in the analysis .
a 22 mixed design with the between - factor condition ( nocebo / neutral ) and within - factor ointment application ( yes / no ) was employed .
all participants received pressure pain stimuli for 60 seconds per finger on the middle phalanx of the ring , middle , and index finger of each hand .
the order of stimulation of the fingers ( middle phalanx of index , middle , and ring finger ) , the starting hand ( right / left ) , the side of the ointment application ( left / right ) , and whether the person s first or second hand was treated with ointment were balanced between the groups . upon the participant s arrival at the laboratory , the experimenter drew a lot out of an envelope specifying these factors .
participants were contacted via the telephone and were sent a set of questionnaires ( symptom inventory , whiteley index [ wi ] , hospital anxiety and depression scale [ hads - d ] , see the measures section ) to fill out at home prior to coming to the laboratory .
, participants read the information that the influence of nonverbal instruction in pain experiments would be tested . to this end , they would be asked to watch a video in which the procedure was demonstrated by actions .
no information concerning the possible effect of the ointment was provided . to focus their attention on the video
, they received five questions about the video prior to viewing and were told that they would have to answer the questions after the video .
the conditions differed solely with regard to the model s pain ratings in the video the participants were shown ; in the nc , the model reported higher pain ratings after the application of an ointment , and in the cc , the model s ratings were low throughout ( see the video section ) .
after they viewed the video and answered the related questions , the participants underwent the same procedure as they observed in the video . depending on the randomization ,
section ) was applied on the middle phalanx of the index , middle , and ring finger of one hand and allowed to take effect for 60 seconds as shown in the video .
pressure pain was applied by a stationary pressure pain algometer ( see the materials section ) on the middle phalanx of the index , middle , and ring finger for 60 seconds on each of the three fingers of both hands . during the application , participants were asked to indicate the intensity of the pain verbally every 20 seconds on an eleven - point numerical rating scale with 0 indicating no pain at all and 10 indicating the worst pain imaginable .
after the pain application procedure , participants filled out the remaining questionnaires ( interpersonal reactivity index [ iri ] and pain catastrophizing scale [ pcs ] ) .
finally , they wrote down which questions they thought were being examined by the study and rated the credibility of the cover story .
an overview of the procedure is presented in figure 1 . to increase the credibility of the procedure , professional surroundings for the experiment
were created ( health care products , disinfectant spray ) , and the experimenters wore white medical coats and gloves when applying the ointment . the experimenters were trained and supervised by the first and senior authors ( ev and ab ) .
they were blind to the conditions and were only given code numbers of the videos to be shown .
the participants wore headphones while watching the video , so that only they could hear the pain ratings .
the group assignments were revealed to the experimenters only after the data from all participants had been collected .
the videos were recorded in the same room in which the subsequent experiment took place .
both videos showed a seated female model in her mid - forties and the hands of a female experimenter .
the videos were recorded from an angle behind the model so that the model s face was only partially visible ( figure 2 ) .
the experimenter told the model that pressure pain stimuli would be applied and explained the rating scale on which the pain intensity was to be rated .
the model rated the pain intensity verbally on the eleven - point numerical rating scale .
the model s ratings for the hand without ointment in both conditions ranged from 2 to 3 .
after all three fingers of the right hand had been stimulated , an ointment was applied to the model s left hand and allowed to take effect for 60 seconds .
then the application of pressure pain resumed . in the video for the nc , the model demonstrated an increase in pain after the ointment application by rating the pain for the hand with ointment from 5 to 7 . in the video for the cc , the model demonstrated no effect of the ointment on the pain ratings .
the model s ratings for the hand with ointment were identical to those without the ointment , ie , ranging from 2 to 3 .
the videos were identical in facial expressions , body posture , and tone of voice .
pain was induced by a stationary pressure pain algometer , which delivered constant pressure over a fixed period .
the algometer consisted of a lever with a weight , and a plunger with a surface area of 3 mm was located at the end .
an electric motor lowered the lever with the plunger onto the finger when a button was pressed , and the lever rose automatically after a predetermined period .
as a safety measure , the procedure could be stopped immediately by pushing a button .
a weight of 300 g set at 8 cm was used , resulting in a total pressure of 0.92 mpa , which was applied for 60 seconds .
it contained the following ingredients : aqua , caprylic / capric triglyceride , glycerin , pentylene glycol , cocos nucifera , hydrogenated lecithin , vitellaria paradoxa , hydroxyethylcellulose , squalane , sodium carbomer , xanthan gum , carbomer , and ceramide 3 .
it was presented in a neutral container , similar to those used by dispensing chemists , and contained no perfume .
since the pain measures and empathy were directly related to our experimental design , we decided to collect these measures after the application of pain to avoid any speculations about the aim of our study . in order to reduce the time for the participants in our laboratory
, they were sent the other questionnaires ( not concerning the pain measures or empathy ) to fill in at home prior to the appointment .
the trait pain catastrophizing was measured with the german version of the pcs , which consisted of 13 items answered on a five - point scale ranging from 0 ( not at all ) to 4 ( all the time).17,18 a sum score ( min = 0 , max = 52 ) and scores for each of the three subscales were calculated .
( min = 0 , max = 16 ) described the inability to stop thoughts concerning pain .
( min = 0 , max = 12 ) reflected the tendency to exaggerate the threat value of pain stimuli . helplessness
( min = 0 , max = 24 ) described the inability to deal with pain .
unspecific somatic complaints were measured with the german symptom inventory ( beschwerdeliste , bl - r).19 the participants indicated the degree to which they suffered from each somatic symptom ( eg , constipation , insomnia , shortness of breath , or lack of energy ) on a four - point scale ranging from 0 ( not at all ) to 3 ( strongly ) .
there were two parallel versions : each consisted of 24 items ( min = 0 , max = 72 for each version ) . in order to improve reliability , we used both versions ( ie , 48 items ) and averaged the values . to measure
it consisted of 14 items that the participant indicated as present or not ( min = 0 , max = 14).20 the german version of the iri ( saarbrcker persnlichkeitsfragebogen ) was used to assess trait empathy.21,22 the questionnaire consisted of 16 items answered on a five - point scale ranging from 1 ( never ) to 5 ( always ) with the subscale
empathic concern , perspective - taking , fantasy , and personal distress ( min = 4 , max = 20 , for each scale ) .
the global score ( min = 12 , max = 60 ) was calculated by summing the scales empathic concern , perspective - taking , and
fantasy.23 as control measures , depression and anxiety were assessed with the german version of the hads - d.24 the hads - d is a 14-item self - report scale designed to measure depression and anxiety symptoms in the previous week .
the items were answered on a four - point scale with item - specific response categories ( min = 0 , max = 21 for each scale ) .
in addition , participants were asked to rate the credibility of the cover story on a scale ranging from 0 ( not credible at all ) to 10 ( completely credible ) .
the following hypotheses were tested :
an interaction exists between condition and ointment application for the pain ratings.in the nc , pain ratings are higher with ointment than without ointment.the pain ratings with ointment are higher in the nc than in the cc.in the nc , positive correlations exist between the nocebo response and empathy , pain catastrophizing , unspecific somatic complaints , and hypochondriacal concerns .
an interaction exists between condition and ointment application for the pain ratings . in the nc ,
the pain ratings with ointment are higher in the nc than in the cc . in the nc
, positive correlations exist between the nocebo response and empathy , pain catastrophizing , unspecific somatic complaints , and hypochondriacal concerns .
differences regarding age , depression , anxiety , pain catastrophizing , unspecific somatic complaints , hypochondriacal concerns , and the credibility ratings between the participants in the two conditions were compared with independent t - tests .
prior tests showed that the assumptions for a 22 repeated measures analysis of variance ( anova ) were fulfilled : the data were normally distributed ( kolmogorov smirnov test ) and variances were homogeneous ( levene s test ) . in order to test the interaction hypothesis for the nocebo effect
, the mean pain intensity score for each hand was calculated , and a 22 repeated measures anova with between - subject factor condition ( nc / cc ) and within - subject factor application of ointment ( yes / no ) was computed .
planned contrasts were calculated using independent or paired t - tests as appropriate . as measures of effect sizes , and cohen s d were calculated . the nocebo response for each individual participant
was determined by the difference between the mean pain intensity ratings with and without ointment for that participant .
pearson correlations were computed for each condition for the nocebo response with empathy , pain catastrophizing , unspecific somatic complaints , and hypochondriacal concerns .
all analyses were carried out with statistica for windows software , version 10 ( statsoft inc .
there were no differences in depression , anxiety , empathy , pain catastrophizing , the score on the complaints list , and hypochondriacal concerns between the conditions ( table 1 ) .
the t - test of the credibility ratings for the information concerning the ointment revealed no differences between the two conditions ( t = 0.05 , p=0.96 ) .
the 22 repeated measures anova revealed a significant effect of condition ( f[1 , 95 ] = 4.76 , p=0.03 , =0.04 ) as well as a significant effect of ointment application ( f[1 , 95 ] = 26.62 , p=0.000001 , =0.04 ) on the pain ratings . according to cohen,25
there was no interaction between condition x ointment ( f[1 , 95 ] = 0.68 , p=0.41 ] .
the paired t - test identified higher pain intensity with as compared to without ointment within the nc ( t = 3.57 , p=0.0008 , d=0.38 ) . according to cohen ,
the effect was of approximately medium size.25 the independent t - test identified higher pain intensity with ointment in the nc than in the cc ( t = 2.18 , p=0.03 , d=0.44 ) .
exploratory analyses identified higher pain intensities with as compared to without ointment within the cc ( t = 3.82 , p=0.0004 , d=0.38 ) and no differences in pain ratings without ointment between cc and nc ( t = 1.85 , p=0.07 , d=0.37 ) ( figure 3 and table 2 ) . for the nc ,
, exploratory analyses revealed that the nocebo response was positively correlated with the sum score of the symptom inventory ( r=0.34 , p<0.05 ) and the sum score of the wi ( r=0.32 , p<0.05 ) .
we examined whether a nocebo hyperalgesia to pressure pain could be induced by social observational learning in a female general population sample .
however , main effects for condition and ointment application on the pain ratings were observed .
planned comparisons revealed that , within the nc , participants reported more pain with as compared to without ointment , so a nocebo effect for the nc was observed .
unexpectedly , pain ratings in the cc with ointment were higher than without , so a pain increase after ointment application was observed in the cc too . due to the unexpected pain increase with ointment in the cc , no interaction was observed .
the pain ratings with ointment were higher in the nc than in the cc , indicating that the observation of the model had an additional effect on pain perception .
contrary to our hypothesis , in the nc , no correlation between the nocebo response and empathy , pain catastrophizing , hypochondriacal concerns , or the amount of bodily symptoms was observed .
in contrast , in the cc , we found that the higher a person s level of hypochondriacal concerns was and the more bodily symptoms she reported , the higher was the nocebo response .
the social observation induced elevated pain ratings to pressure pain , since participants in the nc who watched a model demonstrating higher pain ratings after the application of an ointment rated pressure pain with ointment as more painful than the participants in the cc who watched a model demonstrating no change in pain perception after the application of an ointment . by watching a video in which pain was demonstrated by a model
, the participants might have built up the expectation of pain when an ointment is applied .
the expectation of pain might have led to anxiety , which facilitates pain perception.26 according to benedetti et al26 and colloca and benedetti,27 anxiety is an important mechanism in nocebo hyperalgesia .
hyperalgesia is known to occur when anticipatory anxiety regarding pain itself is experienced , and also if attention is directed toward the pain.5,26,27 these processes may have had an effect on pain perception in the nc .
in addition , ointment application induced higher pain ratings , since participants rated pain with the ointment as more painful than without in the cc .
we can rule out the possibility that any active ingredient of the ointment altered pain perception , since the ointment did not contain any active substances .
in addition , in our last study , no such effects were observed.4 due to the common practice of using ointments for pain relief , the ointment could have triggered the expectation of pain relief despite the information from the video .
perhaps the psychosocial context , which has been shown to strongly influence nocebo effects , triggered the expectation of an increase in pain.26,27 the experimenters wore white medical coats and gloves ; medical supplies were in the room and it smelled of disinfectant spray .
this may have led to the expectation that something painful was imminent that required the prior application of an ointment .
therefore , the participants might have built up the expectation of pain when the ointment was applied . due to the observation of a video model , which demonstrated higher pain after the application of an ointment , pain ratings in the nc with ointment were higher than without ointment and higher than with ointment in the cc .
the pain increase due to the ointment application in the cc explained why no nocebo ( interaction ) effect was observed .
the described results were compatible with the results of our former study.4 in the verbal cc of that study , we provided explicit verbal information that the ointment would have no effect on pain experience and , consequently , observed no nocebo response . in the presence of less definite information , as in our present study
, the ointment application might have activated the expectation of pain , as argued earlier .
contrary to our expectation and the results of our previous study , we found no correlation between pain catastrophizing and nocebo response in the nc.4 neither did we find an association between individual nocebo response and unspecific somatic complaints or hypochondriasis .
the absence of such effects is in line with earlier studies , in which attempts to find variables predicting the placebo response failed to produce strong or consistent results.28,29 for the placebo response , it was concluded that the situation should be taken into account and the interaction of situational variables and personality traits should be investigated.28,29 the same may be concluded for the nocebo response .
unexpectedly , in the cc , the symptom inventory and the nocebo response were positively associated ( moderate effect size ) : the more somatic symptoms a person reported , in general , the more likely she was to report higher pain after the application of the ointment .
this result may have reached significance by chance and should be replicated . if future research confirms these associations , a reason for this could lie in a top - down driven symptom perception , a process especially prominent in people with a tendency to report many negative somatosensory events.30 top - down driven processes may contribute to turning bodily sensations into symptoms by mobilizing schematic information resulting from the person s learning history .
the schema influences the allocation of attention and the way sensations are interpreted or appraised.7,9,30 in the cc , people with many unexplained symptoms and a more top - down driven processing style may have ignored the diverging information that the ointment does not change pain perception and relied more on their schema
, their pain perception may have increased when the ointment was applied . in the presence of the information that the ointment increases pain perception ( nc ) ,
the individual tendency for such interpretations had no influence , and an increase in pain was experienced irrespective of the level of symptom reporting . in a similar vein , a positive correlation between hypochondriacal concerns and the nocebo response was observed in the cc .
this was in line with the findings that health - anxious people focused on their own negative reactions to pain , failed to make use of positive information adequately , and reported more catastrophic thoughts about the meaning and implications of pain.31 one possible explanation could be that the more health anxious a person was , the less she made use of the positive information that the ointment does not change the pain experience .
this reproduced the negative result obtained in our previous study.4 in that study , we could not exclude that the negative result was due to the limited variability of the rather high empathy scores in our sample . in the present study ,
a community sample with more variability ( empathy scale standard deviation [ sd ] = 5.2 as opposed to 3.3 in our last study ) was tested , and still , no correlation was found . in the study by swider and babel , the subscales empathic concern and personal distress predicted the nocebo response.3 in a recent study comparing a face - to - face versus a prerecorded observation of placebo analgesia , hunter et al found no correlation between empathic concern and placebo analgesia in the video replay group , but they did observe a correlation in the live observation group.32 although this has not been investigated for nocebo hyperalgesia , the video presentation of the model could possibly explain the lack of correlation between trait empathy and nocebo response .
a professional , medical environment was created to strengthen the trust of the participants in the investigation .
the credibility ratings of the cover story were high and there were no differences between the conditions , indicating that the instruction was accepted by all participants .
after the experiment , we asked the participants to guess the purpose of the study . in order to classify the responses ,
four independent raters judged the participants answers to see whether they might have the real aim of our study .
only three participants speculated about placebo / nocebo effects as the topic of research ( they were not excluded from the analysis ) .
experimenter expectations may exert an influence on the results in placebo studies , and it is reasonable to think that the same may be true for nocebo studies.33 in order to forestall such effects , the experimenters in the current study were blind with regard to the participants assigned condition .
in addition , they were trained with the support of a video to conduct the experiment in a highly standardized manner . in summary
expectations are crucial to the nocebo response.26,27 we did not ask the participants about their expectations regarding the ointment application and , therefore , can only indirectly infer that such expectations were induced .
our results suggested that we induced the expectation of increased pain in both the conditions . in future studies
one limitation related to the sample tested : all participants were women and they observed a female model ; thus , the results were limited to observational learning in women with female models .
since we investigated acute , experimentally induced pain , it remains an open question whether our results apply to naturally occurring or chronic pain .
we did not control for the effect of anxiety , which might have facilitated a nocebo response.26,27 in our last study , however , we did not find an association between nocebo response and state or trait anxiety.4
as hypothesized , the observation of a model demonstrating pain led to an increase in the pain experience , so , again , a socially induced nocebo effect was observed .
in addition , the application of an ointment led to higher pain ratings , possibly by way of invoking pain schemas .
it appears that , in the absence of definite information , health- and body - related cognitive styles influence these nocebo responses .
if further studies confirm our results that even the observation of pain in general or the unexplained administration of an intervention can lead to hyperalgesia , this may have implications for clinical trials concerned with pain and its assessment .
in addition , these considerations could be applied to minimize the unnecessary expectation - induced pain in medical procedures .
Output:
| purposerecently , it has been shown that nocebo hyperalgesia can be acquired through observational learning .
the aim of this study was to investigate socially induced nocebo hyperalgesia and its relationship with pain catastrophizing , somatic complaints , hypochondriacal concerns , and empathy.participants and methodsninety - seven women ( 43.115.5 years ) were randomly assigned to one of the two conditions .
participants in the nocebo condition ( nc ) watched a video in which a female model displayed more pain when an ointment was applied and less pain when no ointment was applied . in the control condition ( cc ) , the model demonstrated low pain with and without the ointment .
subsequently , all participants received three pressure pain stimuli ( 60 seconds ) on each hand . on one hand ,
the ointment was applied prior to the stimulation .
the order of the stimulation of the fingers ( middle , index , or ring finger ) , the side of ointment application ( left or right hand ) , and the side with which the stimulation began were randomized within each group and balanced across the groups .
depending on the randomization , the pressure pain application started with or without ointment and on the left or right hand .
pain ratings on a numerical rating scale ( 010 ) were collected .
in addition , the participants completed questionnaires regarding body - related cognitive styles and empathy.resultsthere was a significant difference in the pain ratings between the cc and the nc .
the effect of ointment application was also significant , but no interaction between condition and ointment application was found . only in the cc did the nocebo response correlate with hypochondriacal concerns and somatic complaints.conclusionapplication of an ointment as well as the observation of a model demonstrating more pain after a treatment produced elevated pain ratings .
cognitive styles were not related to the socially induced nocebo response , but were related to the nocebo response in the cc . |
PubmedSumm6865 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: comparison of dentine and bone in health and disease research on medical tissues in health and disease ( bone and osteoporosis ) is at least a magnitude more vivid than that in dentistry ( dentine and caries ) .
dental caries was the reason for the establishing the first dental school in baltimore , usa in the mid of 18th century .
this review article is an attempt to shed light on the role of enzymes during dentinogenesis and dentine steady state in health and caries taking models of enzyme functions from bones .
ectoderm covering the stomodeum of an embryo begins to proliferate , giving rise to dental laminae , which occurs in humans during the sixth week in utero .
reciprocal interactions between the ectoderm and mesoderm layers lead to placode formation , some of which develop into tooth germs , containing an enamel organ , dental papilla , and dental follicle .
therefore , teeth are made of ectodermal ( enamel organ ) and ecto - mesenchymal components , containing neural crest - derived cells , which display multipotent capabilities .
dental pulp is externally separated from dentine by odontoblasts and by hhls subodontoblastic cells which are preodontoblasts .
adjacent to this layer , the pulp is rich in collagen fibbers and poor in cells .
then a more internal layer contains progenitor cells and undifferentiated cells , some of which are considered stem cells .
the innermost layer is the core of the dental pulp and comprises the vascular plexus and nerves but some nerve branches and capillary vessels reach the odontoblast layer .
the final differentiation of tooth - forming cells , as well as matrix secretion and mineralization , takes place in the bell - stage .
the junction between the dental papilla and inner enamel epithelium determines the final crown shape and size of a tooth .
odontoblasts secrete a collagenous matrix , called predentine and at the onset mantle dentine , later term being dentine , which is then mineralized during primary dentinogenesis .
primary , secondary and tertiary dentinogenesis primary dentinogenesis in humans is completed when the tooth becomes functional and contacts are established between maxillary and mandibular teeth by late adolescence or early adulthood when it turns into secondary dentinogenesis .
nonproliferative odontoblasts reduce the speed of deposition or , may enter the quiescent state and may remain quiescent during their lifetime .
therefore , the term post - mitotic is often used to refer to both quiescent and senescent odontoblasts .
when primary dentinogenesis turns into secondary but nevertheless , these cells maintain the same denomination .
odontoblast is a nomenclature which has been established by waldeyer as early as in 1885 .
cyte is employed in mineralized tissues to designate the quiescent stage of a cell that previously underwent an active secretory stage and then remained surrounded by the mineralized matrix like osteocytes and cementocytes .
however , in living cells , only the speed of deposition varies between the blast- and cyte- phases .
one exception exists : the cells of the growth plates of long bones proliferate rapidly and are termed chondrocytes , until they undergo apoptosis at the latest when the youngster turns into an adult . the suffix
cyte is now used in mitotic cells . in puberty , both the growth of humans and the elongation of their tooth roots will halt . while the dividing chondrocytes inside the mineralized matrix of bones go through apoptosis and
disappear , the odontoblasts which become quiescent are not renamed odontocytes . the present nomenclature may change in the future : recently larmas and sndor suggested that odontoblasts during secondary dentinogenesis should be renamed as
most mammalian teeth cease their elongation at the cessation of root formation . in some teeth , however , transdifferentiation from odontoblasts to odontocytes does not happen , which would explain why some mammalian teeth ( elephant tusks and rodent incisors ) are ever - growing
. during tertiary dentinogenesis , which is not physiological and occurs in response to a local stimulus , the situation changes again : the resting odontoblasts / odontocytes may return to an activated stage ( forming reactionary dentine ) and/or die out and may be replaced by other cells of pulpal origin . in this case
tertiary dentine is then called reparative dentine ( table 1 ) .
stages of dentinogenesis , cells , and enzymes involved in it
do adult odontoblasts transdifferentiate into odontocytes in teeth with closed root apices , or are they then secondary odontoblasts and after injury tertiary odontoblasts or
this textbook nomenclature is based on the original observations of couve in growing teeth in humans and confirmed recently also in adult teeth .
since there were no interventions or randomized controlled trials involving the role of enzymes during dentinogenesis and dentin steady state identified in a preliminary literature search , the preferred reporting items for systematic reviews and metaanalysis ( prisma ) statement or cochrane handbook were not used in this review .
the keywords used for the searches ( in august , 2014 ) were enzymes and odontoblasts .
only articles written in english were included and their number restricted to enzymes , dentinogenesis and caries : ultimately a manual search of english language dental anatomy and textbooks was performed . using keywords
enzymes and odontoblasts pubmed hits were 598 while scopus hits were 371 . using enzymes and dental caries
enzymes and dentine caries in pubmed gave 179 hits and scopus had 100 hits .
enzymes and enamel caries in pubmed resulted in 131 hits while scopus gave 81 hits .
enzymes and dentinogenesis in pubmed resulted in 183 hits while with scopus there were 91 hits . using key words
enzymes and primary dentinogenesis there were 18 hits in pubmed and in scopus there were 8 . enzymes and secondary dentinogenesis gave 20 hits in pubmed and 8 hits in scopus .
enzymes and tertiary dentinogenesis gave only 6 hits in pubmed and 2 in scopus .
scopus gave a total of 100 hits for enzymes and dentine caries and those were reported as follows : larmas 14 , mkinen 9 , and tjderhane 8 , all authors being from the same research group .
when the english language search was restricted to enzymes , dentinogenesis and caries then only 3 - 4 hits were produced by pubmed and scopus respectively .
cellular events in the early differentiation phases the final differentiation of the tooth - forming cells from embryonic progenitor / stem cells take place in the bell stage of tooth development .
the columnar cells of the enamel organ adjacent to the dental papilla are known as the inner enamel epithelium , which are differentiated from stem cells of inner enamel epithelium , or ameloblasts , as they move outwards or upwards .
ectomesodermal stem cells differentiate into odontoblasts and secrete a collagenous matrix which is then mineralized into extracellular dentine .
first , the enamel - forming ameloblasts secrete an organic matrix that is then mineralized .
thereafter , during a distinct stage called enamel maturation , a sudden and massive influx of mineral ions takes place .
the maturation stage initiates in the cusps while the secretory phase continues in the more cervical parts of the enamel organ .
enzymes in undifferentiated dental cells in order to reach an integrated picture of cell metabolism at the onset of tooth ontogeny , several histochemical studies have been performed on enzymes in cells and structures in experimental animals .
enzymes participating in cell metabolism are normally demonstrable at the stage of active differentiation , but also in differentiated tooth forming cells .
however , it should be considered that quantification of enzyme activity by histochemical means is impossible because changes in enzyme activity may represent a direct change in the number of enzyme molecules , alterations in the physical state of the enzyme molecules or the effects of various co - factors in addition to technical assay problems .
histochemical studies of differentiating , developing and forming human teeth and supporting structures have also been performed .
several arylaminopeptidases and glucosidases were demonstrated in the basal cell layer of stomodeum , in the subjacent mesoderm , in the outer and inner enamel epithelium , in the dental papilla and lamina , and in the primordium of permanent tooth .
no arylaminopeptidase activity could be observed in ameloblasts , odontoblasts , enamel , dentine , stellate reticulum , and pulp , and the inner enamel epithelium also lost its activity during the stage of apposition .
all structures ( except enamel and dentine ) of the human tooth germ revealed dehydrogenases including lactate ( ldh ) , succinate ( sdh ) , glutamate ( gdh ) , and nadh2 activities in different patterns .
ldh activities decreased during the development in the epithelium and the subjacent mesoderm up to the stage of apposition , when ameloblasts and odontoblasts revealed intense ldh , weak sdh activity , and strong nadh2 - diaphorase activity .
these observations suggested that anaerobic glycolysis as an energy source dominated in mineralizing cells at the onset of enamel and dentine formation .
histochemical analyses are essential for understanding the localization of molecules , and biochemical studies are needed for the demonstration of real changes in enzyme activity . in experimental mice , a considerable rise in the membrane - bound enzyme , non - specific alkaline phosphatase ( apase ) activity in the mesenchymal part of tooth germs between the 18 prenatal day and the 1 day was seen .
that time corresponds to the onset of mantle dentine secretion by odontoblasts in mice . because the protein content of the samples also increased during this 2-day period
this stimulation further increased up to the 7 day , after which the protein content dramatically decreased in 4 days and the apase activity in 10 days , indicating that the stimulation period of apase activity in mesenchyme had ended .
the secretion of enamel in mice molars starts between the 1 and 2 postnatal days , at which time the increase in epithelial apase becomes pronounced and continues up to the 7 day .
the observed changes in apase activity in both ectodermal and ectomesenchymal parts of the tooth germs could be due to changes in the number of cells associated with the synthesis and/or activation of apase molecules .
epithelial and mesenchymal parts of teeth could not be isolated at day 11 , when the mice molars had not emerged , but their crown development was complete .
then a significant decrease in the apase activity was seen in the mesenchyme . because the mineralization of dentine matrices closely follows the secretory phase , the role of apase in either secretion or mineralization can not be distinguished .
the developmental stage in the cusp region is more advanced than in the cervical part .
the activity of matrix metalloproteinases ( mmps ) , a class of ca / zn - dependent endopeptidases that remain trapped within the mineralized dentine matrix , is regulated by members of the timp ( tissue inhibitors of metalloproteinase ) family .
the expression of gelatinase a ( mmp-2 ) and gelatinase b ( mmp-9 ) as well as timp-1 , -2 and -3 genes during different stages of mouse tooth development was analyzed .
gene expression was generally found in mesenchymal tissues except for timp-3 , which also was found in dental epithelial cells .
gelatinase b and timp-1 and timp-3 expression showed clear association with epithelial morphogenesis and was restricted to the mesenchyme at the tip of the growing tooth bud .
gelatinase a and timp-1 showed transient expression in secretory odontoblasts at the time of basement membrane degradation , while timp-2 expression continued throughout the dental papilla .
cellular events in primary dentinogenesis during primary dentin formation , odontoblasts retreat from the mineralization front , leaving behind cellular processes that remain trapped in dentinal tubules .
for example , estrogen deficiency , induced by ovariectomy , caused enhanced dentine formation in adult rats , suggesting that estrogen receptors may be present also in dental tissues .
odontoblasts are reported to reveal the expression of mineralization - related genes , including dentine sialophosphoprotein and dentine matrix protein-1 [ 18 - 20 ] .
odontoblasts are dividing in the elongating permanent tooth until the closure of the root apex .
after apical closure old odontoblasts or odontocytes continue to maintain their vital functions during secondary dentinogenesis , which maintains the mechano - modulatory role in adult dentine with a very low rate of dentine formation but contrary to bone , without dentine resorption .
the areas of a developed caries lesion and formed dentin under the lesion during the cariogenic challenge positively correlated in all molars up to 7 weeks after weaning of the rat pup .
then a dramatic drop in both the rate of caries progression and that of dentine formation was seen when compared to adult rats .
some genetic disorders may be linked to the stages of odontoblast differentiation such as dentinogenesis imperfecta in which teeth are blue - brown colour with pulp obliteration or large pulp chambers .
dentinogenesis imperfecta type ii and type iii usually occur in people without other inherited disorders .
this disturbance was connected to stages of odontoblast differentiation : if primary odontoblasts turn into odontocytes , primary dentinogenesis does not progress to secondary dentinogenesis causing type i and ii dentinogenesis imperfecta meaning that odontoblasts are evergrowing .
another genetic disorder , hypophosphataemic vitamin d - resistant rickets , is characterized by pulpal horns which extend to the enamel and by globular circumpulpal dentine in humans .
the globules were normally mineralized , whereas the interspaces between the globules were not mineralized at all .
mantle dentine below the enamel - dentine border was not globular until a width of 0.2 mm toward the pulp was reached .
evidently , ameloblasts or hertwigs epithelial cells resulted in the non - globular region by odontoblasts under the dentino - enamel and cementum - dentine junction .
recent studies have identified a number of molecules with phosphaturic activities , including fibroblast growth factor-23 ( fgf-23 ) and matrix extracellular phosphoglycoprotein .
fgf-23 has been implicated in various human diseases , including autosomal dominant hypophosphatemic rickets and x - linked hypophosphatemia .
fgf-23 is mostly expressed in bone and connective tissue and prior to 2000 was known in the scientific community as phosphatonin .
enzymes in primary dentinogenesis a series of biochemical enzyme assays from samples taken from extracted human teeth was also performed .
samples of drilled dentine powder were taken from ( 1 ) crown enamel dentine , ( 2 ) crown dentine , ( 3 ) crown odontoblastic ( circumpulpal ) dentine , ( 4 ) root odontoblastic dentine , ( 5 ) apical odontoblastic dentine as well as soft carious dentine , from developing teeth and fully - formed teeth .
apase activity was highest in all circumpulpal samples from emerged but still developing sound human teeth and a dramatic drop in the activity was seen in these samples .
this drop was so distinct that apase activity per protein or per wet weight of the sample was used as an indicator of the closure of the apex in clinically borderline cases : high activity represented open apex , low activity indicated the closure .
cell function in secondary dentinogenesis in the adult human teeth the cell division of old odontoblasts or odontocytes is zero and their secretory activity is limited , resulting in secondary dentine formation which is very slow when compared to that of primary dentine apposition .
odontoblasts begin as polygonal cells that leave behind processes in the dentine matrix with numerous branches .
compared early and late odontoblasts with osteoblasts and osteocytes , using two osteocyte markers , dmp1 , an acidic extracellular matrix protein , and e11/gp38 , a transmembrane glycoprotein decreased mineral deposition and lower expression of e11 and other osteocyte markers such as dmp1 . a huge difference between odontoblasts and osteocytes exists since the odontoblasts / cytes are not completely embedded in mineralized matrix like osteocytes .
osteocytes communicate between each other and with osteoblasts / bone lining cells by gap junctions found in their plasma membrane in the end their processes inside the canaliculi , which does not occur in odontoblasts in the same manner .
however , a drop in the apase activity was used as an indicator of the closure of the tooth root apex even in the crown area : high activity represented open apex , low activity indicated the closure and therefore , the existence of a communication system between odontoblasts is supported since some system exists linking odontoblasts in the apex and crown areas .
the remarkable similarities in morphology and the three - dimensional canalicular systems in both odontoblasts and osteocytes , together with a very similar expression pattern of two osteocyte markers , dmp1 and e-11 , in the processes of odontoblasts and dendrites of osteocytes , supported the differentiation pattern of osteoblasts into osteocytes in bone .
terminally differentiated adult odontoblasts , or odontocytes , were found to develop an autophagic - lysosomal system organized mainly by large autophagic vacuoles that are acid - phosphatase - positive to various degrees .
these vacuoles expressed the autophagosomal and lysosomal markers lc3 and lamp2 in an age - related pattern .
recently , couve et al . confirmed these observations of an autophagic - lysosomal system and additionally found mitochondrial autophagy and lipofuscin accumulation in aging odontoblasts .
enzymes in secondary dentinogenesis in sound and carious human teeth histochemical methods of the localization of many enzymes in sound and carious human teeth in different developmental or pathological stages were conducted some decades ago ( figure 1 ) .
hydrolysis of numerous naphthol derivatives was histochemically detected in the dental plaque on advanced carious lesions and in the tubules of soft carious dentine , indicating the occurrence of arylaminopeptidases , carboxylic ester hydrolases , acid phosphatase , phosphoamidases , pyrophosphatases , glycosidases , and arylsulphatase in dentinal tubules of soft carious dentine ( figure 1 ) .
dental plaque and dentinal tubules of carious dentine also revealed ldh , glucose-6-phosphate , and sdh activity ( figure 1e , 1f ) , ldh activity was demonstrable even in the area where no microorganisms ( figure 1f ) were seen under the carious lesion .
examples of the presence of certain hydrolases and oxido - reductases in soft carious dentine of extracted human molar teeth . a = arylaminopeptidase activity in the dentinal tubules of soft carious dentin .
b = higher magnification ( x165 ) of arylaminopeptidase on the borderland between hard ( under ) and soft carious dentine ( above ) . c = glocose-6-phosphate - dehyrogenase in soft carious dentine .
f = higher magnification ( x451 ) of lactate dehydrogenase activity on the borderland between hard ( fractured ) and soft carious dentine revealing enzyme activity in dentinal tubules , ahead microorganims .
the picture is reconstructed from the original slides published by larmas et al . in acta odontol
scand 26 : 127 - 136 , 1968 ( a and b ) and larmas in arch oral biol .
acid phosphatase , glucuronidase , and glycosidase substrates were observed to be hydrolyzed in the odontoblastic layer and the predentine , which area also revealed high apase and occasional succinate dehydrogenase activity .
no activity of any enzyme was demonstrated in hard dentine of sound or carious teeth .
quantitative enzyme activity determinations were also conducted with samples from both soft carious dentine , and from hard , pigmented carious dentine in fully - formed sound and enamel carious lesions , from teeth with dentine caries , teeth with pulpitis , and fully - formed teeth with necrotic pulps .
observations confirmed that apase was activated in peripulpal odontoblasts when caries was in enamel only , further activation was seen when the process reached dentine , which activation was also seen in the peripulpal area of the apex .
these observations were thought to support the view that apase in the entire circumpulpal odontoblast layer reacts as a network of cells in response to caries .
biochemical analysis of the rate of hydrolysis of arylaminopeptidase substrates revealed that enzyme activity was at least ten times higher in soft carious dentine than in non - carious coronal dentine .
approximately three times as much arylaminopeptidase activity was seen in carious lesions from necrotic teeth than lesions from vital teeth which indicated that these teeth harboured different types of microbes .
the occurrence of aminotransferases both in sound and carious human dentine was reported , too indicating degradation of amino acids during the carious process .
changes of these enzyme activities indicated that both microbial metabolism and odontoblastic response mediated the process of progression of caries in dentine .
cell function in tertiary dentinogenesis the most common feature of pulp repair in injury is the formation of tertiary dentine , a subgroup of which is reactionary dentine .
the latter generally follows a mild injury ( for example carious lesions of only moderate progression ) , which odontoblasts survive after the stimuli .
the regulation of odontoblast / cyte activity is clearly central to tooth response against injury .
more intense injury that later leads to odontoblast death is followed by the formation of reparative dentine
. then more complex defence and healing responses occur , with recruitment of stem or progenitor cells from pulpal origin , first reported by gronthos et al . , their differentiation to odontoblast - like cells , and subsequent up - regulation of secretory activity and tissue mineralization which is called reparative dentinogenesis .
investigation of genes and/or signaling pathways which might represent targets for the switch from secondary to tertiary dentinogenesis is important .
endopeptidases in mature human odontoblasts and pulp tissue a couple of decades ago it was not possible to reveal any proteolytic enzyme activity in hard , fully - formed human dentine either by histochemical or biochemical enzyme assays but soft carious dentine revealed peptidase activity and endopeptidases were also demonstrable by biochemical means . therefore , with the development of more sophisticated enzyme activity assays the focus was directed to mmps .
activation of the proteolytic enzymes may be a critical step that leads to dentine extracellular matrix breakdown , especially in the remodelling of predentine to allow dentine formation to occur .
first the presence of gelatinases ( mmp-2 , -9 ) was demonstrated as well as collagenase-2 ( mmp-8 ) in mature healthy dentine .
more detailed analysis demonstrated that mmp-14 ( membrane type mmp , mt1-mmp ) mrna was expressed by native and cultured mature human odontoblasts and pulp tissue .
western blot analysis of human odontoblasts and pulp tissue detected pro- and active forms of mt1-mmp , and smaller truncated mt1-mmp forms .
bmp-2 down - regulated mt1-mmp expression in odontoblasts and pulp tissue , while tgf-1 , alone or with bmp-2 , decreased mt1-mmp mrna levels only slightly .
it was also demonstrated that mt1-mmp was capable of converting prommp-20 into a form corresponding to the active mmp-20 . in conclusion
, observations demonstrated the expression and differential regulation of mt1-mmp in human dentine - pulp complex cells , and the activation of mmp-20 by mt1-mmp .
some osteocyte markers , like bmp-2 , down - regulated mmp-14 expression in mature odontoblasts while tgf-1 alone or with bmp-2 decreased mmp-14 mrna levels slightly .
thus , old odontoblasts / cytes share similar features with osteocytes with regard to the mmp family , which may safeguard osteoblasts from apoptosis during transdifferentiation into osteocytes .
studied the presence and localization of mmp-20 in mature human teeth in health and disease . in immunohistochemistry ,
mmp-20-positive staining was observed most intensively in the radicular odontoblastic layer and also in dilated dentinal tubuli of caries lesions . by western
blotting , mmp-20 was detected in odontoblasts and pulp tissue of both sound and carious teeth , in dentinal fluid and dentine of sound teeth , but not in soft carious dentine .
mmp-20 produced during primary dentinogenesis was synthesized and secreted by ameloblasts and incorporated into dentine outer layer and may be released during caries progression .
the main cellular source of mmp-20 in the dentine - pulp complex was the odontoblasts , which secreted mmp-20 into the dentinal fluid .
the fei - sem analysis revealed positive immunolabelling patterns for mmp-3 , predominantly localized on the intertubular collagen fibrillar network showing mmp-3 directly or indirectly bound to the collagen fibrils .
in carious dentine , cysteine cathepsin activity increased with increasing depth and age in chronic lesions , but decreased with age in active lesions .
recently it was also reported that the abundance of cysteine cathepsins and mmps was markedly higher in caries - affected than in intact dentine .
cysteine cathepsin - b exhibited the highest percentage of co - localization with collagen , followed by mmp-9 , mmp-2 , and cysteine cathepsin - k .
the high expression of cysteine cathepsins and mmps in caries - affected teeth indicated that those host - derived enzymes were intensely involved with caries progression .
histochemical localization of apase in developing teeth with advanced dentinal caries when the carious process was so progressive that it reached the dental pulp in a developing human molar tooth , the histochemical distribution of apase was interesting : enzyme activity disappeared from the odontoblasts of the pulp exposure area , where cells evidently were not vital any more in these growing teeth .
all other odontoblasts around the pulp chamber exhibited strong apase activity , especially in the cells of the open root apices , but also periodontal structures on the root surface around the apex areas , exhibited high activity ( figure 2 ) .
a = a microradiograph of a developing human molar tooth with an advanced carious lesion .
b = localization of alkaline phosphatase activity in the odontoblasts , predentine , cementum , in remaining parts of the periodontal ligament , and some pulpal cells .
c = higher magnification of the localization of alkaline phosphatase activity in pulpal cells under the advanced carious lesion with pulp perforation and pulpal inflammation .
note the disappearance of enzyme activity in odontoblasts in the site of carious exposure and appearance in dentinal tubules in soft carious dentin .
d = higher magnification of the same area of pulp horn showing the presence of arylaminopeptidase activity in the fibroblasts / progenitor / stem cells or inflammatory cells in the inflamed pulp horn .
substrate : n - l - arginyl-2-naphthylamine , fast blue b , ph , 6.8 .
the picture is originally published in the anatomical record : advances in integrative anatomy and evolutionary biology , 296 , p. 565
, 2013 , and the reproduction granted by wiley/ the copyright clearence center inc , license number 3213520064351 . in the inflamed dental pulp , under the pulp perforation area ,
high apase activity was present in pulp fibroblasts or progenitor / stem cells around the inflamed area , where enzyme activity encircled the inflamed pulp horn area ( figure 2c ) .
the presence of pulpal inflammation was indicated by an elevated arylaminopeptidase activity in the cells inside the inflamed pulp horn ( figure 2d ) .
tooth - ache was the cause of the extraction of that tooth and established the presence of inflammation and the histochemical findings .
it seems that apase in human dental pulp was activated by some signalling pathway either in the pulp fibroblasts or in some progenitor pulp cells or in pulp stem cells under the inflamed pulp horn in a developing and elongating ( growing ) tooth or else , by some circulating progenitor / stem cells .
what seems certain is that no apase activity occurred in the odontoblasts in the pulp exposure area , but odontoblasts in the crown or root area exhibited enzyme activity in the developing tooth , whereas pulp fibroblasts normally were without activity . in the advanced stage of carious injury , odontoblasts were non - vital and unable to produce any reactionary dentine or apase
. it still remains unsolved whether pulp fibroblasts or progenitor / stem cells are capable of producing some reparative dentine , for example in the form of pulp stones .
the enzyme spectrum in differentiating and differentiated odontoblasts and in soft carious dentine is broad .
evidently most of the enzymes in carious tissue originate from microorganisms or saliva , which have penetrated into dentine .
whether these enzymes are catabolic for dentine or meant to maintain the vital functions of the microbes remains unsolved .
the catabolic role of mmp enzymes was supported by the findings that dentine mmps may participate in the destruction of dentine collagen following demineralization by bacterial acids
the presence of lactate dehydrogenase deep in the carious lesion suggests that the production of lactic acid is possible there and enables the dissolution of the dentine wall perpendicular to dentinal tubules and thereby their dilation , which explains the undermining appearance found in carious lesions .
the localization and activation of apase in odontoblasts and pulpal fibroblasts or progenitor cells point to the role of apase in cell differentiation during dentine formation .
stem cell - based tooth regeneration is a promising approach to solving the problems of dentine caries and human skeletal muscle stem cells could also differentiate into odontoblasts but required an extracellular matrix scaffold and changes in their integrin profile that was evidenced by appearance of odontoblastic phenotypes .
though dental studies are scanty when compared to bone , the active role of large spectrum of enzymes in healthy and carious dentine was given support .
Output:
| abstractobjectivessearch in pubmed with keywords enzymes , dentinogenesis , and dental caries
revealed only 4 items , but when combined with enzymes , osteogenesis , and osteoporosis as high as 404 items resulted .
dental caries was associated with an order of magnitude fewer studies than the chronic bone disease , osteoporosis .
this observation motivated this review.material and methodsa comprehensive review of the available literature on role of enzymes in dentinogenesis and dental caries was undertaken using medline ( pubmed ) and scopus .
keywords for the search were : enzymes and odontoblasts , enzymes and different forms of dentinogenesis as well as dental caries.resultssearch revealed studies which described odontoblasts harbouring numerous enzymes ( hydrolases , including metalloproteinases , transaminases and dehydrogenases ) during primary dentinogenesis .
alkaline phosphatase activity sharply decreased when odontoblasts turned into quiescent odontoblasts .
tertiary dentinogenesis was characterized first by reactionary dentine formation when alkaline phosphatase was highly reactivated .
then later some of these odontoblasts may die out and be replaced by other progenitor cells of pulpal origin .
this tertiary dentine was called reparative dentine .
pulpal progenitor / stem cells revealed alkaline phosphatase activity in areas encircling inflamed pulp sections .
soft carious dentine revealed high hydrolase , transaminase and dehyrogenase activities that may have originated from invading microbes , saliva or were endogenous .
proteolytic activity was especially demonstrable using histochemical and biochemical means .
specifically , matrix metalloproteases may have originated partly from activated proenzymes of host origin.conclusionsthough dental studies are scanty when compared to bone , the active role of large spectrum of enzymes in healthy and carious dentine was given support . |
PubmedSumm6866 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: termed first by bell in 1970 , cruciate paralysis is a rare neurological disease of the cervicomedullary junction .
cruciate paralysis often presents with bilateral paresis of the upper extremities while sparing the lower extremities .
patients may also present with difficulty breathing , cranial nerve deficits , or a comatose state . while trauma is the most common cause of cruciate paralysis ,
the leading hypothesis involves disruption of the anatomy of the pyramidal decussation at the cervicomedullary junction .
the anatomical decussation extends longitudinally , spanning from the cervicomedullary junction to the c-2 level . within this region ,
the motor tract fibers of the upper extremities cross both ventrally and superiorly to the fibers supplying the lower extremities . by crossing at a spatially different location ,
the independent upper extremity fibers provide a way for lesions to preferentially damage upper extremity fibers while sparing those of the lower extremities .
however , cruciate paralysis is a rare condition with few reported studies ; hence , treatments have been variable and are often without supportive evidence .
in this report , we conducted a systematic literature review from 1966 to the present of patients diagnosed with cruciate paralysis to identify potential prognostic predictors for the outcome . using medline and pubmed central , a comprehensive search for all papers under mesh and keyword term cruciate paralysis
additional information and cases were obtained through google and google scholar , and appropriate search of relevant sources was performed using the same keywords .
a case was included if it met the following criteria : ( 1 ) the paper under review demonstrated appropriate signs and symptoms of cruciate paralysis as defined above ; ( 2 ) a mechanism of injury was noted ; ( 3 ) the type of intervention and treatment was noted ; and ( 4 ) a follow - up examination was documented .
cases with patients presenting in a comatose state were excluded along with papers written in languages other than english .
our study focused on patients who were noncomatose and carried the diagnosis of cruciate paralysis .
this is due to the fact that different states of coma may affect appropriate examination of the upper and lower extremities and hence the diagnosis .
of the 39 cases initially found , 37 of them met our criteria [ table 1 ] . follow up results were classified into three categories of recovery : insignificant recovery , moderate recovery , or full recovery .
a case was considered to have made a full recovery if , at the time of the last documented follow - up , upper extremity neurologic deficits had completely resolved .
a case was considered to have made a moderate recovery if , at the time of the last follow - up , symptomatic improvement was documented , but residual upper extremity neurologic deficits still remained .
finally , a case was considered to have made an insignificant recovery if , at the time of the last follow - up , there was little to no change in upper extremity neurologic deficits since the time of initial presentation .
each category was assigned a numerical score of 1 , 2 , or 3 , respectively , for simplicity of analysis .
treatments were further characterized into two groups : those who underwent surgical intervention and those who did not .
each of the 36 cases was analyzed for outcome trends based on cause ( trauma or nontrauma related ) , and an appropriate anova test was run using the mean numerical scores of each category [ table 2 ] .
the 28 cases associated with trauma were further analyzed , and respective anova tests were run to determine trends and associations of outcomes categorized by age , gender , and type of intervention [ table 3 ] .
clinical studies investigating the management of cruciate paralysis percentage of cases making a full recovery , moderate recovery , or insignificant recovery by cause of symptoms percentage of trauma cases ( 29 patients ) making a full recovery , moderate recovery , or insignificant recovery by age , gender , and type of correctional intervention
in patients who carried the diagnosis of cruciate paralysis and who were not comatose , the overall reported outcome was favorable with 54% of patients achieving full recovery and 29.7% of patients achieving moderate recovery .
the overall outcomes associated with cruciate paralysis secondary to trauma did not differ significantly from other nontraumatic causes , p = 0.5 [ table 2 ] .
since the majority of cases of cruciate paralysis were traumatic ( 29 patients , 78.4% ) , we analyzed factors that might impact outcomes of traumatic cruciate paralysis [ table 3 ] .
patients over the age of 60 years showed significantly worse outcomes as compared to those under the age of 60 , p < 0.001 .
similarly , patients in the both 020 and the 2040 age ranges had statistically better outcomes when compared to the rest of the cohort , p = 0.02 and p = 0.02 , respectively .
male patients also seemed to have slightly better outcomes on average than female patients , p = 0.08 .
finally , patients treated without surgical intervention had better prognoses than those treated surgically but did not reach statistical significance , p = 0.08 [ table 3 ] . we included the details of the patient with traumatic cruciate paralysis that was treated at our institution in figures 13 .
her neurological examination showed a motor strength of 1/5 in the upper extremities and 3/5 in the lower extremities .
sagittal t2-weighted sequence magnetic resonance imaging of the cervical spine demonstrating a type iii odontoid fracture with posterior subluxation causing compression of the cervicomedullary junction with upper cervical spine signal cord change the patient was placed in crown halo traction and her fracture fragment was reduced as demonstrated by the lateral cervical spine x - ray ( a ) .
the patient then was placed in crown halo vest , and a magnetic resonance imaging of the cervical spine was done revealing reduction and realignment with decompression at the cervicomedullary junction as demonstrated with a sagittal t2-weighted sequence ( b ) the patient underwent tracheostomy and percutaneous endoscopic gastrostomy tube placement .
her neurological examination continued to improve . ultimately , the tracheostomy and the percutaneous endoscopic gastrostomy tubes were removed .
she was kept in a crown halo vest for 6 weeks , followed by 6 weeks of rigid collar placement . during her 6-month follow - up visit ,
it resembles central cord syndrome of the subaxial cervical spine , in that it usually affects the upper more than the lower extremities ; however , since it is localized to the upper cervical spine , it is also associated with various degrees of lower cranial nerve palsies and at times states of coma .
our review demonstrated that most cases are traumatic in nature with 78.4% of the cases reported .
overall , in the absence of coma , the outcome following this injury is favorable with 54% of patients achieving full recovery and 29.7% of patients achieving moderate recovery .
patients who were older than 60 years had a worse outcome than younger patients suffering from traumatic cruciate paralysis . while no concrete treatment recommendations have been suggested in the literature , due to the presence of a neurological deficit , severe cruciate paralysis has traditionally warranted surgical intervention .
our review , however , showed that patients who were treated nonsurgically may have better outcomes with a p value of 0.08 .
this may reflect that patients who warrant surgical intervention may be sicker due to other associated injuries or suffer from a biomechanically unstable fracture requiring surgical intervention .
similarly , dickman et al . recommended surgical intervention only be used for patients having more severe fractures with associated ligamentous instability of the atlantoaxial complex .
our study has a few limitations ; the cohort size is small in size since our search focused only on papers that included cruciate paralysis as a keyword and hence some papers that may have included patients with cruciate paralysis secondary to atlantooccipital dissociation and combination atlas and axis fractures were not included .
moreover , patients who were in a comatose state were excluded as well since it would be hard to ascribe coma due to an intracranial or upper cervical spine injury .
while numerous cases of trauma - associated cruciate paralysis have been reported in the literature , there remain insignificant data to make any sound conclusion concerning whether or not surgical intervention is always the best method of treatment .
Output:
| objective : cruciate paralysis is a rare , poorly understood condition of the upper craniovertebral junction that allows for selective paralysis of the upper extremities while sparing the lower extremities . reported cases are few and best treatment practices remain up for debate .
the purpose of this study was to conduct a systemic literature review in an attempt to identify prognostic predictors and outcome trends associated with cases previously reported in the literature.materials and methods : we conducted a systematic literature review for all cases using the term cruciate paralysis , reviewing a total of 37 reported cases .
all outcomes were assigned a numerical value based on examination at the last follow - up .
these numerical values were further analyzed and tested for statistical significance.results:of the 37 cases , 78.4% were of traumatic causes .
of these , there were considerably worse outcomes associated with patients over the age of 65 years ( p < 0.001 ) .
those patients undergoing surgical treatment showed potentially worse outcomes , with a p value approaching significance at p = 0.08.conclusion:numerous cases of trauma - associated cruciate paralysis have been reported in the literature ; however , there remains a strong need for further study of the condition .
while certain risk factors can be elicited from currently reported studies , insignificant data exist to make any sound conclusion concerning whether surgical intervention is always the best method of treatment . |
PubmedSumm6867 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: chronic chylous ascites , associated with malignant obstructions in the lymphatic channel , does not usually cause acute abdominal pain .
that is , chyle extravasation into the peritoneal cavity is rarely associated with the sudden development of peritonitis ( 1 ) .
we present a case of acute chylous peritonitis in a patient with advanced gastric carcinoma who presented with signs and symptoms of peritonitis caused by ovarian torsion .
the department of surgery was consulted for the finding of milky peritoneal fluid in a 41-yr - old female undergoing a complete abdominal hysterectomy with bilateral salphingo - oophorectomy ( tah - bso ) by a gynecologist at our institution .
the patient had been admitted to the yonsei university medical center , seoul , korea , for chemotherapy due to advanced gastric carcinoma . a previous computed tomography ( ct ) scan had shown bilateral metastatic ovarian tumors . during her stay ,
a physical examination revealed direct tenderness to palpation , rebound tenderness , and guarding ; she was also noted to have a palpable left supraclavicular node .
a chest radiography was normal ; an emergent abdominal pelvic ct scan showed increased bilateral ovarian tumors with minimal intraperitoneal fluid collection ( fig .
the initial blood laboratory results showed a total leukocyte count of 3,600/l with 58% neutrophils , hb 12.8 g / dl , platelet count 245,000/l , na 143 mm / l , k 3.9 mm / l , cl 103 mm / l , bun 13.6 mg / dl , creatinine 0.9 mg / dl , glucose 116 mg / dl , ast 20 iu / l , alt 14 iu / l , and total bilirubin 0.6 mg / dl . based on the physical examination and ct findings , peritonitis caused by ovarian torsion was strongly suspected , leading a gynecologist to perform an exploratory laparotomy on an emergency basis . in the operative field ,
however , a minimal to moderate amount of milky peritoneal fluid was observed in the pelvic cavity and along the right paracolic gutter .
after the tah - bso , the patient was evaluated at the department of surgery for chylous ascites . on intraperitoneal exploration ,
the stomach seemed to be tethered to the pancreas , but there was no evidence of peritoneal carcinomatosis .
diffuse lymphatic ectasia and milky fluid discharge were noted around the small bowel mesentery ( fig .
she was given a fat - free diet , and no evidence of reoccurrence of ascites was noted on clinical observation , such as the measurement of daily body weight and abdominal circumference .
chylous ascites is an uncommon finding , with an incidence of 1 in 20,000 hospital admissions ( 2 ) .
paracentesis is the most important diagnostic modality and reveals milky peritoneal fluid with a triglyceride concentration 2 to 8 times that of plasma ( 3 ) .
malignant lymphoma is the most common cause of chylous ascites and accounts for 50% of cancer - related cases ( 4 ) .
malignant invasion causes lymphatic channel fibrosis and disruption of the peritoneal cavity lymphatic system , enhancing extravasation distal to the obstruction .
other malignancies such as colon , pancreatic , stomach , ovarian cancers , and intestinal carcinoid , kaposi sarcoma , and lymphangiomyomatosis ( 5 ) can also cause chylous ascites .
other etiologies include infectious diseases , such as peritoneal tuberculosis and lymphatic filariasis , lymphatic system congenital anomalies , radiation side effects , abdominal surgery complications , and portal hypertension from liver cirrhosis ( 6 ) .
chronic chylous ascites usually does not present with acute abdominal pain , as mentioned previously . in the present case , the abrupt onset was accompanied by peritoneal signs that led to an emergency exploratory laparotomy due to a concern of ovarian torsion caused by large bilateral ovarian krukenburg 's tumors .
strictly speaking , the operative finding did not show any evidence of acute inflammatory changes in the patient 's peritoneal cavity ; however , clinical symptoms definitively suggested peritonitis , requiring immediate surgical intervention .
therefore , the diagnosis of acute chylous peritonitis may be more appropriate than that of chylous ascites , depending on the clinical setting .
although there was no gross lymphadenopathy or peritoneal cancer seeding , microscopic metastasis in the small lymphatic system was suspected as the etiology .
later it was revealed that the patient had left supraclavicular engorgement , which subsequently decreased after the laparotomy .
disruption of the abdominal cavity peripheral lymphatic system , caused by thoracic duct obstruction from a metastatic left clavicular lymph node , resulted in sudden extravasation and acute chylous peritonitis . in our hypothesis , if it had not been for the chylous ascites , the abrupt onset of chylothorax might have occurred , and would have presented with dyspnea as the initial symptom .
the optimal management of chylous ascites includes a protein - rich , low - fat diet , medium - chain triglycerides , sandostatin , and orlistat ( xenical ) ( 7 - 10 ) .
total parenteral nutrition can be used to decrease lymphatic flow and to promote lymphatic disruption closure .
although no drain catheters were placed , there was no evidence of further peritoneal fluid collection . in this case , the symptoms and signs of peritonitis were present ; however , there was no accompanying fever , leukocytosis , or intraperitoneal free air .
although spontaneous acute chylous peritonitis is rare , the disease should be considered in a patient with underlying malignant disease and signs of peritoneal irritation without associated leukocytosis , fever , and intraperitoneal free air . in these cases ,
laparoscopy prior to laparotomy would have confirmed chylous ascites and resulted in a less invasive surgical procedure .
Output:
| the extravasation of chyle into the peritoneal space usually does not accompany an abrupt onset of abdominal pain with symptoms and signs of peritonitis .
the rarity of this condition fails to reach preoperative diagnosis prior to laparotomy . here
, we introduce a case of chylous ascites that presented with acute abdominal pain mimicking peritonitis caused by ovarian torsion in a 41-yr - old female patient with advanced gastric carcinoma . an emergency exploratory laparotomy was performed but revealed no evidence of ovarian torsion .
only chylous ascites was discovered in the operative field .
she underwent a complete abdominal hysterectomy and salphingo - oophorectomy . only saline irrigation and suction - up
were performed for the chylous ascites .
the postoperative course was uneventful .
her bowel movement was restored within 1 week .
she was allowed only a fat - free diet , and no evidence of re - occurrence of ascites was noted on clinical observation .
she now remains under consideration for additional chemotherapy . |
PubmedSumm6868 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the apelin peptides activate the class a rhodopsin - like g - protein - coupled receptor ( gpcr ) named apj.(1 ) apelinapj signaling has been demonstrated within the cardiovascular system , central nervous system , and adipoinsular axis ( as previously reviewed(2 ) ) , among other physiological settings .
apelin is an extremely potent inotropic agent , increasing muscle contractility with a half - maximal effective concentration of 33
pmol / l in rat heart.(3 ) upregulation of apelin is observed in conjunction with an elevated body mass index,(4 ) and plasma levels of apelin are increased during heart failure.(5 ) furthermore , apelin inhibits human immunodeficiency virus fusion to host cells,(6 ) and apelin has been shown to induce angiogenesis during tumor formation . as a whole , these functions have made the apelinapj system popular as a proposed therapeutic target .
apelin is produced as a 77 amino acid preproprotein that is cleaved into a variety of bioactive forms from 13 to 36 residues in length , each of which retain the c - terminus of the precursor.(11 ) the 12 c - terminal residues of apelin constitute the core region essential for apelin function .
our recent nmr studies on apelin-17 suggest that this core region is only moderately structured in solution at physiological temperature , but that binding to apj may lead to more defined structuring.(15 ) sargent and schwyzer(16 ) first formulated the membrane catalysis hypothesis , stating that a small peptide first interacts with the target cell plasma membrane before binding to and activating its target receptor .
the membrane is proposed to act as a receptorligand catalyst by increasing the local concentration of the ligand , improving the probability of diffusional collision between the receptor and ligand , and/or by inducing a conformational change in the peptide to increase the receptor - binding energetics .
this is supported by the fact that many peptide hormones bind to membranes or micelles and in some cases have been shown to adopt a specific structure when bound to the membrane .
a striking example is calcitonin , a peptide hormone involved in calcium homeostasis.(22 ) in the presence of sodium dodecyl sulfate ( sds ) micelles , calcitonin assumes an -helical structure while being unstructured in solution .
furthermore , deletion of the critical f16 residue disrupts in parallel both the induction of the -helical structure and the function of calcitonin .
results of this nature , in the context of the membrane catalysis model , provide strong incentive to investigate the potential interactions of apelin with lipids . herein , we use circular dichroism ( cd ) spectropolarimetry and pulsed field gradient nmr diffusion measurements to probe interactions of apelin-17 and apelin-12 with sds micelles , dodecylphosphocholine ( dpc ) micelles , and 1-palmitoyl-2-hydroxy - sn - glycero-3-[phospho - rac-(1-glycerol ) ] ( lppg ) micelles . an nmr spectroscopy based structure of apelin-17 bound to sds micelles is also presented , and paramagnetic titration gives an overview of the topology of the apelin-17/sds micelle complex .
finally , the significance of these findings in relation to the membrane catalysis model is discussed .
deuterium oxide ( d2o ; 99.8 atom % d ) , sds - d25 , dpc , dpc - d38 , and d2o containing 1% ( w / w ) sodium 2,2-dimethyl-2-silapentane-5-sulfonate ( dss ) were obtained from c / d / n isotopes ( pointe - claire , qc , canada ) .
fmoc - protected amino acids and coupling reagents were obtained from aapptec ( louisville , ky ) .
all other chemicals were obtained at biotechnology , high - performance liquid chromatography , or reagent grade , as appropriate , from sigma - aldrich ( oakville , on , canada ) .
apelin-17 ( h2n - kfrrqrprlshkgpmpf - coo ) and apelin-12 ( h2n - rprlshkgpmpf - coo ) were produced and purified in multimilligram quantities using previous procedures.(15 ) peptide identities were confirmed using matrix - assisted laser desorption ionization mass spectrometry and quantitative amino acid analysis ( hospital for sick children , toronto , on , canada ) .
far - ultraviolet cd spectra of apelin-17 and apelin-12 were recorded at 35 c using a jasco j-810 spectropolarimeter ( easton , md ) .
solutions of apelin peptides ( apelin-12 , 55.2 0.7 m ; apelin-17 , 64.5 5.2 m ; exact concentration determined by quantitative amino acid analysis ; hospital for sick children ) were prepared from a single stock solution . for each apelin peptide
, samples were prepared with no lipid added and 16 mm sds , 19 mm dpc , or 38 mm lppg in 20 mm sodium phosphate adjusted to ph 7.00 0.05 .
spectra were acquired from 260 nm downward ( 1 nm steps ) , with reliable ellipticity values observed at > 190 nm based on spectropolarimeter photomultiplier tube voltages , in 0.5 mm path length quartz cuvettes ( hellma , mllheim , germany ) .
machine data were converted to the mean residue ellipticity , [ ] , averaged over all trials , blank subtracted , and subjected to sliding - window averaging over 3 nm stretches so that [ ] reported at a given wavelength ( ) is
finally , each spectrum was baseline adjusted by subtracting the average ellipticity value over 250260 nm .
three identical nmr samples were prepared with 1 mm apelin-17 in a 90% h2o/10% d2o mixture with 20 mm nacd3coo , 1 mm nan3 , 90 mm sds , and 1 mm dss .
each sample was titrated with mncl2 , 5-doxylstearic acid ( 5-dsa ) , or 16-doxylstearic acid ( 16-dsa ) up to a maximum of 8 mm paramagnetic agent at 35 c .
titrations were halted when a 50% reduction in the intensities of 50% of the peaks was observed using hh total correlation spectroscopy ( tocsy ) relative to a reference spectrum . for each residue ,
the intensities of one or two nonoverlapped cross - peaks were measured ( depending on the availability of nonoverlapped peaks ) .
titration of 16-dsa was at 800 mhz using a varian inova spectrometer ( palo alto , ca ) at the national high field nuclear magnetic resonance centre ( nanuc ; edmonton , ab , canada ) , while both mn and 5-dsa were titrated at 700 mhz on a bruker avance iii spectrometer ( milton , on , canada ) at the national research council institute for marine biosciences ( nrc - imb ; halifax , ns , canada ) .
nmr data were processed using nmrpipe(25 ) and peak intensities measured with a gaussian line shape in sparky 3 ( t. d. goddard and d. g. kneller , university of california , san francisco ) .
four samples of apelin-17 were prepared for dosy experiments with 1 mm apelin-17 , 20 mm nacd3coo , 1 mm nan3 , and 1 mm dss in 90% h2o/10% d2o , with three samples containing 81 mm sds - d25 , 94 mm dpc - d25 , or 187 mm lppg .
dosy spectra were acquired at 35 c using a stimulated echo sequence with bipolar gradients(26 ) and a longitudinal eddy current decay of 5 ms at 500 mhz on a bruker avance ii spectrometer with a txi probe at the nuclear magnetic resonance research resource ( nmr ; halifax , ns ) .
susceptibility - matched tubes ( shegemi , allison park , pa ) were used to minimize diffusion artifacts due to gradient nonlinearity or convection currents .
signal attenuation at the maximum gradient strength was adjusted to be 95% , with 32 increments collected in the diffusion dimension with the gradient strength ranging from 1.7 to 32.0 g / cm .
diffusion coefficients for apelin-17 in each condition alongside those of each micelle in the absence of apelin were obtained using the relaxation module of topspin 2.1 ( bruker ) .
topspin uses an iterative procedure to fit the equation
to the data , where i and i0 are the peak intensities when the experiment is performed with and without a gradient , respectively , d is the translational diffusion coefficient , is the gyromagnetic ratio , and and are the gradient duration and diffusion time , respectively . due to what appeared to be a consistent artifact , the first ( lowest gradient strength ) increment of each experiment was discarded , and 31 diffusion time points were used for fitting . for apelin-17 and each micelle , the translational diffusion coefficient ( d ) was calculated using three separate h nmr peaks for each spectral data set ( i.e. , nine measurements per condition ) , and the values were averaged to give a final value of d with associated standard error . to determine the fraction of apelin-17 bound to each micelle , a fast two - site exchange model(27 ) was used :
where dobsd is the observed diffusion coefficient of apelin-17 in the presence of micelles , fb and db are the fraction of apelin-17 bound to micelles and the diffusion coefficient of the micelles , respectively , and df is the translational diffusion coefficient of free apelin .
we made the assumption that the diffusion coefficient of a micelle , db , does not differ significantly with the presence or absence of apelin-17 .
, the expected effect of the presence of micelles on the value of df was estimated via the following expression for small molecules obstructed by spherical particles:(28 )
where df0 is the measured diffusion coefficient of apelin-17 in water and is the volume fraction of lipids in the sample , which can be estimated by using the weight fraction.(28 ) using eqs 3 and 4 and the values of d obtained using topspin , the fraction of apelin-17 bound to each micelle was estimated .
two 600 l nmr samples were made with 20 mm nacd3coo , 1 mm nan3 , 1 mm dss , 0.5 mm apelin-17 , and either 81 mm sds - d25 or 94 mm dpc - d38 .
hh tocsy ( 80 ms mixing time ) , hh nuclear overhauser effect spectroscopy ( noesy ; 350 ms mixing time ) , gradient - enhanced natural abundance hc heteronuclear single - quantum coherence ( hsqc ) , and hn hsqc experiments were performed at 700 mhz ( nrc - imb avance iii ) with a tci cryoprobe at 35 c .
nmr data were processed using nmrpipe(25 ) and manually assigned in sparky 3 ( t. d. goddard and d. g. kneller , university of california , san francisco ) .
secondary chemical shifts , = (obsd ) (random coil ) , of the h , h , c , and c nuclei were calculated using the random coil chemical shifts of wishart and co - workers.(32 ) xplor - nih version 2.18(33 ) was used for final structure determination of apelin-17 in the presence of sds micelles using the methods of noe intensity calculation and refinement detailed by langelaan and co - workers.(15 ) an ensemble of 200 structures was generated , with the 80 lowest energy structures retained as the final ensemble .
the lsqkab software of the ccp4 suite(34 ) was used to iteratively superpose the ensemble over 217-residue stretches while an in - house tcl / tk script was used to calculate the root mean squared deviation ( rmsd ) of the backbone atoms within the superposed region ( using a previously developed iterative superposition protocol ) .
lastly , the ensemble was analyzed ( i ) using procheck - nmr to determine the proportion of residues in favored , allowed , generously allowed , and disallowed regions of the ramachandran plot,(37 ) ( ii ) with promotif - nmr to determine the number , type , and position of -turns present in the ensemble,(38 ) and ( iii ) using an in - house tcl / tk script to calculate both the deviation and order parameter ( s , as defined by hyberts et al.(39 ) ) of the and dihedral angles .
all chemical shift data for apelin-17 with sds and dpc micelles as well as the final structural ensemble for apelin-17 with sds micelles have been deposited to the biological magnetic resonance bank(40 ) using smsdep ( accession numbers 20082 and 16275 for apelin-17 with sds and dpc micelles , respectively ) .
the far - ultraviolet ( far - uv ) cd spectra from 260 to 190 nm of both apelin-12 and apelin-17 in buffer and in the presence of sds , dpc , or lppg micelles are shown in figure 1 .
for any given condition , the cd spectra for both apelin-12 and apelin-17 have similar features .
as we have previously described,(15 ) the spectra for both apelin-12 and apelin-17 in buffer at 35 c are random coil(41 ) in nature .
this primarily random coil spectrum is convoluted with positive bands at 195 and 218 nm , most likely attributable to the b and la transitions of the c - terminal phenylalanine.(15 ) for both apelin-12 and apelin-17 , dpc micelles do not strongly perturb the cd spectrum relative to the buffer ( figure 1 ) .
in contrast , dramatic spectral changes occur with both apelin isoforms in the presence of either sds or lppg micelles .
the cd spectra with these micelles present are convoluted by an -helix - like band pattern ( difference spectra in figure 1 ) , which may be attributed either to formation of the -helical secondary structure(41 ) or to the formation of -turns .
far - ultraviolet circular dichroism spectra of ( a ) apelin-12 and ( b ) apelin-17 in buffer , sds micelles , dpc micelles , and lppg micelles alongside the difference spectrum between lppg and the buffer .
spectropolarimetry ( sliding - window ( eq 1 ) averaged blank - subtracted averages of three replicates ) was performed at 35 c in 20 mm phosphate buffer at ph 7.00 0.05 .
although the main trends observed in the cd spectra of apelin-12 and apelin-17 are identical , there are a few minor differences between isoforms . in the presence of dpc micelles , a slightly larger deviation from buffer conditions
also , the cd spectra of apelin-17 in the presence of lppg and sds are nearly identical , while for apelin-12 the cd spectrum in lppg shows a larger deviation from buffer conditions in comparison to that in sds ( figure 1 ) . despite these slight differences , the underlying trends in the cd spectra of apelin-12 and apelin-17 are the same , with dpc micelles causing little to no change in the spectra relative to the buffer versus sds and lppg , which produce increasing amounts of perturbation of the cd spectrum relative to the buffer . a similar trend was observed with dpc and sds micelles for apelin-13 , pyroglutamateapelin-13 , and apelin-36 ( bebbington and rainey , unpublished ) , suggesting that all of these apelin peptides undergo similar structural changes in the presence of anionic micelles .
translational diffusion coefficients ( d ) were measured for sds , dpc , and lppg micelles , for apelin-17 in buffer , and for apelin-17 in the presence of each micelle ( table 1 ) . reported literature diffusion values ( dosy determined ) are 1.2 10 m / s for dpc micelles,(46 ) 9.5 10 m / s for sds micelles,(47 ) and 6.62 10 m / s for lppg micelles.(48 ) once adjusted for temperature and viscosity using literature viscosity values(49 ) to match our experimental conditions , these measurements become 1.35 10 , 1.47 10 , and 8.49 10 m / s , respectively .
although our reported d values are slightly higher , the agreement with previous d values is reasonable .
discrepancies may be due to effects of the different temperature and buffer conditions in our study upon the aggregation number of the micelles .
in particular , the aggregation number of the micelles decreases with increasing temperature,(50 ) and our study was at 35 c , while the reported values of d for sds and lppg were at 25 c and that for dpc was at 30 c .
also , the observed d for a micelle is often an overestimate due to contributions from monomeric detergent remaining in solution . under buffer conditions , however , the critical micelle concentrations of the detergents are lowered , and for each micelle employed herein , the contribution of monomeric detergent to d was minor since only 5% , 1% , and 0.03% of sds , dpc , and lppg are estimated to be present as monomers ( based upon critical micelle concentration values of 4 mm,(51 ) 1.1 mm,(52 ) and 0.06 mm(52 ) for sds , dpc , and lppg , respectively ) .
topspin ( bruker ) was used to determine the diffusion coefficients ( dobsd ) of three peaks of the component of interest for three replicate experiments to give an average dobsd with associated average deviation . assuming two - state fast exchange for apelin-17 , fb was estimated using eqs 3 and 4 .
the experimental settings for the diffusion time ( ) and gradient duration ( ) for each experiment are indicated ; pulsed field gradients were varied from 1.7 to 32.0 g / cm . upon determination of d , the fb of apelin-17 with each micelle was calculated using eq 3 , indicating relatively weak binding of apelin-17 to dpc micelles and strong binding with both sds and lppg micelles ( table 1 ) , in good agreement with the cd spectropolarimetry results .
this interaction is somewhat predictable due to the strongly cationic nature of apelin-17 , which contains eight basic residues to facilitate its interaction with anionic headgroups .
however , without experimental demonstration such as this , it is not necessarily predictable that a peptide as hydrophilic as apelin-17 will interact so strongly with detergent micelles in solution .
nearly complete assignment of h , c , and n was obtained for apelin-17 ( table s1 in the supporting information ) in the presence of both sds and dpc micelles using standard methods,(53 ) allowing comparison of for h , c , h , and c nuclei in the presence of sds and dpc micelles to those in buffer that we previously reported(15 ) ( figure 2 ) . for both h and c ,
there is no clear relationship between the value of the secondary chemical shift and the condition used .
however , these values are significantly different in the presence of sds micelles compared to those in either the buffer or dpc conditions over k1k12 , while values in the c - terminal of apelin-17 show little perturbation in the presence of micelles .
the large changes in values of c and h atoms in the presence of sds suggest that apelin-17 is binding to the sds micelles rather than forming a different , canonical secondary structure since h and c would also be expected to have a consistent perturbation with secondary structure formation .
determination of the effect of lppg micelles on values was not possible as deuterated lppg is not available , making spectral assignment infeasible for apelin without isotopic enrichment .
apelin-17 secondary chemical shifts ( = (obsd ) (random coil)(29 ) ) for h , c , h , and c ( the prime symbol denotes a degenerate shift ) at 35 c in buffer(15 ) ( 20 mm cd3coo , ph 5.00 0.05 ) , sds micelles , and dpc micelles .
horizontal lines show the cutoff significant for secondary structuring(31 ) ( note that c and c for pro have identified significance ranges of 4 ppm ) . in all cases
, apelin-17 showed a single , predominant set of chemical shifts at 35 c with d values between those of free apelin and those of each detergent micelle indicative of fast exchange on the nmr time scale between the free and bound states ( i.e. , submillisecond exchange(54 ) ) .
fast exchange may be less relevant in the case of lppg , given the almost 100% binding stoichiometry ; however , it is certainly feasible that similar transient binding is taking place under an equilibrium favored further toward the bound state than in the sds and dpc cases .
conformational sampling of apelin-17 was also evident in the nmr data , as we previously observed in buffer,(15 ) with a minor conformation in the p14f17 region < 10% as populated as the major one .
only the major conformer was sequentially assigned as there were few noe contacts in the minor conformer .
cd spectropolarimetry , dosy , and chemical shift analysis therefore clearly demonstrate that the apelin peptides bind weakly and transiently to zwitterionic dpc micelles but bind favorably to anionic sds and lppg micelles . to determine the region of apelin-17 that is interacting with anionic micelles ,
the hh tocsy peak attenuation of apelin-17 in sds micelles with various concentrations of 5-dsa , 16-dsa , or mn is summarized in figure 3 .
these reagents would be expected to attenuate the nmr signals for nuclei in the tailgroup core of the micelle ( 16-dsa ) , just below the anionic headgroup ( 5-dsa ) , or readily accessible to solution ( mn ) . for both 5-dsa and 16-dsa
, there is no clear trend of peak attenuation over apelin-17 , even at relatively high concentrations of paramagnetic agent , suggesting that apelin-17 does not associate in the hydrophobic core of the micelles or just below the headgroups of sds ( figure 3a ) .
in contrast , a clear trend in peak attenuation is observed with the titration of apelin-17 by mn . at 0.25 mm mn ,
many residues of apelin-17 show large attenuation of peak intensity , notably at the c - terminal region ( figure 3b ) .
after titration with 1 mm mn , only k1 and r6l9 have an observable signal , indicating that these residues of apelin-17 interact most strongly with sds micelles since they are partially shielded from the effects of mn .
however , even these residues are largely attenuated by mn , indicating that although they interact with the micelle , they are still partially solvent exposed and very near the micelle surface , as supported by the lack of peak attenuation induced by 5-dsa or 16-dsa .
retained peak intensity ( the error bar is the average deviation ) of apelin-17 in sds micelles with the indicated amounts of ( a ) 5-dsa or 16-dsa or ( b ) mn calculated from the intensities of the hh tocsy peaks relative to a reference spectrum . in total , 522 unique noesy contacts were observed ( with each noe being considered from the perspective of each nucleus of the spin pair ) .
this is an almost 2-fold increase in observed noe contacts in comparison to those of apelin-17 in buffer at 35 c ( 285 restraints(15 ) ) , indicating a dramatic increase in structuring of apelin-17 bound to sds micelles vs free in solution . of these contacts , the majority which are longer than i + 1 occur c - terminal to r6 ( figure s1 in the supporting information ) , implying that this region of apelin-17 is most structured in the presence of sds micelles .
eight rounds of structure calculation were performed with these noe restraints , with 100 structures generated in rounds 17 and 200 in round 8 .
of the 200 structures in the final round , the 80 structures with the lowest total energy were retained as the final ensemble with minimal noe violations and excellent ramachandran plot statistics ( table 2 ) .
evaluation of and dihedral angle variation in terms of both the average deviation and order parameter ( s of hyberts et al.(39 ) ) demonstrates a stretch of seven residues from r6 to k12 with both low average deviation and high s ( figure 4a , b ) indicative of structural convergence.(35 ) classification of noe restraints using cyana , la systems , tokyo , japan .
xplor - nih energies and average deviations and violation occurrences calculated using an in - house tcl / tk script .
previously reported data.(15 ) analysis of the 80-member nmr - based structural ensemble of apelin-17 bound to sds micelles : ( a ) and ( b ) angle average deviation ( bars ) and order parameters(39 ) ( lines ) .
root mean square deviation ( rmsd ) calculated iteratively for ( c ) backbone atom superpositions over seven - residue segments and ( d ) all heavy atoms over three - residue superpositions with each bar ( the error bar is the average deviation ) plotted at the first residue in a superposition .
independent of this , the ensemble of apelin-17 structures was superimposed in seven - residue stretches , and the root - mean - square deviation ( rmsd ) of backbone atoms was calculated ( figure 4c ) .
( at superposition lengths of eight residues or greater , no rmsds below 0.88 0.2 were observed . ) for a seven - residue superposition , the backbone atom rmsd is the lowest over r6k12 , suggesting that this region is well converged and mirroring the observation of highly defined and dihedral angles .
rmsds over seven residues indicate that both the n- and c - terminal regions of apelin-17 are relatively unstructured in the presence of sds micelles . using promotif - nmr,(38 )
45 type i and 374 type iv -turns were detected in the final ensemble ( table 2 ) , with 98% of the type i -turns being initiated between r6 and l9 .
type iv -turns appear to be distributed throughout apelin-17 , although there is a very well - defined type iv -turn initiated at s10 in 77/80 of the ensemble members ( figure s2 in the supporting information ) .
paramagnetic relaxation enhancement experiments ( figure 3 ) indicate that the structural convergence over r6k12 is the result of apelin binding to the micelle . in the superposed structural ensemble
, the cationic side - chain atoms of r6 and r8 also tend to lie on the same face of the peptide , providing a cationic surface that may interact with the anionic micelle headgroups ( figure 5b ) .
since the structure of apelin-17 induced by anionic micelle binding is consistent between sds and lppg , as observed with cd spectropolarimetry , the nmr ensemble generated for apelin-17 interacting with sds is also representative of the apelin-17 structure when bound to lppg micelles .
structure of apelin-17 bound to an sds micelle : ( a ) superposition of all 80 members of the final ensemble of structures from r6 to k12 ( r6k12 colored blue , remainder green ) with p7 and s10 , initiation points of type i and type iv -turns , respectively , indicated ; ( b ) zoom of the superposition in ( a ) ( backbone atoms green ) showing cationic side chains of r6 and r8 ( blue ; all other side chains red ) falling on the same face of apelin-17 ; ( c ) superposition of all heavy atoms of m15f17 for all 80 ensemble members , with the backbone shown in blue and side chains colored red . upon analysis of superpositions for shorter regions of apelin-17 , an extremely well - converged region of apelin-17 was observed from m15 to f17 ( figure 5c ) , with a heavy atom rmsd of 0.37 0.19 and well - converged and dihedrals ( figure 4a , b , d ) .
this region is just as converged as some of the residues between r6 and k12 in terms of both atom positions and dihedral angles but shows no canonical secondary structuring by promotif - nmr analysis .
notably , this structural convergence was not observed in apelin-17 in solution at 35 c,(15 ) indicating induction by apelinmicelle binding even though m15f17 are not directly interacting with the micelle .
this study implies that apelin is likely to fit with the membrane catalysis model put forward by sargent and schwyzer.(16 ) since apelin interacts almost equally well with two quite different anionic detergent headgroups , binding to biological membranes is likely .
furthermore , the structure observed with apelin bound to sds micelles should represent the bound state with a biological membrane . although a micelle surface is curved , in this system the curvature is negligible .
the radius of an sds micelle is 20 ,(55 ) while the binding region of apelin-17 ( r6l9 ) spans 6.7 , or 5% , of the micelle circumference . upon membrane interaction ,
the membrane catalysis model hypothesizes that a peptide will adopt a conformation that will accelerate binding to its receptor .
the abundant type i and type iv -turns which are induced by the anionic headgroups at the sds and lppg micelle surface may increase apelin s affinity to the apj receptor , in line with the suggestion of tyndall et al .
that -turns are a ubiquitous motif recognized by gpcrs.(56 ) however , the high degree of structuring for m15f17 , although not -turn in character , is a very striking micelle - induced structural element that may be even more likely to allow specific recognition of apelin by apj since this portion of the peptide is not directly membrane - associated and therefore free to bind . taken together , the structural changes that occur to apelin when bound to anionic micelles are likely essential for initiating interactions with apj in a membrane .
since both regions of apelin-17 observed to undergo significant conformational restriction in comparison to the remainder of the peptide reside within the 12-residue functional core retained in all bioactive apelin isoforms , this binding hypothesis is immediately applicable to the other apelin peptides .
the various active isoforms of apelin interact similarly with anionic sds and lppg micelles but not with the zwitterionic dpc micelle .
key to this interaction is the formation of a converged structure from r6 to k12 with significant type i and type iv -turn initiation between r6 and l9 and at s10 , respectively , while the residues n - terminal to this region are largely disordered .
binding of apelin-17 to sds also induces structuring of m15f17 , even though this region is not in direct contact with the micelle surface .
these results , obtained from disparate biophysical methods , suggest that apj activation by apelin may follow the membrane catalysis model , requiring that apelin first bind to the plasma membrane , adopt the observed structure , and then bind to and activate apj .
Output:
| apelin is the peptidic ligand for the g - protein - coupled receptor apj .
the apelinapj system is important in cardiovascular regulation , fluid homeostasis , and angiogenesis , among other roles . in this study
, we investigate interactions between apelin and membrane - mimetic micelles of the detergents sodium dodecyl sulfate ( sds ) , dodecylphosphocholine ( dpc ) , and 1-palmitoyl-2-hydroxy - sn - glycero-3-[phospho - rac-(1-glycerol ) ] ( lppg ) .
far - ultraviolet circular dichroism spectropolarimetry and diffusion - ordered spectroscopy indicate that apelin peptides bind to micelles of the anionic detergents sds and lppg much more favorably than to zwitterionic dpc micelles .
nuclear magnetic resonance spectroscopy allowed full characterization of the interactions of apelin-17 with sds micelles .
titration with paramagnetic agents and structural determination of apelin-17 in sds indicate that r6k12 is highly structured , with r6l9 directly interacting with headgroups of the micelle .
type i -turns are initiated between r6 and l9 , and a well - defined type iv -turn is initiated at s10 . furthermore , binding of apelin-17 to sds micelles causes structuring of m15-f17 , with no evidence for direct binding of this region to the micelles .
these results are placed into the context of the membrane catalysis hypothesis for peptidereceptor binding , and a hypothetical mechanism of apj binding and activation by apelin is advanced . |
PubmedSumm6869 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: we came across a neonate who presented with repeated chest infections and respiratory distress . on evaluation by ct
a full term female baby was born after an uneventful pregnancy . at 1 month of age ,
a plain radiograph of the chest showed increased opacification of the right lung with reduced lung volume , air bronchograms , and mild compensatory hyperinflation of the left lung [ figure 1 ] . following this , a computed tomography ( ct ) scan
was performed , which showed hypoplasia of the right lung with multiple air bronchograms . in the mediastinum ,
two air - filled tubes were visualized , that is , trachea and esophagus [ figure 2a ] . only left mainstem bronchus was visualized at the tracheal bifurcation .
the right mainstem bronchus originated from distal esophagus and coursed superiorly to aerate the right lung [ figure 2b ] .
nasogastric tube was inserted that delineated the retracted air filled esophagus on the right side of the trachea .
dilute barium was slowly injected through the nasogastric tube , which established the diagnosis of bronchoesophageal communication by opacifying the bronchial tree on the right side [ figure 3 ] .
imaging advances such as volume rendered ct and virtual bronchoscopy showed anomalous origin of the right mainstem bronchus from the esophagus [ figure 4a ] and only one opening at the tracheal bifurcation [ figure 4b ] .
chest radiograph shows increased opacification of right lung with air bronchograms , mediastinal shift , and herniation of the contralateral lung towards right ( a ) axial image shows two closely placed air - filled tubes esophagus ( small arrow ) and trachea ( large arrow ) in the mediastinum .
( b ) coronal reformatted image depicts the origin of right the mainstem bronchus(small arrow ) from distal esophagus ( large arrow ) with associated collapse - consolidation of the right lung dilute barium has entered the right bronchial tree , thus , establishing the bronchoesophageal communication ( a ) volume rendered computed tomography scan shows the single left mainstem bronchus at carinal level .
the right mainstem bronchus originates from the distal esophagus and courses superiorly to aerate the right lung .
( b ) virtual bronchoscopy shows the single opening of the left mainstem bronchus ( arrow ) at the tracheal bifurcation .
right mainstem bronchus is not visualized at surgery , a hypoplastic consolidated lung was discovered on the right side .
there was a firm cartilaginous tube ( right mainstem bronchus ) coming from the distal esophagus and entering into the right lung [ figure 5 ] .
right pneumonectomy with enbloc resection of esophageal bronchus was performed , and abnormal opening in the esophagus was ligated and repaired .
operative findings : small consolidated right lung with a cartilaginous right mainstem bronchus(long arrow ) , communicating with the esophagus(short arrow )
sometimes only a segmental bronchus may arise from the lower esophagus with rest of the lung being normal .
diagnosis is usually established within the first 8 months of life , even though late presentations in adulthood are also described .
because of the proximity of the right mainstem bronchus with esophagus , right side is frequently affected .
furthermore , clinical manifestations may vary from recurrent chest infections to severe respiratory failure , depending on the type of malformation .
patients presenting with recurrent chest infections or cough on intake of fluids or food should be investigated with chest radiograph followed by contrast study of esophagus and chest ct .
vascular studies can be further conducted for preoperative mapping as well as to rule out sequestration .
barium esophagogram is the investigation of choice in such cases and should be the ideal choice in patients with recurrent refractory chest infections .
embryologically , the respiratory system develops as a ventral diverticulum from the foregut . as laryngotracheal tube elongates , the tracheoesophageal ridge develops and separates the laryngotracheal tube from rest of the foregut
later , tracheoesophageal ridge fuses to form the septum and divides the foregut into ventral and dorsal portions .
any abnormal development of tracheoesophageal groove along with the differential elongation of trachea and esophagus results in these anomalies .
known associations of esophageal lung include cardiac anomalies , esophageal atresia , and tracheooesophgeal fistula .
foregut duplication cysts , divericulae , intralobar or extralobar pulmonary sequestrations come under the noncommunicating variety .
communicating type is one where there is communication between the respiratory and gastrointenstinal systems . in 1966 ,
braimbridge and keith suggested a classification for congenital fistulas depending upon the communication between esophagus and bronchus / sequestrated lobe .
further , srikanth et al . classified the communicating bronchopulmonary foregut malformations as follows : 1a : total sequestered lung communicating with the foregut , associated with esophageal atresia and tracheoesophageal fistula to the distal pouch 1b : sequestered anatomic lobe or segment communicating with the foregut , associated with esophageal atresia and tracheoesophageal fistula to the distal pouch ii : total sequestered lung communicating with the lower esophagus ; absent ipsilateral mainstem bronchus iii : isolated anatomic lobe or segment communicating with the foregut iv : portion of the normal bronchial system communicating with the esophagus our case falls into category iv where the entire lung was aerated by the right mainstem bronchus , which originated from the lower esophagus .
the entire lung was hypoplastic and consolidated with the left mainstem bronchus arising from the distal esophagus .
the differential diagnosis includes pulmonary sequestration , congenital cystic adenomatoid malformation , and iatrogenic , inflammatory , or neoplastic fistulas .
the two main methods of treatment are division and suturing of the ends of the fistula and complete resection . till today
, less than 20 cases of esophageal lung have been reported , and most of the cases were associated with esophgeal atresia . in our case , there was no esophageal atresia as the nasogastric tube easily passed into the stomach .
bronchopulmonary foregut malformations are rare entities where there is abnormal communication between the respiratory and upper alimentary system . early recognition of this rare entity could guide an appropriate treatment with better clinical outcome .
Output:
| we report a rare case of esophageal lung in a neonate who presented with repeated chest infections and respiratory distress .
chest radiograph revealed increased opacification of the right lung with reduced lung volume and air bronchograms .
further evaluation with computed tomography ( ct ) showed the presence of only left mainstem bronchus at the tracheal bifurcation .
right mainstem bronchus originated from distal esophagus and aerated the right lung .
nasogastric tube was inserted into the stomach with injection of small amount of dilute barium through it , which established the communication of right mainstem bronchus with esophagus .
advanced ct scan imaging by virtual bronchoscopy and volume rendering further delineated the anatomical abnormality precisely prior to surgery .
surgical findings confirmed the diagnosis . |
PubmedSumm6870 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: we present the case of a 60-year - old female with a history of polycythemia , chronic obstructive pulmonary disease ( copd ) on home oxygen , and obesity who presented to the emergency room complaining of mild dyspnea on exertion that had been experienced for 3 days .
she denied any medical history , including autoimmune disease , connective tissue disorders , or vasculitis .
as part of her general workup in the emergency department , she was found to have elevated troponin levels at 0.182 ng / ml ( 0.00.045 ng / ml ) .
ecg revealed sinus tachycardia ; there were no st segment changes suggestive of ischemia ( fig .
the patient was admitted to the floor and managed as a possible case of copd exacerbation .
twelve - lead ekg at the time of emergency department presentation with sinus tachycardia and no acute st segment changes .
a nuclear stress test was performed that revealed a large inferior wall reversible defect with associated inferior wall hypokinesis .
coronary angiography of the right coronary showed a spontaneous dissection throughout the mid - right coronary artery ( fig .
due to poor distal thrombolysis in myocardial infarction ( timi ) 1 flow , it was decided to stent the lesion .
a prowater wire was steered toward the mid - right coronary artery which initially went into the false lumen ; we then pulled the wire back and redirected it to the true lumen which was confirmed by the ability to advance the wire into the distal vessel .
follow - up angiography showed excellent results with complete tacking of the dissection plane and excellent timi 3 flow at the end of the procedure ( fig .
3 ) . coronary angiography showing a dissection plane throughout the mid - right coronary artery .
follow - up angiography showing complete tacking of the dissection plane and timi 3 flow .
while a few of the reported cases have been called idiopathic , a predisposed arterial disease or underlying cause has been identified in most of the cases ( 3 ) .
intimal tear or bleeding of vasa vasorum with intramedial hemorrhage has been proposed ( 4 ) .
younger females in the pregnancy and peri - partum periods are thought to be at a higher risk than the general population which is believed to be secondary to increased hemodynamics during labor and delivery , and possibly hormonal effect on the arterial walls affecting the tunica media ( 5 , 6 ) .
it is unclear whether this inflammatory reaction is reactive or causative of dissection by weakening the coronary architecture ( 5 ) .
connective tissue disorders such as ehler danlos type iv and marfans have also been implicated in scad ( 8 , 9 ) .
our patient did not have any clinical features usually associated with such connective tissue diseases .
she is an elderly female presenting with symptoms initially thought to be suggestive of a copd exacerbation with a troponin elevation secondary to a supply demand mismatch .
this presentation serves as a reminder to include scad in the differential diagnosis even among elderly patients with comorbidities presenting with unexplained troponin elevation .
other management strategies have been proposed in the literature ranging from percutaneous coronary interventions to heart transplantation .
revascularization in scad is challenging and should be considered in patients with ongoing ischemia ( 10 ) .
intravenous ultrasound ( ivus ) may be helpful in confirming the diagnosis . in our patient
, ivus was not used due to her narrow lumen coronaries with a concern of possible worsening of the dissection with the bulky ivus catheter .
none of the authors have any financial or personal bias that would inappropriately compromise the publication of this work .
the authors have not received any funding or benefits from industry or elsewhere to conduct this study .
Output:
| spontaneous coronary artery dissection is a poorly understood phenomenon that usually affects women during pregnancy or the immediate post - partum period .
we present the case of a 60-year - old female with chronic obstructive pulmonary disease who presented with vague complaints of shortness of breath , dizziness , and weakness with a mildly elevated troponin .
she denied any anginal symptoms .
as part of her initial workup , a nuclear stress test revealed inferior wall reversible changes .
coronary angiography revealed spontaneous right coronary artery dissection which was treated with a drug - eluting stent . |
PubmedSumm6871 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: invasive fungal infections are a major problem in the neonatal intensive care unit ( nicu ) .
candida species are as the fourth most common cause of late - onset infections in the neonatal intensive care unit ( nicu ) and are responsible for considerable morbidity and mortality .
about 12% of all neonatal infections are due to candida species [ 24 ] ; cases increased 10-fold between 1981 and 1995 [ 5 , 6 ] .
reported mortality rates for infants with invasive neonatal candidiasis are between 25 and 50% , compared to an overall mortality of 4.7% for all nicu admissions .
major risk factors associated with invasive neonatal candidiasis include extreme prematurity , prolonged central venous catheterization , and prolonged use of broad - spectrum antibacterial agents [ 712 ] .
blood cultures are still considered as the gold standard for the diagnosis of invasive neonatal candidiasis . however , when compared with bacterial pathogens , their sensitivity is less than ideal . in a large report of autopsy - proven invasive candidiasis , the majority of cases lacked a positive blood culture . in a cohort of 41 patients with hematologic malignancies and autopsy - proven candidiasis , 28% of those who had single - organ involvement had a previous positive blood culture . when at least 3 organs were found to be infected in postmortem examination ,
the blood volumes necessary to optimize organism recovery are not easily attainable in neonates [ 15 , 16 ] .
therefore , relying solely in blood cultures could underestimate the true incidence of invasive neonatal candidiasis .
the absence of a fungal pathogen isolated in a blood culture may lead to underdiagnosis of invasive neonatal candidiasis , and in turn , to a delay in treatment institution , which could contribute to the high mortality observed in previous studies [ 1 , 2 , 9 ] .
we assessed for the effect of delayed recognition and treatment of invasive neonatal candidiasis and for risk factors associated with mortality in a tertiary care nicu over the five - year period before the institution of routine fluconazole prophylaxis in our nicu .
we conducted a retrospective cohort study of all cases of culture - proven invasive neonatal candidiasis admitted to the nicu at the ucla medical center between january 1 , 1998 and december 31 , 2002 .
study participants were identified from microbiology records of all infants admitted to the nicu with a positive fungal culture .
cases of invasive neonatal candidiasis were defined as those that fulfilled the following criteria ( 1 ) + ( 2a ) or ( 1 ) + ( 2b ) : a clinical picture compatible with fungal sepsis , defined by patients meeting at least 5 criteria : admission to an nicu with high rate of candidemia , history of broad - spectrum antibiotic coverage , use of a third - generation cephalosporin negative bacterial blood culture results , a falling platelet count , use of systemic steroids , npo , need for mechanical ventilation , and cardiovascular instability requiring pressor support ; a fungal pathogen isolated from blood culture either from a line or peripheral site , urine by bladder catheterization , peritoneal fluid by paracentesis , pleural fluid by pleurocentesis ; when the only fungal isolate came from a deep aspirate from an endotracheal tube , patients had to fulfill clinical criteria for sepsis and all 4 of the following clinical criteria for pneumonia ( radiographic changes , need for increase in mechanical ventilation , increase in tracheal secretions , abnormal peripheral white blood cell count and/or bandemia ) .
the analysis was conducted comparing survivors with nonsurvivors . in cases of multiple fungal infections in a single patient , data was analyzed from the final episode in order to evaluate the primary outcome .
survival was defined as either discharge to home or transfer to a lower level of care .
medical records were reviewed , and information was obtained on gender , birth weight , gestational age , underlying illness , hospital course , invasive procedures , outcome , use of anti - infective agents , and bacterial infections .
data are presented descriptively for demographics , culture location and species of fungus responsible for infection .
student 's t - test was used to compare single variable differences between mortality and survival to discharge groups .
between january 1 , 1998 and december 31 , 2002 , there were 1686 admissions to the ucla nicu .
, 63 patients met our definition for invasive neonatal candidiasis , for a prevalence of 37 cases/1000 admissions .
the mean gestational age ( ga ) of both the infants who expired and survived invasive neonatal candidiasis was 30 weeks ( range : 2340 weeks ) . mean birth weight ( bw ) was 1628 grams ( range : 4094470 ) in patients who expired and 1741 grams ( range 4863800 ) in survivors .
in the survivor group , 10 patients ( 24% ) had ga between 23 and 25 weeks and 13 patients ( 32% ) had ga of 2634 weeks , compared with 7 ( 31% ) and 4 ( 18% ) , respectively , in the mortality group .
10 survivors ( 24% ) had congenital heart disease , compared with 5 ( 23% ) infants in the mortality group . 3 survivors ( 7% ) had other major congenital anomalies , compared with 3 nonsurvivors ( 14% ) .
5 survivors ( 12% ) and 3 nonsurvivors ( 14% ) were diagnosed with chromosomal anomalies .
a previous , culture - proven bacterial infection was identified in 27 survivors ( 66% ) and 18 nonsurvivors ( 82% ) ( p = 0.25 )
both groups differed significantly in mean number of positive fungal cultures , days with central venous catheters , mean platelet count nadir , days in nicu before invasive fungal infection , days on ventilator ( both total and prior to fungal infection ) , previous use of a third - generation cephalosporin , and days of treatment with intravenous antibacterial agents prior to fungal infections .
mean duration of positive cultures , ga , birth weight , total icu days , and days of antifungal therapy were comparable between those infants who expired and those who survived until discharge .
the most common isolates identified were candida albicans ( 57% ) and candida parapsilosis ( 27% ) , followed by candida tropicalis ( 5% ) , candida lusitaniae ( 3% ) , candida glabrata ( 2% ) , and malassezia furfur ( 2% ) .
we did not find an association between fungal species and outcome of invasive fungal infections .
we did not observe a significant difference in culture sites between the survivor and mortality groups ( table 3 ) .
multivariate analysis demonstrated a higher risk of mortality with increasing number of positive fungal cultures as well as the number of days of antibiotic use prior to the fungal infection ( p = 0.005 and 0.009 , resp . ) .
our population included 23 patient with blood isolates ; of these , 15 had the cvc removed after the positive blood culture , 11/15 ( 73% ) survived .
3 of 8 ( 38% ) patients in which the cvc was not removed survived ( p = 0.09 ) . thirty - three patients had further diagnostic studies performed ( head / cardiac / renal / abdominal ultrasound or ophthalmologic exam ) . of these , 8 ( 24% ) had evidence of invasive fungal disease .
of the 8 infants with end - organ evidence of fungal disease , 3 had only blood cultures positive and 5 had positive fungal cultures at multiple sites .
in contrast , 6/25 ( 24% ) patients who had no end - organ evidence of fungal disease expired ( p < 0.01 ) . of these ,
9 patients had multiple positive sites ; in 7 the only source was urine , in 4 peritoneal fluid , 3 had only positive blood cultures , and 2 only tracheal cultures .
5 of these 7 had autopsy evidence of invasive fungal disease and a positive postmortem culture .
they were 25- and 26-week premature infants , respectively , and each had treatment started 4 days after the first positive culture .
the second patient had negative renal and abdominal ultrasounds obtained after peritoneal fluid yielded candida parapsilosis .
the third patient was a full - term infant with congenital heart disease who had autopsy evidence of candida sepsis , with involvement of the heart , liver , and kidneys .
this patient had many negative blood and urine fungal cultures ; the only positive culture isolated came from a tracheal aspirate which was positive for candida lusitaniae .
microabscesses were identified in postmortem examination of the peritoneal cavity ; however , postmortem cultures were negative .
one had candida parapsilosis in tracheal aspirates , and the other had had candida parapsilosis in tracheal aspirates and urine .
median time to initiation of treatment after the first positive fungal culture was obtained was 4 days in the mortality group and 2 days in the survivor group ( p = 0.004 ) .
when we analyzed the relationship between mortality and the interval from the day the first positive culture was drawn and the day that antifungal therapy was started , we found mortality rates of 22.5% ( 7/30 ) , 40% ( 6/15 ) , and 54% ( 7/13 ) when those intervals were 02 days , 27 days , and > 7 days , respectively .
each 24-hour delay in the initiation of antifungal therapy was associated with a 10.9% increase in odds of mortality ( or 1.109 , 95% ci : 1.0031.226 ) .
when we exclude patients in which the only positive culture was obtained by tracheal aspirate , median times to treatment initiation are 4 days for the mortality group and 1 day for survivors ( p = 0.02 ) .
time from culture to treatment was similar in patients without a blood fungal isolate and fungemic patients .
similarly , we did not observe a significant difference in the distribution of culture sites in those patients in which therapy was delayed over 48 hours when compared with those infants who received antifungals earlier .
fifty - eight of 63 patients ( 92% ) received systemic antifungal therapy with either amphotericin b deoxycholate or amphotericin b lipid complex .
of the 5 patients who did not receive therapy , 3 survived , and two expired .
their ga ranged from 25 to 40 weeks , and the diagnoses were as follows : chromosomal anomalies in one baby , prematurity in two infants , congenital heart disease in one patient , and noncardiac congenital anomalies in one subject .
the source of isolates in the patients who expired was tracheal only in one patient and urine plus tracheal aspirate in one infant . in survivors , isolates came from peritoneal fluid in two infants and urine in one patient .
we believe that the observation of increased mortality in patients where a longer interval ensued between obtaining cultures and stating antifungal therapy is important .
although certainly not surprising , an association between delay in initiation of antifungal therapy and mortality has not been documented previously in the literature . in severe infections , one can expect a more favorable outcome when therapy is promptly instituted .
however , there is an inherent delay between the clinical presentation of sepsis , when cultures are presumably obtained , and the availability of results .
a study by schelonka and moser suggested that candidemia can be detected within 72 hours . a septic - appearing newborn routinely receives antibacterial agents at the time of clinical presentation .
in contrast , many clinicians will only start antifungal therapy when a positive culture is reported or when the patient fails to improve after a period of antibacterial agents . in a retrospective study , makhoul et al .
this was attributed to a policy of starting empiric antifungal therapy immediately after obtaining cultures in neonates with risk factors for fungal sepsis , instead of waiting for culture results .
et al . evaluated data from a multicenter cohort to develop a model to provide guidance to neonatologists as to when to consider empirical antifungal therapy .
we did not identify an association between culture site and therapy delay , which could potentially result in a clinician bias against nonblood isolates .
patients in whom the only source for the fungal pathogen was a tracheal culture had a similar outcome to the remainder of the study population .
tracheal cultures are interpreted by many clinicians with skepticism , due to a concern about a perceived poor correlation between tracheal isolate and lower respiratory tract pathogens .
several studies have found correlation between isolation of candida in tracheal cultures and its presence in lung parenchyma or the subsequent risk of candidemia in neonates [ 2022 ] . in a septic - appearing newborn with findings of clinical pneumonia ,
when a bacterial pathogen is not found , or when empiric antibacterial therapy fails to create a clinical response , one may consider that the presence of a fungal isolate in a tracheal aspirate should be considered a true pathogen , and specific therapy should be instituted .
the patients who died had onset of infection at a mean of 69 days versus 33 days in the survivors .
this conflicts with data presented previously from a review of a private practice database , which reported that a younger age at the time of infection is associated with mortality .
this could be due to the inherent selection bias in patient complexity observed in large , tertiary referral institutions , when compared with community - based practices .
although candida albicans was the most common isolate recovered , our data confirm the emergence of non - albicans species as major causes of invasive neonatal candidiasis [ 1 , 2 ] .
we did not find a correlation between fungal species and mortality . in a study of 45 cases of neonatal candidiasis over a 10-year period ,
faix reported that 7 of 29 infants with candida albicans died , compared to no deaths in 16 infants with candida parapsilosis .
the relatively large number of candida parapsilosis found in newborns could be due to the known propensity of candida parapsilosis to adhere to foreign material [ 17 , 24 , 25 ] .
it has been suggested that the high prevalence of candida parapsilosis reflects the aggressive use of intravascular devices in nicus .
there is evidence that candida parapsilosis is commonly carried on the hands of health care workers .
transmission from infected mothers is unlikely to account for the unusual prevalence of this organism in neonates , since candida parapsilosis is rarely seen on vaginal cultures , whereas candida glabrata , a common vaginal isolate , is an uncommon cause of candidemia in infants and children [ 26 , 27 ] .
other species , such as candida lusitaniae and candida tropicalis , were uncommon in our study population , as observed by others .
the previous use of a third - generation cephalosporin antibiotic was associated with mortality in our study population . in our study population
, these agents ( cefotaxime and ceftazidime ) were used empirically in virtually all cases .
third - generation cephalosporins have been previously identified as risk factors for acquisition of an invasive fungal pathogen [ 6 , 10 , 11 , 17 ] .
the number of positive fungal cultures , time in the nicu , and total time of mechanical ventilation were all increased in nonsurvivors .
the relationship between multiple positive cultures and outcome has been reported previously [ 29 , 30 ] .
several other studies have illustrated the link between duration of intubation and length of nicu hospitalization with emergence of fungal sepsis [ 8 , 9 , 31 ] .
the presence of suggestive imaging studies and multiple positive fungal cultures were predictive of mortality in infants with fungal sepsis in our population .
end - organ involvement and multiple positive cultures have been shown to be markers for treatment failure and predictors of disease severity [ 29 , 31 ] .
our study had the unique feature of an unusually high rate of autopsies performed , which confirmed the presence of gross pathology findings of invasive fungal disease in 5 neonates , including ischemic fungal colitis in 2 patients , peritoneal microabscesses in one patient , renal mycetomas in one neonate , and multiple organ involvement in one infant .
these data have the limitations inherent to a single - center , retrospective study , therefore we were unable to answer questions about the reasons for delay in initiation of antifungal therapy .
however , given the degree of difficulty in the diagnosis of neonatal candidiasis , its increasing incidence , and the delay of fungal cultures , we believe that a risk - factor - based approach to empirical treatment could be justified in a sick appearing newborn .
Output:
| objective / methods .
to determine the outcomes of invasive neonatal candidiasis before institution of routine antifungal prophylaxis , we conducted a retrospective review of cases of invasive candidiasis in newborns in a referral - based neonatal intensive care unit located in a single tertiary academic center between january 1998 and december 2002 .
results .
sixty - three newborns with invasive neonatal candidiasis were identified .
overall mortality rate was 35% .
virtually every infant had a central venous catheter ( cvc ) , required mechanical ventilation and previous administration of antibacterial agents .
delayed institution of antifungal therapy was associated with increased mortality . in addition ,
length of hospitalization , duration of prior antibacterial therapy , mechanical ventilation , and cvc use , as well as evidence of end - organ disease , were associated with an adverse outcome .
conclusions .
reliance on available laboratory tools in cases of invasive neonatal candidiasis can result in delayed diagnosis and increased mortality .
a risk - factor - based approach to empirical treatment could be justified in this setting . |
PubmedSumm6872 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: trabeculectomy is a surgical glaucoma procedure that aims to lower the intraocular pressure ( iop ) by creating a fistula for aqueous drainage from the anterior chamber to the subtenon space .
lower iop will prevent further insult to the optic nerve and hence further visual field loss .
mitomycin c ( mmc ) is commonly used as adjunctive treatment in trabeculectomy in order to increase the survival of filtering bleb .
however , mmc also increases the incidence of bleb leak . bleb leakage that occurs within the first 1 month following trabeculectomy
is considered an early postoperative leak , and it is frequently encountered as an unfortunate complication.1 its incidence varies from 0% to 30%.2 the bleb leak may be self - limiting or complicated with a shallow and flat anterior chamber , cataract formation , choroidal detachment , and hypotony maculopathy.3 risk of bleb - related infection increases up to 26-fold following bleb leakage.4 conservative measures and medical approaches are practiced prior to consideration of surgical retreatment in bleb leak cases .
these include pressure patching , bandage soft contact lens , collagen shield , sclera shell tamponade , aqueous suppressants , compression suture , conjunctiva suturing , trichloroacetic acid , and autologous blood injection.5 for decades , surgical repair or wound revision has been a gold standard in the management of leaking bleb . the application of tissue adhesive has been widely accepted as a suture alternative in recent times .
the use of cyanoacrylate tissue glue ( catg ) has been successfully reported in ophthalmology literatures , ranging from sealing corneal perforations to closure of retinal breaks and reattachment of retina in retinal detachment cases.6 cyanoacrylate belongs to a family of polymers .
the liquid form of cyanoacrylate consists of monomers of cyanoacrylate molecules , with clear colorless appearance and strong odor .
the ester form of cyanoacrylate , n - butyl-2-cyanoacrylate , is one of the adhesive components that have been widely used in medical and veterinary applications.7 cyanoacrylate liquid monomers rapidly solidify by polymerization and form a firm adhesive bond when coming into contact with weak base , releasing a little heat , as well as in presence of ionic substances such as moisture , blood , or tissue fluids.7 in polymerized form , the tensile strength of bonding of these polymers has been observed to be the highest among all glues .
it also has bacteriostatic property.8 another alternative group of adhesives available include biological fibrin glue ( a blood - derived product ) , gelatin and thrombin products , albumin and glutaraldehyde products , as well as polyethylene glycol polymers.9 we reported three successfully sealed early bleb leak cases with catg .
we retrospectively analyzed the outcome of three patients with early leaking filtering blebs managed with catg .
we reviewed the medical records of three patients who underwent augmented trabeculectomy with mmc with early bleb leak between january 2009 and june 2010 at the hospital universiti sains , malaysia .
two cases had bleb leakage at postoperative day 1 , and bleb leakage was detected at postoperative day 7 in one case . the diagnosis of bleb leaks was confirmed by a positive seidel s test , which also identified the leakage site .
they occurred either from the conjunctival flap buttonhole or along the suture track , which was located > 2 mm from the limbus .
the leak was complicated with low iop of < 10 mmhg and shallow anterior chamber depth but without iridocorneal touch .
other complications , such as choroidal detachment , hypotony maculopathy , or endophthalmitis , were absent in all cases .
the first line of management was conservative , which consisted of pressure padding , bandaged contact lens , and aqueous suppression .
in the first case , catg was used along with a plastic disk after 2 days of failed pressure bandage management . in the second case ,
catg alone was used after 2 days failed conservative management and subsequent surgical procedure , while in the third case , catg was used in combination with surgical procedure after 2 days failed pressure bandage management
all patients underwent application of catg under topical anesthesia of proparacaine 0.5% or subconjunctival lignocaine 2% . to facilitate instillation of catg ,
0.1 ml of catg was filled in a 1 ml tuberculin syringe mounted with a 30 g needle .
it was a modified disk of 4 mm diameter , cut from sterile soft clear plastic cover of a butterfly needle using straight scissors .
postgluing , they received topical eyedrops of prednisolone acetate 1% 4-hourly per day , ciprofloxacin 2-hourly per day , and homatropine 1% twice daily for 2 weeks . at 2 weeks
, both prednisolone acetate 1% and ciprofloxacin were tapered to four times per day for another 2 weeks , while homatropine was stopped . at 4 weeks , ciprofloxacin was stopped and prednisolone acetate 1% was used four times daily for a further period of 23 months .
patients were followed up weekly after gluing for 1 month , and then subsequent monthly reviews were undertaken . during clinic visits , blebs were diffusely formed with no recurrent leak in all cases .
a 57-year - old male with right eye neovascular glaucoma secondary to branch retinal vein occlusion underwent right eye augmented trabeculectomy .
on ocular examination , there was presence of shallow bleb , with a positive seidel test seen at the nasal part of the bleb .
examination on following day revealed persistent slow bleb leak from a similar site ( figure 1 ) .
sealing of the leaking bleb with catg with plastic disk was done at postoperative day 3 under slit lamp .
the patient was first seated , and then the identified bleb leakage site was dried .
one drop of catg was applied ( figure 2 ) , and a plastic disk was placed on top ( figure 3 ) . it was allowed to crystallize for 5 minutes .
the site was again checked with fluorescein sodium strip , and no sign of leakage was observed ( figure 4 ) . eye examination on day
1 postgluing showed negative seidel test , clear cornea , and deepened anterior chamber with iop 18 mmhg .
two weeks later , the plastic disk glue became dislodged with no subsequent ocular complication .
follow - up at 3 months showed well - sealed bleb and no recurrent leak , with iop of 19 mmhg .
a 63-year - old male underwent left eye augmented trabeculectomy surgery in january 2009 for refractory secondary glaucoma after failed initial nonaugmented trabeculectomy .
on ocular examination , there was presence of shallow bleb with positive seidel test at the temporal part of the bleb .
on postoperative day 3 , the bleb showed leakage again from the similar site with iop of 7 mmhg .
sealing of the leaking bleb with catg was done on the same day . as the patient was laid supine , an eye speculum was placed to prevent blinking .
the glued site was checked with fluorescein strip , and no sign of leakage was observed .
eye examination on day 1 postgluing revealed negative seidel test , clear cornea , and anterior chamber deepened , with iop of 12 mmhg .
he complained of mild foreign body sensation for the subsequent 1 week , which was tolerable with minimal irritation .
the final follow - up was at 3 months after the procedure : the filtering bleb was siedel negative and the iop was maintained below 15 mmhg .
an 81-year - old female , a case of advanced primary open - angle glaucoma of both eyes , underwent left eye augmented trabeculectomy in march 2009 .
on ocular examination , there was presence of bleb leak with positive seidel test near the limbus .
as the bleb was persistently leaking , she underwent the combined techniques of resuturing and applying catg at postoperative day 10 . in the supine position ,
one drop of catg was applied , and it was left to crystallize for 5 minutes .
the sutured and glued site was checked with fluorescein strip , and there was no sign of leakage . eye examination on day
1 postgluing showed that the seidel test was negative , cornea was clear , and the anterior chamber deepened , with iop of 10 mmhg .
there was complaint of mild foreign body sensation postgluing for 3 weeks ; however , no severe irritation was noted . at the 3-month follow - up ,
a 57-year - old male with right eye neovascular glaucoma secondary to branch retinal vein occlusion underwent right eye augmented trabeculectomy .
on ocular examination , there was presence of shallow bleb , with a positive seidel test seen at the nasal part of the bleb .
examination on following day revealed persistent slow bleb leak from a similar site ( figure 1 ) .
sealing of the leaking bleb with catg with plastic disk was done at postoperative day 3 under slit lamp .
the patient was first seated , and then the identified bleb leakage site was dried .
one drop of catg was applied ( figure 2 ) , and a plastic disk was placed on top ( figure 3 ) . it was allowed to crystallize for 5 minutes .
the site was again checked with fluorescein sodium strip , and no sign of leakage was observed ( figure 4 ) .
eye examination on day 1 postgluing showed negative seidel test , clear cornea , and deepened anterior chamber with iop 18 mmhg .
two weeks later , the plastic disk glue became dislodged with no subsequent ocular complication .
follow - up at 3 months showed well - sealed bleb and no recurrent leak , with iop of 19 mmhg .
a 63-year - old male underwent left eye augmented trabeculectomy surgery in january 2009 for refractory secondary glaucoma after failed initial nonaugmented trabeculectomy .
on ocular examination , there was presence of shallow bleb with positive seidel test at the temporal part of the bleb .
on postoperative day 3 , the bleb showed leakage again from the similar site with iop of 7 mmhg .
sealing of the leaking bleb with catg was done on the same day . as the patient was laid supine , an eye speculum was placed to prevent blinking .
the glued site was checked with fluorescein strip , and no sign of leakage was observed .
eye examination on day 1 postgluing revealed negative seidel test , clear cornea , and anterior chamber deepened , with iop of 12 mmhg .
he complained of mild foreign body sensation for the subsequent 1 week , which was tolerable with minimal irritation .
the final follow - up was at 3 months after the procedure : the filtering bleb was siedel negative and the iop was maintained below 15 mmhg .
an 81-year - old female , a case of advanced primary open - angle glaucoma of both eyes , underwent left eye augmented trabeculectomy in march 2009 .
on ocular examination , there was presence of bleb leak with positive seidel test near the limbus .
as the bleb was persistently leaking , she underwent the combined techniques of resuturing and applying catg at postoperative day 10 . in the supine position ,
one drop of catg was applied , and it was left to crystallize for 5 minutes .
the sutured and glued site was checked with fluorescein strip , and there was no sign of leakage . eye examination on day
1 postgluing showed that the seidel test was negative , cornea was clear , and the anterior chamber deepened , with iop of 10 mmhg .
there was complaint of mild foreign body sensation postgluing for 3 weeks ; however , no severe irritation was noted . at the 3-month follow - up ,
managing bleb leaks often pose a challenge upon failing both conservative approach and surgical repair .
the incidence of postoperative bleb leakage after trabeculectomy was reported to reach up to 56%,10 in which higher risk was anticipated with the use of augmenting metabolites.11 the wide use of mmc as adjunctive therapy during trabeculectomy was found to be a cause for delayed bleb leaks.12 meanwhile , early bleb leaks , which comprise wound leak and conjunctival buttonholes , are likely to be contributed by fluctuations and changes in tissue swelling during the postoperative period , cutting through of sutures , or changes in wound apposition caused by blinking or eye rubbing , apart from deficient wound closure , patent stitch tracts , and surgically traumatized conjunctiva.13 despite that , early bleb leak is not a poor prognostic indicator for intermediate bleb survival and iop control in patients undergoing mmc trabeculectomy , as proved by alwitry et al.1 longer follow - up of > 1 year is necessary to further determine the relationship between early bleb leak and long - term bleb survival .
cyanoacrylate is used in managing bleb leaks and the glue has the advantage of biocompatibility , which allows application over the ocular surface with minimal toxicity while promoting and facilitating rapid reepithelialization.14 successful closure of leaking blebs with cyanoacrylate adhesive in studied cases was achieved either using the glue alone or in combination with other conservative methods , such as pressure patching , bandage soft contact lens , simmons shell , aqueous suppressant , autologous blood , and dye - enhanced argon laser photocoagulation.1517 several applications of the tissue adhesives , however , may be required to ensure favorable outcome , as reported by okabe et al.18 however , unsuccessful results have also been reported with the tissue glue .
mandal19 attempted cyanoacrylate in four out of seven cases with late bleb leak but found them unsuccessful .
most of the previously reported bleb leaks were of late - onset occurrence , and the majority of studies did not specify the size of the leak . in our cases ,
all three were detected very early within a week posttrabeculectomy , which was augmented with mmc .
this is in agreement with the study conducted by alwitry et al,1 which found that the time of detection of early bleb leak ranges from 1 day to 21 days in mmc trabeculectomy patients .
the size of the leak was small in all of our cases , permitting the use of catg .
we considered that premature intervention without hypotony maculopathy or choroidal detachment was reasonable after adequate trial of conservative postoperative care being undertaken .
the glue was attempted after failed initial conservative and/or surgical method in all of our cases . from our three cases
however , we admit that we are not too certain that the glue alone contributed to the effective seal of the bleb leaks as many of early leaks seal spontaneously . in the more complicated case 3 , in
which gluing was undertaken but in combination with resuturing , again the success can not be attributed solely to the glue . from a comparison of literature review and our cases , we observed that catg could effectively be used as adjunct , rather than primary treatment , to seal an early bleb leak of size 2 mm or less .
the advantages of catg in the management of early bleb leakage in our cases are as follows : 1 ) clinically no toxic effect on vascular tissue , 2 ) strong and rapid bonding , 3 ) good adherence to conjunctiva , 4 ) ability to bond in the presence of small amount of blood and tears , 5 ) possible bacteriotoxicity , 6 ) water - tight , sutureless closure , and 7 ) accessible , affordable , fast , safe , simple , and relative ease of application .
there are a few insignificant limitations over its use that have been addressed : 1 ) big presterilized glue container tip , making it difficult to specify and localize to the desired site ; 2 ) excessive liquidic properties , causing it to diffuse to other undesired surrounding sites while waiting for it to solidify ; 3 ) formation of a solid , impermeable mass in situ , which persists as a foreign body , thus giving rise to foreign body sensation ; 4 ) impermeability to fluids and metabolites ; and 5 ) risk of development of severe peribleb inflammation around both the glue and the plastic disk in the weeks after gluing , before the glue ultimately naturally dislodges .
catg may serve as one of the effective alternative adjunctive methods in the management of posttrabeculectomy early bleb leak .
nevertheless , further study of its use in various phases of bleb leak is required .
Output:
| we demonstrated a noninvasive management of early bleb leak following trabeculectomy using cyanoacrylate tissue glue ( catg ) .
three patients who underwent augmented trabeculectomy with mitomycin c with early bleb leak between january 2009 and june 2010 were reviewed .
case 1 and case 2 exhibited bleb leak on postoperative day 1 and case 3 showed leak on follow - up at postoperative day 7 .
case 1 was successfully sealed with catg at postoperative day 3 , after failed pressure padding and bandage contact lens .
case 2 was successfully sealed with catg at postoperative day 3 , after failed pressure padding and conjunctiva flap resuturing . in case 3 ,
the leaking conjunctival flap was managed with combined techniques of resuturing and applying catg at postoperative day 9 , after failed pressure padding . during leakage ,
the intraocular pressure was low ( 68 mmhg ) in all three cases , with shallow anterior chamber depth and absence of other complications such as choroidal detachment , hypotony maculopathy , or endophthalmitis .
foreign body sensation was the main complaint following the procedure .
no clinical allergy reaction was documented .
catg may serve as a potential adjunctive and effective method in the management of posttrabeculectomy early bleb leak . |
PubmedSumm6873 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: understanding the toxicity of nanomaterials and nano - enabled products is important for human and environmental health and safety as well as public acceptance .
the scientific literature is a primary source of information about nanomaterial toxicology and thus plays a role in the emerging dialogue about the safety of nano - enabled products .
there have been several recent reviews , reports , and assessments on the current state and/or challenges of determining the toxicology of nanomaterials ( buzea et al .
2007 ; fischer and chan 2007 ; hutchison 2008 ; lubick 2008 ; maynard et al . 2006 ; nel et al .
most agree that there has been a lack of systematic approaches to assessing the toxicology of nanomaterials and that there is a need for standard methodologies to examine the human health and environmental implications of novel nanomaterial characteristics .
hutchison ( 2008 ) ; fischer and chan ( 2007 ) argue for characterization of the entire nanomaterial life - cycle , paying attention to both exposure pathway and final fate .
lubick ( 2008 ) also points to a deluge of papers in a broad range of journals that make it difficult to remain informed about the current toxicological results . extending this line of concern for the state of nanotoxicology , we employed bibliometric techniques to characterize the prevalence and distribution of the current scientific literature , asking the following questions : what is the relative distribution of published nanotoxicological research across the areas of human health and the environment?within each of these research domains , what emphases have emerged thus far?which materials and exposure pathways have been researched and which have not?which stages of the nanomaterial life - cycle
have been addressed in toxicological research ? what is the relative distribution of published nanotoxicological research across the areas of human health and the environment ? within each of these research domains , what emphases have emerged thus far ?
which stages of the nanomaterial life - cycle have been addressed in toxicological research ? in this commentary , we use the above questions to determine base - line measures for the current state of knowledge about nanomaterial toxicity .
we highlight apparent gaps in the ongoing nano - toxicological literature that could have significant implications for experts , regulators , and the public.1 assessing the scientific literature is important at this juncture as the toxicology of nanomaterials has increasingly become the subject of regulatory and media attention.2
to characterize the peer - reviewed literature on nanotoxicology , we utilized two complementary bibliometric strategies .
first scifinder scholar , a search engine for scientific literature across the physical , biomedical , and natural sciences utilizing the cas ( chemical abstracts service ) and medline ( u.s . national library of medicine ) databases were used.3 to construct a comprehensive population of journal and review articles in english for the period between 2000 and 2007 , we used a modified search term strategy from a list developed by the international council on nanotechnology ( icon ) at rice university for their database of research on environmental health and safety ( ehs ) of nanomaterials.4 the search terms included : safety , environmental health , human health , animal health , toxic , nano , nanomaterial , nanoparticle , nanotechnology , buckyball , fullerene , quantum dot , and ultrafine .
we also utilized the icon ehs database to examine the types of studies that have been researched ( e.g. , in vivo vs. in vitro ) and to compare across nanomaterial types ( e.g. , carbon , semiconductor , metal , etc . ) .
the selection and categorization of nanomaterial types ( e.g. , oxides , carbon , etc . ) was consistent with that of the icon database , which categorizes primarily on a chemical basis .
peer - reviewed research on nanomaterials and their toxicology has grown nearly 600 percent since the year 2000 , increasing almost exponentially across the 7-year period . as noted by lubick ( 2008 ) ,
our search of scifinder scholar produced approximately 900 total articles in about 58 different journals .
the journals with the greatest number of relevant articles had 18 articles at most and are spread across chemistry , biology , physics and engineering fields .
this is consistent with the interdisciplinarity of nanotechnology , showing that if one is to stay current on the published literature , it requires maintaining a knowledge base from a variety of different sciences .
the journal articles were also analyzed by country of origin , using gis plots of the institution at which the research was performed .
as shown in fig . 1 , the united states leads in publications on nanotoxicology with almost 550 more publications .
this diversity of where the research is performed , along with the interdisciplinary nature of the nanotechnology field , can be one explanation for the variety of approaches and lack of standard methods for studying the toxicity of nanomaterials noted by lubick ( 2008 ) ; fischer and chan ( 2007).fig .
1global distribution of published nanotoxicology research by institution global distribution of published nanotoxicology research by institution to characterize the approaches and techniques used to study the toxicology of each nanomaterial , we relied on the icon ehs database , searching by method of study for each nanomaterial type . while there are differences in the number of studies for each nanomaterial , as shown in fig . 2
, we found that most research has relied on in vitro techniques across all specified material types .
this confirms the conclusions of fischer and chan ( 2007 ) , hutchison ( 2008 ) , and lubick ( 2008 ) , showing that there has been a lack of in vivo studies ; even fewer focus on environmental impact and fate .
the low number of studies on semiconductors and the absence of any environmental studies on these materials are particularly striking , especially as these materials are closer to commercialization in nano - electronics and currently available in the form of quantum dots for fluorescent tags in cell and mice studies.5 this is not surprising , however , considering the far lower costs of in vitro research when compared to the cost of in vivo studies.fig .
2number of articles relating to material and type of study number of articles relating to material and type of study as fischer and chan ( 2007 ) point out , the toxicology of nanomaterial is likely to change with not only material type , but also the exposure route .
the exposure pathway would also determine the dosage , and thus has implications in the toxicity of nanomaterials . to address the question
about which exposure pathways are most researched , we again utilized the icon ehs database to characterize the articles based on material type .
our results show that most research has not specified an exposure pathway ( fig . 3 )
. this may be reflective of the relative infancy of the field , as most studies have been concerned with acute toxicity and not with the complex interactions that would take place in an actual ( human ) organism .
it also points to a predominant concern for traditional dose - dependent mortality without sensitivity to multifaceted and/or chronic exposure hazards and morbidity .
when specified , inhalation exposure has been the most researched pathway . this may signal that much work in the field is based on seminal research dealing with exposure to fine and ultrafine particles in the context of air pollution ( oberdrster et al .
3number of articles by material type and exposure pathway ( collected from icon ) number of articles by material type and exposure pathway ( collected from icon ) using icon ehs database , we also characterized the articles by the cell / organism type that would be affected by the nanomaterials .
as shown in fig . 4 , most research has utilized mammalian tissues or organisms .
this shows a focus on how the nanomaterial would affect humans or human models ( such as mice ) and again reflects less overall attention to environmental toxicity .
this is particularly noticeable in the low numbers of studies of nanomaterials in soil.fig .
4number of articles dealing with ecosystem and material type ( collected from icon ) number of articles dealing with ecosystem and material type ( collected from icon ) scifinder scholar was used to explore what research has been done on nanomaterial life - cycle and to characterize at what stage the toxicity of nanomaterials has been determined .
we relied on the categorization of articles by the search engine and assigned categories to one of three stages : basic materials , components or parts , or nano - enabled products .
most articles have been concerned with the toxicity of basic materials , rather than intermediate materials or components which incorporate nanoparticles , or nano - enabled consumer products .
we found no evidence of toxicological research on the environmental fate of nano - enabled consumer products in the publicly available literature.fig .
5the number of toxicology articles by stage in life - cycle ( collected from scifinder ) the number of toxicology articles by stage in life - cycle ( collected from scifinder )
the nano - toxicological literature is dispersed across a range of disciplines and sub - fields .
most of the published research has focused on in vitro testing and does not take into account the complexity of in vivo interactions .
most research has not specified exposure pathway(s ) and has focused on acute toxicity and mortality rather than chronic exposure and morbidity .
there is very little research on consumer products , particularly on their environmental fate , and most research is on the toxicity of nanomaterials followed by intermediates .
this focus on basic materials can be explained by lack of basic understanding , as the nanotechnology field is in its infancy .
for example , the differences in behaviors of single - walled carbon nanotubes ( swcnt ) and multi - walled carbon nanotubes ( mwcnt ) remain unclear especially in a biological environment and cnts are among the best studied nanomaterials . the lack of publicly available research on the toxicity of nano - enabled consumer products and the product end life has implications for public acceptance of nanotechnology .
a survey of industrial practices suggests that industrial nanotoxicological testing of consumer products is limited ( conti et al .
it is likely that companies such as dupont who developed their own nanomaterial testing guidelines6 are doing in - house testing .
however , the results of such studies may not be published in the peer - reviewed literature characterized here .
we would point to a significant risk to the nanotechnology enterprise if hazard data are to come only from industry .
the us public is unlikely to trust and accept such assurances , and indeed , such assurances from an un - trusted source are likely to amplify public perception of risk ( poortinga and pidgeon 2004 ) .
these initial results have significant implications for toxicologists , regulators , and social scientists studying nanotechnology and society .
the diffuseness of the scholarly literature may challenge the abilities of the public and civil society to stay informed about the toxicological implications of nanomaterials , as keeping up to date with the literature requires subscription to a proprietary database and not just access to a single or a few journals .
it may also make it more difficult to communicate realistic expectations about health and safety to consumers . as described by hutchison ( 2008 )
, unknown toxicity of consumer products may pose serious problems for public acceptance of nano - enabled products . with its database , icon
has provided a valuable service in making the references to the scientific literature publicly available ; however , a larger , coordinated effort in clearinghouse construction seems to be called for , as access to the journals themselves is necessarily limited to those in academia or industry with collective resources .
( 2006 ) elaborates further by urging for systematic risk research to emerge in all facets , government , industry , academia , and with other stakeholders if nano - industries are to thrive , from nano - materials to nano - enabled products .
this research provides measures for the claims in previous reports on nanomaterial toxicology , demonstrating significant gaps in the emerging field of nanotoxicology .
are these merely the result of the newness or infancy of the field that will be remedied over time as more attention and funding are dedicated to nanotoxicological research ? or , are such gaps the result of specific challenges posed by
nano - scale materials to established toxicological approaches ? addressing these questions will require additional research , the accessible dissemination of which will contribute to the comprehensive development of the nanotoxicology field .
Output:
| understanding the toxicity of nanomaterials and nano - enabled products is important for human and environmental health and safety as well as public acceptance . assessing
the state of knowledge about nanotoxicology is an important step in promoting comprehensive understanding of the health and environmental implications of these new materials . to this end
, we employed bibliometric techniques to characterize the prevalence and distribution of the current scientific literature .
we found that the nano - toxicological literature is dispersed across a range of disciplines and sub - fields ; focused on in vitro testing ; often does not specify an exposure pathway ; and tends to emphasize acute toxicity and mortality rather than chronic exposure and morbidity .
finally , there is very little research on consumer products , particularly on their environmental fate , and most research is on the toxicity of basic nanomaterials .
the implications for toxicologists , regulators and social scientists studying nanotechnology and society are discussed . |
PubmedSumm6874 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: genomics and related fields are becoming increasingly relevant in clinical practice for a wide variety of settings , including the deployment of next generation sequencing in specific scenarios .
however , the arrival of genomics to the bedside in its current state represents only the initial part of the translational highway .
genomic research falls on a continuum of 4 translational phases beyond initial discovery ( t0 ) : t1 , developing candidate health applications ; t2 , evaluating candidate health applications and developing evidence - based recommendations ; t3 , integrating evidence - based recommendations into care and prevention ; and t4 , assessing health outcomes and population impact .
a more realistic expectation would be that interventions of putative value will enter clinical practice and only over time will enough evidence be accumulated to support evidence - based guidelines .
research beyond bench to bedside ( t2t4 ) supports the evaluation of the clinical validity and utility of promising applications , as well as their comparative effectiveness and implementation and outcomes research to achieve population health benefits .
the history of medicine teaches us that premature implementation of promising new technologies without meeting an evidentiary threshold can lead to potential harms and increasing healthcare costs . yet ,
a previous pubmed analysis found that less than 1% of the published literature on human genomics was related to phases t2 or beyond .
this trend follows closely the current level of funding in human genomics research by the national cancer institute ( only 2% of human genomics research funding goes to t2 or beyond ) . since 2012
, the office of public health genomics , in collaboration with the national cancer institute , has been regularly tracking the translational genomics research scientific literature to develop a current baseline for the field and identify opportunities , gaps and challenges in genomic medicine .
we briefly summarize the one year data herein , and discuss a process for integrated horizon scanning of such research that can inform research , policy and practice .
each week , the centers for disease control and prevention ( cdc ) s office of public health genomics publishes the free genomics and health impact update newsletter online and delivers it by e - mail to more than 50,000 subscribers worldwide .
horizon scanning for translational research in this weekly update includes a pubmed targeted search query , supplemented by monitoring of online news using google alerts , and genomics - related websites .
publications collected by this process are reviewed and classified by two or more coders according to the schema in table 1 . in this brief report , we limit our analysis and presentation only to papers identified in pubmed beyond bench - to - bedside phases ( t2t4 ) . because of small numbers , we group products in two groups ( t2 : what works ? ) and ( t3t4 : how has it been implemented and is it working in the real world ? ) .
during the one - year period from may 16 , 2012 , through may 15 , 2013 , 505 articles were identified in pubmed . of these ,
44% were classified as t2 research and 56% as t3 or t4 ( table 2 ) .
there were 312 original research articles , 123 reviews , 38 papers describing clinical guidelines , policies and recommendations , and 32 describing tools , decision support and educational materials .
the appendix shows a list of published papers describing guidelines , policies and recommendations , by topic and source .
not included here are 7 additional policies and guidelines that were not listed in pubmed during the horizon scan ( e.g. , fda , cms , european union , and uk human genetics commission ) .
table 2 also shows specific examples of the types of translational research publications by category .
more than three - fourths of these publications ( n=399 ) addressed a specific genetic test or other health application ; almost half of these ( n=180 ) were related to cancer .
the next - largest categories were hereditary disorders ( 21% ) , cardiovascular disease ( 11% ) and birth defects ( 6% ) .
figure 1 summarizes application - specific publications by indication , along with the proportion in each group related to cancer .
cancer represented 45% ( 180/399 ) of all articles referencing a specific genetic test or genomic technology in the t2t4 space .
one third of cancer genetic testing and genomic technology articles were related to risk assessment , followed by 19% therapeutic , 18% diagnostic , 16% prognostic , 7% preventive , and 2% population screening , with the remaining 4% addressing a combination of these .
germline testing ( including utilization of family history tools ) was the focus in 63% of articles addressing cancer genetic testing and genomic technologies .
somatic testing represented 36% , including 5 articles that overlapped both germline and somatic testing .
forty nine percent ( 88/180 ) of the cancer genetic testing and genomic technology articles were classified as t2 and fifty one percent ( 92/180 ) were classified as t3 .
family history tools and methods represented 7% of all articles in our collection , sub - categorized under t2 ( n=10 ) and t3t4 ( n=25 ) . sixteen percent ( n=82 ) of all articles addressed pharmacogenomic testing . almost half of the pharmacogenomic articles were cancer - related .
in this brief report , we present baseline data on an ongoing horizon scanning by the cdc office of public health genomics , in collaboration with nci , of the translational genomics research scientific literature .
this public health surveillance activity identifies promising genomic applications for clinical practice as well as knowledge gaps that necessitate additional research . before commenting on these findings ,
first , in spite of our systematic effort to capture the pertinent literature , our pubmed queries had imperfect sensitivity and specificity .
although we have steadily improved specificity through manual curation by multiple reviewers , it is more difficult to quantify accurately the number of missed items .
these baseline data can be used to continue to improve search capacity using machine learning tools .
we will also continue to refine the use of online search tools to capture research that is not published , or is published only in abstracts from scientific meetings , websites or online databases , or the grey literature . during the one - year period we analyzed , such searches identified 15 additional items , including the 7 additional guidelines and policies ) .
finally , we should note that publications in a given year represent the results of research initiated in prior years . to feel the pulse of translational research in genomic medicine , it is important to integrate these analyses with existing databases of clinical trials , genetic testing information , and ongoing research funding by the nih and other institutions .
we present these data as a baseline survey of post bench to bedside translational research in genomic medicine .
they provide a starting point for future horizon scanning and a foundation for future enhancements as suggested above .
while we can not get an accurate estimate of the denominator for such research during the period of horizon scanning , a search of pubmed for genetics and genomics research in humans yielded almost 95,000 published articles in 2012 .
therefore , we estimate that our number of t2t4 publications presented here are about half a percent of all published human genetics and genomics research
. these data are consistent with previous analyses conducted in the 2000 s for general human genetics research and specifically for cancer .
it is not clear what percentage of all genomic research should be distributed across t2 , t3 , and t4 , as genomic medicine is still a rapidly moving discovery field .
as the field matures we expect an increasing proportion of research and publications to be conducted in later phases of translation .
it is interesting to note that , even in the rapidly developing field of genomic medicine , 38 articles describing guidelines , policies and recommendations were published in a single year ( appendix ) .
these articles covered a wide range of topics including newborn screening , prenatal testing , pharmacogenomics , cancer and other fields .
surveillance efforts such as the one presented here will become even more important in the near future , as additional guidelines and recommendations are developed for new genomic applications .
the cdc office of public health genomics ( ophg ) continues to track new or emerging health applications of genomic research through the gappfinder , , which is an integral part of an online genomic applications in practice and prevention knowledge base ( gappkb ) . as part of gappkb
, we classify genomic applications according to the maturity of evidence and readiness for use into routine clinical practice ( according to a three tier classification system ) .
these efforts , along with the newly launched nih genetic testing registry will help capture , over time , a more complete picture of the existing evidence on validity and utility of emerging genomic applications and the body of t2t4 research that supports their use in practice .
this evolving body of information will inform researchers , practitioners , patients , as well as policy makers . in summary , continued horizon scanning helps identify and monitor translational research that addresses the evaluation , implementation , and health impact of genomic applications .
an especially important area is cancer prevention and treatment , where some of this research funded by the national cancer institute is already in progress .
we also expect that recent funding by the national human genome research institute for pilot demonstration projects will increase the amount of information available for informed decision making on implementation and impact of genomic medicine .
other stakeholders and organizations , private and public are likely to benefit from increasing emphasis on translational research over . the importance of translational research in genomic medicine beyond the bedside can not be overemphasized .
relevant research questions in this area need to be asked and subsequently responded to with appropriate funding .
Output:
| the dizzying pace of genomic discoveries is leading to an increasing number of clinical applications .
however , very little translational research is ongoing beyond bench to bedside to assess validity , utility , implementation and outcomes of such applications . here
we report cross sectional results of ongoing horizon scanning of translational genomic research conducted between may 16 , 2012 and may 15 , 2013 . based on a weekly , systematic query of pubmed
, we created a curated set of 505 beyond bench - to - bedside research publications , including 312 original research articles , 123 systematic and other reviews , 38 clinical guidelines , policies and recommendations , and 32 papers describing tools , decision support and educational materials .
most papers ( 62% ) addressed a specific genomic test or other health application ; almost half of these ( n=180 ) were related to cancer .
we estimate that these publications account for 0.5% of reported human genomics and genetics research during the same time .
these data provide baseline information to track the evolving knowledge base and gaps in genomic medicine .
continuous horizon scanning is crucial for an evidence - based translation of genomic discoveries into improved health care and disease prevention . |
PubmedSumm6875 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: although hemorrhage into the thyroid gland is well recognized , massive bleeding into the thyroid gland after trauma is rare . given the anatomical location of the thyroid gland and the potential for airway compromise secondary to external compression , this is an issue that emergency physicians ( eps ) must not overlook .
we report the case of a patient presenting to the emergency department ( ed ) with a spontaneously expanding neck hematoma , approximately 24 h after a seemingly benign fall .
c , a 75-year - old female , had been experiencing 4 days of dizziness before sustaining an unwitnessed syncopal episode at home after getting up from bed .
she called the emergency medical services ( ems ) , which transported her to a local ed . except for a mild bradyarrhythmia , the patient was stable and was transferred to our hospital ed for further evaluation .
she was known for benign paroxysmal positional vertigo ( bppv ) , atrial fibrillation and hypertension .
on further questioning , the patient remembered experiencing vertigo prior to the fall . in the ed , she continued to complain of vertigo , nausea , mild headache and tinnitus .
she had one episode of vomiting while in the ed , which was managed with 50 mg of dimenhydrinate intravenously .
her vital signs included a blood pressure of 175/85 , an irregular pulse of approximately 75 and an oxygen saturation of 96% with a respiratory rate of 14 .
her physical exam , including a complete musculoskeletal exam , was unremarkable except for bilateral chronic pedal edema .
an electrocardiogram revealed atrial fibrillation with a ventricular rate of 66 to 75 beats per minute .
laboratory tests revealed a hemoglobin of 142 g / l , a white blood cell count 10.3 10/l , a platelet count of 185 10/l and a blood glucose of 8.6 mmol / l ( all within normal limits ) .
the patient was given a diagnosis of fall secondary to bppv , and was discharged home asymptomatic and in stable condition after a 6-h observation period .
she was instructed to return to the ed if her symptoms persisted . within 3 h of discharge , the patient called ems complaining of vomiting and of an enlarging neck mass .
she was immediately transported back to our hospital ed where a new team of eps assessed her .
the patient stated that the mass had been enlarging for the past hour and that it was accompanied by a sensation of fullness in her neck , dysphagia and some mild respiratory difficulties .
after obtaining a history of a trauma 24 h earlier , cervical spine immobilization was immediately initiated .
the patient had a blood pressure of 150/75 , an irregular pulse of approximately 68 and an oxygen saturation of 99% on 4 l of oxygen by nasal prong .
she was noted to be in minimal respiratory distress , with a respiratory rate of 22 . on examination ,
the patient was found to have a large swelling in the right anterior triangle of the neck , at the level of the thyroid gland .
a bedside ultrasound performed by the ep confirmed a large fluid - filled structure adjacent to the thyroid gland . a provisional diagnosis of neck hematoma causing potential airway compromise was given .
computed tomography scan ( ct ) of the patient s head , neck and cervical spine was immediately ordered .
four units of fresh frozen plasma were ordered to correct the patient s anticoagulation . the ear , nose and throat specialists ( ent ) , already in the ed , were consulted and immediately assessed the patient .
the ct of the patient s head and cervical spine showed no fracture or abnormality .
the ct of her neck revealed a large hematoma , centered in the right thyroid lobe measuring 7.2 5.0 6.9 cm .
the trachea was moderately deviated towards the left but without significant reduction in the cross - sectional area . while ent was establishing a course of action , the patient complained of a subjective increase in respiratory distress in the ed .
c was immediately transferred to the operating room , successfully intubated and had her neck mass explored .
the patient did very well postoperatively and was discharged from the hospital 2 days later .
pathologic examination of the resected specimen revealed an intrathyroidal hematoma involving a hrthle cell adenoma .
spontaneous hemorrhage in the thyroid gland , although not frequent , is not an uncommon phenomenon [ 1 , 2 ] . blunt traumatic etiologies , however , are much more rare . reported cases include direct blunt trauma to the neck from a motor vehicle steering wheel , bicycle handlebars , secondary to airbag deployment as well as a fall on the neck .
rare cases of thyroid hemorrhage following indirect trauma ( trauma near the neck but not directly to the thyroid gland ) [ 1 , 7 ] , and excessive valsalva maneuvers [ 2 , 8 ] have also been described .
the symptoms displayed by the patients ranged from a painless neck lump to sudden respiratory collapse .
the time to presentation to a physician ranged from immediate [ 2 , 3 , 8 ] to more than 24 h [ 6 , 7 ] .
a concomitant thyroid pathology was either known or subsequently discovered on pathologic examination [ 13 , 58 ] .
thyroid pathology seems to be an important risk factor in causing neck hematoma following blunt trauma .
this was illustrated as early as in 1922 by terry s experimental work , in which he showed that in pathological states , coughing or straining raises the patient s central venous pressure sufficiently to cause thyroid vessel bleeding .
it is believed that many thyroid pathologies , including adenomas , induce angiogenesis of immature , fragile blood vessels that are prone to rupture [ 10 , 11 ] .
this vulnerability is compounded by the fact that blood flow increases in diseased states , potentially causing vessel rupture with major bleeding after seemingly benign trauma .
one important contributing factor unique to the present case was the fact that the patient was taking warfarin for atrial fibrillation . while no single cause seems sufficient to account for mrs .
c s intrathyroidal hemorrhage , the combination of different factors might have been enough to account for her significant hematoma .
these may include a possible trauma to the neck during her fall , the action of warfarin and the presence of a hrthle cell adenoma . in light of the diverse nature of presentations in patients with trauma - related intrathyroidal hemorrhages illustrated here ,
all patients with obvious direct trauma to the neck and thyroid gland require close observation with respect to possible airway compromise .
however , in patients with known or suspected thyroid pathology , even minor trauma can pose a risk for delayed intrathyroidal hemorrhage .
these patients may require a prolonged period of observation before being safely discharged from the ed .
given that the currently discussed case is only the ninth reported in the literature , it is difficult to suggest any specific duration for monitoring . since very delayed complications may still occur ,
patients and/or their caregivers should receive , upon discharge , appropriate and detailed information regarding indications to return to the ed .
luckily , most hemorrhages into thyroid adenomas are usually gradual and generally respond to conservative treatment .
we believe that given the different compressive nature of soft tissue masses , this measure would be ineffective at detecting and preventing airway compromise before it is subjectively or objectively apparent .
we illustrated the case of a patient presenting with an intrathyroidal hemorrhage causing respiratory distress approximately 24 h after a seemingly benign fall .
it is important to recognize the potential for such complications , especially in the presence of thyroid pathology .
the greatest challenge for the emergency physician is to recognize this risk factor and to consider the possibility of delayed airway compromise when deciding on the final disposition of the patient .
Output:
| a rare event of a fall causing delayed intrathyroidal hematoma and respiratory distress is reported here .
a 75-year - old woman with symptoms of vertigo causing syncope and fall 24 h earlier was seen and discharged from our emergency department after an unremarkable physical exam and 6-h observation period . within 3 h of discharge
, the patient was transported back by emergency medical services with an enlarging neck mass and subjective respiratory distress .
ct scan demonstrated a large , expanding hematoma , and the patient underwent an emergency hemithyroidectomy .
hrtle cell adenoma was found on pathologic specimen examination .
a review of the literature of similar cases is presented , emphasizing the notion that concurrent thyroid pathology is a risk factor for airway compromise after seemingly benign trauma and that airway compromise can present in a delayed fashion . |
PubmedSumm6876 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: extracellular vesicles have received a great deal of attention during the last decade as a novel approach to detect diseases as messengers or mediators of disease pathophysiology .
the main classes of extracellular vesicles generally include exosomes , microvesicles / microparticles ( mps ) , and apoptotic bodies , which are differentiated by their biogenesis and secretion mechanisms .
exosomes are released by endocytosis following intracellular assembly in multivesicular bodies that contain intraluminal vesicles .
mps are shed from the plasma membrane through direct outward budding , and they are larger than exosomes ( 1002,000 nm ) .
mps are enriched in phosphatidylserine and contain a membrane component that is similar to that of the parent cell membrane.1 apoptotic bodies are 14 m in diameter and are released from the plasma membrane as blebs of cells undergo apoptosis .
apoptotic bodies may contain dna fragments , noncoding rnas , and cell organelles.2 several cell types ( such as macrophages , platelets , endothelial cells , granulocytes , monocytes , lymphocytes ) release mps following chemical ( cytokines , thrombin , and endotoxin ) , physical ( shear stress and hypoxia ) , and apoptotic stimuli . mps play an active role in the initiation and amplification of the coagulation cascade , and a pivotal role has been proposed for them in thrombosis , propagating inflammation , modulating vascular tone , angiogenesis , stem cell engraftment , and tumor metastasis.3 mps have been isolated from different biological fluids including plasma,4 serum,5 cerebrospinal fluid,6 bronchoalveolar lavage,7 and synovial fluid.8 the phenotype of circulating mps and , consequently , their origin are different in various pathological conditions , and detection of their cellular origin may serve as a predictor or marker of diseases.9 mps are more than just a miniature version of the specific cell of origin , although the antigens found on the surface of mps and their cargo resemble those of their parental cells ( eg , lineage markers ) , as certain mp components are selectively enriched compared to their parental cell .
interest has been attracted to mps because of their positive correlations with various vascular diseases , but now investigation is also being made of mps in pulmonary diseases in view of their amplified numbers , procoagulant properties , and participation in inflammatory events .
mutschler et al showed , for the first time ever , the presence of mps , derived from platelets , in pulmonary air liquid interfaces in sedated pigs.8 recent investigations conducted in bronchoalveolar lavage fluid characterized intra - alveolar procoagulant mps in patients with acute respiratory distress syndrome and hydrostatic pulmonary edema . in acute respiratory distress syndrome patients ,
intra - alveolar mps contain high levels of tissue factor , show a highly procoagulant activity , and likely contribute to intra - alveolar fibrin formation , a critical pathogenic feature of acute lung injury.10,11 chronic obstructive pulmonary disease ( copd ) is a lung disease characterized by irreversible lung destruction which results in airflow limitation .
the severity of the disease depends largely on the degree of airflow limitation , which is measured by forced expiratory volume in 1 second ( fev1).12 in 2010 , porro et al13 provided evidence of the presence of mps in sputum obtained from cystic fibrosis patients and also found that mps obtained from cystic fibrosis sputum are proinflammatory when injected into the lungs of mice.14 the goal of the present study is to investigate the presence and source of sputum mps in copd patients and to correlate the number and source of mps to the clinical picture .
changes in mp number and composition may reflect the disease pathophysiological conditions and , therefore , could have potential prognostic value for diagnostic use .
understanding mp involvement in copd may provide insight into disease mechanisms and also aid in the development of novel therapeutic strategies .
the study was approved and performed according to the ethical standards of ce azienda ospedaliero - universitaria ospedali riuniti di foggia on human experimentation .
induced sputum samples were collected from 18 male subjects with mild to severe copd ( i iv stages according to global initiative for chronic obstructive lung disease guidelines ) enrolled at the institute of respiratory diseases ( ospedali riuniti of foggia ) .
presence of main comorbidities was also evaluated and it was found that the majority of patients had been affected by cardiovascular diseases ( table 1 ) .
all subjects completed the study questionnaires on smoking status , copd assessment test score , and general data , and performed standardized spirometry .
the equipment was calibrated daily using a 3 l syringe . in accordance with the global initiative for chronic obstructive lung disease guidelines ,
the subjects were defined as copd when fev1/forced vital capacity was < 70% post - bronchodilation .
all patients with copd had stable disease with no exacerbation or respiratory tract infection 2 months before the study .
drugs for copd ( inhaled corticosteroid / long - acting 2-agonist or long - acting muscarinic antagonist ) were interrupted at least 7 days before the collection of sputum .
the data about the 6-minute walking test ( 6mwt ) , and body mass index ( bmi ) , and dyspnea by borg scale15 were also collected , and the bode index was then calculated according to international guidelines were also calculated according to international guidelines.16 sputum induction was achieved by making the patients inhale hypertonic saline solution via ultraneb devilbiss ( sunrise medical , wollaston , uk ) treated with sputasol ( oxoid , hampshire , uk ) according to european respiratory society guidelines.17 the whole expectorate was collected directly into a clear plastic petri dish where the selection process was performed .
after homogenization , the solution was filtered through a nylon mesh filter ( 53 m nylon mesh ) .
the filtered cell suspension was centrifuged at 600 g for 10 minutes at 4c8c , and the supernatant was aspirated and stored at 80c for the analysis of mps , performed later .
the total cell count and viability of sputum cells were obtained simultaneously in a brker counting chamber .
cytospins were prepared , stained with diff quick stain ( medion diagnostics , ddingen , switzerland ) , and two researchers with training in reading induced sputum slides independently counted 400 nonsquamous cells on the stained slides .
the supernatant was then centrifuged at 253 g for 10 minutes and recentrifuged at 253 g for 20 minutes to remove the cells and large debris , respectively .
two hundred microliters of each mp - containing supernatant was frozen and stored at 80c until characterization by flow cytometry .
the mp population was characterized in the sputum supernatant according to the expression of membrane - specific antigens .
antihuman cd11a labeling was used to count leukocyte mps , while counting of granulocyte mps was performed using antihuman cd66b .
platelets and megakaryocytic mps were counted using antihuman cd41 , platelet endothelial mps ( emps ) using antihuman cd31 , and mps from red blood cells were counted using antihuman cd235ab .
human immunoglobulin m was used as isotype - matched negative control for cd66b , igg1 was used as isotype - matched negative control for cd11a , cd41 , and cd31 , while igg2 was the negative control for cd235ab . for these studies ,
10 l of supernatant mps was incubated with 10 l of specific antibody ( 1 g / ml ; fluorescein iso - thiocyanate conjugated ; biolegend , san diego , ca , usa ) .
after 15 minutes of incubation at + 4c , the samples were diluted in 500 l of 0.9% saline solution .
then , 10 l of flow count beads were added to each sample and analyzed in a flow cytometer ( beckman coulter epics xl - mcl , miami , fl , usa ) .
all data are reported as mean standard deviation and analyzed by statistica software ( statsoft , inc , tulsa , ok , usa ) .
the relationships between variables were determined by measuring the pearson s correlation coefficient or spearman s correlation for the variables which were not normally distributed . a p - value of < 0.05 was considered statistically significant .
the study was approved and performed according to the ethical standards of ce azienda ospedaliero - universitaria ospedali riuniti di foggia on human experimentation .
induced sputum samples were collected from 18 male subjects with mild to severe copd ( i iv stages according to global initiative for chronic obstructive lung disease guidelines ) enrolled at the institute of respiratory diseases ( ospedali riuniti of foggia ) .
presence of main comorbidities was also evaluated and it was found that the majority of patients had been affected by cardiovascular diseases ( table 1 ) .
all subjects completed the study questionnaires on smoking status , copd assessment test score , and general data , and performed standardized spirometry .
the equipment was calibrated daily using a 3 l syringe . in accordance with the global initiative for chronic obstructive lung disease guidelines ,
the subjects were defined as copd when fev1/forced vital capacity was < 70% post - bronchodilation .
all patients with copd had stable disease with no exacerbation or respiratory tract infection 2 months before the study .
drugs for copd ( inhaled corticosteroid / long - acting 2-agonist or long - acting muscarinic antagonist ) were interrupted at least 7 days before the collection of sputum .
the data about the 6-minute walking test ( 6mwt ) , and body mass index ( bmi ) , and dyspnea by borg scale15 were also collected , and the bode index was then calculated according to international guidelines were also calculated according to international guidelines.16
sputum induction was achieved by making the patients inhale hypertonic saline solution via ultraneb devilbiss ( sunrise medical , wollaston , uk ) treated with sputasol ( oxoid , hampshire , uk ) according to european respiratory society guidelines.17 the whole expectorate was collected directly into a clear plastic petri dish where the selection process was performed .
after homogenization , the solution was filtered through a nylon mesh filter ( 53 m nylon mesh ) .
the filtered cell suspension was centrifuged at 600 g for 10 minutes at 4c8c , and the supernatant was aspirated and stored at 80c for the analysis of mps , performed later .
the total cell count and viability of sputum cells were obtained simultaneously in a brker counting chamber .
cytospins were prepared , stained with diff quick stain ( medion diagnostics , ddingen , switzerland ) , and two researchers with training in reading induced sputum slides independently counted 400 nonsquamous cells on the stained slides .
the processed sputum was centrifuged at 37 g for 3 minutes . the supernatant was then centrifuged at 253 g for 10 minutes and recentrifuged at 253 g for 20 minutes to remove the cells and large debris , respectively .
two hundred microliters of each mp - containing supernatant was frozen and stored at 80c until characterization by flow cytometry .
the mp population was characterized in the sputum supernatant according to the expression of membrane - specific antigens .
antihuman cd11a labeling was used to count leukocyte mps , while counting of granulocyte mps was performed using antihuman cd66b .
platelets and megakaryocytic mps were counted using antihuman cd41 , platelet endothelial mps ( emps ) using antihuman cd31 , and mps from red blood cells were counted using antihuman cd235ab .
human immunoglobulin m was used as isotype - matched negative control for cd66b , igg1 was used as isotype - matched negative control for cd11a , cd41 , and cd31 , while igg2 was the negative control for cd235ab . for these studies ,
10 l of supernatant mps was incubated with 10 l of specific antibody ( 1 g / ml ; fluorescein iso - thiocyanate conjugated ; biolegend , san diego , ca , usa ) .
after 15 minutes of incubation at + 4c , the samples were diluted in 500 l of 0.9% saline solution .
then , 10 l of flow count beads were added to each sample and analyzed in a flow cytometer ( beckman coulter epics xl - mcl , miami , fl , usa ) .
all data are reported as mean standard deviation and analyzed by statistica software ( statsoft , inc , tulsa , ok , usa ) .
the relationships between variables were determined by measuring the pearson s correlation coefficient or spearman s correlation for the variables which were not normally distributed . a p - value of < 0.05 was considered statistically significant .
study participants were aged between 51 and 85 years and had a mean fev1 of 52.39%22.19% .
induced sputum was characterized by a high level of neutrophils ( 86.33%13.98% ) and although in two patients we found a higher number of eosinophils , in both cases , the level was lower than 10% , while the prevalence of neutrophils was higher than 85% ( table 2 ) .
the mp phenotype was analyzed by evaluating the presence of different antigens representing all cell types .
the expression of cd66b - mps ( granulocytes ) was higher than that of other mps , cd235ab ( erythrocytes ) , and cd31-mps ( platelets / endothelial cell adhesion molecules 1 ) were also frequently found , instead the levels of cd41-mps and cd11a - mps were generally low ( table 3 ) .
there was a negative correlation between cd31-mps and fev1 ( r=0.53 , p<0.05 ; figure 1 ) .
cd66b - mps were correlated with a worse copd performance index , being positively correlated with the bode index and negatively correlated with 6mwt : 0.65 and 0.64 , respectively ( p<0.05 ) .
cd235ab - mps showed a negative correlation with bmi ( r=0.86 , p<0.05 ) and a positive correlation with dyspnea index ( r=0.91 , p<0.05 ) .
cd41-mps and cd11a - mps did not show correlations with the other parameters analyzed ( data not shown ) .
finally , no correlation was found between the number of mps and induced sputum cellularity , or with the number of disease exacerbations .
study participants were aged between 51 and 85 years and had a mean fev1 of 52.39%22.19% .
induced sputum was characterized by a high level of neutrophils ( 86.33%13.98% ) and although in two patients we found a higher number of eosinophils , in both cases , the level was lower than 10% , while the prevalence of neutrophils was higher than 85% ( table 2 ) .
the mp phenotype was analyzed by evaluating the presence of different antigens representing all cell types .
the expression of cd66b - mps ( granulocytes ) was higher than that of other mps , cd235ab ( erythrocytes ) , and cd31-mps ( platelets / endothelial cell adhesion molecules 1 ) were also frequently found , instead the levels of cd41-mps and cd11a - mps were generally low ( table 3 ) .
table 4 summarizes the correlations between the mp phenotype and the main copd parameters . there was a negative correlation between cd31-mps and fev1 ( r=0.53 , p<0.05 ; figure 1 ) .
cd66b - mps were correlated with a worse copd performance index , being positively correlated with the bode index and negatively correlated with 6mwt : 0.65 and 0.64 , respectively ( p<0.05 ) .
cd235ab - mps showed a negative correlation with bmi ( r=0.86 , p<0.05 ) and a positive correlation with dyspnea index ( r=0.91 , p<0.05 ) .
cd41-mps and cd11a - mps did not show correlations with the other parameters analyzed ( data not shown ) .
finally , no correlation was found between the number of mps and induced sputum cellularity , or with the number of disease exacerbations .
the main result of the present study is the demonstration that in the sputum of patients affected by copd , it is also possible to detect the presence of mps .
the mps were obtained with the same protocol used in a previous study13 and they were identified through measures of cytofluorimetric analysis .
the phenotype of some mps is related with the main copd parameters such as fev1 , bode index , or 6mwt .
these results , together with other data , suggest that mps are likely implicated in the pathogenesis of copd .
there are various subtypes of mps that are defined according to specific membrane antigens , such as endothelial / platelet cell adhesion molecule 1 ( cd31 ) , leukocytes ( cd11a ) , megakaryocytic ( cd41 ) , granulocytes ( cd66b ) , monocyte - macrophages ( cd11b ) , and red blood cells ( cd235ab ) , which have recently been described in a number of diseases including pulmonary hypertension and acute coronary syndrome.18 different mps were found in induced sputum of all patients enrolled ; the levels of cd41-mps and cd11a - mps were low , cd235ab - mps and cd31-mps were frequently found , and cd66b - mps were the most abundant among all other mps . no correlation was found between the number of mps and induced sputum cellularity , as well as the number of exacerbations .
this could mean that mps were not strictly derived from sputum cells or influenced by exacerbations .
platelet / endothelial cell adhesion molecule 1 ( cd31 ) is a signaling molecule that plays various roles in vascular biology , in particular , in the regulation of platelet function , angiogenesis , t- and b - cell activation , endothelial cell permeability , and transmigration across the endothelium.1924 pecam-1 is concentrated at endothelial junctions and is also expressed on the surface of platelets , neutrophils , and subsets of lymphocytes . unlike vascular endothelial - cadherin , pecam-1 is located outside the adherence junctions on endothelial cells.25 takahashi et al26 reported that cd31-emps are released from pulmonary microvascular endothelial cells mainly in response to apoptosis induced by stimulation by h2o2 or cigarette smoke extract . thus , the released emps likely reflect the apoptosis of injured endothelial cells.6 in a recent paper , thomashow et al27 demonstrated that circulating levels of cd31-mps were higher in copd patients compared to control subjects and , moreover , that there was a negative correlation with fev1 and with the percentage of emphysema .
liu et al28 also found a relationship between cd31 and the severity of obstruction in animal models . in our study , we found high levels of cd31-mps also , in the sputum of copd patients , the numbers being negatively correlated with the severity of disease .
patients with a worse lung function have highest levels of cd31-mps ( figure 1 ) .
thus , we can hypothesize that cd31-mps could be directly correlated with lung damage ; in fact , these data indicate that the high levels of circulating and local mps could reflect the decline of small airway function in copd patients .
moreover , the presence of cd31-mps in sputum could hypothesize lung epithelium and vascular endothelium damage in copd patients . on the other hand , cd66b - mps and cd235ab - mps
were more strongly correlated with a worsening of the main copd indexes such as bode and 6mwt .
moreover , cd235ab - mps showed a negative correlation with bmi and a positive correlation with dyspnea index . in this case , it is more difficult to explain the relationship with mps because they are multiparametric indexes and , therefore , different components could be involved in their decline .
we can only suppose that during the progression of disease , endothelial activations are increased , and this mechanism could upregulate the expression of a pool of mps , including cd66b and cd235ab .
recent studies , in fact , demonstrated that the main causes of death in copd patients are not respiratory events , but cardiovascular events such as ischemic heart disease and stroke.29 vascular abnormalities in the endothelium have been reported in both pulmonary30 and systemic vasculatures31 in copd patients .
impaired endothelial function , as assessed by flow - mediated dilation of the brachial artery , is associated with a low fev1 in copd patients.6,32 endothelial injury in the pulmonary capillary vasculature leads to lung destruction , and since cardiovascular diseases are the main cause of death among individuals with copd , emps are now receiving attention as potential biomarkers for copd . the number of circulating emps is increased in patients with vascular disorders , such as acute coronary disease,33,34 renal failure,35 and metabolic diseases,36 and reflects the endothelial damage occurring in these patients . moreover ,
the number of emps is a sensitive marker of pulmonary capillary endothelial damage induced by smoking in healthy active smokers.37 the number of apoptotic epithelial and endothelial cells is increased in emphysematous lung as compared to normal lung.38 the senescence of alveolar epithelial and endothelial cells is accelerated in patients with emphysema.39 greater numbers of apoptotic lung cells are observed in lung tissues from copd patients than in those from smokers without copd.4042 furthermore , morphological and biochemical markers of autophagy are increased in the lungs of patients with copd compared with normal lung tissue .
these results indicate the importance of injured cells in the pathophysiology of lung destruction and copd.6 mps are not passive agents induced from activated or injured cells , but rather active modulators that promote both proinflammatory and anti - inflammatory signals.43 mps contain proteins and micrornas and can deliver those components to distant endothelial cells.44 therefore , increased emps may influence vascular function and systemic inflammation under copd exacerbation.17 increased dna fragmentation in the pulmonary capillaries and arteriolar endothelium of individuals with copd was shown by segura - valdez et al.45 in addition , kasahara et al38,46,47 reported increased septal cell death ( endothelial and epithelial cells ) in human emphysematous lungs compared with lungs of nonsmokers or smokers without emphysema.37
the main result of our study is not only the presence of mps in copd patients sputum , but also the relation between the number of emps and fev1 .
this indicates that endothelial injury is closely connected to the pathophysiology of copd . since copd is a heterogeneous disease characterized by various combinations with small airway disease and emphysema , the relationships between the severity of the emphysema and the emp count are of great interest .
moreover , as quicker responses can be seen in circulating emp levels compared with an annual fev1 decline , monitoring emp levels is valuable as a means of estimating copd progression .
simple and noninvasive biomarkers in copd are needed to monitor disease progression , identify exacerbations , and evaluate the efficacy of novel therapies .
sputum is a rich , noninvasive source of biomarkers of inflammation and infection , and has been used extensively to assess inflammation in lung airways pathologies .
the presence of cd31-mps in copd sputum could be a new noninvasive method to monitor the disease course .
main limitations of this study are that only a limited number of subjects with lung diseases were enrolled , so it was not possible to evaluate different expression of mps according to severity of the disease , as well as the obvious absence of a control group with healthy subjects in whom it would be difficult to obtain sputum even if induced . however , our preliminary data suggest that high levels of mps reflect the presence of endothelial inflammation .
cd31-mps , cd66b - mps , and cd235ab - mps could be good new candidates for the study of pulmonary endothelial injury and copd progression .
future studies could aim to evaluate if different stages of diseases can influence the phenotype of mps and define the possible role of them in monitoring the effectiveness of medication .
Output:
| backgroundmicroparticles ( mps ) are small membrane vesicles of 0.11 m which are released by cells following chemical , physical , and apoptotic stimuli . mps represent more than a miniature version of the cell .
their composition and function depend not only on cellular origin , but also on stimuli .
chronic obstructive pulmonary disease ( copd ) is a lung disease characterized by nearly irreversible lung destruction which results in airway limitation.purposewe investigated the presence and source of mps in sputum of copd patients to evaluate if changes in mp number and origin may reflect the pathophysiological conditions of disease and may serve as potential biomarkers for diagnostic and prognostic use.methodsinduced sputum samples were collected from 18 male subjects and liquefied with sputasol .
mps obtained were immunolabeled for leukocyte ( cd11a ) , granulocyte ( cd66b ) , monocyte - macrophage ( cd11b ) , platelets and megakaryocytic cells ( cd41 ) , endothelial cells ( cd31 ) , and red blood cells ( cd235ab ) and analyzed by cytofluorimetry.resultsthere was a negative correlation between cd31-mps and forced expiratory volume in 1 second ( r=53 , p<0.05 ) and cd66b - mp level was correlated with worse performance index of copd such as the body mass index airflow obstruction , dyspnea , and exercise capacity ( bode ) ; they were negatively correlated with 6-minute walking test : 0.65 and 0.64 , respectively ( p<0.05 ) .
cd235ab - mps showed a negative correlation with body mass index ( r=0.86 , p<0.05 ) , while there was a positive correlation with dyspnea index ( r=0.91 , p<0.05).conclusionthe main finding of this study was that mps were detected in the sputum of patients affected by copd .
the phenotype of some of them was related to the main copd parameters .
these results suggest that mps could be implicated in the pathogenesis of copd . |
PubmedSumm6877 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
strategies to abrogate tgf- effects provide promising antifibrotic results , however , in vivo data regarding smad activation during fibrogenesis are scarce .
methods : here , liver fibrosis was assessed subsequent to bile duct ligation by determining liver enzymes in serum and collagen deposition in liver tissue .
activated hepatic stellate cells were identified by immunohistochemistry and immunoblots for alpha smooth muscle actin .
rtpcr for smad4 and smad7 was conducted with total rna and northern blot analysis for smad7 with mrna .
results : cholestasis induces tgf- signaling via smad3 in vivo , whereas smad2 phosphorylation was only marginally increased .
, negative feedback regulation of tgf- signaling by increased smad7 expression in activated hepatic stellate cells occurs , however does not interfere with fibrogenesis .
Output:
| abstractbackground / aims : profibrogenic tgf- signaling in hepatic stellate cells is modulated during transdifferentiation .
strategies to abrogate tgf- effects provide promising antifibrotic results , however , in vivo data regarding smad activation during fibrogenesis are scarce .
methods : here , liver fibrosis was assessed subsequent to bile duct ligation by determining liver enzymes in serum and collagen deposition in liver tissue .
activated hepatic stellate cells were identified by immunohistochemistry and immunoblots for alpha smooth muscle actin .
cellular localization of smad3 and smad7 proteins was demonstrated by immunohistochemistry .
rtpcr for smad4 and smad7 was conducted with total rna and northern blot analysis for smad7 with mrna .
whole liver lysates were prepared to detect smad2/3/4 and phospho- smad2/3 by western blotting .
results : cholestasis induces tgf- signaling via smad3 in vivo , whereas smad2 phosphorylation was only marginally increased .
smad4 expression levels were unchanged .
smad7 expression was continuously increasing with duration of cholestasis .
hepatocytes of fibrotic lesions exhibited nuclear staining smad3 .
in contrast to this , smad7 expression was localized to activated hepatic stellate cells .
conclusions : hepatocytes of damaged liver tissue display increased tgf- signaling via smad3 . further , negative feedback regulation of tgf- signaling by increased smad7 expression in activated hepatic stellate cells occurs , however does not interfere with fibrogenesis . |
PubmedSumm6878 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: more than half of the world 's population in approximately 100 countries is exposed to malaria .
iran is situated in the eastern mediterranean region , where about 45% of the population live with the risk of both falciparum and vivax malaria .
countries of this region are situated in either afrotropical ( such as somalia , sudan ) , oriental ( such as pakistan , south - eastern iran , part of afghanistan ) or palearctic ( such as turkmenistan , uzbekistan , tajikistan ) eco - epidemiological zones regarding malaria .
the malaria endemic areas of iran are located in the south - eastern part of the country , bordered in the south by the persian gulf and the gulf of oman , and to the east by afghanistan and pakistan .
the south - eastern corner of iran consists of the sistan and bluchistan province , the hormozgan province and the tropical part of kerman province with a combined population of approximately 3 million and is considered to be " refractory malaria region " .
annual parasite incidence ( api ) was reported to be 8.74 per 1,000 population . in this part of the country
, malaria is of the oriental type , hence more difficult to control than elsewhere in iran .
inherent problems are the drug resistance of p. falciparum and the vector resistance to insecticides , complicated by an increasing rate of imported malaria , mostly p. falciparum , from afghanistan and , to a lesser extent , from pakistan .
parasite and insecticide resistance , aggravated by war and socio - economic factors have limited the possibilities for disease control . a large proportion of the malaria cases diagnosed in the south - eastern part of iran , and an increased risk of local transmission has been observed in these regions .
delayed or missed diagnosis of falciparum malaria increases the risk of complicated or severe disease , which may be fatal especially in non - immunes .
p. falciparum from much of the world , including iran , is largely chloroquine resistant and thus would not be eradicated by the standard treatment used for p. vivax .
when parasite levels are very low , the information obtained by microscopy is limited , and in some cases biased , by the inability to devote the necessary amount of time to the examination of blood smears .
although malaria is one of the major public health problems in iran , with more than 32,616 cases in 1998 , no study has been done to date using the polymerase chain reaction ( pcr ) . as part of a project aimed at improving the diagnosis and control of malaria in iran
, we evaluated a nested polymerase chain reaction ( pcr ) assay for the detection of malaria parasite species in blood samples obtained from individuals in chahbahar district of sistan and bluchistan province .
the malaria endemic areas of iran are located in the south - eastern part of the country .
these areas incorporated less than 5% of iran 's total population , but contain more than 85% of the total incidence of malaria cases in the whole country with p. vivax and p. falciparum are both present .
the sistan and bluchistan province is the most important area with more than 60% of all cases .
the study was conducted in the chahbahar district of sistan and bluchistan province in south - eastern of iran . in chahbahar district ,
malaria transmission occurs year - round with two peaks in may - june and october - november .
p. vivax is dominant during first peak ; but p. falciparum is responsible for about 45% of cases and is the dominant species in second peak . a total of 120 patients aged from 4 to over 50 years , who sought treatment at the malaria health center in chahbahar city public health department in sistan and bluchistan province , were invited to participate in the study .
the patients were selected randomly from different ethnic and racial groups ( bluch , fars , afghan , pakistani , etc . ) .
finger - prick blood samples were collected and thick and thin blood smears were prepared for microscopical observation .
two millilitres blood samples for pcr assay were obtained by informed consent before treatment from patients with either slide - confirmed p. falciparum and p. vivax infection or from slide - negative patients who had been referred to the clinic because of fever and headache . a history of fever , symptoms , and drugs taken , if any , was recorded for each subject .
giemsa - stained thick blood films were routinely used for the detection of parasites without any quantitative estimation of parasitaemia . in this study ,
both thin and thick blood films were prepared and sent with blood samples to the biotechnology dept .
, pasteur institute of iran , in order to determine the parasitaemia and to confirm the parasite species by pcr analysis .
thick and thin films were interpreted as negative only after examination with an oil immersion lens at 1,000 magnification for at least 100 oil immersion fields by an expert microscopist .
all the samples were air - dried , fixed in methanol and then stained for 1530 minutes in giemsa ( bdh ltd ) ; a 1:10 diluted giemsa ( ph 7.2 ) was used .
the stain was washed off with tap water and the smear was examined by 1,000 magnification .
the percentage of the parasitaemia was calculated from a total count of 1,000 red blood cells ( rbcs ) counted in a giemsa stained thin blood film .
rbcs extraction of parasite deoxyribonucleic acid ( dna ) and pcr assay were carried out as described by snounou et al .. briefly , blood samples were thawed and the parasite dna was extracted after the lysed erythrocytes had been treated with proteinase k , using a phenol - chloroform mixture ( 1:1 ) .
dna samples were processed by pcr to amplify species - specific sequences of the small sub - unit ribosomal ribonucleic acid ( ssrrna ) genes of p. vivax , p. falciparum , and p. malariae .
genomic dna prepared from healthy individuals with no history of malaria , living in none - malarious areas of the country have been included as negative controls in all pcr diagnostic assays .
the amplified products were resolved by 2.5% agarose gel electrophoresis for p. vivax , p. falciparum and p. malariae and stained with ethidium bromide for visual detection by ultraviolet transillumination . in order to prevent cross - contamination , different sets of pipettes and different work areas
were used for template preparation , preparation of master mix for pcr , addition of template to first and second ' nests ' and pcr assays ; one uninfected blood sample was included for every ten samples processed .
the malaria endemic areas of iran are located in the south - eastern part of the country .
these areas incorporated less than 5% of iran 's total population , but contain more than 85% of the total incidence of malaria cases in the whole country with p. vivax and p. falciparum are both present .
the sistan and bluchistan province is the most important area with more than 60% of all cases .
the study was conducted in the chahbahar district of sistan and bluchistan province in south - eastern of iran . in chahbahar district ,
malaria transmission occurs year - round with two peaks in may - june and october - november .
p. vivax is dominant during first peak ; but p. falciparum is responsible for about 45% of cases and is the dominant species in second peak .
a total of 120 patients aged from 4 to over 50 years , who sought treatment at the malaria health center in chahbahar city public health department in sistan and bluchistan province , were invited to participate in the study .
the patients were selected randomly from different ethnic and racial groups ( bluch , fars , afghan , pakistani , etc . ) .
finger - prick blood samples were collected and thick and thin blood smears were prepared for microscopical observation .
two millilitres blood samples for pcr assay were obtained by informed consent before treatment from patients with either slide - confirmed p. falciparum and p. vivax infection or from slide - negative patients who had been referred to the clinic because of fever and headache .
a history of fever , symptoms , and drugs taken , if any , was recorded for each subject .
giemsa - stained thick blood films were routinely used for the detection of parasites without any quantitative estimation of parasitaemia . in this study ,
both thin and thick blood films were prepared and sent with blood samples to the biotechnology dept .
, pasteur institute of iran , in order to determine the parasitaemia and to confirm the parasite species by pcr analysis .
thick and thin films were interpreted as negative only after examination with an oil immersion lens at 1,000 magnification for at least 100 oil immersion fields by an expert microscopist .
all the samples were air - dried , fixed in methanol and then stained for 1530 minutes in giemsa ( bdh ltd ) ; a 1:10 diluted giemsa ( ph 7.2 ) was used .
the stain was washed off with tap water and the smear was examined by 1,000 magnification .
the percentage of the parasitaemia was calculated from a total count of 1,000 red blood cells ( rbcs ) counted in a giemsa stained thin blood film .
extraction of parasite deoxyribonucleic acid ( dna ) and pcr assay were carried out as described by snounou et al .. briefly , blood samples were thawed and the parasite dna was extracted after the lysed erythrocytes had been treated with proteinase k , using a phenol - chloroform mixture ( 1:1 ) .
dna samples were processed by pcr to amplify species - specific sequences of the small sub - unit ribosomal ribonucleic acid ( ssrrna ) genes of p. vivax , p. falciparum , and p. malariae .
genomic dna prepared from healthy individuals with no history of malaria , living in none - malarious areas of the country have been included as negative controls in all pcr diagnostic assays .
the amplified products were resolved by 2.5% agarose gel electrophoresis for p. vivax , p. falciparum and p. malariae and stained with ethidium bromide for visual detection by ultraviolet transillumination . in order to prevent cross - contamination , different sets of pipettes and different work areas
were used for template preparation , preparation of master mix for pcr , addition of template to first and second ' nests ' and pcr assays ; one uninfected blood sample was included for every ten samples processed .
90 ( 75% ) males and 30 ( 25% ) females participated in this study , aged between 4 to over 50 years old .
one hundred and twenty suspected malaria patients were examined by thick blood film analysis by an experienced technician in field station . by light microscopy , 84 ( 70% )
were identified as having only p. vivax and 20 ( 16.7% ) as only p. falciparum infections , while 3 ( 2.5% ) were interpreted as having mixed p. vivax - p .
falciparum infections ; 13 ( 10.8% ) were slide - negative ( table 1 ) .
the thin films showed that parasitaemia ranged from 0.001% to 5.8% , with one case of p. falciparum with a parasitaemia over 17% .
comparison of nested pcr assay with giemsa staining for detection of plasmodium infection in iranian malaria patients p. v : p. vivaxp .
f : p. falciparum pcr analysis for detection of the plasmodium genus and species determination is also shown in table 1 .
mono infection , and mixed infections were 70 ( 58.3% ) , 12 ( 10% ) and 34 ( 28.4% ) , respectively .
twenty - three of the 34 mixed infections diagnosed microscopically as p. vivax only and 8 out of 34 as p. falciparum only with three mixed infection .
schematic representation of agarose gel electrophoresis of nested pcr products from clinical specimens using species - specific oligonucleotide pairs for a ( p. vivax ) , b ( p. falciparum ) , c ( mix p. vivax & p. falciparum ) .
( a ) the representative microscopically p. vivax diagnosed samples , which were positive by using p. vivax - specific primers ( left panel ) , and negative by p. falciparum - specific primers ( right panel ) . ( b )
the representative microscopically p. falciparum diagnosed samples , which were positive by using p. falciparum - specific primers ( right panel ) , and negative by p. vivax - specific primers ( left panel).(c ) demonstrates the representative samples , diagnosed by species - specific primers as mix p. falciparum and p. vivax , and which have been diagnosed by microscopy as p. vivax .
eight out of 13 specimens microscopically diagnosed as negative were positive as p. vivax with nested - pcr .
one of the samples , which had been initially misdiagnosed as negative by light microscopy was also , diagnosed as mixed infection by the pcr assay .
all 9 microscopically diagnosed as negative samples , have been shown to be positive by pcr , and confirmed as positive by repeating extraction and the nested pcr assay . in order to ensure that the results are true and not due to technical errors such as cross contamination , assays were all carried out with concurrent human negative controls .
one of these patients had initially been diagnosed with p. vivax ten days before this study and treated with chloroquine and primaquine . at the time of blood samples collection , the technician diagnosed p. falciparum by thick blood film analysis . this patient may have had a mixed p. vivax - p .
another patient presenting with a history of malaria symptoms for the past 14 days was diagnosed as negative by repeated examination of thick blood films , but proved to be positive for p. falciparum by pcr .
two other cases , initially diagnosed positive for p. vivax and p. falciparum , were still positive by microscopy and pcr 14 days after treatment with chloroquine and primaquine ; while these two cases might have been resistant strains of both species , re - infection can not be excluded . with nested - pcr assay using malaria specific primers ,
chahbahar district has been selected as the study area for the following reasons : 1 .
inhabitants are from different ethnic and racial groups ( bluch , fars , afghan , pakistani and etc . ) , some with family members living 200300 km away in the bluchistan province of iran and the bluchistan province of pakistan .
2 . movement of people from different parts of iran , pakistan , afghanistan and the other side of the oman sea to chahbahar for holidays , job - hunting and financial activities may affect parasite populations and cause the re - introduction of malaria into areas , where an interruption of transmission had been achieved before ( i.e. in the northern , central and western ) .
3 . presence of some p. falciparum cases with no response to chloroquine treatment in chahbahar district .
to date the situation in south - eastern iran is quite serious , because of the proximity to afghanistan , a country with disrupted health systems .
a clinical diagnosis of malaria currently depends on the visualization of parasites by light microscopy of giemsa - stained thick and thin blood smears .
this procedure is cheap and simple , but it is a labour intensive procedure and requires well - trained personnel .
many studies have demonstrated the greater sensitivity and specificity of pcr compared to thick blood films .
the detection of low p. vivax and p. falciparum parasitaemia by pcr , at levels undetectable by microscopy , has been reported by brown et al .
, wataya et al . , khoo et al . , black et al . , roper et al . and
singh et al .. the present study between microscopy and nested pcr assay showed that the results obtained by pcr were equivalent or superior to those obtained by microscopy , in that all microscopy - positive samples were positive by pcr .
in addition , the pcr test was able to detect mixed infections that were missed by microscopy .
this may be due to the tendency to one species to be dominant over other species . with the spread of parasite resistance to antimalarial drugs in sistan and bluchistan province and the increasing difficulty in controlling malaria in these areas , it is important to diagnose malaria accurately and to treat it correctly .
microscopic observation of parasites stained with giemsa in thick smears is an inexpensive and simple method that is still used in these areas with malaria transmission and where the diagnosis of malaria is part of primary health care .
several malaria infections from endemic countries are subpatent , with very low parasitaemia , and our results also showed this has occurred in our study area . the problem of population migration , together with the possibility of tourists and professionals travelling to areas at risk for malaria , has increased the number of cases in areas in which malaria transmission was low or previously eradicated . in these cases ,
an accurate malaria diagnosis is very important so that a possible recrudescence after an incorrect treatment of infected individuals can be avoided .
mixed infections with asexual blood forms of p. falciparum and p. vivax are well described but relatively uncommon compared to single species infections .
shute ( 1951 ) described the frequency of mixed infections as less than 1% among the hundreds of british troops he examined in southern italy during 1943 .
in contrast , there are several lines of evidence suggesting that p. vivax may have a suppressive effect on p. falciparum .
james , in his classic review of studies of induced malaria was impressed that p. vivax was the predominant species . in their studies of induced malaria ,
boyd & kitchen often used small doses of quinine which has long been known to have a greater suppressive effect on p. vivax than on p. falciparum . in three instances where p. vivax parasitaemia rose and no drug was administered , asexual p. falciparum parasitaemia fell to submicroscopic levels .
delayed or missed diagnosis of falciparum malaria increases the risk of complicated or severe disease , which may be fatal , especially in non - immunes , and many isolates of p. falciparum are chloroquine resistant and thus would not be eradicated by the standard treatment for p. vivax .
when parasite levels are very low and in the detection of mixed species infections , the information obtained by microscopy is restricted , and in some cases biased , by the inability to devote the necessary amount of time to the examination of blood smears
. a missed diagnosis of p. vivax concurrent with p. falciparum is more problematic since these species could cause relapses , thereby compounding morbidity . because of negative microscopical diagnosis untreated patients may be carriers of the malaria parasites in these particular areas .
the number of patients who had travelled to pakistan , afghanistan and other parts of sistan and bluchistan province were high , with the risk of introducing new isolates ( including drug resistant parasites ) from neighbouring countries .
1 . the nested pcr using the 18s ssrrna gene of p. falciparum described by snounou et al . is useful as an adjunct to conventional microscopy in selected cases for the diagnosis of low - level parasitaemia .
it showed high sensitivity and it could be performed relatively quickly when many samples must be tested .
2 . the correct diagnosis of malaria parasite species and correct treatment can reduce the number of malaria - infected individuals who carry the parasites between populations and may thus reduce the risk of re - introducing of malaria into other parts of iran , outside this province , where an interruption of transmission had been previously achieved .
the results of the nested pcr also showed that the number of malaria cases , the ratio of p. vivax to p. falciparum and the level of mixed infection compared to mono - infection were increased from april to september
. this may be due to the prevalence and ability of vector species to simultaneously transmit the different parasite species .
these results also suggest that , in malaria endemic areas where transmission of both p. falciparum and p. vivax occurs , nested pcr detection of malaria parasites can be a very useful complement to microscopical examination in order to obtain the real incidence of each species and also for the follow - up of patients after specific treatment .
we are grateful for the hospitality and generous collaboration of zahedan university of medical sciences ( dr . m.t .
tabatabai ) , staff in public health department , sistan and bluchistan province ( mr . shahbakhsh ) , chahbahar district ( dr .
Output:
| backgroundrapid diagnosis and correct treatment of cases are the main objectives of control programs in malaria - endemic areas.methods and resultsto evaluate these criteria and in a comparative study , blood specimens were collected from 120 volunteers seeking care at the malaria health center in chahbahar district .
one hundred and seven out of 120 giemsa - stained slides were positive for malaria parasites by microscopy .
eighty - four ( 70% ) and 20 ( 16.7% ) were identified as having only plasmodium vivax and plasmodium falciparum infections , respectively , while only 3 ( 2.5% ) were interpreted as having mixed p. vivax - p .
falciparum infections.the target dna sequence of the 18s small sub - unit ribosomal rna ( ssrrna ) gene was amplified by polymerase chain reaction ( pcr ) and used for the diagnosis of malaria in south - eastern iran .
one hundred twenty blood samples were submitted and the results were compared to those of routine microscopy .
the sensitivity of pcr for detection of p. vivax and p. falciparum malaria was higher than that of microscopy : nested pcr detected 31 more mixed infections than microscopy and parasite positive reactions in 9 out of the 13 microscopically negative samples .
the results also confirmed the presence of p. vivax and p. falciparum.conclusionsthese results suggest that , in places where transmission of both p. vivax and p. falciparum occurs , nested pcr detection of malaria parasites can be a very useful complement to microscopical diagnosis . |
PubmedSumm6879 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: atrial fibrillation is the most common cardiac dysrhythmia , with a prevalence cited in the literature of 10% in individuals over the age of 80 [ 1 , 2 ] .
fibrillatory conduction of the atria results in blood stasis , formation of thrombotic clots , and an increased risk of thromboembolic events , such as stroke .
studies have shown that oral anticoagulant therapy , such as warfarin , can help reduce the risk of thromboembolic events by up to 60% compared to those receiving no treatment .
warfarin has a narrow therapeutic range and can also be associated with hemorrhagic side effects , including a known increased risk of gastrointestinal bleeding and hemorrhagic stroke .
regular monitoring of patients on warfarin to maintain levels within therapeutic range is necessary to decrease the incidence of such side effects .
this need for continuous monitoring , along with recommendations for an increasing number of patients on warfarin therapy , has led to the development of alternative models for monitoring oral anticoagulant therapy .
traditionally , oral anticoagulation therapy has been monitored by specialists or directly by family physicians , as was the case at the south east toronto family health team ( setfht ) , a community based academic teaching unit . with the development of multidisciplinary family health teams ( fhts ) in ontario , canada , expanding roles for nonphysician health care providers in patient care have occurred .
a recent study found nurse - led inr monitoring of inr to be equally effective as physician monitoring . in july 2007 , setfht changed its delivery of oral anticoagulation monitoring from individual physician based to a centralized model in which a pharmacist followed the blood testing results and managed all patients in the clinic who were taking warfarin . in may 2008 ,
the model was changed to a weekly pharmacist - led point - of - care ( poc ) inr clinic , where patients would come for an appointment with the pharmacist , have a poc inr done on site using the coagucheck xs machine ( roche diagnostics ) , and warfarin dose adjusted immediately based on these results .
the objective of this study was to determine the efficacy of the pharmacist - led poc inr clinic compared with routine pharmacist managed inr .
a chart audit using quasiexperimental study was performed by searching electronic charts at setfht to identify patients who were receiving warfarin therapy .
patients were included if they were taking warfarin for atrial fibrillation or atrial flutter , and if they had a target inr of 2 to 3 .
baseline data was collected on all patients who were taking warfarin from feb 1 , 2008 to april 30 , 2008 .
this timeline was chosen as it was just prior to starting the poc inr clinic and was 9 months into the pharmacist - led monitoring of inr .
data was collected through chart review and included inr values , patient demographics , and comorbidities .
planned inconsistencies in warfarin therapy administration , such as initiating , discontinuing , or holding warfarin during the study period ( for instance , if a patient was undergoing a surgical procedure ) , were also recorded .
similar data was also collected for patients who were monitored in the poc inr clinic from feb 1 , 2010 to april 30 , 2010 .
this timeline was chosen as the poc inr clinic had been running for 2 years and it was thought that other external variables ( holidays , seasonal vitamin k variations ) would be minimized by using the same 3-month period .
patients were considered to be monitored in the poc clinic as long as the poc clinic was the source of at least half of their recorded inr values .
time in therapeutic range ( ttr ) is an estimate of the number of days that a patient has an inr value within their target range .
ttr was determined for both groups of patients using the rosendaal method of linear interpolation .
linear mixed models were used to compare the ttrs from 2008 and 2010 to evaluate the effect of the poc clinic as this method can handle missing data without deleting subjects in a repeated measure study .
data from patients with planned inconsistent warfarin use during the study period were then excluded .
this study was approved by the research ethics board at the toronto east general hospital .
119 patients were identified who met the inclusion criteria ( table 1 ) . of these patients ,
51.3% ( n = 61 ) were female and mean age was 78.8 years .
figure 1 presents the grouping of patients based on availability of estimated ttr measurement in 2008 and 2010 . of 119 patients , 5(4% )
those included in only one cohort was almost equally divided between 2008 ( n = 42 ) and 2010 ( n = 40 ) .
distribution of study characteristics were similar , except for frequency of diabetes and dyslipidemia that is higher in the 2010 group .
the ttr in 2008 was compared to the ttr in 2010 to evaluate the effect of the poc clinic .
the estimated marginal mean ttr for year 2008 was 64.8% and for year 2010 was 70.4% ; the mean increase in ttr from 2008 to 2010 was 6.34% ( 95% ci 4.30 , 16.99 ) .
type iii test for the effect of poc was not statistically significant ( p = 0.24 ) .
a total of 20 patients ( 16.8% ) had planned inconsistent warfarin usage during the study time .
this included patients who were initiating or discontinuing warfarin therapy during the study period and those holding due to a procedure or medication interaction .
when the patients with planned inconsistent warfarin usage were excluded from the analysis , mean ttr in 2008 was 64.4% and the mean ttr in 2010 was 77.1% .
using linear mixed models , the ttrs were on average 12.68% ( ci : 1.18 , 24.18 ) higher in 2010 than in 2008 . this difference and type iii test for the effect of poc
our study indicates a significant increase in ttr after the implementation of the pharmacist - led poc inr clinic .
pharmacist - managed inr has been shown to be more effective than physician - managed inr .
a study in the us looked at patients whose warfarin therapy was stabilized in a pharmacist - managed anticoagulation clinic and then discharged to the care of their family physicians .
these patients showed a significant decrease in inr control once care was assumed by their family physicians .
there have been some studies describing benefits of poc inr in managing patients on warfarin in different settings .
several descriptive case studies have highlighted the benefit of poc inr testing by pharmacists for patients who live in rural or remote areas with limited access to hospitals and medical clinics [ 9 , 10 ] .
a retrospective cohort study found improved inr control in patients at cardiology clinics who took part in a nurse - run , mobile poc anticoagulation therapy clinic . to our knowledge
, our study is the first one to examine the effectiveness of a pharmacist - led poc inr clinic within a family medicine setting .
an advantage of a poc clinic is having immediate access to inr results , eliminating lag time between blood test and medication adjustment .
as well , patients have the opportunity to discuss any medication concerns with the pharmacist at the time of the poc inr appointment .
as patients on warfarin are at higher risk of drug interactions and adverse events , this benefit is important .
the calculation of ttr assumes that the change in inr between two known points is linear .
it is not possible to take into account the natural fluctuations in inr , for example , due to dietary changes .
nevertheless , the rosendaal method of linear interpolation is an accepted method for calculation of ttr .
missing ttr measurements for a significant number of patients was another limitation ; to conduct a study with repeated measurement design pre - and post- poc implementation , availability of both measurements for all patients would have been ideal . however , this was a quasiexperimental study , and we did not have control on completeness or availability of data in patient records . a small number of patients with missing ttr in both pre- and post - poc implementation were excluded .
we employed linear mixed modeling techniques to analyze the remaining data and reduced the impact of missing information findings of this study suggest that a centralized poc inr clinic led by a pharmacist improves control of anticoagulation therapy in patients receiving warfarin for atrial fibrillation in a family medicine setting .
given the positive results shown in our analysis , expanding the poc inr clinic to other family health teams in the community is an option worthy of consideration .
Output:
| purpose . monitoring patients ' international normalized ratio ( inr ) within a family medicine setting can be challenging .
novel methods of doing this effectively and in a timely manner are important for patient care .
the purpose of this study was to determine the effectiveness of a pharmacist - led point - of - care ( poc ) inr clinic .
methods . at a community - based academic family health team in toronto , canada , charts of patients with atrial fibrillation managed by a pharmacist with usual care ( bloodtesting at lab and pharmacist
follow up of inr by phone ) from february 2008 to april 2008 were compared with charts of patients attending a weekly poc inr clinic from february 2010 to april 2010 .
time in therapeutic range ( ttr ) was measured for both groups .
results .
119 patient charts were reviewed and 114 had ttr calculated . after excluding patients with planned inconsistent coumadin use ( 20 ) , such as initiating coumadin treatment or stopping for a surgical procedure , the mean ttr increased from 64.41% to 77.09% with the implementation of the poc clinic .
this was a statistically significant difference of 12.68% ( ci : 1.18 , 24.18 ; p = 0.03 ) .
conclusion .
a pharmacist - led poc - inr clinic improves control of anticoagulation therapy in patients receiving warfarin and should be considered for implementation in other family medicine settings . |
PubmedSumm6880 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: malignant melanoma is a neoplastic disorder which results from the malignant transformation of natural melanocytes . during the neonatal period ,
these parts include the skin , meninges , mucous membranes , upper esophagus and the eyes . in all of these areas
its involvement is less than 3% of all malignant melanomas and constitutes less than 1% of all tumors of the anorectal area .
however , the most common site for development of melanoma in the alimentary tract is the anorectal area . the first case of this disease
the most important factor in predicting survival is the disease stage at the time of diagnosis .
invasive methods such as abdominoperineal resection ( apr ) and bilateral inguinal lymphadenectomy are less suggested today due to the low survival rate of this condition . nowadays , in cases in which adequate margin is available , less invasive techniques besides preserving the sphincter are more commonly recommended . in the various studies
performed so far , the overall survival rate of the patients treated with these two methods did not show any significant difference .
nevertheless , it seems that the local control in patients treated with the apr surgical method is better and the recurrence rate is lower .
the records of anorectal melanoma cases referred to omid oncology center , mashhad , iran , from 2001 to 2011 were extracted and studied .
all required data were gathered from the files and their present general condition was recorded by calling each and every patient by phone .
one patient had been referred with complaints of pain in the perineal area and the rest with the chief complaint of rectorrhagia . in two patients ,
melanoma had been diagnosed with hemorrhoids and the melanomas were confirmed after surgery and pathology assessment . in our study ,
two cases had been referred with initial diagnosis of lymphoma which in complementary studies with immunohistochemistry ( ihc ) and examining the tissue sample following surgery , the diagnosis of melanoma had confirmed ( figure 1 , 2 ) .
three of the seven patients ( 43% ) had distant metastases to the liver , lungs , omentum and mesentery whereas another 4 ( 57% ) had locally advanced disease . in patients with locally advanced stages , 2 cases serosa ( figure 3 ) , in one case , pelvic lymph nodes and in one case
four cases had undergone apr surgery alone with curative intent . in these cases , we recommended adjuvant radiotherapy for two patients after apr due to lymphadenopathy based on pathology reports .
palliative chemotherapy had been administered in two patients to lessen metastases symptoms . at the time of data analysis
only 2 cases were alive . after 8 and for another 15 months of follow up
for all patients , the median survival was 4 month ( range 1 - 15mo ) ( table 1 ) .
the anorectal area is the third most common site for melanoma after the skin and eye . in the recent years
, the incidence of this condition has raised in the young male population . in a study conducted on 117 cases in the u.s . , the probable association between anorectal melanoma and hiv has been proposed [ 4 , 5 ] .
nevertheless , most of cases of this disease occur in the 5th or 6th decades of life . in the present study ,
the mean age of the studied cases was 64 years which is consistent with the global age ranges for this condition .
the common and usual manifestations of this condition are rectal haemorrhage and changes in the defecation habits .
such symptoms are also the most common manifestations of other benign diseases of this area including hemorrhoids , fissures and polyps . in our investigation ,
one patient had been referred with complaints of pain in the perineal area and the rest with the chief complaint of rectorrhagia .
such lesions are often fully diagnosed following a simple surgical procedure . in the present investigation
on macroscopic evaluation , the anorectal melanoma manifests with a pigmented or non - pigmented polypoid mass .
when microscopically viewed , it is seen as cellular nests which are diagnosed by specific staining against melanosomal proteins ( immunostaining ) .
the level of invasiveness and malignancy of anorectal melanoma is defined by the short disease - free survival time ( dfs ) , the overall survival and the high rate of metastasis . around 26% of the cases had distant metastases at the time of diagnosis .
three of the seven patients ( 43% ) had distant metastases to the liver , lungs , omentum and mesentery while the other ( 57% ) had advanced local disease .
in the current study , the mean time between the onsets of symptoms to confirmation of the final diagnosis was 8 months and the median survival following diagnosis was 4 months .
this high rate of metastasis could be due to the delay in diagnosing the disease . in cooper
et al study on 65 cases with anorectal melanoma , the mean duration of symptoms before diagnosis was 5.3 months and 38% of the cases had distant metastatic disease at the time of diagnosis .
the number of anorectal melanoma patients even in major oncology centers is limited . in general , one case is reported every year from each center .
apr could be the definite cure for lesions with a less than 2 mm invasion depth .
this is based on the hypothesis that this disease spreads through the submucosal lymphatic system and the mesenteric lymph nodes .
therefore , the apr surgical method could be proposed as the method of choice in such patients .
radiotherapy is considered as a palliative treatment in tumors with extensive involvement and often unresectable or in cases in whom surgery is contraindicated due to other underlying medical disorders . in metastatic patients , the combination of radiotherapy and chemotherapy can be applied as a palliative treatment .
overall , the prognosis of anorectal melanoma seems to be poor and the delay in diagnosis leads to high disease stage at the time of treatment .
most probably distant micro - metastases had been occurred in our cases ( 4 patients ) who presented locally advanced .
anorectal melanoma is a rare disease and should be considered as an uncommon differential diagnosis for lesions in this area to prevent misdiagnosis .
better results could be further achieved by the close cooperation of different related specialties which could lead to the earlier diagnosis and better prognosis in such cases .
anorectal melanoma is a rare disease and should be considered as an uncommon differential diagnosis for lesions in this area to prevent misdiagnosis .
better results could be further achieved by the close cooperation of different related specialties which could lead to the earlier diagnosis and better prognosis in such cases .
Output:
| backgroundanorectal melanoma is one of the rare but significant malignancies of the anorectal area .
this malignancy currently accounts for 1% of all types of melanoma and less than 1% of all the anorectal area malignancies .
very rare cases of this disease have been reported worldwide.anorectal melanoma is mostly diagnosed while treating other benign conditions of this area such as hemorrhoids with conventional modalities .
its treatment of choice has always been a controversial issue.methodsin this study , clinical pathology and outcome of 7 cases with anorectal melanoma referred to omid oncology teaching hospital during 2001 - 2011 were assessed.resultsout of seven cases , 2 patients had been diagnosed with hemorrhoids and undergone surgery and 2 other cases had been referred with the primary diagnosis of lymphoma .
initially , only in 3 cases melanoma was diagnosed in clinicopathology setting .
three cases of patients had distant metastases to the liver , lungs , omentum and mesentery , while the other 4 patients had advanced local disease .
no patient had been diagnosed in the primary stages of the disease .
the mean time duration between symptoms onset to diagnosis of disease had been 8 months .
the median survival time was 5 months.conclusionrare anorectal melanoma and its similar manifestations to other common anorectal conditions can delay the diagnosis , therefore should be considered as an uncommon differential diagnosis .
the disease 's outcome is poor and most probably delay in the diagnosis has an important role in the treatment results . |
PubmedSumm6881 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: although in 1835 , purkinje and valentin ( 1835 ) published the first treatise to include studies of mammalian cilia , the history of what may be considered modern research on mammalian cilia does not extend back more than a few years longer than the history of this journal .
motile mammalian cilia attracted the attention of microscopists before the advent of electron microscopy , because they moved and were obviously similar in this motion to protozoan cilia . nevertheless , several light microscope structures whose later fine structure appearance ( and molecular biology ) had little in common with cilia were nevertheless labeled cilia , including the stereocilia of the hair cells , which are in fact modified microvilli . in 1954 ,
the electron microscope observations of fawcett and porter ( 1954 ) definitively characterized the 9 + 2 pattern of the cytoskeleton , the axoneme , of motile mammalian and other cilia .
they showed that this structure was enclosed by an extension of the cell membrane , the ciliary membrane .
the axoneme of true cilia was always an extension of a basal body and related to the nine - fold construction of the centriole . by 1956 , porter ( 1957 ) and de robertis ( 1956 ) realized that cilia were found as sensory structures in , for example mammalian photoreceptors , where the central pair of microtubules in the axoneme was absent , and the cilia were nonmotile , hence 9 + 0 .
finally , in the early 1960s , a number of electron microscopy studies showed that solitary 9 + 0 cilia , now termed primary cilia , are present on many differentiated cells of tissues of the mammalian and vertebrate body , including kidney cells , fibroblasts , neurons and even schwann cells ( barnes 1961 ; sorokin 1962 ; grillo and palay 1963 ) .
although specific antibodies against detyrosinated and acetylated tubulin became available to detect primary cilia in immunofluorescence microscopy ( piperno et al .
1987 ; cambray - deakin and burgoyne 1987 ) , primary cilia were generally neglected as interesting cell organelles .
the biggest problem was that primary cilia had no demonstrable function , even though considerable circumstantial evidence suggested that they were some form of chemical or mechanical sensor . on this basis ,
poole et al . ( 1985 ) proposed that primary cilia of connective tissue cells functioned as a cellular cybernetic probe , or in current terminology , as a cellular global positioning system .
roth et al . ( 1988 ) then demonstrated that primary cilia on cultured kidney epithelial cells could be bent by flow , and wheatley ( 1995 ) suggested that if primary cilia in renal epithelia did not function properly in sensing flow , there would be pathophysiological consequences .
while early studies of mammalian cilia focused on showing that the mechanism and biochemistry of motility was virtually identical to that discovered in other cilia , more recent studies have examined the way that cilia are built .
these studies have led to novel insights for both motile and nonmotile , including primary , cilia .
all cilia can now be viewed as sensory cellular antennae that coordinate a plethora of cellular signaling pathways , and this view has had unanticipated consequences for our understanding of developmental processes and disease . a recent review of mammalian cilia structure and function covering many of the topics presented here , in further detail , is found in satir and christensen ( 2007 ) .
the basic mechanism of ciliary motility is now reasonably well understood , although many details of how waveform is generated and propagated remain obscure . while much of the information about this mechanism was derived from protistan and invertebrate organisms ( satir 1985 )
, the basic principles clearly apply to mammalian cilia of the respiratory and reproductive tract , and to brain ependymal cilia .
cross - sections show the 9 + 2 axoneme of motile cilia ( asterisk ) .
the axoneme grows from a basal body , with a basal foot ( arrowhead ) pointing in the direction of the effective stroke .
the transition zone between basal body and axoneme contains the ciliary necklace ( arrow ) .
( from dirksen and satir 1972 , unpublished , with permission ) classic transmission electron micrograph of mouse oviduct cilia .
cross - sections show the 9 + 2 axoneme of motile cilia ( asterisk ) .
the axoneme grows from a basal body , with a basal foot ( arrowhead ) pointing in the direction of the effective stroke .
the transition zone between basal body and axoneme contains the ciliary necklace ( arrow ) .
( from dirksen and satir 1972 , unpublished , with permission ) ciliary motility is caused by the relative sliding of the nine outer axonemal doublets , operating as two opposing sets , one ( doublets 14 ) to produce the effective stroke ( or principal bend in flagella ) , one ( doublets 69 ) to produce the recovery stroke ( or reverse bend ) , powered by atp and a set of molecular motors , the axonemal dyneins .
the axonemal dyneins are arranged in two sets of arms : the outer dynein arms ( odas ) consisting of two heavy - chain dynein isoforms in mammalian cilia , packaged with intermediate and light chains , with four identical odas , each aligned along 96-nm long doublet microtubule ( nicastro et al .
the idas , more centrally located , consist of at least seven heterodimeric and monomeric heavy - chain dynein isoforms per 96 nm .
generally , the odas and idas function together , but the odas principally regulate beat frequency , in part by camp - dependent phosphorylation of an oda regulatory light chain , while the idas control beat form . both frequency and form change by changing the rate of sliding and the switching of activity between the doublet sets . sliding is converted into propagated bending , most efficiently by control of ida activity via phosphorylation and mechanical interaction involving the radial spoke , central pair complex . in effect , the 9 + 2 axoneme is a nanomachine composed of perhaps over 600 proteins in molecular complexes , many of which also function independently as nanomachines . the enzymes that control axonemal response , for example protein kinase a , are structurally part of the complexes .
strong support for this mechanism of ciliary motility comes from studies of paralyzed and other mutants of protistan cilia , where a structural defect and a corresponding genetic mutation can directly be correlated with a change in ciliary beat .
similarly , strong support for the applicability of the mechanism to human cilia comes from studies , mainly of ciliary structural defects and genetic mutations associated with impaired mucociliary function in the respiratory system , which produces sinusitis and bronchiectasis .
clinical features of pcd , which include chronic rhinitis / sinusitis , otitis media , male infertility and an increased incidence of hydrocephalus , point to physiological processes where ciliary motility is essential ( afzelius 2004 ) . as might be anticipated , prominent causes of pcd are mutations that affect the assembly or function of the dynein arms most commonly a mutation in dnah5 , a gene encoding a dynein heavy chain of the odas ( olbrich et al .
any mutation affecting the ciliary beat mechanism will potentially produce pcd , depending on the severity of beat impairment .
an instructive example is hydin , a component of the central pair projection complex that interacts with the radial spokes in the switching mechanism between doublet sets .
hydin - deficient flagella of chlamydomonas become intermittently paralyzed , stopping for long times at the end of the effective or recovery strokes , where the direction of beat is reversed ( lechtreck and witman 2007 ) .
mutant cilia were unable to bend properly and frequently stalled , implying that because central pair structure was defective , interactions between the central pair and the radial spokes that affected dynein arm switching were abnormal , and consequently cilia - generated flow was impaired .
one would predict that human mutations in hydin are also likely to result in hydrocephalus or a form of pcd .
many people diagnosed with pcd have situs inversus totalis that is reversal of left right asymmetry of body organs such as the heart .
this is now known to be produced , because fluid flow produced by motile cilia at the embryonic node is defective ( hirokawa et al .
the usual flow pattern produced by the cilia is unidirectional right - to - left , and this activates a left - side - only gene cascade , probably by impinging on primary cilia at the left side of the node ( mcgrath et al .
the nodal cilia are mainly missing the central pair of axonemal microtubules , hence , although motile , are often 9 + 0 , but with some unique oda dynein isoforms ( supp et al . 1999 ) .
it is not known whether the response of the primary cilia at the node is to mechanical displacement ( flow sensing ) or if it involves morphogens produced in membrane parcels in the node ( tanaka et al . 2005 ) .
morphogen - containing multimembrane vesicles are a feature of nodal response that could also apply respiratory and other ciliated epithelia , where flow occurs .
while mouse mutants or knockouts that are missing cilia develop situs inversus , hydin mutants do not show this phenotype , presumably because their motility is sufficient to generate appropriate nodal flow . in a similar way , by examining the pcd phenotype of mutations in various ciliary proteins , identified by proteomics , it should be possible to dissect details of the function of the protein in the mechanism of beat generation ( avidor - reiss et al . 2004 ; badano et al .
a major breakthrough in the understanding of the importance of cilia in the body has come from the study of chlamydomonas ciliogenesis .
ciliogenesis involves transport of materials into , along and out of the cilium , directly visualized as
ift requires molecular motors , several kinesins for anterograde transport and a specialized cytoplasmic dynein for retrograde transport . coupling the transported cargo to the molecular motors that move along the outer doublets of the axoneme
remarkably , this machinery is conserved almost universally wherever cilia are built , and orthologs of the motors and ift proteins are found in sensory cilia and their derivatives , such as the mammalian photoreceptor ( baker et al .
however , motile cilia of mammalian tissues often assemble in mass ( gaillard et al . 1989 ; dirksen 1991 ) .
centriologenesis of hundreds of basal bodies occurs from a fibrogranular mass in the cytoplasm and cilia sprout from the cell surface .
it is unclear whether classical ift is the major mechanism of ciliogenesis in respiratory epithelium , or what modifications of the process occur .
( 1971 ) and archer and wheatley ( 1971 ) studied ciliogenesis of primary cilia of established cell lines in vitro .
postmitotic cells reassemble primary cilia in g1 and maintain the cilium as the cells enter growth arrest ( g0 ) and undergo differentiation .
in contrast to motile cilia , the primary cilium emanates uniquely from the distal end of the existing mother centriole of the centrosome , which migrates to the cell surface during growth arrest .
ciliogenesis by ift is initiated while the centrosome is positioned at the golgi apparatus near the nucleus , while extensive ift and elongation of the cilium take place after docking of the nascent cilium at the cell surface , where microtubule pairs are quickly assembled to form the mature axoneme .
two recent and extensive reviews of the complex interactions between ift particles , molecular motors , centrosomal proteins and other microtubule - associated proteins in ciliogenesis are presented in pedersen et al .
the first human illness that could be linked to primary cilia in epithelial cells was polycystic kidney disease ( pkd ) .
one of the orthologs of ift88 is the mammalian protein polaris mutated in a transgenic mouse tg737 , which was a model for the study of pkd .
( 2000 ) demonstrated that , similarly , cilia of the mouse kidney were abnormally short or missing , which suggested that pkd might be a ciliary disease .
mechanical deflection of kidney tubule epithelial cells induces an increase in intracellular calcium ( praetorius and spring 2001 ) , and the pkd proteins , polycystins 1 and 2 in ca - signaling , localize to the ciliary membrane ( pazour et al .
many other proteins whose functions are disrupted in cystic diseases , e.g. nephrocystins , have now been localized to the cilium or at the ciliary basal body , supporting the conclusion that the primary cilium in kidney tubules partly functions as a mechanosensor that , upon bending , activates a series of signaling pathways in the cilium to control development and homeostasis of the tissue ( for reviews , see yoder et al . 2007 ; hildebrandt and zhou 2007 ) , as originally envisaged by roth et al .
thus , even if primary cilia are present , unless these proteins are targeted appropriately to the cilia or the ciliary basal body , pathology develops .
it is now clear that the ciliary membrane is a privileged and specialized compartment for receptor signaling and that the polycystins are only one type of many membrane proteins that must be targeted to the primary cilium to function properly .
further , essential downstream components in pdgfr and hedgehog signaling as well as signaling in neurotransmission , wnt pathways , extracellular matrix interaction and osmolyte transportation uniquely localize to the cilium and/or to the ciliary centrosome ( gerdes et al . 2007 ; corbit et al . 2008 ; for reviews , see singla and reiter 2006 ; michaud and yoder 2006 ; christensen et al . 2007 ; christensen and ott 2007 ) . in many of these signaling systems ,
deficiencies in placement of receptors and their immediate downstream signaling components in the cilium or at the ciliary base results in ciliopathy , including cystic kidney , pancreatic and liver diseases , retinitis pigmentosa , cancer , defective neurogenesis , bardet - biedl syndrome , polydactyly , anosmia and other developmental defects . in the tg737 mouse ,
2 , primary cilia with hedgehog receptor pathway signaling are found on human embryonic stem cells ( kiprilov et al . 2008 ) , which suggests that ciliary signaling is involved in differentiation from the beginning of embryogenesis . in embryogenesis , signaling through the primary cilium is necessary for normal development , probably because such signaling regulates the balance between cell division , polarity , migration , differentiation and apoptosis for many tissues .
immunofluoresence microscopy using acetylated tubulin antibody ( tb ) reveals the presence of primary cilia ( arrows ) on human embryonic stem cells . in the absence of stimulation ,
the hedgehog receptor patched ( ptc ) colocalizes with the acetylated tubulin all along the ciliary membrane .
nuclei are stained with dapi ( blue ) . upon stimulation , as part of the signaling cascade , ptc leaves the cilium and the smoothened receptor ( smo ) enters to activate the hedgehog signaling cascade .
( from kiprilov et al . 2008 , with permission , courtesy of the journal of cell biology ) primary cilia of human embryonic stem cells .
immunofluoresence microscopy using acetylated tubulin antibody ( tb ) reveals the presence of primary cilia ( arrows ) on human embryonic stem cells . in the absence of stimulation ,
the hedgehog receptor patched ( ptc ) colocalizes with the acetylated tubulin all along the ciliary membrane .
nuclei are stained with dapi ( blue ) . upon stimulation , as part of the signaling cascade , ptc leaves the cilium and the smoothened receptor ( smo ) enters to activate the hedgehog signaling cascade .
primary cilia persist in many differentiated cells , including kidney tubule epithelial cells , fibroblasts and neurons , after organogenesis is complete and cell division rates fall . presumably , as semipermanent structures , the cilia function as mechano- or chemosensors and as a cellular global positioning system to detect changes in the surrounding environment , to initiate cellular replacement after damage , for example . to test this hypothesis ,
techniques are being used to knock out primary cilia or ciliary proteins in specific tissues of adult organisms .
( 2007 ) have completed one of the first of these studies , using an inducible system in adult mice to disrupt ift in several different ways , causing loss of primary cilia .
surprisingly , when primary cilia are lost from all adult tissues , the devastating abnormalities and lethality seen after embryonic loss of cilia are not observed .
this delay correlates well with a greatly reduced rate of cell division and a different pattern of gene expression in the mature kidney and could explain the increase in human pkd with age .
such changes in cell proliferation rate may relegate the primary cilium of adult tissues to a less immediate role , involving long - term homeostasis of the tissue . because signaling through primary cilia is coupled to cell cycle events , for example in pdgfr signaling in fibroblasts , long - term disruption of ciliary signaling could be a factor in oncogenesis .
one adult tissue responds immediately to ciliary knockout however that is nervous tissue , most specifically neurons in the hypothalamus .
knockout of all adult primary cilia in the mouse , or specifically only of primary cilia on pomc neurons , leads to hyperphagia compulsive and excessive eating leading to obesity .
these defects do not occur if the knockout mice are kept on a restricted diet . eating behavior
these fndings suggest that the leptin receptor might be located in the membrane of the primary cilia of the pomc neurons .
the hypothalamic hormone somatostatin is a negative regulator of leptin . while leptin leads to reduced eating , somatostatin increases eating behavior .
the somatostatin receptor sst 3 is localized to primary cilia in hypothalamic neurons ( stepanyan et al . 2007 ) .
( 2007 ) suggest that , much like the patched and smoothened receptors work in hedgehog signaling , the leptin receptor and a somatostatin receptor could work in a yin - yang relationship within the pomc primary cilium ( satir 2007 ) .
whatever the precise cell biological explanation of the relationship between ciliary knockout and hyperphagia , the effect of knockout is behavioral .
we might expect that mutations in other proteins of neuronal primary cilia could lead to other behavioral responses .
there are reports that the rages that fueled the famous hatfield - mccoy feud of appalachia probably were driven by a family suffering from von hippel - landau ( vhl ) syndrome .
perhaps a more ciliocentric view of neuronal activity affecting recurrent or addictive actions is warranted .
beginning with important electron microscopic studies and culminating in immunolocalization combined with molecular genetic technology , much has been learned about motile , sensory and primary cilia in mammals .
defects in building the primary cilium or mutations in ciliary membrane or axonemal proteins lead to ciliopathies , important human diseases .
the cilium has moved to a prominent place in studies of embryogenesis and tissue differentiation and maintenance .
there are hints that the fundamental cell biology of cilia will also be important in oncogenesis , aging diseases and human behavioral disorders .
the strides of the past half century in understanding this organelle have been impressive , and the promise of discovery in the next half century is compelling .
Output:
| in the past half century , beginning with electron microscopic studies of 9 + 2 motile and 9 + 0 primary cilia , novel insights have been obtained regarding the structure and function of mammalian cilia .
all cilia can now be viewed as sensory cellular antennae that coordinate a large number of cellular signaling pathways , sometimes coupling the signaling to ciliary motility or alternatively to cell division and differentiation .
this view has had unanticipated consequences for our understanding of developmental processes and human disease . |
PubmedSumm6882 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: hemolytic uremic syndrome ( hus ) is characterized by the triad of microangiopathic hemolytic anemia , thrombocytopenia and acute renal failure .
hus in children is most commonly caused by shiga - like toxin - producing escherichia coli ( stec ) , with pneumococcal - associated hus ( phus ) accounting for 5% of acquired cases .
up to 85% of patients require dialysis with a mortality rate of > 10% [ 1 , 2 ] .
streptococcus pneumoniae cleaves n - acetylneuraminic acid ( sialic acid ) and exposes the thomsen friedenreich antigen ( t - antigen ) on glomerular endothelial cell glycoproteins .
this process , known as t - activation , then leads to igm binding from circulating igm anti - t antibodies , and the clinical syndrome of hus ( figure 1 ) .
if necessary , transfusion of washed blood products is preferable to avoid increasing the levels of preformed anti - t antibodies , which are high in unwashed products .
anecdotal evidence supports the use of plasma exchange with 5% albumin replacement , and avoiding fresh frozen plasma ( ffp ) due to preformed anti - t antibodies in the pooled product [ 57 ] .
a 12-year - old female with steroid - resistant nephrotic syndrome presented to the emergency department with fever , shortness of breath and cough .
she was started on vancomycin and cefotaxime , and admitted to our pediatric intensive care unit for further management .
past medical history was remarkable for the diagnosis of nephrotic syndrome at the age of 5 years .
although initially responsive to steroids she suffered several relapses when the steroid dose was tapered . at the age of 6 years
genetic testing for inherited nephrotic syndromes identified a heterozygous , non - coding mutation in the transient receptor potential cation channel subfamily c member 6 ( trpc6 ) gene of unknown clinical significance .
after relapse and a failed attempt to induce full remission with oral steroids she was started on tacrolimus . over the next 3 years she had a partial clinical response , with improved edema but persistent proteinuria .
out of concern for missed focal segmental glomerular sclerosis ( fsgs ) and long - term calcineurin inhibitor nephrotoxicity , a repeat biopsy was performed .
due to drug - resistant nephrotic syndrome and biopsy findings suggesting possible drug injury she was started on a trial of adrenocorticotrophic hormone ( h.p .
acthar gel ; mallinckrodt pharmaceuticals , st louis , mo , usa ) twice weekly in addition to tacrolimus .
an initial blood culture grew out s. pneumoniae at 8 h , and a nasopharyngeal swab pcr was positive for parainfluenza type 2 . overnight the patient developed oliguria , the creatinine increased from 1.4 to 2.4 mg / dl , and the hemoglobin decreased from 11.4 to 7.4 g / dl ( table 1 ) .
she was transfused one unit of unwashed packed red blood cells ( prbcs ) and started on continuous veno - venous hemodiafiltration due to worsening kidney function and pulmonary edema .
table 1.pertinent laboratory datalaboratory testadmission ( day 1)after plex ( day 8)day 25referencehemoglobin ( g / dl)7.48.610.112.115.1hematocrit ( % ) 22.626.429.536.144.3platelet count ( 109/l)10081225140440lactate dehydrogenase ( u / l)294nana100250bilirubin ( mg / dl)0.10.9na00.4blood urea nitrogen ( mg / dl)3010509.018.0creatinine ( mg / dl)1.41.980.20.8fibrinogen ( mg / dl)737426na177401pt / aptt ( in seconds)19.4/48.621.1/43.9na1216.1/2340.6dctnanegativepositivenegativeadamst1372%70%smear ( schistocytes)positivenegativeadamst13 , a disintegrin and metalloproteinase with thrombospondin type 1 motif , member 13 ; dct , direct coombs test ; na , not available / not obtained ; plex , plasma exchange ; pt / aptt , prothrombin time / activated partial thromboplastin time .
pertinent laboratory data adamst13 , a disintegrin and metalloproteinase with thrombospondin type 1 motif , member 13 ; dct , direct coombs test ; na , not available / not obtained ; plex , plasma exchange ; pt / aptt , prothrombin time / activated partial thromboplastin time . on hospital
a computed tomography scan of the chest demonstrated bilateral patchy consolidation consistent with bronchopneumonia , and bilateral pleural effusions .
high - dose hydrocortisone was administered due to concern for adrenal suppression from chronic steroid / acthar administration .
the platelet count continued to decrease and her clinical condition worsened , requiring intravenous vasoactive support .
initially the presumed mechanism for her worsening clinical course was the development of thrombocytopenia - associated multiple organ failure ; therefore , ffp was used as the replacement fluid during the exchange .
the possibility of phus was raised shortly after initiation of plex and the lack of clinical response to replacement with ffp .
a direct coombs test was checked and came back negative ; however , a false negative could be explained by the removal of plasma antibodies from plex . indeed , a follow - up direct coombs test drawn after completion of plex was positive .
the platelet count reached a nadir of 36 on day 13 , after which it slowly improved without the need for transfusion . with supportive care , antibiotics and temporary kidney replacement therapy ( krt ) , the patient slowly recovered .
she was eventually discharged home on hospital day 39 , her creatinine having returned to the baseline level of 0.6 mg / dl .
an initial blood culture grew out s. pneumoniae at 8 h , and a nasopharyngeal swab pcr was positive for parainfluenza type 2 . overnight the patient developed oliguria , the creatinine increased from 1.4 to 2.4 mg / dl , and the hemoglobin decreased from 11.4 to 7.4 g / dl ( table 1 ) .
she was transfused one unit of unwashed packed red blood cells ( prbcs ) and started on continuous veno - venous hemodiafiltration due to worsening kidney function and pulmonary edema .
table 1.pertinent laboratory datalaboratory testadmission ( day 1)after plex ( day 8)day 25referencehemoglobin ( g / dl)7.48.610.112.115.1hematocrit ( % ) 22.626.429.536.144.3platelet count ( 109/l)10081225140440lactate dehydrogenase ( u / l)294nana100250bilirubin ( mg / dl)0.10.9na00.4blood urea nitrogen ( mg / dl)3010509.018.0creatinine ( mg / dl)1.41.980.20.8fibrinogen ( mg / dl)737426na177401pt / aptt ( in seconds)19.4/48.621.1/43.9na1216.1/2340.6dctnanegativepositivenegativeadamst1372%70%smear ( schistocytes)positivenegativeadamst13 , a disintegrin and metalloproteinase with thrombospondin type 1 motif , member 13 ; dct , direct coombs test ; na , not available / not obtained ; plex , plasma exchange ; pt / aptt , prothrombin time / activated partial thromboplastin time .
pertinent laboratory data adamst13 , a disintegrin and metalloproteinase with thrombospondin type 1 motif , member 13 ; dct , direct coombs test ; na , not available / not obtained ; plex , plasma exchange ; pt / aptt , prothrombin time / activated partial thromboplastin time . on hospital
a computed tomography scan of the chest demonstrated bilateral patchy consolidation consistent with bronchopneumonia , and bilateral pleural effusions .
high - dose hydrocortisone was administered due to concern for adrenal suppression from chronic steroid / acthar administration .
the platelet count continued to decrease and her clinical condition worsened , requiring intravenous vasoactive support .
initially the presumed mechanism for her worsening clinical course was the development of thrombocytopenia - associated multiple organ failure ; therefore , ffp was used as the replacement fluid during the exchange .
the possibility of phus was raised shortly after initiation of plex and the lack of clinical response to replacement with ffp .
a direct coombs test was checked and came back negative ; however , a false negative could be explained by the removal of plasma antibodies from plex .
indeed , a follow - up direct coombs test drawn after completion of plex was positive .
the platelet count reached a nadir of 36 on day 13 , after which it slowly improved without the need for transfusion . with supportive care , antibiotics and temporary kidney replacement therapy ( krt ) , the patient slowly recovered .
she was eventually discharged home on hospital day 39 , her creatinine having returned to the baseline level of 0.6 mg / dl .
diagnosis of phus is based on the association of the clinical triad of hus with confirmed or suspected s. pneumoniae infection .
evidence of t - antigen exposure ( direct coombs test , polyagglutination test or peanut lectin agglutination test ) can help support the diagnosis , but is not mandatory .
the patient met diagnostic criteria for phus , and additionally had a positive direct coombs test ( table 1 ) .
while disseminated intravascular coagulation ( dic ) with multiorgan failure was considered as an alternative diagnosis , it was eventually rejected due to evidence of autoimmune hemolysis ( schistocytes , positive coombs ) , and normal fibrinogen level .
initially the mildly prolonged prothrombin time / activated partial thromboplastin time ( pt / aptt ) hinted toward the possibility of dic , but coagulation abnormalities are common in phus , and dic is typically not considered without significant pt / aptt elongation along with decreased fibrinogen .
the median age of phus reported in the literature ranges from 13 to 24 months [ 1 , 13 , 14 ] .
two of these patients had undergone splenectomy , and so underlying immunodeficiency is presumably a risk factor for development of phus at an older age .
nephrotic syndrome is a well - known cause of secondary immunodeficiency due to multiple factors including edema , urinary loss of immunoglobulins and complement factors , and secondary effects of cytotoxic therapies [ 1921 ] .
streptococcus pneumoniae in particular is a major cause of sepsis and peritonitis in nephrotic syndrome , yet this is the first reported case of phus in a patient with nephrotic syndrome .
tacrolimus has a well - known association with hus , but does not typically cause a positive coombs test .
also , in a review of 16 cases of tacrolimus - induced hus , the average time from initiating tacrolimus to disease onset was 7.1 months , while our patient had been treated for over 3 years .
in addition to tacrolimus , our patient was started on acthar 2 months prior to presentation .
acthar gel is a repository corticotropin injection that was first approved by the fda in 1952 for a variety of autoimmune and inflammatory diseases , and is an approved treatment for nephrotic syndrome .
proposed mechanisms of action include increased endogenous steroidogenesis , immunomodulation via melanocortin receptor binding and podocyte protection .
adrenocorticotropic hormone ( acth ) therapy is tolerated by most patients , with adverse effects similar to those of glucocorticoid therapy ( weight gain , bone loss , cushingoid features ) .
although we do not suspect a pathogenic role of acth in the development of hus , and our patient had several risk factors for pneumococcal infection , it is worth noting this serious complication in the setting of acthar administration .
the clinical course of phus is typically more severe than diarrheal hus , with more frequent need for dialysis and transfusions , and longer hospital stays . in 2008 ,
copelovitch and kaplan reviewed all previous cases of phus reported in the english literature , and found a 12.3% mortality rate , with 10% progressing to end - stage renal disease , and 16% with chronic kidney disease and/or hypertension .
management of phus is primarily supportive , with prompt administration of antibiotics , transfusions and krt as needed .
ffp and unwashed prbcs should be avoided , due to the possibility of increased exposure to anti - t antigen igm antibodies .
plasma exchange with 5% albumin replacement fluid has been advocated for the treatment of phus due to the theoretical benefit of removing anti - t igm antibodies and bacterial neuraminidase .
guidelines rate the indication for plasma exchange as a category iii : optimum role of apheresis therapy is not established and care should be individualized .
further conclusions can not be reached without a randomized controlled trial or high - powered case series .
the advisory committee on immunization practices recommends that children aged 618 years with immunocompromising conditions ( including nephrotic syndrome ) receive both the 13-valent pneumococcal conjugate vaccine ( pcv13 ) and the 23-valent pneumococcal polysaccharide vaccine ( ppsv23 ) ( table 2 ) . the epidemiology of invasive pneumococcal disease , and phus in particular , has been altered dramatically with the introduction of pneumococcal vaccines .
most notably , rates of invasive pneumococcal disease have plummeted in children younger than 5 years , and non - vaccine serotypes have risen in prevalence .
the patient received pcv7 vaccination from her primary pediatrician , but did not receive subsequent pcv13 or ppsv23 .
results of serotyping for this case are still pending , but the possibility that the infection was caused by a vaccine - preventable serotype underscores the importance of ensuring vaccine understanding among both community and specialist pediatricians .
table 2.pneumococcal immunization recommendations in nephrotic syndromeacip recommendations for pcv13 and ppsv23 administration in children aged 618 years old with immunocompromising conditions ( including nephrotic syndrome)pcv13ppsv23ppsv23patients who have not previously received ppsv231 dose1st dose 8 weeks after pcv13 dose2nd dose 5 years after 1st ppsv23 dosepatients who have previously received ppsv231 dose 8 weeks after last ppsv23 dosen / a already received 1st dose5 years after 1st ppsv23 doseacip , advisory committee on immunization practices ; pcv13 , 13-valent pneumococcal conjugate vaccine ; ppsv23 , 23-valent pneumococcal polysaccharide vaccine .
pneumococcal immunization recommendations in nephrotic syndrome acip , advisory committee on immunization practices ; pcv13 , 13-valent pneumococcal conjugate vaccine ; ppsv23 , 23-valent pneumococcal polysaccharide vaccine .
this case highlights the diagnostic challenges that phus presents , and the importance of early recognition .
management often requires intensive supportive care with dialysis , transfusion with washed blood products and consideration of plex with 5% albumin .
this case also highlights the need to consider phus in older patients with immunocompromising conditions such as nephrotic syndrome that increase the risk of invasive pneumococcal infection
. finally , proper vaccination practices are important to help prevent pneumococcal disease and its associated sequelae .
Output:
| pneumococcal - associated hemolytic uremic syndrome ( phus ) is a rare but severe complication of invasive streptococcus pneumoniae infection .
we report the case of a 12-year - old female with steroid - resistant nephrotic syndrome treated with adrenocorticotrophic hormone ( h.p .
acthar gel ) , who developed pneumococcal pneumonia and subsequent phus .
while nephrotic syndrome is a well - known risk factor for invasive pneumococcal disease , this is the first reported case of phus in an adolescent patient with nephrotic syndrome , and reveals novel challenges in the diagnosis , treatment and potential prevention of this complication . |
PubmedSumm6883 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: low back pain is a common disorder affecting 80% of people in their lives and one of the most common reasons to visit primary care physicians.1 - 3 ) it is often described as localized pain in the iliac crest area in patients with chronic back pain.4 ) it has been reported that 15% to 25% of pain in patients with pain in the posterior iliac crest area results from injury of the posterior ramus of the t12 thoracic nerve due to fracture or degenerative changes and this pain is often confused with back pain originating in the sacral region.5 ) we describe the case of a patient with low back pain and pain around the right gluteal area , refractory to vertebroplasty and autogenous bone grafting , which was improved via management of thoracolumbar junction syndrome .
a 42-year - old korean woman with low back pain , general weakness , loss of appetite , and indigestion for 3 months presented to the department of family medicine , dongsan medical center , daegu , korea via the outpatient clinic for evaluation and conservative management .
the patient has been followed up on for hypertension , dyslipidemia , and osteogenesis imperfecta for 8 years .
the patient had been treated with monthly intravenous administration of pamidronate 15 mg for osteoporosis since the dual - energy x - ray absorptiometry had demonstrated a t score of -2.93 8 years ago , but there was no improvement in bone mass density .
the patient has had percutaneous vertebroplasty for a t11 compression fracture 6 years ago , but her low back pain has continued .
the patient had presented to the orthopedic outpatient clinic with aggravation of low back pain 4 years ago , in which she was diagnosed with osteogenesis imperfecta and had an magnetic resonance imaging ( mri ) demonstrating a t11 compression fracture with thoracolumbar kyphotic deformity .
one year ago , the patient had kyphosis correction with autogenous bone grafting for continued low back pain and 30 degrees kyphosis .
a relief in symptoms was reported for some time thereafter , but her symptoms worsened for the past 3 months , requiring conservative treatment including pain medication and physical therapy .
the patient has been taking angiotensin receptor blockers and statins daily for 4 years for hypertension and hyperlipidemia with intermittent use of zolpidem for insomnia .
her daughter and son were diagnosed with osteogenesis imperfecta as well and have been followed up at pediatrics .
thoracic mri demonstrated no significant changes other than improvement in kyphosis at the t10 - 11 level from the previous surgery .
the patient 's general weakness , depressed mood , insomnia and decreased appetite have been improving with the management of major depressive disorder which includes emotional support and medical management using mirtazapine 15 mg daily .
however , the patient was complaining of aggravated pain on the left posterior iliac crest area , rating it as an 8/10 on the visual analogue scale ( vas ) . on physical examination , she exhibited local hyperesthesia and tenderness on the skin over the left posterior iliac crest compared to the right side when a fold of the skin and subcutaneous tissue was taken and rolled .
tenderness upon palpation of spinous processes and the facet joint of the thoracolumbar junction was also observed .
based on these typical findings of physical examination of the posterior iliac crest and nonspecific findings of imaging studies , the patient was diagnosed with thoracolumbar junction syndrome .
the patient could not benefit from facet joint injection which was tried in cooperation with the pain clinic at our facility on the 4th day of admission .
the continuation and severity of the symptoms prompted the decision to proceed with epidural nerve block using triamcinolone and 0.5% mepivacaine .
the patient reported an improvement in pain , reporting a 4.5/10 on the vas . on the 8th day of admission ,
a lumbar sympathetic nerve block was performed with 0.5% mepivacaine upon patient 's complaining of increased pain to 5.5/10 on the vas .
the patient 's gastrointestinal symptoms including bloating and lower abdominal pain , also improved after epidural block , suggesting that the symptoms were also functional disabilities accompanied by throcolumbar junction syndrome .
the patient was discharged on the 11th day of admission with improved clinical symptoms and instructed to follow - up via the outpatient clinic .
this case report describes a 42-year - old female who experienced aggravation of pre - existing low back pain without recent changes in imaging studies , and the diagnostic approach and treatment she received .
low back pain is a common musculoskeletal condition with annual prevalence of 15% to 20% which improves without treatment in most cases .
however , once it continues , it can affect the activities of daily living and deteriorate quality of life.6 ) back pain has many causes including lumbar instability , herniated disc , degenerative disc disease , inflammation , tumor , trauma , osteoporosis , etc.7 ) in order to differentiate the various causes of low back pain , imaging studies and tests for metabolic disease may be required .
plain radiographs on the pelvis and thoracolumbar spine should be performed in case of acute trauma or in order to determine the status of the spine . computed tomography or mri
can be useful for spinal stenosis or disc diseases.8 ) however , we should keep in mind that the symptoms and radiological findings do not always match .
most of the conditions causing low back pain may not demonstrate specific findings on imaging studies and the findings suggestive of degenerative changes can be seen even in asymptomatic patients.9 ) physical examination is more important than other tests,10 ) and this case is a good example showing that clinical examination may be very important when evaluating patients with chronic low back pain .
maigne11,12 ) described thoracolumbar junction syndrome as a condition with typical pain on the iliac crest and tenderness on palpation of the thoracolumbar junction , and it is accompanied by lesions in the spine in about 60% of patients . in most cases ,
symptoms generally appear when there are lesions in t12-l1 , which is the thoracolumbar junction .
in addition , it may appear when there are functional abnormalities or lesions in t11 - 12 or l1 - 2 .
the posterior ramus supplies subcutaneous tissue of the upper buttocks and lower waste , the anterior ramus supplies the lower abdomen and groin , and the lateral cutaneous branch supplies the trochanter .
therefore , patients may complain of pseudo - visceral pain in the lower abdomen , pseudo - sciatica , pubic tenderness , and irritable bowel symptoms besides low back pain , which can lead to misdiagnosis.11 ) when examining the thoracolumbar junction , one must always look carefully for tender points upon palpation of spinous processes and facet joints .
looking for the presence of a posterior iliac crestal point tenderness and performing a positive pinch - roll test can also be beneficial.13 ) thoracolumbar junction syndrome is particularly responsive to spinal manipulative therapy,13 ) and no further treatment is required in most cases as long as it is performed adequately .
however , indications and contraindications should be considered based on proper assessment of the spine .
spinal manipulative therapy is contraindicated when the condition is combined with severe osteoporosis and osteogenesis impefecta as in the patient of this case report . for those with contraindications for spinal manipulative therapy , steroid injection directly to the involved facet joint is beneficial.14,15 ) iliac crest pain usually responds to facet joint steroid injection , but in the case of refractory pain , local anesthesia and steroid injection directly to the iliac crest can be used as an alternative strategy.16 ) according to the reports of hwang et al.,17 ) marked relief in acute symptoms and a decrease in severity of chronic symptoms can be achieved by epidural nerve block .
however , there was only little relief in the iliac crest with epidural block in our case , which corresponds to choe 's study;18 ) and marked relief of symptoms was achieved with lumbar sympathetic ganglion block .
lumbar sympathetic nerve block has been widely used to diagnose and manage patients with sympathetically maintained pain , such as complex regional pain syndrome , failed back surgery syndrome , peripheral vascular diseases , and raynaud 's disease.19,20 ) to accomplish successful lumbar sympathetic ganglion block and achieve maximum effect with minimum side effects , it is important to inject the local anesthetic into the ganglion as close as possible .
lumbar sympathetic ganglion encompasses a wide variety of anatomical structures , mostly in l2 - 3 and l4 - 5 intervertebral discs.21 - 23 ) mizuno et al.24 ) reported on their rat model of lumbar nerve root ligation that the group with sympathetic ganglion block maintained a significant decrease in allodynia and hyperalgia thereafter .
we conclude that thorough history taking and physical examination accompanied by different therapeutic approaches are important in treating patients with low back pain in which there is no typical radiologic findings .
Output:
| thoracolumbar junction syndrome is characterized by referred pain which may originate at the thoracolumbar junction , which extends from 12th thoracic vertebra to 2nd lumbar vertebra , due to functional abnormalities .
clinical manifestations include back pain , pseudo - visceral pain and pseudo - pain on the posterior iliac crest , as well as irritable bowel symptoms . during clinical examination
, pain can be demonstrated by applying pressure on the facet joints or to the sides of the spinous processes .
radiological studies show only mild and insignificant degenerative changes in most cases .
we report a 42-year - old female patient with osteogenesis imperfecta who suffered from chronic low back pain . under the diagnosis of thoracolumbar junction syndrome ,
she was treated with an epidural block and a sympathetic nerve block , which improved her symptoms . |
PubmedSumm6884 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: over the last twenty years , important progress in molecular biology and recombinant technologies has led to new applications and areas of research in the field of protein nmr .
the ability to produce , by recombinant technologies , pure , highly concentrated , and isotopically labeled samples has allowed both solution and solidstate protein nmr to gain insight into the structural dynamics of many biomolecular systems with an atomic resolution . on the other hand ,
the very use of recombinant technology has led the field largely to neglect the importance of posttranslational modifications ( ptms ) , an indispensable step in the maturation of proteins towards their functional forms that regulate the activity , localization , stability , and physicochemical properties of proteins .
ptms have become especially relevant in the study of intrinsically disordered proteins ( idps ) , which are attracting considerable interest among the biomolecular nmr community .
indeed , idps are more susceptible to undergoing ptms than folded proteins.1 because of the inherent flexibility of these proteins , ptms will have an important impact on their activity , cellular localization , and interaction properties , by modulating their structural dynamics.2 , 3 , 4 , 5 , 6 , 7 , 8 for example , nterminal acetylation of synuclein9 increases the helical propensity of the nterminal segment7 and enhances the affinity of synuclein for calmodulin by a factor of 10.10 thus , neglecting the impact of ptms on the general properties of proteins will necessarily lead to an inaccurate description of their biochemical properties and ultimately of their physiological functions .
nmyristoylation is the covalent attachment , catalyzed by the enzyme nmyristoyl transferase ( nmt ) , of a 14carbon saturated fatty acid to the nterminal glycine residue through an amide bond ; in eukaryotic systems it usually occurs cotranslationally .
nmyristoylation is a very common ptm . by increasing the hydrophobicity of the modified protein ,
myristoylation is generally involved in membrane binding , targeting , and subcellular trafficking.11 as such , many myristoylated proteins are involved in important physiological processes such as signaling pathways , oncogenesis , or viral replication.12 myristoylation can also be used to tune the activity of a protein through the effect known as the myristoylelectrostatic switch .
this effect consists of a conformational change of the protein ( usually triggered by the binding of a ligand ) that will expose the myristoyl group , previously sequestered in a hydrophobic pocket.13 this mechanism is at the core of the function of proteins such as the adp ribosylation factor or recoverin .
finally , myristoylation appears to play an important role in apoptosis , because many proteolitic products of caspase 3 are myristoylated and subsequently up or downregulate apoptosis.14
myristoylation does not naturally occur in escherichia coli , the most commonly used organism for protein expression .
therefore , to obtain large amounts of isotopically labeled myristoylated proteins suitable for biomolecular nmr studies , two options are available .
the first one is in vitro myristoylation , which requires , additionally to the protein of interest , purified nmt , myristoylcoa ( the cosubstrate of nmt ) , and an additional purification step to separate the myristoylated protein from the byproducts .
an alternative approach is based on the coexpression of the nmt and the substrate protein by use of a bicistronic vector , in order to enable incell modification.15 however , liu et al .
reported that in minimal medium this procedure leads to mixtures of myristoylated and lauroylated forms of the recombinant protein.16 however , the factors leading to lauroylation remain unclear , and the degree of lauroylation seems to be highly variable and inconsistent .
indeed , other studies based on this myristoylation strategy ( both in rich and in minimal media ) did not report the formation of a lauroylated form.15 , 17 , 18
here we confirm the observation of liu et al . and demonstrate that myristoylated and lauroylated forms of the same protein exhibit significantly different lipidbinding properties , emphasizing the need to ensure the homogeneity of the attached fatty acid chains .
this strategy has been applied to the production of two myristoylated proteins : brain acid soluble protein 1 ( basp1 , also known as nap22 and cap23 ) and the first two domains of csrc : namely the unique and sh3 domains ( ush3 ) .
basp1 is a 25 kda intrinsically disordered protein highly abundant in the brain during development , involved in growth cone guidance and actin cytoskeleton organization19 and interacting with holocam specifically in its myristoylated form.20 csrc is the leading member of the src family of nonreceptor tyrosine kinases ( sfks ) , which are involved in many signaling pathways .
deregulation of these kinases , and in particular of csrc itself , affects cell migration , proliferation , and survival , all of which contributes to its oncogenic potential .
the nterminal ( sh4 ) region of csrc is cotranslationally myristoylated at the nterminal glycine unit .
sh4 is a basic peptide situated at the beginning of the unique domain of src , an intrinsically disordered domain not conserved among the src family .
myristoylated sh4 is responsible for csrc membrane anchoring , through concurrent hydrophobic and electrostatic interactions .
we expressed recombinantly myristoylated basp1 ( myrbasp1 ) by using the bicistrionic vector designed by glck et al.15 in order to measure the extent of myristoylation by mass spectrometry , we first performed the expression in minimal medium supplemented with unlabeled ( n ) ammonium chloride .
the lcms analysis revealed the presence of two species differing in mass by 27 da ( figure 1 ) , thus suggesting that both nmyristoylated and nlauroylated forms of basp1 ( differing in mass by 28 da ) had been produced , as reported previously in the case of arf1.16 nmr analysis of the putative ( later confirmed ) myristoylated basp reveals that the nterminal acylation leads to a disappearance of the h , n hsqc crosspeaks corresponding to the n terminus ( figures s1 and s2 in the supporting information ) , probably due to micelle formation .
b ) and c ) ms analysis of products corresponding to peaks 1 and 2 , respectively . further ms analysis of the two species by means of electron capture dissociation ( ecd ) and collisionally activated dissociation ( cad ) confirmed that the difference in mass is 28.03020.0035 da ( ch2ch2 , calcd mass 28.0313 da ) and is due to myristoylation and lauroylation at the n terminus of basp1 ( supporting information , data 1 ) . in order to explore the origin of the lauroylated form of basp1 ( laubasp1 ) , we measured the proportions of nmyristoylated and nlauroylated forms of basp1 in samples expressed under different conditions ( figure 2 ) . when expressed in rich medium ( lysogeny broth , lb ) , basp1
is only found in its nmyristoylated form ( figure 2 b ) . when expressed in minimal medium basp1
is found in both its nmyristoylated and nlauroylated forms , and the proportion of the nlauroylated form increases with the length of the expression time ( figure 2 a and c ) .
this suggests that under scarce conditions ( minimal medium and/or long expression times ) , myristoylcoa is converted into lauroylcoa through oxidation and then used by the nmt ( which is known to show weak discrimination between myristoylcoa and shorter acylcoa ) to acylate basp1 . expressing basp1 in the presence of lauric acid
only leads to the lauroylated form of basp1 both in rich and in minimal medium ( figure 2 d and e ) .
the same observations were made for ush3 ( with a different expression strain of e. coli ) , regardless of whether it is expressed in rich or minimal medium ( see below ) , thus suggesting that this problem is not specific to basp1 but is instead a general problem that occurs especially in minimal medium but can also be observed in rich medium .
esi spectra of human basp coexpressed with hnmt in a ) m9 overnight , supplemented with myristic acid ,
b ) lb for 4 h , supplemented with myristic acid , c ) m9 for 4 h , supplemented with myristic acid , d ) and e ) lb and m9 , respectively , supplemented with lauric acid ; red circles in ( a ) show calculated isotopic profiles for [ m+30 h ] ions of lauroylated and myristoylated protein . to test whether the biochemical properties of basp1 and ush3 are affected by the length of the nacyl chain , we performed surface plasmon resonance ( spr ) experiments with immobilized liposomes . because this method does not require isotopic labeling , we obtained fully myristoylated or lauroylated samples by expression in rich medium supplemented with the corresponding fatty acid ( lauric or myristic acid ) . in the case of basp1 ( figure 3
a ) , the binding to 1,2dimyristoylsnglycero3phosphocholine / lphosphatidylserine ( dmpc / ps ) liposomes of laubasp1 ( k
d=86 nm ) shows an affinity reduced by a factor of 10 relative to myrbasp1 ( k
d=7.9 nm ) .
additionally , the length of the acyl chain also seems to affect the dissociation behavior because myrbasp1 dissociates from the liposome more slowly than laubasp1 ( figure 3 a ) .
spr analysis of the binding properties of different acylated forms of basp and ush3 towards liposomes .
a ) realtime spr response showing binding of myrbasp and laubasp to surfaceimmobilized dmpc / ps ( 3:1 ) liposomes .
b ) realtime spr response showing binding of myrush3 and lauush3 to surfaceimmobilized dmpc / dmpg ( 2:1 ) liposomes ; the protein concentration was 20 m . in the case of myristoylated ush3 ( myrush3 ) , the difference is even more pronounced .
lauroylated ush3 ( lauush3 ) binding to dmpc / dmpg ( 2:1 ; dmpg=1,2dimyristoylsnglycero3phosphorac(1glycerol ) ) liposomes is four times weaker than for myrush3 ( figure 3 b ) .
dissociation of the lauroylated form from the liposomes is also faster than for the myristoylated form .
our spr results clearly show that the length of the nacyl chain influences biochemical properties . therefore the two species should be separated in order to obtain biochemically pure samples .
our spr results show that the lengths of the nacyl chains influence the properties of nacylated proteins .
therefore , it is necessary to obtain a pure nmyristoylated sample for the pursuit of subsequent biochemical and nmr studies . as described above , the lauroylated and myristoylated forms of basp1 can be easily separated by rphplc .
however , the use of organic solvent is not generally applicable to proteins containing folded domains , as in the case of ush3 . after protein expression , the soluble fraction of ush3 elutes from the sizeexclusion column in the form of three different peaks ( figure 4 a ) .
sdspage ( figure 4 b ) reveals that peak 1 contain both ush3 and nmt , whereas peak 2 only contain ush3 ( peak 3 contains a degraded form of the protein ) .
further ms analysis ( figure 4 c and d ) showed that in peak 1 ( which contains both ush3 and nmt ) ush3 is exclusively myristoylated whereas in peak 2 ush3 ( figure 4 e ) is only found in its unmodified and lauroylated forms .
hence , it appears that myrush3 copurifies with nmt whereas lauush3 remains free of nmt due to the lower affinity of the enzyme for the shorter acyl chain forms .
b ) sdspage analysis of pooled fractions of the peaks observed in ( a ) .
this copurification might be exploitable , because the purification of the complex could lead to a fully myristoylated sample .
however , we were not able to dissociate the complex fully , either by chromatographic methods ( such as ion exchange or hydrophobic separation ) or by the use of myristoylated coenzyme a as a competitor as suggested elsewhere.21 consequently , we applied and refined an alternative method originally proposed by ha et al.22 this exploits the strong affinity of the myristoylated protein towards membrane : a significant amount of myristoylated protein remains in the cell pellet upon centrifugation , whereas most of the nmt remains in the supernatant .
this procedure relies on the resuspension and resolubilization of the membranebound protein , with use of triton , before further purification .
this procedure leads to a mixture of lauroylated and myristoylated ush3 that can be separated by sizeexclusion chromatography .
as can been seen from the sizeexclusion profile ( figure 5 a , red curve ) , the first peak corresponds to lauush3 ( figure 5 b ) whereas the second corresponds to myrush3 ( figure 5 c ) .
intriguingly , when large amounts of lauush3 are produced ( figure 5 a , green curve ) , a third peak corresponding to a mixture of myr and lauush3 is observed ( figure 5 d ) .
when the expression conditions are optimized to minimize the production of lauush3 ( see below for a detailed explanation ) , pure myrush3 can easily be obtained ( figure 5 a , blue curve ) .
thus , in order to be able to prepare pure myristoylated protein efficiently , the expression protocols have to be optimized to minimize the presence of lauroylated forms before the purification .
in addition , size separation of the two acylated forms is a property of our particular system and might not occur for other proteins , thus emphasizing the necessity to use conditions that ensure the presence of pure myristoylated proteins .
red curve : in rosetta cells , in the presence of both myristic and palmitic acid ( 20 h , 20 c ) , two elution peaks are observed .
green curve : in t7 cells , in the presence only of myristic acid ( 20 h , 20 c ) , three elution peaks are observed .
blue curve : in t7 cells , in the presence of both myristic and palmitic acid ( 5 h , 28 c ) , one elution peak is observed .
b ) and c ) mass spectrometric analysis after separate pooling of the fractions corresponding to peaks 1 and 2 , respectively .
d ) rphplc analysis of peak 3 of the red curve in ( a ) after pooling of its fractions .
e ) and f ) rphplc and ms analysis of peak 2 of the blue curve after pooling of its fractions .
this hypothesis would explain the observation that lauroylation increases under conditions of limited availability of carbon sources ( minimal medium ) or after extended expression ( presumably associated with nutrient depletion ) .
thus , one of the strategies that we tested was the addition of palmitic acid .
nmt does not incorporate palmitoyl groups , but oxidation of palmitic acid would contribute to replenish the myristoylcoa pool .
table 1 summarizes the effects of different expression factors on the relative amounts of myrush3 and lauush3 obtained after the triton wash procedure , nickel column purification , and sizeexclusion chromatography .
the induction time appears to be the most important factor , because longer expression times lead to greater amounts of lauroylated form .
nevertheless , some factors such as the expression strain or the addition of palmitic acid to the growth medium also have a significant impact on the myristoylation level .
more specifically , expression in t7 cells yields lower lauroylation levels than expression in rosetta cells . in rich medium , ush3 is found as a mixture of myristoylated and lauroylated forms even after short induction times ( whereas under the same conditions basp1 was fully myristoylated ) .
however , adding palmitic acid to the growth medium leads to almost pure myristoylated ush3 . to sum up ,
the set of best conditions consists of a short induction time in the presence of both palmitic and myristic acid in the expression medium .
use of these conditions together with the triton wash purification procedure leads to pure and homogeneous naturalabundance myrush3 samples ( figure 5 a , blue curve , and e / f ) .
however , expression in minimal media , required in order to produce isotopically labeled proteins , did not provide pure myrush3 , presumably due to limited availability of carbon sources .
this limitation was overcome by using the marley method , which consists of generating cell mass in unlabeled rich media and subsequent transfer into labeled media just before induction.23 in that case we were able to obtain sufficient amounts of labeled proteins ( 95 % ) to enable nmr measurement .
finally , this protocol was also successfully used for the expression and purification of myrbasp1 , thus demonstrating the robustness of the method .
effects of expression conditions in lb medium on the relative amounts of myristoylated and lauroylated ush3 .
the relative amounts of myristoylated and lauroylated ush3 were determined by integrating the elution peaks from sizeexclusion chromatography performed on the mixtures obtained after the triton wash purification procedure . [ a ] at 28 c .
we expressed recombinantly myristoylated basp1 ( myrbasp1 ) by using the bicistrionic vector designed by glck et al.15 in order to measure the extent of myristoylation by mass spectrometry , we first performed the expression in minimal medium supplemented with unlabeled ( n ) ammonium chloride .
the lcms analysis revealed the presence of two species differing in mass by 27 da ( figure 1 ) , thus suggesting that both nmyristoylated and nlauroylated forms of basp1 ( differing in mass by 28 da ) had been produced , as reported previously in the case of arf1.16 nmr analysis of the putative ( later confirmed ) myristoylated basp reveals that the nterminal acylation leads to a disappearance of the h , n hsqc crosspeaks corresponding to the n terminus ( figures s1 and s2 in the supporting information ) , probably due to micelle formation .
b ) and c ) ms analysis of products corresponding to peaks 1 and 2 , respectively . further ms analysis of the two species by means of electron capture dissociation ( ecd ) and collisionally activated dissociation ( cad ) confirmed that the difference in mass is 28.03020.0035 da ( ch2ch2 , calcd mass 28.0313 da ) and is due to myristoylation and lauroylation at the n terminus of basp1 ( supporting information , data 1 ) . in order to explore the origin of the lauroylated form of basp1 ( laubasp1 ) , we measured the proportions of nmyristoylated and nlauroylated forms of basp1 in samples expressed under different conditions ( figure 2 ) . when expressed in rich medium ( lysogeny broth , lb ) , basp1
is only found in its nmyristoylated form ( figure 2 b ) . when expressed in minimal medium basp1
is found in both its nmyristoylated and nlauroylated forms , and the proportion of the nlauroylated form increases with the length of the expression time ( figure 2 a and c ) .
this suggests that under scarce conditions ( minimal medium and/or long expression times ) , myristoylcoa is converted into lauroylcoa through oxidation and then used by the nmt ( which is known to show weak discrimination between myristoylcoa and shorter acylcoa ) to acylate basp1 . expressing basp1 in the presence of lauric acid
only leads to the lauroylated form of basp1 both in rich and in minimal medium ( figure 2 d and e ) .
the same observations were made for ush3 ( with a different expression strain of e. coli ) , regardless of whether it is expressed in rich or minimal medium ( see below ) , thus suggesting that this problem is not specific to basp1 but is instead a general problem that occurs especially in minimal medium but can also be observed in rich medium .
esi spectra of human basp coexpressed with hnmt in a ) m9 overnight , supplemented with myristic acid ,
b ) lb for 4 h , supplemented with myristic acid , c ) m9 for 4 h , supplemented with myristic acid , d ) and e ) lb and m9 , respectively , supplemented with lauric acid ; red circles in ( a ) show calculated isotopic profiles for [ m+30 h ] ions of lauroylated and myristoylated protein .
to test whether the biochemical properties of basp1 and ush3 are affected by the length of the nacyl chain , we performed surface plasmon resonance ( spr ) experiments with immobilized liposomes .
because this method does not require isotopic labeling , we obtained fully myristoylated or lauroylated samples by expression in rich medium supplemented with the corresponding fatty acid ( lauric or myristic acid ) . in the case of basp1 ( figure 3 a ) , the binding to 1,2dimyristoylsnglycero3phosphocholine / lphosphatidylserine ( dmpc / ps ) liposomes of laubasp1 ( k
d=86 nm ) shows an affinity reduced by a factor of 10 relative to myrbasp1 ( k
d=7.9 nm ) .
additionally , the length of the acyl chain also seems to affect the dissociation behavior because myrbasp1 dissociates from the liposome more slowly than laubasp1 ( figure 3 a ) .
spr analysis of the binding properties of different acylated forms of basp and ush3 towards liposomes .
a ) realtime spr response showing binding of myrbasp and laubasp to surfaceimmobilized dmpc / ps ( 3:1 ) liposomes .
b ) realtime spr response showing binding of myrush3 and lauush3 to surfaceimmobilized dmpc / dmpg ( 2:1 ) liposomes ; the protein concentration was 20 m . in the case of myristoylated ush3 ( myrush3 ) ,
lauroylated ush3 ( lauush3 ) binding to dmpc / dmpg ( 2:1 ; dmpg=1,2dimyristoylsnglycero3phosphorac(1glycerol ) ) liposomes is four times weaker than for myrush3 ( figure 3 b ) .
dissociation of the lauroylated form from the liposomes is also faster than for the myristoylated form .
our spr results clearly show that the length of the nacyl chain influences biochemical properties . therefore the two species should be separated in order to obtain biochemically pure samples .
our spr results show that the lengths of the nacyl chains influence the properties of nacylated proteins .
therefore , it is necessary to obtain a pure nmyristoylated sample for the pursuit of subsequent biochemical and nmr studies . as described above , the lauroylated and myristoylated forms of basp1 can be easily separated by rphplc . however , the use of organic solvent is not generally applicable to proteins containing folded domains , as in the case of ush3 . after protein expression , the soluble fraction of ush3 elutes from the sizeexclusion column in the form of three different peaks ( figure 4 a ) .
sdspage ( figure 4 b ) reveals that peak 1 contain both ush3 and nmt , whereas peak 2 only contain ush3 ( peak 3 contains a degraded form of the protein ) .
further ms analysis ( figure 4 c and d ) showed that in peak 1 ( which contains both ush3 and nmt ) ush3 is exclusively myristoylated whereas in peak 2 ush3 ( figure 4 e ) is only found in its unmodified and lauroylated forms .
hence , it appears that myrush3 copurifies with nmt whereas lauush3 remains free of nmt due to the lower affinity of the enzyme for the shorter acyl chain forms .
b ) sdspage analysis of pooled fractions of the peaks observed in ( a ) .
e ) ms analysis of the peaks 2 . this copurification might be exploitable , because the purification of the complex could lead to a fully myristoylated sample .
however , we were not able to dissociate the complex fully , either by chromatographic methods ( such as ion exchange or hydrophobic separation ) or by the use of myristoylated coenzyme a as a competitor as suggested elsewhere.21 consequently , we applied and refined an alternative method originally proposed by ha et al.22 this exploits the strong affinity of the myristoylated protein towards membrane : a significant amount of myristoylated protein remains in the cell pellet upon centrifugation , whereas most of the nmt remains in the supernatant .
this procedure relies on the resuspension and resolubilization of the membranebound protein , with use of triton , before further purification .
this procedure leads to a mixture of lauroylated and myristoylated ush3 that can be separated by sizeexclusion chromatography .
as can been seen from the sizeexclusion profile ( figure 5 a , red curve ) , the first peak corresponds to lauush3 ( figure 5 b ) whereas the second corresponds to myrush3 ( figure 5 c ) .
intriguingly , when large amounts of lauush3 are produced ( figure 5 a , green curve ) , a third peak corresponding to a mixture of myr and lauush3 is observed ( figure 5 d ) .
when the expression conditions are optimized to minimize the production of lauush3 ( see below for a detailed explanation ) , pure myrush3 can easily be obtained ( figure 5 a , blue curve ) .
thus , in order to be able to prepare pure myristoylated protein efficiently , the expression protocols have to be optimized to minimize the presence of lauroylated forms before the purification .
in addition , size separation of the two acylated forms is a property of our particular system and might not occur for other proteins , thus emphasizing the necessity to use conditions that ensure the presence of pure myristoylated proteins .
a ) sizeexclusion chromatography profiles of acylated ush3 expressed under different conditions .
red curve : in rosetta cells , in the presence of both myristic and palmitic acid ( 20 h , 20 c ) , two elution peaks are observed .
green curve : in t7 cells , in the presence only of myristic acid ( 20 h , 20 c ) , three elution peaks are observed .
blue curve : in t7 cells , in the presence of both myristic and palmitic acid ( 5 h , 28 c ) , one elution peak is observed .
b ) and c ) mass spectrometric analysis after separate pooling of the fractions corresponding to peaks 1 and 2 , respectively .
d ) rphplc analysis of peak 3 of the red curve in ( a ) after pooling of its fractions .
e ) and f ) rphplc and ms analysis of peak 2 of the blue curve after pooling of its fractions .
this hypothesis would explain the observation that lauroylation increases under conditions of limited availability of carbon sources ( minimal medium ) or after extended expression ( presumably associated with nutrient depletion ) .
thus , one of the strategies that we tested was the addition of palmitic acid .
nmt does not incorporate palmitoyl groups , but oxidation of palmitic acid would contribute to replenish the myristoylcoa pool .
table 1 summarizes the effects of different expression factors on the relative amounts of myrush3 and lauush3 obtained after the triton wash procedure , nickel column purification , and sizeexclusion chromatography .
the induction time appears to be the most important factor , because longer expression times lead to greater amounts of lauroylated form .
nevertheless , some factors such as the expression strain or the addition of palmitic acid to the growth medium also have a significant impact on the myristoylation level .
more specifically , expression in t7 cells yields lower lauroylation levels than expression in rosetta cells . in rich medium , ush3 is found as a mixture of myristoylated and lauroylated forms even after short induction times ( whereas under the same conditions basp1 was fully myristoylated ) .
however , adding palmitic acid to the growth medium leads to almost pure myristoylated ush3 . to sum up ,
the set of best conditions consists of a short induction time in the presence of both palmitic and myristic acid in the expression medium .
use of these conditions together with the triton wash purification procedure leads to pure and homogeneous naturalabundance myrush3 samples ( figure 5 a , blue curve , and e / f ) .
however , expression in minimal media , required in order to produce isotopically labeled proteins , did not provide pure myrush3 , presumably due to limited availability of carbon sources .
this limitation was overcome by using the marley method , which consists of generating cell mass in unlabeled rich media and subsequent transfer into labeled media just before induction.23 in that case we were able to obtain sufficient amounts of labeled proteins ( 95 % ) to enable nmr measurement .
finally , this protocol was also successfully used for the expression and purification of myrbasp1 , thus demonstrating the robustness of the method .
effects of expression conditions in lb medium on the relative amounts of myristoylated and lauroylated ush3 .
the relative amounts of myristoylated and lauroylated ush3 were determined by integrating the elution peaks from sizeexclusion chromatography performed on the mixtures obtained after the triton wash purification procedure . [ a ] at 28 c .
coexpression of yeast nmt with the protein of interest in e. coli provides an efficient method but is complicated by the simultaneous formation of lauroylated and myristoylated proteins . although they are chemically similar , spr experiments showed that the variation in chain length greatly alters the lipidbinding properties .
therefore , a suitable method to obtain purely myristoylated proteins in e. coli needs to be developed .
we suggest here that the addition of the shorter acyl chain appears to be due to the conjunction of two factors : 1 ) the availability of a shorter acylcoa generated through oxidation of the myristic acid that needs to be supplemented to the growth medium , and 2 ) the poor discrimination of the human nmt for the shorter acylcoa.24 on the basis of this hypothesis , we have shown that addition of palmitic acid , which is not incorporated into the protein by nmt but can resupply the myrcoa pool , contributes , under some conditions , to minimize the formation of the lauroylated form . the capacity to isolate lauroylated and myristoylated proteins from mixtures of
the two is dependent upon the physiochemical properties of the proteins of interest . in the case of a fully disordered protein ( basp1 ) , the two forms can be separated by rphplc thanks to their different hydrophobicities . in the case of a partially or fully folded protein ( ush3 ) , we had to develop a more sophisticated procedure based on 1 ) optimization of the expression conditions to minimize the formation of lauush3 , 2 ) use of the triton wash purification protocol to obtain nmtfree myristoylated protein with a low proportion of the lauroylated form , and 3 ) final purification by affinity and sizeexclusion chromatography .
interestingly , although both proteins have acyl moieties attached to a disordered segment , their biochemical properties seem to be affected in different ways by the length of the acyl chain .
a second binding event is usually required.11 examples include electrostatic interactions , a second aliphatic anchor , or additional contacts with amphipathic regions of the peptide backbone .
clearly , the myristoyl chain plays a stronger role in lipid binding by ush3 than by basp1
. this might be due to the proximity of the charged residues and the acyl chain in ush3 , coupling the strength of the electrostatic interaction with the insertion of the acyl chain in the lipid bilayer , or might be the result of an indirect effect caused by modulation of the sh4 and sh3 interactions by the presence of distinct fatty acid chains attached to the sh4 domain.25
thus , if pure lauroylated and myristoylated forms of the same protein can be obtained independently or separated from mixtures , the comparison of their lipidbinding properties provides additional insight into the processes involved in fattyacidmediated lipid interactions .
to summarize , we provide evidence as to why the production of myristoylated proteins in e. coli by coexpressing nmt results in a heterogeneously nacylated sample .
we have demonstrated that the different nacylated forms have different biochemical properties and we have developed an expression / purification protocol to generate a homogeneously nmyristoylated sample .
we expect these observations to be especially relevant for the conduct of nmr studies in which the homogeneity of the sample is essential .
protein expression and purification of myristoylated basp1 : expression was achieved with e. coli strain t7 express ( new england biolabs ) and the bicistronic vector petduet16his_hnmt_hbasp1_6his as already described.15 expression of basp1 for the analysis of the protein by mass spectrometry was done either in rich medium ( lb medium ) or in m9 minimal medium with unlabeled ( n ) ammonium chloride ( 1 g l ) and ( c ) glucose ( 4 g l ) . in order to produce myristoylated protein , myristic acid was added to the growth medium at a final concentration of 50 m 10 min before induction .
fresh myristic acid stock solution was prepared as described elsewhere.15 the cells were grown at 37 c to an od600 of 0.8 and induced by adding isopropyl dthiogalactopyranoside ( iptg , 0.8 mm ) .
the cells were pelleted by centrifugation at 2862 g at 4 c for 20 min .
the pellet was resuspended in lysis buffer ( pbs ) with protease inhibitors ( complete , mini protease inhibitor tablets , edtafree , roche ) and sonicated on ice with a branson w450 d sonifier with a microtip ( 3 min , 50 % amplitude ) before centrifugation at 36 223 g for 20 min at 4 c .
the supernatant was applied to a niloaded histrap hp column ( 5 ml , ge healthcare ) that was preequilibrated with pbs .
the column was washed with pbs and highsalt pbs [ nacl ( 1.5 m ) , imidazole ( 20 mm ) ] and five column volumes of pbs before elution with a linear gradient of pbs / pbs with imidazole ( 0.5 m ) .
fticr mass spectrometry : protein samples were desalted with vivaspin 500 centrifugal concentrators ( sartorius , germany , pes membrane , mwco 5000 ) as described previously26 briefly , a protein solution ( 10 m , 500 l ) was concentrated to 100 l , and an aqueous ammonium acetate solution ( 100 mm , 400 l ) was added .
the process was repeated five times , followed by six cycles of concentration and dilution with h2o . for esi ( flow rate 1.5 l min ) ,
desalted protein was diluted to 2 m in h2o / ch3oh 1:1 with acetic acid ( 1 % vol ) as additive .
h2o was purified to 18 mcm at room temperature with a milliq system ( millipore , austria ) ; ch3oh ( acros , austria ) was hplcgrade .
experiments were performed with a 7 tesla fourier transform ion cyclotron resonance ( fticr ) mass spectrometer equipped with an electrospray ionization source , a collision cell for cad , and a hollow dispenser cathode for ecd .
myristoylated ush3 expression : ush3 expression was performed in e. coli rosetta ( de3)plyss cells ( novagen ) or t7 express ( new england biolabs ) cells and using the bicistronic vector petduet16his_hnmt_ush3_6his .
the cells were grown at 37 c to an od600 of 0.8 , and 10 min before induction with iptg ( final concentration 1 mm , melford ) , freshly prepared myristic and/or palmitic acid ( sigma ) were added to the cell culture , at a final concentration of 200 m . for the expression of
was used:23 cells were first grown in lb to an od600 of 0.4 and were then centrifuged at 1000 g and 4 c for 20 min .
the pellet was resuspended in half the volume of minimal medium containing ammonium chloride and glucose . after 20 min at 37 c , myristic and palmitic
the expression temperature was either 28 c ( for 5 h ) or 20 c ( for 20 h ) .
the cells were pelleted by centrifugation at 3993 g at 4 c for 30 min .
the pellet was resuspended in lysis buffer [ trishcl ( 20 mm ) , nacl ( 300 mm ) , imidazole ( 5 mm ) , ph 8 ] , to which protease inhibitors ( protein inhibitor cocktail and phenylmethanesulfonyl fluoride ( pmsf ) ; 1 mm ) , both from sigma ) were added .
myrush3 purification : the resuspended pellet was sonicated on ice before centrifugation at 25 000 rpm for 45 min at 4 c .
the protein appeared to be distributed between the supernatant and the pellet , so two different purification methods were used . for the soluble fraction ,
the supernatant was applied to a ninta column ( qiagen ) followed by sizeexclusion chromatography in a superdex 75 column in sodium phosphate buffer ( na3po4 ) [ nap ( 50 mm ) , nacl ( 150 mm ) , edta ( 0.2 mm ) , ph 7.5 ] . for the insoluble fraction ,
the pellet was resuspended in lysis buffer containing triton x100 ( 1 % ) .
the resuspended pellet was centrifuged again for 30 min at 75 600 g , and the procedure was repeated twice or three times .
the supernatant from the triton washes was purified by immobilized metal affinity chromatography as described above .
if lauroylated species were present , they eluted from the sizeexclusion chromatographic column at an apparent higher molecular weight than the myristoylated ones .
this method enabled the two different acylated species to be separated and their respective amounts quantified .
a comparison of various expression and purification protocols is presented in the results section .
lcms : the purities and identities of the products were established by uplc coupled to ms [ acquity chromatograph with a biosuite pphenyl column ( 1000rpc 2.075 mm ) ] coupled to a lctpremier spectrometer ( waters corporation ) .
liposome preparation : dmpc , dmpg , and ps were purchased from avanti polar lipids , inc .
the lipids were dissolved in chloroform or , in the case of dmpg , in chloroform / methanol / h2o ( 65:35:8 ) .
the solvent was removed in a rotary evaporator , followed by rehydration and vortexing at 40 c with the buffer used for spr analysis , with a final lipid concentration of 1 mm .
the different liposomes were prepared with a dmpc / dmpg ratio of 2:1 or a dmpc / ps ratio of 4:1 .
large unilamellar vesicles were mechanically extruded at 40 c by use of a thermobarrel extruder ( 10 ml thermobarrel extruder ; lipex northerns lipids inc .
burnaby , canada ) with at least ten cycles of extrusion and use of a polycarbonate filter ( 100 nm ) . to verify the appropriate size of the liposomes , the mean diameter was checked by dynamic light scattering ( zetasizer nanoseries s , malvern instruments )
.
surface plasmon resonance ( spr ) : spr experiments with basp1 were carried out with a biacore 2000 instrument ( biacore , ge healthcare ) and spr sensor chip ( l1 , biacore , ge healthcare ) .
liposomes were injected for 500 s at a flow rate of 5 l min .
the reference channel was coated with bsa by use of a 200 s injection of bsa ( 1 mg ml , sigma , fatty acid free ) at a flow rate of 10 l min .
the interaction of myrbasp1 or laubasp1 with liposomes was followed by observing the spr response when a solution of protein was injected for 100 s ( association phase ) , followed by a 300 s washing period ( dissociation phase ) .
myrbasp1 binding to dmpc / ps liposomes was monitored by injections at concentrations ranging from 10 nm to 2.5 m .
laubasp1 binding to dmpc / ps liposomes was monitored by injections at concentrations ranging from 20 nm to 7.5 m .
all experiments were performed in the running buffer , which consisted of na3po4 ( 20 mm ) , nacl ( 50 mm ) , ph 7.4 .
the surface was regenerated with a series of chaps ( 20 mm)/hcl ( 10 mm)/chaps ( 20 mm ) pulses , each pulse for 30 s at 100 l min .
liposome coating was reproducible , with a variation smaller than 4 % between subsequent coatings , ensuring very reproducible protein binding curves .
spr experiments with myrush3 were performed in a very similar fashion , with slight modifications .
the spr chip ( a 2d carboxymethyldextran surface ) was purchased from xantec and modified by covalent attachment of phytosphingosine ( tebubio ) to allow the capture of dmpc : dmpg ( 2:1 ) liposomes .
liposomes were injected at 10 l min for 200 s before the protein binding experiment : myrush3 or lauush3 was injected at 50 l min for 60 s , and dissociation was allowed for 300 s. the running buffer was composed of na3po4 ( 50 mm ) , nacl ( 150 mm ) , edta ( 0.2 mm , ph 7.5 ) .
liposome coating was reproducible , with a variation of about 1 % between the subsequent coatings , ensuring very reproducible protein binding curves .
as a service to our authors and readers , this journal provides supporting information supplied by the authors .
such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset .
technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .
Output:
| abstractincorporation of myristic acid onto the n terminus of a protein is a crucial modification that promotes membrane binding and correct localization of important components of signaling pathways .
recombinant expression of nmyristoylated proteins in escherichia coli can be achieved by coexpressing yeast nmyristoyltransferase and supplementing the growth medium with myristic acid .
however , undesired incorporation of the 12carbon fatty acid lauric acid can also occur ( leading to heterogeneous samples ) , especially when the available carbon sources are scarce , as it is the case in minimal medium for the expression of isotopically enriched samples . by applying this method to the brain acid soluble protein 1 and the 1185 nterminal region of csrc , we show the significant , and proteinspecific , differences in the membrane binding properties of lauroylated and myristoylated forms .
we also present a robust strategy for obtaining laurylfree samples of myristoylated proteins in both rich and minimal media . |
PubmedSumm6885 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a major change associated with human aging is a progressive decline in skeletal muscle mass ( smm ) , which is a downward spiral that may lead to decreased strength and function .
age - related decline in physical fitness is related to many problems in the elderly population . according to previous epidemiological studies on the elderly ,
physical performance may be related to maintenance of physical fitness , improvement of life motivation , quality of life ( qol ) , and nutrition.14 sterberg et al suggested that a lack of occlusal support was related to general physical muscle weakness.5 this study was based on three 70-year - old cohorts ( n=1,380 ) .
furthermore , yamaga et al reported that dental occlusion is associated with dynamic strength of the lower extremities , agility , and balance in the elderly.6 this sample consisted of 591 individuals aged 70 years and 158 aged 80 years selected from the registry of residents in niigata city , japan .
, walking speed is very important in qol ; however , there have been no reports on the relationship between walking speed and oral condition .
sarcopenia is a syndrome characterized by progressive and generalized loss of smm and strength , with a risk of adverse outcomes such as physical disability , poor qol , and death.7,8 the european working group on sarcopenia in older people ( ewgsop ) recommends using the presence of both low muscle mass and muscle function ( strength or performance ) for the diagnosis of sarcopenia .
the age - dependent loss of smm begins at ~40 years of age and becomes prominent after 50 years of age in japanese adults.9 some studies have suggested that an exercise habit in middle - aged people was a protective factor against sarcopenia in older age and is effective for maintaining muscle strength and physical performance in older age.10,11 from the national dental survey , the prevalence of periodontitis in those aged 4045 and 5559 years was 25.6% and 47.0% , respectively.12 decline in the number of teeth and the muscle mass and its function begins from 40 years of age ; however , several epidemiological studies have identified relationships between oral conditions and physical performance parameters in community - dwelling older adults .
however , few reports have studied the relationship between the number of teeth and the muscle mass and its function related to diagnosis of sarcopenia after the age of 40 years .
therefore , the aim of this study was to validate the relationship between muscle mass and its function ( timed 10 m walk test , hand grip strength , and smm of the whole body ) and oral function ( the number of teeth and dental occlusion ) after 40 years of age in a community - dwelling population in japan after adjusting for explanatory variables such as age , body mass index ( bmi ) , diabetes , hypertension , cardiovascular disease , stroke , serum albumin concentration ( g / dl ) , smoking status , habitual alcohol intake , marital status , level of education , and exercise habits .
the subjects comprised of 607 volunteers ( 222 males and 385 females , all 40 years ) who participated in the iwaki health promotion project in 2013 .
exclusion criteria for our study were medical history of cancer , stroke , and ischemic heart disease .
subjects with incomplete data were excluded from the study . eventually , 552 participants ( 198 males and 354 females ) were included in our study .
this study was approved by the ethics committee of hirosaki university school of medicine , and all subjects had provided written informed consent before participating in the study .
the demographic data ( age , sex , education level , and marital status ) , lifestyle ( smoking and drinking ) , and medical history were obtained from self - report questionnaires and interviews . for exercise habit ,
the participants were instructed to choose from the following five items : none , 1 day / week , 23 days / week , 45 days / week , 6 days / week , or every day .
the height and weight of the subjects were measured , and their bmi was calculated using the following equation : bmi ( kg / m ) = weight ( kg)/(height [ m ] height [ m ] ) . in previous studies ,
serum albumin concentration ( g / dl ) was considered for confounding factor because it represents nourishment.2,6 nonfasting blood samples were obtained , and plasma concentrations of albumin were measured using standard assay procedures in conjunction with a completely automated system ( srl ltd . ,
dental examinations were conducted by trained and experienced dentists under artificial lighting , with both the dentist and the subject in seated position .
the teeth present were defined as healthy , carious , or treated . according to the records of dental examinations ,
the subjects were divided into three classes based on the eichner index , which was used as an indicator of occlusal condition.13 the eichner index is based on existing natural tooth contact between the maxilla and the mandible in the bilateral premolar and molar regions ( presence of tooth contact was defined as the presence of a natural tooth on the maxilla and corresponding mandible , including wisdom teeth , but excluding the remaining roots or root caps ) .
class b represents the contact in one to three zones or in the frontal region only .
each subject was instructed to walk at a comfortable , normal pace for 16 m measured.14 however , only the 10 m in between were timed using a stopwatch to eliminate the effects of acceleration and deceleration.15,16 the starting and stopping of the performance time coincided with the toes of the leading foot crossing the 3 and 13 m mark , respectively .
maximum hand grip strength was measured in both the dominant and nondominant hands using a digital dynamometer ( tkk5401 grip - d ; takei scientific instruments company limited , niigata , japan ) .
measurements of the smm of the whole body ( kg ) were obtained from the bioelectrical impedance analysis of each participant using a tanita mc-190em body composition analyzer ( tanita corporation , tokyo , japan ) , which uses an eight - point tactile electrode impedance meter .
participants were instructed to stand upright on the electrodes and grasp the handles of the analyzer , and then to slightly abduct their arms and remain still during the measurement . the participant s smm ( kg )
was computed through proprietary algorithms and was displayed on the analyzer s control panel and recorded .
the body weight ( kg ) of the participants was automatically determined when they stood on the electrodes of the scale platform .
multiple linear regression analyses were performed with the measures of muscle mass and its function as objective variables and the measures of the number of teeth , age , bmi , diabetic and hypertensive readings , serum albumin concentration ( g / dl ) , smoking status , habitual alcohol intake , marital status ( living vs not living with a spouse ) , level of education , and exercising habits as explanatory variables .
the relationship between the eichner index and the muscle mass and its function was analyzed using analysis of covariance , after adjusting for explanatory variables .
spss for windows ( v22 ; ibm corporation , armonk , ny , usa ) was applied for the statistical analysis .
the subjects comprised of 607 volunteers ( 222 males and 385 females , all 40 years ) who participated in the iwaki health promotion project in 2013 .
exclusion criteria for our study were medical history of cancer , stroke , and ischemic heart disease .
subjects with incomplete data were excluded from the study . eventually , 552 participants ( 198 males and 354 females ) were included in our study .
this study was approved by the ethics committee of hirosaki university school of medicine , and all subjects had provided written informed consent before participating in the study .
the demographic data ( age , sex , education level , and marital status ) , lifestyle ( smoking and drinking ) , and medical history were obtained from self - report questionnaires and interviews . for exercise habit ,
the participants were instructed to choose from the following five items : none , 1 day / week , 23 days / week , 45 days / week , 6 days / week , or every day .
the height and weight of the subjects were measured , and their bmi was calculated using the following equation : bmi ( kg / m ) = weight ( kg)/(height [ m ] height [ m ] ) . in previous studies ,
serum albumin concentration ( g / dl ) was considered for confounding factor because it represents nourishment.2,6 nonfasting blood samples were obtained , and plasma concentrations of albumin were measured using standard assay procedures in conjunction with a completely automated system ( srl ltd . ,
dental examinations were conducted by trained and experienced dentists under artificial lighting , with both the dentist and the subject in seated position .
the teeth present were defined as healthy , carious , or treated . according to the records of dental examinations
, the subjects were divided into three classes based on the eichner index , which was used as an indicator of occlusal condition.13 the eichner index is based on existing natural tooth contact between the maxilla and the mandible in the bilateral premolar and molar regions ( presence of tooth contact was defined as the presence of a natural tooth on the maxilla and corresponding mandible , including wisdom teeth , but excluding the remaining roots or root caps ) .
class b represents the contact in one to three zones or in the frontal region only .
each subject was instructed to walk at a comfortable , normal pace for 16 m measured.14 however , only the 10 m in between were timed using a stopwatch to eliminate the effects of acceleration and deceleration.15,16 the starting and stopping of the performance time coincided with the toes of the leading foot crossing the 3 and 13 m mark , respectively .
maximum hand grip strength was measured in both the dominant and nondominant hands using a digital dynamometer ( tkk5401 grip - d ; takei scientific instruments company limited , niigata , japan ) .
measurements of the smm of the whole body ( kg ) were obtained from the bioelectrical impedance analysis of each participant using a tanita mc-190em body composition analyzer ( tanita corporation , tokyo , japan ) , which uses an eight - point tactile electrode impedance meter .
participants were instructed to stand upright on the electrodes and grasp the handles of the analyzer , and then to slightly abduct their arms and remain still during the measurement . the participant s smm ( kg ) was computed through proprietary algorithms and was displayed on the analyzer s control panel and recorded .
the body weight ( kg ) of the participants was automatically determined when they stood on the electrodes of the scale platform .
multiple linear regression analyses were performed with the measures of muscle mass and its function as objective variables and the measures of the number of teeth , age , bmi , diabetic and hypertensive readings , serum albumin concentration ( g / dl ) , smoking status , habitual alcohol intake , marital status ( living vs not living with a spouse ) , level of education , and exercising habits as explanatory variables .
the relationship between the eichner index and the muscle mass and its function was analyzed using analysis of covariance , after adjusting for explanatory variables .
spss for windows ( v22 ; ibm corporation , armonk , ny , usa ) was applied for the statistical analysis .
timed 10 m walk test , hand grip strength , smm , and bmi were greater in males compared with females .
diabetes mellitus , smoking status , habitual alcohol intake , and marital status were significantly different between males and females .
table 2 presents the results of the multiple linear regression analyses between the number of remaining teeth and the muscle mass and its functions . after adjusting for confounding factors ,
the number of teeth was shown to be an independent risk factor for the timed 10 m walk test ( in females ) and smm ( in males ) .
table 3 shows the results of the analysis of covariance with adjustment for confounding factors and reveals that the timed 10 m walk test was significantly correlated with the eichner index ( classes a and c in females were correlated ) .
timed 10 m walk test , hand grip strength , smm , and bmi were greater in males compared with females .
diabetes mellitus , smoking status , habitual alcohol intake , and marital status were significantly different between males and females .
table 2 presents the results of the multiple linear regression analyses between the number of remaining teeth and the muscle mass and its functions . after adjusting for confounding factors ,
the number of teeth was shown to be an independent risk factor for the timed 10 m walk test ( in females ) and smm ( in males ) .
table 3 shows the results of the analysis of covariance with adjustment for confounding factors and reveals that the timed 10 m walk test was significantly correlated with the eichner index ( classes a and c in females were correlated ) .
the present cross - sectional study investigated the occlusal condition and its correlation with physical condition and muscle mass in a community - dwelling japanese population .
because the participants in this study lived in the tohoku region , most of them were engaged in agriculture .
physical fitness of individuals in the rural area may be higher than that of individuals in the urban area . in females ,
the number of teeth present showed a negative correlation with the timed 10 m walk test , and the timed 10 m walk of females in class a was faster than those in class c. thus , decline in the number of teeth and occlusal support region may be the risk factors for lower speed in the timed 10 m walk test .
this mechanism can be explained by the decreased mastication due to the limited number of teeth , resulting in reduced stimulation of the nerve center through the periodontal membrane that caused a reduction in physical functions such as ambulatory speed .
kawakubo et al assessed the effect of teeth clenching on the force of hand grip and cortical activity during the occurrence of facilitatory effects using functional magnetic resonance imaging.17 they suggested that occlusal function may affect the function of remote muscles through cortical activation , which supported the findings listed previously in this study . in contrast , when ambulatory speed is slower , physical function and muscle mass may decrease , causing poor oral hygiene , resulting in loss of teeth .
lower muscle mass is considered to influence qol because it is associated with increased risk of mobility loss . according to the ewgsop
, buchner et al showed that small changes in physiological capacity may have substantial effects on physical performance in frail adults , while large changes in physiological capacity have little or no effect in healthy adults.18,19 some researchers have suggested that timed usual gait provides a predictive value for the onset of disability , severe mobility limitation , and mortality.20,21 another study reported that lifestyles of elderly persons with 20 remaining teeth tend to be more active than those with < 20 remaining teeth , which supports the findings of this study.22 considering the care of the elderly and frailty of daily life , timed usual gait is more important than muscular strength .
this study showed that the number of teeth and occlusal condition were related to the results of the timed 10 m walk test .
therefore , worsened mastication function may be a predictor of frailty or severe movement restrictions and even death .
in contrast to females , the number of teeth did not show significant correlations with the timed 10 m walk in males ( p=0.088 ) , whereas it showed positive correlation with total muscle mass .
poor mastication function caused by loss of teeth and limited occlusal support region influence the amount of food intake and its quality . in particular , in case of periodontal disease , chronic inflammation , producing inflammatory cytokines ,
results in loss of muscle mass throughout the body.2326 loss of muscle mass affects certain physical functions ( eg , brushing teeth and gargling ) that are associated with maintaining dental hygiene , which may worsen the periodontal diseases .
furthermore , a previous epidemiological study reported that in persons aged 4079 years , the total smm decreased by 10.8% in males and 6.4% in females ; the percentage of the total smm was greater in males than in females.9 furthermore , tanimoto et al investigated the influence of age on muscle mass by estimating the muscle mass of the upper and lower limbs , trunk , and whole body in 4,003 community - dwelling japanese elderly and found that muscle mass of the lower limbs was the first to be affected and showed the greatest decrease.27 however , loss of muscle due to aging needs to approach a certain level to affect the ambulatory speed of a person.28 thus , reduced muscle in lower limb in males was not considered to have affected the ambulatory speed in this study , mainly due to the presence of greater muscle mass in males than in females . in brief
, they have enough muscle in the lower limb to overpower the high decrease rate of muscle mass with age in males , resulting in no apparent changes in their walking . for both females and males , decreased number of teeth caused reduced total muscle mass and ambulatory speed and suggested lower qol .
however , preventing teeth loss may be more important in females because they showed greater decrease in ambulatory speed , which is closely associated with qol .
first , the study design was cross - sectional , which did not enable identifying the detailed causal connections among the measured items .
second , the total smm measurement was estimated using bioelectrical impedance analysis in this study , which was not the method recommended by the ewgsop for its assessment .
third , several potential confounding factors , such as socioeconomic level and use of dentures , were not assessed in this study .
this was largely due to the fact that the socioeconomic statuses of individuals are considered a part of personal information in japan , and thus , we were unable to include it in this study .
fourth , all participants in this study were volunteers who showed interest in their own health , who may have been healthier than other local residents . in brief ,
the muscle mass and its function and the number of teeth of those who did not participate in this study may differ from the subjects of this study .
finally , due to our relatively small sample size , we were unable to exclude beta error as the cause of our failure to detect associations between the number of teeth and the muscle mass and its functions .
the authors believe that prevention of teeth loss is important for maintaining muscle strength and its function in people aged 4079 , especially for walking ability .
this cross - sectional study on a japanese community - dwelling population revealed relationships between partial oral conditions and the muscle mass and its function .
however , the interpretation of our results was hampered by a lack of data , including those on socioeconomic status and longitudinal observations .
therefore , future research exploring teeth loss and the muscle mass and its function is warranted .
Output:
| purposedecline in the number of teeth and physical fitness begins from 40 years of age ; however , several epidemiological studies have identified relationships between oral conditions and physical performance parameters in community - dwelling elderly population .
the aim of this study was to validate the relationship between the muscle mass and its function and oral conditions ( number of teeth and dental occlusion ) after 40 years of age in a community - dwelling population in japan.materials and methodsthe subjects comprised of 552 volunteers ( 198 males and 354 females , 4079 years ) who participated in the iwaki health promotion project in 2013 .
multiple linear regression analyses were performed with the measures of the muscle mass and its function as objective variables and the measures of the number of teeth , age , body mass index , medical history , serum albumin concentration , smoking status , habitual alcohol intake , marital status , education levels , and exercising habits as explanatory variables .
the relationships between the eichner index and the muscle mass and its function were analyzed using analysis of covariance , with adjustment for confounding factors.resultsafter adjusting for confounding factors , the number of teeth was shown to be an independent risk factor for the timed 10 m walk test ( in females ) and the skeletal muscle mass of the whole body ( in males ) .
the results also revealed that the timed 10 m walk test was significantly correlated with the eichner index ( classes a and c in females were correlated).conclusionthis cross - sectional study on a japanese community - dwelling population revealed relationships between oral conditions and the muscle mass and its function .
however , the interpretation of our results was hampered by a lack of data , including those on socioeconomic status and longitudinal observations .
future research exploring teeth loss and the muscle mass and its function is warranted . |
PubmedSumm6886 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: one fourth of cerebrovascular events are attributable to atherosclerotic carotid artery disease.1 large population - based studies indicate that the prevalence of carotid stenosis ranges from approximately 0.5% in individuals above the age of 60 and 10% in those above 80 years old ; however , stenosis remains asymptomatic in the majority of cases.24 the incidence of stroke will probably increase in the next 20 years due to the aging of the population and the improved survival rate of patients with a history of stroke or myocardial infarction ; these are people who are at increased risk of further vascular accidents .
randomized controlled trials have shown that the surgical treatment of carotid artery stenosis is more efficient than medical therapy alone in terms of stroke prevention when treating carotid artery stenosis > 70% in asymptomatic patients or > 50% in symptomatic patients.4 , 7 in recent years , carotid artery stenting ( cas ) has gained worldwide attention as a less invasive treatment option for stroke prevention .
data from recent studies and registries show that cas can be performed with excellent technical success and a 30-day stroke / death rate of 2.2%
4.8%.810 although several registries and trials have assessed the feasibility and results of cas in the world , such studies on this important procedure and its results in iran are scarce.10 , 11 in this study , we sought to evaluate cas efficacy and safety in our center and report our short and long - term clinical results in the treatment of 40 consecutive patients .
the data of 40 patients with internal carotid artery stenosis who underwent cas with the use of an embolic protection device between july 2008 and december 2009 were analyzed .
all the patients had evidence of carotid stenosis in non - invasive tests such as doppler sonography , ct , or magnetic resonance angiography .
all the patients provided signed informed consent and agreed to undergo regular follow - up evaluations .
all the patients referred to the clinic one month later and were , thereafter , followed up by clinic visits or telephone calls .
of the patients examined , 19 ( 47.5% ) were classified as symptomatic because they had a history of transient ischemic attack or stroke within the 6-month period prior to the stenting procedure , and 21 ( 52.5% ) were classified as asymptomatic .
quantitative analysis was employed only when the visual assessment of individual lesions approximated borderline stenosis . in - hospital neurological events
were documented and were categorized as transient ischemic attack ( a focal ischemic neurological deficit with an abrupt onset within 24 hours ) ; minor stroke ( focal neurological deficit lasting > 24 hours ) , with regression ; and major stroke ( focal neurological deficit lasting > 24 hours ) , without regression . to evaluate the influence of experience in cas on in - hospital neurological complications ,
the patients were divided into two groups : group 1 comprised the first 20 treated patients and group 2 consisted of the remaining 20 patients .
data on the procedural details were also collected , including the use of embolic protection devices , type of stents and balloons , technical success rate , and causes of technical failure .
furthermore , complications at the access site and contrast medium amount were evaluated . for the evaluation of contrast - induced nephropathy ,
baseline creatinine values of 1.8 2.5 and > 2.5 mg / dl were defined as moderate and severe renal insufficiency , respectively .
contrast - induced neuropathy was defined as an increase of 0.5 mg / dl in the baseline serum creatinine value .
myocardial infarction was defined as the occurrence of a new q - wave in two leads .
the primary end - point was the rate of 30-day major or minor stroke and/or death and/or myocardial infarction .
acetylsalicylic acid ( 100 mg ) and clopidogrel ( 75 mg per day ) were administered at least 3 days prior to the procedure and those patients who were not on an antiplatelet medication received a 300-mg clopidogrel loading dose on the same day . during the intervention
, 50007500 units of heparin were administered to maintain an activated clotting time of 200250 .
nearly all the interventions were performed under local anesthesia via a trans - femoral access ; only in one case was the brachial artery chosen due to the severe occlusive disease of the distal abdominal aorta ( right brachial approach for left carotid angioplasty ) .
after an angiogram of the aortic arch , selective carotid angiography was done with a 6-fr right judkins catheters and vitek and sidewinder simmons i & ii catheters for type iii and bovine aortic arch . finally , intra - cerebral angiography was also performed .
subsequently , long sheaths ( 6 or 7 fr ) or guiding catheters ( 7 8 fr ) were utilized to engage the common carotid artery . in both approaches , the catheters were advanced into the common carotid artery on support of 0.035-inch stiff wires .
different embolic protection devices were thereafter employed . to prevent a baroreceptor reaction , 1 mg of atropine was given intravenously before dilation .
in all the cases , a self - expandable stent was implanted to cover the entire lesion , and in 2 patients two overlapping stents were placed .
pre - dilation was performed occasionally and was followed , in most cases , by post - dilation . to confirm the correct position of the stent and to rule out complications , a final angiogram of the cerebral circulation
residual stenosis < 30% with no alteration in the brain circulation was considered a satisfactory result .
the patients were monitored continuously both during the intervention and during the whole in - hospital period .
all the patients were repeatedly examined by residents , and all the symptomatic patients were examined by neurologists .
post - procedural brain ct was performed if the neurological status of the patient changed .
the patients were discharged on dual antiplatelet therapy ( aspirin 100 mg and clopidogrel 75 mg per day ) at least for 1 month and aspirin was continued indefinitely .
the continuous data are presented as mean standard deviation ( sd ) or , if adequate , as median and range .
the comparisons between the groups were analyzed for significance using the fisher exact test or the chi - square test , as appropriate .
all the tests were two - sided , and significance was assumed at p value < 0.05 .
in total , there were 40 patients comprised of 20 men and 20 women at an average age of 65 11 years ( range 38 88 years ) . amongst the study population ,
4 ( 10% ) patients were 80 years old ; 35 ( 90% ) were at high surgical risk ( table 1);12 8 ( 20% ) suffered from significant ( > 70% ) bilateral carotid artery disease ; 13 ( 32.5% ) had old myocardial infarction ; and 37 ( 92.5% ) had evidence of coronary artery disease , 32 ( 80% ) of whom had multi - vessel ( two vessels ) involvement .
nearly half of the asymptomatic patients , who were referred by cardiovascular surgeons , required surgery in the following 4 6 weeks .
overall , neurological complications during hospital stay included 1 ( 2.5% ) transient ischemic attack in an asymptomatic 71-year - old man during the procedure and 1 ( 2.5% ) major stroke in a symptomatic 88-year - old man 3 days after the procedure with a much calcified aortic arch .
two ( 5% ) patients died during the in - hospital course ; one of them was a symptomatic 57-year - old woman who expired during the first 24 hours due to hyper - perfusion syndrome and evidence of intracranial hemorrhage in ct .
she also had percutaneus coronary intervention ( pci ) on the right coronary artery in the same session and intra - procedural activated clotting time ( act ) was 400 .
the other case was a symptomatic 77-year - old man with ischemic heart failure ( ejection fraction = 20% ) who died a few hours after the procedure due to hypotension and intractable ventricular tachycardia ( vt ) and finally ventricular fibrillation ( vf ) .
therefore , the overall in - hospital stroke / death rate was 7.5% ( table 5 ) , with all the cases being symptomatic . with respect to the learning curve , there were 1(5% ) transient ischemic attack and 2 ( 10% ) deaths in group 1 ; whereas in group 2 , there was only 1(5% ) major stroke .
the average amount of contrast medium consumed during angiography was 325 120 ml . a mild reversible contrast - induced nephropathy after intervention was found in 3 ( 7.5% ) patients , two of whom were diabetics and the other one suffered from severe renal failure .
the mean follow - up was available in 34 patients for a mean period of 12 9 months . in this interval
, 2 patients died after the surgical procedures : one patient after coronary artery bypass graft surgery due to pump failure and the other one after mitral and aortic valve replacement surgery due to abdominal complications .
there was no major stroke , and the major stroke / neurological death rate was 0% .
in our experience , the overall technical success rate was 100% , which compares well with the published data . given that one fourth of our cases had a difficult aortic arch and that more than half of the cas procedures were on the left side , which is clinically more difficult , this high technical success rate is important . in our study
, none of the selected patients was excluded due to comorbidities ; consequently , all the patients considered high surgical risk ( 90% ) were treated .
therefore , of the 40 procedures , the combined complication rate ( death / stroke ) at 30 days ( including intra- and post - procedural complications ) was 7.5% . as was mentioned earlier , 80% of the patients in our study had evidence of multi - vessel coronary artery disease ; still , no myocardial infarction occurred and the combined death / stroke / myocardial infarction rate was 7.5% .
the most recent randomized trial , eva-3s , showed a cas stroke / death rate of 9.6% at 30 days .
this study showed post - carotid endarterectomy ( cea ) complication results comparable with those in the literature ( 3.9% stroke / transient ischemic attack at 30 days ) .
it is clear that the biggest limitations of the study were the scarce endovascular technique experience of the operators ( 12 carotid artery stenting procedures or 35 procedures performed on supra - aortic trunks , five of which were carotid ) and the pre - procedural anti - platelet therapy , which was only recommended and not always homogeneously administered .
double anti - platelet therapy was administered to 82.9% of the patients and only 85.4% were administered anti - platelet therapy after the intervention.13 the space trial failed as well to demonstrate the non - inferiority of the endovascular treatment compared with cea , reporting a complication ( stroke / death ) rate at 30 days of 7.68% for cas and 6.51% for cea .
such high rates may be due to the limited use of cerebral protection devices , as well as to the insufficient operator s experience required ( 25 consecutive successful angioplasty or stent procedures).14 our results are inferior to those of other studies such as the sapphier and aha guidelines . in the sapphier trial ,
156 patients were treated with cas with the use of a cerebral protection device and 151 with cea .
the death / stroke rate in the group of patients treated with cas was 4.5% and in those treated with cea was 6.6% ; such results were beyond the limits of the aha guidelines , which are based on the acas and nascet .
this may be explained by the fact that these latter studies excluded high - risk patients such as those with contra lateral carotid occlusions , restenosis after cea , age above 80 years , or the presence of concomitant cardiovascular pathologies.15 in our experience , 10% of the study patients were 80 years ; 20% had contralateral involvement , which increased the adverse results ; and 90% had concomitant cardiovascular disease . thus , the most important reasons for the higher adverse results in our study are more high - risk patients and the inadequate experience of the operators .
it is , therefore , prudent that lower - risk patients be selected in an early learning curve .
it is also recommended to avoid coronary pci and cas concomitantly , which would require higher act . in the kassaian et al .
experience in iran , age 70 years , three - vessel disease , hypertension , plaque ulceration , type c lesion , and a score of 22 were the independent predictors of adverse events after cas.10 numerous clinical reports have highlighted the importance of the operator s experience as a crucial factor in the clinical success of cas.7 , 16 , 17 recent published data by theiss et al.7 demonstrated a peri - procedural stroke / death rate of 5.9% at centers with < 50 interventions , whereas at centers with > 150 patients , the stroke / death rate was significantly lower ( 3.0% ) .
in addition , procedural time and contrast volume decreased significantly with increased physician s experience.18 the effect of the learning curve was demonstrated , as well , in randomized studies such as the eva-3s trial.13 in our experience , in group 1 , which included the first 20 patients , the death / stroke rate was 10% and in group 2 , which included the remaining 20 patients this rate was 5% .
this difference was not statically significant , probably due to the small size of the study population .
apart from neurological complications , there are other procedure - related complications such as puncture - site complication and contrast - induced nephropathy . despite heparinization and antiplatelet therapy and the use of 8 fr guiding catheters in the majority ( 82.5% ) of cases , no access - site complication was detected .
the incidence of mild contrast - induced nephropathy in our study was 7.5% , which returned to the previous values in all the cases . amongst patients with diabetes mellitus and pre - existing renal disease ,
the incidence of contrast - induced nephropathy is estimated to be as high as 50%.19 nevertheless , despite the fact that 52.5% of our patients had diabetes mellitus and 15% had a renal insufficiency , we had an acceptable incidence of contrast - induced nephropathy .
the amount of dye in our study was relatively high , mostly due to the unavailability of road map technology in our cath . lab .
at the one - year follow - up , which was available in 34 patients , there was no major stroke or neurological death , which is definitely promising .
this was an analysis of a small - sized , single - center patient population and thus had all the limitations of such a study which results in a low statistical power .
we achieved a good technical success and a relatively acceptable in - hospital stroke / death rate .
however , as was explained earlier , the occurrence of neurological complications may be associated with the learning curve .
the major stroke / neurological death rate was also promising in the long - term follow - up .
finally , this study can be a guide to our colleagues in the country who are interested in cas .
not only is it advisable that lower - risk patients be selected in an early learning curve but also concomitant coronary pci and cas should be avoided in that it would necessitate higher act .
Output:
| backgroundcarotid artery stenting is now used as an alternative to surgical endarterectomy .
this study was done to assess the feasibility , safety , and immediate and late clinical outcomes in patients undergoing carotid stenting.methodsbetween july 2008 and december 2009 , a total of 40 patients ( 20 male , mean age : 65 11 years , 19 symptomatic , and 90% high risk for endarterectomy ) underwent carotid artery stenting with different embolic protection devices and carotid stents .
thirty - seven patients had coronary artery disease . technical success rate , stroke / death / myocardial infarction rate at 30 days , access - site complications , and contrast - induced nephropathy were assessed . for the evaluation of the influence of experience in carotid artery stenting on complications
, the patients were divided into two groups : group 1 included the first 20 treated patients and group 2 comprised the remainder of the patients.resultsthe overall technical success rate was 100% .
the cumulative in - hospital stroke death rate was 7.5% ( n = 3 : 2 deaths and 1 major stroke ) .
complications were more frequent in group 1 ( 2/20 , 10% ; 2 deaths ) than in group 2 ( 1/20 , 5% ; 1 major stroke ) , but this was not statistically significant ( p value = 0.09 ) .
no access - site complications occurred , and mild contrast - induced nephropathy occurred in 3 patients ( 7.5% ) .
no major stroke or neurological deaths occurred during a mean follow - up of 12 months.conclusioncarotid stenting seemed feasible and relatively safe in our experience .
advanced experience in carotid artery stenting appears to confer an acceptable peri - procedural stroke - death rate . |
PubmedSumm6887 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: stroke is the most common chronic disease in the world , and the most important known cause for disability and reduction of independency and quality of life ( qol ) in adults .
as stroke causes lifelong complications in nervous system , it is counted as one of the common health problems .
about 5.5 million people die of this disease each year worldwide , an it is known as the third cause for mortality in the world of which two thirds occur in developing countries such as iran .
the incidence of stroke was reported as 139 out of 100,000 in iran , which is notably higher than in the western countries . as stroke
is usually accompanied with functional dependency , the above rate of prevalence can not show the real impact of cerebral vascular accident(cva ) alone .
it is the cause for a high number of lifelong and serious major disabilities , and is the main cause that results in an increase the number of the patients with sensory and motor defects as well as absence of function .
stroke is the most common disabling disorder in the nervous system that leaves a deep impact on the patients and their families .
although about 80% of the stroke survivors are discharged from hospital after passing the acute stage of the disease and having a stable condition , they suffer from numerous social , physical , sensory , conceptual , mental , psychological , cognitive , and social complications such as a defective consciousness , motor disorder , paralysis , muscular atrophy , imbalance , dysphasia and its risk of aspiration pneumonia , incontinency , constipation , pressure sore , dermal irritations , urinary retention , deep vein thrombosis ( dvt ) , thromboembolim , pulmonary embolim , unstable hypertension , and shoulder pain . among the other complications , immobility ,
spasity , problem in standing and walking , hemiplegia , and oral and motor disorders can be counted .
these disorders result in loss of patients independency and an increased dependency on relatives , reduced self - confidence , mental complications such as depression , a reduction in satisfaction and qol , and a disorder in appropriate function and individuals independency during participation in everyday life activities .
these problems are the major challenges for such patients and their caregivers after their discharge from hospital .
therefore , making a vast range of functional changes in various biological , psychological , mental , and social dimensions of human beings , especially in biological dimension , stroke causes some internal changes including individuals reaction and usage of coping mechanisms against these changes to adapt with .
these reactions are coping strategies in terms of active and passive behavioral and cognitive efforts in response to stressful conditions ( diseases ) , as well as overcoming the disease - related challenges , reduction of their negative outcomes , and tolerating the impacts of stroke to preserve the personal value and integrity of patients personality .
on the one hand , human being is a psychobiological and social creature and a stimulation imposed to any of his / her dimensions influences the other dimensions . on the other hand
, he / she is constantly changing in response to the environmental , physical , social , and mental changes , and should have interactions with them and show adaptive reactions toward them .
individuals power in preservation of their health depends on having the ability and needed energy to positively adapt with the stimulations .
adaptation also results in feeling of safety , and in case of an imbalance in adaptation , the patients experience stress , anxiety , and lack of safety . in such situations ,
as adaptation strategies are weakened and individuals usual efforts for adaptation are inefficient , nursing care is needed , as nurses play a pivotal role in supporting the patients with chronic diseases .
the first and most important question that flashes in nurses mind in a clinical setting is how they can help their clients and give them care . in this regard
one of the nursing models that has vastly and deeply worked on adaptation in psychobiological and social dimensions in chronic disease is roy adaptation model , which aims at administration of nursing interventions for improvement of adaptive responses in each dimension ( physiological , self - concept , interdependence , and role function ) .
research showed the positive effect of roy adaptation model on improvement of disease control and increase of adaptive responses in chronic diseases . based on roy adaptation model ,
the patient is precisely detected and his / her adaptive behaviors are increased through nursing intervention and manipulation of their causes as their stimulants , and consequently , a better physiological and psychological adaptation is obtained .
it goes without saying that adaptation with a chronic disease is a dynamic process through which the patients can achieve more appropriate self - control by increasing their physical and cognitive adaptation level , as an ultimate goal in the management of chronic diseases .
based on this model , detection of unknown behavioral stimulants leads to precise exploration of the causes of patients maladaptive behaviors and helps the nurses to design an accurate care plan to solve the patients problems ( through adaptive behaviors ) .
therefore , it is predicted that adaptive behaviors ( healthy behaviors ) are increased in patients by application of a care plan that is designed based on this model , which results in a reduction in complication , the most important goal in stroke patients . with regard to vast involvement of stroke patients biological dimension ,
one of the interventions that could be administered by nurses is giving care in this dimension .
search conducted in several databases revealed the absence of this model among the nursing interventions provided in taking care of stroke patients in iran , especially in biological dimension .
therefore , the present study aimed to investigate the effect of biological dimention care plan on stroke patients physiological adaptation level base on roy adaptation model , in order to make suggestions to the nursing society based on its findings .
this is a two - group ( study and control ) , two - stage , before after clinical trial .
the researcher attended al - zahra and kashani hospitals in isfahan and selected the patients who met the inclusion criteria and were hospitalized in neurology wards as the subjects .
those who were interested to participate filled the informed consent form , and then the demographic characteristics form .
after selection of the patients through convenient sampling , they were randomly assigned to two groups of study ( n = 25 ) and control ( n = 25 ) by random number [ table 1 ] .
then , 2 weeks after discharge and by making necessary coordination , roy adaptation questionnaire was filled by researcher 's referral to the patients ( at their home , physician 's office , or a clinic ) in both groups . after filling the questionnaires , the researcher reviewed the data obtained using roy questionnaires in two stages . at the first stage ,
stimulants for each of these maladaptive behaviors were determined in this dimension . after investigating the data and determination of the patients maladaptive behaviors and the related stimulants in biological dimension , the researcher designed the care plan .
researcher formed a health care team including a nurse ( the researcher ) , neurologist physician , and a psychologist .
then , in the study group , the subjects were divided into four- or five - member groups , if there was no limitation for an interventional plan ( determined by the related physician ) , and the theoretical and practical care plan , in addition to an educational booklet , were given to them .
this care plan included four 6090 min educational sessions held during 2 weeks ( twice a week ) for the stroke patients and their families .
comparison of the frequency distribution of demographic characteristics of patients with stroke in both study and control groups the administered care plan contained an educational regular protocol including theoretical and practical education . after ending the educational program sessions
, there were phone follow - ups for the patients for 1 month ( once a week ) .
inclusion criteria were age over 18 years , having obtained permission from the physician for administration of the care plan , absence of any problem in consciousness level , patients complete orientation to time , place , and recognition of their relatives , no defect in patients vision and hearing ability , absence of any muscular problem that would prevent administration of the care plan , having the first stroke , being familiar with persian language , having motivation and being interested in education and the designed care plan administered , being fit for the interventional program , and absence of conceptual or global aphasia .
exclusion criteria were patients loss of interest to go on with the care plan and absence for more than two sessions during the study .
the sample size was calculated as 25 in each group by confidence interval of 95% ( error of 5% ) .
roy assessment form was designed through library resources and internet search and consideration of related tools . to determine face and content validity ,
it was distributed to 10 academic members of isfahan nursing and midwifery school and two academic members in the school of medicine , and necessary modifications were made based on their indications .
reliability of the questionnaire was established by conducting a pilot study and calculation of cronbach 's alpha ( 76.6 ) among 10 patients .
roy recognition and assessment form consists of 28 items in patients physiologic dimension , including questions on activity , rest , nutrition , defecation , circulation and oxygenation , fluids and electrolytes , and endocrine system .
these items are scored through a five - point likert 's scale ( 0 = never , 1 = for a short time , 2 = sometimes , 3 = often , and 4 = always ) .
maladaptive behaviors and their stimulants in physiologic dimension were determined and compared once before intervention and another time after administration of the care plan in the two groups using this form .
the subjects in the control group underwent conventional and routine care , and after 8 weeks , their adaptation was assessed using the form again . after the end of the study , an educational booklet was given to them and they received necessary explanations in a session .
care plan was designed and administered in four sessions with regard to determination of maladaptive behaviors ( unhealthy behaviors ) and their stimulants in the subjects of the study group to achieve the study goal ( development of healthy behaviors ) .
the first session included patients awareness of the disease , its signs , and familiarization with personal health obedience to do everyday life activities . in the second session ,
the education was on exercises of the limbs in their range of motion , balance , self - care methods in cases of sensory and motor disorders , and defecation and urinary disorders .
the third session contained psychological counseling to cope with anxiety and depression and the subjects were referred to a psychologist if needed . in the fourth session , the group of nutrients and the diet were discussed and patients were educated . at the end of the course , all presented materials were given to the patients in form of an educational booklet ; a phone call was made to the patients in the study group once a week for a month , and their questions on their condition and motor exercises were answered .
in fact , a sort of feeling of being supported was formed among the patients . at the end
, roy adaptation assessment form was filled again and the obtained data were analyzed by independent t - test , paired t - test , and wilcoxon test with confidence interval of 95% through version 18 spss [ figure 1 ] .
general research plan
it has been explained the goal of accompanying the study to head nurse and ward 's personnel and it has been attracted their competitionit has been explained the goal and the manner of studying and it has been received their written satisfaction mindfullyit has been explained to the studied wards and the head of hospital that if they get the results of study , they will be give themthe participants can exist the study whenever they wantit has been favor literature right and honesty completely in using science references , books and text translating .
it has been explained the goal of accompanying the study to head nurse and ward 's personnel and it has been attracted their competition it has been explained the goal and the manner of studying and it has been received their written satisfaction mindfully it has been explained to the studied wards and the head of hospital that if they get the results of study , they will be give them the participants can exist the study whenever they want it has been favor literature right and honesty completely in using science references , books and text translating .
it has been explained the goal of accompanying the study to head nurse and ward 's personnel and it has been attracted their competitionit has been explained the goal and the manner of studying and it has been received their written satisfaction mindfullyit has been explained to the studied wards and the head of hospital that if they get the results of study , they will be give themthe participants can exist the study whenever they wantit has been favor literature right and honesty completely in using science references , books and text translating .
it has been explained the goal of accompanying the study to head nurse and ward 's personnel and it has been attracted their competition it has been explained the goal and the manner of studying and it has been received their written satisfaction mindfully it has been explained to the studied wards and the head of hospital that if they get the results of study , they will be give them the participants can exist the study whenever they want it has been favor literature right and honesty completely in using science references , books and text translating .
mean ( sd ) ages were 67.5 ( 9.8 ) years ( range 4981 years ) and 69.04 ( 8.9 ) years ( range 4980 years ) in the study and control groups , respectively . in order to ensure homogeneity of the groups concerning personal characteristics and baseline variables ,
a review on roy adaptation assessment showed that mean adaptation score in physiologic dimension increased from 49.7 before intervention to 50.7 after intervention , with no significant difference in the control group ( p = 0.21 ) .
meanwhile , in the study group , mean score of adaptation significantly increased from 47.4 to 94.7 after intervention ( p < 0.0001 ) [ table 2 ] .
comparison of mean scores of physiological adaptations in stroke patients in the study and control groups
it goes without saying that patients adaptation with long - term problems and complications of the diseases plays a pivotal role in their disease control and improvement of their qol in all chronic diseases .
the present study pursued the same goal to investigate the effect of one of the nursing models , roy adaptation model .
the results showed that a self - care plan , designed based on this model , could efficiently influence stroke patients physiologic condition .
roy ( 2002 ) emphasizes that physiologic adaptation is a factor that stabilizes chronic disease process and prevents its complications .
our results showed a significant increase in mean adaptation score in physiologic domain in the study group ( p < 0.0001 ) .
therefore , it can be stated that the designed care plan increased the level of adaptation in physiologic dimension among stroke patients . as patients participation in care - related intervention ,
as a team work with the cooperation of nurses and other professionals such as psychologists and nutritionists , is a valuable action in disease control , it was used in the present study to fulfill patients needs with the coordination of nurses and their constant support , and a notable change was observed in patients adaptation during 2 months of intervention .
as humans have a holistic approach , patients and their families education can notably affect their self - concept and self - efficacy .
in other words , patients empowerment can be accompanied with their self - concept in the formation of a positive attitude toward the lifestyle change and leads to adaptation .
shokati , in a study , investigated the effect of participative self - care among stroke patients on their qol and showed that intervention in one dimension resulted in modification of all dimensions such as everyday life activities ( personal hygiene , bathing , nutrition , going to toilet , combing hair , defecation and urine control , mobility and using a wheelchair ) among stroke patients .
sadeghnejad investigated the effect of roy model based self - care on adaptation of diabetic patients in 10 group education sessions and a 1-month follow - up , and showed that patients urea and potassium levels were reduced and their level of albumin increased .
analysis of roy assessment form showed that mean score of maladaptive behaviors in physiologic dimension significantly decreased to 1.9 after intervention , compared to before intervention ( 5.7 ) ( p < 0.001 ) .
rogers and keller used roy model to increase physical activity in the sedentary older adults .
he held a weekly 1 h educational session in the form of a 15-member class for 12 weeks .
physical and physiological dimensions were measured through measurement of level of physical activity and function . finally , the intervention resulted in a 6-min walk increase in patients , reduction of hypertension , and an increase in their muscular power and modification of their balance .
burns , in a study on physical and psychological dimension of adaptation in hemodialysis patients , measured and recorded their bp , weight , and potassium level before dialysis .
the patients used various adaptation mechanisms such as trusting god , positive thinking , positive attitude toward god 's blessing in life , thinking about positive issues in life , being humorous , listening to relaxing music , and calling up the family members .
they finally observed no significant association between intervention using adaptation mechanisms and the incidence of physiologic problems including the ones in bp , level of potassium , and weight ( p < 0.05 ) .
in physiologic dimension , parental presence during anesthesia induction resulted in a reduction in anxiety and catecholamine release , increase of oxygenation , decreased hospitalization , reduction of postoperative nausea and vomiting , and reduction in the need for pain relief .
marry ( 2003 ) investigated the effect of biologic nursing intervention and relaxing massage on physiologic effects in premature neonates ( 2732 weeks of gestational age ) who were medically weak .
after administration of relaxing massage , conducted from day 7 to 17 post birth , the subjects pulse and o2 saturation level became stable .
hakari and mohammadzadeh , in a study on women 's adaptation with coronary artery diseases based on roy four - dimensional model , reported a significant decrease in mean maladaptive behavior in physiologic dimension from 5.7 to 1.9 after intervention .
these results show that through formation of adaptive behaviors , the patients could achieve the goal of controlling disease and its complications .
involvement of the patients in maladaptive behaviors is an important variable in adaptation with a chronic disease .
therefore , changing and manipulation of maladaptive behaviors stimulants is an important issue to achieve an appropriate control for a chronic disease .
however , patients active participation in this process were helped in their physical and psychological adaptation .
most of the studies emphasize on improvement of nursing activities by focusing , organizing , and directing the nurses thought and function toward taking care of chronic patients and increasing their adaptive responses in all four dimensions of roy model during administration of nursing interventions .
health care providers , especially nurses , should pay close attention to this issue in their planning for these patients health promotion . as
roy model - based self - care plan is a non - invasive , non - medication , and cost - effective method in control of physical and psychological problems and is conveniently applicable by the nursing staff , it can be used for chronic patients and their problems , especially for stroke patients , to increase their adaptation .
Output:
| background : stroke is a stressful event with several functional , physical , psychological , social , and economic problems that affect individuals different living balances . with coping strategies , patients try to control these problems and return to their natural life .
the aim of this study is to investigate the effect of a care plan based on roy adaptation model biological dimension on stroke patients physiologic adaptation level.materials and methods : this study is a clinical trial in which 50 patients , affected by brain stroke and being admitted in the neurology ward of kashani and alzahra hospitals , were randomly assigned to control and study groups in isfahan in 2013 .
roy adaptation model care plan was administered in biological dimension in the form of four sessions and phone call follow - ups for 1 month .
the forms related to roy adaptation model were completed before and after intervention in the two groups .
chi - square test and t - test were used to analyze the data through spss 18.results:there was a significant difference in mean score of adaptation in physiological dimension in the study group after intervention ( p < 0.001 ) compared to before intervention .
comparison of the mean scores of changes of adaptation in the patients affected by brain stroke in the study and control groups showed a significant increase in physiological dimension in the study group by 47.30 after intervention ( p < 0.001).conclusions : the results of study showed that roy adaptation model biological dimension care plan can result in an increase in adaptation in patients with stroke in physiological dimension .
nurses can use this model for increasing patients adaptation . |
PubmedSumm6888 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: pesticides enhance economic potential through increased food and fiber production as well as through control of vector - borne diseases .
this ease of availability has resulted in a gradual increase in accidental and suicidal poisoning [ 14 ] . globally ,
each year , poisoning due to organophosphorus compounds is responsible for approximately three million episodes that result in nearly 200 000 deaths .
the vast majority of these occur in developing countries like india , as a result of fatal pesticide self - poisoning [ 68 ] .
however , developing countries account for only 20% of global pesticide use . on the morning of 2 february 2008
, residents of sindhikela village , bolangir district , in the indian state of orissa were admitted to the hospital with complaints that included vomiting , profuse sweating and fits . some were in serious condition .
sindhikela is a small village with a poor rural population , where people sometimes do not have the resources to cook themselves breakfast : they eat a snack on the street instead . as a response to the alert
, the additional district medical officer ( public health ) and a graduate from the indian field epidemiology training programme ( fetp ) proceeded to the village immediately with the district task force to identify for the cause of the outbreak and ensure preventive and control measures .
we defined a case as occurrence of vomiting and profuse sweating between 6:00 am and 8:00 am on 2 february 2008 in a resident of sindhikela .
we plotted an epidemic curve , drew a map of the residence of the case patients , and calculated age and sex specific attack rates to describe the outbreak by time , place , and person . to identify risk factors we conducted a case control study .
we included all cases as defined above and recruited controls as the healthy neighbors of case patients .
we collected information from the case patients and the control subjects on symptoms , date and time of onset , source of food taken in the last 24 hours and drinking water source .
we compared the frequency of exposure variables between cases and controls through odds ratio with 95% confidence intervals .
we collected residual specimens of food from a roadside eatery that we suspected as a possible source and sent them to a laboratory .
we collected water specimens from different drinking water sources and sent them for chemical analysis to the public analyst , state surveillance cell , bhubaneswar , the state capital .
sindhikela is located 100 km away from bolangir ( 2008 population : 5263 ; male / female : 2680 : 2613 ) .
we confirmed the occurrence of an outbreak as 65 cases and two deaths were reported within an hour in the context of a background rate of less than one hospitalization per month ( overall attack rate : 12 per 1000 , case fatality : 3% ) .
the distribution of cases over time ( figure 1 ) pointed to an initial peak of 33 cases between 6:15 am and 6:30 am followed by a decline and two last cases at 7:15 am , suggesting a point source outbreak .
the spot map ( figure 2 ) indicated that there was a clustering of cases in harijanpada and hatpada , two adjacent localities of the village .
the attack rate per 1000 was the highest among the 5 to 8 years of age and among males ( table 1 ) .
vomiting and sweating were present in all cases ( as per our definition ) ; whereas 77% had myosis and 31% convulsions ( figure 3 ) .
the proportion of case patients with convulsions decreased with age , from 83% ( 10/12 ) among children 04 years of age , to 60% ( 6/10 ) among 58 children years of age , to 17% ( 2/12 ) among children 913 years of age to 6% ( 2/31 ) among persons 14 years of age and older ( p < .001 , chi square , 3 degrees of freedom ) . the point source pattern of the outbreak and the clustering in a specific location close to a roadside eatery led us to suspect a mixed foodborne and waterborne origin .
we included all 65 patients cases and 65 healthy neighbors as controls in our case control analysis .
however , cases were more likely to be children 013 years ( or : 3 , 95% confidence interval [ c.i . ] : 1.46.2 , table 2 ) .
consumption of water from a specific source ( or : 35 , c.i . : 1393 ) and eating at the roadside eatery ( or : 2.3 , c.i . : 1.14.7 ) was associated with illness ( table 2 ) .
48 cases and 36 controls had eaten in that roadside eatery that morning ( the eatery was popular , even among small children ) . in an analysis restricted to those who had eaten in the eatery ,
cases were more likely to have eaten pakoda with a water - based chutney preparation ( or : 3.9 , c.i . :
neither the food specimens nor the vomitus collected from three case patients grew any organism on culture . on 31 january 2008 , some villagers had used a pesticide ( folidol ec 50 , an emulsifiable concentrate ) to kill street dogs .
pipelines supplying drinking water that were damaged at many places were located beneath the drain .
these pipelines supplied drinking water twice a day , while during the rest of the time , they had a negative pressure .
on 2 february 2008 early in the morning ( 6 am ) , when the first phase of drinking water was supplied to harijanpada , it may have rinsed off pesticide that had been aspirated in the pipelines during the nocturnal phase of negative pressure .
the owner of the small roadside eatery near harijanpada collected water from that particular point to prepared pakoda and the water - based chutney .
this leads to accumulation of acetylcholine resulting in over stimulation of muscarinic and nicotinic receptors of skeletal muscles .
the case patients during this outbreak had a typical syndrome of organophosphorous poisoning . however , we could not do any serological test to exclude another etiology nor estimate the serum cholinesterase and red blood cell cholinesterase levels .
further , autopsy could not be practiced on the two deceased case - patients because they died on their way to the hospital .
we treated patients at the sindhikela community health center , referred serious cases to subdivisional hospital , titilagarh , and to a medical college hospital in burla .
the population of the village frequently used folidol to kill rats and street dogs , an inappropriate indication .
after the dogs were killed , the containers with the residual insecticide could have contaminated the drinking water as the damaged pipe lines were going right beneath the drains and presented negative pressure .
the actual product that was used , folidol ec 50 , is an emulsifiable concentrate , a who class i product . those are actually banned for use in india ( the villagers reported that they used an old stock procured before the ban ) .
an accidental poisoning of a less potent organophosphorous ( who class ii or iii ) would have been unlikely to have lead to this many casualties .
in addition to deliberate self - poisoning with pesticide , the burden of accidental poisoning with organophosphorous is unclear , because these episodes are not systematically reported .
as an example , in 2006 , in the same area of bolangir , in the state of orissa , we investigated a cluster of 33 cases of organophosphorous poisoning secondary to inhalation of themit .
the cluster occurred among agricultural workers who were planting in a paddy field that had been recently sprayed .
because of the nature of their activity , they were working with their face less than a meter away from the ground . if it were not for the presence of an epidemiologist from the field epidemiology training programme ( fetp ) of india posted in the district ( an unusual event given the number of trainees and the size of the country ) , this cluster would not have been reported .
we stopped supplying the suspected contaminated drinking water and provided alternate drinking water through tankers .
we discussed with villagers the issue of safe drinking water and proper handling of pesticides ( including abstaining from inappropriate indication such as use to kill dogs ) .
, systematic epidemiological investigations such as the one we report must be conducted for clusters of toxicoses of unknown origin .
facilities to diagnose organophosphorous poisoning in relevant health care facilities and systematic reporting of clusters would also provide additional capacity to document and prevent such occurrences .
Output:
| introduction . we investigated a cluster of pesticide poisoning in orissa .
methods .
we searched the village for cases of vomiting and sweating on 2 february 2008 .
we described the outbreak by time , place , and person .
we compared cases with controls .
results .
we identified 65 cases ( two deaths ; attack rate : 12 per 1000 ; case fatality : 3% ) .
the epidemic curve suggested a point source outbreak , and cases clustered close to a roadside eatery .
consumption of water from a specific source ( odds ratio [ or ] : 35 , confidence interval [ ci ] : 1393 ) and eating in the eatery ( or : 2.3 , ci : 1.14.7 ) was associated with illness .
on 31 january 2008 , villagers had used pesticides to kill street dogs and had discarded leftovers in the drains .
damaged pipelines located
beneath and supplying water may have aspirated the pesticide during the nocturnal negative pressure phase and rinsed it off the next morning in the water supply .
conclusions .
innapropriate use of pesticides contaminated the water supply and caused this outbreak .
education programs and regulations need to be combined to ensure a safer use of pesticides in india . |
PubmedSumm6889 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: numerous studies have
revealed the importance of tams on tumor
growth and development .
they are present in both tumor stroma and nests , accounting for up to 50% of tumor mass .
tams contribute to tumor growth by producing stromal breakdown factors
and by suppressing adaptive immunity .
moreover ,
tams induce chemoresistance by inhibiting tumor cell apoptosis . recently , there is also compelling evidence
that tam infiltration in tumors is correlated with poor prognosis
of many cancers , including breast , pancreatic , ovarian , prostate ,
cervix , bladder cancer , and certain types of glioma and lymphoma in
patients .
tams are thus considered a potentially viable target in designing
innovative imaging and therapy strategies .
in fact , there are various
reported methods to target tams . among them , using the membrane receptors
on tams is commonly explored .
for example , the endocytic cd163 protein was recently
proposed as a tam target for anticancer and antiangiogenesis drug
design .
folate receptor- , another
protein commonly expressed on the surface of macrophages , had also
been exploited to target toxins to tams .
because tams overexpress mannose receptor ( mr ) , there had been efforts to increase the delivery of oligos ,
dna , imaging agents , and vaccines to tams by surface - modifying the
delivery systems with mannose derivatives , anti - mr nanobody , or galactose derivative .
unfortunately , many of the previously reported
delivery systems can be inevitably taken up by macrophages that are
not in tumors because those macrophages often express similar membrane
receptors as the tams do . to address
this issue , we recently constructed an acid - sensitive
sheddable pegylated , mannose - modified nanoparticle platform ( as - m - nps ) .
the nanoparticles are prepared with plga , surface - modified with mannose ,
and pegylated with an acid - sensitive peg amphiphile , peg - hydrazone - c18
( or phc ) , which was synthesized by conjugating peg ( molecular weight ,
2000 ) with stearic hydrazide using a hydrazone bond .
injection ,
the long flexible peg chains shield the mannose on the surface of
the nanoparticles and prevent the interaction of the nanoparticles
with macrophages before the nanoparticles reach tumors .
once the nanoparticles
accumulate in tumors by the enhanced permeability and retention ( epr )
effect , however , the slightly acidic
tumor microenvironment ( ph 6.84 ) helps catalyze the hydrolysis of the hydrazone bond and facilitate
the shedding of the peg chains , exposing the mannose for interaction
with mrs on the surface of tams . previously , we showed fluorescence
images of the histological sections of tumors in mice injected with
fluorescein - labeled as - m - nps , which indicated that the as - m - nps can
potentially target tams .
however , direct
evidence is needed to demonstrate that the as - m - nps can indeed target
tams . in the present report , we present ex vivo fluorescence
imaging data to demonstrate that surface - modification of plga nanoparticles
incorporated with the self - fluorescent dox with acid - sensitive sheddable
peg and mannose can effectively target the dox into tumors by interacting
with tams . moreover , by taking advantage of the cytotoxicity of dox ,
we showed that the dox - as - m - nps were more effective than free dox
in inhibiting tumor growth . the dox - as - m - nps significantly decreased
tam population in tumors , but showed only minimum effect on macrophages
in mouse mps organs such as liver and spleen .
o - stearoyl mannose ( m - c18 ) , polyethylene
glycol 2000-hydrazone - c18 ( phc ) , and polyethylene glycol 2000-amide - c18
( pac ) were synthesized following our previously published methods .
zoledronic acid , 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide ( mtt ) , plga ( 752h ) , and poly - d - lysine were from sigma - aldrich
( st .
hematoxylin - eosin ( h&e ) and anti - cd31 antibody
were from abcam ( cambridge , ma ) .
the 5-bromo-2-deoxyuridine ( brdu ) and primary
brdu monoclonal antibody were from bd biosciences ( san jose , ca ) .
anti - cd206 , rm0029 - 11h3 , and fitc - labeled anti - cd206 antibody were
from santa cruz biotechnology , inc .
j774a.1 macrophage cells , b16-f10
murine melanoma cells , bxpc-3 human pancreatic cancer cells , and tc-1
murine lung cancer cells were from american type culture collection
( atcc , manassas , va ) and cultured in dmem ( or rpmi1640 for bxpc-3 )
at 37 c and 5% co2 .
media were supplemented with
10% fetal bovine serum ( fbs ) , 100 u / ml of penicillin , and 100 g / ml
of streptomycin , all from invitrogen ( carlsbad , ca ) .
female c57bl/6
mice ( 68 weeks ) and male athymic nude mice were from charles
river laboratories ( wilmington , ma ) .
animal studies were performed
in accordance with the national research council guide for the care
and use of laboratory animals .
animal protocol was approved by the
institutional animal care and use committee at the university of texas
at austin .
briefly , 0.9 ml of tetrahydrofuran ( thf ) containing plga 752h ( 3
mg ) and dox ( 0.3 mg ) was added dropwise into 4.5 ml of water under
stirring .
the nanoparticles were collected by centrifugation ( 13 000
g , 10 min , 4 c ) after the evaporation
of thf . for the purpose of surface modification , m - c18 ( 1.2 mg ) , pac
( 1.2 mg ) , or phc ( 3.6 mg ) were dissolved together with plga and dox
in thf and added into water .
particle
sizes and zeta potentials of the nanoparticles were determined using
a malvern zeta sizer nano zs ( westborough , ma ) .
the morphology of
the nanoparticles was analyzed using a zeiss supra 40 vp scanning
electron microscope ( sem ) ( zeiss smt ag , oberkochen , germany ) in the
icmb microscopy and imaging facility at the university of texas at
austin .
the entrapment efficiency ( ee )
of dox was determined spectrophotometrically at 490 nm by measuring
the amount of free unentrapped dox in the external aqueous solution
after centrifugation of the nanoparticles in suspension for 5 min
at 13 000 g. to determine the total
amount of dox in the nanoparticles , 500 l of nanoparticles
in suspension were mixed with 4.5 ml of dimethyl sulfoxide ( dmso )
for 5 min by sonication , and the concentration of dox was determined .
the ee was calculated according to the following equation : the rate at which dox
was released from nanoparticles was measured
as a function of time when the nanoparticles were incubated in phosphate - buffered
saline ( pbs , ph 7.4 or 6.8 , 10 mm ) .
triplicate samples of 5 mg of
nanoparticles were suspended in 0.5 ml of pbs and sonicated briefly
in an ultrasonic water bath .
the samples were then incubated in an
orbital shaker at 37 c , 100 rpm . at various time points
, the
particles were centrifuged at 13 000 g for 5 min , and 100 l of supernatant was removed and replaced
with fresh pbs .
the fluorescence intensity of dox in the supernatant
was measured using a biotek synery ht multi - mode microplate reader
( winooski , vt , usa ) at excitation 470 nm / emission 590 nm to determine
the dox released from nanoparticles .
j774a.1
cells were seeded with a density of 5 10 cells
per well on poly - d - lysine - precoated glass coverslips , placed
inside wells of a 6-well tissue culture plate , and incubated overnight .
on the second day , cell culture medium was replaced with 2.5 ml of
50 m dox in various nanoparticles ( i.e. , dox - nps , dox - m - nps ,
dox - ai - m - nps , and dox - as - m - nps ) .
cells were incubated for 20 min ,
followed by five additional minutes of incubation with 50 m
hoechst 33342 in a 37 c incubator and protected from light .
cells were then washed with pbs three times , fixed with 4% paraformaldehyde ,
and observed under a fluorescence microscope ( olympus bx 53 , center
valley , pa ) connected to the olympus cellsens dimension software .
to investigate the effect of ph on the cellular uptake
, nanoparticles
were preincubated with pbs ( ph 6.8 ) at 37 c for 6 h before further
incubating with cells . in order to track the intracellular fate
of nanoparticles ,
dox - as - m - nps were prepared with 5% ( w / w ) of plga
752h that was conjugated with fluorescein isothiocyanate ( fitc ) .
cells were incubated with nanoparticles for
15 , 30 , or 60 min , followed by five additional minutes of incubation
with hoechst 33342 .
cells were then washed , fixed , and observed under
a microscope as mentioned above .
b16-f10
cells ( 80% confluence ) were plated at a cell density of 5 10 cells / well into 96-well plates . after 24 h of incubation
at 37 c with 5% co2 ,
the growth medium was removed ,
and the cells were incubated for another 24 h with various dox formulations ,
with dox concentrations ranging from 0.001 to 10 g / ml .
controls
included cells incubated with dox - free medium or blank nanoparticles
( i.e. , dox - free as - m - nps ) .
cells were washed twice with pbs and incubated
with 20 l of mtt ( 5 mg / ml ) solution for 4 h. formazan crystals
were solubilized with 150 l of dmso .
cell viability was calculated by
comparing the absorbance with the untreated cells . to evaluate
the cytotoxicity of the dox - nps in macrophages ,
j774a.1 cells were
seeded into 96-well plates at a cell density of 1 10 cells / well .
after 24 h of incubation ,
cells were treated with free dox or various dox - nps , and cell viability
was determined 24 h later using an mtt assay as mentioned above .
similarly ,
controls included cells incubated with dox - free medium or dox - free
as - m - nps .
c57bl/6 mice were subcutaneously
( s.c . ) injected with b16-f10 cells ( 5 10/mouse )
in the right flank .
injected with pbs , free dox solution , dox - nps , dox - m - nps ,
dox - ai - m - nps , dox - as - nps , or dox - as - m - nps ( dox dose , 10 mg / kg ) .
mice
were euthanized 6 h later to collect blood , tumor , and major organs
( e.g. , heart , kidneys , liver , spleen , and lung ) .
all samples were
then imaged using an ivis spectrum ( caliper , hopkinton , ma ) ( em / ex
of 465/600 nm ) . in order to evaluate the effect of tams on the
uptake of the dox - as - m - nps by tumors in mice ,
b16-f10 tumor - bearing
c57bl/6 mice were intraperitoneally ( i.p . ) injected with zoledronic
acid ( 5 mg / kg ) 7 days after tumor cell injection to reduce macrophages
in mice .
two days after the last injection
( i.e. , 25 days after tumor cells injection ) , mice were i.v .
injected
with dox - as - m - nps ( dox , 10 mg / kg ) . as controls ,
b16-f10 tumor - bearing
mice that were not treated with zoledronic acid were i.v .
mice were euthanized 6 h later to
collect tumor and major organs for ex vivo imaging
using ivis spectrum .
tumor tissues were also stained with rm0029 - 11h3 ,
a macrophage marker , to confirm the reduction of tams by treatment
with zoledronic acid . finally , to evaluate the kinetics of the
biodistribution of the
dox - as - m - nps in mice , b16-f10 tumor - bearing mice were i.v .
injected
with dox - as - m - nps ( 10 mg dox / kg ) , and three mice were euthanized 6 ,
12 , 24 , or 48 h later to collect tumor , blood , and major organs , which
were then imaged using the ivis spectrum . for mice bearing bxpc-3
and tc-1 tumor ,
when tumor grew to around
7 mm in diameter , mice were grouped and i.v .
injected with dox - as - m - nps ,
free dox , or sterile pbs .
mice were euthanized 6 h ( bxpc-3 tumor - bearing
mice ) or 12 h ( tc-1 tumor - bearing mice ) later to collect tumors and
major organs for ex vivo imaging .
mice were s.c . injected with b16-f10 cells ( 5 10/mouse ) in the right flank on day 0 . on day 6 ,
mice were randomized
( n = 8) and i.v . injected with pbs , free dox solution ,
or dox - as - m - nps .
tumor volume was calculated using the following equation : tumor volume = ( length width)/2 . on day 16 , mice were euthanized to collect tumor , liver , and
spleen .
injected with brdu , 100 g / g body weight ,
30 min prior to euthanasia .
tumor tissues were stained with
h&e or anti - cd206 , anti - cd31 , or anti - brdu antibodies .
when tumors reached about 9 mm , mice were randomized and i.v .
injected with pbs , free dox , or various dox - nanoparticles .
tumor cell suspensions were stained with fitc - labeled anti - cd206 antibodies
( 1:200 dilution ) for 20 min on ice and washed 3 times with pbs .
cells
were then analyzed using a bd facs aria flow cytometer ( san jose ,
ca ) .
the percent of cd206 cells that took up dox ( i.e. ,
dox / cd206% ) was analyzed with the flow jo
software ( tree star inc .
dead cells and cells debris
were excluded based on the fsc - ssc plot .
live cells were then plotted
in the green ( fitc ) vs red ( dox ) dot plot quadrants .
double negative
control was the tumor tissue single cell suspension from mice that
were injected with sterile pbs .
positive control was the fitc - anti - cd206
stained tumor tissue single cells isolated from mice that were injected
with sterile pbs .
positive control for the dox was the tumor tissue
single cell suspension from mice that were injected with sterile pbs ,
and the cells were coincubated with a dox solution in culture for
20 min .
statistical analyses were completed by performing
anova followed by fisher s protected least significant difference
procedure .
the following dox - incorporated
nanoparticles were prepared : dox - nps ( dox - incorporated plga nanoparticles
without surface modification ) , dox - m - nps ( dox - nps that were surface - modified
with mannose but not pegylated ) , dox - as - nps ( dox - nps that were pegylated
with acid - sensitive sheddable peg , but not surface - modified with mannose ) ,
dox - as - m - nps ( dox - nps that were surface - modified with mannose and
pegylated with acid - sensitive sheddable peg ) , and dox - ai - m - nps ( dox - nps
that were surface - modified with mannose and pegylated with the acid - insensitive
peg2000-amide - c18 ) ( figure 1a ) .
all dox - loaded
nanoparticles were around 130150 nm in diameter , with a narrow
size distribution ( see polydispersity indices ) ( figure 1a ) .
the zeta potentials of dox - loaded nanoparticles were 24
to 35 mv ( figure 1a ) .
the nanoparticles were spherical ( e.g. , dox - as - m - nps , figure 1b ) .
the release of the dox from the nanoparticles
was biphasic ; a typical burst release phase was followed by a slower
release phase ( figure 1c ) .
the cytotoxicity
of the dox - loaded nanoparticles was tested in b16-f10 mouse melanoma
cells and in j774a.1 mouse macrophage cells . in b16-f10 cells , the
ic50 values of all dox - loaded nanoparticles
were not different
from one another , but they were significantly higher than that of
free dox ( figure 1d ) . in j774a.1 cells , except
the dox - m - nps , the ic50 values of all other dox - loaded
nanoparticles were not different from that of free dox ( figure 1d ) .
however , after the dox - as - m - nps were preincubated
in a ph 6.8 buffer for 6 h to facilitate the shedding of the peg chains
before they were added into cells , their ic50 value in
j774a.1 cells was significantly decreased ( by more than 50% ) ( figure 1d ) . the cytotoxicity of dox - as - m - nps after preincubation
at ph 6.8 was evaluated only in j774a.1 cells because there is evidence
that the murine macrophages cells express mannose receptor .
( b ) a representative sem graph of dox - as - m - nps .
( c ) the in
vitro release profile of dox from dox - as - m - nps ( inset , the
release profile in the initial 8 h ) .
( d ) ic50 values of
free dox and various dox - nanoparticles in b16-f10 cells and j774a.1
cells . as a control ,
the cytotoxicity of the dox - free as - m - nps was
also evaluated ( * the ic50 values of the dox - free as - m - nps
are the equivalent dox concentrations , if the as - m - nps were incorporated
with dox ) . data in panels a , c , and d are mean sd ( n 3 ) . in panel
d , p < 0.05 . to verify the surface modification
of dox - nanoparticles ( i.e. , pegylation and/or mannose - modification ) ,
the uptakes of various dox - loaded nanoparticles ,
dox - nps , dox - m - nps ,
dox - ai - m - nps , and dox - as - m - nps , by j774a.1 mouse macrophages were
evaluated microscopically after the nanoparticles were preincubated
in pbs ( ph 6.8 ) for 6 h. a minimum 6 h of incubation is needed for
the shedding of 50% of the peg chains . without the 6 h preincubation at
ph 6.8 , only the uptake of the
dox - m - nps was extensive ( figure 2a ) .
however ,
after 6 h of preincubation , the cellular uptake of the dox - as - m - nps ,
but not the dox - ai - m - nps , was significantly increased to a level similar
to that of the dox - m - nps ( figure 2a ) .
( a ) uptake of different dox - nanoparticles ( red ) that were
preincubated or not , at ph 6.8 for 6 h. cells were incubated with
dox - nanoparticles for 20 min .
( b ) intracellular location of dox ( red )
or dox - as - m - nps ( green ) after incubated with j774a.1 cells for 20
min , 30 min , or 1 h. cell nuclei were stained with hoechst ( blue ) .
the red fluorescent signals in
figure 2a
were from the dox and were an indirect indication of the uptake of
the dox - nanoparticles .
a further step was taken by labeling the as - m - nps
with fluorescein ( fitc was chemically conjugated to plga molecules )
to directly observe the cellular uptake of the nanoparticles .
as shown
in figure 2b , dox ( red fluorescence signal )
was observed in the cytoplasm of cells in 20 min , and within 1 h after
incubation , it was in both cytoplasm and cell nuclei ( i.e. , overlap
of red and blue signals ) .
fitc - labeled nanoparticles ( green signals )
were observed in the cytoplasm in 20 min as well , and the fluorescence
intensity in the cytoplasm was increased as the incubation time was
increased ( to 1 h ) ( figure 2b ) . however , the
green fluorescence signals remained in the cytoplasm , not detectable
in the cell nuclei ( figure 2b ) .
the dox that
accumulated in the cell nuclei may be released from the dox - as - m - nps
before and/or after the cellular internalization of the nanoparticles . to evaluate the
extent to which the as - m - nps can deliver dox into tumors , while minimizing
its accumulation in mps organs ( e.g. , liver and spleen ) , the distribution
of dox in tumors , blood , and major organs in c57bl/6 mice with pre - established
subcutaneous ( s.c . )
injected into the mice . as shown in figure 3a ( and figure s1 , supporting
information ) , in mice that were injected with dox - nps or dox - m - nps ,
especially the dox - m - nps ,
significant dox accumulation was observed
in mouse liver , spleen , lung , and kidneys , but not in tumors , 6 h
after the injection . in mice that were injected with the dox - ai - m - nps ,
dox distribution in the liver , spleen , lung , and kidneys of the mice
was reduced , but increased in tumor ( figures 3a and s1 , supporting information ) . in
mice that were injected with the dox - as - m - nps , dox distribution in
tumor
was further increased , as compared to in mice that were injected
with dox - ai - m - nps ( figures 3a and s1 , supporting information ) . shown in figure 3b
are the fluorescence intensities of dox in the
mouse blood 6 h after mice were injected with free dox or various
dox - nanoparticles .
the fluorescence intensity was higher in mice that
were injected with dox - ai - m - nps or dox - as - m - nps and relatively lower
in mice that were injected with the dox - nps or dox - m - nps ( figure 3b ) .
d
( and figure s2 , supporting information )
are the biodistribution of the dox - as - m - nps in s.c .
b16-f10 tumor - bearing
mice 6 , 12 , 24 , and 48 h after i.v . injection .
the fluorescence intensity
of dox - as - m - nps peaked in tumors about 24 h after i.v .
injection ,
whereas the contents dox - as - m - nps in blood and other organs slowly
decreased as a function of time ( figures 3c , d
and s2 , supporting information ) .
representative ex vivo fluorescence images of b16-f10 tumors and other
major organs ( a ) and mean fluorescent intensity of dox in mouse blood
samples ( b ) , 6 h after mice were i.v . injected with pbs , dox , dox - nps ,
dox - m - nps , dox - ai - m - nps , or dox - as - m - nps ( p < 0.05 ) .
( c ) representative ex vivo images of b16-f10 tumors and other major organs 6 , 12 , 24 , or 48
h after mice were i.v . injected with dox - as - m - nps .
( d ) mean fluorescent
intensity of dox in tumors , organs , and blood at various time points
after mice were i.v .
( e ) representative ex vivo images of b16-f10 tumors and other major organs
6 h after mice were injected with dox - as - m - nps or dox - as - nps .
imaging
was repeated in at least 3 mice , with similar trends ( t = tumor , k
= kidneys , h = heart , lr = liver , s = spleen , and ln = lung ) . in order to verify the function
of the mannose - modification on
the biodistribution of the nanoparticles ,
the biodistribution of the
dox - as - m - nps in b16-f10 tumor - bearing mice was compared with that
of the dox - as - nps .
the dox - as - nps was significantly lower than
in mice that were i.v .
injected with the dox - as - m - nps ( figures 3e and s3 , supporting information ) . finally , to confirm that the dox - as - m - nps are effective
in delivering
dox into tumors other than the b16-f10 tumors , athymic nude mice with
s.c .
injected tc-1 mouse lung cancer cells were used . as shown
in figure 4 ,
dox - as - m - nps significantly increased
the delivery of dox in the bxpc-3 tumors ( figure 4a ) and tc-1 tumors ( figure 4b ) , as
compared to free dox .
( a ) relative fluorescence intensities of dox in tumors
and major
organs of athymic nude mice 6 h after they were i.v . injected with
dox - as - m - nps or free dox .
( b ) relative fluorescence intensities of
dox in tumors and major organs of c57bl/6 mice 12 h after they were
i.v . injected with dox - as - m - nps or free dox . imaging was repeated
in 23 mice / group ( k = kidneys , h = heart , and s = spleen )
( * p < 0.05 , dox - as - m - nps , vs dox or pbs in tumors ) .
to understand the role
of tams in the as - m - nps ability to target dox into tumors ,
b16-f10 tumor - bearing mice were treated with zoledronic acid to reduce
the macrophage population , including tams .
immunohistochemical staining
confirmed the reduction of cd206 staining ( an m2 macrophage
marker ) in tumors in mice that were treated with zoledronic acid ( figure 5a ) .
the accumulation of dox - as - m - nps in tumors in
mice that were treated with zoledronic acid was significantly decreased ,
as compared to that in mice that were not treated with zoledronic
acid ( figures 5b and s4 , supporting information ) .
( a ) representative images of b16-f10 tumors
stained with rm0029 - 11h3 .
tumor - bearing mice were treated , or not , with zoledronic acid ( za ) .
( b ) representative ex vivo images of b16-f10 tumors
and other major organs 6 h after mice were injected with dox - as - m - nps .
prior to the injection of dox - as - m - nps
, one group of mice was treated
with za ( t = tumor , k = kidneys , h = heart , lr = liver , s = spleen ,
and ln = lung ) . to test whether dox - as - m - nps
increase the uptake of dox by tams ,
b16-f10 tumor - bearing mice were i.v . injected with free dox or various
dox - nanoparticles , and the percent of cd206 cells that
contained dox ( i.e. , dox / cd206% ) was measured
using flow cytometry 6 h after injection .
as shown in figure 6a , b , the percent of dox / cd206 cells in tumors in mice that were i.v . injected with dox - as - m - nps
was significantly higher than in mice that were injected with free
dox , dox - ai - m - nps , or dox - as - nps .
in fact , it was 23-fold
higher in tumors in mice that were injected with the dox - as - m - nps
than with other nanoparticles or free dox ( figure 6b ) .
uptake of dox by cd206 cells in b16-f10 tumors 6 h
after tumor - bearing mice were i.v . injected with free dox or various
dox - nanoparticles .
( a ) representative flow cytometric graphs of single
tumor cell suspensions after stained with fitc - labeled anti - cd206 .
( b ) the percentage of cd206 cells in b16-f10 tumors that
took up dox ( i.e. , dox / cd206% ) .
data are mean
sem from at least 3 mice ( p < 0.05 ) . because the dox - as - m - nps
were shown to be more effective than other
nanoparticles in delivering dox into tumors , while minimizing the
accumulation of dox in mps organs such as liver , the antitumor activity
of dox - as - m - nps was evaluated in b16-f10 tumor - bearing mice and compared
to that of free dox .
b16-f10 tumors in mice that were i.v . injected
with the dox - as - m - nps grew significantly slower than in mice that
were injected with free dox at an identical dox dose ( figure 7a ) . at the end of the study ( i.e. , 16 days after
tumor cell injection ) ,
the mean weight of tumors in mice that were
treated with dox - as - m - nps was about 50% of that in mice that were
treated with free dox , less than 20% of that in mice left untreated
( figure 7b ) .
shown in figure 7c are digital images of tumors at the end of the study , and
the mean body weights of the mice during the treatment period are
in figure 7d . in vivo antitumor activity
of dox - as - m - nps .
( a )
growth curves of b16-f10 tumors in c57bl/6 mice that were treated
with dox - as - m - nps ( ) or free dox ( ) .
arrows indicate days on which
mice were treated ( * p < 0.05 , dox vs dox - as - m - nps ) .
mean weight ( b ) and digital photographs ( c ) of tumors on day 16 ( in
panel b , p < 0.05 ) .
( e ) representative micrographs of tumors stained with h&e ,
anti - cd31 antibody , or anti - brdu antibody ( necrotic areas , hemorrhagic regions , and blood vessels ) . for h&e
and anti - cd31 staining , bar = 100 m ; for anti - brdu staining ,
bar = 50 m . in panels
a , b , and d , data are mean sem
( n = 8) .
tumors in mice that were injected with sterile pbs ( i.e. ,
negative
control ) showed large cell nuclei and small intercellular spaces ,
with necrosis and hemorrhage rarely observable ( h&e ) , while cd31 ( an angiogenesis maker ) and brdu staining ( a
cell proliferation marker ) were extensive ( figure 7e ) .
tumors in mice that were treated with free dox had some
necrotic areas and small hemorrhagic regions , and cd31 and brdu staining remained extensive ( figure 7e ) .
in contrast , tumors in mice that were treated
with dox - as - m - nps showed numerous necrotic and hemorrhagic areas ,
with decreased cd31 staining and brdu staining
( figure 7e ) . to evaluate the effect of the dox - as - m - nps
on tams and macrophages in mps , the tumor , liver , and spleen tissues
from b16-f10 tumor - bearing mice that were treated with dox - as - m - nps
were stained with anti - cd206 ( an m2 macrophage marker ) or rm0029 - 11h3
( a pan - macrophage marker ) .
mice were treated with dox - as - m - nps or
free dox at 6 and 12 days after tumor cell injection , and tissues
were collected 4 days after the second treatment . as shown in figure 8a , the extent of cd206 staining was
significantly lower in tumors in mice that were treated with dox - as - m - nps
than in mice that were treated with free dox or left untreated .
however ,
there was no apparent difference in the extents of rm0029 - 11h3 staining in the liver and spleen in mice that were treated
with dox - as - m - nps or free dox ( figure 8b ) .
representative
micrographs of ( a ) tumor tissues stained with anti - cd206
antibody ( bar = 50 m ) and ( b ) liver and spleen tissues stained
with rm0029 - 11h3 ( bar = 100 m ) .
traditionally , active tumor - targeting is
focused on exploiting
receptors and proteins that are overexpressed by tumor cells or molecules
that are overexpressed in tumor neovasculature .
recently , there is increasing interest in exploring other cellular
or noncellular components in tumor tissues , such as immune cells ,
fibroblasts , and extracellular matrix materials , for active tumor
targeting .
in fact , there have been some efforts in utilizing tams as a target
for tumor imaging .
altering the tumor microenvironment
that is involved in tumor angiogenesis and progression could markedly
decrease metastasis , gaining better response to tumor resistance .
in addition , since tams exist mainly in the stroma of many tumors , targeting of tams could be an effective antitumor strategy for a
wide variety of tumors .
our data indicated that acid - sensitive sheddable
pegylation and mannose - modification of plga nanoparticles could increase
the distribution of the plga nanoparticles in tumor tissues via interaction
with tams while decreasing their accumulation in mps organs such as
liver .
injection ,
free dox hardly accumulated in tumors and major organs such as liver ,
spleen , heart , lung , and kidneys .
the un - pegylated dox - nps mainly
accumulated in mps organs such as liver , likely due to opsonization .
dox - m - nps were un - pegylated , but surface - modified
with mannose , and their accumulation in mouse liver , lung , and kidneys
were further increased , as compared to dox - nps , likely because of
the presence of mr - expressing macrophages in those organs as well .
both dox - as - m - nps and dox - ai - m - nps are pegylated , and as expected ,
their distributions in major organs such as liver , lung , and kidneys
were significantly decreased , but increased in tumor tissues ( figure 3a ) , and data in figure 3b
indicate that pegylation increased the blood circulation time of the
nanoparticles .
importantly , compared to dox - ai - m - nps , the distribution
of dox - as - m - nps in tumor was significantly higher , demonstrating the
importance of acid - sensitive sheddable pegylation in increasing the
delivery of the nanoparticles into tumors . in order to understand
the significance of surface - modification with mannose on the nanoparticles
ability to target tumors ,
the biodistribution of dox - as - m - nps and
dox - as - nps were compared , and data in figure 3e showed that the tumor accumulation of dox - as - m - nps was significantly
higher than that of dox - as - nps , confirming that both acid - sensitive
sheddable pegylation and surface - modified with mannose are required
for successful targeting of the dox - nps into tumors .
injection
dox - as - m - nps increased the delivery of dox into s.c .
the observed
relatively higher accumulation in spleen was likely related to the
relatively higher background fluorescence signal in the spleen ( especially
in the tc-1 tumor bearing mice ( figure 4b ) ) ,
as compared to in other organs tested .
a similar trend was also observed
when tested in male nude mice with orthotopic panc-1 human pancreatic
tumors and in female nude mice with orthotopic mda - mb-231 human breast
tumors ( data not shown ) .
therefore , the as - m - nps ability to
increase the biodistribution of molecules carried by them into tumors
is not limited to the b16-f10 tumors .
tams are critical for the as - m - nps
to target tumors , and thus , the distribution of as - m - nps in different
tumors will likely be affected by the population of tams in the tumors .
therefore , the as - m - nps will
likely be more effective in targeting tumors that contain a higher
population of tams .
zoledronic acid belongs to a group of bisphosphonates ,
which are
often used to reduce macrophage population in mouse models .
data in figure 5b showed
that the distribution of dox - as - m - nps in tumors in mice that were
treated with zoledronic acid was significantly reduced , as compared
to in similar tumor - bearing mice that were not treated with zoledronic
acid , demonstrating that tams are required for the as - m - nps to successfully
improve the distribution of dox into tumors .
in fact , dox - as - m - nps
increased the uptake of dox by tams in b16-f10 tumor - bearing mice
by 23-fold , as compared to dox - ai - m - nps or dox - as - nps ( figure 6 ) , further indicating that the interaction between
the mannose on the surface of the dox - as - m - nps and tams after acid - sensitive
shedding of the peg chains from the nanoparticles in tumor tissues
is critical for the enhanced delivery of dox into tumors .
data
in figure 7 showed that dox - as - m - nps
are significantly more effective than free dox in controlling tumor
growth .
in addition , the dox - as - m - nps were also more effective than
free dox in suppressing angiogenesis ( cd31 staining ) and
cell proliferation ( brdu staining ) in tumor tissues ( figure 7e ) . the stronger antitumor activity of the dox - as - m - nps
is likely in part due to the nanoparticle s ability to increase
the delivery of dox into tumors ( figure 3a ) .
however , it remains unknown to what extent the stronger antitumor
activity of the dox - as - m - nps can be attributed to their ability to
reduce the tam population in tumors ( figure 8a ) . in vitro cytotoxicity data
showed that dox - as - m - nps
were cytotoxic not only to b16-f10 tumor cells , but also to the j774a.1
macrophages , and shedding of the peg chains on the dox - as - m - nps significantly
increased the nanoparticle s cytotoxicity to j774a.1 cells
( figure 1d ) .
in b16-f10 tumor - bearing mice , i.v .
injection of dox - as - m - nps almost doubled the percentage of tams that
took up dox , as compared to i.v .
therefore ,
the strong antitumor activity of the dox - as - m - mps is likely related
to their ability to reduce tam population in tumors .
it is possible
that b16-f10 tumors with a reduced population of tams are smaller
than the same b16-f10 tumors with a normal population of tams . in
addition , since tams promote tumor cell proliferation and induce immune
suppression , a reduction of tam population in tumors may also have
contributed to the slower tumor growth in mice that were treated with
dox - as - m - nps . of course ,
although dox - as - m - nps increased the delivery
of dox into tams ( figure 6 ) , it is unlikely
that all the dox - as - m - nps that reached the tumor were taken up by
tams .
some dox - as - m - nps that were delivered to tumor tissues were
likely taken up by b16-f10 tumor cells .
in addition , some dox that
was released from the dox - as - m - nps , before or after the nanoparticles
reached tumors , may also have been taken up by tumor cells .
therefore ,
the mechanism underlying the strong antitumor activity of the dox - as - m - nps
is expected to be multifactorial .
for example , the dox - as - m - nps were
also more effective than dox alone in inhibiting angiogenesis and
cell proliferation in tumors ( figure 7e ) .
it
was noted that extensive necrosis was present in tumors in mice treated
with dox - as - m - nps ( figure 7e ) .
it is possible that the dox that was slowly released from the dox - as - m - nps
maintained a low concentration of dox in the tumor tissues and caused
the significant necrosis . shown in figure 8 are the micrographs of
tumor , liver , and spleen tissues of b16-f10 tumor - bearing mice after
the tissues were stained with anti - cd206 ( an m2 macrophage marker )
or rm0029 - 11h3 ( a pan - macrophage marker ) .
compared to the tumor tissues
from mice treated with free dox or left untreated , the extent of cd206 staining was significantly decreased in tumors in mice that
were treated with dox - as - m - nps ( figure 8a ) ,
demonstrating dox - as - m - nps ability to reduce tam population
in tumor tissues .
importantly , the extents of rm0029 - 11h3-positive
staining in both liver and spleen of mice that were treated with dox - as - m - nps
appear not different from that in mice treated with free dox or left
untreated ( figure 8b ) , indicating that the
dox - as - m - nps did not significantly affect the total macrophage population
in mps organs such as liver and spleen . many compounds including
the bisphosphonate zoledronic acid can
be used to deplete tams .
however , zoledronic
acid also significantly affects macrophages that do not reside in
tumors .
the as - m - nps are advantageous because they can target tumors
and tams but have only minimum effects on macrophages that are not
tumor - associated .
of course , since macrophages are white blood cells
differentiated from monocytes , arising from progenitor cells in the
bone marrow , there is the possibility
that 4 days after the second treatment of the b16-f10 tumor - bearing
mice with dox - as - m - nps any major effects that the dox - as - m - nps may
have had on macrophages in mps organs were restored , whereas the tam
population in tumors may take a longer time to replenish .
more experiments
will need to be carried out to study the effect of the dox - as - m - nps
on the dynamics of macrophages in tumor and nontumor tissues in the
future . nonetheless , when fully developed , the tam - targeting nanoparticle
platform can potentially be applied to deliver cytotoxic agents or
macrophage - modulating agents into tumors to decouple the interaction
between tams and tumor cells , making the tumor microenvironment less
favorable for tumor growth , but more favorable for chemotherapy .
we demonstrated that surface - modification of plga nanoparticles
with acid - sensitive sheddable peg molecules and mannose as a ligand
of mr , which is overexpressed on tams , allows the nanoparticles to
effectively target dox into tumors .
the targeting is dependent on
the presence of sufficient tams in tumors . compared to free dox , dox
carried by the acid - sensitive sheddable pegylated , mannose - modified
plga nanoparticles
more effectively inhibited tumor growth , reduced
tam population in tumors , but showed no or only minimum effect on
the macrophage population in mps .
Output:
| tumor - associated
macrophages ( tams ) are increasingly considered
a viable target for tumor imaging and therapy .
previously , we reported
that innovative surface - functionalization of nanoparticles may help
target them to tams . in this report , using poly(lactic - co - glycolic ) acid ( plga ) nanoparticles incorporated with doxorubicin
( dox ) ( dox - nps ) , we studied the effect of surface - modification of
the nanoparticles with mannose and/or acid - sensitive sheddable polyethylene
glycol ( peg ) on the biodistribution of dox and the uptake of dox by
tams in tumor - bearing mice .
we demonstrated that surface - modification
of the dox - nps with both mannose and acid - sensitive sheddable peg
significantly increased the accumulation of dox in tumors , enhanced
the uptake of the dox by tams , but decreased the distribution of dox
in mononuclear phagocyte system ( mps ) , such as liver .
we also confirmed
that the acid - sensitive sheddable pegylated , mannose - modified dox - nanoparticles
( dox - as - m - nps ) targeted tams because depletion of tams in tumor - bearing
mice significantly decreased the accumulation of dox in tumor tissues .
furthermore , in a b16-f10 tumor - bearing mouse model , we showed that
the dox - as - m - nps were significantly more effective than free dox in
controlling tumor growth but had only minimum effect on the macrophage
population in mouse liver and spleen .
the as - m - nps are promising in
targeting cytotoxic or macrophage - modulating agents into tumors to
improve tumor therapy . |
PubmedSumm6890 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| we present a case of progressive interstitial fibrosis in a retired shipyard worker who was exposed to asbestos during the postwar era of the late 1940s and 1950s , when asbestos exposures in the workplace were not regulated .
forty years later , at 63 years of age , the patient presented with restrictive lung disease .
the patient was diagnosed with asbestos - related pleural disease and parenchymal asbestosis .
he remained stable for the next 7 years , but then he began to manifest rapid clinical progression , which raised the possibility of an unusual variant of asbestosis , a concomitant interstitial process , or an unrelated disease .
lung biopsy was not undertaken because of the patient 's low pulmonary reserve and limited treatment options .
an empiric trial of oral steroids was initiated , but his pulmonary status continued to deteriorate and he died of pulmonary failure at 72 years of age .
many diseases result in pulmonary interstitial fibrosis .
ideally , open lung biopsy should be performed , but this procedure inevitably causes complications in many patients with end - stage restrictive lung disease . furthermore , while the presence of asbestos bodies in tissue sections is a sensitive and specific marker of asbestos exposure , neither this finding nor any other charge is a marker indicative of asbestosis or the severity of asbestosis . with the enactment of the asbestos standard in the united states , asbestos exposures have been decreasing in this country .
however , industries that produce asbestos products and wastes continue to expand in developing countries .
prevention of asbestos - related lung disease should be a global endeavor , and asbestos exposures should be regulated in both developed and developing countries.imagesfigure 1figure 2figure 3figure 4 |
PubmedSumm6891 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: alcoholism is one of the major health and social problems faced in developing countries . although there are various drugs , none of them proved to be efficacious in the long run owing to the cost , adverse effects and the inadequate compliance for the long term management of alcohol de - addiction . for naltrexone and acamprosate , though approved in the west , their cost effects are a burden for the lower and middle class in the indian society .
but its compliance rates are considerably affected due to the large number of adverse effects contributing to the high percentage of default rates .
although majority of adverse effects was noted by poulsen et al , they also stated that it could not be differentiated from sobriety or manifestations of alcohol abuse . since efficacy of a medication depends on its mode of action , seriousness of illness and its toxicity , this cross - sectional study is aimed at noting the efficacy of 125 mg od dsm in contrast to the study conducted on 250 mg od dsm by srinivasan et al , on patients , initially in the hospital and later at the home setup under supervision .
this study concentrated mainly on adverse effects , change in laboratory parameters and compliance rates .
this cross - sectional study was conducted on alcohol - dependent patients who were undergoing detoxification for alcoholic de - addiction therapy in a private hospital for 40 days .
dsm iv criteria , alcohol - dependent patients.alcoholics 20 - 60 years of age with normal liver function test 's after detoxification .
alcoholics 20 - 60 years of age with normal liver function test 's after detoxification .
relapse cases.liver function test 's above normal range .
liver function test 's above normal range . patients satisfying inclusion criteria were examined and routine investigations like complete hemogram , lipogram , blood glucose , serum electrolytes , liver function test and occult blood in stool along with psychiatry evaluation before the administration of dsm and on the 30 and 60 days of dsm administration . patients received 125 mg of dsm od after lunch initially under supervision of hospital staff and later by the family members , to enhance the compliance rates .
patients were followed up regularly during hospital stay for the first 30 days and later weekly up to the 60 day . at each follow up , drug adverse effects , alcohol consumption and default rate was noted .
days of abstinencedropout rate ( > 5 alcoholic drinks/40 g alcohol in 24hr).adverse effects complainedalterations in the lab parameters
dropout rate ( > 5 alcoholic drinks/40 g alcohol in 24hr ) .
adverse effects complained alterations in the lab parameters statistical analysis was done using spss package , kruskal - wallis test , wileoxon - segned rank sum test , anova ( fishers test ) and students paired - t - test .
dsm iv criteria , alcohol - dependent patients.alcoholics 20 - 60 years of age with normal liver function test 's after detoxification .
alcoholics 20 - 60 years of age with normal liver function test 's after detoxification .
liver function test 's above normal range . patients satisfying inclusion criteria were examined and routine investigations like complete hemogram , lipogram , blood glucose , serum electrolytes , liver function test and occult blood in stool along with psychiatry evaluation before the administration of dsm and on the 30 and 60 days of dsm administration . patients received 125 mg of dsm od after lunch initially under supervision of hospital staff and later by the family members , to enhance the compliance rates .
patients were followed up regularly during hospital stay for the first 30 days and later weekly up to the 60 day . at each follow up , drug adverse effects , alcohol consumption and default rate was noted .
days of abstinencedropout rate ( > 5 alcoholic drinks/40 g alcohol in 24hr).adverse effects complainedalterations in the lab parameters
dropout rate ( > 5 alcoholic drinks/40 g alcohol in 24hr ) .
adverse effects complained alterations in the lab parameters statistical analysis was done using spss package , kruskal - wallis test , wileoxon - segned rank sum test , anova ( fishers test ) and students paired - t - test .
the results of this study indicated that there were few adverse drug reactions ( adr ) with dsm [ figures 17 ] .
this may be due to either fallacious reporting or symptoms present in sobriety which was aggravated with dsm and those were tiredness , depression , nausea and anxiety .
this is similar to the findings by zawar and nerliers vide figures 89 , where a thirty - three year old male developed pustular lesions after 42 - 43 days of dsm therapy .
a forty seven year old male had an aggravation of psoriatic lesion after 32 days of dsm therapy shown in figure 10 .
no instance of psychosis which is common in india was noted with 125 mg dsm when compared to the study conducted by srivasan et al . in our study ,
psychiatric clinical examination was done on admission , 30 , and 60 days . among these , 5 of them had depressive symptoms , 16 had hallucination and 10 of them had both the symptoms vide figure 1 .
there were significant changes in lab parameters of sgpt(p=0.007 ) , sgot(p=0.001 ) , ggt(p=<0.001 ) , mcv(p=0.001 ) , serum cholesterol ( p=0.002 ) , serum hdl(p=0.05 ) , serum ldl(p=0.014 ) especially between first and third samples showing in dsm playing an important role in altering liver functions .
figure 5 shows sgot having significant change in samples between 0 - 30 day and 0 - 60 day . in figure 6 ,
the variation in ggt values between 0 - 30 , 30 -60 , and 30 -60 days were significant as per wileoxon - segned rank sum test .
mcv values between 0 - 30 , 30 - 60 , and 30 -60 days were significant based on students paired - t - test as shown in figure 7 .
the adr was not of severe magnitude that necessitated withdrawal of drug or institution of life saving measures which was similar to the findings of liskow et al , and contrary to borup et al .
no hepatic dysfunction was noted though it is a well known adr for which liver function tests were done during dsm treatment as per recommendations by wright et al , at 2 week interval at initial 2 months and later at 3 - 6 month interval .
it may be due to careful selection of patients , low dose of dsm and short period of assessment .
histogram of adverse drug reaction group - comparison values of individual lab parameters comparison between sgot samples taken on 0 , 30 , and 60 day comparison between ggt samples taken on 0 , 30 , and 60 day comparison between mcv samples taken on 0 , 30 and 60 day patient having a pustule in the anterior abdomen wall along left mid - clavicular line pustular lesion from a close view patient with dsm induced aggravated skin reaction dsm was well tolerated and had lesser dropout rate .
the reason for dropouts includes easy availability of alcohol , failure of supervision and deceleration of motivation .
patients find it difficult to differentiate between the symptoms of alcohol withdrawal and those due to adr of dsm
none of the patients blamed adr in particular , for the default which is similar to the findings of srinivasan et al , and contrary to borup et al .
although nitrazepam was used for the detoxification in the study , its influence in the de - addiction therapy per se is minimal .
the effect of various drugs like naltrexone , dsm , acamprosate , fluoxetine and serotonergic agents like ondansetron used in the present day alcoholic de - addiction therapy is literary disappointing .
ssri like fluoxetine has no effect on drinking behaviour per se , but it may treat underlying depression leading to drinking .
benzodiazepines are effective as an adjuvant and are not the mainstay treatment in de - addiction therapy .
studies showed that ondansetron is useful only in cases of early onset of alcohol dependence and topiramate is more efficacious than placebo but not as a long - term treatment option .
the complex interplay of various systems like dopamine , opiod , serotonin , glutamate , gaba on addiction makes its treatment , a daunting possibility .
this is reflected in the varied drugs that are used in alcohol de - addiction i.e. nalmefene , tiapiride , metronidazole , lithium , and ondansetron .
presently dsm , naltrexone and acamprosate are approved drugs for alcohol de - addiction therapy .
naidu et al , in their study , concluded that naltrexone had less craving for alcohol along with significant decline of ggt level when compared to dsm . also naltrexone had better outcome in reducing relapse rates when compared to that of acamprosate .
a study by staffen et al , showed that dsm was better than naltrexone and acamprosate both on cost , efficacy and in reduction of alcohol craving and binge drinking.[1921 ] thus playing an important role in long term management in alcohol de - addiction along with effective psychotherapy and counseling unlike to the writings of mann and williams .
other studies supporting for long term dsm management and it being better than other treatment protocols are petrakis et al , and de souza .
although there were some adr , 76.5% of patients had taken full course of treatment and thereby it shows that adr werent the reason for default and dsm achieved better compliance without losing its primary deterrent action and psychological effects .
since usage of dsm needs repeated physician 's advice and active decision process by the patient , fear and experience of dsm - ethanol reaction further helps him to continue sobriety .
dsm - ethanol reaction noted in this dosage was of mild intensity which could be taken care at a primary care setting . to increase the efficacy of de - addiction management , combination of pharmacotherapy acting on various neuronal pathways
one such methodology is usage of dsm implants alone or in combination with naltrexone for higher abstinence rates .
long - term acting injectables are another way to look forward in order to avoid supervision and achieve long - term compliance rates .
molecular and behavioral advances can be utilized interfering with alcohol metabolism based on genetic characteristics of the individuals .
the concerns with alcohol addiction are wide and appropriate regulations and treatment protocols have to be formulated mainly by addictive medicine , a specialty subject which is the need of the hour .
moreover it 's safe and effective.dsm as an unsupervised domiciliary therapy for the larger part of 6 the months therapy is a cause for concern as there is a point where deceleration in motivation , overwhelming temptation and easy availability crack the de - addiction course leading to relapse .
supervised domiciliary therapy for a 6-month period along with active participation at psychosocial and alcoholic anonymous meetings is advocated.occurrence of adr is not the reason for default.patient finds it confusing to differentiate adr from symptoms of alcohol manifestation.dsm-ethanol reaction at this dosage can be managed at primary care setting.use of long acting dsm , injectables , implants , combination of drugs , pharmacotherapy based on genetic characters is another option to look for .
dsm as an unsupervised domiciliary therapy for the larger part of 6 the months therapy is a cause for concern as there is a point where deceleration in motivation , overwhelming temptation and easy availability crack the de - addiction course leading to relapse .
supervised domiciliary therapy for a 6-month period along with active participation at psychosocial and alcoholic anonymous meetings is advocated .
use of long acting dsm , injectables , implants , combination of drugs , pharmacotherapy based on genetic characters is another option to look for .
Output:
| aim : assessment of safety and efficacy profile of disulfiram ( dsm ) in the alcoholic de - addiction regimen.objectives:a .
assessment of adverse drug reaction ( adr ) profile ; b. evaluation of effectiveness of various deaddiction regimen ; c. defaulters and dropoutspatients and methods : fifty - one patients in a de - addiction center were investigated on 0th , 30th and 60th day along with psychiatric evaluation , adr surveillance was made .
statistical analysis was done thereafter.results:125 mg dsm given od for 2 months .
76.5% patients had taken full course of treatment , 45% did n't complain of any adr . of adr reported 27.4% had drowsiness , 21.4% tiredness , 7.8% skin manifestation.conclusion:dsm is the main drug among naltrexone , acamprosate , nalmefene and other drugs used in alcoholic de - addiction .
relative and effectiveness is lost by the degree of dropouts and hence relapses .
low - dose dsm had decreased adverse effects with 76.5% patients taking the full course of treatment .
dsm alters liver functions as there were significant changes in the lab parameters of sgpt(p=0.007 ) , sgot(p=0.001 ) , ggt(p=<0.001 ) between first and third samples .
occurrence of adr is not the cause of default ; patients find it confusing to differentiate between the symptoms of alcohol withdrawal and those due to adr of dsm . |
PubmedSumm6892 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: migration of physicians has become a prominent issue as a result of the increasing globalisation of the physician workforce .
the establishment of regional labour markets has provided a new legal framework governing the international movements of individuals .
such a framework may foster the free movement of physicians , particularly through the harmonisation and recognition of qualifications and diplomas across countries .
foreign physicians also play an important role in compensating for an inadequate domestic supply in many countries of the oecd .
the permanent departure of skilled labour might deplete the human capital of home countries , thus reducing the possibility for economic growth and raising the level of inequalities and poverty in those countries .
moreover , increasing concerns in host countries about the safety and quality of health care provision by foreign physicians has created barriers to migration and , in some cases , discrimination against foreign physicians .
this paper presents a comprehensive study of international migration of physicians by documenting migration flows in oecd countries and by analysing impact , regulation , and health policy implications of physician migration . the empirical evidence on the contribution of foreign physicians to the physician workforce of oecd countries is briefly reviewed . a societal perspective is then adopted to analyse the benefits and costs of physician migration on home and host countries . international regulation governing physician migration and its impact on migration flows are examined in the subsequent section
. policies that oecd countries have implemented to attract foreign physicians in order to sustain their domestic physician workforce are then evaluated .
the final section discusses lessons learnt from experiences of oecd countries with physician migration with a view to developing approaches to physician migration that confer benefits on home and host countries .
in order to investigate the complexity of international migration of physicians , information was derived from a variety of data sources . the secretariat sent a quantitative questionnaire to national correspondents of participating oecd countries .
this questionnaire elicited data about the proportion of practising physicians who are foreign - trained and the number of physicians who move abroad to attend postgraduate training or to practise . in order to be able to judge the quality and comparability of data across countries , national correspondents provided details of the body responsible for collecting data , the national source of information , the coverage and time period of the data .
correspondents were also able to provide additional comments on data quality , if they so wished .
in addition to this , the secretariat sent a qualitative questionnaire to correspondents , which dealt with issues relating to the impact of immigration and emigration on physician supply , the recognition of foreign - trained physicians , and policies governing physician migration .
both questionnaires were designed by the secretariat and approved by national correspondents during an expert meeting dedicated to the data collection exercise in april 2001 .
questionnaires were sent to the 22 oecd countries that expressed a wish to participate in the study during autumn 2002 , with 17 countries returning at least one of the two questionnaires .
these countries were australia , austria , canada , france , germany , japan , korea , mexico , netherlands , new zealand , norway , slovak republic , spain , sweden , switzerland , united kingdom and united states ( response rate of 77% ) .
this was supplemented by a secondary analysis of data on physician migration flows from the eurostat labour force survey .
the review was not systematic , but designed to identify and learn from the experiences of oecd countries with respect to the impact , regulation and health policy implications of international migration of physicians .
the following electronic databases were searched : medline , embase , healthstar , social science citation index , health management information consortium , and econlit .
individual journals in this field were searched and additional studies were collected from the bibliographies of articles retrieved . national correspondents and a number of experts in this area of research
were also contacted in an effort to access official documents produced by oecd governments , unpublished studies and conference reports . statements made in this article are based on the findings of the survey , unless otherwise stated .
annual flows of physicians in and out of a country are an important factor influencing domestic supply . in canada
, the net effect of immigration and emigration flows of physicians has generally been a net loss to the canadian physician workforce over the last two decades ( see figure 1 ) .
foreign - trained physicians now make a substantial contribution to the national supply of physicians , particularly in anglo - saxon countries where they comprise more than 20% of the physician workforce in 2000 ( see figure 2 ) .
international migration of physicians appears to be driven by a number of ' pull ' factors such as opportunities for professional training , offers of higher wages , and better employment opportunities in the host country . '
push ' factors such as less attractive pay and working conditions , high unemployment rates , political instability and insecurity in the home country also play a role .
notes : data for england relate to physicians in the national health service . data for new zealand refer to foreign - trained practicing physicians .
] physicians move abroad for training purposes , either to obtain a medical degree , to acquire additional professional qualifications or to gain experience with medical techniques .
immigration for training purposes can account for a substantial number of foreign - trained physicians in a country .
overseas physicians who were attending postgraduate training in england made up 39.6% of all overseas physicians in the national health service in 1995 , 36.2% in 2000 and 37.3% in 2001 .
international medical graduates who came to the united states to attend postgraduate training comprised 11.9% of all international medical graduates in 1980 , 12.1% in 1990 , 15.1% in 1995 and 13.1% in 2000 .
similarly , training opportunities may account for a significant proportion of emigrating physicians . in 2001 ,
the number of physicians who were registered in switzerland , but were living abroad to attend postgraduate training and to practise was 555 and 629 , respectively .
table 1 reports the composition of the foreign(-trained ) physician workforce of selected oecd countries .
these data show that developing countries are just one , but not necessarily the main source of international recruitment of physicians by oecd countries : a large contribution to the foreign physician workforce of australia , austria , belgium , canada , denmark , france , germany , ireland , norway and switzerland originated from another european country .
although a large proportion of foreign(-trained ) physicians in the united kingdom and the united states originate from india , this country is actively pursuing a policy to export physicians .
supply of foreign(-trained ) physicians in selected oecd member countries sources : eurostat labour force survey , [ 17 - 21 ] .
additionally , table 1 illustrates that flows of physicians between oecd countries are not always unidirectional .
countries showing a high number of physicians ' emigration also present a significant inflow of foreign - trained physicians , who usually end up in posts that nationals are reluctant to take .
for instance , during the 1990s , around 1% of the canadian stock of active physicians left the country each year , the majority to the united states . on the other hand
, we note that nowadays around 25% of canada 's practicing physicians are foreign - trained .
the major source of foreign - trained physicians was the uk , followed by south africa and india .
in particular alberta and saskatchewan have been actively recruiting primary care physicians from south africa to fill practices located in remote areas .
for instance , in the 1960s many physicians working in developing countries originated from developed countries , but in the 1990s developing countries were estimated to supply 56% of all migrating physicians and receive less than 11% .
language affects migration flows in that physicians are more likely to move between countries speaking the same language . amongst oecd countries ,
this is mirrored in the incidence and extent of migration flows between australia , canada , ireland , the united kingdom and the united states ; between austria , germany and switzerland ; between belgium and france ; and between denmark , finland , norway and sweden ( see table 1 ) .
historical , administrative and legislative frameworks , training institutions , professional associations and regulation have influenced practices in former colonies and affected the migration of physicians for training and employment opportunities .
this explains the significant migration flows of physicians from india towards australia , canada , the united kingdom and the united states and from north african and middle eastern countries to france ( see table 1 ) .
migration of physicians is not necessarily beneficial from a social point of view . in making the decision to move , the potential migrant takes into account the private costs and benefits of the move .
however , migration also produces externalities that influence the welfare of people in both the home and host country . in assessing the impact of physician migration on health care provision in the home country , it is crucial to consider the issues of physician supply and the duration of migration . a number of countries such as cuba , india and the philippines systematically train more physicians than they need and send them abroad to benefit from remittances .
remittances , the money that migrants earn working abroad and send back to their home country , can be a crucial source of foreign exchange and aid the long - term development of the home country .
for instance , a study focusing on physicians from the philippines who practise overseas estimated that remittances were large enough to compensate for the economic losses associated with emigration .
the impact of emigration on health care provision in the home country is limited , as these countries have an adequate supply of physicians . however , many host countries are developing countries that face physician shortages themselves . in this case
, emigration represents a brain drain from home countries and is likely to lead to a deterioration in the working conditions of remaining physicians .
moreover , it may affect access to and quality of care , and impair the ability of the health care system to achieve health objectives for its population .
migration may also influence the capacity of the home country to provide quality training to new physicians and the research capacity of medical schools .
for instance , in nigeria and other countries in sub - saharan africa , most medical research institutions have collapsed from the massive emigration flows of highly - skilled physicians .
it is also important to distinguish between permanent and temporary migration . whereas temporary migration of physicians may produce benefits through an upgrading of skills , technological and financial transfers , permanent migration represents a net transfer of human capital from the home to the host country . in the case of permanent migration
, the home country incurs two types of costs : the first corresponds to resources spent to educate a physician ; and the second represents the value of the health care services that the emigrating physician would have rendered to his / her country in the absence of migration .
permanent migration might improve the prospects of individual physicians , but substantial and lasting emigration flows may weaken the capacity of the home country 's health care system .
these consequences are most important in the poorest countries that are not able to attract substitutes from other countries .
temporary migration may be inspired by the desire to acquire higher professional qualifications or to gain experience with new techniques not available in the home country .
if the host country subsidises the education of foreign students and these migrants return to their home country after they graduate , temporary migration of physicians can contribute to a general upgrading of skills in the home country .
if the skills that migrants have acquired during their stay abroad are too specialised , the home country may not be in a position to take advantage of them . in oecd countries ,
this is because foreign physicians are more willing to practise in certain organisational settings and in certain geographical areas that domestic physicians tend to avoid .
this is sometimes referred to as the ' safety - net ' role . in the united kingdom ,
general practitioners who graduated in south asian medical schools ( bangladesh , india , pakistan and sri lanka ) are concentrated in less attractive areas with large patient lists and relatively deprived populations . in the united states ,
however , in canada , policies requiring foreign physicians to practise in pre - specified areas have been legally challenged as a violation of basic human rights and have been judged against the canadian charter of human rights .
consumers may benefit from improved access to care and may gain from reduced medical care prices .
estimates of the gain to consumers from immigration in the united states , measured as a percentage of total expenditures on physician services , ranged from near 1% in 1966 to over 12% by 1971 .
increased competition between physicians may raise the quality of health care services provided in the host country . on the other hand
, immigration may endanger the safety and quality of health care provision if the physicians concerned have a lower standard of medical practice .
concerns that qualifications are not equivalent across countries and differences in practice patterns have been used by professional associations to exclude foreign physicians .
although oecd countries generally favour long - term policies of national self - sufficiency to sustain their physician workforce , such policies usually co - exist with short - term or medium - term policies to attract physicians from abroad , on a temporary or permanent basis .
immigration of physicians is considered to be important in maintaining an adequate supply of physicians in countries such as australia , canada , england , germany , new zealand , norway , sweden , switzerland and the united states .
conversely , canada , new zealand and sweden perceived physician emigration to negatively affect the supply of physicians in their country . as a result , oecd countries have entered into international agreements regulating physician migration by imposing general requirements that physicians have to fulfil in order to move and work abroad .
these provisions refer to , amongst other things , nationality and citizenship requirements , national regulation governing the issuance of work permits , procedures and tests for examining asylum applications .
one of the agreements that covers the temporary immigration of physicians into an oecd country is the general agreement on trade in services ( gats ) . if a wto member decides to make a commitment to the sector of health services , the country must specify whether and to what extent market access and national treatment are granted .
if a wto member grants full market access , the country must refrain from operating any of six types of restrictions enumerated in article xvi of the agreement .
these are mostly quota - related barriers that may limit , for example , the number of service providers ( hospitals , physicians , etc . ) or operations ( number of beds , practices , etc . ) .
also precluded under this article is the use of economic need tests , e.g. the conditioning of access approvals on pre - established indicators such as the number of hospital beds or practices per head of population .
members may also provide some , but limited market access , i.e. they may maintain any of the six types of restrictions provided they list them in their schedule of commitments .
article xvii defines national treatment as the absence of any measures that modify the conditions of competition to the detriment of foreign services or service suppliers .
again , however , members are free to make no commitment on national treatment , or to provide partial national treatment provided they list the measures they maintain which discriminate in favour of nationals in their schedule . for the health services sector
, commitments under gats can be made separately for four modes of supply : ( a ) cross - border trade ( e.g. telemedicine ) ; ( b ) consumption abroad ( e.g. a patient travels to another country for health treatment ) ; ( c ) commercial presence ( e.g. a foreign hospital establishes in another country ) ; and ( d ) temporary movement of service suppliers ( e.g. a physician working temporarily in another country ) .
commitments can also be made for a mode of supply across all service sectors ( a so - called " horizontal commitment " ) .
although most countries ' commitments on movement of service suppliers are horizontal , they tend to be very limited , due to sensitivities over the potential impact of temporary foreign workers and the desire of countries to retain full flexibility in their temporary migration regimes .
gats seems to have had a limited impact so far on the migration of physicians .
very few commitments have been made for trade in health services : only 29 countries have made commitments for health services , and then only partial commitments for some health services . commitments to the movement of physicians are also very limited .
for instance , as a result of commitments under the gats , temporary resident visas are available in australia only for suitably qualified physicians who satisfy labour market requirements ( i.e. provide services to rural and remote communities ) .
moreover , within the gats framework , members are free to pursue domestic policies in areas such as technical standards , licensing and qualifications to ensure the safety and quality of health care provision .
that implies that a commitment to allow entry of foreign physicians is still subject to those physicians meeting all domestic regulatory requirements to practise .
gats states only that such requirements must be transparent ( i.e. made publicly available ) and must be administered in a reasonable , objective and impartial manner .
international agreements stimulating the immigration of foreign physicians have been accompanied by requirements licensing medical practice in a country to ensure the quality and safety of services provided by migrants .
however , licensing provisions may also serve to reduce competition in the host country and to raise the income of domestic physicians .
this raises the issue of how foreign physicians are mobilised within the health care system of the host country and the conditions under which they have to work . in some cases ,
this has lead to a situation where physicians whose qualifications have not been recognised by the host country still practise medicine even though their status is unclear . in other cases , specialists work as generalists or generalists work as nurses . once registered , physicians may also face discriminatory employment practices .
a survey showed that 9% of foreign physicians claim discriminatory practices in finding employment in the united kingdom .
licensing requirements usually consist of holding the required qualifications ( i.e. medical degree ) from a recognised medical school and of having completed a period of training
. however , the license is only valid within the jurisdiction of the granting body .
this is usually an entire country , but in some cases a province or state , as in canada and the united states .
this implies that physicians who wish to practise in another country have to go through the process of having their qualifications recognised by the relevant body in the host country . in australia ,
physicians who are seeking permanent residency are required to pass an examination administered by the australian medical council .
this examination is set at the standard of medical knowledge , clinical skills and attitudes required of newly qualified graduates from australian medical schools . in canada , international physicians must take the medical council of canada evaluating examination and must fulfil registration requirements of licensing bodies . in order to practise in the united states
for instance , from 1 may 2002 , graduates of british medical schools recognised by the general medical council are eligible for permanent registration in new zealand without having to sit the new zealand medical council registration examination .
there is also a mutual recognition agreement between australia and new zealand , providing for automatic recognition of primary medical qualifications conferred by all medical schools within these jurisdictions .
licensing provisions governing the migration of canadian physicians to the united states have been simplified in that fewer visa restrictions apply and canadian physicians do not have to pass the clinical skills assessment exams .
the treaty of rome ( enforced in 1957 and subsequently amended by the treaty of amsterdam in 1997 ) gives every european union citizen a fundamental , personal right to move and reside freely within the territory of the member states .
in addition to this , member states have adopted sectoral directives that facilitate the movement of physicians through the harmonisation and recognition of qualifications and diplomas . in the context of physician migration ,
the most relevant directives are the so - called " doctors ' directives " ( 75/362/eec and 75/363/eec ) .
these directives entitle any european union physician who has completed basic training in a member state and who holds a recognised qualification to be automatically registered in any other member state . to this effect
, the doctors ' directives have established minimum standards with respect to the nature , minimum content and length of education and training programmes .
the sectoral directives are based on the principle of mutual confidence and comparability of training levels .
this is reflected in the " recognition of foreign professional qualifications act " , which requires european union member states to consider the practical experience of an individual in the process of recognition of qualifications . in case of structural differences in education and training programmes between countries ,
member states are entitled to require an adaptation period and an aptitude test , which imposes an additional barrier on the migration of physicians .
the impact of the european union doctors ' directives on the movement of physicians has been minimal , except in some isolated cases .
for instance , since the adoption of the directives in 1977 , there has been an increase in the number of physicians emigrating to the united kingdom from other member states , although these numbers have reached a ceiling in more recent years .
the limited impact of the european union doctors ' directives is linked to the general absence of physician surpluses in other member states ( which restricts the pool of potential migrants ) , failure to implement the directives and recognise the equivalence of qualifications by some member states .
in addition , there have been reports that some professional associations refuse to register physicians from certain member states who comply with european union minimum qualification standards . to justify such practices ,
professional associations claim variations in qualifications that might occur because of differences in the number of patient contacts or in practical experience .
this might be linked both to the educational and cultural system of the migrant . in this regard
, we note that flows are more intense among countries with similar health care systems .
furthermore , despite the presence of provisions allowing member states to request information regarding the good character , reputation or the criminal past of an individual , many member states are concerned about the immigration of physicians who have had dubious medical practices in the past .
such concerns are motivated by the fact that some member states have difficulty in keeping reliable data on physicians .
in fact , cases have been reported of physicians who lost their licence to practise in one country for misconduct who were subsequently authorised to practise in another european union country .
given the limited success of international agreements regulating physician migration , oecd countries have adopted specific policies designed to stimulate the immigration of foreign physicians , whilst minimising its negative impact on the home country .
these have consisted of launching international recruitment campaigns , easing immigration requirements and setting up special arrangements that foster shared learning between health care systems .
international recruitment campaigns have involved advertisements in the medical press and participation in job fairs in germany and language courses in norway .
changes to the immigration act regulation favour the immigration of physicians and increased efforts are being made to support licensure of foreign - trained physicians .
australia and the united states have made the relaxation of immigration requirements conditional on foreign physicians practising in rural areas . in ireland
in addition to the two previous types of policies stimulating physician immigration , the united kingdom has put in place arrangements that foster international co - operation and promote the national health service abroad .
an international fellowship programme was launched in 2002 to attract experienced specialists from abroad to selected posts in the national health service for periods of one to two years .
it targets those specialities that need to grow in order to fulfil the national health service plan and those specialities with perceived shortages such as cardio - thoracic surgery , histopathology , radiology , nuclear medicine and psychiatry .
however , concerns about ethical recruitment have led some oecd countries to discourage recruitment from developing countries . in may 2003
, commonwealth countries adopted an international code of practice for the international recruitment of health workers .
the code of practice is intended to discourage physician recruitment from countries that are themselves experiencing shortages .
fairness implies that host countries would not seek to recruit physicians who have an outstanding obligation to the home country and would inform migrants of their rights and job requirements . finally , international recruitment of physicians would be based on mutuality of benefits to host and home countries .
given that the temporary outflow of physicians from developing countries may be beneficial in terms of investment in skills , a second type of policy has focused on offering grants to foreign students to enter medical school , while at the same time making it impossible for foreign graduates to obtain a work permit for a certain amount of time ( e.g. five years ) .
this , in effect , forces them to return to their home country after they graduate .
some oecd countries have created regulations or have entered into bilateral agreements restricting the stay of foreign physicians .
for instance , the united states has created a ' cultural exchange visa ' that can be issued to foreign health care workers only for a limited duration of work .
after the permitted stay , the visitor is required to return home for a two - year period before he is entitled to apply for re - admittance .
a third approach has consisted of financially compensating the developing country for losses in terms of costs of education and training and the value of the health care services that could have been provided if the physician had not left the country .
the reimbursement of educational costs is in fact proposed by the international code of practice approved by commonwealth countries .
however , the problem with such policies is the difficulty in evaluating the country 's net loss ( subtracting direct and indirect costs created by the departure of the physicians from migration gains , such as an increase in scientific knowledge and remittances ) .
in addition , the potential return of the physician might represent a problem in setting the level of compensation .
such difficulties may explain the fact that previous schemes attempting to tax host countries , and even migrants , have not proven to be successful .
few oecd countries appear to have implemented policies to reduce the level of emigration of physicians and little is known about the effectiveness of existing programmes .
new zealand has undertaken efforts to maintain contact with expatriate physicians , encouraging their overseas development while offering some incentives for their return . in ontario , canada ,
a repatriation programme was introduced for canadians who had undertaken a postgraduate training programme in the united states .
annual flows of physicians in and out of a country are an important factor influencing domestic supply . in canada
, the net effect of immigration and emigration flows of physicians has generally been a net loss to the canadian physician workforce over the last two decades ( see figure 1 ) .
foreign - trained physicians now make a substantial contribution to the national supply of physicians , particularly in anglo - saxon countries where they comprise more than 20% of the physician workforce in 2000 ( see figure 2 ) .
international migration of physicians appears to be driven by a number of ' pull ' factors such as opportunities for professional training , offers of higher wages , and better employment opportunities in the host country . '
push ' factors such as less attractive pay and working conditions , high unemployment rates , political instability and insecurity in the home country also play a role .
notes : data for england relate to physicians in the national health service . data for new zealand refer to foreign - trained practicing physicians .
] physicians move abroad for training purposes , either to obtain a medical degree , to acquire additional professional qualifications or to gain experience with medical techniques .
immigration for training purposes can account for a substantial number of foreign - trained physicians in a country .
overseas physicians who were attending postgraduate training in england made up 39.6% of all overseas physicians in the national health service in 1995 , 36.2% in 2000 and 37.3% in 2001 .
international medical graduates who came to the united states to attend postgraduate training comprised 11.9% of all international medical graduates in 1980 , 12.1% in 1990 , 15.1% in 1995 and 13.1% in 2000 .
similarly , training opportunities may account for a significant proportion of emigrating physicians . in 2001 ,
the number of physicians who were registered in switzerland , but were living abroad to attend postgraduate training and to practise was 555 and 629 , respectively .
table 1 reports the composition of the foreign(-trained ) physician workforce of selected oecd countries .
these data show that developing countries are just one , but not necessarily the main source of international recruitment of physicians by oecd countries : a large contribution to the foreign physician workforce of australia , austria , belgium , canada , denmark , france , germany , ireland , norway and switzerland originated from another european country .
although a large proportion of foreign(-trained ) physicians in the united kingdom and the united states originate from india , this country is actively pursuing a policy to export physicians .
supply of foreign(-trained ) physicians in selected oecd member countries sources : eurostat labour force survey , [ 17 - 21 ] .
additionally , table 1 illustrates that flows of physicians between oecd countries are not always unidirectional .
countries showing a high number of physicians ' emigration also present a significant inflow of foreign - trained physicians , who usually end up in posts that nationals are reluctant to take .
for instance , during the 1990s , around 1% of the canadian stock of active physicians left the country each year , the majority to the united states . on the other hand
, we note that nowadays around 25% of canada 's practicing physicians are foreign - trained .
the major source of foreign - trained physicians was the uk , followed by south africa and india .
in particular alberta and saskatchewan have been actively recruiting primary care physicians from south africa to fill practices located in remote areas .
for instance , in the 1960s many physicians working in developing countries originated from developed countries , but in the 1990s developing countries were estimated to supply 56% of all migrating physicians and receive less than 11% .
language affects migration flows in that physicians are more likely to move between countries speaking the same language . amongst oecd countries ,
this is mirrored in the incidence and extent of migration flows between australia , canada , ireland , the united kingdom and the united states ; between austria , germany and switzerland ; between belgium and france ; and between denmark , finland , norway and sweden ( see table 1 ) .
historical , administrative and legislative frameworks , training institutions , professional associations and regulation have influenced practices in former colonies and affected the migration of physicians for training and employment opportunities .
this explains the significant migration flows of physicians from india towards australia , canada , the united kingdom and the united states and from north african and middle eastern countries to france ( see table 1 ) .
migration of physicians is not necessarily beneficial from a social point of view . in making the decision to move , the potential migrant takes into account the private costs and benefits of the move
. however , migration also produces externalities that influence the welfare of people in both the home and host country . in assessing the impact of physician migration on health care provision in the home country , it is crucial to consider the issues of physician supply and the duration of migration . a number of countries such as cuba , india and the philippines systematically train more physicians than they need and send them abroad to benefit from remittances .
remittances , the money that migrants earn working abroad and send back to their home country , can be a crucial source of foreign exchange and aid the long - term development of the home country .
for instance , a study focusing on physicians from the philippines who practise overseas estimated that remittances were large enough to compensate for the economic losses associated with emigration . the impact of emigration on health care provision in the home country is limited , as these countries have an adequate supply of physicians . however , many host countries are developing countries that face physician shortages themselves . in this case , emigration represents a brain drain from home countries and is likely to lead to a deterioration in the working conditions of remaining physicians .
moreover , it may affect access to and quality of care , and impair the ability of the health care system to achieve health objectives for its population .
migration may also influence the capacity of the home country to provide quality training to new physicians and the research capacity of medical schools .
for instance , in nigeria and other countries in sub - saharan africa , most medical research institutions have collapsed from the massive emigration flows of highly - skilled physicians .
it is also important to distinguish between permanent and temporary migration . whereas temporary migration of physicians may produce benefits through an upgrading of skills , technological and financial transfers , permanent migration represents a net transfer of human capital from the home to the host country . in the case of permanent migration
, the home country incurs two types of costs : the first corresponds to resources spent to educate a physician ; and the second represents the value of the health care services that the emigrating physician would have rendered to his / her country in the absence of migration .
permanent migration might improve the prospects of individual physicians , but substantial and lasting emigration flows may weaken the capacity of the home country 's health care system .
these consequences are most important in the poorest countries that are not able to attract substitutes from other countries .
temporary migration may be inspired by the desire to acquire higher professional qualifications or to gain experience with new techniques not available in the home country .
if the host country subsidises the education of foreign students and these migrants return to their home country after they graduate , temporary migration of physicians can contribute to a general upgrading of skills in the home country .
if the skills that migrants have acquired during their stay abroad are too specialised , the home country may not be in a position to take advantage of them .
in oecd countries , foreign physicians are predominantly used as a supplement to local labour .
this is because foreign physicians are more willing to practise in certain organisational settings and in certain geographical areas that domestic physicians tend to avoid .
this is sometimes referred to as the ' safety - net ' role . in the united kingdom ,
general practitioners who graduated in south asian medical schools ( bangladesh , india , pakistan and sri lanka ) are concentrated in less attractive areas with large patient lists and relatively deprived populations . in the united states ,
however , in canada , policies requiring foreign physicians to practise in pre - specified areas have been legally challenged as a violation of basic human rights and have been judged against the canadian charter of human rights .
consumers may benefit from improved access to care and may gain from reduced medical care prices .
estimates of the gain to consumers from immigration in the united states , measured as a percentage of total expenditures on physician services , ranged from near 1% in 1966 to over 12% by 1971 . increased competition between physicians may raise the quality of health care services provided in the host country . on the other hand
, immigration may endanger the safety and quality of health care provision if the physicians concerned have a lower standard of medical practice .
concerns that qualifications are not equivalent across countries and differences in practice patterns have been used by professional associations to exclude foreign physicians .
in assessing the impact of physician migration on health care provision in the home country , it is crucial to consider the issues of physician supply and the duration of migration . a number of countries such as cuba , india and the philippines systematically train more physicians than they need and send them abroad to benefit from remittances .
remittances , the money that migrants earn working abroad and send back to their home country , can be a crucial source of foreign exchange and aid the long - term development of the home country . for instance ,
a study focusing on physicians from the philippines who practise overseas estimated that remittances were large enough to compensate for the economic losses associated with emigration .
the impact of emigration on health care provision in the home country is limited , as these countries have an adequate supply of physicians
. however , many host countries are developing countries that face physician shortages themselves . in this case , emigration represents a brain drain from home countries and is likely to lead to a deterioration in the working conditions of remaining physicians .
moreover , it may affect access to and quality of care , and impair the ability of the health care system to achieve health objectives for its population .
migration may also influence the capacity of the home country to provide quality training to new physicians and the research capacity of medical schools .
for instance , in nigeria and other countries in sub - saharan africa , most medical research institutions have collapsed from the massive emigration flows of highly - skilled physicians .
it is also important to distinguish between permanent and temporary migration . whereas temporary migration of physicians may produce benefits through an upgrading of skills , technological and financial transfers , permanent migration represents a net transfer of human capital from the home to the host country . in the case of permanent migration
, the home country incurs two types of costs : the first corresponds to resources spent to educate a physician ; and the second represents the value of the health care services that the emigrating physician would have rendered to his / her country in the absence of migration .
permanent migration might improve the prospects of individual physicians , but substantial and lasting emigration flows may weaken the capacity of the home country 's health care system .
these consequences are most important in the poorest countries that are not able to attract substitutes from other countries .
temporary migration may be inspired by the desire to acquire higher professional qualifications or to gain experience with new techniques not available in the home country .
if the host country subsidises the education of foreign students and these migrants return to their home country after they graduate , temporary migration of physicians can contribute to a general upgrading of skills in the home country .
if the skills that migrants have acquired during their stay abroad are too specialised , the home country may not be in a position to take advantage of them .
in oecd countries , foreign physicians are predominantly used as a supplement to local labour .
this is because foreign physicians are more willing to practise in certain organisational settings and in certain geographical areas that domestic physicians tend to avoid .
this is sometimes referred to as the ' safety - net ' role . in the united kingdom ,
general practitioners who graduated in south asian medical schools ( bangladesh , india , pakistan and sri lanka ) are concentrated in less attractive areas with large patient lists and relatively deprived populations . in the united states ,
however , in canada , policies requiring foreign physicians to practise in pre - specified areas have been legally challenged as a violation of basic human rights and have been judged against the canadian charter of human rights .
consumers may benefit from improved access to care and may gain from reduced medical care prices .
estimates of the gain to consumers from immigration in the united states , measured as a percentage of total expenditures on physician services , ranged from near 1% in 1966 to over 12% by 1971 . increased competition between physicians may raise the quality of health care services provided in the host country . on the other hand
, immigration may endanger the safety and quality of health care provision if the physicians concerned have a lower standard of medical practice .
concerns that qualifications are not equivalent across countries and differences in practice patterns have been used by professional associations to exclude foreign physicians .
although oecd countries generally favour long - term policies of national self - sufficiency to sustain their physician workforce , such policies usually co - exist with short - term or medium - term policies to attract physicians from abroad , on a temporary or permanent basis .
immigration of physicians is considered to be important in maintaining an adequate supply of physicians in countries such as australia , canada , england , germany , new zealand , norway , sweden , switzerland and the united states .
conversely , canada , new zealand and sweden perceived physician emigration to negatively affect the supply of physicians in their country . as a result , oecd countries have entered into international agreements regulating physician migration by imposing general requirements that physicians have to fulfil in order to move and work abroad .
these provisions refer to , amongst other things , nationality and citizenship requirements , national regulation governing the issuance of work permits , procedures and tests for examining asylum applications .
one of the agreements that covers the temporary immigration of physicians into an oecd country is the general agreement on trade in services ( gats ) .
if a wto member decides to make a commitment to the sector of health services , the country must specify whether and to what extent market access and national treatment are granted . if a wto member grants full market access , the country must refrain from operating any of six types of restrictions enumerated in article xvi of the agreement .
these are mostly quota - related barriers that may limit , for example , the number of service providers ( hospitals , physicians , etc . ) or operations ( number of beds , practices , etc . ) .
also precluded under this article is the use of economic need tests , e.g. the conditioning of access approvals on pre - established indicators such as the number of hospital beds or practices per head of population .
members may also provide some , but limited market access , i.e. they may maintain any of the six types of restrictions provided they list them in their schedule of commitments .
article xvii defines national treatment as the absence of any measures that modify the conditions of competition to the detriment of foreign services or service suppliers .
again , however , members are free to make no commitment on national treatment , or to provide partial national treatment provided they list the measures they maintain which discriminate in favour of nationals in their schedule . for the health services sector
, commitments under gats can be made separately for four modes of supply : ( a ) cross - border trade ( e.g. telemedicine ) ; ( b ) consumption abroad ( e.g. a patient travels to another country for health treatment ) ; ( c ) commercial presence ( e.g. a foreign hospital establishes in another country ) ; and ( d ) temporary movement of service suppliers ( e.g. a physician working temporarily in another country ) .
commitments can also be made for a mode of supply across all service sectors ( a so - called " horizontal commitment " ) .
although most countries ' commitments on movement of service suppliers are horizontal , they tend to be very limited , due to sensitivities over the potential impact of temporary foreign workers and the desire of countries to retain full flexibility in their temporary migration regimes .
gats seems to have had a limited impact so far on the migration of physicians .
very few commitments have been made for trade in health services : only 29 countries have made commitments for health services , and then only partial commitments for some health services . commitments to the movement of physicians are also very limited .
for instance , as a result of commitments under the gats , temporary resident visas are available in australia only for suitably qualified physicians who satisfy labour market requirements ( i.e. provide services to rural and remote communities ) . moreover , within the gats framework , members are free to pursue domestic policies in areas such as technical standards , licensing and qualifications to ensure the safety and quality of health care provision .
that implies that a commitment to allow entry of foreign physicians is still subject to those physicians meeting all domestic regulatory requirements to practise .
gats states only that such requirements must be transparent ( i.e. made publicly available ) and must be administered in a reasonable , objective and impartial manner .
international agreements stimulating the immigration of foreign physicians have been accompanied by requirements licensing medical practice in a country to ensure the quality and safety of services provided by migrants .
however , licensing provisions may also serve to reduce competition in the host country and to raise the income of domestic physicians .
this raises the issue of how foreign physicians are mobilised within the health care system of the host country and the conditions under which they have to work . in some cases , this has lead to a situation where physicians whose qualifications have not been recognised by the host country still practise medicine even though their status is unclear . in other cases , specialists work as generalists or generalists work as nurses .
a survey showed that 9% of foreign physicians claim discriminatory practices in finding employment in the united kingdom .
licensing requirements usually consist of holding the required qualifications ( i.e. medical degree ) from a recognised medical school and of having completed a period of training
. however , the license is only valid within the jurisdiction of the granting body .
this is usually an entire country , but in some cases a province or state , as in canada and the united states .
this implies that physicians who wish to practise in another country have to go through the process of having their qualifications recognised by the relevant body in the host country . in australia ,
physicians who are seeking permanent residency are required to pass an examination administered by the australian medical council .
this examination is set at the standard of medical knowledge , clinical skills and attitudes required of newly qualified graduates from australian medical schools . in canada , international physicians must take the medical council of canada evaluating examination and must fulfil registration requirements of licensing bodies . in order to practise in the united states
for instance , from 1 may 2002 , graduates of british medical schools recognised by the general medical council are eligible for permanent registration in new zealand without having to sit the new zealand medical council registration examination .
there is also a mutual recognition agreement between australia and new zealand , providing for automatic recognition of primary medical qualifications conferred by all medical schools within these jurisdictions .
licensing provisions governing the migration of canadian physicians to the united states have been simplified in that fewer visa restrictions apply and canadian physicians do not have to pass the clinical skills assessment exams .
the treaty of rome ( enforced in 1957 and subsequently amended by the treaty of amsterdam in 1997 ) gives every european union citizen a fundamental , personal right to move and reside freely within the territory of the member states .
in addition to this , member states have adopted sectoral directives that facilitate the movement of physicians through the harmonisation and recognition of qualifications and diplomas . in the context of physician migration ,
the most relevant directives are the so - called " doctors ' directives " ( 75/362/eec and 75/363/eec ) .
these directives entitle any european union physician who has completed basic training in a member state and who holds a recognised qualification to be automatically registered in any other member state . to this effect
, the doctors ' directives have established minimum standards with respect to the nature , minimum content and length of education and training programmes .
the sectoral directives are based on the principle of mutual confidence and comparability of training levels .
this is reflected in the " recognition of foreign professional qualifications act " , which requires european union member states to consider the practical experience of an individual in the process of recognition of qualifications . in case of structural differences in education and training programmes between countries ,
member states are entitled to require an adaptation period and an aptitude test , which imposes an additional barrier on the migration of physicians .
the impact of the european union doctors ' directives on the movement of physicians has been minimal , except in some isolated cases .
for instance , since the adoption of the directives in 1977 , there has been an increase in the number of physicians emigrating to the united kingdom from other member states , although these numbers have reached a ceiling in more recent years .
the limited impact of the european union doctors ' directives is linked to the general absence of physician surpluses in other member states ( which restricts the pool of potential migrants ) , failure to implement the directives and recognise the equivalence of qualifications by some member states .
in addition , there have been reports that some professional associations refuse to register physicians from certain member states who comply with european union minimum qualification standards . to justify such practices ,
professional associations claim variations in qualifications that might occur because of differences in the number of patient contacts or in practical experience .
this might be linked both to the educational and cultural system of the migrant . in this regard
, we note that flows are more intense among countries with similar health care systems . furthermore , despite the presence of provisions allowing member states to request information regarding the good character , reputation or the criminal past of an individual , many member states are concerned about the immigration of physicians who have had dubious medical practices in the past .
such concerns are motivated by the fact that some member states have difficulty in keeping reliable data on physicians .
in fact , cases have been reported of physicians who lost their licence to practise in one country for misconduct who were subsequently authorised to practise in another european union country .
given the limited success of international agreements regulating physician migration , oecd countries have adopted specific policies designed to stimulate the immigration of foreign physicians , whilst minimising its negative impact on the home country .
these have consisted of launching international recruitment campaigns , easing immigration requirements and setting up special arrangements that foster shared learning between health care systems .
international recruitment campaigns have involved advertisements in the medical press and participation in job fairs in germany and language courses in norway .
changes to the immigration act regulation favour the immigration of physicians and increased efforts are being made to support licensure of foreign - trained physicians .
australia and the united states have made the relaxation of immigration requirements conditional on foreign physicians practising in rural areas . in ireland
in addition to the two previous types of policies stimulating physician immigration , the united kingdom has put in place arrangements that foster international co - operation and promote the national health service abroad .
an international fellowship programme was launched in 2002 to attract experienced specialists from abroad to selected posts in the national health service for periods of one to two years .
it targets those specialities that need to grow in order to fulfil the national health service plan and those specialities with perceived shortages such as cardio - thoracic surgery , histopathology , radiology , nuclear medicine and psychiatry .
however , concerns about ethical recruitment have led some oecd countries to discourage recruitment from developing countries . in may 2003
, commonwealth countries adopted an international code of practice for the international recruitment of health workers .
the code of practice is intended to discourage physician recruitment from countries that are themselves experiencing shortages .
fairness implies that host countries would not seek to recruit physicians who have an outstanding obligation to the home country and would inform migrants of their rights and job requirements .
finally , international recruitment of physicians would be based on mutuality of benefits to host and home countries .
given that the temporary outflow of physicians from developing countries may be beneficial in terms of investment in skills , a second type of policy has focused on offering grants to foreign students to enter medical school , while at the same time making it impossible for foreign graduates to obtain a work permit for a certain amount of time ( e.g. five years ) .
this , in effect , forces them to return to their home country after they graduate .
some oecd countries have created regulations or have entered into bilateral agreements restricting the stay of foreign physicians .
for instance , the united states has created a ' cultural exchange visa ' that can be issued to foreign health care workers only for a limited duration of work .
after the permitted stay , the visitor is required to return home for a two - year period before he is entitled to apply for re - admittance .
a third approach has consisted of financially compensating the developing country for losses in terms of costs of education and training and the value of the health care services that could have been provided if the physician had not left the country .
the reimbursement of educational costs is in fact proposed by the international code of practice approved by commonwealth countries .
however , the problem with such policies is the difficulty in evaluating the country 's net loss ( subtracting direct and indirect costs created by the departure of the physicians from migration gains , such as an increase in scientific knowledge and remittances ) .
in addition , the potential return of the physician might represent a problem in setting the level of compensation .
such difficulties may explain the fact that previous schemes attempting to tax host countries , and even migrants , have not proven to be successful .
few oecd countries appear to have implemented policies to reduce the level of emigration of physicians and little is known about the effectiveness of existing programmes .
new zealand has undertaken efforts to maintain contact with expatriate physicians , encouraging their overseas development while offering some incentives for their return . in ontario , canada ,
a repatriation programme was introduced for canadians who had undertaken a postgraduate training programme in the united states .
this paper has examined the impact of physician migration on home and host countries , and focused on international regulation and policy approaches governing physician migration . when formulating policy recommendations , it is helpful to first consider the determinants of international migration of physicians . on the one hand ,
physician immigration to oecd countries is driven by a number of ' pull ' factors such as opportunities for professional training , higher wages , and better employment opportunities in the host country .
this takes place within the overall context of oecd countries actively promoting international recruitment as a way of sustaining their domestic physician workforce .
therefore , many oecd countries have entered into international and regional agreements easing border controls in order to facilitate the movement of physicians across countries .
however , the success of these legal changes remains limited due to practical barriers relating to qualification and licensing requirements .
alternative policies that ease immigration requirements , launch international recruitment campaigns and set up special arrangements that foster shared learning between health care systems appear to have been more successful in increasing the flow of physicians into host countries .
however , in many of these countries , there are still remnants of traditional hostility towards foreign - trained physicians , especially within the domestic medical profession , as foreign - trained physicians may not reach the quality standards of the host country and may infringe vested interests of the domestic physician workforce .
on the other hand , a number of ' push ' factors such as less attractive pay and working conditions , high unemployment rates , political instability and insecurity in the home country play a role in encouraging emigration of physicians .
therefore , even though it is reasonable for home countries to argue that they ca n't compete with for example higher pay and more attractive training and working conditions offered to physicians in host countries , home countries still need to recognise that they themselves have a role to play in developing strategies that attract and retain physicians .
these driving forces of international migration of physicians suggest that migration is likely to continue .
therefore , one needs to focus on how the process of international migration of physicians can be managed and regulated in ways that confer benefits on both home and host countries .
home countries need to face the reality of increasing globalisation of the physician workforce and the freedom of individual physicians to move .
in addition , physician migration may produce benefits through remittances and an upgrading of skills upon return of the physician to the home country . to balance concerns about brain drain , home countries can attract and retain physicians by reforming their education system , improving pay and working conditions , and implementing strategies that encourage physicians to return to their home country .
south africa , for example , has tried to sustain and increase domestic physician supply by shortening the educational curriculum ; by making medical training more responsive to the needs of the south - african population and the reality of clinical practice in south africa ; by requiring physicians to serve in mostly rural areas for one year upon graduation ; and by offering housing , social advantages , improved pay and security to physicians working in the public health sector .
it is also important to create incentives for physicians to return to their home country by guaranteeing employment that takes account of the experience and competences that the physician acquired abroad .
host countries need to reconcile their desire to attract foreign(-trained ) physicians with the need to adhere to principles of good practice in international recruitment .
however , to date , codes of practice on ethical recruitment have not yet produced their expected effect , given that such codes are not legally binding ; do not exclude recruitment of physicians from identified countries , but only forbid recruitment campaigns in such countries ; and apply to a limited number of countries .
therefore , countries need to develop and strengthen codes of good practice on international migration of physicians on a global scale .
current bilateral agreements and agreements developed as part of regional world areas need to be co - ordinated as to ensure consistency and improve opportunities both for home and host countries . identifying countries that have a surplus of physicians and putting in place an international framework that creates and enforces ethical policies governing
such a framework must exclude recruitment from countries in which emigration could harm local health service provision and include policies that promote temporary migration .
it has also been suggested that host countries compensate home countries for the cost of educating and training physicians and the value of health care services that would have been provided if the physician had not emigrated . to date
, the implementation of such policies has been hampered by difficulties in quantifying the home country 's net loss associated with physician emigration .
therefore , work that the who is currently carrying out on this issue needs to be applauded and may provide an avenue for considering such compensation schemes .
such compensation schemes may enable home countries to train a sufficient number of physicians to compensate for physician emigration and to sustain the domestic workforce .
alternatively , host countries can aid developing countries in sustaining domestic supply of physicians by strengthening development aid policies .
host countries , for instance , can provide grants to foreign students to enter medical school in the host country ; set up projects of shared learning with home countries ; support the transfer of medical technology to home countries ; and encourage physicians from host countries to spend a sabbatical year abroad . finally , in the context of growing physician shortages in many oecd countries , it can be argued that migration flows can only offer temporary solutions and act as a short - term buffer .
instead , countries need to focus on how they can create an adequate supply by implementing policies affecting education and training , levels and methods of remuneration , retention and retirement of domestic physicians .
the experience of oecd countries with respect to the impact , regulation and policy approaches to international migration of physicians suggests that physician movement between countries may confer benefits to both home and host countries in specific cases .
temporary migration may produce benefits in the home country through remittances and an upgrading of skills .
however , international migration of physicians may put pressure on the health care system of a few countries that are net exporters .
additionally , moves to recruit physicians from developing countries need to be balanced by concerns about a brain - drain in the home country .
further work is needed to devise mechanisms that reconcile the freedom of individual physicians to migrate with societal interests of home and host countries to develop a health care system that meets the health needs of the population .
. an earlier version of this paper was presented at the second meeting of invited experts for the oecd human resources for health care project , paris , 1618 december 2002 .
the views expressed in this paper are those of the authors and not the secretariat or oecd countries .
the authors would like to thank stphane jacobzone , jeremy hurst and peter scherer for their useful comments on earlier drafts of this paper .
Output:
| backgroundin the face of rising demand for medical services due to ageing populations , physician migration flows are increasingly affecting the supply of physicians in organisation for economic co - operation and development ( oecd ) countries .
this paper offers an integrated perspective on the impact of physician migration on home and host countries and discusses international regulation and policy approaches governing physician migration.methodsinformation about migration flows , international regulation and policies governing physician migration were derived from two questionnaires sent to oecd countries , a secondary analysis of eurostat labour force surveys , a literature review and official policy documents of oecd countries.resultsoecd countries increasingly perceive immigration of foreign physicians as a way of sustaining their physician workforce . as a result
, countries have entered into international agreements regulating physician migration , although their success has been limited due to the imposition of licensing requirements and the protection of vested interests by domestic physicians .
oecd countries have therefore adopted specific policies designed to stimulate the immigration of foreign physicians , whilst minimising its negative impact on the home country .
measures promoting immigration have included international recruitment campaigns , less strict immigration requirements and arrangements that foster shared learning between health care systems .
policies restricting the societal costs of physician emigration from developing countries such as good practice guidelines and taxes on host countries have not yet produced their expected effect or in some cases have not been established at all.conclusionsalthough oecd countries generally favour long - term policies of national self - sufficiency to sustain their physician workforce , such policies usually co - exist with short - term or medium - term policies to attract foreign physicians . as this is likely to continue
, there is a need to create a global framework that enforces physician migration policies that confer benefits on home and host countries . in the long term
, oecd countries need to put in place appropriate education and training policies rather than rely on physician migration to address their future needs . |
PubmedSumm6893 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the family of homer scaffolding proteins consists of three family members : homer1 , homer2 , and homer3 , with respective splice variants for each member .
these proteins are typically expressed in a concentrated fashion at post - synaptic densities , but have been ascribed with certain non - neuronal functions ( babu et al . , 2004 ; stiber et al . ,
the majority of proteins that belong to the homer family share two structurally conserved features in their secondary form : an n - terminal enabled / vasodilator - stimulated phosphoprotein homology 1 ( evh1 ) domain responsible for associating with proline - rich sequences contained within its target / ligand proteins , and a c - terminal coiled - coil domain containing multiple leucine zipper motifs that control homo / heteromerization of homer proteins ( xiao et al . , 1998 ;
one short homer protein splice variant , homer1a , does not contain this c - terminal region ( brakeman et al . , 1997 ) , allowing it to exist as a dominant - negative inhibitor to the scaffolding functions of the long forms .
importantly , homer proteins have been demonstrated to associate with many different proteins , including several which are critical to the transduction of peripheral somatosensory information .
group 1 metabotropic glutamate receptors ( mglur1/5 ) expressed in the spinal cord ( yashpal et al . , 2001 ) and amygdala ( neugebauer et al . , 2003 ; kolber et al .
2011b ) have been shown to be important to pain processing , and are tightly modulated by homer scaffolding proteins ( brakeman et al .
as shown in figure 1 , homer proteins link mglur1/5 to intracellular calcium stores through inositol-1,4,5-trisphosphate ( ip3 ) receptor types 1 and 3 ( tu et al . , 1998 ) , thereby regulating calcium release and neuronal excitability .
also , homer proteins are suspected to mediate the coupling of mglur and n - methyl - d - aspartate ( nmda ) receptors , prevalent in post - synaptic densities ( guo et al . , 2004 ) .
homer proteins associate with numerous other proteins as well , but scaffolding combinations outlined herein have recently been demonstrated to have significant effects on multiple pain models .
the homer scaffolding complex links mglur1/5 receptors to intracellular calcium stores via ip3 receptors , and also links to nmda receptors to dynamically regulate the transfer of somatosensory information . the shortened splice variant homer1a and its dominant - negative ability to associate with target proteins but not scaffold additional homer proteins , has been demonstrated to be an important mediator of peripheral pain . in 2006 , tappe et al .
reported that homer1a protein expression is significantly greater in activated sensory synapses ( tappe et al . , 2006 ) , in agreement with other groups that report neuronal activation - dependent increases in protein expression ( brakeman et al .
, 1997 ; kato et al . , 1997 ; bottai et al . , 2002 ; vazdarjanova et al . ,
for example , short hairpin rna ( shrna ) designed to knock - down homer1a protein expression significantly prolongs thermal hyperalgesia following viral administration of cfa - injected animals ( tappe et al . , 2006 ) .
indeed , through viral expression of homer1a , tappe and colleagues demonstrated that the short splice variant functions as an activity - dependent negative modulator of mglur scaffolding to intracellular calcium stores .
this inhibition can serve as a negative modulator of neuronal sensitization at first afferent pain synapses following peripheral inflammation . in short , homer1a exists in post - synaptic densities to reduce inflammatory hyperalgesia by preventing the longer homer proteins from associating with mglur1/5 and scaffolding other proteins to the receptor .
multiple groups have since demonstrated that homer proteins participate as critical modulators of synaptic plasticity as scaffolding proteins . in the amygdala ,
homer1a expression reduces arthritic pain hypersensitivity and negatively affects typical changes in interneuron plasticity following an inflammatory challenge ( tappe - theodor et al . ,
further , the induction of chronic compression of the l4/l5 dorsal root ganglia ( ccd ) induces rapid expression of homer 1a in the spinal dorsal horn , thereby reducing synaptic plasticity and hence , associated pain ( ma et al . , 2009 ) .
given that homer1a can interfere with intracellular calcium mobilization ( yuan et al . , 2003 )
, it could also protect against inflammatory pain and other mglur - activated signaling mechanisms that influence second - order neuron sensitivity , such as mapk activation ( ji et al . , 2002 ) .
therefore , homer - dependent scaffolding mechanisms significantly affect afferent pain transduction , serving as an important modulator that could be pharmacologically manipulated in the future to provide therapeutic benefit .
neuronal plasticity is predominantly studied as a function of neuronal activation between pre- and post - synaptic neurons in the central nervous system . as the rate of depolarization increases ,
membrane receptors undergo alterations in expression , post - translational modification , and/or subcellular localization that directly affect the likelihood of repeated receptor activation , such as for homer1a - dependent manipulations of mglur systems . in this scenario , neurons work to endogenously protect the receptor , the terminal , and the neuron itself from potential damage due to over - activation .
however , few studies have dissected the molecular changes that occur within the primary afferent terminal at the site of tissue innervation .
recent reports have identified that the scaffolding protein a - kinase anchoring protein 79/150 ( akap 79/150 ) is expressed in the periphery and dynamically recruits enzymes to modify transient receptor potential ( trp ) receptors , thereby affecting receptor response to stimuli .
identified in the early 1990s as a scaffolding protein for protein kinase a ( pka ) ( bregman et al . , 1991 ; carr et al . , 1992 ) , akap 79/150 functions to localize certain enzymes to target substrates on a sub - cellular level . in terms of its designations
, akap79 refers to the human isoform of the scaffolding proteins , expressed at 79 kda in molecular weight , while akap150 is the rodent isoform with additional amino acids that push its molecular weight to 150 kda ( referred to as akap150 from here forth ) .
the additional amino acids in akap150 comprise a series of multiple repeats that have no significant effect on scaffolding actions , and may have been evolutionarily contracted down to the human akap79 analog .
multiple research groups have since identified a myriad of substrates and enzymes that akap scaffolds together to establish organized and efficient signal transduction . in terms of enzymes ,
akap150 is anchored predominantly at the plasma membrane in multiple cell types , including neurons , and scaffolds pka , protein kinase c ( pkc ) , and calcineurin ( can , pp2b ) ( coghlan et al . ,
1995 ) along discrete sections of its secondary structure ( hoshi et al . , 2005 ) .
these enzymes are then able to efficiently act upon membrane targets that akap150 is reported to associate with , including the nmda receptor ( colledge et al . , 2000 ) , -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid ( ampa ) receptor ( colledge et al . , 2000 ) , kv7.2/kcnq2 potassium channel ( hoshi et al . , 2003 ) , and l - type voltage - gated calcium channels ( gao et al . , 1997 ) .
recent work by several labs has also confirmed akap150 association with trp channels , including trpv1 ( jeske et al . , 2008 ; schnizler et al .
this scaffolding association affords sensory neurons with the plasticity required to dynamically respond to various stimuli known to cause pain . the first link between akap150 and trpv1
was established in experiments investigating pka catalytic subunit proximity to neuronal plasma membranes following administration of inflammatory mediators ( rathee et al . , 2002 ) .
trpv1 was found to act as the pka - sensitive heat transducer responsible for inflammatory hypersensitivity to a thermal stimulus , although the hypersensitivity was itself sensitive to st - ht31 , a peptide that blocks pka association with akap150 .
indeed , forskolin dependent sensitization of trpv1 currents in dorsal root ganglia ( drg ) neurons was blocked following pre - incubation with st - ht31 , suggesting that akap150 exists as part of the trpv1-signaling module that mediates inflammatory sensitization of the channel .
although reports at that time were unable to demonstrate a physical interaction between gs subunit , akap150 , and trpv1 in any model system , the significance was established that scaffolding proteins dynamically affected receptor sensitivities to pro - algesic effectors .
akap scaffolds support multiple enzymes to modify substrate proteins in specific sub - cellular compartments . while some akap scaffolds bind enzymes including phosphodiesterase 4 d3 ( pde4d3 ) ( dodge et al . , 2001 ;
2001 ) , protein kinase n ( takahashi et al . , 1999 ) , and protein phosphatase 2a ( takahashi et al . , 1999 ) , akap150 primarily orients pka , pkc , and can with plasma membrane substrates , including trpv1 ( figure 2 ) . sirna knock - down and genetic ablation studies indicate that the loss of akap150 impairs pka- and pkc - phosphorylation and sensitization of trpv1 ( jeske et al . , 2008 , 2009 ) , indicating that akap150 expression is essential to certain inflammatory signaling pathways that utilize these two kinases , including prostaglandin ( schnizler et al . , 2008 ) and bradykinin ( zhang et al . , 2008 ) receptor - activated pathways .
however , de - phosphorylation and desensitization of trpv1 by can ( docherty et al . , 1996 ;
2010 ) , suggesting that can may be attracted to trpv1 by other means , including calmodulin ( numazaki et al . , 2003 ) .
although kinase scaffolding by akap150 has been repeatedly demonstrated to regulate trpv1 activation by multiple stimuli , later studies demonstrate cellular mechanisms that dictate akap150:trpv1 association in sensory neurons .
akap 79/150 ( akap150 ) is natively anchored to the plasma membrane via pip2 linkages that are hydrolyzed following phospholipase c ( plc ) activation , releasing akap150 to associate with substrate receptors , such as trpv1 .
akap150 association with trpv1 allows for pka- and pkc - mediated phosphorylation and sensitization of the receptor to peripheral stimuli .
later work in this field would not only demonstrate physical association between akap150 and trpv1 in multiple cell models , but also show that the association is dynamic and controlled by intracellular factors .
several research groups have provided indirect evidence of physical protein - protein interaction(s ) between akap150 and trpv1 including co - immunoprecipitation from transfected homologous cell culture models as well as primary sensory neuron cultures ( jeske et al . , 2008 ; schnizler et al . , 2008 ; zhang et al . , 2008 ) .
additional total internal reflective fluorescence - forster resonance energy transfer ( tirf - fret ) findings indicate strong association at the plasma membrane in co - transfected cells ( chaudhury et al . , 2011 ) .
importantly , tirf - fret studies also demonstrate that akap150 association with trpv1 is a calcium - sensitive process , revealing that calcium - bound calmodulin significantly reduces trpv1 interaction with the scaffolding protein ( chaudhury et al . , 2011 ) .
this dissociative interaction between calmodulin : trpv1 and akap150:trpv1 likely exists as an endogenous desensitization mechanism , allowing for calcium - sensitive , calmodulin - bound can to associate with and de - phosphorylate trpv1 , while blocking akap150-bound pka and pkc from phosphorylating and re - sensitizing trpv1 .
akap150 association with trpv1 is also negatively controlled by the anchoring of the scaffolding protein to phosphatidylinositol-4,5-bisphosphate ( pip2 ) in the plasma membrane .
working from the previously described anchorage of akap150 with certain phosphoinositides ( dell'acqua et al . , 1998 ) , recent findings indicate that phospholipase c ( plc ) activation releases akap150 from its plasma membrane moorings by hydrolyzing pip2 into ip3 and diacylglycerol ( dag ) .
released akap150 is then free to associate with membrane - associated proteins , such as trpv1 ( jeske et al . , 2011 ) , thereby providing an explanation for the diverging roles for pip2 in trpv1 regulation ( prescott and julius , 2003 ; lukacs et al .
although homer and akap scaffolds work similarly to dictate protein - protein interactions within both subcellular and temporal foci , there are several types of scaffolds that are devoid of protein structure , yet similarly organize and mediate signal transduction . organized structures within the plasma membrane such as caveolae and lipid rafts serve to regulate the activation efficiencies of certain receptors by scaffolding these receptors and/or effector molecules to dictate intracellular signal transduction .
therefore , protein - lipid interactions are as important as protein - protein interactions in influencing afferent plasticity . the fluid - mosaic model for biological plasma membrane organization proposed by singer and nicholson 40 years ago ( singer and nicolson , 1972 ) has been modified in recent years with the discovery and characterization of lipid raft microdomains ( simons and ikonen , 1997 ) .
lipid rafts consist of densely packed cholesterol and sphingolipid moieties that impart a reduced specific density compared to adjacent plasma membrane constituents . for certain receptor complexes ,
lipid rafts serve to concentrate extracellular - to - intracellular communication , thereby focusing signaling cascades . indeed , certain receptors and signaling molecules associate with lipid raft microdomains , providing for energy efficient signal transduction . in this vein ,
lipid rafts can be considered scaffolding structures for organizing receptor activation , as the activation of certain receptor complexes by somatosensory stimuli have been demonstrated to be dependent upon lipid raft association .
importantly , the dynamic association / dissociation of receptors and down - stream effectors with lipid rafts constitute a role in the dynamic synaptic plasticity of afferent pain transduction .
trp channel function in both trigeminal ganglia ( tg ) and drg neurons is reported to be sensitive to cholesterol depletion ( reducing lipid raft integrity ) . in cultured drg neurons ,
cholesterol depletion by methyl--cyclodextrin resulted in a significant reduction in capsaicin - induced currents ( liu et al . ,
further , similar treatments to reduce cholesterol in tg neurons resulted in decreased calcium uptake following capsaicin or resiniferatoxin application in culture ( szoke et al . ,
the cold sensing channel trpm8 also associates with lipid rafts ( morenilla - palao et al . , 2009 ) , and differentially reacts to cold and menthol stimuli depending on channel association with the cholesterol - laden microdomains in drg neurons .
taken together , data suggest that trp channel association with lipid rafts affects channel activities ( figure 3 ) .
interestingly , trp channels are composed of multiple plasma membrane - spanning domains , negating the need for lipid raft association to target the channels to the extracellular surface .
however , n - terminal prenylation of trpm8 was found to regulate most of the channel association with lipid rafts , further indicating that association with lipid rafts may be dynamic , and that other biochemical forces dictate channel localization to these cholesterol microdomains . lipid raft scaffolding at plasma membranes .
lipid rafts centralize signal transduction through certain receptors , including the -opioid receptor ( mor ) , trpm8 and trpv1 , via their intracellular association with microdomains concentrated in cholesterol and sphingolipids .
lipid rafts also anchor extracellular peptidases ep24.15/16 , to metabolize neuropeptides such as bradykinin ( bk ) , reducing free extracellular content available for receptor activation .
g - protein coupled receptor ( gpcr ) complexes also demonstrate associative properties with lipid raft moieties ( navratil et al . , 2003 ; chini and parenti , 2004 ; monastyrskaya et al . ,
2005 ) , as well as g - protein association ( ross , 1995 ) . given the role of -opioid receptor ( mor ) in effectively reducing somatic pain , reported data demonstrating mor association with lipid rafts proves to be highly significant .
work from the law research group illustrates that association of the receptor with lipid raft microdomains ( figure 3 ) is affected by ligand specificity , demonstrating that etorphine induces receptor translocation out of lipid rafts , while morphine has no effect ( zheng et al . , 2008 ) .
receptor localization was found to be dependent upon association with its gi2 signaling molecule , such that agonist activation of mor stimulates translocation to non - raft plasma membrane domains .
however , etorphine agonism , which strongly promotes mor association with -arrestin , stimulates receptor complex dissociation from lipid rafts , while morphine agonism , which weakly promotes receptor association with -arrestin ( whistler and von zastrow , 1998 ) , results in mor re - association with gi2 in lipid rafts .
therefore , in the case of mor , dynamic association with and internalization by -arrestin dictates gpcr activation and propagation of signal , in so much that dynamic association of mor with lipid rafts maintains receptor quiescence , while dissociation from lipid rafts allows for proper signal transduction downstream .
in addition to receptors intracellularly associated with lipid rafts , certain proteins are also extracellularly bound to raft microdomains , and constitute important regulators of neuropeptide functions .
metalloendopeptidases ec 3.4.24.15 and ec 3.4.24.16 ( ep24.15/16 ) are two closely related peptidases that co - localize with bradykinin type-2 receptors ( b2rs ) in lipid raft domains in tg neurons ( jeske et al . , 2006a ) .
among the many substrates that ep24.15/16 are capable of degrading , bradykinin ( bk ) exists as a high affinity substrate ( rioli et al .
therefore , the extracellular tethering of ep24.15/16 allows for the peptidases to degrade free bk before it can bind to and activate lipid - raft - associated b2r ( gomez et al . , 2011 ) .
given the role of bk as an inflammatory mediator that sensitizes numerous trp channels to normally - innocuous stimuli , lipid raft association of the receptor , as well as extracellular ep24.15/16 , provide for a dynamic micro - environment capable of significantly influencing afferent somatic activation .
dynamic changes in somatosensory perception occur in many subcellular locales , including the plasma membrane , through the reorganization and redistribution of proteins and scaffolding complexes .
post - translational changes target transducers of environmental stimuli that typically inform an organism that danger and/or injury is present .
these receptor transducers serve as substrates and points of control in multiple pathways , and scaffolding structures maintain dynamic , yet strict energy - efficient control over reactions that significantly affect receptor response . although scaffolding structures exist as large membrane - associated proteins , as well as microdomains within the membranes themselves .
both structures function to provide a framework to support and regulate dynamic changes to transducers of somatosensory information , prompting continued research into the roles of scaffolding proteins and structures in injury and disease pathologies .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
Output:
| dynamic changes in somatosensory perception occur as a result of multiple signaling events . in many instances , over - activation of sensory receptors results in the desensitization and subsequent increased threshold for activation of receptors . in other cases ,
receptor sensitization can occur following tissue injury and/or inflammation . in both cases , signaling mechanisms that control alterations in receptor activities can significantly affect organism response to sensory stimuli , including thermal , mechanical , and chemical .
due to the homeostatic nature of somatosensory recognition , dynamic changes in receptor response can negatively affect an individual 's way of life , as well as alert individuals to tissue damage . here , we will focus on scaffolding structures that regulate somatosensory neuronal excitability . |
PubmedSumm6894 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: human hydatid disease is caused by echinococcus granulosus , a cestode that is commonly lodged in the liver .
several endemic regions exist ; however , the disease may be observed anywhere in the world .
surgery remains the main modality of treatment , despite advances in medical and minimally invasive radiological therapies . in the last decade , laparoscopic surgery has become a part of the discussion of this issue , and several studies have reported encouraging results .
whatever the technique , surgeons should focus on safe evacuation and sterilization of the cyst 's cavity . on the other hand , obliteration of the cavity with greater omentum
herein , we report our series of patients with hydatid disease of the liver who underwent laparoscopic surgery , including omentoplasty and fixation of the omentum with helical fasteners .
between january 1998 and april 2000 , 13 patients ( 5 men and 8 women ) , mean age 36 years ( range 23 to 63 years ) with hydatid disease of the liver were considered for laparoscopic surgery at our department .
in the patient who had two , both of the cysts were in the right lobe .
the cysts ' localizations were as follows : five in segment 8 , five in segment 5 , three in segment 4 , and one in segment 2 .
the diagnoses were made with computerized tomography ( ct ) , ultrasonography ( us ) , and specific serological examinations .
five patients were primarily diagnosed with us and 8 with ct . nevertheless , ct studies were added to the first group to have an optimum morphological evaluation .
no evidence or suspicion existed of biliary rupture upon clinical findings and radiological studies ( history of cholangitis or jaundice , evidence of dilatation of the biliary tree , or connection with the cyst ) .
indirect hemagglutination tests ( iht ) and elisa tests were done as serological tests and were positive in all patients .
the patients who had evidence of biliary rupture , a history of recurrence , cysts deep or difficult to access in liver ( central or posterior localizations ) , multiple cysts ( more than two with unfavorable localizations ) , large cysts ( > 15 cm in diameter ) , and cysts with thick , calcified walls were not considered candidates for laparoscopy .
the urinary bladder was catheterized , a nasogastric tube was placed , and antibiotics were administered half an hour prior to the operation .
the first trocar was inserted at the umbilicus and a 30 laparoscope was used to visualize the peritoneal cavity .
the operating surgeon stood at the patient 's left side ; the camera assistant managed the laparoscope from the left for right - sided cysts and from the right for left - sided cysts .
the patient was placed in deep trendelenburg position and the subdiaphragmatic area was filled with 200 to 300 cc of 10% povidone - iodine for right - sided cysts .
the cyst then was punctured with a veress needle and the cyst 's fluid was aspirated as much as possible .
the cyst was refilled with 20% hypertonic saline , which is a potent scolocidal agent and left for 5 minutes . during this procedure ,
a 5-mm aspirator was placed beside the puncture point to prevent any fluid spillage into the peritoneal cavity .
the insertion of the locking trocar into the cavity to minimize the contamination by the cyst 's fluid .
worth , texas , usa ) was inserted from a point nearest to the cyst that was immobilized with a grasper .
then this trocar , which was primarily designed to avoid inward and outward movement through the abdominal wall , was inserted into the cyst , and the umbrella - like lock was opened immediately . the cyst was pulled upwards and pinched between the abdominal wall and the umbrella lock of the trocar ( figure 1 ) .
a 10-mm aspirator was inserted through the trocar and the cyst 's contents , including germinative membrane and daughter cysts , were aspirated .
the superficial and visible part of the cystic wall was excised with an electrosurgical hook or shears , and the specimen was removed from the abdominal cavity within an endobag .
the cystic cavity was then explored with a laparoscope to check whether any remnants of the cyst , biliary rupture , or hemorrhage were present .
an adequate portion of greater omentum was pulled and inserted into the cyst 's cavity .
the omentum was fixed to the cut edges of the cyst wall with a helical fastener ( pro tack , auto suture , norwalk , connecticut , usa ) , an instrument designed to fix mesh patches in endoscopic hernia surgery ( figure 2 ) .
the drain was removed and the patient was discharged if no bile or ascites drainage were present .
albendazole was administered , 10 mg / kg / day , for 6 months postoperatively , and an intermittent therapy regimen was planned as a 4-week course of drug therapy and 2 weeks of no treatment .
radiological controls with ct and us were performed in the sixth month , and then annually .
no perioperative complications such as bleeding occurred during application of the helical fasteners . in 1 case , with a single cyst in the right lobe , bile leakage was observed postoperatively , whereas no evidence of biliary rupture had been found during exploration .
the biliary drainage gradually tapered off and ceased spontaneously on postoperative day 9 without any further intervention . except for this case , no early or late complications occurred .
no radiological recurrence was observed in an average length of follow - up of 17 months ( range 4 to 36 months ) .
in the last decade , laparoscopic treatment of hydatid disease of the liver has been carried out in many centers .
a variety of techniques have been suggested for the surgical treatment of hydatid disease , all to sterilize the cysts , but the most commonly performed ones , both conventional or laparoscopic , are pericystectomy , simple drainage , or unroofing with omentoplasty .
however , regardless of the method , the surgical principles are sterilization of the cyst cavity , careful evacuation of the cyst 's content without intraperitoneal spread , investigation of the biliary rupture , and obliteration of the cyst 's cavity .
to succeed in laparoscopic hydatid disease surgery , these objectives are best reached with the meticulous selection of patients . as for current opinion
obliteration of the cyst 's cavity with greater omentum has been reported to provide further benefits concerning prevention of postoperative abdominal complications . for this purpose ,
we modified it by securing an omental flap to the edges of the excised cavity with helical fasteners that are designed to fix mesh patches in video endoscopic hernia surgery .
this allows a better and faster fixation of greater omentum that may easily drop into the peritoneal cavity . a critical point while applying this method is to apply fasteners only to the edges of the remnant of the cyst wall and to avoid injury to the liver .
the other hand , spread of cystic fluid into the peritoneal cavity may result in peritoneal hydatidosis .
we have used a locking ( or umbrella ) trocar , as previously described by seven et al , and a 10-mm rigid aspirator to evacuate the cyst 's contents .
when approaching right - sided cysts , we filled the subdiaphragmatic space with 10% povidone - iodine ( betadine ) , to take measures against intraperitoneal spread , and 20% hypertonic saline solution was used to sterilize the cystic cavity .
the scolocidal effect of povidone - iodine has been demonstrated in several experimental studies . although the use of 20% hypertonic saline solution to sterilize the cavity is now widely accepted because of it 's safety and ease of application , we preferred povidone - iodine for filling the pericystic area . in our series , except for 1 patient with 2 cysts that allowed easy access , we excluded patients with multiple cysts .
although not contraindicated , multiple cysts are not suitable for laparoscopy . in such cases ,
maneuver of laparoscopic devices becomes exceptionally difficult unless the surgeon uses an excessive number of ports .
also , cysts deep into the liver have increased surgical risks , such as difficult identification , bleeding , or the inability to check for biliary rupture .
khoury et al reported on a patient who developed anaphylaxis on laparoscopic evacuation of a hydatid cyst , localized deep into the liver .
it should be kept in mind that even minimal contact of cystic fluid with blood or with the peritoneal surface may lead to anaphylactic shock , and this contact is not preventable in deep cysts .
therefore , an open surgical technique must have priority in deep cysts because the surgeon 's ability to prevent cyst fluid from contact with blood is significantly more difficult .
another question concerning difficult cases for laparoscopy is biliary rupture . in a series of 328 patients ,
erguney et al reported a biliary rupture rate of 10.3% . in the preoperative evaluation , evidence of jaundice ,
right upper quadrant abdominal pain , cholangitis , or dilated biliary tract must warn the surgeon of a possible biliary rupture and a decision in favor of laparoscopic surgery should be reconsidered .
one patient was overlooked on preoperative assessment in our series and presented with biliary fistula during the postoperative course . nevertheless , biliary drainage ceased with conservative management .
spiliadis et al performed endoscopic sphincterotomy for complicated hydatid disease of the liver and 80% of patients suffering from postoperative biliary fistulas were successfully treated .
endoscopic sphincterotomy by ercp ( endoscopic retrograde cholangiopancreatography ) is the treatment of choice for persistent biliary fistulas .
with growing experience , laparoscopy seems to be quite feasible in hydatid disease of the liver . however , laparoscopy should not limit the surgeon 's performance in every surgical step of hydatid disease surgery . in many instances ,
omentoplasty with helical fasteners provides an easy and effective obliteration of the cyst 's cavity during laparoscopic access .
Output:
| objectives : the objectives of this study were to investigate the characteristics and outcome of patients with hydatid disease of the liver who were laparoscopically managed at our clinic and to define technical details including an effective method of omentoplasty with helical fasteners.methods:between january 1998 and november 2000 , 13 patients , mean age 36 years ( range 23 to 63 years ) , with hydatid disease of the liver were considered for laparoscopic surgery in our department .
all the patients underwent laparoscopic surgical interventions.results:in all patients , laparoscopic cystotomy , unroofing , and omentoplasty with helical fasteners , which were originally designed for endoscopic hernia repair procedures , were performed .
no conversion to laparotomy was necessary . in 1 case , with a single cyst in the right lobe , bile leakage was observed .
no radiological recurrence was observed in an average follow - up of 17 months ( range 4 to 36 months).conclusions : obliteration of the residual cystic cavity decreases postoperative complication rates , so an effective omentoplasty is essential especially for laparoscopic procedures .
laparoscopy is quite feasible to perform in hydatid disease of the liver , and the use of helical fasteners allows effective omental flap fixation . |
PubmedSumm6895 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .
nurses have the responsibility that within their career limit , make decisions and act based on their professional values .
values are intrinsically valuable concepts , and can be defined as the basis by which an individual or community selects the criterion of right or wrong . taking into account the exalted position of nursing , professional values
are determined by qualified associations and organization . in our country , the limits and boundaries of the actions , in many cases , are determined by islam and our constitution . as much
as the ethical values are in compliance with religious principles , they are universal and transnational . the most important principles that should be considered in nursing profession are :
respecting the patient / client and preserving human dignityaltruism and sympathydevotion to professional obligationsaccountability , responsibility and consciencejustice in servicescommitment to honesty and loyaltymaintaining patient s privacy , and commitment to confidentiality , and trustcontinuous improvement of scientific and practical competencepromote the awareness of professional rules and ethical guidelines , and respecting themmutual respect and appropriate communication with other health care providersrespecting autonomy of the patient / clientcompassion and kindness respecting the patient / client and preserving human dignity altruism and sympathy devotion to professional obligations accountability , responsibility and conscience commitment to honesty and loyalty maintaining patient s privacy , and commitment to confidentiality , and trust continuous improvement of scientific and practical competence promote the awareness of professional rules and ethical guidelines , and respecting them mutual respect and appropriate communication with other health care providers respecting autonomy of the patient / client compassion and kindness
the nurse should :
1 - 1 . make effort for : improvement of community health , prevention of diseases , restoration of health and alleviation of pain and suffering of patients ; and consider these as her / his main mission.1 - 2 .
offer the nursing care regardless of race , nationality , religion , culture , gender , age , socioeconomic status , political conditions , physical or mental illness , or any other factor ; and strive to eliminate injustice and inequality in society.1 - 3 . provide the nursing care to client / patient with respect to the human rights while considering ; to the extent it is possible ; values , socio - cultural traditions , and religious beliefs of patient / client.1 - 4 .
educate the community in term of health promotion and disease prevention and consider it as one of his / her most important responsibilities .
nursing care and standard teaching must be presented in a way to fit the culture , beliefs , values and individual s needs.1 - 5 .
be sensitive to the challenges and ethical issues , in both community and workplace , that could undermine the sanctity of the nursing profession ; and offer the appropriate solution when is necessary.1 - 6 . while cooperating and coordinating with other individuals , groups and social institutions ,
try to address social needs and resolve ethical issues raised in the area of health care.1 - 7 .
pay special attention to vulnerable groups and individuals such as children , elderly , people with physical disability , mental illness , and so on.1 - 8 .
while have attention to the medical health at the local level , endeavor to achieve the health goals in national and international levels.1 - 9 .
perform his / her responsibilities , in crises and natural disasters such as war , earthquake , flood , and disease epidemic , while taking the necessary precautions . 1 - 1 .
make effort for : improvement of community health , prevention of diseases , restoration of health and alleviation of pain and suffering of patients ; and consider these as her / his main mission .
1 - 2 . offer the nursing care regardless of race , nationality , religion , culture , gender , age , socioeconomic status , political conditions , physical or mental illness , or any other factor ; and strive to eliminate injustice and inequality in society .
1 - 3 . provide the nursing care to client / patient with respect to the human rights while considering ; to the extent it is possible ; values , socio - cultural traditions , and religious beliefs of patient / client .
1 - 4 . educate the community in term of health promotion and disease prevention and
nursing care and standard teaching must be presented in a way to fit the culture , beliefs , values and individual s needs . 1 - 5 .
be sensitive to the challenges and ethical issues , in both community and workplace , that could undermine the sanctity of the nursing profession ; and offer the appropriate solution when is necessary . 1 - 6 .
while cooperating and coordinating with other individuals , groups and social institutions , try to address social needs and resolve ethical issues raised in the area of health care
pay special attention to vulnerable groups and individuals such as children , elderly , people with physical disability , mental illness , and so on . 1 - 8 .
while have attention to the medical health at the local level , endeavor to achieve the health goals in national and international levels . 1 - 9 .
perform his / her responsibilities , in crises and natural disasters such as war , earthquake , flood , and disease epidemic , while taking the necessary precautions .
take into account ethical responsibilities , as well as the legal and professional liabilities , when implementing the nursing interventions and making the clinical decisions.2 - 2 .
2-whitin the limits of his / her power and duties , attempt to provide a safe and healthy environment for the client / patient.2 - 3 .
maintain the safety of the client / patient by : being on time , efficient performance of the professional duties , and accurate and complete recording of the performed care.2 - 4 . provide the best care to the client / patient ; based on professional standards which is resulted from valid research and reliable evidence.2 - 5
carry out all the nursing interventions with respect to the client / patient and his / her family.2 - 6 . do his / her maximum effort to conserve patient s confidentiality and privacy , and respect autonomy , and obtain the informed consent.2 - 7 .
prevent the probable damage to the client / patient by detecting and reporting the professional errors of medical team.2 - 8 . in case of mistake in nursing interventions , explain honestly to the client / patient , and proceed with truthfulness and fairness in any circumstances.2 - 9 .
maintain and enhance his / her physical , mental , social , and spiritual abilities.2 - 10 .
keep his /her knowledge and skills up to date , in order to maintain the professional competence.2 - 11 .
have the capability and knowledge of effective and safe nursing care , without direct supervision , and be accountable for his / her actions.2 - 12 .
perform in a way that nobody could question his / her professional credibility and dignity.2 - 13 .
be cautious about misuse of his / her name and position for commercial advertising of products.2 - 14 .
avoid the acceptance of any gift or benefit from the client / patient or their relatives , which may cause any limitation either now or in the future .
take into account ethical responsibilities , as well as the legal and professional liabilities , when implementing the nursing interventions and making the clinical decisions . 2 - 2 .
2-whitin the limits of his / her power and duties , attempt to provide a safe and healthy environment for the client / patient .
2 - 3 . maintain the safety of the client / patient by : being on time , efficient performance of the professional duties , and accurate and complete recording of the performed care .
2 - 4 . provide the best care to the client / patient ; based on professional standards which is resulted from valid research and reliable evidence .
carry out all the nursing interventions with respect to the client / patient and his / her family . 2 - 6 .
do his / her maximum effort to conserve patient s confidentiality and privacy , and respect autonomy , and obtain the informed consent . 2 - 7 .
prevent the probable damage to the client / patient by detecting and reporting the professional errors of medical team . 2 - 8 .
in case of mistake in nursing interventions , explain honestly to the client / patient , and proceed with truthfulness and fairness in any circumstances .
maintain and enhance his / her physical , mental , social , and spiritual abilities .
keep his /her knowledge and skills up to date , in order to maintain the professional competence . 2 - 11 .
have the capability and knowledge of effective and safe nursing care , without direct supervision , and be accountable for his / her actions .
perform in a way that nobody could question his / her professional credibility and dignity .
be cautious about misuse of his / her name and position for commercial advertising of products .
avoid the acceptance of any gift or benefit from the client / patient or their relatives , which may cause any limitation either now or in the future .
the nurse should :
3 - 1 . introduce him /herself with name , title and his / her professional role to the client / patient.3 - 2 .
provide all the nursing interventions with respect to the client / patient and preserving their dignity.3 - 3 .
consider the client / patient s demands regardless of their age , sex , race , economic status , lifestyle , culture , religion , political beliefs and physical abilities.3 - 4 .
produce a gentle behavioral and verbal communication , in a way that with attracting the client/ patient trust , their needs and concerns could be understood.3 - 6 . before performing any nursing interventions ,
, the nurse should provide sufficient information about nursing intervention for the patient , so that she / he could have the possibility of well - informed acceptance or rejection of the service.3 - 7 . when presenting or applying a new product in clinical practice , have a complete knowledge of its risks .
moreover , provide the client / patient with the necessary information about benefits and disadvantages of the product , hence they could have the possibility of informed choice.3 - 8 .
be aware that no one has the right to consent in place of a competent adult . in case of children , giving the consent is one of the legal guardian s responsibilities.3 - 9 .
in order to empower the client / patient , educate him / her and their family ; in frame of care plan and discharge program.3 - 10 . as an exception , in case of an emergency , when the immediate therapeutic action is mandatory for saving the client / patient s life , start the necessary intervention without patient s consent.3 - 11 .
perform the appropriate intervention based on existing standards and patient s higher interests ; when obtaining the informed consent or realizing the patient s wishes is not possible.3 - 12 .
apply the safety measures to be sure that nursing interventions are harmless , and when is necessary , consult this matter with other health team members.3 - 13 .
consider all the information given or obtained during the care process as the professional secrets , and do not reveal them without client / patient s permission except in legally permissible cases.3 - 14 .
employ the medical information of client / patient only for health related purposes ( treatment , research ) and in patient s interest .
inform the client / patient that part of his/ her medical record might be disclosed to other team members for medical consultation.3 - 15 . using
the medical information of the client / patient in research or education should be with their permission .
presentation of the result must be done without mentioning the name , address or any other information that could lead to identification of the patient.3 - 16 .
when performing the ideal service is unfeasible , continue the health care , in best of his /her ability , until establishment of a new health care program.3 - 18 . provide the care for injured or patients in emergency situations , even outside the workplace.3 - 19 . in case of dissatisfaction of the client / patient or other problem ,
respect their right to change the charged nurse or other health care providers , and as much as possible , try to satisfy the client / patient in this matter.3 - 20 . in case of noticing a violation of standards of care ,
avoid any action , even in patient s request , that requires ethical , legal or religious violation.3 - 23 .
assist the patients who spend the last days of their life for accepting the reality and to appropriately planning of their demands , including performing the religious practices or recording their wills .
introduce him /herself with name , title and his / her professional role to the client / patient .
provide all the nursing interventions with respect to the client / patient and preserving their dignity .
consider the client / patient s demands regardless of their age , sex , race , economic status , lifestyle , culture , religion , political beliefs and physical abilities .
3 - 4 . perform the nursing care based on current knowledge and common sense .
produce a gentle behavioral and verbal communication , in a way that with attracting the client/ patient trust , their needs and concerns could be understood .
, the nurse should provide sufficient information about nursing intervention for the patient , so that she / he could have the possibility of well - informed acceptance or rejection of the service .
when presenting or applying a new product in clinical practice , have a complete knowledge of its risks .
moreover , provide the client / patient with the necessary information about benefits and disadvantages of the product , hence they could have the possibility of informed choice .
be aware that no one has the right to consent in place of a competent adult . in case of children , giving the consent is one of the legal guardian s responsibilities .
educate him / her and their family ; in frame of care plan and discharge program .
3 - 10 . as an exception , in case of an emergency , when the immediate therapeutic action is mandatory for saving the client / patient s life , start the necessary intervention without patient s consent . 3 - 11 .
perform the appropriate intervention based on existing standards and patient s higher interests ; when obtaining the informed consent or realizing the patient s wishes is not possible . 3 - 12 .
apply the safety measures to be sure that nursing interventions are harmless , and when is necessary , consult this matter with other health team members . 3 - 13 .
consider all the information given or obtained during the care process as the professional secrets , and do not reveal them without client / patient s permission except in legally permissible cases . 3 - 14 .
employ the medical information of client / patient only for health related purposes ( treatment , research ) and in patient s interest .
inform the client / patient that part of his/ her medical record might be disclosed to other team members for medical consultation .
using the medical information of the client / patient in research or education should be with their permission .
presentation of the result must be done without mentioning the name , address or any other information that could lead to identification of the patient .
when performing the ideal service is unfeasible , continue the health care , in best of his /her ability , until establishment of a new health care program .
3 - 18 . provide the care for injured or patients in emergency situations , even outside the workplace . 3 - 19 .
in case of dissatisfaction of the client / patient or other problem , respect their right to change the charged nurse or other health care providers , and as much as possible , try to satisfy the client / patient in this matter .
avoid any action , even in patient s request , that requires ethical , legal or religious violation .
assist the patients who spend the last days of their life for accepting the reality and to appropriately planning of their demands , including performing the religious practices or recording their wills .
the nurse should
4 - 1 . cooperate with medical team members , the client / patient and their family , for more efficient presentation of nursing interventions.4 - 2 .
contribute the client / patient or legal guardian in making decision about nursing interventions.4 - 3 .
share his / her professional knowledge and experience with other colleagues.4 - 4 . establish a good relation based on mutual trust , with medical team.4 - 5 .
have a respectable conduct with other nurses , professors and students.4 - 6 . in case of any conflict of interest in the care of the client / patient ,
discuss it with senior colleagues and the principals , while giving the priority to preserving the clients / patients rights.4 - 7 .
establish a respectful professional relationship with co - workers in various levels , including the head nurse , supervisor , nursing director and department heads4 - 8 .
cooperate with medical team members , the client / patient and their family , for more efficient presentation of nursing interventions .
4 - 2 . contribute the client / patient or legal guardian in making decision about nursing interventions . 4 - 3 . share his / her professional knowledge and experience with other colleagues .
4 - 4 . establish a good relation based on mutual trust , with medical team .
in case of any conflict of interest in the care of the client / patient , discuss it with senior colleagues and the principals , while giving the priority to preserving the clients / patients rights .
4 - 7 . establish a respectful professional relationship with co - workers in various levels , including the head nurse , supervisor , nursing director and department heads 4 - 8 .
act as a role model for other nurses in all aspects of professional carrier . 4 - 10 . put his / her maximum efforts into the transfer of legal and ethical information to other nurses .
4 - 11 . provide the necessary conditions for participation of nurses in continuous training program . 4 - 12 .
when required , consult ethicists , in order to resolve the ethical problems occur during nursing interventions .
according to the hierarchy , collaborated with other colleagues , act in line with client / patient s interest .
do his / her maximum effort to maintain a good working environment and increase professional motivation . 4 - 15 .
behave fairly in the process of evaluation and promotion of nurses while considering the professional standards and nursing ethics code .
nursing professors should employ their maximum efforts to update their scientific knowledge , and to promote ethical knowledge and conduct .
the relationship between professors and students in scientific , educational and research environments should be based on professional ethics and mutual respect .
nursing professors should make effort to improve students knowledge and skills , and promote their ethical and professional performance .
consider carefully and accurately the patient s rights and ethical concerns , in cases of using the patients for educational purposes .
medical services should not be affected if client /patient or their family do not wish to - cooperate in education of the students .
5 - 6 . to improve the healthcare services , the quality of nursing training courses , existing guidelines and standards must be continually reviewed and revised .
nurses , who are involved in research , must pass the specific training courses , have knowledge about the research regulations , and be familiar with national , general , and specific ethical guidelines and be pledged to these regulations .
nurses should not use their professional positions to convince the client / patient to participate in the research project . 5 - 9 .
refusal of participation in the research project by the patient or his / her family should not influence the delivery of the nursing interventions .
clinical nurses should make effort to enhance the expertise and clinical capacities of nursing and midwifery students .
the nurse should :
1 - 1 . make effort for : improvement of community health , prevention of diseases , restoration of health and alleviation of pain and suffering of patients ; and consider these as her / his main mission.1 - 2 .
offer the nursing care regardless of race , nationality , religion , culture , gender , age , socioeconomic status , political conditions , physical or mental illness , or any other factor ; and strive to eliminate injustice and inequality in society.1 - 3 . provide the nursing care to client / patient with respect to the human rights while considering ; to the extent it is possible ; values , socio - cultural traditions , and religious beliefs of patient / client.1 - 4 .
educate the community in term of health promotion and disease prevention and consider it as one of his / her most important responsibilities .
nursing care and standard teaching must be presented in a way to fit the culture , beliefs , values and individual s needs.1 - 5 .
be sensitive to the challenges and ethical issues , in both community and workplace , that could undermine the sanctity of the nursing profession ; and offer the appropriate solution when is necessary.1 - 6 . while cooperating and coordinating with other individuals , groups and social institutions ,
try to address social needs and resolve ethical issues raised in the area of health care.1 - 7 .
pay special attention to vulnerable groups and individuals such as children , elderly , people with physical disability , mental illness , and so on.1 - 8 .
while have attention to the medical health at the local level , endeavor to achieve the health goals in national and international levels.1 - 9 .
perform his / her responsibilities , in crises and natural disasters such as war , earthquake , flood , and disease epidemic , while taking the necessary precautions . 1 - 1 .
make effort for : improvement of community health , prevention of diseases , restoration of health and alleviation of pain and suffering of patients ; and consider these as her / his main mission .
1 - 2 . offer the nursing care regardless of race , nationality , religion , culture , gender , age , socioeconomic status , political conditions , physical or mental illness , or any other factor ; and strive to eliminate injustice and inequality in society .
1 - 3 . provide the nursing care to client / patient with respect to the human rights while considering ; to the extent it is possible ; values , socio - cultural traditions , and religious beliefs of patient / client .
1 - 4 . educate the community in term of health promotion and disease prevention and
nursing care and standard teaching must be presented in a way to fit the culture , beliefs , values and individual s needs . 1 - 5 .
be sensitive to the challenges and ethical issues , in both community and workplace , that could undermine the sanctity of the nursing profession ; and offer the appropriate solution when is necessary . 1 - 6 .
while cooperating and coordinating with other individuals , groups and social institutions , try to address social needs and resolve ethical issues raised in the area of health care
pay special attention to vulnerable groups and individuals such as children , elderly , people with physical disability , mental illness , and so on . 1 - 8 .
while have attention to the medical health at the local level , endeavor to achieve the health goals in national and international levels . 1 - 9 .
perform his / her responsibilities , in crises and natural disasters such as war , earthquake , flood , and disease epidemic , while taking the necessary precautions .
the nurse should :
2 - 1 . take into account ethical responsibilities , as well as the legal and professional liabilities , when implementing the nursing interventions and making the clinical decisions.2 - 2 .
2-whitin the limits of his / her power and duties , attempt to provide a safe and healthy environment for the client / patient.2 - 3 .
maintain the safety of the client / patient by : being on time , efficient performance of the professional duties , and accurate and complete recording of the performed care.2 - 4 .
provide the best care to the client / patient ; based on professional standards which is resulted from valid research and reliable evidence.2 - 5 .
carry out all the nursing interventions with respect to the client / patient and his / her family.2 - 6 . do his / her maximum effort to conserve patient s confidentiality and privacy , and respect autonomy , and obtain the informed consent.2 - 7 .
prevent the probable damage to the client / patient by detecting and reporting the professional errors of medical team.2 - 8 . in case of mistake in nursing interventions , explain honestly to the client / patient , and proceed with truthfulness and fairness in any circumstances.2 - 9 .
maintain and enhance his / her physical , mental , social , and spiritual abilities.2 - 10 .
keep his /her knowledge and skills up to date , in order to maintain the professional competence.2 - 11 .
have the capability and knowledge of effective and safe nursing care , without direct supervision , and be accountable for his / her actions.2 - 12 . perform in a way that nobody could question his / her professional credibility and dignity.2 - 13 .
be cautious about misuse of his / her name and position for commercial advertising of products.2 - 14 .
avoid the acceptance of any gift or benefit from the client / patient or their relatives , which may cause any limitation either now or in the future .
take into account ethical responsibilities , as well as the legal and professional liabilities , when implementing the nursing interventions and making the clinical decisions . 2 - 2 .
2-whitin the limits of his / her power and duties , attempt to provide a safe and healthy environment for the client / patient .
2 - 3 . maintain the safety of the client / patient by : being on time , efficient performance of the professional duties , and accurate and complete recording of the performed care .
2 - 4 . provide the best care to the client / patient ; based on professional standards which is resulted from valid research and reliable evidence .
carry out all the nursing interventions with respect to the client / patient and his / her family . 2 - 6 .
do his / her maximum effort to conserve patient s confidentiality and privacy , and respect autonomy , and obtain the informed consent .
prevent the probable damage to the client / patient by detecting and reporting the professional errors of medical team . 2 - 8 .
in case of mistake in nursing interventions , explain honestly to the client / patient , and proceed with truthfulness and fairness in any circumstances .
maintain and enhance his / her physical , mental , social , and spiritual abilities .
keep his /her knowledge and skills up to date , in order to maintain the professional competence .
have the capability and knowledge of effective and safe nursing care , without direct supervision , and be accountable for his / her actions .
perform in a way that nobody could question his / her professional credibility and dignity .
be cautious about misuse of his / her name and position for commercial advertising of products .
avoid the acceptance of any gift or benefit from the client / patient or their relatives , which may cause any limitation either now or in the future .
the nurse should :
3 - 1 . introduce him /herself with name , title and his / her professional role to the client / patient.3 - 2 .
provide all the nursing interventions with respect to the client / patient and preserving their dignity.3 - 3 . consider the client / patient s demands regardless of their age , sex , race , economic status , lifestyle , culture , religion , political beliefs and physical abilities.3 - 4 .
produce a gentle behavioral and verbal communication , in a way that with attracting the client/ patient trust , their needs and concerns could be understood.3 - 6 . before performing any nursing interventions , obtain the patient or his / her legal guardian consent . in this regard
, the nurse should provide sufficient information about nursing intervention for the patient , so that she / he could have the possibility of well - informed acceptance or rejection of the service.3 - 7 . when presenting or applying a new product in clinical practice , have a complete knowledge of its risks .
moreover , provide the client / patient with the necessary information about benefits and disadvantages of the product , hence they could have the possibility of informed choice.3 - 8 .
be aware that no one has the right to consent in place of a competent adult . in case of children , giving the consent is one of the legal guardian s responsibilities.3 - 9 . in order to empower the client / patient ,
educate him / her and their family ; in frame of care plan and discharge program.3 - 10 . as an exception , in case of an emergency , when the immediate therapeutic action is mandatory for saving the client / patient s life , start the necessary intervention without patient s consent.3 - 11 . perform the appropriate intervention based on existing standards and patient s higher interests ; when obtaining the informed consent or realizing the patient s wishes is not possible.3 - 12 .
apply the safety measures to be sure that nursing interventions are harmless , and when is necessary , consult this matter with other health team members.3 - 13 .
consider all the information given or obtained during the care process as the professional secrets , and do not reveal them without client / patient s permission except in legally permissible cases.3 - 14 .
employ the medical information of client / patient only for health related purposes ( treatment , research ) and in patient s interest .
inform the client / patient that part of his/ her medical record might be disclosed to other team members for medical consultation.3 - 15 .
using the medical information of the client / patient in research or education should be with their permission .
presentation of the result must be done without mentioning the name , address or any other information that could lead to identification of the patient.3 - 16 .
when performing the ideal service is unfeasible , continue the health care , in best of his /her ability , until establishment of a new health care program.3 - 18 . provide the care for injured or patients in emergency situations , even outside the workplace.3 - 19 . in case of dissatisfaction of the client / patient or other problem , respect their right to change the charged nurse or other health care providers , and as much as possible , try to satisfy the client / patient in this matter.3 - 20 . in case of noticing a violation of standards of care , inform the authorities who have sufficient power for improvement of condition.3 - 21 .
avoid any action , even in patient s request , that requires ethical , legal or religious violation.3 - 23 .
assist the patients who spend the last days of their life for accepting the reality and to appropriately planning of their demands , including performing the religious practices or recording their wills .
introduce him /herself with name , title and his / her professional role to the client / patient .
provide all the nursing interventions with respect to the client / patient and preserving their dignity .
3 - 3 . consider the client / patient s demands regardless of their age , sex , race , economic status , lifestyle , culture , religion , political beliefs and physical abilities .
3 - 4 . perform the nursing care based on current knowledge and common sense .
produce a gentle behavioral and verbal communication , in a way that with attracting the client/ patient trust , their needs and concerns could be understood .
, the nurse should provide sufficient information about nursing intervention for the patient , so that she / he could have the possibility of well - informed acceptance or rejection of the service .
when presenting or applying a new product in clinical practice , have a complete knowledge of its risks .
moreover , provide the client / patient with the necessary information about benefits and disadvantages of the product , hence they could have the possibility of informed choice .
be aware that no one has the right to consent in place of a competent adult . in case of children , giving the consent is one of the legal guardian s responsibilities .
educate him / her and their family ; in frame of care plan and discharge program .
3 - 10 . as an exception , in case of an emergency , when the immediate therapeutic action is mandatory for saving the client / patient s life , start the necessary intervention without patient s consent
perform the appropriate intervention based on existing standards and patient s higher interests ; when obtaining the informed consent or realizing the patient s wishes is not possible .
apply the safety measures to be sure that nursing interventions are harmless , and when is necessary , consult this matter with other health team members . 3 - 13 .
consider all the information given or obtained during the care process as the professional secrets , and do not reveal them without client / patient s permission except in legally permissible cases . 3 - 14 .
employ the medical information of client / patient only for health related purposes ( treatment , research ) and in patient s interest .
inform the client / patient that part of his/ her medical record might be disclosed to other team members for medical consultation . 3 - 15 . using the medical information of the client / patient in research or education should be with their permission .
presentation of the result must be done without mentioning the name , address or any other information that could lead to identification of the patient .
when performing the ideal service is unfeasible , continue the health care , in best of his /her ability , until establishment of a new health care program .
3 - 18 . provide the care for injured or patients in emergency situations , even outside the workplace . 3 - 19 .
in case of dissatisfaction of the client / patient or other problem , respect their right to change the charged nurse or other health care providers , and as much as possible , try to satisfy the client / patient in this matter .
avoid any action , even in patient s request , that requires ethical , legal or religious violation .
assist the patients who spend the last days of their life for accepting the reality and to appropriately planning of their demands , including performing the religious practices or recording their wills .
the nurse should
4 - 1 . cooperate with medical team members , the client / patient and their family , for more efficient presentation of nursing interventions.4 - 2 .
contribute the client / patient or legal guardian in making decision about nursing interventions.4 - 3 . share his / her professional knowledge and experience with other colleagues.4 - 4 .
have a respectable conduct with other nurses , professors and students.4 - 6 . in case of any conflict of interest in the care of the client / patient ,
discuss it with senior colleagues and the principals , while giving the priority to preserving the clients / patients rights.4 - 7 .
establish a respectful professional relationship with co - workers in various levels , including the head nurse , supervisor , nursing director and department heads4 - 8 .
cooperate with medical team members , the client / patient and their family , for more efficient presentation of nursing interventions .
4 - 2 . contribute the client / patient or legal guardian in making decision about nursing interventions . 4 - 3 . share his / her professional knowledge and experience with other colleagues .
4 - 4 . establish a good relation based on mutual trust , with medical team .
4 - 6 . in case of any conflict of interest in the care of the client / patient ,
discuss it with senior colleagues and the principals , while giving the priority to preserving the clients / patients rights .
4 - 7 . establish a respectful professional relationship with co - workers in various levels , including the head nurse , supervisor , nursing director and department heads 4 - 8 .
act as a role model for other nurses in all aspects of professional carrier . 4 - 10 . put his / her maximum efforts into the transfer of legal and ethical information to other nurses .
4 - 11 . provide the necessary conditions for participation of nurses in continuous training program . 4 - 12 .
when required , consult ethicists , in order to resolve the ethical problems occur during nursing interventions .
according to the hierarchy , collaborated with other colleagues , act in line with client / patient s interest .
do his / her maximum effort to maintain a good working environment and increase professional motivation . 4 - 15 .
behave fairly in the process of evaluation and promotion of nurses while considering the professional standards and nursing ethics code .
nursing professors should employ their maximum efforts to update their scientific knowledge , and to promote ethical knowledge and conduct .
the relationship between professors and students in scientific , educational and research environments should be based on professional ethics and mutual respect .
nursing professors should make effort to improve students knowledge and skills , and promote their ethical and professional performance .
consider carefully and accurately the patient s rights and ethical concerns , in cases of using the patients for educational purposes .
medical services should not be affected if client /patient or their family do not wish to - cooperate in education of the students .
5 - 6 . to improve the healthcare services , the quality of nursing training courses , existing guidelines and standards must be continually reviewed and revised .
nurses , who are involved in research , must pass the specific training courses , have knowledge about the research regulations , and be familiar with national , general , and specific ethical guidelines and be pledged to these regulations .
nurses should not use their professional positions to convince the client / patient to participate in the research project .
refusal of participation in the research project by the patient or his / her family should not influence the delivery of the nursing interventions .
clinical nurses should make effort to enhance the expertise and clinical capacities of nursing and midwifery students .
Output:
| nurses are ever - increasingly confronted with complex concerns in their practice . codes of ethics are fundamental guidance for nursing as many other professions . although there are authentic international codes of ethics for nurses , the national code would be the additional assistance provided for clinical nurses in their complex roles in care of patients , education , research and management of some parts of health care system in the country .
a national code can provide nurses with culturally - adapted guidance and help them to make ethical decisions more closely to the iranian - islamic background . given the general acknowledgement of the need
, the national code of ethics for nurses was compiled as a joint project ( 20092011 ) .
the code was approved by the health policy council of the ministry of health and medical education and communicated to all universities , healthcare centers , hospitals and research centers early in 2011 .
the focus of this article is on the course of action through which the code was compiled , amended and approved .
the main concepts of the code will be also presented here . no doubt , development of the codes
should be considered as an ongoing process .
this is an overall responsibility to keep the codes current , updated with the new progresses of science and emerging challenges , and pertinent to the nursing practice . |
PubmedSumm6896 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: farming is one of the oldest industries in the world and often portrayed as a happy way of life . despite this , agriculture has one of the highest rates of suicides than any industry .
studies from canada , australia , united kingdom ( uk ) , and sri lanka have found high levels of distress and high suicide rate among farmers . based on proportional mortality ratios ,
farmers were among the top ten occupational groups with highest proportional mortality rates in the uk . in a psychological autopsy study from england ,
mental illness was most often judged as an important risk factor for suicide by farmers . in australia ,
suicide by farmers is linked with the occurrence of droughts . in india , in the 10 years , between 1997 and 2006 as many as 166,304 farmers have committed suicide .
the farmers ' suicide rate in the country in the year 2001 was 12.9 which was about one - fifth higher than the general suicide rate , which was 10.6 in that year .
economic factors such as indebtedness , crop failures , and acute financial loss or responsibility ( e.g. , marriage in family ) were significantly associated with farmers ' suicides in vidarbha region of maharashtra and rural punjab . a qualitative study from vidarbha region revealed that farmers perceived debt , addiction , environmental problems , low price for farm produce , stress , family responsibility , government apathy , etc .
studies on this issue in india so far have focused on socioeconomic and farming related risk factors .
this study was undertaken to meet this unmet need with objectives of studying socioeconomic and psychological correlates of farmers ' suicide .
a matched case control study was conducted from july 2008 to december 2009 in wardha district , located in vidarbha region of maharashtra state of india , one of the worst affected regions by farmers ' suicides .
wardha district has an area of 6310 km with total cultivable area 429,600 hectare , and only one - fourth of it is under irrigation .
it has a population of 1.23 million with male to female ratio of 1:0.9 and 80.5% literacy .
ethics committee approval was obtained from institute ethics committee for research on human subjects , mahatma gandhi institute of medical sciences , sevagram , wardha , india . before participating in the study ,
a written informed consent was obtained in local language ( marathi ) from the respondents .
we had planned to include all 111 consecutive cases of suicides listed under farmers ' suicide category in wardha district that occurred from april 1 , 2007 , to march 31 , 2008 ( one financial year ) .
this list was provided by office of district magistrate wardha , government of maharashtra , india on their official website .
of 111 families 10 were not available on given home address and neither could be assessed on the first and nor on a second home visit .
one household refused to participate in the study while two suicide victims were not farmers by occupation , so they were not included in the study .
2 years ) , sex and occupation matched living controls who were residing in the same village .
they were preferably identified from the same lane where suicide ( case ) households were residing .
in a situation where eligible controls could not be identified or declined to participate in the study from same lane , adjacent lanes were visited for selection of controls .
there were 89 villages / towns spread across wardha district where farmers in the list had committed suicides .
these villages were located on map , and a team of psychiatry resident doctor and psychologist trained in psychiatric assessment visited the households . while planning the visits a minimum period of 3 months was ensured between date of suicide and date of interview for resolution of grief . after explaining the purpose of our visit , a key informant in the family
was identified who was living with the subject under study and had good knowledge about his life . whenever felt necessary
a semi - structured interview schedule was developed by inputs and consensus of all investigators .
data were gathered regarding sociodemographic variables , farming practices , economic status and indebtedness , behavioral symptoms during a lifetime with special attempt to ascertain mental status in 6 months before suicide for cases .
yellow colored ration card is issued to those families with low income and is termed below poverty line ( bpl ) ration card .
a detailed description was obtained whenever there were some behavioral changes , and attempt was made to ascertain diagnostic category using diagnostic and statistical manual of mental disorders - fifth edition ( tr ) diagnostic criteria .
an overall attempt was made to get the details of mental status of the study subjects by empathetic and nonthreatening interview of informants .
variables about suicide and circumstances around it like date , time , place , method of suicide , planning involved , expression of suicide ideas or suicide note , etc .
stressful life events in prior 3 years were enquired in depth with special focus on stressors related to farming , interpersonal relations , economic difficulties , major health problems , legal issues , etc . , there was also a provision to record multiple stressful life events including those not on the list prepared .
government of india provides financial aid and farming implement as ex gratia help to suicide households , details of which were also noted .
respondents were also asked if someone attempts suicide where they would take the person and whether psychiatric consultation should be done for such a person . in the end
, appropriate referral services were offered to family members after ascertaining need and willingness of the person .
all the data were entered in the microsoft excel and analyzed by stata / se 14.1 statistical package ( stata corp , 2015 ) .
we assessed the association of various individual risk factors of farmer suicides by univariate analysis through mantel - haenszel estimate of odds ratio ( or ) .
the final model was built through multivariable conditional logistic regression analysis model with a forward stepwise procedure , the farmers ' suicide being the dependent variable , and all other identified risk factors as independent variables .
the estimate of the percentage of variance in the outcome explained by the model was done by calculating pseudo r value . all
we had planned to include all 111 consecutive cases of suicides listed under farmers ' suicide category in wardha district that occurred from april 1 , 2007 , to march 31 , 2008 ( one financial year ) .
this list was provided by office of district magistrate wardha , government of maharashtra , india on their official website .
of 111 families 10 were not available on given home address and neither could be assessed on the first and nor on a second home visit .
one household refused to participate in the study while two suicide victims were not farmers by occupation , so they were not included in the study .
2 years ) , sex and occupation matched living controls who were residing in the same village .
they were preferably identified from the same lane where suicide ( case ) households were residing .
in a situation where eligible controls could not be identified or declined to participate in the study from same lane , adjacent lanes were visited for selection of controls .
there were 89 villages / towns spread across wardha district where farmers in the list had committed suicides .
these villages were located on map , and a team of psychiatry resident doctor and psychologist trained in psychiatric assessment visited the households . while planning the visits a minimum period of 3 months was ensured between date of suicide and date of interview for resolution of grief . after explaining the purpose of our visit , a key informant in the family
was identified who was living with the subject under study and had good knowledge about his life . whenever felt necessary
a semi - structured interview schedule was developed by inputs and consensus of all investigators .
data were gathered regarding sociodemographic variables , farming practices , economic status and indebtedness , behavioral symptoms during a lifetime with special attempt to ascertain mental status in 6 months before suicide for cases .
yellow colored ration card is issued to those families with low income and is termed below poverty line ( bpl ) ration card .
a detailed description was obtained whenever there were some behavioral changes , and attempt was made to ascertain diagnostic category using diagnostic and statistical manual of mental disorders - fifth edition ( tr ) diagnostic criteria .
an overall attempt was made to get the details of mental status of the study subjects by empathetic and nonthreatening interview of informants .
variables about suicide and circumstances around it like date , time , place , method of suicide , planning involved , expression of suicide ideas or suicide note , etc .
stressful life events in prior 3 years were enquired in depth with special focus on stressors related to farming , interpersonal relations , economic difficulties , major health problems , legal issues , etc . , there was also a provision to record multiple stressful life events including those not on the list prepared .
government of india provides financial aid and farming implement as ex gratia help to suicide households , details of which were also noted .
respondents were also asked if someone attempts suicide where they would take the person and whether psychiatric consultation should be done for such a person . in the end
, appropriate referral services were offered to family members after ascertaining need and willingness of the person .
all the data were entered in the microsoft excel and analyzed by stata / se 14.1 statistical package ( stata corp , 2015 ) . characteristics of cases and controls were described with numbers and percentages .
we assessed the association of various individual risk factors of farmer suicides by univariate analysis through mantel - haenszel estimate of odds ratio ( or ) .
the final model was built through multivariable conditional logistic regression analysis model with a forward stepwise procedure , the farmers ' suicide being the dependent variable , and all other identified risk factors as independent variables .
the estimate of the percentage of variance in the outcome explained by the model was done by calculating pseudo r value . all
of 111 suicide households visited , 98 could be recruited for study ; thus , the response rate was 88.28% .
minimum and maximum intervals between date of suicide and date of interview were 7 months and 31 months respectively with an average of 20 months .
fifty percent of the subjects were younger than 40 years of age with male to female ratio of 8.8:1 .
ninety - two percent were educated up to 10 grade , majority were married ( 76.5% ) and resided in nuclear families ( 65.3% ) . according to ration card type , 36 ( 36.7% ) of suicide households and 43 ( 43.9% ) of control families were bpl .
most farmers had farming experience of more than 10 years and had small size farms ( < 4 hectares ) without irrigation facilities [ table 1 ] . case and
sociodemographic and farming profile of farmers suicide victims and controls home ( n = 50 , 51.0% ) was most common place of suicide followed by farm ( n = 41 , 41.8% ) and other places ( n = 7 , 7.2% ) . methods of suicide adopted were : pesticide consumption 67 ( 68.37% ) followed by hanging 15 ( 15.31% ) , drowning 12 ( 12.24% ) , self - immolation 3 ( 3.06% ) , and one farmer committed suicide by run over by train ( 1.02% ) .
recent change in behavior of suicide victim was noticed by 55 ( 56.12% ) of the family members .
relatives reported that 19 ( 19.4% ) of suicide victims had expressed suicidal ideas to family members or friends within 1 month period before suicide .
several social and economic factors were examined for their association with farmers ' suicides . in terms of social variables ,
suicide households were significantly more likely to lease out their farms , had to sell their farm land or bullocks in preceding 5 years to meet their expenses [ table 2 ] .
procurement of any amount of debt in the preceding 3 years four times increased risk of completed suicides by farmers while debt from multiple sources increased odds of completed suicide 28 times .
univariate regression analysis of social and economic risk factors of farmer 's suicides responsibility of marriage of some female family member in the near future increased risk of completed suicides by nearly 3 times ( or = 2.66 ; 95% confidence interval [ 95% ci ] = 1.235.73 ) . case and
control groups did not differ significantly in terms of annual income , irregular repayment of debt , and amount of pending debt to be repaid .
the presence of diagnosable psychiatric illness increased the odds of completed suicide nearly eight times ( or = 8.16 ; 95% ci = 3.4919.06 ) .
sixty percent ( n = 59 ) of suicide victims had some diagnosable psychiatric illness , of these five had received psychiatric treatment .
common probable diagnoses in cases and controls ( n = 98 ) respectively were depression ( 37 [ 37.7% ] and 6 [ 6.1% ] ) , alcohol dependence syndrome ( 10 [ 10.2% ] and 8 [ 8.1% ] ) , brief psychotic disorder ( 4 [ 4.0% ] and 1 [ 1.0% ] , schizophrenia 3 [ 3.1 ] and 0 ) , alcohol dependence syndrome with major depressive disorder ( 2 [ 2.0% ] and 0 ) , erectile dysfunction ( 1 [ 1.0% ] and 0 ) , alcohol - induced psychotic disorder ( 1 [ 1.0% ] and 1 [ 1.0% ] ) , and acute stress reaction ( 1 [ 1.0% ] and 0 ) . use of alcohol irrespective of abuse or dependence , increased risk of suicide nearly two times ( or = 2.15 ; 95% ci = 1.114.15 )
. there were no significant differences among two groups in terms of problem drinking based on cage scores , presence of other substance abuse , previous suicide attempts , and family history of mental illness or suicide .
the presence of a stressful life event in the preceding year increased odds of completed suicides 4 times ( or = 4.44 ; 95% ci = 2.159.15 ) while presence of more than one stressful life events 9 times increased the risk of suicide ( or = 9.25 ; 95% ci = 3.2925.95 )
. reported stressful life events among cases and controls respectively were crop failure ( 52 [ 53.06% ] and 37 [ 37.76% ] ) , problems in interpersonal relationships ( 15 [ 15.31 ] and 0 ) , physical illness or disability ( 9 [ 9.18% ] and 2 [ 2.04% ] ) , marriage of sister of daughter ( 6 [ 6.12% ] and 7 [ 7.14% ] ) , and death of a family member ( 3 [ 3.06% ] and 8 [ 8.16% ] ) .
univariate regression analysis of psychological risk factors of farmer 's suicides on multiple forward stepwise conditional logistic regression analysis after controlling for collinear covariates , three important risk factors emerged .
these were indebtedness in preceding 5 years ( or = 3.86 ) , presence of diagnosable psychiatric illness ( or = 7.81 ) , and presence of stressful life events in preceding year ( or = 3.20 ) as described in table 4 .
multivarite forward stepwise conditional logistic regression analysis model with suicide as dependent variable government of india provides ex gratia help to survivors of farmers ' suicides either in the form of money ( rs .
only 45% of the suicide households had received some form of aid from the government .
perceived first point of help in a situation of suicide attempt by family member was also assessed .
of all the farmers in study ( n = 196 ) , primary health care center was perceived as first point of contact by 102 ( 52.04% ) , civil hospital ( government district hospital ) by 47 ( 23.98% ) , tertiary care center like medical college by 37 ( 18.85% ) , and 10 ( 5.10% ) perceived police station as first point of help .
sixty - eight percent farmers were in favor of psychiatric consultation after suicide attempt by a person .
case control psychological autopsy with living persons as controls is a standard and accepted method in the study of suicides .
these factors often operate with cumulative effect and have complex interactions among them . in this study ,
majority of the suicide victims were male farmers with a male to female ratio of 8.8:1 .
this ratio is much higher than the ratio of 1.7:1 for suicides in the general population in india .
high proportion of suicides among male farmers compared to females had been reported from high - income countries such as england and wales , australia , north america , and european countries .
other similarities between findings of the present study with that of studies from high - income countries were the presence of high psychological morbidity , economic problems , and stressful life events as important risk factors for suicides by farmers . given this , there are some important differences also .
the proportion of farmers with economic difficulties and indebtedness is significantly high in the present study than that quoted in western studies .
family history of mental illness or suicides and interpersonal problems were seen less often in the present study than that reported in studies from high - income countries .
majority of farmers in india had lower annual income , and many either did not possess bullocks and livestock or had sold it .
this is in contradiction to findings from the uk where presence of livestock , especially pigs , was one of the important risk factors for suicides by farmers .
pesticides in lethal concentrations are easily available in rural as well as urban communities in india which are the reason for pesticide consumption being most common method of suicide in country . in similar lines , common methods of suicide used by farmers in the present study were pesticide poisoning followed by hanging and self - immolation while , common methods of suicide by farmers in west was by firearms , hanging , and carbon monoxide poisoning .
farmers , in general , have higher psychological morbidity than general population . farmers face compounding effects of physical stressors , environmental changes , changing farm economics , lack of differentiation between professional and personal life with no customary age of retirement leading to conflicts among different generations in family .
a study from the uk using ghq-12 questionnaire showed significantly higher psychological morbidity among farmers and their family members compared to nonfarmer controls .
one study from australia differs in this regard where mental health problems in farmers were comparable to nonfarmer controls indebtedness has been proposed as one of the major causes of suicide by farmers in india . however , there are very few controlled studies assessing role of this factor in causation of farmers ' suicides .
the present study found that significantly more suicide households than controls had experienced crop failure , had some additional economic liabilities , had procured debt especially debt for nonagricultural purposes and debt from multiple sources . in this study , majority of farmers ( 82% of all farmers interviewed ) had procured debt .
most common source of debt was commercial banks , which issue crop loan to farmers to meet expenses during sowing season .
it is hoped that providing money to spend on agriculture will help in better inputs and ultimately good yields for crops so that these debts are paid back to banks , with good profit to farmers . when there are additional or unexpected expenses like family liabilities ( e.g. , health , education , and festivals ) , marriage of female family members , etc . , or loss due to crop failure occurs ; farmer gets trapped into this cycle with mounting amounts of debt , causing distress .
, there was some diagnosable psychiatric illness in 60% of the farmers who completed suicide .
significant correlation between mental illness and suicide by farmers had been reported from the uk .
there is no prior controlled psychological autopsy study with only farmers as study group from india .
there are psychological autopsy studies on suicide in general population from major cities in different parts of india such as from bangalore , chandigarh , and chennai , which have reported significantly higher rate ( ranging from 43% to 88% ) of mental illness among suicide victims than general population controls .
the most common psychiatric diagnosis was depression followed by alcohol dependence and other psychiatric illnesses .
other findings from these studies replicated in present study were near similar age distribution of suicide victims , association with lower socioeconomic status and poverty and significantly higher proportion of stressful life events compared to controls . however , there are some notable differences among farmers ' suicides and suicides in general population
. significantly higher proportion of farmers ' suicide victims had indebtedness than reported among suicide victims in general .
on the other hand , interpersonal problems , violence in family , correlation with alcohol dependence , history of suicide attempt , and family history of suicide were lesser among farmers ' who had committed suicide than that found in above - mentioned psychological autopsy studies from india . in this study
, we also explored what was the perceived first source of help in situation of suicide attempt by family member .
primary health care centers and government hospitals at district place were most preferred the first source of help in an event of suicide attempt by family member .
most of these hospitals in india are not equipped with resources required to treat pesticide poisoning which is the most common method of suicide in country .
majority of respondents were in favor of seeking psychiatric consultation for a person who attempts suicide which is important point in favor of involvement of mental health professionals in prevention of farmers ' suicides .
the present study emphasizes role of multiple risk factors in causation of farmers ' suicides , highlights how farmers ' suicides differ from suicide in general population and also throws light on perceived points of contacts in a situation of suicide attempt . thus , suicide prevention program for farmers should be multipronged aiming at socioeconomic and psychological well - being of farmers along with provision of support in situations of stressful life events .
strategies for prevention of farmers ' suicides need should have both short- and long - term interventions .
present study reveals some important risk factors which can help early identification of farmers at risk .
early identification and appropriate support to these farmers are urgently needed to prevent further suicides . over short term
, interventions targeting method of suicide can be the most effective intervention to reduce number of deaths and thus suicide rate .
these include compulsory dilution of pesticides at manufacturing units to reduce lethality of pesticides before reaching market , providing lockable boxes to farmer households and educating farmers about safe use of pesticides .
similar strategy has significantly reduced suicide rate in sri lanka . as primary and secondary health care centers are the most common perceived sources of help in case of suicide attempt , upgrading infrastructure and training of staff in management of pesticide poisoning , life support skills , etc .
mandatory psychiatric evaluation after suicide attempt is important step in preventing future attempts . over long term , definitive steps are needed at macro and micro level to uplift the farm economy .
considering its diversity india needs a socioculturally relevant suicide prevention program which can be incorporated into broader health , education , and other welfare programs . creating a referral network of government and private hospitals and mental health professionals , training health professionals in identifying high - risk farmers , and strategies aimed at reducing stigma attached to mental illness will go a long way in suicide prevention .
first , this study involved only one district of india and considering geographic and cultural diversity in the country findings can not be generalized .
recall bias on part of informants is also a limiting factor as in some cases here was long interval between suicide and date of interview of family member .
this is likely to be compounded by stress and grief reaction in family members . in the absence of person in consideration , diagnoses reached upon by psychological autopsy can only a probable diagnosis .
this research was funded by intramural grant by mgims sevagram , which was used for travel expenses during data collection .
first , this study involved only one district of india and considering geographic and cultural diversity in the country findings can not be generalized .
recall bias on part of informants is also a limiting factor as in some cases here was long interval between suicide and date of interview of family member .
this is likely to be compounded by stress and grief reaction in family members . in the absence of person in consideration , diagnoses reached upon by psychological autopsy can only a probable diagnosis .
this research was funded by intramural grant by mgims sevagram , which was used for travel expenses during data collection .
Output:
| background : despite more than two decades since recognition of suicides by farmers in india , systematic studies comparing various risk factors are lacking .
this is major hurdle for the formulation of strategies for farmers ' suicide prevention.objective:to identify socioeconomic and psychological risk factors and their relative contribution in suicides by farmers.materials and methods : a matched case
control psychological autopsy was done on 98 farmers ' suicide victims and 98 controls in central india.results:economic problems , psychiatric illness , and stressful life events were found to be important contributors to farmers ' suicides .
important economic risk factors were procurement of debt , especially from multiple sources and for nonagricultural reasons and leasing out farms .
psychiatric illness was present significantly in higher proportion among cases than controls .
crop failure , interpersonal problems , medical illness , and marriage of female family member were significant stressful life events.conclusions:there are socioeconomic and psychological risk factors for suicide by farmers which can be targets of prevention policy . |
PubmedSumm6897 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: up to now six codons have been known which are deciphered by the corresponding trnas as amino acids different from those assigned by the universal genetic code in animal mitochondria ( figure 1 ) .
uga termination codon in the universal genetic code is deciphered to trp in all animal mitochondria , aua ile to met in most metazoan except echinoderm , planarian , cnidarian , placozoan and poriferan mitochondria , aaa lys to asn in echinoderm and some platyhelminth mitochondria , and aga / agg arg to ser in most invertebrate mitochondria , gly in tunicate ( urochordata ) mitochondria , and termination codon in vertebrate mitochondria .
uaa termination codon was assumed to be a tyr codon in a planaria and a nematode mitochondria , but there is neither structural information on mt trna that decodes the uaa codon , nor information about the mitochondrial ( mt ) release factor relevant to this phenomenon .
the codon - amino acid correspondence was first deduced by comparison of mt dna sequence containing the codon with amino acid sequence of the corresponding protein . since mt proteins exist in a small number ( in most cases , 13 ) and which are encoded by a small sized mt dna ( 16,500 bp in the case of human mitochondria ) , the correspondence can be unambiguously accomplished . in the next step , in order to analyze the molecular mechanism of the codon change , the corresponding trna sequence was analyzed especially focused on the anticodon sequence .
it is an advantageous point for analysis of mt trnas that in metazoan mitochondria , trna genes are restricted to 22~24 species on the mt genomes , and that trnas are not imported from the cytoplasm in almost all metazoan mitochondria except for a few cases such as in cnidaria . as the results , several modified nucleosides such as 5-carboxymethylaminomethyl(2-thio)uridine(cmnm(s)u )
, 5-taurinomethyl(2-thio)uridine ( m(s)u ) , 5-formylcytidine(fc ) , 7-methylguanosine(mg ) in the anticodon first position , and pseudouridine ( ) in the anticodon second position were found to be involved in the genetic code variations ( figure 2 ) , in which m(s)u and fc are novel modified nucleosides found by our group .
thus , an expanded wobble rule was established in which cmnm(s)u , mu , and fc at the anticodon first position pair with a or g in the codon third position , and mg pairs with all nucleotides in the codon third position [ 10 , 11 ] ( figure 3 ) . it was speculated that unmodified g in the anticodon first position should pair with c , u , and a in the codon third position in the case of fruit fly , drosophila melanogaster trnagcu for decoding agu / agc / aga codons , and in the anticodon second position strengthens the pairing interaction with a in the codon second position in the case of echinoderm trnagu for decoding aaa codon . in the third step ,
the wobble pairings as inferred from the above - expanded wobble rule were confirmed by an in vitro translation system of animal mitochondria , in which in vitro translation was performed by e. coli or bovine mt translation system using synthetic polyribonucleotide made of a series of nonuniversal codon as a messenger , and incorporation of a certain amino acid corresponding to the nonuniversal codon was identified [ 13 , 14 ] . in the forth step ,
the wobble pairings were confirmed by an in vitro experiment , in which natural mrna including a specific codon which was replaced with a certain nonuniversal codon was translated in vitro , and the mrna activity was detected by enzymatic activity if the mrna encodes a certain enzyme such as dihydrofolate reductase ( dhfr ) ( hanada , t. , suzuki , t. and watanabe , k. , unpublished results ) . in this review ,
we summarize mostly the results obtained in the second step , together with a few cases in the third step , and inquire into the nature of codon - anticodon interaction in the mt translation process and the relationship between nonuniversal genetic code and modified nucleoside in the trna anticodon deciphering the codon , during the course of animal evolution .
these studies may lead to the understanding as to how the genetic code evolves and how mt trnas keep up with the genetic code variations by providing modification at the anticodon of trnas .
it is also important to consider the involvement of aminoacyl - trna synthetase ( aars ) in the recognition of trna , especially in the case when aars recognizes the anticodon region of trna as the identity determinant .
since a few cases have been known about the animal mt aarss , some discussions will be added in the applicable sections , about the recognition mechanisms of aarss toward the corresponding trnas involved in the genetic code variations .
in mitochondria of all animal phyla , uga is read as trp instead of termination codon in the universal genetic code [ 4 , 6 ] . in the protostome ( nematode and probably platyhelminth )
mitochondria , the anticodon first position ( wobble position ) is modified to 5-carboxymethylaminomethyluridine ( cmnmu ) or 5-carboxymethylaminomethyl-2-thiouridine ( cmnmsu ) [ 15 , 16 ] .
therefore , the modification of u to cmnm(s)u in the anticodon first position in trnauca may restrict the base pairing only with purine nucleosides ( a / g , symbolized by r ) at the codon third position ( figures 3(a ) and 3(b ) ) , which would overcome the competition with mitochondrial release factor .
it is known that unmodified uridine ( u ) at the wobble position recognizes all four nucleosides ( a / g / u / c , symbolized by n ) at the codon third position ; thus , in mitochondria all four codon boxes are mostly read by the respective single trnas with unmodified u at the anticodon wobble position ( see figure 1 ) .
this modified uridine is similar in the chemical structure with cmnmum ( 5-carboxymethylaminomethyl - o-2-methyluridine ) in escherichia coli trna4 and mnmu in e. coli trna and is considered to fix its conformation by interresidual hydrogen bonding .
the mnmu possesses the same side chain at position 5 of uracil base as mnmsu in trna , which enables to take rigid
in the in vitro translation system using ms2 rna as a messenger , trna4 having cmnmum and trna5 having 2-o - methylcytidine ( cm ) at the anticodon first position , both recognized uua and uug codons , but not uuu and uuc codons at all .
it was clarified by nmr analysis that the orthodox c3-endo - g form of both cmnmum and cm are very stable .
it is considered that the posttranscriptional modification to form cmnmum and cm fixes their conformations very rigid , which regulates not to recognize the uuu / uuc codons . in summary , in the trnas recognizing a- or
g - ending codons by dividing 2:2 in the codon box , u and c ( in the case of fc , see section 2.3 ) at the anticodon first position are modified by introducing side chains to position 5 of the nucleobase , 2-thiolation at position 2 of the nucleobase , or methylation at position 2 of the ribose moiety . by combining these modifications ,
the conformation of the nucleoside becomes more rigid and which guarantees the precise recognition toward nna / nng codons ( figures 3(a ) and 3(b ) ) . in the tunicate ( ascidian ) and
vertebrate mitochondria , the anticodon first letter of trna is modified to 5-taurinomethyuridine ( mu ) ( [ 8 , 23 ] ) .
that mu recognizes only a- and g - ending codons ( figures 3(a ) and 3(b ) ) were verified in two ways .
examined the translation activity of human trnauaa possessing mu ( at that time it was an unknown modified uridine ( u * ) , and later it was elucidated to be mu ) in a bovine mitochondrial in vitro translation system using synthetic mrnas possessing 30 triplet repeats for the leu codons uua and uug , as well as uuc as a negative control [ 24 , 25 ] .
they showed clearly that wild - type trnauaa translated both poly(uua)30 and poly(uug)30 to poly(leu ) efficiently , but scarcely translated poly(uuu)30 or poly(uuc)30 .
measured the decoding activity of e. coli trnauaa possessing mu , cmnmu , or unmodified u ( negative control ) in the anticodon wobble position which was constructed by using molecular surgery technique in e. coli s30 in vitro cell - free system with synthetic oligoribonucleotides including uun codon as messengers .
they clearly demonstrated that trnauaa possessing either mu or cmnmu in the anticodon wobble position could translate uua / uug - containing messengers efficiently but could translate neither uuu- nor uuc - containing messenger .
the trnauaa with unmodified u34 efficiently translated the uua codon , but decoding of the uug codon was approximately one third the activity of decoding uua .
however , this trnauaa could not translate either uuu or uuc in consistent with the results obtained for mitochondrial translation .
thus , either mu- or cmnmu - modification was proved to be essential for restricting the base - pairing to the purine - ending codons ( figures 3(a ) and 3(b ) ) .
the conformation of mu has not been analyzed , but it can be speculated that it is very similar to that of cmnmu , because only their side chains at position 5 of the uridine base are different ; glycine and taurine are linked to 5-methyluridine in cmnmu and mu , respectively ( figure 2 ) . as described above , the modified uridine possessing the side chain at position 5 of uridine base which is linked through a methylene group takes very rigid conformation , which enables base pair with g as well as a in the codon third position .
mitochondrial glycyl - trna synthetase ( glyrs ) has scarcely been studied at the molecular level .
it is suggested that a tunicate ( ciona intestinalis ) genome encodes single glyrs gene responsible for synthesis of both cytoplasmic and mt glyrss ( yokobori et al . , unpublished results ) .
elucidated that a tunicate ( h. roretzi ) mt trnamucu is glycylated in vivo .
these results strongly suggest that tunicate mt glyrs is possible to recognize trnamucu possessing mu34 .
5-formylcytidine ( fc ) occurs at the anticodon wobble position of trna of most invertebrate ( fruit fly , drosophila melanogaster , squid , loligo bleekeri , and nematode , ascaris suum ) , and vertebrate ( bovine , bos taurus ) mitochondria , where aua codon is read as met instead of ile [ 1 , 5 ] .
however , in echinoderm , some platyhelminth ( such as planaria ) , cnidarian , placozoan , and poriferan mitochondria , aua codon is read as ile , like universal genetic code . in the former case
, it is considered that fc34 of trna could restrict the base pair with a and g in the codon third letter ( figures 3(c ) and 3(d ) ) , but in the latter case , the wobble nucleoside of trna is g34 , so that this trna would translate aua codon as not met , but ile . by constructing an in vitro translation system from bovine liver mitochondria , takemoto et al
. examined the decoding properties of the native mt trna carrying fc in the anticodon compared to a transcript that lacks the modification .
the native mt met - trna could recognize both aug and aua codons as met , but the corresponding synthetic trna lacking fc ( anticodon cau ) recognized only the aug codon in both the codon - dependent ribosomal binding and in vitro translation assays .
furthermore , the e. coli elongator trnam with the anticodon accau ( acc=4-acetylcytidine ) and the bovine cytoplasmic initiator trna ( anticodon cau ) translated only the aug codon for met on mt ribosome .
these results demonstrate that the fc modification in mt trna plays a crucial role in decoding the nonuniversal aua codon as met , and that the genetic code variation is compensated by a change in the trna anticodon , not by a change in the ribosome .
conformation analysis of fc by 500-mhz nmr showed that the nucleoside takes a very rigid c3'-endo - anti form .
this feature may be advantageous for the decoding properties of trna , because a very rigid pyrimidine in the first position of the anticodon can not form base pairs with u and c in the codon third position [ 34 , 35 ] , so that the trna can not decode the auu and auc ile codons .
in addition , it is to be anticipated that the stability conferred by a rigid ribose moiety in the first anticodon nucleotide will to some extent be propagated to the second and third anticodon residues .
this would result in greater overall stability of the stacked anticodon bases , and thus of codon - anticodon pairings .
it is apparent that fc can interact in the expected manner with g of the aug met codon ( figure 3(d ) ) , reflecting the finding that the conformation of fc is similar to that of cytidine . in order to read the aua met codon , the intriguing possibility exists that fc pairs with a in the aua met codon by protonation ( figure 3(c ) ) .
the protonation of a at n-1 in an a - c pair at ph values above the pk of the monomer has been demonstrated in oligoribonucleotide duplexes .
in addition , a was found to adopt a pk of 6.5 in the active site of a pb - dependent ribozyme .
they found that the enzyme recognizes the anticodon region of trna as an identity determinant and aminoacylates both human mt trnacau transcript and bovine trnafcau with similar km ( 0.150.16 m ) and kcat ( 0.02 s ) values .
as the nucleotide sequences of human and bovine mt trnascau are almost identical to each other with 5 nucleotide differences at positions 16 , 27 , 50 , 56 , and 60 , and it has turned out that human mt trnascau also possesses fc at the anticodon wobble position these kinetic data clearly demonstrate that human mt metrs recognizes the substrate trnacau irrespective of the presence or absence of fc34 .
found that 7-methylguanosine ( mg ) is present at the wobble position of trnagcu in most invertebrate mitochondria .
therefore , the anticodon mgcu of trnagcu is most likely responsible for reading all four agn codons as ser ( figures 3(e)3(h ) ) . on the other hand ,
the agg codon is absent from some metazoan mitochondria , such as fruit fly drosophila melanogaster mitochondria ( table 1 ) , and the anticodon wobble position of trnagcu is unmodified g . in this case
, the unmodified gcu anticodon of trnagcu seems to read the three codons agu , agc , and aga as ser .
therefore , it is summarized that g34 of drosophila trnagcu base pairs with only u , c , and a in the third letter of ser codon , and in most invertebrate mt trnasgcu , it is prerequisite for g34 to be modified to mg for recognizing g in the third letter of ser codon .
the purine - purine base pairing is well discussed by murphy and ramakrishnan for i - a pair .
they reported the crystal structure of i - c and i - a base pairs in the context of the ribosomal decoding center , clearly showing that the i - a base pair is of an ianti -aanti conformation , as predicted by crick although the distance between c1-c1 of i and a residues is broader than the usual one . owing to this observation ,
g - a and also mg - a base pairs in question would be possible to take a similar structure as that of i - a base pair ( figure 3(g ) ) .
since mg can form a structure in which a proton is cleaved from hn1 and o6 becomes o ( but g can not form the structure ) , mg - g base pair can be formed in which mg moves to the minor groove side in the context of the ribosomal decoding center ( figure 3(h ) ) .
such base pair stacks well on the neighboring second base pair of codon - anticodon pairing , so that the whole interaction would be stabilized .
this speculation must be confirmed experimentally , the simplest way of which would be to use an in vitro translation system .
the recognition mechanism of bovine mt serrs toward trna has been elucidated well by biochemical [ 47 , 48 ] as well as x - ray crystallographic studies .
both results clearly demonstrated that the anticodon region of trna is not involved in the identity determinant for bovine mt serrs .
thus , it can be concluded that the presence or absence of mu in the anticodon wobble position has no influence on the recognition of serrs toward trna . in echinoderm and some platyhelminth mitochondria , not only the usual asn codons aau and aac , but also the usual lys codon aaa ,
elucidated that starfish mt trna possesses the anticodon gu , whose second position is modified to pseudouridine ( ) .
in contrast , mt trna , corresponding to another lys codon , aag , has the anticodon cuu .
mt trnas possessing anticodons closely related to that of trna , but responsible for decoding only two codons each ( trna , trna , and trna ) ( see figure 1 ) , were found to possess unmodified u35 in all cases , suggesting the importance of 35 in trna for decoding the aau , aac , and aaa codons . experiments with an e. coli in vitro translation system confirmed that trnagu has about two - fold higher translational efficiency than trnaguu , in which trnagu was constructed by chemical synthesis and ligation , and trnaguu was obtained by in vitro run - off transcription .
it is exceptional that modification at the anticodon second nucleoside is involved in the codon - anticodon interaction efficiency .
there is a report that within the base - paired region at position 35 in a model for the codon - anticodon interaction in trna increases the tm by several degrees .
in considering the evolution of the genetic code , there are so far two main hypotheses , the codon - capture hypothesis based on directional mutation pressure proposed by osawa and jukes , and the ambiguous intermediate hypothesis proposed by schultz and yarus .
codon capture hypothesis proposes temporary disappearance of a sense codon ( or stop codon ) from coding frames by conversion to another synonymous codon , followed by loss of the corresponding trna that translates the codon .
( for a stop codon , the release factor ( rf ) must change simultaneously so as not to recognize the stop codon . )
this change may be caused by directional mutation pressure acting on genome ( at or gc pressure ) , changes of rf , or genome economization , which will produce an unassigned codon .
the codon reappears later by the conversion of another codon caused by directional mutation pressure and emergence of a trna ( or rf ) that translates ( or recognizes ) the reappeared codon with a different assignment , thus , the codon is reassigned or captured . in the ambiguous intermediate hypothesis , it is presumed that reassignment of codons is facilitated by a translationally ambiguous intermediate where the transitional codon is read simultaneously as two different amino acids by two trnas , one cognate and the other near cognate .
there has been little experimental evidence in support of the presence of these trnas that decode a single codon as two different amino acids simultaneously .
simulation study on codon reassignment suggested that the pathway of codon reassignment in favor of either codon capture or ambiguous codon depends on the initial conditions such as genome size and number of codons in interest .
we adopt here the former hypothesis essentially to explain the genetic code variations of animal mitochondria , because the characteristics of the animal mitochondrial genome such as at richness and genome economization would be suitable for the adoption of the codon - capture hypothesis .
there has been so far no report of a release factor recognizing uga codon [ 55 , 56 ] .
such a release factor corresponding to eubacterial rf2 was probably lost in the animal mt system , so that the uga codon became unassigned . when the anticodon wobble position of trna changed from c to modified u ( u * : cmnm(s)u or mu ) , and a part of the trp ugg codon in reading frames
was changed to uga by at pressure , the uga codon was captured by trnau*ca and read as trp ( figure 4(a ) ) .
why lower animals use cmnm(s)u for u * , whereas higher animals use mu instead of cmnm(s)u ( table 1(a ) ) , and from which stage of animals conversion of cmnm(s)u to mu occurs remain to be clarified . to explain the evolutionary change of other nonuniversal codons in metazoan mitochondria , in addition to at pressure , the genome economization effect ( especially , that trna genes are restricted to 22~24 species , and that trnas are not imported from the cytoplasm in almost all metazoan mitochondria except for a few cases in cnidaria and so on ) should be taken into consideration . at the same time
, we should include the idea of competition between two different trnas toward a certain codon , to explain the role of modified nucleoside in the anticodon region of trna .
namely , any codon can be read by the corresponding trna , but if a competitor trna or a release factor arises that has stronger affinity toward the codon than does the original trna , the codon will then be read by the competitor .
the aua codon is read as ile in cnidarian , placozoan , poriferan , some platyhelminths , and echinoderm mitochondria , but it is read as met in most metazoan mitochondria ( table 1(b ) ) .
fc in most metazoan mitochondria [ 8 , 9 , 12 , 31 ] and mu in tunicate mitochondria found at the wobble position of trna may be important for understanding the codon reassignment from aua - ile to aua - met .
since the interaction between trnagau and aua on the ribosome might be more unstable than that between the trnagau and auy codons , when trna acquired the capacity to decode aua by 5-formylation of c or 5-taurinometylaton of u at the wobble position , trnafcau or trnamuau may have prevailed over trnagau in the interaction with the aua codon .
thus , the reassignment of ile to met could have easily occurred ( figure 4(b ) ) . in echinoderm
mitochondria , fc or mu modification was lost in trna , so that aua is read as ile by tnagau because the competitor trna was lost .
why most metazoan trnas possess fc modification , but only tunicates trna possess mu modification is also to be solved .
the aaa codon is read as lys in most metazoan mitochondria , but only in some platyhelminth and echinoderm mitochondria is read as asn ( table 1(c ) ) . in this case , pseudouridylation at the second position of the anticodon of trna was critical for the codon reassignment ( figure 4(c ) ) .
the interaction between trnagu and aaa may have prevailed over that between trnauuu or trnacuu ( in various metazoan mitochondria such as those of echinoderms and fruit fly drosophila melanogaster ) and aaa .
it is interesting observation that echinoderm and a part of platyhelminth mitochondria use aua as a universal ile codon and aaa as a nonuniversal asn codon , while all the other animal mitochondria use aua as a nonuniversal met codon , and aaa as a universal lys codon .
this should be clarified in the relationship between genetic code change and animal evolution .
agr codons are used as ser codons in most invertebrate mitochondria , gly codons in tunicate mitochondria and termination codons in vertebrate mitochondria ( table 1(d ) ) . the scenario for
in the evolutionary process from cnidaria , placozoa , and porifera to higher invertebrates , trnau*cu to decode agr codons as arg disappeared from the mt genome , because of the reduction in genome size ( in cnidaria , most of trna genes are absent from the mt genome and most trnas are thought to be imported from the cytoplasm , but , in most higher animal mitochondria , import of trna has not been reported ) .
since the agr - arg sites in the mitochondrial genomes of protista such as trypanosoma are mostly replaced with cgn - arg codons and partially by a few other codons throughout metazoan mitochondria , agr codons were converted mainly to cgn upon the deletion of trnau*cu , so that agr codons became unassigned ( first step ) .
once the anticodon wobble position ( g34 ) of trnagcu was modified to mg , all four agn codons became ready to be decoded as ser [ 10 , 11 ] .
agr codons pairing with this trnamgcu then appeared in reading frames because of the mutation of agy - ser codons or other codons to agr codons , and they were captured by ser ( second step ) . in ancestors of tunicates and vertebrates , demethylation of mg of mt trnamgcu may have occurred , so the resulting mt trnagcu no longer reads the agg codon .
strong selective constraints resulting from the lost translation of agg caused the agg codon to change mainly to agy or other codons , so that the agg codon became unassigned ( third step ) .
after tunicates were separated from vertebrate ancestors , a fourth event may have occurred ; the mt trnaucc gene was duplicated in mitochondrial dna ( mtdna ) ( in fact , the ascidian mt genome has two trna genes ) , and the anticodon of one species of trnaucc was converted from tcc to tct because of at pressure , resulting in trnaucu , which might have occurred in tunicate mt genomes .
then , the anticodon wobble position of trnaucu must have been modified to mu ( trnamucu ; ( [ 8 , 23 ] ) so as to decode agr codons .
at the same time , at pressure caused ggn codons to change to agr codons . since the interaction of trnamucu with agr is stronger than that of trnagcu with agr , agr codons are captured by trnamucu , resulting in the translation of agr codons as gly .
the low gc content of the cytochrome oxydase subunit i region in ascidian ( tunicate ) mitochondria in comparison to that of vertebrates is consistent with the speculation that at pressure occurred on the tunicate mt genome . in the ancestors of vertebrate mitochondria
, agr codons may have appeared in the reading frames by the deletion of u from the uag termination codon , concomitantly with a functional change in the vertebrate rf so as to recognize agr codons ( a possible candidate for an mt rf capable of recognizing agr codons was reported ) .
the rf prevails over trnagcu in decoding the aga codon and , thus , changes agr codons to termination codons ( figure 4(d ) ) .
why mg- and mu - modifications have become to be used in most metazoan and tunicate mitochondria , respectively , for decoding agr codons are intriguing problems , which should be pursued in future .
the concept of the universal genetic code was forced to change since the discovery of nonuniversal codon in human mitochondria [ 4 , 5 ] , and it was known that not only mitochondria but also usual cellular systems ( nuclear genomes ) contain the nonuniversal genetic codes . nowadays , it is widely accepted that the genetic code is not universal but is changeable depending on the lineage of organisms .
especially , it should be mentioned that animal mt genomes contain several variations in the genetic code , and the nonuniversal genetic codes are decoded by trnas which possess modified nucleosides in their anticodon first or second positions . in animal mt genetic code , variations occur only in the 2 codon boxes where one family box is divided 2 : 2 ( which may be easily understandable ) , and only purine - ending codon(s ) are the target for codon reassignment ( figure 1 ) .
the questions may arise as to why no codon changes has occurred in two codon boxes of his(cay)-gln(car ) and/or asp(gay)-glu(gar ) and why pyrimidine - ending codon(s ) ( nny ) do not become the target for codon reassignment . for the former question , such cases may be found in future and for the latter question , it may be because it is difficult to provide any modified nucleoside in the trna anticodon wobble position which can decode purine - ending codons ( nnr ) and one or both of pyrimidine - ending codons ( nny ) .
the way of codon - anticodon interaction in the decoding process of the nonuniversal genetic code follows the base - pairing rule based on the physiochemical property of nucleosides .
it is the future problems to be answered why various modified nucleosides such as cmnm(s)u , mu , fc , mg , and have been selected as the key molecules for decoding the nonuniversal genetic code and how these modified nucleosides have been distributed among various animal mitochondria .
the genetic code consists of interaction between codon and anticodon of trna , and inspections of genetic code changes in animal mitochondria in which considerable number of changes occur in various animal lineages will lead to the elucidation of the basic principle of origin and evolution of the genetic code .
it is expected that these studies will shed light on a way to approach the origin of life .
Output:
| in animal mitochondria , six codons have been known as nonuniversal genetic codes , which vary in the course of animal evolution .
they are uga ( termination codon in the universal genetic code changes to trp codon in all animal mitochondria ) , aua ( ile to met in most metazoan mitochondria ) , aaa ( lys to asn in echinoderm and some platyhelminth mitochondria ) , aga / agg ( arg to ser in most invertebrate , arg to gly in tunicate , and arg to termination in vertebrate mitochondria ) , and uaa ( termination to tyr in a planaria and a nematode mitochondria , but conclusive evidence is lacking in this case ) .
we have elucidated that the anticodons of trnas deciphering these nonuniversal codons ( trnatrp for uga , trnamet for aua , trnaasn for aaa , and trnaser and trnagly for aga / agg ) are all modified ; trnatrp has 5-carboxymethylaminomethyluridine or 5-taurinomethyluridine , trnamet has 5-formylcytidine or 5-taurinomethyluridine , trnaser has 7-methylguanosine and trnagly has 5-taurinomethyluridine in their anticodon wobble position , and trnaasn has pseudouridine in the anticodon second position .
this review aims to clarify the structural relationship between these nonuniversal codons and the corresponding trna anticodons including modified nucleosides and to speculate on the possible mechanisms for explaining the evolutional changes of these nonuniversal codons in the course of animal evolution . |
PubmedSumm6898 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: india 's phenomenal economic growth during recent decades has yet to be matched by commensurate improvements in health care access and health .
india 's infant mortality rate of 41 per 1,000 live births and maternal mortality rate of 190 per 100,000 live births are still among the world 's highest1 , and widespread inequality in health outcomes exists across income groups2 .
poor health outcomes and inequality are exacerbated by high rates of out - of - pocket ( oop ) medical expenditure .
over 75 per cent of health care costs are financed oop in india , a higher rate than in many developing countries3 , and medical expenses push as many as 63.2 million indians into poverty every year3456 . with a rising burden of non - communicable diseases ( ncd ) in india ,
oop medical expenditure associated with chronic and hospital care will continue to increase . in 2008 , 5.2 million indians died of non - communicable diseases , accounting for 53 per cent of all deaths7 .
the number of potentially productive years of life lost due to cardiovascular diseases for the 35 - 64 yr age group in india is predicted to be 17.9 million by 20307 .
the median 15-month oop expenditure for treating cardiovascular diseases in 2011 was 145,850 ( assuming 1$=
50)8 - an enormous burden for most indian households - and during 2012 - 2030 , the economic cost of cardiovascular disease , cancer , chronic respiratory disease , diabetes , and mental health in india is estimated to be 279 trillion ( assuming 1$= 45 ) in 2010 .
historically , india has addressed these challenges through targeted supply - side health care delivery mechanisms . however , in 2008 , the indian government launched the rashtriya swasthya bima yojana ( rsby ) , an inpatient health insurance scheme for the poor . with a cumulative enrolment of more than 37 million poor families , and an annual budget of 10.97 billion ( us$ 182.8 million , assuming 1 $ = 60 ) in 2012 - 2013 ,
although rsby is relatively recent , there have been several studies on its impact on health care utilization and financial outcomes111213141516171819 .
considering the non - randomized nature of rsby rollout across the indian districts , all these studies are based on observational data , which has led to a debate among researchers on methodological challenges in understanding the true impact of rsby12151819 . in this paper , we review the existing evidence on rsby 's impact in the context of the international literature on health insurance .
we describe potential pathways through which health insurance can affect health and economic outcomes , discuss evidence from methodologically strong ( e.g. , randomized ) studies from other developing countries , and point out the potential biases and inconsistencies in existing studies on rsby impact .
until the national health policy ( 2002 ) , health policy in india was focused on individual diseases or conditions and lacked a unifying framework . this policy and its successor , the national rural health mission ( 2005 ) , aim to streamline public health care by integrating existing stand - alone policies , decentralizing service delivery ( e.g. through community health workers ) , and focusing more on states that lag on health indicators20 .
the report by the high - level expert group ( hleg ) of the planning commission's20 on universal health coverage20 advocates the integration of individual policies into a national health package , emphasizing the need for more supply - side resources .
the report also encourages provision of private care under contract from the government in locales where public health care delivery is inadequate . in 2008 ,
rsby , a large - scale national hospital insurance scheme for the poor , was launched . at a nominal out - of - pocket enrolment fee of 30 per year ( us$1 = 65 , approximately in 2015 ) ,
officially poor ( below the national poverty line , or bpl ) families can cover up to five members for more than 700 medical treatments and procedures at government - set prices under rsby .
the scheme only covers inpatient health care up to a maximum of 30,000 per year per family but requires no deductible or copay ( copayment ) .
however , additional near - poor groups such as domestic , construction , and beedi industry workers , rickshaw pullers , and taxi drivers have been recently brought under the purview of rsby , and the scheme is being pilot - tested for outpatient coverage2122 .
health care services are provided nationwide by government - contracted hospitals , both public and private , and beneficiaries use a rsby biometric identity card , without the need for cash transactions or insurance claims .
coverage and payouts under rsby are provided by private and state - run health insurance companies , while the government pays a significant proportion of the insurance premiums .
the premiums are based on negotiated contracts between the state government and insurance companies and vary by district . after conducting procedures ,
the total cost of the programme is divided between the central and state governments , with the centre bearing 75 per cent of the cost .
( for jammy and kashmir and the northeastern states , the contribution of the central government is 90 per cent ) .
rsby was introduced , and implemented until mid-2015 , by the ministry of labour , government of india .
while the actual benefits of rsby are not yet known , literature available on health insurance in developing countries has indicated some potential benefits .
most studies on the impact of health insurance look at health ( either process measures such as utilization or direct health measurements ) or financial outcomes . there is some evidence that insurance improves objective health23 , but because health is difficult to measure without a large sample size and repeated surveys to detect effects that emerge over time , the evidence is not strong .
studies from other countries have found that insurance increases overall health care consumption242526 , though the results are not uniformly positive27 .
while some studies have reported that insurance lowers oop expenditure232829 , others have found the opposite effect and that insurance induces health care utilization beyond coverage limits3031 .
also , growing evidence indicates that individuals respond to health shocks by selling assets , borrowing money , and using savings323334353637 , but there is little evidence that insurance mitigates these behaviours in developing countries38 .
finally , health shocks affect non medical consumption39404142 and may induce poverty345 , but it is unclear how insurance addresses these problems .
increased medical expenditures may not imply reduced non medical expenditures if individuals have access to savings , loans , or informal insurance .
wagstaff and pradhan23 did not find any effect of insurance on the variability of non medical consumption in vietnam ; although in a different context , finkelstein and mcknight43 found that insurance could have an independent negative effect on the welfare of risk - averse individuals in the united states .
a large number of studies use observational data to study the effectiveness of health insurance programmes .
if enrolment in health insurance is voluntary or if the scheme targets a particular population subgroup , beneficiaries of programme may be systematically different from non - beneficiaries .
comparing the outcomes of these two groups will lead to biased estimates of the impact of health insurance25444546 .
there are various econometric tools that can mitigate some of the biases of observational studies , such as instrumental variables , natural experiments4748 , regression discontinuity analysis , or matching methods232949 - 51 .
difference - in - difference methods may also eliminate the time - invariant systematic differences in unobservable characteristics between the beneficiary and non - beneficiary groups2352 .
however , individuals may choose to insure themselves based on changes in their health outcomes or wealth status over time ( instead of initial levels ) .
in such a case , even this sophisticated difference - in - difference approach may not entirely eliminate selection bias or account for unobservable , time - varying factors53 .
another way of addressing selection bias and estimating the causal impact of policy interventions may be to employ random assignment to programme participation .
five large - scale health insurance studies across the world have employed random assignment until now the rand health insurance experiments in the united states54 and china55 , the seguro popular health insurance experiment in mexico5657 , the oregon medicaid lottery study5859 , and a voluntary health insurance study in nicaragua60 .
two important but smaller experimental studies in other countries have recently been completed , though all results have not been released .
a group in the philippines is studying the effect of insurance provided through microfinance companies61 .
levine and colleagues studied the sky insurance plan in cambodia38 . although randomization is accepted as a useful method for estimating causal inference , it is not free from criticism .
thus , while the selection of study participants may be randomized , the first stage selection of study sites themselves may not be random .
this leads to the concerns about the external validity or generizability of the findings of randomized studies6263 .
in addition , randomized studies may suffer from performance biases such as hawthorne and john henry effects , attrition bias that may result in a non random follow up sample , assesment and reporting biases , and lack of statistical power of the sample , all of which may result in inacruate estimates64 . finally , there may be some ethical concerns about withholding the intervention from the control group in a randomized study6566 , particularly for high - value health insurance coverage which may mean a difference between life and death for the poor .
the ethical dilemma is generally tackled by delaying the intervention implementation in the control group until the completion of the study .
although existing rsby evaluation studies are based solely on observational data , yet rsby is supposed to be both means - tested , with eligibility initially restricted to bpl populations and recently expanded to include some other socio - economically marginalized groups , and voluntary , with enrolment rates that vary depending on socio - economic and institutional factors or regional bottlenecks2167 .
while this is highly desirable from a societal perspective , it poses a challenge for evaluating the impact of the scheme .
therefore , claiming the success or failure of the programme in improving health and economic outcomes on the basis of observational estimates is risky .
however , secular trends affecting individual health or wealth can confound causal inferences in these cases68 .
for instance , some areas may be more likely to adopt insurance when they anticipate rapid growth for other reasons or may adopt insurance when the incomes of the poor are expected to stagnate .
other studies of rsby compare the insured to the non - insured in cross - sectional studies11 , yet this design suffers from selection bias , as these two groups may be inherently different .
one randomized controlled trial involved rsby , but it evaluated the effect of an information campaign on enrollment and utilization rather than the effect of the scheme itself69 .
a study15 argues that rsby and other health insurance schemes may have increased oop expenditure for the poor in the state of tamil nadu . on this basis , the authors pronounce rsby a failure and call for a replacement health financing mechanism .
another study12 raise some methodological concerns about this above study , which are further contested by the original authors17 .
other researchers18 also question the validity of the original study , and propose analytical refinements .
findings from two cross - sectional studies of rsby in gujarat1170 showed no significant difference between the oop expenditure of insured and non - insured groups .
further , the authors found that almost 60 per cent of rsby beneficiaries had to make a median oop payment of 4000 ( $ 80 ) in 2011 for hospitalizations , primarily related to drug purchases .
another study71 examined a statestate health insurance scheme similar to rsby , called rajiv aarogyasri , in andhra pradesh . using both difference - in - difference methods and matching , it was found that the scheme significantly reduced oop medical expenditure , more so for inpatient cases .
finally , rao et al72 used similar difference - in - difference method to evaluate the rajiv aarogyasri scheme in andhra pradesh and rsby in maharashtra .
the authors found that after the implementation of these health insurance schemes , hospitalization rates increased , along with oop expenditure and borrowings related to inpatient care .
however , these studies also used observational data and might suffer from methodological problems . in any case , the implications of higher oop spending among insurance beneficiaries are uncertain . just as a government subsidy for purchase of a house might increase private expenditures on housecleaning supplies , a public hospital insurance programme may increase private expenditures on postoperative drugs .
unless there is a serious concern with moral hazard or irrational decision - making caused by a government programme , the increase in spending on complementary products may be evidence of efficacy , not failure , of the programme .
moreover , the proper remedy for higher oop spending under rsby might be to expand coverage to include medications or physician services rather than scrap the programme altogether .
a cluster - randomized community - based health insurance ( cbhi ) study in bihar and uttar pradesh by the microinsurance academy is currently in progress7374 .
preliminary findings from this study show the dynamics of enrolment into the cbhi , particularly in the presence of rsby in these states74 .
another new study has been recently launched in karnataka . using a randomized design , the study aims to evaluate the impact of rsby on the health and financial outcomes of the above - poverty - line population75 .
there are some additional concerns about rsby that are not directly related to the impact of health insurance , but are very important for the overall effectiveness of the programme .
first , there is a lack of administrative data on various aspects of the scheme , including time trend data on enrolment rates , rates of attrition and re - enrolment , and uptake and benefit utilization rates . while presumably these data are collected at a frequent interval by insurance companies or third party administrators , these need to be made widely available to researchers and other policymakers . without such data ,
second , there is considerable uncertainty surrounding the sustainability of the scheme in the medium and long term . a study by dror and vellakkal19 estimated that it would cost the central government as much as 33.5 billion , or 0.3 per cent of india 's union budget in 2010 - 2011 , in insurance premiums for complete rsby coverage ( all bpl families ) .
in comparison , the scheme was severely underfunded , with actual union budget allocations being only 3.15 billion in 2010 - 2011 and 4.6 billion in 2011 - 201219 .
the enrolment under rsby in 2010 - 2011 was estimated to cost 9.29 billion , and the budgeted resources could cover only about a third of it19 .
furthermore , the budget allocation for rsby may be even more inadequate when we consider the potential utilization patterns of the scheme .
since rsby only covers the poor who are generally more vulnerable to most ailments , its utilization rates might be higher than other health insurance programmes that cover a wider population .
the unfavourable risk pool ( known as the adverse selection problem ) may reduce the financial viability of rsby . therefore , along with increasing budgetary allocations , the risk pool should also be normalized by enrolling more non - bpl people .
third , as with many government schemes , rsby faces problems with system leakage , insurance frauds , and other inconsistencies .
for example , there have been reports of fraudulent claims76 or out of pocket medical expenditure by beneficiaries1170 .
rsby suffers from various structural shortcomings , preventing it from fully protecting the poor from health and financial shocks16217677 .
it is well known that bpl lists , which form the main basis for eligibility into rsby , also suffer from inaccuracies in many states78 .
surveys of health care providers reveal problems related to poor functioning of the paperless mechanism of claims , inadequate reimbursement , and lack of training707779 .
the additional cost of doing business is often passed onto the consumer , which can lead to higher oop payments or unnecessary medical procedures80 .
a systematic evaluation of rsby would provide data on most of these systemic inefficiencies and a basis for targeted improvement . and
ideal evaluation should also look beyond the regular questions asked by researchers , such as its impact on health care utilization and medical expenditure .
data should also be collected on softer measures of the success of the scheme , such as enrolment and hospitalization experience , trust in the programme , and perceived well - being .
rsby is india 's ambitious hospital insurance programme , but the evidence on its intended effects remains inconclusive .
for example , in the absence of natural experiment settings involving exogenous variations in rsby implementation or coverage , future roll out of rsby may be randomized in some regions , even if only on a small scale1021 .
alternatively , randomized studies of rsby coverage can also be conducted among people who are near poverty but not officially on the bpl list and , therefore , not eligible for rsby .
this would allow researchers to answer important questions about the programme 's true benefit , much of which is currently masked by the methodological problems in observational studies .
rigorous impact evaluation of rsby will not only capture the real impact of the scheme , but may also be able to estimate the extent of systemic inefficiencies at the level of the consumer .
budget inconsistencies also need to be addressed , as a resource - starved programme may be beneficial in principle but not in practice .
this is particularly important if rsby plans to also cover outpatient treatment in future , as indicated by pilot studies in odisha and gujarat .
the potential for rsby or an rsby - like scheme is enormous as the need to improve health outcomes and decrease financial shocks is great . at this point , knowing how to grow or alter the scheme so it can achieve these objectives is paramount .
Output:
| in this review the existing evidence on the impact of rashtriya swasthya bima yojana ( rsby ) is discussed in the context of international literature available on health insurance .
we describe potential pathways through which health insurance can affect health and economic outcomes , discuss evidence from other developing countries , and identify potential biases and inconsistencies in existing studies on rsby impact . given the relatively recent introduction of rsby , lack of quality , verifiable data on utilization patterns , and the absence of reliable evaluation studies , there is a need to exercise caution while assessing the merits of the programme . considering the enormous potential and cost of the programme , we emphasize the need for a rigorous impact evaluation of rsby .
it will not only help capture the real impact of the scheme , but may also be able to estimate the extent of systemic inefficiencies at the level of the consumer . |
PubmedSumm6899 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: multiple sclerosis ( ms ) is a long - lasting disease typically affecting young adults characterized by the presence of multifocal inflammatory demyelinated plaques distributed over time and space within the central nervous system ( cns ) .
pathological features of ms include breakdown of the blood - brain barrier , multifocal inflammation , demyelination , oligodendrocyte loss , reactive gliosis , and various degrees of axonal damage , ranging from transient dysfunction to irreversible loss , even at early stages of the disease .
although acute inflammation usually causes reversible neurological dysfunction , ms relapses may also lead to residual irreversible disability involving both motor and cognitive functions [ 3 , 4 ] . in the last decade , improved diagnostic criteria and availability of effective disease - modifying drugs have led to a paradigm shift towards earlier diagnosis and treatment [ 5 , 6 ] . in spite of this , either the actually available disease - modifying treatment or the other pharmacological approaches
have little or no impact on permanent impairments , with motor symptoms and cognitive deficit reported , respectively , by 4590% and 4065% of patients throughout their disease , with a certain degree of overlap [ 79 ] .
consequently , the management of motor and cognitive disturbances still relies on rehabilitative strategies [ 10 , 11 ] , which have been reported to be effective in ameliorating these functional domains , suggesting that remediation / compensation may occur into even damaged brain structures .
this may imply that rehabilitation is able to enhance neuroplasticity , that is , the intrinsic property of the cns to structurally and functionally adapt itself in response to external stimuli , environmental changes , or injuries . while in healthy individuals the plasticity represents the basis of brain development , learning , and memory , in the context of ms this term encompasses molecular , synaptic , cellular events and even reorganization of the brain cortex or fibers that result in recovery of function after an acute or chronic damage .
the most promising advanced magnetic resonance imaging ( mri ) techniques for investigating brain plasticity are the functional mri ( fmri ) and diffusion tensor imaging ( dti ) . the fmri is based on the detection of changes in the blood oxygenation level - dependent ( bold ) signal , which is in turn affected by changes in neural activity in a specific brain region and the underlying physiology or pathology .
changes in bold signals can be investigated during the execution of a specific task ( e.g. , simple motor activity , sensory stimulation , and cognitive effort ) or at rest to explore the functional connectivity ( fc ) , that is , the functional interaction between different brain regions .
the dti is a method to assess myelin integrity in vivo , providing information on the integrity of the myelin - axon unit based on the directional asymmetry of water diffusion , that is , the so - called fractional anisotropy ( fa ) .
the fa value is determined by the ratio of axial diffusivity ( ad ) and radial diffusivity ( rd ) , and decreased ad and increased rd are considered as markers of axonal damage and demyelination , respectively , thus representing parameters that are sensitive to underlying pathological processes of ms . using these advanced mri techniques
, it has been recently demonstrated that rapid - onset plasticity and functionally relevant chronic reorganization processes are preserved even in the most advanced stage of the disease and that these phenomena are functionally relevant to maintain motor and cognitive function [ 16 , 20 , 21 ] .
all these findings support the hypothesis that neuroplasticity may be enhanced by rehabilitation . in this view
, advanced mri may address knowledge gaps between the observed clinical improvement and the neural mechanisms underlying the improved function after rehabilitation , providing a powerful tool to investigate functional and structural brain changes related to recovery of function .
however , only few studies have investigated the mechanisms of rehabilitation - induced neuroplasticity so far , providing fragmented and incomplete data , in spite of the fact that rehabilitation is recognized as having a key role in the management of patients with ms .
therefore , in this systematic review , we sought to summarize the existing mri - based evidences that motor and cognitive rehabilitation may induce functional and structural plasticity into the brain of patients with ms .
search strategy and article selection . according to the preferred reporting items for systematic review and meta - analyses ( prisma ) statement , two electronic databases ( pubmed and scopus )
the search was run using the following terms : ( training or rehabilitation ) and imaging and multiple sclerosis
[ all fields ] . no article type limitations or time period restrictions were applied , and the latest search was undertaken on january 20 , 2015 .
we were not familiar with any study currently in progress that could be considered for inclusion , except for one study from our group recently submitted .
published conference abstracts , articles not available in english , and those including patients also affected by neurological conditions other than multiple sclerosis were excluded . to fit the main purpose of this systematic review , that is , summarize the existing mri - based evidences of rehabilitation - enhanced functional and structural plasticity in ms , we also excluded studies whose training was based on short - term learning , those in which mri was used to predict the outcome of rehabilitation , and those in which the occurrence of brain plasticity was assessed by means of techniques other than mri ( e.g. , transcranial magnetic stimulation , electroencephalogram , etc . ) .
abstracts of resulting articles were then examined in order to select studies that met eligibility criteria . to assess eligibility , two investigators ( surnames are provided ) independently searched for articles , and agreement between them was required in order to include an article . in case of disagreement ,
the decision was made by the most experienced author ( p. pantano ) after reading the whole article .
first author , year of publication , sample size , study design , type and duration of intervention , clinical and mri outcome measures , and interpretation of findings were extracted from included articles and recorded on an electronic spreadsheet ( m. c. piattella ) .
methodological quality of included articles was assessed using the scale developed by the physiotherapy evidence database ( pedro ) initiative .
the purpose of the pedro scale is to determine the external validity ( criterion 1 ) , internal validity ( criteria 29 ) , and statistical soundness ( criteria 10 - 11 ) of a study included in a systematic review .
good , studies scoring 4 - 5 were of fair quality , studies scoring below 4 were felt to be of poor quality .
the strategy search initially yielded 216 and 231 articles in the pubmed and scopus databases , respectively ; additional 10 articles were found from other sources ( references of selected papers ) . after applying the inclusion / exclusion criteria and checking full - text articles for eligibility , a total of 16 articles
were included in the qualitative synthesis , as shown in the flow diagram in figure 1 .
six studies investigated whether motor rehabilitation strategies enhance brain plasticity , as evaluated by either task - related fmri ( n = 2 ) [ 26 , 27 ] , dti ( n
= 3 ) [ 2830 ] , or both techniques ( n = 1 ) ( see table 1 ) . ten studies investigated whether cognitive rehabilitation strategies enhance brain plasticity , as evaluated by either task - related fmri ( n = 5 ) [ 3235 , 37 ] ( see table 2 ) or resting - state ( rs)-fmri ( n = 4 ) ( see table 3 ) [ 3841 ] ; just one article provided findings by combining task - related fmri and rs - fmri with structural mri for mapping changes in white matter ( wm ) and grey matter ( gm ) ( included in table 2 ) .
data from pedro scale showed that selected article scored between 4 and 10 of 11 total points .
studies based on nonrandomized design [ 2628 , 3133 , 35 , 40 ] or those without an alternative sham training as control group obtained lower scores [ 30 , 36 , 38 , 41 ] . the first attempt to demonstrate the occurrence of brain plasticity following motor rehabilitation was done by rasova and colleagues who selected ( without randomization ) 28 patients with ms . of them ,
17 received a 2-month outpatient physiotherapy program ( 1-hour sessions , twice per week ) based on sensorimotor learning and adaptation by combining different disciplines ( vojta 's reflective locomotion , bobath concept , sensorimotor stimulation , proprioceptive neuromuscular facilitation , burger concept , and yoga ) , while the remaining 11 patients did not undergo any special training .
a control group of 13 healthy subjects was also enrolled to investigate whether rehabilitation might lead brain function to approach standard
( i.e. , values found in healthy group ) , as evaluated by task - related fmri consisting of repetitive thumb and index flexions at a 3-second frequency , according to a visual stimulus .
although a relevant clinical improvement was found in the active group when compared with the control group , the authors failed to demonstrate between - group differences in the amplitude of fmri signal of four areas contributing to sensorimotor learning ( primary sensorimotor cortex , supplementary motor cortex , nucleus dentatus , and putamen ) , as well as increased interhemispheric dependence . moreover , there was no relationship between changes in clinical parameters and in brain activation .
the authors concluded that the unpredictable course of the disease and the heterogeneous , symptom - tailored rehabilitation strategy hampered the detection of changes at group - level in fmri activation , questioning about the appropriateness of fmri for investigating motor plasticity .
the same group explored the impact of operator - assisted facilitation physiotherapy on microstructural properties of the corpus callosum in 11 right - handed patients with ms .
they were scanned in two separate occasions 1 month apart ( run - in period ) and then after the 2-month rehabilitation ( 2-hours per week ) . increased callosal fa , reduced mean diffusivity ( md ) and rd were found after the intervention ( by approaching the values of 11 healthy controls ) , while no difference was observed during the run - in period .
improved scores at the paced auditory serial addition test ( pasat ) and a trend towards an improvement of the expanded disability status scale ( edss ) score are reported by the authors , but the relationship between clinical improvement and mri changes was not reported .
more recently , a similar study was conducted to investigate the immediate and long - term effects of a 2-month motor program activation therapy ( 1-hour sessions , twice weekly ) .
patients were clinically evaluated and scanned four times to obtain dti data of the corpus callosum and motor task - related fmri ( flexion and extension of metacarpophalangeal joints ) .
follow - up data were available for 12 patients who experienced a significant improvement in some clinical scales and in dti metrics of corpus callosum ( increased fa and reduced md ) immediately after and even one month after the end of the intervention , while no relevant change was found in terms of fmri data .
tomassini and colleagues submitted 23 patients and 13 healthy controls to short - term and long - term practice of a visuomotor task . the short - term and long - term training consisted of 12-minute training , done during the first fmri session , and 13-minute home - based sessions , once daily , for 15 days , respectively ; at the end of the training , patients and healthy subjects had a second fmri session .
from a clinical standpoint , although patients performed poorer than healthy subjects in terms of overall tracking error for the visuomotor task , the ms group improved similar to healthy group after both short - term and long - term practices , regardless of mri measures of brain damage and disability . after the long - term practice that may be considered as equivalent to a short rehabilitative intervention , a significant reduction in task - related activation of the occipital and parietal cortices was found in patients .
greater long - term clinical improvement was found to be related to smaller changes in task - related activation over time in the left superior lobule and right lateral occipital cortex , but this correlation failed to reach a statistical significance .
long - term postintervention fmri changes observed in patients differed from those found in healthy subjects who showed reduced task - related activation only in the occipital cortex .
the authors concluded that adaptive plasticity is preserved even in chronically disabled patients with ms , but this plasticity is modulated by brain systems different from those acting in healthy subjects . to investigate the possibility that rehabilitation induces microstructural changes of wm bundles involved in voluntary motor control , bonzano and colleagues randomized ( in a 1 : 1 ratio ) 30 patients with ms to receive either 2-month active , task - oriented motor rehabilitation ( active group ) or a 2-month passive motor rehabilitation ( control group ) of the upper limbs ( 1-hour sessions , thrice per week ) . before and after rehabilitation , dti data of the corpus callosum , left and right corticospinal tracts , and left and right superior longitudinal fasciculus were obtained .
after rehabilitation , the unimanual motor performance improved in both groups , while the bimanual coordination task worsened in control group and remained stable in active group . accordingly , reduced fa and increased rd of corticospinal tracts and corpus callosum were found in the control group , but not in the active one .
the authors concluded that active ( voluntary ) , but not passive , rehabilitation preserves wm integrity of brain structures specifically involved in the trained function , thus supporting the beneficial effect of task - oriented rehabilitation . based on data from a randomized , two - period , crossover pilot study , showing a beneficial effect of the nintendo wii balance board on static balance , prosperini and colleagues investigated whether dti parameters of cerebellar connections significantly changed after intervention and whether these changes correlated with clinical improvement .
a total of 36 patients with ms were randomized in a 1 : 1 ratio to two counterbalanced groups : group a received 30-minute sessions , 5 days per week for 12 consecutive weeks of home - based video game training ( intervention period ) , followed by a 12-week period without any specific intervention ( observation period ) ; group b was given the treatment in reverse order .
patients were clinically evaluated and mri scanned at study beginning and at the end of the first and the second study periods ; mri data were available for 27 patients .
improved dti measures of superior cerebellar peduncles were found after the training ( increased fa and reduced rd ) , suggesting the occurrence of activity - dependent myelomodulation in partially damaged pathways ( see figure 2 ) .
these microstructural changes were also significantly related to clinical improvement of static balance , supporting the hypothesis that structural plasticity may be enhanced in brain areas specifically involved in the function trained with high - intensity , task - oriented rehabilitation .
however , there was no retention of training - induced improvement in clinical and mri measures . in a preliminary study ,
11 patients with ms suffering from mild to severe cognitive impairment were submitted to a 3 - 4-week intervention with the aixtent software to train alertness , divided attention , selective attention , and vigilance . by comparing pre- and posttraining clinical findings and task - related fmri features , penner and kappos demonstrated both a clinical improvement and an increased activation of regions in the cingulate gyrus , precuneus , and frontal cortex ; all these areas are known to be involved in a network functionally related to attention processing .
the effect of a mixed intervention ( game - like group activities and computer - aided training ) was investigated by sastre - garriga and colleagues in an open - label , proof - of - concept trial .
fifteen patients with ms underwent an extensive neuropsychological evaluation and were scanned to obtain task - related ( pasat ) fmri before and after a 5-week run - in period .
further clinical and fmri data were collected at the end of a 5-week cognitive training period ( 1-hour sessions , thrice per week ) .
five healthy subjects who were scanned at the same time - points served as healthy controls . after the training , patients exhibited an improved performance in backward version of digit span and increased fmri activation in right posterior lobe ( uvula and declive ) and left anterior and posterior lobes of cerebellum ( declive and culmen ) .
however , clinical findings and fmri changes did not significantly correlate , likely because the study was underpowered to detect relevant clinical changes owing the small sample size . a double - blind , placebo - controlled ,
randomized clinical trial was designed to investigate changes in brain activation following modified story memory technique ( msmt ) , a rehabilitative approach used for treating new learning and memory deficits .
a total of 16 patients were randomized either to a 5-week treatment using msmt ( active group ) or to story reading and answering related questions ( control group ) , with the same schedule ( 4560-minute sessions , twice per week ) .
both groups were scanned to obtain task - related fmri data during list - learning and word - recognition tasks .
the proportion of patients who improved memory performance on california verbal learning test short - delay free recall after the intervention was greater in the active than in the control group . compared to controls , patients in the active group showed an increased activation in some areas of frontal , parietal , temporal , and occipital cortices and in the cerebellum .
there was also a significant correlation between improved memory performance and increased activation of the right middle frontal gyrus , which is known to be associated with visual and context - dependent learning .
some patients originally enrolled in this latter study underwent also rs - fmri , in order to explore fc using the left and the right hippocampus ( implicated in memory function ) and posterior cingulated cortex ( involved in the default - mode network ) as seeding points . out of the two analyses performed , the less conservative one showed that after the training the active group had an increased connectivity between the left hippocampus , the insula , and pyramids of vermis , between the right hippocampus and the postcentral gyrus , and between the posterior cingulated cortex and thalamus .
brain activation changes following a 6-week visual imagery training ( 2-hour sessions , once weekly ) were investigated in 4 patients with ms .
they underwent pre- and posttraining clinical evaluations and task - related fmri ( evocation of specific personal memories ) .
a significant improvement of autobiographic memory performance , coupled with increased activation of posterior cerebral areas specifically involved in memory retrieval ( right cuneus , left precuneus , left inferior and superior occipital gyri , and left lateral temporal cortex ) , was found after the rehabilitation .
cerasa and colleagues performed a randomized , double - blind , controlled trial in which 26 patients with ms were allocated to receive a 6-week computer - aided training ( 1-hour sessions , twice per week ) either with the rehacom package , a modular system developed to treat a wide spectrum of cognitive functioning , including alertness , attention , memory , executive functions , and visual field ( active group ) , or with a simple visuomotor coordination task ( control group ) . before and after the intervention , both groups were clinically examined and scanned to obtain task - related fmri data ( visual pasat ) .
performance at stroop test improved in the active group only , which also showed increased activation of brain areas subserving refreshing phonological stimuli and short - term information storage , that is , the right posterior cerebellar lobule and left superior parietal lobule .
filippi and colleagues used functional and structural mri to investigate brain changes after a 12-week computer - assisted training with rehacom .
twenty patients with ms were randomly allocated either to the active group ( n = 10 ) or to the control group , which did not undergo any intervention ( n = 10 ) . before and after the 12-week study period ,
both groups were assessed by a complete neuropsychological evaluation and scanned to map changes in wm and gm structures and to obtain task - related fmri ( stroop test ) and rs - fmri data .
the active group showed a clinical improvement in some tests of attention , information processing , and executive functions , an increased activation of posterior cingulated cortex and/or precuneus and dorso - lateral prefrontal cortex ( bilaterally ) during the task - related fmri , and increased rs - fc of the anterior cingulated cortex ( salience processing ) , left dorsolateral prefrontal cortex ( executive function ) , right inferior parietal lobule , posterior cingulated cortex , and/or precuneus ( default - mode network ) . neither wm nor gm microarchitecture , assessed with dti and voxel - based morphometry , was impacted by the rehabilitation .
the authors concluded that rehabilitation of attention , information processing speed , and executive function enhance recruitment of brain networks subserving the trained functions . in another study
, data from the same population were reanalyzed using the anterior cingulated cortex as seed to explore its rs - fc . at follow - up
, the anterior cingulum showed an increased fc with the right inferior parietal lobule and decreased fc with the right inferior temporal gyrus in the active group only ; some of these fc changes were significantly related to improved pasat scores after the training .
bonavita and colleagues performed a nonrandomized parallel - group trial in which 18 patients were trained using the rehacom package ( active group ) and 14 patients were submitted to newspaper reading and content referring for 8 consecutive weeks .
both groups underwent an extensive neuropsychological evaluation and rs - fmri study at entry and at the end of follow - up .
several neuropsychological tests of information processing speed and verbal and visual sustained memory improved in the active , but not in the control , group after the 8-week study period . likewise , increased rs - fc in the posterior cingulated cortex and inferior parietal cortex bilaterally ( subserving the default - mode network ) was found in the active group .
lastly , de giglio and colleagues performed a randomized , wait - list controlled study to investigate the effectiveness of 8-week home - based playing period with the dr .
kawashima nintendo brain training , an educational video game aimed at training memory , attention , visuospatial processing , and calculations .
the active group exhibited a significant improvement in sustained / divided attention and some aspects of executive functions . in a post
hoc analysis recently submitted for publication , 24 patients enrolled in the original trial underwent rs - fmri before and after the cognitive training .
we found that this type of cognitive rehabilitative training induced an increased thalamic fc in brain areas corresponding to the posterior component of the default - mode network ( cingulum , precuneus , and bilateral parietal cortex ) and a decreased connectivity in the vermis and left dorsolateral prefrontal cortex ( see figure 3 ) .
moreover , positive correlations were found between improved cognitive performance ( pasat , symbol digit modalities test , and stroop test ) and increased fc in areas belonging to the default - mode network .
brain plasticity represents the substrate for interventions promoting functional recovery , by means of neural restoration or compensation [ 12 , 20 , 21 ] .
findings from the present systematic review suggest that there is mri - based evidence that functional or structural plasticity occurred following motor or cognitive rehabilitation in patients with ms .
in addition , some studies also showed relevant relationship between improved function and mri - detected brain changes [ 27 , 30 , 34 , 3638 , 40 , 41 ] .
this latter feature supports the notion that training - induced plasticity is specifically linked to the trained function and it is not merely a general effect of any rehabilitation .
although they differed from each other , studies on motor rehabilitation support the notion that brain plasticity is enhanced by task - dependent and target - selected training [ 27 , 29 , 30 ] , rather than by an holistic
approach . improved microstructural properties of corpus callosum were found following high - intensity , repetitive training of motor functions involving the lower limbs and task - oriented exercises aimed at improving upper limb functions [ 28 , 29 , 31 ] .
callosal fibers connect homologous cortical areas of the two hemispheres , thus subserving a wide range of motor and cognitive function , including gait and bimanual coordination [ 4548 ] .
favourable changes in the microarchitecture of the superior cerebellar connections were reported after a video game - based training of balance .
superior cerebellar peduncles mainly contain output fibers projecting from cerebellum to the neocortex , contributing to a high - level sensory weighting for postural control .
however , the interpretation of dti parameters in relation to pathological changes derived is still controversial , and some authors argued that rd does not selectively measures demyelination due to ms but represents more complex tissue changes .
in addition , the reliability and sensitivity to changes of dti measures are not well elucidated yet .
studies on cognitive rehabilitation are somewhat more consistent than those on motor rehabilitation , not only in terms of trained functions but also in their results . the majority of intervention strategies consisted of computer - assisted training of attention , short - term memory , and executive functions [ 32 , 33 , 3638 , 40 , 41 ] . despite some differences regarding the neuropsychological scales and clinical outcome measures adopted ,
task - related fmri and rs - fmri findings are quite consistent , pointing out the role of some specific brain regions such as the cingulated cortex [ 32 , 34 , 36 , 38 , 40 , 41 ] , precuneus [ 32 , 3436 , 41 ] , and cerebellum [ 33 , 34 , 37 , 39 ] . the cingulated cortex is known to cover emotion formation and processing , learning , and memory , thus linking behavioral outcomes to motivational learning [ 5254 ] .
the precuneus is involved in episodic memory and visuospatial imagery and it has been suggested to be a specific target for visual mirror therapy and virtual reality - based rehabilitation [ 55 , 56 ] .
being connected with many association networks , the cerebellum has been now recognized to be not only involved in motor planning and learning , but also in different cognitive domains , including attention , memory , and learning , executive control , language , and visuospatial function [ 58 , 59 ] . despite some encouraging findings reported above , the studies included in the present systematic review suffer from several drawbacks , mainly concerning the small sample size and the absence of a nonactive control group , blindness , and/or randomization in the study design .
moreover , the selected articles are not comparable because clinical outcome measures , mri biomarkers , and intervention are not standardized .
only few articles report data about the occurrence of acute relapses and disability progression [ 28 , 30 , 37 , 38 , 41 ] or information on disease - modifying and symptomatic treatments taken by patients while on study [ 28 , 29 ] .
however , this should have not biased findings / interpretation of the included studies for several reasons : ( i ) no patients relapsed or experienced disability progression ( when reported ) [ 28 , 30 , 37 , 38 , 41 ] ; ( ii ) it is very unlikely that relapses and disability progression might have occurred , given the short duration of the studies ( from a minimum of 15 days to a maximum of 24 weeks ) in the remaining studies [ 26 , 27 , 29 , 3136 , 39 , 40 ] ; ( iii ) as per inclusion criteria only patients in a stable phase of the disease were enrolled ; ( iv ) the randomization procedure ( when applied ) should have prevented any imbalance in known and unknown baseline characteristics between treatment and control groups [ 29 , 30 , 34 , 3639 , 41 ] .
the lack of statistical inferences aimed at exploring correlations between imaging results and clinical outcomes represents another major limit of some studies [ 26 , 28 , 29 , 31 , 32 , 34 , 35 , 40 ] since there is recommendation that mri changes following the rehabilitative interventions should be quantified and compared with clinically relevant , sensitive , and reproducible outcomes [ 20 , 60 ] .
postintervention study phases were planned only rarely , but they may provide important information about the retention of rehabilitation - induced clinical and mri improvements , especially for defining the most appropriate duration and timing of rehabilitation .
therefore , efforts for future research should be focused on establishing ( i ) the most appropriate strategies for effective rehabilitation ; ( ii ) standardised , valid , and reliable endpoints to assess the efficacy of rehabilitation , taking into account the concept of ecological validity and patient - centered outcomes ; and ( iii ) clinical and mri measures that most effectively detect the occurrence of beneficial brain plasticity after specific training .
another new intriguing field of research that is worth developing encompasses the possibility of combining rehabilitation with pharmacologic treatments or neuromodulation , to obtain a synergistic or even a more than additive effect on brain plasticity , as demonstrated in other pathological conditions [ 6163 ] . in conclusion ,
the current knowledge about the rehabilitation - induced brain plasticity in ms is still fragmented and incomplete .
the ultimate goal should be to demonstrate , at an evidence - based level , that effective rehabilitation favourably affects the brain structures , improves the trained function , and promotes the patient 's quality of life .
Output:
| rehabilitation is recognized to be important in ameliorating motor and cognitive functions , reducing disease burden , and improving quality of life in patients with multiple sclerosis ( ms ) . in this systematic review ,
we summarize the existing evidences that motor and cognitive rehabilitation may enhance functional and structural brain plasticity in patients with ms , as assessed by means of the most advanced neuroimaging techniques , including diffusion tensor imaging and task - related and resting - state functional magnetic resonance imaging ( mri ) . in most cases ,
the rehabilitation program was based on computer - assisted / video game exercises performed in either an outpatient or home setting . despite their heterogeneity , all the included studies describe changes in white matter microarchitecture , in task - related activation , and/or in functional connectivity following both task - oriented and selective training .
when explored , relevant correlation between improved function and mri - detected brain changes was often found , supporting the hypothesis that training - induced brain plasticity is specifically linked to the trained domain .
small sample sizes , lack of randomization and/or an active control group , as well as missed relationship between mri - detected changes and clinical performance , are the major drawbacks of the selected studies .
knowledge gaps in this field of research are also discussed to provide a framework for future investigations . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.