id
stringlengths 11
16
| query
stringlengths 279
826k
| answer
stringlengths 174
4.34k
|
---|---|---|
PubmedSumm119600 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: subcutaneous panniculitis - like t - cell lymphoma ( sptl ) is a rare subgroup of primary cutaneous t - cell lymphoma with major manifestation in the subcutaneous tissues .
histologically , sptl is characterized by infiltration of pleomorphic t cells in the subcutis , mimicking lobular panniculitis [ 2 , 3 ] .
given clear differences in disease outcome the world health organization - european organization for research and treatment of cancer ( who - eortc ) classification for cutaneous lymphomas defines as sptl only cases with an /+ t - cell phenotype and a usually indolent clinical course .
in contrast , the aggressive /+ form of cutaneous t - cell lymphomas with frequent subcutaneous involvement was separated as a distinct entity .
we describe complete disease remission in a 63-year - old woman with primary cutaneous /-type sptl following treatment with bexarotene and prednisone . in light of a lack of standard treatment for sptl
, we describe our experiences with using bexarotene as a first - line therapy and its efficacy in /-type sptl .
a 63-year - old woman presented with painful subcutaneous nodules bilaterally on her upper thighs ( fig .
no other diseases were known . without evidence of pancreatitis , alpha 1-antitrypsin deficiency , or lupus erythematosus ,
initial treatment with systemic prednisone of up to 100 mg per day and nsaids like ibuprofen led to some improvement without remission .
additional histopathology taken 8 months after onset of disease revealed dense lobular lymphocytic infiltrates rimming around adipocytes ( fig .
2a , b ) with the infiltrates staining positively for cd3 , cd8 ( fig .
2c , d ) , perforin , tia-1 , and negatively for cd4 , cd5 , cd56 .
complete staging , including ct of thorax and abdomen and head mri revealed no systemic involvement .
t - cell receptor polymerase chain reaction ( pcr ) from skin biopsy was performed by a reference laboratory and revealed clonality as well as an / phenotype .
the combination of clinical findings , histopathology and molecular biology prompted us to make the diagnosis of primary / sptl .
the patient was started on a treatment of 150 mg / day bexarotene and 80 mg / day prednisone .
bexarotene was increased to 300 mg / day while prednisone was tapered in step - wise fashion .
complete remission was achieved and bexarotene was discontinued . in the following 2 years two recurrences occurred .
for the first recurrence , bexarotene alone was given for 4 months , after which a complete remission was seen .
bexarotene alone was again reintroduced for the second recurrence and clinical improvement but no complete remission is currently observed after a follow up of 5 months .
sptl was first described in 1991 by gonzalez et al . as a distinct form of cutaneous lymphoma characterized by subcutaneous tissue localization , aggressive clinical course and frequent association with hemophagocytic syndrome .
there are two distinct types of sptl with very different disease outcome . in a study of 83 cases of sptl , patients with /+ t - cell phenotype had an indolent clinical course with a five - year survival of 82% .
in the same study , patients with /+ t - cell phenotype showed a more aggressive disease with extracutaneous dissemination , and the five - year survival was 11% .
this clear difference in clinical outcome necessitates development of separate therapeutic strategies for each type of sptl .
bexarotene is a retinoid that selectively activates the retinoid x receptors ( rxr ) . in a clinical trial with heavily pretreated refractory cutaneous t - cell lymphoma ( ctcl ) patients ,
bexarotene treatment resulted in a response rate of 54% in early - stage ctcl and 45% in advanced - stage ctcl patients .
side effects of bexarotene treatment include elevation in lipid and cholesterol levels and hypothyroidism at higher doses .
thus , patients on bexarotene need to be closely monitored for toxicity , and lipid - lowering medications and levothyroxine might be necessary .
a number of treatment strategies including chemotherapy , systemic corticosteroid therapy , local radiotherapy and surgery have been reported with various success rates [ 7 , 8 , 9 , 10 ] . in a study of 63 patients with / sptl ,
31 patients were treated with cyclophosphamide , doxorubicin , vincristine , and prednisone ( chop ) or similar chemotherapy and 19 patients showed complete remission .
sixteen of 24 patients went into complete remission after they were given less aggressive initial treatments , including combinations of prednisone , chlorambucil , methotrexate , cyclophosphamide , interferon- ? , and gemcitabine
we present the first report of complete remission in a sptl patient with combined bexarotene and prednisone treatment .
it is not possible to clearly assess the contribution of each substance to the therapeutic effect .
but the fact that a prior therapy with prednisone and nsaids did not result in complete remission substantiates the contribution of bexarotene . furthermore , after discontinuation of treatment , the patient presented with a relapse of sptl , but went into remission when monotherapy with bexarotene was restarted . in comparison to the dosage used to treat mycosis fungoides
, the patient showed remission with relatively low daily doses of 300 mg / day of bexarotene .
studies have demonstrated that bexarotene is generally well tolerated at the lower doses ( 150300 mg / day ) , which results in limited toxicity .
low toxicity makes bexarotene a less aggressive and , taking into consideration the indolent nature of sptl , potentially a better initial therapy , as compared to chop or methotrexate .
patients with sptl are known to suffer numerous relapses after establishing complete remission . for patients who tolerate bexarotene well
, continuous low - dose treatment might be utilized after complete remission to maintain the disease - free state .
Output:
| subcutaneous panniculitis - like t - cell lymphoma ( sptl ) of the / type is a rare subtype of non - hodgkin 's lymphoma of the skin .
although these tumors usually run an indolent course , disease - related morbidity is often severe .
clinical findings include subcutaneous tumors located on the extremities or trunk , often accompanied by systemic symptoms like fever or fatigue . due to the low incidence of sptl
, no standardized therapy has been defined so far and there is currently no curative therapy available for this type of non - hodgkin 's lymphoma . by sharing our experience with bexarotene therapy , we present a safe and potentially improved treatment for patients with sptl . in the case
presented , bexarotene was able to induce remission even after recurrence of disease . |
PubmedSumm119601 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: cardiac procedures have some of the highest risks of bleeding , with almost 50% of patients experiencing some type of bleeding - related consequence.1 other common surgical procedures have bleeding rates ranging from < 10% to 35%.1 uncontrolled bleeding is associated with increased risk of death,2 blood transfusions , and increased costs due to increased health care resource utilization ( hru).3 adjunctive hemostats are intraoperative products that play a critical role in the control of bleeding in the operative setting , and were used in approximately 30% of procedures in 2010.4 there are a variety of adjunctive hemostatic agents that can reduce or stop bleeding .
four of the most common are : 1 ) oxidized regenerated celluloses ( orcs ) , 2 ) gelatins , 3 ) flowables , and 4 ) topical thrombins .
orcs and gelatins are mechanical hemostats.5 orcs are a plant - derived product ( cellulose ) , typically in a knitted or non - woven fabric form , which work by providing a surface for platelet adhesion and aggregation.6 gelatins are porcine - or bovine - derived products , which typically consist of a dry sponge.6,7 the gelatin products can be moistened with saline,6 in which case they would function like orcs by providing a surface for platelet adhesion and aggregation .
however , gelatins are also frequently moistened with thrombin.6 flowables are also gelatin - based , but in the form of a flowable matrix7 that can be applied with a syringe and cannula .
thrombins are proteolytic enzymes that aid in the polymerization of the patient s own fibrinogen.5,7 overall , there has been an increase over time in the use of adjunctive hemostatic agents to control bleeding in all surgical procedures.4 the objective of this study was to compare the hru , costs ( in us$ ) , and outcomes associated with using orcs compared to other adjunctive hemostats ( oahs ; flowables , gelatins , and topical thrombins ) for surgical procedures performed in us inpatient settings in which both orcs and oahs were commonly utilized for hemostasis . the hemostatic effect of orcs compared to other hemostat classes has been studied in a number of prospective clinical trials,812 and orcs plus thrombin have been compared to other hemostat classes regarding their impact on inpatient length of stay ( los ) via a retrospective analysis of us hospital inpatient data.13 however , to the best of our knowledge , the current study is the first to use a cross - sectional dataset to retrospectively analyze the difference in a broad range of hrus , costs , and outcome metrics for orcs compared to other classes of adjunctive hemostats .
data for this retrospective , observational cohort study were obtained from the premier healthcare database ( referred to as the premier database ) .
premier is a consortium of us community and teaching hospitals that are non - profit and non - governmental , with approximately 6 million discharges annually .
the premier database covers approximately 25% of all hospital discharges in the us annually14 and is nationally representative .
the database includes patient demographic and hospital characteristics , diagnoses , and procedures , as well as chargemaster data , which includes discharge - level resource utilization .
this database contains a day of service - stamped log containing all billed items ; laboratory , diagnostic , and therapeutic services rendered ; and medications administered during the hospital stay . as an aggregated ,
de - identified , hipaa compliant and statistically certified database , no institutional review board approval is required for analysis and publication .
the premier database was chosen for our current study due to its broad coverage of us inpatient procedure data allowing for generalizability to the entire us hospital market , and the ability to define the patient population and measure outcomes of interest . the study cohort consisted of hospital discharges for adult patients ( aged 18 years ) undergoing inpatient cardiovascular , carotid endarterectomy , cholecystectomy , or hysterectomy procedures during the 20112012 calendar years , in which adjunctive hemostats in the orc , flowable , gelatin , or topical thrombin classes were utilized ; table 1 lists the products included in each class . the only orc products currently approved for use in the us are surgicel ( ethicon , inc . , somerville , nj , usa ) products
flowables , gelatins , and thrombins were combined into a single comparison category , because these products are frequently used in combination during a single procedure .
patients with missing data or who were treated with a combination of the orcs and oahs during the same procedure were excluded .
cardiovascular procedures , carotid endarterectomy , cholecystectomy , and hysterectomy were selected for evaluation in the present study because both orc and oah usage were relatively common in these procedures , with each of these procedures including at least 3,000 discharges for orc and oah utilization .
the original list of procedures considered for inclusion included arteriovenous graft , brain operations , coronary artery bypass graft surgery , carotid endarterectomy , cholecystectomy , and hysterectomy , operations on the kidney , prostatectomy , and valve surgery ( figure 1 ) .
valve surgery and coronary artery bypass graft surgery were combined to create the cardiovascular procedure group since there was a significant overlap in the patients with these procedures .
procedures were identified based on the international classification of diseases , ninth revision , clinical modification ( icd-9-cm ) procedures and current procedural terminology codes ; table s1 lists icd-9 codes .
the primary endpoints for this study were los , adjunctive topical hemostatic product units per procedure , total procedure cost , transfusions during hospitalization , and mortality .
los and total cost for each hospitalization were abstracted from the dataset as directly supplied by the hospital .
the adjunctive topical hemostat product units per procedure abstraction was based on the count of the product units per discharge .
standard charge codes for transfused blood products and transfusion procedure codes were used to identify patient discharges with transfusions .
all analyses were performed separately for the indications of cardiovascular procedure , carotid endarterectomy , cholecystectomy , and hysterectomy .
outcome variables were compared between matched cohorts using standard statistical tests , eg , paired t - tests and mcnemar s tests for continuous and categorical measures , relevant to the outcome variable data type and distribution . to reduce the effect of treatment - selection bias , matched pairs of orc and oah patients
were created using a propensity score matching ( psm ) approach.15 psm is frequently used in the medical literature as a means to adjust for confounding factors when using observational data to estimate the effect of treatments on outcomes.16 once matched cohorts are created , several outcomes can be studied ; this method provides an advantage over creating independent regression models for each outcome , because there is less concern about model misspecification.17 in this study , psm was used to create matched patient cohorts based on their propensity to be treated with an orc . to estimate a patient
s propensity for a particular treatment , logistic regression models were fit , regressing on patient and hospital characteristics , specifically age , ethnicity , sex , and comorbidities ; table s2 identifies codes .
pre - existing bleeding conditions , also used to estimate propensity , are listed in table s3 .
teaching / non - teaching hospital status , hospital census region , and urban / rural hospital location were also considered in the estimation of treatment propensity . additionally , to remove confounding factors due to the effects of other hemostat classes , concomitant use of non - orc / non - oah adjunctive hemostats were matched to isolate differences in outcomes between orc and oah classes .
patients were matched using a 1:1 greedy matching algorithm,18 and the balance of all patient and hospital characteristics was assessed .
after the matched cohorts were created , differences between orc and oah cohorts were calculated for all outcome measures : los , total costs , transfusions , mortality , and orc / oah units per discharge for each procedure .
statistical differences between orcs and oahs for los were assessed with wilcoxon signed - rank sum tests .
statistical analysis was performed using sas version 9.2 software ( sas institute inc . , cary , nc , usa ) .
data for this retrospective , observational cohort study were obtained from the premier healthcare database ( referred to as the premier database ) .
premier is a consortium of us community and teaching hospitals that are non - profit and non - governmental , with approximately 6 million discharges annually .
the premier database covers approximately 25% of all hospital discharges in the us annually14 and is nationally representative .
the database includes patient demographic and hospital characteristics , diagnoses , and procedures , as well as chargemaster data , which includes discharge - level resource utilization .
this database contains a day of service - stamped log containing all billed items ; laboratory , diagnostic , and therapeutic services rendered ; and medications administered during the hospital stay . as an aggregated ,
de - identified , hipaa compliant and statistically certified database , no institutional review board approval is required for analysis and publication .
the premier database was chosen for our current study due to its broad coverage of us inpatient procedure data allowing for generalizability to the entire us hospital market , and the ability to define the patient population and measure outcomes of interest .
the study cohort consisted of hospital discharges for adult patients ( aged 18 years ) undergoing inpatient cardiovascular , carotid endarterectomy , cholecystectomy , or hysterectomy procedures during the 20112012 calendar years , in which adjunctive hemostats in the orc , flowable , gelatin , or topical thrombin classes were utilized ; table 1 lists the products included in each class . the only orc products currently approved for use in the us are surgicel ( ethicon , inc . ,
somerville , nj , usa ) products ; thus , the dataset only included surgicel - brand orcs .
flowables , gelatins , and thrombins were combined into a single comparison category , because these products are frequently used in combination during a single procedure .
patients with missing data or who were treated with a combination of the orcs and oahs during the same procedure were excluded .
cardiovascular procedures , carotid endarterectomy , cholecystectomy , and hysterectomy were selected for evaluation in the present study because both orc and oah usage were relatively common in these procedures , with each of these procedures including at least 3,000 discharges for orc and oah utilization .
the original list of procedures considered for inclusion included arteriovenous graft , brain operations , coronary artery bypass graft surgery , carotid endarterectomy , cholecystectomy , and hysterectomy , operations on the kidney , prostatectomy , and valve surgery ( figure 1 ) .
valve surgery and coronary artery bypass graft surgery were combined to create the cardiovascular procedure group since there was a significant overlap in the patients with these procedures .
procedures were identified based on the international classification of diseases , ninth revision , clinical modification ( icd-9-cm ) procedures and current procedural terminology codes ; table s1 lists icd-9 codes .
the primary endpoints for this study were los , adjunctive topical hemostatic product units per procedure , total procedure cost , transfusions during hospitalization , and mortality .
los and total cost for each hospitalization were abstracted from the dataset as directly supplied by the hospital .
the adjunctive topical hemostat product units per procedure abstraction was based on the count of the product units per discharge .
standard charge codes for transfused blood products and transfusion procedure codes were used to identify patient discharges with transfusions .
all analyses were performed separately for the indications of cardiovascular procedure , carotid endarterectomy , cholecystectomy , and hysterectomy .
outcome variables were compared between matched cohorts using standard statistical tests , eg , paired t - tests and mcnemar s tests for continuous and categorical measures , relevant to the outcome variable data type and distribution . to reduce the effect of treatment - selection bias , matched pairs of orc and oah patients
were created using a propensity score matching ( psm ) approach.15 psm is frequently used in the medical literature as a means to adjust for confounding factors when using observational data to estimate the effect of treatments on outcomes.16 once matched cohorts are created , several outcomes can be studied ; this method provides an advantage over creating independent regression models for each outcome , because there is less concern about model misspecification.17 in this study , psm was used to create matched patient cohorts based on their propensity to be treated with an orc . to estimate a patient
s propensity for a particular treatment , logistic regression models were fit , regressing on patient and hospital characteristics , specifically age , ethnicity , sex , and comorbidities ; table s2 identifies codes .
pre - existing bleeding conditions , also used to estimate propensity , are listed in table s3 .
teaching / non - teaching hospital status , hospital census region , and urban / rural hospital location were also considered in the estimation of treatment propensity . additionally , to remove confounding factors due to the effects of other hemostat classes , concomitant use of non - orc / non - oah adjunctive hemostats were matched to isolate differences in outcomes between orc and oah classes .
patients were matched using a 1:1 greedy matching algorithm,18 and the balance of all patient and hospital characteristics was assessed .
after the matched cohorts were created , differences between orc and oah cohorts were calculated for all outcome measures : los , total costs , transfusions , mortality , and orc / oah units per discharge for each procedure .
statistical differences between orcs and oahs for los were assessed with wilcoxon signed - rank sum tests .
statistical analysis was performed using sas version 9.2 software ( sas institute inc . , cary , nc , usa ) .
a total of 107,667 patients with a cardiovascular discharge during the 2-year study period were identified in the premier hospital database . after accounting for the inclusion criteria ,
for the carotid endarterectomy analysis , 30,480 patients were identified during the study period , with 6,689 orc and 9,017 oah patients meeting eligibility criteria .
there were 130,931 cholecystectomy patients in the 2-year study period ; 12,549 and 3,097 were treated with orcs and oahs , respectively .
finally , within the 102,882 identified hysterectomy patients , 5,982 were treated with orcs compared to 7,742 with oahs ( table 2 ) .
the psm produced cohorts of 22,718 patients for cardiovascular procedures ( match rate of 96% relative to orc patients ) , 10,890 patients for carotid endarterectomy ( match rate 81% relative to orcs ) , 6,090 patients for cholecystectomy ( match rate 98% relative to oahs ) and 9,348 patients for hysterectomy ( match rate 78% relative to orcs ) , with patients divided equally between orcs and oahs .
after matching , patients in the orc and oah groups were similar with respect to demographic data , health status , hospital characteristics , and combinations with other hemostat types ( table 2 ) . across all four procedure groups , the number of orc product units used and cost per discharge were considerably lower than for oah ( figure 2 ) .
carotid endarterectomy gave the greatest differential , with 41% fewer units of orcs used per discharge compared to oahs ( p<0.001 ) .
average total topical adjunctive hemostat cost was 47% less for orcs than for oahs , equating to a reduction of us$88 per procedure .
the other procedures also had considerably lower product units per procedure utilization for orcs compared to oahs ( 31% , 18% , and 16% lower for cardiovascular procedures , cholecystectomy , and hysterectomy , respectively ; p<0.001 for all three procedure types ) .
differences in mean los between the orc and oah cohorts were generally associated with total discharge costs . in carotid endarterectomy and cholecystectomy procedures , the shorter los for orcs ( table 2 ; p<0.001 for both procedure groups ) aligned with the lower total procedure costs associated with the orc cohorts in carotid endarterectomy ( 6% lower ; p<0.001 ) and cholecystectomy ( 14% lower ; p<0.001 ) .
conversely , in the cardiovascular group , a non - statistically significant 0.2-day longer los for procedures where orcs were used ( p=0.948 ) was observed alongside a 3% higher total procedure cost for orcs ( p=0.003 ) .
hysterectomy procedures displayed an interesting trend , whereby a longer los associated with orcs ( p<0.001 ) was observed in conjunction with almost equivalent total procedure costs for the orc and oah cohorts ( p=0.542 ) .
mortality rates for all procedures were low , < 4% , and there was no statistically significant difference between orcs and oahs .
a decrease in transfusion rates was found in the carotid endarterectomy and cholecystectomy orc cohort compared to the oah cohort ( p<0.001 for both procedures ) ( table 3 ) .
a total of 107,667 patients with a cardiovascular discharge during the 2-year study period were identified in the premier hospital database . after accounting for the inclusion criteria ,
for the carotid endarterectomy analysis , 30,480 patients were identified during the study period , with 6,689 orc and 9,017 oah patients meeting eligibility criteria .
there were 130,931 cholecystectomy patients in the 2-year study period ; 12,549 and 3,097 were treated with orcs and oahs , respectively .
finally , within the 102,882 identified hysterectomy patients , 5,982 were treated with orcs compared to 7,742 with oahs ( table 2 ) .
the psm produced cohorts of 22,718 patients for cardiovascular procedures ( match rate of 96% relative to orc patients ) , 10,890 patients for carotid endarterectomy ( match rate 81% relative to orcs ) , 6,090 patients for cholecystectomy ( match rate 98% relative to oahs ) and 9,348 patients for hysterectomy ( match rate 78% relative to orcs ) , with patients divided equally between orcs and oahs .
after matching , patients in the orc and oah groups were similar with respect to demographic data , health status , hospital characteristics , and combinations with other hemostat types ( table 2 ) .
across all four procedure groups , the number of orc product units used and cost per discharge were considerably lower than for oah ( figure 2 ) .
carotid endarterectomy gave the greatest differential , with 41% fewer units of orcs used per discharge compared to oahs ( p<0.001 ) .
average total topical adjunctive hemostat cost was 47% less for orcs than for oahs , equating to a reduction of us$88 per procedure .
the other procedures also had considerably lower product units per procedure utilization for orcs compared to oahs ( 31% , 18% , and 16% lower for cardiovascular procedures , cholecystectomy , and hysterectomy , respectively ; p<0.001 for all three procedure types ) .
differences in mean los between the orc and oah cohorts were generally associated with total discharge costs . in carotid endarterectomy and cholecystectomy procedures , the shorter los for orcs ( table 2 ; p<0.001 for both procedure groups ) aligned with the lower total procedure costs associated with the orc cohorts in carotid endarterectomy ( 6% lower ; p<0.001 ) and cholecystectomy ( 14% lower ; p<0.001 ) .
conversely , in the cardiovascular group , a non - statistically significant 0.2-day longer los for procedures where orcs were used ( p=0.948 ) was observed alongside a 3% higher total procedure cost for orcs ( p=0.003 ) .
hysterectomy procedures displayed an interesting trend , whereby a longer los associated with orcs ( p<0.001 ) was observed in conjunction with almost equivalent total procedure costs for the orc and oah cohorts ( p=0.542 ) .
mortality rates for all procedures were low , < 4% , and there was no statistically significant difference between orcs and oahs .
a decrease in transfusion rates was found in the carotid endarterectomy and cholecystectomy orc cohort compared to the oah cohort ( p<0.001 for both procedures ) ( table 3 ) .
we compared patients treated with surgicel orcs to patients treated with oahs on cost and resource utilization metrics including los , units of hemostat product usage , and transfusions using hospital chargemaster data . after creating comparable cohorts of orc and oah patients with psm , across the four procedures studied ( cardiovascular procedure , carotid endarterectomy , cholecystectomy , and hysterectomy ) , adjunctive hemostatic agent costs were significantly lower when orcs were used instead of oahs .
other measures , such as transfusions and readmissions , were similar to or in favor of orcs compared to oahs for most procedure types .
los and total procedure cost were lower for orc patients for both the carotid endarterectomy and cholecystectomy procedures .
overall , the average cost of orcs was lower than oahs , but the difference in overall procedure costs was greater than the cost difference of the hemostatic agents used .
the total cost of treatment was lower for oahs in the procedures in which los was lower .
cardiovascular disease was the only procedure in which the los and costs were not lower in orc patients compared to oah patients .
it is not possible to discern from the current analysis why cardiovascular disease patients had higher costs when orcs were used , but it may be due to different burdens of bleeding or different requirements for adjunctive hemostat characteristics during cardiovascular procedures , as compared to other procedures . in the present study , cardiovascular patients los ranged from 9.3 to 9.5 days ; in a study conducted by stokes et al,3 cardiovascular patients los was similar , with an average of 8.5 days .
the stokes study also found that bleeding - related complications or blood product transfusions increased los in cardiac , vascular , and reproductive organ procedures by 4.8 , 9.3 , and 3.6 days , respectively,3 with cost increases of $ 10,000 , $ 15,000 , and $ 3,000 , respectively .
more recently , wright et al found that the frequency of adjunctive hemostatic agent use in major surgeries has increased rapidly over time.4 while studies have been conducted on the reduction of bleeding due to adjunctive hemostat use , or bleeding s impact on costs and resource utilization , there have been a limited number of studies on the impact of adjunct hemostats on both costs and outcomes .
a meta - analysis of studies focused on fibrin sealant use did not find a significant difference in the length of hospital stay compared to no adjunctive hemostat use.19 while there have been several studies on the effect of fibrin sealants , there has been very little published on the comparative effects and costs of flowables , thrombins , gelatins , or orcs .
a randomized controlled trial evaluating different hemostat options ( gelatin , orc , flowable , and thrombin ) would be useful to confirm or refute the results of the present study . in a previous study of orcs in cardiovascular , carotid endarterectomy , and brain / cerebral operations , the newer , advanced products , surgicel snow ( ethicon , inc . , somerville , nj , usa ) and surgicel fibrillar ( ethicon , inc . ) , were associated with lower hru and costs compared with surgicel original products.20 the present study found similar outcomes for all orcs compared to oahs .
a future study designed to compare the newer advanced products to each other would further help to evaluate adjunctive hemostat options .
not all of the factors that influence a physician s choice of products to treat specific patients are represented in the current dataset . additionally , because the patients were not randomized
, we can not be certain that there were not inherent differences between the specific procedures or patients receiving orcs and oahs that influenced patient outcomes .
however , we attempted to account for this by using psm to create similar groups for comparison .
psm can not control for unmeasured characteristics , such as the use of medications prior to hospital admission not captured in a cross - sectional database such as premier , which could influence hemostasis in the operative setting ; psm is also less powerful than randomization .
however , the patient populations evaluated in the present study were made comparable for all observable characteristics , and were assumed to be similar on unmeasured characteristics such as pre - admission medication use .
the data do not capture hospital readmissions to other facilities with different medical record systems and non - hospital - based office visits , and also do not include all outpatient data for all hospitals that submit inpatient data .
additionally , it is unclear whether treatment patterns and outcomes differ between hospitals that are within or outside of the premier hospital database and whether these hospitals are representative .
however , these results are most likely generalizable to many patients across the us , as approximately 25% of all hospital discharges are from a hospital within the premier database.14 results outside the us may differ because product availability varies by geography .
finally , as with all claims and chargemaster data , coding errors or omitted procedure / product codes could lead to misclassification of patients and potential bias in the results .
however , since these data are used for payment , there is a strong incentive for accuracy .
adjunctive hemostat use has the potential to reduce bleeding complications and associated resource use and costs associated with those complications .
as adjunctive hemostat use rises , there is interest in understanding the relative benefits of different hemostat types with respect to clinical and economic outcomes . in the premier database , over 370,000 cardiovascular , carotid endarterectomy , cholecystectomy , and hysterectomy procedures utilized adjunctive hemostats from 2011 to 2012 . based on this finding , one may estimate that in the us , for these procedures alone , approximately 750,000 adjunctive hemostat units are used annually in cardiovascular , carotid endarterectomy , hysterectomy , and cholecystectomy procedures .
in conclusion , while clinical outcomes were similar between procedures where orcs and oahs are used , orc use was associated with fewer adjunctive hemostat units per procedure , as well as lower adjunctive hemostat spending when orcs rather than oahs were utilized .
additionally , in carotid endarterectomy , cholecystectomy , and hysterectomy procedures , orc use was associated with lower overall los . in the present study , we also found that procedural adjunctive hemostat costs were at least 50% lower when orcs were used compared to oahs , with similar clinical outcomes . utilizing more orcs compared to oahs during appropriate surgical procedures
Output:
| backgroundadjunctive hemostats are used to assist with the control of intraoperative bleeding .
the most common types are flowables , gelatins , thrombins , and oxidized regenerated celluloses ( orcs ) . in the us , surgicel products are the only us food and drug administration - approved orcs.objectiveto compare the outcomes of health care resource utilization ( hru ) and costs associated with using orcs compared to other adjunctive hemostats ( oahs are defined as flowables , gelatins , and topical thrombins ) for surgical procedures in the us inpatient setting.patients and methodsa retrospective , us - based cohort study was conducted using hospital inpatient discharges from the 20112012 calendar years in the premier healthcare database .
patients with either an orc or an oah who underwent a cardiovascular procedure ( valve surgery and/or coronary artery bypass graft surgery ) , carotid endarterectomy , cholecystectomy , or hysterectomy were included .
propensity score matching was used to create comparable groups of orc and oah patients .
clinical , economic , and hru outcomes were compared.resultsthe propensity score matching created balanced patient cohorts for cardiovascular procedure ( 22,718 patients ) , carotid endarterectomy ( 10,890 patients ) , cholecystectomy ( 6,090 patients ) , and hysterectomy ( 9,348 patients ) . in all procedures ,
hemostatic agent costs were 28%56% lower for orcs , and mean hemostat units per discharge were 16%41% lower for orcs compared to oahs .
length of stay and total procedure costs for patients treated with orcs were lower for carotid endarterectomy patients ( 0.3 days and us$700 ) and for cholecystectomy patients ( 1 day and us$3,350 ) ( all p<0.001).conclusioncosts and hru for patients treated with orcs were lower than or similar to patients treated with oahs
. proper selection of the appropriate hemostatic agents has the potential to influence clinical outcomes and treatment costs . |
PubmedSumm119602 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: helminths have developed a unique evolutionary dialogue with their hosts ' immune system due to their longevity within the host , their complex life cycles , and multicellular nature .
these pathogens induce very different immune responses in comparison to bacteria , fungi , viruses , or protozoa .
cells of the innate and adaptive immune system are important for the initiation of type 2 immunity , which characterises the response to helminth infection , as well as allergic reactions .
the key players in t helper ( th ) 2-type immunity are cd4 th2 cells and involve the cytokines interleukin ( il-)4 , il-5 , il-9 , il-10 , and il-13 and immunoglobulin ( ig)e .
cd4 th2 cells also express some of the cytokines mentioned above as well as the chemokine ligand ccl11 and the chemokine receptor ccr3 [ 13 ] .
these factors lead to recruitment and infiltration of eosinophils , basophils and mast cells , and expansion of alternatively activated macrophages .
notably , th2-type immune responses are composed of three major features : inflammation , wound repair , and , most importantly , resistance to helminths .
parasites have developed various strategies to modulate the immune system and ultimately suppress host protective th2-type immune responses for example , by induction of innate and adaptive regulatory cells , anti - inflammatory cytokines and specific inhibitory antibody isotypes ( reviewed by anthony et al . ) .
hence , helminth parasites are master regulators of immune responses in order to ensure life - long persistence in the host
. one strategy of immune regulation that has evolved is the secretion of a wide range of immunoregulatory molecules , which are able to target various host cells and alter them to induce a highly directed host response known as a
this response is designed to limit a possibly detrimental th2 immune response , thus restraining the extreme symptoms that are often observed in allergy or in aspects of helminth diseases such as fibrosis in schistosoma mansoni . in immunological terms , the modified th2 response is defined by the development of specific antibody isotypes , including induction of igg4 accompanied by a decrease in ige , as well as il-4 and il-5 , while il-10 levels from different regulatory cell sources increase .
these mechanisms can lead to attenuation of pathology and clinical symptoms , tolerance , and ultimately persistence of the worm , which is associated with a hyporesponsive immune system .
asymptomatic infection assures long - term survival of the parasite within the host and therefore sustains parasite feeding , completion of the life cycle , and successful reproduction [ 3 , 5 ] .
many studies of animal and human helminth infections have shown their potential for downregulating the immune system . moreover , relevant epidemiological studies have observed that helminth - infected populations exhibit lower levels of immunopathological diseases such as th1-related autoimmune diseases or abberrant th2-related diseases for example , asthma or allergic rhinitis .
these observations indicate an inverse global distribution of allergy / autoimmune diseases and helminth infections , the first being an expanding problem of developed and industrialized countries , while the latter being a feature in developing countries [ 69 ] .
such findings support the hypothesis that the immune system has coevolved to operate in the presence of immunomodulatory helminth infections , while in the absence of exposure to helminths , the immunoregulatory components that would normally prevent allergy and autoimmune disease become weakened [ 5 , 10 ] . here , we focus on recent advances in cellular mechanisms that are employed and modulated during helminth infections as well as on reports from field research and studies on animal models .
these studies have identified helminths and helminth - derived products that play a role either in induction of th2 responses and immune modulation in parasitic infections ( reviewed in table 1 ) or in downregulation of bystander th2-type immunopathologies like allergic asthma , allergic inflammation and airway hyperreactivity , food allergy , eczema , atopic dermatitis ( th1/th2 ) , or anaphylaxis ( reviewed in table 2 ) .
it has long been known that helminths induce a specific immune phenotype in the majority of persons that allows for establishment of infection while simultaneously preventing or reducing signs of disease in the host .
antigen - specific cellular hyporesponsiveness was described for filarial infections more than 30 years ago by ottesen et al . studying a population in the cook islands endemic for lymphatic filariasis . in this study
lymphocytes from adults infected with the filarial species wuchereria bancrofti showed significantly lower levels of proliferation in response to filarial antigen compared with endemic controls who were negative for all signs of infection or disease but constantly exposed to infection and , therefore , putatively consistently exposed to the antigens .
later , another study from the same group made the distinction between microfilariae ( mf ) positive asymptomatically infected persons and mf negative patients showing clinical symptoms of filariasis ( e.g. , elephantiasis or hydrocoele ) .
the resulting data suggested that the outcome of disease depends on the host response together with a mechanism of immune modulation induced by the parasite ( reviewed by ottesen ) .
epidemiological studies of helminth - infected persons recognise distinct clinical outcomes that depend on immune regulation induced by the parasite in conjunction with the genetic background of the host ( reviewed by maizels and yazdanbakhsh ) .
resistant individuals are constantly exposed to the parasite but show no signs of infection or disease ; this group develops an appropriate response , defined by equal proportions of th1 , th2 , and t regulatory ( treg ) cells with a balance of igg4 and ige levels .
a second group develops a hyporesponsive phenotype characterised by asymptomatic infection , which tolerates the presence of fecund adult worms .
this group has high levels of regulatory cells and il-10 , leading to a modified th2 response .
finally , a small proportion of patients develops a hyperresponsive phenotype ( characterised by an immunopathological response ) [ 3 , 11 , 14 ] . in s. mansoni , w. bancrofti , and brugia malayi infections ,
the main pathological response is a result of overreactive t cell responses that cause inflammation and injure the host .
this group exhibits increased ige responses , and the treg compartment is greatly diminished . in w. bancrofti and b. malayi infections , this can result in elephantiasis , whereby the lymphatic tissue becomes dilated and hypertrophic .
parasite death leads to the release of antigenic material that causes lymphatic obstruction in the vessels and chronic inflammation .
a second , rare result of these infections is tropical pulmonary eosinophilia characterised by chronic lung obstruction , peripheral blood eosinophilia , and extremely elevated levels of ige , greater than in elephantiasis . in onchocerca volvulus infection
the rare chronic hyperreactive form , known as sowda , is also defined by high levels of ige .
this is accompanied by strong th2 responses , including il-4 , il-5 , and il-13 .
thus a fine balance of different aspects of immunity is required to develop a response beneficial to the host .
therefore , immune modulation acts in favour of persistent infection and continuous transmission while simultaneously enabling the host to tolerate infection by diminishing clinical symptoms .
coinfection studies of helminths with other diseases provide supporting evidence that helminths have great ability to modulate immune responses , some aspects of which may then affect bystander infections .
in fact , protective inflammatory immune responses that typically develop in bacterial or intracellular parasitic infections can be downregulated when a coinfecting helminth is present , resulting in increased susceptibility in the host to the former infection .
for example , individuals coinfected with latent tuberculosis ( tb ) and w. bancrofti showed lower levels of tb - protective proinflammatory cytokines in vitro than tb patients without filarial infection .
research focusing on individuals coinfected with multiple filarial species and plasmodium falciparum demonstrated a modulation of the antimalarial immune response by helminths that increased anti - inflammatory responses .
after stimulation with malaria antigen , filarial - infected individuals demonstrated significantly lower levels of interferon ( ifn)- , tumour necrosis factor ( tnf)- and il-17a , and higher levels of il-10 from cd4 t cells compared with filarial - uninfected individuals .
similarly , a study examining the effect of helminth infections on responses to oral cholera vaccine demonstrated that ascaris lumbricoides infection was associated with lower cholera antigen - specific il-2 cytokine responses .
these epidemiological studies demonstrate the ability of helminths to modulate immune responses to themselves as well as to concurring and unrelated infections .
eradication of helminth infections in industrialised countries in the past 30 years has had a great impact on the prevalence of diseases associated with inappropriate immune responses .
the observed increase in the appearance of allergy - related diseases might be a result of this and altered hygienic measures in everyday life .
one possible explanation is the hygiene hypothesis [ 50 , 51 ] , which includes a number of factors like improved public health , use of antibiotics and vaccines that in consequence reduce the occurrence of viral , bacterial or helminth infections early in life , contributing to higher numbers of individuals with allergic , and/or autoimmune disorders .
there are numerous cohort studies determining allergic disease status and immune responses to parasite - specific antigens or environmental allergens of helminth - infected individuals in parasite - endemic areas ( reviewed by others [ 6 , 8 ] ) .
however , when interpreting this data it is important to take into consideration the time of first infection , duration and intensity of infection , helminth species , as well as host genetic and environmental factors . infections with trematodes , whipworms and hookworms were described to be negatively correlated with the allergen skin prick test .
results from a study of gabonese school children tested for skin reaction to house dust mites ( hdms ) and other allergens , for schistosoma eggs in urine and microfilariae of loa loa and mansonella perstans in blood , showed lower prevalence of a positive skin test to hdms in children with urinary schistosomiasis . moreover , schistosome antigen - specific concentrations of il-10 were significantly higher in infected children and concentrations of il-10 were negatively associated with a positive skin test result .
several population studies done in endemic areas of schistosoma infections in brazil [ 54 , 55 ] and of ascaris , trichuris , and ancylostoma in ecuador revealed a strong inverse association between helminth infections and immediate skin test reactivity to common environmental aeroallergens .
cooper et al . reported a negative association between very high levels of ige antibodies and allergen skin test reactivity .
it is possible that anti - helminth - ige competes for the same high - affinity ige receptors targeted by allergen - specific ige .
although other studies from africa reported on a reverse association between hookworm infections and sensitization to hdm dermatophagoides pteronissinus ( der p 1 ) , they did not show a significant association between skin test sensitivity to hdms , allergen - specific iges and between total serum ige levels and helminth - specific iges [ 57 , 58 ] .
the contribution of helminth infections to the inverse correlation with allergy - related diseases was demonstrated in studies with anthelminthic treatment .
results from a randomized , controlled trial on the effect of repeated treatment with anthelminthics on a population of gabonese school children showed a significant increase in the rate of developing skin sensitivity to hdms .
this was in part mediated by reductions of ascaris and/or trichuris infections , directly pointing to the importance of a presence of live worms to suppress allergic responses during infection and also preventing allergy later in life .
lynch et al . also reported an effect of anthelminthic treatment on the allergic reactivity of children in the tropics in venezuela .
the authors showed that the effective elimination of intestinal helminth infection resulted in significantly decreased total serum ige levels .
however , immediate - hypersensitivity skin test reactivity and serum levels of specific ige antibody against common allergens were significantly increased in treated children .
also other studies reported that anthelminthic treatments increase allergen skin reactivity to environmental allergens [ 61 , 62 ] . rodrigues et al . reported that brazilian children with heavy infection in early childhood with trichuris trichiura had a lower prevalence of allergen skin test reactivity to a wide spectrum of common environmental allergens ( hdms , blomia tropicalis , fungi , animal , and cockroach allergens ) later in childhood , even when the helminth infection was no longer present .
additionally , a population study in taiwan showed that schoolchildren bearing pinworm enterobius were diagnosed with lower prevalence of asthma and allergic rhinitis ; moreover , these children had reported an infection of pinworms early on in life .
thus , early exposures and infections with helminths may have a protective effect and suppress allergic inflammation later during life .
additionally , host genetic factors may play a role in prevalence of helminth infections and allergies .
notably variants of genes involved in th2 immune responses like il13 or stat6 were associated with increased risk of asthma and allergy [ 9497 ] .
studies among african - americans shed a light on the limited understanding we have on asthma genetics .
polymorphisms in candidate genes associated with asthma showed higher frequency among certain ethnic backgrounds that developed strong th2 immune responses [ 6 , 98 , 99 ] .
thus , genes , which in the evolution of the immune system were initially responsible for induction of th2-type immune responses and for parasite expulsion , now cause problems with allergy - related diseases when living in sterile and modern societies .
in contrast to population studies reporting a negative correlation between allergy and helminth infections as discussed above , various studies from south america , europe , and asia on a. lumbricoides infections and allergy reported increased rather than decreased prevalence of asthma [ 100102 ] .
for example , two cross - sectional surveys among schoolchildren in former east germany revealed that children with low doses of helminthic antigens ( low worm burden ) but ascaris - ige seropositivity had higher levels of total ige and higher prevalence of allergic rhinitis and asthma to inhalant allergens .
it was proposed that heavy parasitic infections might generate immune suppressive mechanisms , whereas mild worm exposure and low - level contact with helminths may enhance reactivity to environmental allergens or even potentiate the th2 immune response that in some cases may promote allergic inflammation . as ascaris infection has been well - documented as a risk factor for asthma ( described elsewhere [ 103106 ] ) , there are two main hypotheses why ascaris promotes allergic reactions .
the first relates to the specific pulmonary phase in the ascaris life cycle that causes inflammation and eosinophilia , which results in ige - mediated asthma with high total- and specific - ige titres against larvae and adult worms .
the second hypothesis of increased allergy in ascaris infection is explained by cross - reactivity of ascaris - specific molecules with environmental allergens like hdms or the storage mites b. tropicalis that induce allergen - specific iges leading to strong th2-type responses and therefore contributing to overall pathogenesis .
moreover , ascaris - tropomyosin , a pan allergen , induced wheal and flare in skin prick tests and histamine release from basophils of asthmatics and nonasthmatics .
these results suggest that ascaris - tropomyosin in some allergic individuals potentiates the pathogenesis of asthma and other allergic diseases [ 109111 ] .
interestingly , the promotion of atopy can also be observed in parasitic infections where the human is not the definitive host and , therefore , chronic infection is not established , for example , toxocara spp . [ 52 , 112 ] .
in addition , the nematode anisakis simplex , regularly infecting marine mammals as definitive hosts but accidentally also leading to gastrointestinal ( gi ) infections in humans , who ingest raw fish , was described to cause allergic reactions .
allergy to a. simplex is being recognised as an occupational disease with a wide spectrum of allergic reactions ( rhinitis , asthma urticaria , allergic contact dermatitis , and anaphylactic shock ) [ 113115 ] .
as both parasites cause accidental and infrequent infections , in case of infection the immune system may be exposed to th2-inducing events rather than to immunomodulatory mechanisms that occur in chronic infections .
it is important to keep in mind that variations in epidemiological studies may have many confounding factors like types of parasitic infections , intensity and timing of the infection , other coinfections , first exposure to allergen as compared to parasitic infection , types of allergens , nutritional status of the patients , medication received , and genetic background .
current research has focused particularly on identifying the cells targeted by parasitic immune modulation , and the exact helminth - derived molecules responsible for this .
immune modulation by the parasite occurs through production of specific parasite - derived molecules that target mammalian host immune cells and signaling pathways . during infection
this is strictly dependent on live parasites as shown by the recovery of cellular hyporesponsiveness in patients treated with anthelminthic chemotherapy .
in addition , a study by da'dara and harn demonstrated that killing of schistosome parasites could reinstate immune responses to a bystander vaccine targeting human immunodeficiency virus-1 , which were greatly diminished in the presence of the parasite .
similarly , another study demonstrated that prior elimination of intestinal helminths in patients vaccinated with bacille calmette - guerin resulted in greater protective responses to the vaccine compared with patients who did not receive anthelminthic chemotherapy . during active infection ,
both gi and tissue - dwelling helminths can establish long - term chronic infections and have many immunomodulatory molecules in common , which , despite the different anatomical locations target similar host cells employing comparable regulatory mechanisms .
thus , experimental models together with human studies have helped to elucidate the mechanisms and cell targets underlying parasite - induced immune modulation . in this section ,
presenting cells ( apcs ) required in priming the adaptive immune response , dendritic cells ( dcs ) are an essential driving force of th2 induction in helminth infections and in allergy - related diseases .
the field of research on dcs targeted by parasite - induced immune modulation is as vast as that on macrophages , and there is definitive evidence of a specific dc phenotype that develops in helminth infection , demonstrating modulation by the parasite to deviate host inflammatory responses .
several groups could show that in helminth infection , dcs mature only selectively or show impaired functions in terms of tlr responsiveness [ 119122 ] .
as dcs are the main messenger cells to communicate with t cells and initiate an immune response , interference with their functions represents a key mechanism for helminths to induce an environment conducive to their survival .
the downregulation of proinflammatory cytokines appears to be a frequent feature in helminth - mediated modulation of the th2-type response .
murine dcs stimulated with lipids from s. mansoni eggs matured to induce specifically tregs that produced il-10 , reducing th1 responses whilst producing a modulated th2 response .
dcs that have been previously exposed to helminth products can also effectively prime th2 cells .
s. mansoni soluble egg antigen ( sea ) is a particularly strong inducer of th2 responses , and importantly the glycoprotein omega-1 was identified as the main th2-inducing component in sea .
human dcs exposed to b. malayi mf showed higher levels of apoptosis and decreased production of il-12 and il-10 .
in fact when human monocytes that were being differentiated to dcs in vitro were stimulated with b. malayi mf antigen , they produced significantly decreased levels of il-12p40 , il-12p70 , and il-10 in response to bacterial adjuvant .
massacand et al . also demonstrated how dcs exposed to excretory - secretory ( es ) products from both nippostrongylus brasiliensis and heligmosomoides polygyrus had reduced expression of the proinflammatory cytokine il-12/23p40 .
similarly , balic et al . reported that bone - marrow - derived dcs exposed to n. brasiliensis es ( nes ) products actively matured and could induce a th2 response when transferred into nave mice .
high levels of il-4 , il-5 , and il-10 were detected after reexposure to nes . in vitro , these dcs produced high levels of il-6 and il-12p40 but full production of il-12p70 was blocked .
finally it was shown that murine lipopolysaccharide- ( lps- ) or cpg - matured dcs exposed to es products from taenia crassiceps showed diminished responses to stimulation through tlrs 4 and 9 . these dcs significantly decreased levels of proinflammatory cytokines , including il-12p40 and il-12p70 , as well as tnf- and il-15 .
thus , downregulation of proinflammatory cytokines seems to be a frequent mechanism in immune modulation by helminths . combined with suppression of proinflammatory cytokines , a key aspect in modulation of dcs is the downregulation of costimulatory molecules , leading to induction of a th2 response .
. illustrated that stimulation of murine bone - marrow - derived dcs with a. lumbricoides pseudocoelomic body fluid ( abf ) influenced dc maturation by inducing expression of il-6 , il-12p40 , and macrophage inflammatory protein 2 .
however , dc maturation was only partial as levels of costimulatory molecules cd80 , cd86 , cd40 , ox40l , and major histocompatibility complex ( mhc ) class ii were not affected .
furthermore , when dcs were cultured in the presence of ovalbumin ( ova ) with abf and then transferred into nave mice , restimulation resulted in significantly increased levels of il-4 , il-5 , and il-10 compared to dcs cultured without abf .
coculturing of es products but not adult worm antigen from h. polygyrus with lps - treated dcs induced a semimature phenotype with moderate expression of cd40 , cd86 , and mhc class ii .
in fact when dcs were treated with es and ova and subsequently cultured with ova - specific t cells , the t cells developed a regulatory phenotype , expressing cd25 and high levels of il-10 .
furthermore , a novel subset of dcs expressing low levels of cd11c have also recently been identified in mice chronically infected with h. polygyrus . in this infection setting , dcs acted as efficient apcs and induced high numbers of cd4 t cells expressing foxp3 but only low numbers of cd4 effector t cells .
this population of dcs was suggested to be one of the main target cells involved in inducing an immunoregulatory environment in h. polygyrus infection , allowing the establishment of chronic infection .
nevertheless , dcs are clearly essential for efficient priming of the th2 response , as depletion of cd11c cells during development of the adaptive cd4 t cell response in s. mansoni infection drastically impaired the th2 response .
macrophages that are activated by the th2-type cytokines il-4 and il-13 develop an alternatively activated phenotype and have a well - described role in helminth infections ( reviewed by hoerauf et al . ) .
alternatively activated macrophages ( aams ) are recruited in large numbers to the sites of helminth infection where they can proliferate , as recently shown .
aams are characterised in mice by expression of specific markers , including arginase-1 , resistin - like molecule ( relm)- ( also known as found in inflammatory zone , fizz1 ) , ym-1 , ym-2 , acidic mammalian chitinase ( amcase ) , and mannose receptor c type ( mrc)-1 .
aams are important in tissue homeostasis , downregulation of the adaptive immune system , acting as effector cells against parasites , and to reduce or heal any ensuing damage caused by infection .
aams recruited during b. malayi infection have been demonstrated to drive cd4 th2 responses , deviating the immune system from inducing a proinflammatory th1 response that could be detrimental to parasite survival .
monocytes from b. malayi asymptomatically infected patients have also been described to show an alternatively activated phenotype , expressing the aam - specific markers arginase-1 , mrc-1 , resistin , and ccl18 as well as the downregulatory cytokines transforming growth factor ( tgf)- and il-10 ( similar to what has been described for mouse aams ) . however ,
translation of characterised markers into the human system in general should be done with caution , as reports indicate arginase-1 may not be a reliable marker for aams in humans as it is found in other cell types .
furthermore , human monocytes do not express arginase-1 after stimulation with il-4 and il-13 , unlike mouse macrophages ( reviewed by raes et al . ) .
this indicates that the translation from murine to human data can be difficult , and reliable markers for alternative activation in human monocytes should be further investigated .
macrophages from b. malayi infected mice were shown to be fully capable of processing and presenting antigen and providing costimulation for t cells , however the resulting antigen - specific t cell population remained suboptimal with cell proliferation but not th2 cell cytokine production being impaired .
these macrophages were il-4-dependent and required direct contact with t cells to induce hyporesponsiveness . in a mouse model of s. mansoni
infection , arginase - expressing macrophages played an essential role in host protection by suppressing expression of the classical inflammatory cytokines il-12 and il-23 .
removal of these cells resulted in an accumulation of parasite eggs in the intestines and intestinal haemorrhage , thus preventing the eggs from being excreted .
large numbers of aams were shown to accumulate in n. brasiliensis infection in the gut , characterised by expression of arginase-1 , relm- and ym-1 , in an il-4- and il-13-dependent manner .
macrophage depletion resulted in impaired worm expulsion from the small intestine and prevented smooth muscle hypercontractility .
relm- was shown to be essential in regulating lung inflammation , granuloma size and fibrosis in mice challenged with s. mansoni eggs .
moreover , pesce et al . illustrated that challenge of relm- deficient mice with s. mansoni eggs resulted in elevated eosinophil levels and ige titres . in the same study relm- deficient mice challenged with n. brasiliensis infection produced increased th2 responses , manifested by elevated lung pathology and expulsion of adult worms .
importantly , addition of exogenous relm- reversed the pathological th2 responses in this infection .
this represents relm- as a key host - derived molecule induced by helminth infection to allow prolonged parasite survival .
these studies point at a host protective role for aams in specific tissue dwelling and gi helminth infections . among the cell types targeted during helminth infections ,
natural cd4 tregs develop in the thymus and express the transcription factor foxp3 , the il-2 receptor chain ( cd25 ) , ctla-4 , and a range of immunosuppressive proteins including il-10 and tgf- .
additionally , other adaptive cd25 treg populations exist in the periphery that develop from nonregulatory t cell subsets , with their expression of il-10 and tgf- distinguishing them from activated cd4cd25 nonregulatory t cells .
tregs are important in reducing pathology in the host via suppression of both th1 and th2 responses , thus preventing disease symptoms as demonstrated by evidence of treg involvement in both th2-mediated allergies and th1-mediated autoimmunity ( reviewed by else ) . in a murine model of schistosomiasis cd4cd25 t cells expressing high quantities of il-10 were shown to play a significant role in reducing immunopathology , especially in the chronic stage of infection .
mckee and pearce illustrated that in s. mansoni - infected mice cd4cd25foxp3 cells produced significant levels of il-10 that were required to prevent dc - derived il-12 , thereby suppressing th1 responses .
in fact , isolated schistosome eggs were demonstrated to be capable of modulating th2 responses , without the need for the former life cycle stages that develop during infection .
schistosome eggs injected into mice were shown to induce a population of foxp3 cells that expanded to control the cd4 t cell response , preventing inflammatory th1 responses while modulating th2 responses to prevent th2-mediated immunopathology .
both natural and adaptive tregs have been described in filarial - infected persons , with the adaptive treg population producing high levels of il-10 .
our group has shown that in h. polygyrus infection , foxp3 tregs are a requirement for limiting immunopathology and represent a potential source of il-10 [ 152 , 153 ] .
thus , while treg depletion did not affect worm burdens , the th2 response was greatly accelerated and augmented , with high levels of il-4 and il-13 being produced .
the uncontrolled th2 response led to increased immunopathology in the intestine , demonstrating that tregs were essential in regulating this response .
foxp3 tregs were also induced after stimulation with h. polygyrus es products , reducing proliferation of effector cells by activating the tgf- signaling pathway . during infection , tregs may therefore be seen as important effector cells required to prevent or reduce pathology in the host by modulating the ensuing th2 response , thereby simultaneously allowing establishment of chronic infection .
host protection as well as regulation by antibodies and b cells is being recognised as an essential component in th2 responses in helminth infections . in s.
mansoni - infected mice , where the dominant isotypes are igg1 and ige , blockade of b cell production resulted in high levels of the proinflammatory cytokines ifn- and il-12 but low levels of the th2 cytokines il-4 and il-10 in acute infection . moreover mice deficient in b cells could not downregulate granuloma formation in the chronic stage of infection , and this mechanism was mediated by fcr , indicating a role for antibodies in down modulation of pathology . in fact , antibody isotypes are demonstrated to have an important role in determining the outcome of helminth infection in the host .
the cytokines il-4 and il-13 act on b cells to induce both igg1 and ige in mice and igg4 and ige in humans .
high levels of igg4 but low levels of ige are found in the blood of hyporesponsive , asymptomatic persons infected with b. malayi , w. bancrofti , and o. volvulus [ 16 , 157 ] .
igg4 correlates with high levels of il-10 and the presence of adult worms in hyporesponsive persons . in bancroftian filariasis
, high levels of igg4 but low levels of ige were found in mf positive individuals compared to patients with clinical disease ( elephantiasis or tropical pulmonary eosinophilia ) .
ige is known to activate degranulation of mast cells ( mcs ) , basophils and eosinophils and induce antibody - dependent cell - mediated cytoxicity ( adcc ) [ 154 , 160 ] .
igg1 in mice and igg4 in humans compete with ige for binding sites and therefore may inhibit such processes .
thus , inhibitory igg4 may prevent immunopathological responses in helminth asymptomatically infected individuals and can simultaneously provide an indication of the clinical outcome in infected persons .
regulatory b cells have been first described in autoimmune diseases , where the main mediator of suppression is il-10 .
helminth infections can also induce specific b cell phenotypes with regulatory properties as shown in infection with s. mansoni and h. polygyrus . in s. mansoni infection ,
a particular subset of b cells has been described that are cd1d and express high levels of il-10 ( defined as cd19il-10cd1dcd5cd21cd23igdigmcells ) .
transfer of these cells into ova - sensitized mice reduced ova - induced allergic airway inflammation via induction of foxp3 tregs ; the effect was tgf- independent as showed in anti - tgf- mab treatment experiments .
furthermore , another group demonstrated that transfer of il-10-producing b cells from il-4 deficient mice infected with s. mansoni provided complete resistance to experimentally induced anaphylaxis when applied to nave mice .
thus , absence of il-4 was essential to prevent exacerbation of this allergic response .
in another study , the same group proved that the protective response of s. mansoni infection was entirely dependent on b cells as depletion of igm b cells resulted in mice becoming completely susceptible to anaphylaxis . interestingly , adoptive transfer of a population of cd19cd23 b cells from h. polygyrus - infected mice could reduce the effects of allergic airway inflammation of ova - sensitized mice , however , in an il-10 independent manner .
these mesenteric lymph node b cells reduced secretion of il-5 and infiltration of eosinophils into the airways , suppressing allergen - induced pathology . thus , b cells from helminth infections exhibit regulatory capacity in unrelated diseases and are of therapeutic interest in allergies , therefore their phenotype and functional aspects should be further investigated .
there are numerous studies examining the effects of different helminth infections ( e.g. , s. mansoni [ 7375 ] , h. polygyrus [ 78 , 81 , 164 ] , n. brasiliensis , trichinella spiralis , and litomosoides sigmodontis ) on allergy - related diseases in experimental animal models , where helminths show the capacity to suppress abberrant th2 immune responses .
in addition , es products either from h. polygyrus or n. brasiliensis were described to have similar beneficial immunoregulatory effects .
furthermore , helminths act through various cell types and can interfere with allergy symptoms in animal models via distinct mechanisms including tregs [ 79 , 82 , 88 ] , b cells [ 73 , 80 , 163 ] , and induction of regulatory cytokines like il-10 [ 78 , 81 , 83 , 87 ] or tgf- [ 87 , 88 , 163 ] , as discussed in the previous section and reviewed in table 2 .
these and other studies led to the discovery of specific immunomodulatory helminth - derived molecules and products that induce a microenvironment beneficial to the parasite , while at the same time preventing immune - related pathology associated with vigorous th2 responses ( figure 1 ) . however , as mentioned earlier , persistence of the parasite is not obligatory to reduce allergic symptoms in later life .
moreover , these functionally and structurally diverse molecules are expressed throughout the parasite life cycle and interact directly with host cells .
a summary of helminth - derived immunomodulatory molecules and products is given in table 1 .
we focus here on molecules that are relevant for human disease , established animal models of host - parasite interactions , and defined molecules that downregulate unrelated th2 inflammation .
the existence of parasite - derived homologues of host mammalian anti - inflammatory cytokines reveals an apparent evolutionary struggle between the parasite and the host , whereby the parasite has evolved mechanisms to establish chronic infection . for example , two tgf- homologues found in brugia species , bm - tgh-1 and bm - tgh-2 , have been well characterised , the second of which is thought to have an immunomodulatory role .
tgh-2 is secreted by adult worms and in its recombinant form was shown to bind the human tgf- receptor , thus potentially influencing treg development [ 43 , 165 ] .
s. mansoni male worms express a member of the tgf- receptor family known as smrk-1 for which mammalian tgf- may be a ligand involved in worm development .
h. polygyrus es contains remarkable tgf--like activity , inducing foxp3 expression in nave t cells and modulating immune functions , thereby maintaining worm burdens to induce chronic infection .
the beneficial role of homologues of mammalian chemokines such as macrophage migration inhibitory factor ( mif ) is less apparent .
mif homologues have been described in multiple helminth species ( reviewed elsewhere [ 168 , 169 ] ) .
helminth mif has direct chemotactic effects on human monocytes but appears to be associated with anti - inflammatory , modified th2-type responses . in a murine model of asthma , a recombinant mif - like protein from a. simplex ( as - mif ) was described to have a protective effect and to suppress the th2-type response , reduce production of il-4 , -5 and -13 in the bronchoalveolar lavage fluid ( bal ) , inhibit eosinophilia , goblet cell hyperplasia , and ameliorate lung hyperreactivity .
the effect of as - mif was possibly mediated by il-10 and tgf- production in the bal as well as via treg induction in the lungs of as - mif - treated animals when compared to asthmatic controls .
another helminth - derived molecule with structural similarities to mammalian chemokines is ancylostoma - secreted protein-2 ( na - asp-2 ) secreted by the infective larvae of necator americanus hookworm .
recombinant na - asp-2 was shown to recruit high numbers of neutrophils when injected into an air pouch ( a sterile inflammatory setting ) in mice .
the influx of neutrophils was suggested to create permeability in host vessels , thus facilitating larval migration .
hence , cytokine homologues seem to be exploited by the parasite for efficient immune evasion ; however more work is needed to assess which of those molecules participate in suppression of unrelated inflammation .
the cystatins and serpins are the best - characterised protease inhibitors of helminths that have immunomodulatory potential .
mammalian cysteine proteases are essential for efficient processing and presentation of antigen on mhc class ii to induce an appropriate adaptive t cell response .
mammalian cystatins play a vital role in regulating these pathways ; however , helminth cystatins from acanthocheilonema viteae , b. malayi , n. brasiliensis , and o. volvulus have been shown to interfere with this process to dampen antigen - dependent immune reactions ( reviewed by klotz et al . ) .
bm - cpi-2 , a cystatin from b. malayi , was illustrated to interfere with antigen processing , which led to a reduced number of epitopes presented to t cells in vitro .
studies from our own group have demonstrated that onchocystatin ( rov17 ) from o. volvulus reduced antigen - driven proliferation of peripheral blood mononuclear cells in a monocyte - dependent manner .
recombinant avcystatin ( rav17 ) from a. viteae has potent immunomodulatory roles illustrated by its ability to reduce antigen - specific and unspecific t cell responses .
avcystatin is recognised by macrophages and upon uptake induces phosphorylation of the mitogen - activated protein kinase signaling pathways erk1/2 and p38 in macrophages .
this led to tyrosine kinase - dependent il-10 production in macrophages [ 34 , 35 ] .
furthermore , we could show in an ova - induced airway hyperreactivity mouse model that avcystatin - treated asthmatic mice exhibited amelioration of the disease .
avcystatin administered intraperitoneally ( i.p . ) during the sensitization phase as well as before challenge with ova , suppressed recruitment of eosinophils into the lungs , ova - specific and total ige levels , and reduced allergen - specific il-4 production .
il-10 is a key element in avcystatin - induced immunomodulation , as blocking of il-10 with an anti - il-10r mab reversed the beneficial effect on cell recruitment and production of ige .
moreover , depletion of macrophages with clodronate liposomes before airway allergen challenge diminished the antiallergic effect of avcystatin .
the rodent filarial species l. sigmodontis secretes a cystatin at various stages of the life cycle , which after injection via microosmotic pumps into the peritoneal cavity of l. sigmodontis - infected mice greatly decreased nitric oxide production and proliferation of antigen - specific spleen cells . similarly , recombinant cystatin from the es product of the gi nematode n. brasiliensis ( named nippocystatin , nbcys ) was shown to inhibit cathepsins l and b , and suppressed antigen processing by apcs . furthermore , ova - sensitized and nbcys - treated mice showed decreased ova - specific spleen cell proliferation , reduced ova - specific ige levels and cytokine production due to inhibition of cathepsin b and l - dependent antigen processing . similar to cystatins , serpins ( serine protease inhibitors )
have important roles in mammalian biological processes including regulation of complement activation , inflammatory pathways , and cell interactions .
bm - spn-2 is a serpin expressed by b. malayi microfilariae , which could inhibit proteases of human neutrophils , thereby interfering with and potentially circumventing the most abundant leukocyte to encounter mf in the bloodstream .
however , another study by stanley and stein contests the enzymatic activity of bm - spn-2 .
taken together , protease inhibitors such as cystatins are a class of molecules found in numerous helminths that have important immunomodulatory functions .
a secreted 62 kda glycoprotein from a. viteae known as es-62 is one of the best - characterised helminth immunomodulators .
es-62 has been shown to exhibit a plethora of well - documented anti - inflammatory properties and contains phosphorylcholine moieties , which are largely responsible for immunomodulation ( reviewed by harnett et al . ) .
ova - specific cd4 t cells exhibited lower levels of proliferation and il-2 production after challenge with es-62 , as well as inhibition of il-4 and il-13 .
it was also shown that es-62 acts on macrophages to inhibit production of il-12 if the cells were subsequently exposed to lps and ifn- [ 37 , 38 ] .
es-62 could also be shown to act on bone - marrow - derived precursors of dcs to inhibit a proinflammatory response induced by lps and b cells by modulating t and b cell interactions .
it directly inhibited fcri - induced release of allergy mediators from human mcs by selectively blocking key signal transduction events .
es-62 also interfered with mcs in vivo in a mouse model of immediate - type hypersensitivity to oxazolone , thereby diminishing ear swelling and mc - dependent hypersensitivity , as well as ex vivo mc degranulation in mice that were previously injected with the molecule .
moreover , es-62 ameliorated ova - induced murine airway inflammation , airway hyperresponsiveness , lung pathology , and eosinophilia by suppression of mc function .
thus , es-62 is likely to be a key mediator of filarial - induced immunoregulation , and its properties might be used to dampen overwhelming unrelated inflammation in the future .
schistosome soluble egg antigen ( sea ) and es products released by the egg stage of the parasite contain potent th2-inducing and immunomodulatory activity .
sea from s. mansoni was shown to be an extremely strong inducer of th2 responses without the need for live infection or the addition of adjuvant .
recently it was shown that omega-1 , a hepatotoxic ribonuclease , is one of the key players in this response [ 23 , 24 ] .
omega-1 is a glycoprotein , which was demonstrated to polarise human monocyte - derived and cd11c murine dcs in a direction supporting th2 responses even in the presence of lps .
in fact , sea depleted of omega-1 was not able to sufficiently induce a th2 response in vitro .
however , the th2-suppressive actions of schistosome - derived antigens clearly highlight the ability of this helminth to modulate host immune responses .
es- or omega-1-treated dcs display the typical modulated phenotype that is critical for induction of a th2 response , including reduced expression of costimulatory molecules and a lowered efficiency in participating in dc - t cell conjugates .
in fact , this study demonstrated that omega-1 was shown to alter the morphology of dcs , possibly preventing t cell activation .
ipse / alpha-1 is another glycoprotein present in sea and abundant in es , which could induce il-4 production from human basophils in an ige - dependent but antigen - independent mechanism .
demonstrated that glycan - containing sea could induce high levels of il-5 , ige production , and eosinophilia when administered intranasally into mice .
the same group was subsequently able to show that s. mansoni sea contained the carbohydrate lacto - n - fucopentaose iii ( lnfpiii ) , which induced high levels of il-4 , il-5 , and il-10 by nasal lymphocytes bypassing the need for an adjuvant .
dcs are also targeted by lyso - phosphatidylserine ( lyso - ps ) present in sea , to dampen the th2 response .
lyso - ps was shown to act on dcs via the tlr2 pathway , endowing them with the ability to induce il-10-producing treg cells .
whole sea , as well as sea - derived molecules , has been described to interfere with animal models of allergy - related diseases .
yang et al . used s. japonicum sea to test its effect in experimentally induced asthma in mice .
sea increased il-10 production and expression of foxp3 on cd4cd25 t cells , both with immunosuppressive activity , while at the same time decreasing the expression of th2 ( il-4 and il-5 ) cytokines , suppressed antigen - induced airway inflammation , recruitment of inflammatory cells into the lungs , and development of asthma .
s. mansoni egg - secreted chemokine - binding protein ( smckbp ) was reported to significantly diminish ear swelling of hapten - sensitized mice in a contact hypersensitivity model .
isolation of the inflammatory infiltrate from hapten - treated ears of smckbp - treated mice showed reduction of neutrophilia when compared to cells isolated from the ears of control animals .
showed that smckbp has specific in vivo activity , suppressing immediate or local inflammation . additionally , three s. mansoni antigens sm22.6 ( soluble protein associated with the s. mansoni tegument ) , piii ( a multivalent antigen of s. mansoni adult worms ) , and sm29 ( a membrane bound glycoprotein on the s. mansoni adult worm tegument ) were evaluated in the ova - induced airway inflammation mouse model .
all three antigens showed a beneficial immunomodulatory effect in this allergy model characterised by suppression of airway inflammation , reduced eosinophilia in the lungs , decreased ova - specific ige levels , and lower th2-specific cytokine production in bal when compared to asthmatic animals .
sm22.6 significantly induced higher levels of il-10 , while both sm22.6 and piii lead to increased expression of cd4foxp3 t cells suggesting that treg cells might be involved in the modulation of this aberrant th2 inflammation .
although ascaris infections are described to support allergic inflammation ( section 2.3 ) , products from a. suum have also been described to contain immunomodulatory activity , in particular the 200 kda protein pas-1 .
administration of pas-1 to mice that had been injected with lps into sterile air pouches resulted in a significant decrease in neutrophil migration as well as suppressing proinflammatory cytokines il-6 , tnf- , and il-1 .
itami et al . used a murine model of asthma induced by another a. suum - molecule , apas-3 that promotes ige production , to test the suppressive effect of pas-1 . in this experimental model of asthma induced by apas-3 , pas-1-treated mice showed decreased eosinophil migration into the lungs , lower il-4 , il-5 , ccl11 and rantes production in the bal , as well as reduced airway hyperreactivity .
moreover , il-10 production was considerably increased after pas-1 treatment when compared to apas-3-immunized controls .
thus , a. suum has allergenic components as well as suppressive products that downregulate allergic responses .
more recently , a study from the same group showed suppressive effect of pas-1 also in ova - induced airway inflammation . in line with previous findings , pas-1 reduced eosinophilia , decreased production of th2 associated cytokines in the bal and ova - specific ige and igg1 levels in serum .
moreover , the effect was observed in il-12- but not in il-10- and ifn--deficient animals , thus il-10 and ifn- played a role in the immunomodulatory effect of pas-1 .
furthermore , the authors reported that the immunomodulatory effect of pas-1 was mediated by cd4cd25 and cd8 t cells as shown by adoptive cell - transfer into ova - sensitized and challenged mice .
recipients of pas-1-primed cd4cd25 t cells had increased levels of il-10/tgf- whereas mice with transferred pas-1-primed cd8 t cells showed prominent ifn- production .
those three cytokines were described to play important roles in the suppression of allergic diseases and reported to be strongly induced during successful allergen - specific immunotherapy in humans as reviewed by holgate and polosa .
helminths have had millions of years to evolve regulatory mechanisms that circumvent the mammalian immune response and allow for the longevity characteristically observed during infection .
thus , understanding of this coevolutionary nature is important in order to comprehend the immunomodulatory potential of helminth - derived molecules .
this will better allow the development of therapeutical targets in symptomatic disease in helminth infections and help to break transmission of infection in endemic countries .
furthermore , the genetic basis underlying differences in responses of different individuals to helminth infections should be examined to develop a full understanding of these parasites , and current studies are beginning to address this .
in particular , relevant experimental models for filarial disease are required to study both asymptomatic and pathological responses .
the epidemiological data reported in this paper together with experimental studies clearly support the view of the immunomodulatory potential of helminth - derived products to interfere with and even prevent aberrant allergic inflammation .
research should focus on studying the immunomodulatory effects of helminth - derived products on allergy and strive to develop new therapeutic strategies by identifying the mechanisms and pathways utilised by such molecules in mediating their immunomodulatory effects .
Output:
| helminths are master regulators of host immune responses utilising complex mechanisms to dampen host protective th2-type responses and favour long - term persistence .
such evasion mechanisms ensure mutual survival of both the parasite and the host . in this paper
, we present recent findings on the cells that are targeted by helminths and the molecules and mechanisms that are induced during infection .
we discuss the impact of these factors on the host response as well as their effect in preventing the development of aberrant allergic inflammation .
we also examine recent findings on helminth - derived molecules that can be used as tools to pinpoint the underlying mechanisms of immune regulation or to determine new anti - inflammatory therapeutics . |
PubmedSumm119603 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: while opportunistic infections continue to be enameled care of patients infected with acquired immunodeficiency , cancer remains overlooked in the care of these patients in developing countries . according to center disease control ( cdc ) ,
the revised definition of aids criteria includes the biological criteria ( cd4 below 200 ) and/or clinical criteria ( opportunistic infections , cancers of the cervix , kaposi sarcoma , and non - hodgkin lymphoma ) associated with infection by human immunodeficiency virus ( hiv ) .
the occurrence of malignant tumors in patients with hiv infection currently represents for years to come one of the most difficult and controversial challenges of therapeutic management of these patients . as of 2011
africa was the epicenter of viral related cancers even prior to the hiv epidemic ( e.g. , kaposi 's sarcoma ( ks ) , burkitt 's lymphoma , cervical cancer , and hepatocellular carcinoma ) .
indeed , 30 to 40% of patients infected with hiv are likely to develop cancer about their disease ; the incidence of certain cancers such as kaposi 's sarcoma has decreased since the introduction of potent antiretroviral therapies ; other malignancies associated with aids do not seem to be affected by the establishment of this new therapeutic strategy .
the prevalence coinfection tb / hiv ( 25.5% ) is well known while no study on cancers associated with hiv has been performed in our country .
the widespread use of antiretroviral therapy ( arv ) in industrialized countries since the mid-1990s led to a dramatic decrease in mortality of patients with hiv infection and incidence of opportunistic infections .
however , antiretroviral treatment types haart also had a significant impact on the natural history of hiv - associated malignancies .
a us study found an increase in median survival of aids patients from 11.3 months before 1985 to 12.5 months in 1986 to 20.8 months in 1987 for aids cases diagnosed in washington . according to a recent british study ,
40% of aids patients have cancer during the course of their disease . in france ,
a study showed that , out of a total of 964 recorded deaths , 149 were attributed to the type of aids defining cancers . according to the regional office for africa of who
sub - saharan african countries have experienced nearly 600,000 deaths in 2008 related to tumors . if this epidemiological trend continues due to longer life expectancy and increased exposure to tobacco , africa will have by 2020 from 800,000 to 1,000,000 new cases of cancer each year [ 10 , 11 ] .
the cancer incidence rate is estimated at 95.5 cases per 10 inhabitants in west africa and 90.0 per 10 in guinea . as in most sub - saharan african countries ,
there is very little data available on the prevalence of hiv infection in cancer patients in west africa , especially in our country .
this study aims to determine the prevalence of hiv infection among patients seen at the surgical oncology unit of donka .
data from this study were obtained from the hospital and came from surgical oncology unit of donka national hospital , teaching hospital of conakry ( guinea ) .
the study involved the records of cancer patients followed with hiv infection from may 2007 to december 2012 .
this checkup has become routine for any cancer patient received in our unit since january 2009 .
the prevalence has been determined according to the number of patients and pathology subject of consultation or follow - up .
pathologies associated with hiv have been classified into malignant , benign , and inflammatory diseases .
social characteristics ( age , gender , marital status , tobacco and alcohol consumption , education , and body mass index ) and immune status ( hiv type , cd4 count , and antiretroviral treatment ) were reviewed according malignant tumor pathologies , divided into defining aids and nondefining aids cancers . gynecological history ( age at menarche , first full pregnancy ) was determined in women with breast cancer .
out of 3143 patients received from may 2007 to december 2012 , 69 ( 2.2% ) tested positive for hiv in our unit .
this proportion was 12 ( 1.9% ) of 625 patients from 2007 to 2008 and 57 ( 2.3% ) of 2518 patients from 2009 to 2012 .
of the 64 hiv - infected patients , 54 ( 78.3% ) had a malignant tumor , 8 ( 11.6% ) of benign and 7 ( 10.1% ) of inflammatory tumors ( table 1 ) .
the prevalence of hiv in cancer patients was 54 on 2598 cases ( 2.1% ) .
of the 54 cases of cancers associated with hiv , there were 11 ( 20.4% ) defining aids and 43 ( 79.6% ) nondefining aids .
cancer patients had a median age of 39 ( iqr 3148 ) against 32 ( iqr 2538 ) for noncancer patients .
this median age was different about defining aids status : 33 ( 25.040.0 ) versus 39 ( iqr 35.750.0 ) ( p = 0.007 ) . their body mass index was 20,4 kg / m ( iqr 17.721.8 ) .
they were unschooled in 40 ( 74.1% ) and married in 35 ( 64.8% ) .
tobacco use was found in 13 ( 24.1% ) and alcohol consumption in 14 ( 20.2% ) .
cd4 count , performed in 22 patients , showed a median of 317 cells / ml ( iqr 246.2534.2 ) .
antiretroviral treatment was performed in 40 ( 74.1% ) patients of which it was performed in 39 only after the cancer diagnosis .
table 2 shows the distribution of different types of cancers depending on the aids definition . among the cancers defining aids , non
- hodgkin 's lymphoma ( 6 ) ( 11.1% ) and cervical cancer ( 5 ) ( 9.3% ) were the most common .
breast cancer ( 6 ) ( 11.1% ) , followed by cancer of the liver ( 6 ) ( 11.1% ) , and eye and annexes ( 6 ) ( 11.1% ) were leading nondefining aids cancers .
patients with breast cancer had a median age of 14.0 years ( iqr 12.515.0 ) at menarche and 22.0 years ( iqr 17.025.0 ) in the first full term pregnancy ; and they had 1.0 full pregnancy in term ( iqr 0.53.0 ) .
this preliminary study shows a high prevalence ( 2.1% ) of the hiv infection in patients with cancer in our surgical oncology unit .
this prevalence appeared to be higher than in the general population in guinea ( 1.5% ) but lower than in the tertiary hospital ( 6.0% ) in nigeria .
risk of cancer occurrence in hiv - infected people is 6.39 times higher compared to uninfected hiv people . in this study ,
non - aids defining cancers were more frequent than defining aids cancers ( 77.8% versus 22.2% ) .
this could be explained partly by the decrease in the number of cancer cases defining aids since the beginning of antiretroviral therapy as supported by yanik et al . in the us . also , kaposi 's sarcoma ( ks ) and cervical cancer are mainly managed , respectively , by the dermatology and gynecology departments of teaching hospital .
kaposi 's sarcoma is very common in dermatology and the guinean first data were published by cisse et al . .
in nigeria , ks and cervical cancer are the most common cancers among non - aids defining cancers .
cervical cancer is the most common cancer in guinea with a high prevalence of human papillomavirus infection . in this study , nhl was leading defining aids cancer .
this predominance of breast cancer among nondefining aids cancers is reported by studies in sub - saharan africa [ 21 , 22 ] .
the hiv infection is very prevalent , about 35.4% among women with breast cancer in uganda and 19.7% in south africa . in developed countries ,
lung cancer is the most common of nondefining aids cancers [ 16 , 23 ] .
conversely , those with aids classifying cancer were younger than those who had a non - aids defining illness cancer .
the female gender and the young age of patients are already reported by several authors [ 14 , 21 ] .
this could be related to the irregular availability of reagents for cd4 and antiretroviral despite their free access in our country .
cd4 count , carried out for 22 cases out of 54 , showed no difference in the depth of immunosuppression that cancer is either aids defining or not . for defining aids cancers
, there is no doubt that the risk is higher in the case of lower cd4 count ( < 200 cells / ml ) [ 24 , 25 ] .
however , there are controversies with regard to the depth of immunosuppression in nondefining aids cancer [ 22 , 23 , 25 ] .
we consider that the art coverage rate ( 74.1% ) is low in this category of the population infected with hiv , although this rate is higher than the rate of coverage in guinea ( 50.0% ) .
these patients are faced with two problems : hiv / aids with the supported opportunistic infections and cancer that is not supported by the national program against aids .
that is why a national prospective study is needed to determine the true prevalence of cancer among people living with hiv .
it will also be important to determine whether hiv changes the risk factors , clinicopathological futures , and prognosis of these cancers .
breast cancer is the most common in this association . a national survey of a large sample is needed to determine the true prevalence and impact of hiv on cancer prognosis .
Output:
| aim . to determine the prevalence of hiv infection among patients seen at the surgical oncology unit of donka ( conakry , guinea )
. method .
we conducted a retrospective and descriptive study of hiv infection in cancer patients from may 2007 to december 2012 .
social characteristics ( age , gender , marital status , and education ) and immune status ( hiv type , cd4 count ) were reviewed .
results . out of 2598 cancer patients ,
54 ( 2.1% ) tested positive for hiv .
there were 11 ( 20.4% ) defining aids and 43 ( 79.6% ) nondefining aids cancers .
the most frequent cancers were breast ( 14 ) ( 26.0% ) , non - hodgkin lymphoma ( 6 ) ( 11.1% ) , liver ( 6 ) ( 11.1% ) , eye and annexes ( 6 ) ( 11.1% ) , and cervical cancer ( 5 ) ( 9.3% ) .
these patients were female in 34 ( 63.0% ) and had a median age of 39 years and body mass index was 20,3 kg / m2 .
they were unschooled in 40 ( 74.1% ) and married in 35 ( 64.8% ) .
cd4 count showed a median of 317 cells / ml .
antiretroviral treatment was performed in 40 ( 74.1% ) .
conclusion .
hiv prevalence is higher in patients in our unit of surgical oncology .
breast cancer was the most common in this association .
a national survey of a large sample is needed to determine the true prevalence and impact of hiv on cancer prognosis . |
PubmedSumm119604 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: interest in tomosynthesis and its clinical applications has been revived by recent advances in digital x - ray detector technology . in tomosynthesis , an x - ray tube and an x - ray receptor
tomosynthesis captures only one set of discrete x - ray projections that can be used to reconstruct any plane of the object retrospectively .
this article will review and identify indications for x - ray digital linear tomosynthesis ( dlt ) .
the chest phantom ( n-1 type , kyoto kagaku co. , tokyo , japan ) and the artificial pulmonary nodules of type n1 are depicted in the images [ figures 1 and 2 ] .
the artificial pulmonary nodules were of the ground - glass opacity type ( 5 and 7 mm ) , and the spheres were of the same diameter and composition .
for the dual - energy evaluation study , calcification was simulated using hydroxyapatite ( powder type ) .
the relationship between the radiation attenuation properties of glass and those of real pulmonary nodules was correlated .
tomosynthesis ( sonialvision safire ii , shimadzu co. , kyoto , japan ) and ct ( 64-slice somatom definition scanner ; siemens medical systems , forchheim , germany ) images of the artificial pulmonary nodules ( ground - glass opacity type ) .
the quality of the images obtained by tomosynthesis imaging were clearer than those obtained by ct ( ct slice thickness : 5 mm ) .
des - tomosynthesis and des radiography ( sonialvision safire ii ) of the same slice , demonstrates the content of the artificial pulmonary nodules with and without calcification .
the high - contrast detectability phantom case having a clear , contrast detectability on des - tomosynthesis imaging produced for identical planes ( tomosynthesis acquisition angle : 40 ) .
owing to its high sensitivity , normal - dose helical computed tomography ( ct ) is currently considered the gold standard for lung cancer detection .
early reports indicate that low - dose helical ct has the potential to detect early lung cancer , and thus decrease morbidity .
ct has the advantage of improved detection of lesion by eliminating visual clutter of overlying anatomy [ figure 1 ] .
however , there are disadvantages of using ct when compared with chest radiography , such as high - radiation dose and cost . on the other hand , although chest radiography has advantages such as short examination time , low cost , and easy access , there are also important disadvantages such as low sensitivity and specificity . in chest radiography , the three - dimensional chest is projected onto a two - dimensional image .
consequently , the ability to detect pathological findings is limited by the overlapping anatomy rather than by quantum noise .
chest radiography has been shown to have a relatively low sensitivity for the detection of pulmonary nodules .
the poor sensitivity of chest radiography precludes its use as a screening modality , despite its advantages of low cost , low dose , and wide distribution of devices .
dlt is a method that provides some of the tomographical benefits of ct at a reduced radiation dose and cost and with an approach that can be easily implemented in conjunction with chest radiography .
current state of dlt originates from the older technique of geometric tomography , which has largely fallen out of favor in chest imaging owing to positioning difficulty , high radiation dose , and residual blur from out - of - plane structures .
dlt overcomes the difficulties of geometric tomography by permitting reconstruction of numerous slices of the image from a single low - dose acquisition of image data [ figure 1 ] .
although improving detection of pulmonary nodules may be an early area of emphasis for the application of tomosynthesis , it also has potential for use in other areas of thorax imaging.[12 ]
presence of calcification and stability of the mass over 2 years suggest its benign nature . a benign pattern of the calcifications has been considered necessary to exclude malignancy . in the evaluation of diffusely
disseminated pulmonary nodules , identification of diffusely disseminated pulmonary nodules and calcifications in the nodules has been helpful in limiting the differential diagnosis .
conventional radiography and conventional tomography have been used to detect calcifications , but they have been largely replaced by ct .
however , ct has several inherent problems , including motion artifacts and the variety of reconstruction algorithms that are used by different ct scanners . dual energy subtraction ( des ) imaging has been proposed and investigated by many researchers as a means of reducing the impact of anatomic noise on disease detection by chest radiography .
des involves making two radiographical projections of the patient using different energy x - ray beams . by exploiting the difference in the energy dependence of attenuation between bone and soft tissue ,
the bone contrast can be reduced to produce a soft tissue image and the contrast of the soft tissue can be reduced to produce a bone image .
des digital radiography has been found to be useful in detecting calcifications within pulmonary masses .
main drawback of the des technique , is that its projections may result in overlap of anatomical features ( e.g. , calcifications superimposed over the ribs or spine ) .
des dlt is a new technique , and therefore there is no guidance for its integration into the clinical practice of chest radiography .
the most reliable signs for discriminating between benign and malignant masses are the growth rate of the mass and presence or absence of calcifications within the mass .
since calcifications are commonly observed in benign masses and no other radiographical characteristic is specific in characterizing a mass , it is important to detect and characterize calcification within lesions . using des dlt , the presence , distribution , and characteristics of calcifications in lung nodules can be assessed to an extent that is not possible with currently available ct imaging and projection - type des techniques .
in addition , this technique is not susceptible to the problems of image overlap , partial volume effect , or shifting of the image plane [ figures 2 and 3 ] . calcified tuberculous foci in a 74-year - old man .
comparison of the chest images obtained with x - ray radiography , digital tomosynthesis , des - tomosynthesis , and high - resolution ct ( hr - ct ) .
des - tomosynthesis and hr - ct appear to have similar accuracy in detecting calcification in the pulmonary nodules .
ideally , structures in a given plane of interest should be clearly displayed in the corresponding tomosynthesis reconstruction plane , whereas structures located outside of that plane should not be visible .
essentially , the limited angular range of the tomosynthesis image acquisition geometry dictates that spatial resolution is limited in the dimension perpendicular to the detector plane . as a result
, out - of - plane structures can not be completely removed from the reconstruction plane and are present in every such plane
. however , most of these structures are not visible because various low - amplitude structures from projections overlap in the reconstruction plane , and therefore , appear blurred .
out - of - plane structures from high - attenuation features can not be blurred and appear as multiple replicates in every reconstruction plane , except for the one in which the actual high - attenuation feature ( e.g. , rib ) is located . at one projection angle , these ghosting features are distributed along the line made by the x - ray source and the actual feature [ figure 4 ] . out - of - plane
structures are present in every reconstruction plane , but most are not visible because the various low - amplitude structures from projections overlap each other in the reconstruction plane , and therefore are blurred .
tomosynthesis is worthy of further evaluation because it is flexible and can accurately reproduce the shape of an artificial pulmonary nodule .
tomosynthesis can be considered the modality of choice to detect and investigate simulated artificial pulmonary nodules with and without calcification .
Output:
| the purpose of this paper is to identify indications for volumetric x - ray digital linear tomosynthesis ( dlt ) with single- and dual - energy subtraction techniques for artificial pulmonary nodule detection and compare x - ray dlt , x - ray digital radiography , and computed tomography . |
PubmedSumm119605 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: endothelial dysfunction causes different disorders in human body including preeclampsia during pregnancy . the pathogenesis may be due to inflammatory responses that trigger pregnancy - induced hypertension consequently
preeclampsia complicates up to 510 and 3% of pregnancies in developed and developing countries , respectively .
it plays an important role in occurring prenatal and perinatal events including premature delivery , severe hypertension , increasing the risk of stroke , maternal death .
mothers with the medical history of preeclampsia are predisposed to for cardiovascular diseases due to endothelial dysfunction may be persistent after delivery .
several studies reported the role of endothelial cells in endothelial - dependent diseases including preeclampsia and it is recently proved that endothelial dysfunction plays an important role in pathogenesis of preeclampsia . the endothelial function should be evaluated by measuring brachial artery flow - mediated dilation ( fmd ) by high - resolution b - mode ultrasonography after triggering shear stress .
reported that low - dose aspirin , as an antiplatelet , in early pregnancy decrease the risk of preeclampsia and intrauterine growth retardation ( iugr ) .
another study represented that low - dose aspirin decreases the risk of preeclampsia in healthy nulipar pregnant women but has no impact on prenatal morbidity .
although there are lots of surveys on preeclampsia , a few studies evaluate the effect of asa in preeclamptic patients .
the aim of this study is to evaluate the effect of low - dose acetylsalicylic acid ( asa ) on endothelial dysfunction in preeclamptic patients .
this trial has been registered at http://www.irct.ir/ registration with i d number irct2016040527135n2 and has been approved by the isfahan university of medical sciences ethical board . in this randomized clinical trial , pregnant women with documented preeclampsia on the basis of national high blood pressure education program working group on high blood pressure in pregnancy , 2000 , who visited in st - zahra hospital , isfahan , iran ,
patients with any clinical evidences of diabetes mellitus , pernicious anemia , aplastic anemia , megaloblastic anemia , known cardiovascular disease , hypercholesterolemia , hypertriglyceridemia , renal failure , thyroid disease , history of pregnancy - induced hypertension , malignancy , liver dysfunction , infectious disease , migraine , and stroke did not include in this study .
in addition , patients with the history of twin pregnancy , smoking cigarette , alcohol consumption , and drug abuse did not include in the study .
women who sensitize to the drug ( vertigo , insomnia , rash , severe cough , angioedema , purities and bronchospasm , and drug consumption ) , poor compliance to use prescribed drug and hygiene advice and who use drugs < 2 months during pregnancy excluded from the study .
enrolled patients were divided randomly ( allocation ratio equal to 1:1 ) into two groups by random allocation service ( www.saghaei.net/ra/ ) .
asa80 mg ( osveh , tehran , iran ) or placebo was taken daily by oral administration from the initiation of diagnosis until 2 months after delivery by the trial participant .
every patient 's fmd were evaluated at the beginning and 2 months after delivery with the same experienced operator at a same period of the time ( 35 pm ) by high - resolution b - mode ultrasonographic ( sonoace , deutschland ) .
fmd estimated by the following formula : fmd ( % ) = ( [ pod bbd]/bbd ) 100 basal brachial diameter ( bbd ) is measured in resting position , and postocclusion diameter ( pod ) is measured 30 s before and 90 s after cuff evacuation ( cuff pressure is increased up to 300 mmhg for 5 min before evacuation ) .
potential confounding variables included in the independent samples t - test were maternal age , parity , prepregnancy body mass index ( bmi ) , and abortion .
t - test or mann whitney test will be used in the comparison of means of birth weight and gestational age , between the intervention and placebo groups . to compare fmd in each group , before and after the intervention ,
paired t - test was used by spss software , version 21 , chicago , il , usa ( p < 0.05 was decided significant ) .
this trial has been registered at http://www.irct.ir/ registration with i d number irct2016040527135n2 and has been approved by the isfahan university of medical sciences ethical board . in this randomized clinical trial , pregnant women with documented preeclampsia on the basis of national high blood pressure education program working group on high blood pressure in pregnancy , 2000 , who visited in st - zahra hospital , isfahan , iran ,
patients with any clinical evidences of diabetes mellitus , pernicious anemia , aplastic anemia , megaloblastic anemia , known cardiovascular disease , hypercholesterolemia , hypertriglyceridemia , renal failure , thyroid disease , history of pregnancy - induced hypertension , malignancy , liver dysfunction , infectious disease , migraine , and stroke did not include in this study .
in addition , patients with the history of twin pregnancy , smoking cigarette , alcohol consumption , and drug abuse did not include in the study .
women who sensitize to the drug ( vertigo , insomnia , rash , severe cough , angioedema , purities and bronchospasm , and drug consumption ) , poor compliance to use prescribed drug and hygiene advice and who use drugs < 2 months during pregnancy excluded from the study .
enrolled patients were divided randomly ( allocation ratio equal to 1:1 ) into two groups by random allocation service ( www.saghaei.net/ra/ ) . asa80 mg ( osveh , tehran , iran ) or placebo was taken daily by oral administration from the initiation of diagnosis until 2 months after delivery by the trial participant .
every patient 's fmd were evaluated at the beginning and 2 months after delivery with the same experienced operator at a same period of the time ( 35 pm ) by high - resolution b - mode ultrasonographic ( sonoace , deutschland ) .
fmd estimated by the following formula : fmd ( % ) = ( [ pod bbd]/bbd ) 100 basal brachial diameter ( bbd ) is measured in resting position , and postocclusion diameter ( pod ) is measured 30 s before and 90 s after cuff evacuation ( cuff pressure is increased up to 300 mmhg for 5 min before evacuation ) .
potential confounding variables included in the independent samples t - test were maternal age , parity , prepregnancy body mass index ( bmi ) , and abortion .
t - test or mann whitney test will be used in the comparison of means of birth weight and gestational age , between the intervention and placebo groups . to compare fmd in each group , before and after the intervention ,
paired t - test was used by spss software , version 21 , chicago , il , usa ( p < 0.05 was decided significant ) .
eighty - two preeclamptic pregnant patients were enrolled in this study between february 2015 and february 2016 .
the mean of patients ages was 31.03 4.21 years ( with a range of 2141 years ) .
as shown in table 1 , patients have no significant differences in age , bmi , level of serum triglycerides , low - density lipoprotein , high - density lipoprotein , fasting blood sugar , and hemoglobin . demographic and baseline characters of patients the mean value of fmd in intervention ( 9.61 5.58 ) and control group ( 9.40 4.33 ) have no significant differences before consumption of drugs ( p = 0.089 ) . as demonstrated in table 2 , fmd increased significantly in intervention group after daily consumption of 80 mg of asa . in control group , in contrast , fmd has shown no significant differences before and after daily consumption of placebo .
flow - mediated dilation in each group before and after consumption of drug / placebo meanwhile , fmd in intervention group significantly increases after daily consumption of 80 mg asa in comparison with control group after daily consumption of placebo .
in this clinical trial on pregnant women suffering from preeclampsia visited in st - zahra hospital , isfahan , iran , 82 enrolled patients were divided randomly into two groups who received asa 80 mg or placebo daily by oral administration from initiation of diagnosis until 2 months after delivery .
our results showed that daily oral administration of low - dose asa increase fmd significantly which means it can improve endothelial function .
several experimental studies approved the effect of asa on platelet function as a potent antioxidant .
these surveys showed asa can affect endothelial function through oxidative stress pathway in vascular inflammation process .
fmd is inversely correlated to platelet reactivity in both controls and acute myocardial infarction patients .
this study showed that platelet adhesion and aggregation in inflammation state lead to endothelial dysfunction and platelet reactivation decrease endothelial dilation . in support of this study , raghavan et al . also reported that antiplatelet treatment can reduce vascular dysfunction .
magen et al . in a study at 2005 showed that addition of low - dose aspirin to antihypertensive treatment and statins in hypertensive and hypercholesterolemic patient can reduce systolic and diastolic blood pressure through improved no - mediated endothelial function .
similar effects of low - dose aspirin on blood pressure and reduce risk of preeclampsia were seen in a study on pregnant women in houston , and suggest that aspirin administration in pregnancy are useful for high - risk mothers and are safe for fetus .
endothelial dysfunction due to inflammation process and imbalance between vasoconstrictor and vasodilator modulates are known pathophysiology of preeclampsia . in endothelial disorders , such as preeclampsia ,
poor placental perfusion leads to activation of platelets and the clotting cascade , resulting in an imbalance among prostacyclin ( vasoactive modulates in blood flow and inhibit aggregation ) with thromboxane a2 ( acting as a vasoconstrictor and promoting platelet aggregation ) .
increased thromboxane and reduced prostacyclin levels are associated with infarction and thrombotic vasculopathy , which caused preeclampsia and its adverse features outcomes .
schramm et al . in a study on aspirin effect for the prevention of preeclamsia in lupus pregnant patient reported that low - dose aspirin ( 6080 mg / day ) may prevent preeclampsia by modulating the thromboxane a2/prostacyclin ratio to optimize placental blood flow and prevent placental thrombosis
while aspirin will not eliminate all cases of preeclampsia , it is currently the best and safest available drug for influencing the pathogenesis and clinical presentation of preeclampsia . in this study ,
aspirin treatment had a risk reduction of up to 20% for preeclampsia development in lupus patient .
furuno et al . in a survey about the effects of various doses of aspirin on platelet activity and endothelial
function indicate that aspirin at any daily dose over 81 mg suppressed platelet activity , and the optimal dose of endothelial function was 162 mg / day . however , 660 mg / day of aspirin worsened endothelial function
. this study explains aspirin plays an important role in the primary and secondary prevention of cardiovascular events and it has remained the most cost - effective clinical drug for over three decades .
a high dose of aspirin achieves both platelet inhibition and vasodilation , whereas a low dose spares endothelial cyclooxygenase activity and vasodilatation .
pregnant women reported prescription of aspirin ( 60150 mg / day ) to this group , appears to be effective in reducing the prevalence of early pe .
aspirin also can reduce the risk of preterm delivery , iugr , and prenatal death .
study showed similar effects and suggested that low - dose aspirin initiated at 16 weeks of gestation is associated with a greater reduction of perinatal death and other adverse perinatal outcomes than when initiated at > 16 weeks .
first and most important limitation of our study is small sample size due to difficulties to diagnosis pure preeclamptic patients who met inclusion criteria .
the last but not least was an unequal period of drug administration by participants due to emergency indications for cesarean section which some of the participants did meet .
first and most important limitation of our study is small sample size due to difficulties to diagnosis pure preeclamptic patients who met inclusion criteria .
the last but not least was an unequal period of drug administration by participants due to emergency indications for cesarean section which some of the participants did meet .
this study demonstrated an association between low - dose aspirin and increase flow - mediated vasodilation in the brachial artery in preeclamptic patient .
increase mean of fmd in groups who took regular daily oral 80 mg aspirin starting right at the initiation of diagnosis until 2 months after delivery shows that this drug through biological pathway can improve endothelial function and can be significantly affected maternal blood pressure during pregnancy and some endothelium - dependent disease such as preeclampsia and its associated adverse outcomes .
this study was supported by isfahan university of medical sciences , isfahan , iran ( grant no .
this study was supported by isfahan university of medical sciences , isfahan , iran ( grant no .
fb contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
mh contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
ez contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
kh contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
sb contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
Output:
| background : preeclampsia complicates up to 3% of pregnancies in developing countries .
endothelial dysfunction plays an important role in pathogenesis of preeclampsia . in this study
, we aim to evaluate the effect of low - dose aspirin on endothelial dysfunction in preeclamptic patients.materials and methods : in this triple - blind randomized clinical trial , enrolled patients were divided randomly into two groups . acetylsalicylic acid ( asa )
80 mg or placebo will be taken daily by oral administration from the initiation of diagnosis until 2 months after delivery .
every patient 's flow - mediated dilation ( fmd ) were evaluated at the beginning of study and 2 months after delivery with the same experienced operator at a same period of the time ( 35 pm ) by high - resolution b - mode ultrasonographic .
t - test or mann whitney test was used in the comparison of means between the intervention and placebo groups . to compare fmd in each group , before and after the intervention , paired t - test was used.results:mean value of fmd in intervention
( 9.61 5.58 ) and control group ( 9.40 4.33 ) have no significant differences before drug consumption ( p = 0.089 ) .
fmd in intervention group significantly increased after asa consumption ( [ 9.61 5.58 vs. 13.65 7.91 ] [ p = 0.044]).conclusion : increase mean of fmd in intervention group shows that this supplement can improve endothelial function . |
PubmedSumm119606 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
eyfp - actin and eyfp - nls - actin expression plasmids were kindly provided by primal de lanerolle ( university of illinois , chicago ) .
eyfp tagged actin behaves like an endogenous actin and has been used to visualize actin dynamics in the inner cells .
we have confirmed that the expressed eyfp - nls - actin accumulates in the nucleus and forms nuclear f - actin bundles .
hela cells were cultured in dulbecco 's modified eagle 's medium ( gibco ) supplemented with 10% fetal bovine serum and antibiotics ( penicillin and streptomycin ) at 37 c in a 5% co2 humidified atmosphere .
transfection of hela cells was performed using lipofectamine 2000 ( invitrogen ) and 2 g of plasmid dna .
captured images of hela cells expressing the eyfp - actin or the eyfp - nls - actin are shown in fig . 1 .
total rna was isolated from the eyfp - actin or eyfp - nls - actin expressing hela cells by using an rneasy mini kit ( qiagen ) according to the manufacturer 's protocol .
the quality of isolated rna was assessed by monitoring the rna integrity number ( rin ) .
we confirmed that the rin scores of the sample rnas isolated from the eyfp - actin or eyfp - nls - actin expressing hela cell were 10 .
rna labeling was performed using a low input quick amp labeling kit ( one - color ) .
0.6 g of cyanin-3 ( cy3)-labeled crna probe , prepared from 100 ng of total rna , was fragmented and hybridized to the agilent-039494 sureprint g3 human ge v2 8x60k microarray ( gpl16699 ) using a gene expression hybridization kit ( agilent ) according to the manufacturer 's instructions .
after hybridization , the array was scanned using an agilent dna microarray scanner ( g2565ca ) .
the agilent feature extraction software ( agilent ) was used to extract raw data from the scanned array images .
these raw data files were registered as geo ( gse59799 ) . a scatter plot , showing normalized signal intensity values of different genes in eyfp - actin and eyfp - nls - actin expressing hela cells , is shown in fig .
as shown , the scatter plot exhibited good correlation coefficient ( r = 0.9859 ) between these signal intensities .
an ma plot is used to identify systematic variations within the arrays , where m is the log ratio ( log2 ( exp .
gscale signal ) log2 ( base gscale signal ) ) and a is the average log of the product of the two intensities [ { log2 ( exp .
as shown , the number of up - regulated genes was greater than the number of down - regulated genes , suggesting that the nuclear actin is mainly involved in gene activation rather than in gene repression .
eyfp - actin and eyfp - nls - actin expression plasmids were kindly provided by primal de lanerolle ( university of illinois , chicago ) .
eyfp tagged actin behaves like an endogenous actin and has been used to visualize actin dynamics in the inner cells .
we have confirmed that the expressed eyfp - nls - actin accumulates in the nucleus and forms nuclear f - actin bundles .
hela cells were cultured in dulbecco 's modified eagle 's medium ( gibco ) supplemented with 10% fetal bovine serum and antibiotics ( penicillin and streptomycin ) at 37 c in a 5% co2 humidified atmosphere .
transfection of hela cells was performed using lipofectamine 2000 ( invitrogen ) and 2 g of plasmid dna .
captured images of hela cells expressing the eyfp - actin or the eyfp - nls - actin are shown in fig . 1 .
total rna was isolated from the eyfp - actin or eyfp - nls - actin expressing hela cells by using an rneasy mini kit ( qiagen ) according to the manufacturer 's protocol .
the quality of isolated rna was assessed by monitoring the rna integrity number ( rin ) .
we confirmed that the rin scores of the sample rnas isolated from the eyfp - actin or eyfp - nls - actin expressing hela cell were 10 .
rna labeling was performed using a low input quick amp labeling kit ( one - color )
. 0.6 g of cyanin-3 ( cy3)-labeled crna probe , prepared from 100 ng of total rna , was fragmented and hybridized to the agilent-039494 sureprint g3 human ge v2 8x60k microarray ( gpl16699 ) using a gene expression hybridization kit ( agilent ) according to the manufacturer 's instructions .
after hybridization , the array was scanned using an agilent dna microarray scanner ( g2565ca ) .
the agilent feature extraction software ( agilent ) was used to extract raw data from the scanned array images .
these raw data files were registered as geo ( gse59799 ) . a scatter plot , showing normalized signal intensity values of different genes in eyfp - actin and eyfp - nls - actin expressing hela cells , is shown in fig .
as shown , the scatter plot exhibited good correlation coefficient ( r = 0.9859 ) between these signal intensities .
an ma plot is used to identify systematic variations within the arrays , where m is the log ratio ( log2 ( exp .
gscale signal ) log2 ( base gscale signal ) ) and a is the average log of the product of the two intensities [ { log2 ( exp .
2b . as shown , the number of up - regulated genes was greater than the number of down - regulated genes , suggesting that the nuclear actin is mainly involved in gene activation rather than in gene repression .
herein , we describe the nuclear actin - mediated regulation of gene expression in hela cells by using a commercially available rna microarray .
our microarray analysis data will be useful for elucidating the role of nuclear actin in transcription regulation .
Output:
| actin , an integral component of the cytoskeleton , plays crucial roles in a variety of cell functions , including cell migration , adhesion , polarity and shape change .
studies performed during the last couple of decades have revealed that the actin also exists in the nucleus .
however , the function and properties of nuclear actin remained elusive so far .
recently , we showed that an actin tagged with eyfp and fused with a nuclear localization signal ( eyfp - nls - actin ) formed visible filamentous ( f)-actin bundles in cells . to obtain further details about the individual genes that are affected by the nuclear actin
, we have used the microarray analysis to determine the changes in the expression levels of rnas in hela cells as a result of eyfp - nls - actin expression .
our results suggest that the nuclear actin plays a role in the activation of genes rather than their repression .
the data has been deposited in the gene expression omnibus ( geo ) database under the accession number gse59799 . |
PubmedSumm119607 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: urticaria is a condition characterized by localized or widespread pruritic wheals that typically exist for no more than 24 h. by definition acute urticaria lasts no longer than six weeks , whereas chronic urticaria lasts longer , often several years .
autoimmune urticaria is not a well - defined term but it is generally recognized that those with autoimmune urticaria have anti - igg antibodies against the high - affinity ige receptor ( fceri ) on mast cells and basophils or directly to ige antibodies .
h1 antihistamines are recommended as first - line therapy for chronic urticaria ; leukotriene receptor antagonists are indicated as second - line therapy , whereas immunosuppressive drugs such as corticosteroids , azathioprine or cyclosporine a should be reserved for severe recalcitrant disease .
omalizumab is a recombinant humanized monoclonal antibody that blocks the high - affinity fc receptor of ige .
. however , there is currently more and more data showing promising results in the management of patients suffering from other allergic conditions such as chronic urticaria .
we present a case series of chronic urticaria patients in a university department treated with omalizumab and give an overview of the existing literature concerning omalizumab treatment of therapy - resistant chronic urticaria .
the cases reported herein were selected consecutively from the department of dermatology at bispebjerg hospital in copenhagen .
all patients were initially referred to the department with a diagnosis of urticaria and were considered eligible for this report if they began treatment with omalizumab for urticaria during the one - year period from november 2010 to october 2011 . for each case , the type and duration of urticaria was recorded as well as any previous medical treatment . if available , the results of relevant serological markers including serum total ige and the urticaria hr test were noted . a histamine release > 16.5% was regarded as positive ( reflab , copenhagen , denmark ) .
all patients were treated with omalizumab at an initial dose of 150 mg once every two weeks , which was the department 's standard dosing regimen . the clinical response to treatment with omalizumab was recorded and for each patient it was possible to score the individual response to treatment as : no response , partial response , or almost complete / complete resolution of symptoms during treatment .
furthermore , the duration and any side effects of omalizumab were recorded . the response to treatment in our case series
was compared with reports from the existing english language literature retrieved from pubmed using the search terms :
omalizumab and anti - ige. cross - references were retrieved but this did not identify additional studies .
a total of 19 patients ( 14 females ) began treatment with omalizumab during the observation period ( table 1 ) .
the mean age at the time of omalizumab initiation was 36 years for females and 49 for males .
the mean duration of disease at initiation of omalizumab in the sample was 21 months for females and 24 months for males ( one male patient had a duration of nine years ) .
a total of 12 patients ( 63% ) were classified as having chronic idiopathic urticaria , six patients ( 32% ) had chronic autoimmune urticaria demonstrated by a positive urticaria hr test , whereas one patient had delayed pressure urticaria .
all patients had antihistamine - resistant disease and all but two had been treated with other systemic drugs ; 14 ( 74% ) with prednisolone , 7 ( 37% ) with azathioprine , cyclosporine a and/or mycophenolate mofetil , and 6 ( 32% ) with tnf - a inhibitors . in total , 11 patients ( 58% ) experienced almost complete or complete resolution of symptoms during treatment with omalizumab , whereas five ( 26% ) experienced partial resolution ; three patients ( 16% ) had no benefit of the treatment and of these , one had to discontinue treatment due to side effects ( nausea , headache and flu - like symptoms ) .
however , in general , treatment was tolerated very well and only three patients ( 16% ) reported side effects .
these three patients were all females and among the youngest in the sample ( 15 , 19 and 29 years of age ) .
the present case series included 19 patients with therapy - resistant chronic urticaria . on an initial dose of omalizumab of 150 mg once every two weeks , a total of 84% of the patients experienced resolution of symptoms to a degree that exceeded the effect of previous treatments .
the symptomatic effect of the treatment occurred in many of the patients after one or just a few days and no serious side effects were reported .
these data add to the growing body of evidence supporting the use of omalizumab as a safe and effective treatment option for chronic urticaria . particularly , by december 2011 , to our knowledge , a total of 59 cases of chronic urticaria treated with omalizumab have been reported in the literature comprising five cases of solar urticaria , two cases of heat urticaria , two cases of cold urticaria , three cases of delayed pressure urticaria , three cases of urticaria factitia , three cases of cholinergic urticaria , 40 cases of chronic idiopathic urticaria , and 16 cases of chronic autoimmune urticaria .
furthermore , a total of 139 patients have been enrolled in two randomized controlled trials comparing omalizumab with placebo ( table 2 ) [ 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 ] .
the first randomized trial was restricted to patients with ige against thyroperoxidase ; 27 patients were randomized to omalizumab and 22 to placebo .
the absolute mean decrease in the urticaria activity score ( uas ) during the 24 weeks of treatment was 17.8 points in the experimental group and 7.9 points in the placebo group . according to the investigator 's global assessment ,
as many as 67% of the patients in the experimental group were assessed as having achieved complete resolution of symptoms during the study compared with only 4% in the placebo group .
the second trial included 90 patients with chronic idiopathic urticaria randomized to one of three different doses of omalizumab ( 75 , 300 or 600 mg ) or to placebo .
the absolute mean decrease in the uas four weeks after a single dose of omalizumab was 14.6 points in the group receiving 600 mg omalizumab , 19.9 points in the group receiving 300 mg omalizumab , 9.8 points in the group receiving 75 mg omalizumab , and 6.9 points in the group receiving placebo .
the mean decrease in the groups receiving 300 and 600 mg omalizumab was statistically significantly greater than in the placebo group . a total of 28.6 , 36.0 , and 4.4% of the patients had complete resolution of urticaria symptoms after receiving a single dose of 600 , 300 and 75 mg omalizumab , respectively .
both randomized trials reported mild but rather frequent side effects such as diarrhoea , headache , dysmenorrhoea and upper respiratory tract infections that , however , did not differ in prevalence between the groups receiving active treatment and placebo .
the rapid improvement of urticaria symptoms reported in almost all previous cases treated with omalizumab indicates that ige plays an important role in chronic urticaria .
however , although anti - ige mechanisms are thought to be the principal mode of action for omalizumab , several of the published cases support a role of other mechanisms such as induction of eosinophil apoptosis , downregulation of the inflammatory cytokines il-2 , il-4 , il-13 and tnf - a , increase in the activity of cd4 + cells by atp release , decrease in basophil releasability as well as a marked decrease in the expression of fceri [ 18 , 20 , 21 , 25 ] .
these observations offer an explanation for the successful results also among patients with low levels of ige .
the dosing of omalizumab for chronic urticaria is in many cases based on the recommendations for asthma , i.e. based on serum total ige levels and the weight of the patient .
we saw a marked effect in most of our patients of treatment with 150 mg once every two weeks . in comparison ,
most of the previous cases were treated with a higher dose , predominantly with an initial dose of 300 mg , which was also the dose that produced the most marked clinical response in the experimental trials . on the contrary ,
earlier published case reports , in general , overestimated the effect of omalizumab compared with the controlled trials , and also did not report side effects or scored them as negligible or absent .
despite an undeniable value of omalizumab for chronic urticaria , it is still not clear why the drug is effective in some patients and less so in others
. nevertheless , the collective evidence points to omalizumab as a safe and effective treatment option for patients with chronic urticaria who do not sufficiently respond to standard therapy as recommended by existing guidelines .
Output:
| omalizumab is a recombinant humanized monoclonal antibody that blocks the high - affinity fc receptor of ige .
omalizumab has been approved for the treatment of moderate to severe asthma ; however , there is currently more and more data showing promising results in the management also of chronic urticaria .
we present a case series of 19 patients with chronic urticaria treated in a university department with omalizumab and give an overview of the existing literature comprising an additional 59 cases as well as a total of 139 patients enrolled in two randomized controlled trials comparing omalizumab with placebo .
the collective evidence points to omalizumab as a safe and effective treatment option for patients with chronic urticaria who do not sufficiently respond to standard therapy as recommended by existing guidelines . |
PubmedSumm119608 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: post - laser - assisted in situ keratomileusis ( lasik ) ectasia ( ple ) consists of progressive corneal steepening with stromal thinning due to a reduction in biomechanical stability of the cornea.14 although ple is a rare adverse outcome of laser refractive surgery , it is a significant sight - threatening complication leading to compromised visual function and patient morbidity.14 corneal collagen cross - linking ( cxl ) halts progressive corneal ectasia by strengthening the collagen lamellae of the cornea.5 although this treatment was only recently approved by the us food and drug administration , cxl efficacy and safety have been extensively documented since 2003 in both keratoconus ( kc ) and ple patients.59 traditional epithelium - off cxl involves removal of the corneal epithelium , and therefore recovery is uncomfortable and long , with significant time off work , productivity loss , and compromised lifestyle . furthermore , the potential for significant complications exists.10 epithelium - on techniques have been developed to minimize recovery and complications , but have not shown the same efficacy and may not be suitable for ple.11,12 we propose a novel , less invasive technique to treat ple at an earlier clinical stage , before significant loss of cdva .
the method we have termed under - flap cxl ( ufcxl ) involves soaking the stromal bed with riboflavin , repositioning the flap , then applying ultraviolet ( uv ) light to the corneal surface .
we hypothesize that ufcxl will halt the ectatic progression in early ple by strengthening the corneal tissue under the flap and , in so doing , preserve existing refractive error , uncorrected distance visual acuity ( udva ) , and corrected distance visual acuity ( cdva ) before it worsens . by eliminating the need to remove the epithelium , it can also minimize known complications of standard epi - off cxl , minimize patient discomfort , and significantly hasten recovery time .
the purpose of this study is to describe this novel technique of ufcxl in treating early ple and to report on 6-month outcomes of the first treated eyes .
inclusion criteria were early ple eyes , defined as presenting with new onset of progressive manifest refraction cylinder up to 1.50 d , udva of 20/40 or better , cdva of 20/25 or better , and new topographic irregular astigmatism and/or inferior steepening , with under - flap stromal bed of 325 m or greater , resulting in a total corneal thickness ( stromal bed + flap ) of 400 m or greater .
the study was approved by the ethics review board of the canadian ophthalmic research centre and fulfilled all principles of the declaration of helsinki . written informed consent was received from all patients .
all procedures were formed using an internally - developed standardized technique for under - flap stromal cxl . the existing lasik flap was lifted and retracted back onto a weck pillow ( merocel , beaver - visitec international inc . , waltham , ma , usa ) on the superior bulbar conjunctiva . ultrasound pachymetry ( sonogage inc . ,
cleveland , oh , usa ) was performed on the stromal bed . a 7 mm circular sponge ( corneal light shield , beaver - visitec international inc . )
was soaked with drops of 0.25% riboflavin solution ( riboflavin dissolved in 0.87% nacl ; haber s compounding pharmacy , toronto , on , canada ) and was placed on the stromal bed for a duration of 3 minutes ( similar to accelerated protocols used in adjunct lasik cxl1317 ) , with meticulous care not to expose the flap to riboflavin .
the quick riboflavin soak time , using a concentration of 0.25% , did not allow the retracted , exposed flap to dry out .
the stromal bed was then dried , and any excess riboflavin was removed with a weck sponge .
the flap was then refloated back into position , and remaining riboflavin was irrigated away .
the flap was reexamined at the slit lamp and adjusted , if necessary , as per normal lasik procedure .
accelerated uv light exposure was then performed as published elsewhere.1317 uv light ( ccl - vario cross - linking radiation system ; peschke trade gmbh , huenenberg , switzerland ) was applied for 3 minutes at 18 mw / cm , resulting in a total irradiation dose of 3.24 j / cm at the corneal surface .
after uv treatment , the flap was again verified to be free of striae , debris , and in good position .
postoperative treatment of ufcxl eyes included the administration of zymar four times a day for 5 days , and pred - forte as follows : every hour on day 1 ; every 2 hours on day 2 ; and four times a day for days 3 , 4 and 5 .
data from ophthalmic examinations at pre - lasik , pre - ufcxl , and 1 , 2 , 3 , 6 months , and later time points post - ufcxl were collected for analysis , including manifest refraction sphere , cylinder , spherical equivalent ( mrse ) , udva , cdva , maximum keratometry ( kmax ) , central pachymetry , corneal irregularity indices , presence of haze , and/or other complications at slit lamp .
keratometry and corneal irregularity indices were obtained with the orbscan iiz system ( bausch & lomb , rochester , ny , usa ) at each time point .
all statistical analyses were carried out in matlab r2016b software ( mathworks , natick , ma , usa ) using two - sample paired student s t - tests ( eg , to compare pre- and post - ufcxl variable means ) and two - sample kolmogorov
inclusion criteria were early ple eyes , defined as presenting with new onset of progressive manifest refraction cylinder up to 1.50 d , udva of 20/40 or better , cdva of 20/25 or better , and new topographic irregular astigmatism and/or inferior steepening , with under - flap stromal bed of 325 m or greater , resulting in a total corneal thickness ( stromal bed + flap ) of 400 m or greater .
the study was approved by the ethics review board of the canadian ophthalmic research centre and fulfilled all principles of the declaration of helsinki . written informed consent was received from all patients .
all procedures were formed using an internally - developed standardized technique for under - flap stromal cxl . the existing lasik flap was lifted and retracted back onto a weck pillow ( merocel , beaver - visitec international inc . , waltham , ma , usa ) on the superior bulbar conjunctiva .
cleveland , oh , usa ) was performed on the stromal bed . a 7 mm circular sponge ( corneal light shield , beaver - visitec international inc . )
was soaked with drops of 0.25% riboflavin solution ( riboflavin dissolved in 0.87% nacl ; haber s compounding pharmacy , toronto , on , canada ) and was placed on the stromal bed for a duration of 3 minutes ( similar to accelerated protocols used in adjunct lasik cxl1317 ) , with meticulous care not to expose the flap to riboflavin .
the quick riboflavin soak time , using a concentration of 0.25% , did not allow the retracted , exposed flap to dry out . the stromal bed
the flap was then refloated back into position , and remaining riboflavin was irrigated away .
the flap was reexamined at the slit lamp and adjusted , if necessary , as per normal lasik procedure .
accelerated uv light exposure was then performed as published elsewhere.1317 uv light ( ccl - vario cross - linking radiation system ; peschke trade gmbh , huenenberg , switzerland ) was applied for 3 minutes at 18 mw / cm , resulting in a total irradiation dose of 3.24 j / cm at the corneal surface .
after uv treatment , the flap was again verified to be free of striae , debris , and in good position .
postoperative treatment of ufcxl eyes included the administration of zymar four times a day for 5 days , and pred - forte as follows : every hour on day 1 ; every 2 hours on day 2 ; and four times a day for days 3 , 4 and 5 .
data from ophthalmic examinations at pre - lasik , pre - ufcxl , and 1 , 2 , 3 , 6 months , and later time points post - ufcxl were collected for analysis , including manifest refraction sphere , cylinder , spherical equivalent ( mrse ) , udva , cdva , maximum keratometry ( kmax ) , central pachymetry , corneal irregularity indices , presence of haze , and/or other complications at slit lamp .
keratometry and corneal irregularity indices were obtained with the orbscan iiz system ( bausch & lomb , rochester , ny , usa ) at each time point .
all statistical analyses were carried out in matlab r2016b software ( mathworks , natick , ma , usa ) using two - sample paired student s t - tests ( eg , to compare pre- and post - ufcxl variable means ) and two - sample kolmogorov
data were available for eight eyes of seven patients , who underwent previous hansatome microkeratome lasik and presented with early ple .
the average age was 33.89.6 years , mean pre - ufcxl udva of 0.180.13 logmar ( 20/30 ) , cdva of 0.040.04 logmar ( 20/201 ) , and cylinder of 0.780.49 d. average time to ufcxl was 30.513.5 months post - lasik , with an average follow - up time post - ufcxl of 7.64.1 months .
there was no significant difference ( p=0.44 ) in accuracy pre- to post - ufcxl , with r values of 0.99 vs. 0.96 , respectively ( figure 1a ) .
a total of 50% , 88% and 88% of ple eyes were respectively within 0.25 d , 0.50 d , and 1.00 d of intended correction pre - ufcxl ( figure 1b ) , compared with 38% , 50% , and 75% post - ufcxl ( p=0.70 ) . moreover , 25% , 50% , and 63% of eyes were within 0.25 d , 0.50 d , and 1.00 d of intended plano cylinder pre - ufcxl ( figure 2 ) , compared to 13% , 25% , and 63% post - ufcxl ( p=0.69 ) , respectively . at the time of diagnosis , early ple resulted in a decreased lasik efficacy index of 0.790.25 pre - ufcxl , which was unchanged post - ufcxl ( 0.830.31 , p=0.76 ) .
there was a nonsignificant ( p=0.68 ) increase in the percentage of eyes achieving cumulative snellen udva of 20/20 and 20/30 in post - ufcxl ( 25% and 88% , respectively ) vs. pre - ufcxl ( 13% and 63% , respectively ) compared with pre - lasik cdva ( 50% and 100% , respectively ; figure 3a ) .
this was apparent when comparing the difference in snellen lines of pre - lasik cdva to pre - ufcxl udva ( 25% with three or more lines worse and 0% with one or more lines better ) and pre - lasik cdva to post - ufcxl udva ( 12.5% with three or more lines worse and 25% with three or more lines better , figure 3b ) .
cylinder vector analysis revealed a nonsignificant trend toward overcorrection post - ufcxl compared with pre - ufcxl ( figure 4a , correction index : 1.100.67 vs. 0.830.33 , respectively ; p=0.44 ) and an increased index of success ( ios ) post - ufcxl compared with pre - ufcxl ( ios : 0.861.12 vs. 0.580.52 , respectively ; p=0.45 ) .
for both pre- and post - ufcxl compared with pre - lasik , the overall angle of error was within 25 and + 25 in the majority of eyes ( 75% and 75% , respectively ; figure 4b ) .
there was a slight nonsignificant ( p=0.26 ) increase in cylinder magnitude 6 months post - ufcxl ( 1.090.76 d ) , compared with pre - ufcxl ( 0.780.49 d ) .
the safety index was unchanged pre- to post - ufcxl ( 1.030.09 vs. 1.040.15 , p=0.89 ) .
five eyes had the same snellen cdva post - ufcxl ( figure 5a ) , whereas one eye lost one line and two eyes gained one line .
the cumulative snellen cdva was unchanged ( p=0.93 ) between pre - lasik , pre - ufcxl , and post - ufcxl ( figure 5b ) .
mrse was stable post - ufcxl at all time points examined ( p=0.44 at 6 months , figure 6a ) , as was cylinder ( p=0.26 , not shown ) .
corneal topography showed no evidence of ectasia progression over the follow - up time period .
kmax was stable across all time points ( p=0.94 at 6 months , figure 6b ) .
furthermore , there was no significant difference pre- to post - ufcxl in the orbscan iiz corneal irregularity indices within both the central 3 mm ( 3.210.87 vs. 3.191.04 , respectively ; p=0.52 ) and 5 mm corneal areas ( 3.360.72 vs. 3.310.70 , respectively ; p=0.73 ) .
one eye had mild , nonvisually significant haze that had fully resolved by the last post - ufcxl visit , and one eye had epithelial ingrowth requiring removal , which obtained 100% efficacy and safety after healing .
there was no significant difference ( p=0.44 ) in accuracy pre- to post - ufcxl , with r values of 0.99 vs. 0.96 , respectively ( figure 1a ) .
a total of 50% , 88% and 88% of ple eyes were respectively within 0.25 d , 0.50 d , and 1.00 d of intended correction pre - ufcxl ( figure 1b ) , compared with 38% , 50% , and 75% post - ufcxl ( p=0.70 ) .
moreover , 25% , 50% , and 63% of eyes were within 0.25 d , 0.50 d , and 1.00 d of intended plano cylinder pre - ufcxl ( figure 2 ) , compared to 13% , 25% , and 63% post - ufcxl ( p=0.69 ) , respectively .
at the time of diagnosis , early ple resulted in a decreased lasik efficacy index of 0.790.25 pre - ufcxl , which was unchanged post - ufcxl ( 0.830.31 , p=0.76 ) .
there was a nonsignificant ( p=0.68 ) increase in the percentage of eyes achieving cumulative snellen udva of 20/20 and 20/30 in post - ufcxl ( 25% and 88% , respectively ) vs. pre - ufcxl ( 13% and 63% , respectively ) compared with pre - lasik cdva ( 50% and 100% , respectively ; figure 3a ) .
this was apparent when comparing the difference in snellen lines of pre - lasik cdva to pre - ufcxl udva ( 25% with three or more lines worse and 0% with one or more lines better ) and pre - lasik cdva to post - ufcxl udva ( 12.5% with three or more lines worse and 25% with three or more lines better , figure 3b ) .
cylinder vector analysis revealed a nonsignificant trend toward overcorrection post - ufcxl compared with pre - ufcxl ( figure 4a , correction index : 1.100.67 vs. 0.830.33 , respectively ; p=0.44 ) and an increased index of success ( ios ) post - ufcxl compared with pre - ufcxl ( ios : 0.861.12 vs. 0.580.52 , respectively ; p=0.45 ) . for both pre- and post - ufcxl compared with pre - lasik ,
the overall angle of error was within 25 and + 25 in the majority of eyes ( 75% and 75% , respectively ; figure 4b ) .
there was a slight nonsignificant ( p=0.26 ) increase in cylinder magnitude 6 months post - ufcxl ( 1.090.76 d ) , compared with pre - ufcxl ( 0.780.49 d ) .
the safety index was unchanged pre- to post - ufcxl ( 1.030.09 vs. 1.040.15 , p=0.89 ) .
five eyes had the same snellen cdva post - ufcxl ( figure 5a ) , whereas one eye lost one line and two eyes gained one line .
the cumulative snellen cdva was unchanged ( p=0.93 ) between pre - lasik , pre - ufcxl , and post - ufcxl ( figure 5b ) .
mrse was stable post - ufcxl at all time points examined ( p=0.44 at 6 months , figure 6a ) , as was cylinder ( p=0.26 , not shown ) .
corneal topography showed no evidence of ectasia progression over the follow - up time period .
kmax was stable across all time points ( p=0.94 at 6 months , figure 6b ) .
furthermore , there was no significant difference pre- to post - ufcxl in the orbscan iiz corneal irregularity indices within both the central 3 mm ( 3.210.87 vs. 3.191.04 , respectively ; p=0.52 ) and 5 mm corneal areas ( 3.360.72 vs. 3.310.70 , respectively ; p=0.73 ) .
one eye had mild , nonvisually significant haze that had fully resolved by the last post - ufcxl visit , and one eye had epithelial ingrowth requiring removal , which obtained 100% efficacy and safety after healing .
cxl performed under a lasik flap ( sometimes referred to as intrastromal cxl and trade named lasik xtra by avedro , waltham , ma , usa ) has been used as an adjunct with lasik surgery .
its purpose has been prophylaxis against refractive regression in high myopia or hyperopia and to prevent ectasia in higher risk cases.1315,1722 the literature already documents that such ufcxl is safe1315,1722 with no vision loss or endothelial cell loss . to the best of our knowledge though
, ufcxl has never been described as a way to prevent further progression of an early ectatic process in ple diagnosed patients .
the reported incidence of ple is low , varying between 0.04% and 0.6% depending on the population being studied.2,3 given the large number of lasik procedures performed each year , even a low incidence of ple is significant and warrants efforts to reduce its occurrence and also to improve on current available treatments . in the current study , using ufcxl we present a novel , less invasive technique than traditional epi - off cxl to treat ple at an early clinical stage , before significant loss of cdva .
we treated seven patients ( eight eyes ) , with cxl under the lasik flap ( ufcxl ) , who developed clear signs of early ple .
we used the same parameters ( riboflavin concentration and uv light dose ) as previously described accelerated protocols for adjunct lasik cxl .
this technique leaves an intact epithelium and therefore has the potential to minimize known complications of corneal surgery and those of epi - off cxl , such as delayed epithelial healing and slow recovery , keratitis , dry eye , haze , loss of visual acuity , induced refractive error , and more.2327 none of the eyes presented here experienced any of these complications , including any significant haze .
it is a potential complication of flap re - lifting , and needs to be monitored and dealt with as with all lasik flap relifts . to our knowledge ,
the only report similar to this technique for early ple is the case of a 28-year - old female who presented 4 months post - lasik with unilateral inferior corneal steepening and decreased visual acuity.28 the one eye was treated with what was termed intrastromal cxl , and ended up asymptomatic with 20/20 acuity and no sign of disease progression on corneal topography after 1 year.28 in contrast to our study , the flap was only opened , and riboflavin was injected between the flap and the stroma bed .
the flap was , therefore , also soaked in riboflavin and was cross - linked . in our case series , the flap was fully retracted , and riboflavin was administered only to the stromal bed , and after removal of any excess solution , the flap was repositioned .
uv light was then administered to the surface of the cornea , thereby cross - linking the riboflavin - soaked stromal bed under the flap .
this ufcxl technique allows strengthening and stiffening of the underlying cornea rather than the flap , which in lasik surgery provides little biomechanical strength to the cornea.29 our inclusion criteria were topographic and refractive signs consistent with early ple . in this way
, any ectatic progression could be halted at a point where visual acuity was not yet significantly compromised , and good vision could be preserved after treatment .
our preliminary results demonstrate the maintenance of visual accuracy , efficacy , and safety at 6 months post - ufcxl , with quicker recovery times than traditional epi - off cxl .
stability was also maintained at 6 months , with no evidence of progressive ectasia based on refraction , vision , kmax , topographic cylinder , and corneal irregularity indices .
post - lasik patients are often not followed up routinely with regularly scheduled postoperative topographies . if they develop ectasia , they present with moderate to advanced disease once they complain of poor vision and seek an enhancement .
as well , the few ple patients who do present early , with only topographic signs of ectasia yet minimal refractive changes and good udva and cdva , are often not immediately treated .
both surgeons and patients are reluctant to treat ( or be treated ) with standard epi - off cxl at these earliest ple stages due to the risk of cxl complications , the potential for the procedure itself to worsen vision , the long recovery period , and the surgeon s reflex to document progression as with keratoconus , before embarking on a relatively invasive intervention.2327 as a result , ple patients tend to be treated months to years after early ple signs , with their cdva already compromised.7,30,31 while it is indeed difficult to determine which new cases of early ple will be progressive and to what extent , and without a control group in this study , we can not be definitive that it is the intervention that halted progression , we do know that a large number of ple cases lead to significant visual loss with difficult rehabilitation affecting quality of life .
we also know that a high percentage of kc patients progress . having a lasik flap that destabilizes a cornea may cause a greater percentage of ple patients to progress . a treatment that poses little risk to safety or visual downside allows immediate intervention once a diagnosis of ple is made , in order to preserve vision before significant loss of cdva occurs and before significant irregular astigmatism contributes to complicated visual rehabilitation . with regular monitoring , if progression were detected , ufcxl could be repeated or epi - off cxl initiated at that time . although the current follow - up was only 6 months ( with one eye followed for 18 months ) , if stability maintains long term as with epi - off cxl treatment , then treating early ple eyes with ufcxl would outweigh the risks of disease progression followed by treating with the epi - off technique .
it would also change the standard of care for post - lasik surgery , requiring consistent long - term follow - up with regularly scheduled topographies , looking for early signs of ectasia that could benefit from early ufcxl in order to preserve vision .
while this preliminary experimental case series provides first data and guidelines for this novel ple treatment strategy , it has limitations . our small sample of patients ( eight eyes ) reflects the low incidence of ple and potentially limits our statistical power .
the latter might have prevented us from detecting subtle trends in the data , such as the slight increase in post - ufcxl cylinder documented herein .
in addition , we did not perform optical coherence tomography imaging to assess the depth of the cxl demarcation line , thought to indicate the extent of cxl effect .
notwithstanding , we used the same protocols as with adjunct lasik cxl which showed good effect.1317 even smaller total irradiation doses demonstrated sufficient uv light absorption with post - treatment demarcation lines as deep as 280 m . considering that the clinical scenario in this study is ple with only under - flap tissue being cross linked , higher total doses may be required .
the amount of total energy delivered to the stromal bed and the actual amount of cross - linked tissue necessary to halt progression in early ple needs to be elucidated with further studies , and reliable in vivo biomechanical measurements would prove useful . while in vivo confocal microscopy revealed no endothelial cell loss 12 months after adjunct cxl with lasik,13 endothelial cell count was not performed herein and should therefore be investigated in future ufcxl studies .
our preliminary 6-month results are promising , demonstrating maintenance of visual accuracy , efficacy , and safety , with no evidence of progressive corneal ectasia based on vision , refraction , kmax , topographic cylinder , and corneal irregularity indices .
while our study is limited to a small sample of eyes , reflecting the low - incidence of ple , it suggests that ufcxl has the potential to be a safe and effective method of preserving visual function by halting ple progression early , prior to its detrimental effects .
control studies with more patients and longer follow - up times are required to further validate these findings .
Output:
| purposecollagen cross - linking ( cxl ) for post - laser - assisted in situ keratomileusis ( lasik ) ectasia ( ple ) is traditionally performed either epi - on or epi - off on the corneal surface .
this study describes a novel technique in treating early ple with under - flap cxl ( ufcxl ) to the stromal bed and reports on 6-month outcomes.patients and methodscase series of seven patients ( eight eyes ) with topography - diagnosed early ple treated with ufcxl .
inclusion criteria were early , mild ple defined as new - onset postoperative manifest refraction cylinder 1.50 d , with new topographic inferior steepening consistent with ectasia , uncorrected distance visual acuity ( udva ) of 20/40 or better , and corrected distance visual acuity ( cdva ) of 20/25 or better .
existing lasik flap was lifted , riboflavin was applied directly to the stromal bed , flap was repositioned , and 18 mw / cm2 ultraviolet light was applied for 3 minutes to the corneal surface .
post - ufcxl manifest refraction , udva and cdva , corneal cylinder , kmax , and corneal irregularity index were compared with pre - ufcxl measurements.resultspatients had a pre - ufcxl sphere of 0.090.48 d and cylinder of 0.780.49 d. at 6 months , post - ufcxl sphere ( 0.060.8 d ; p=0.89 ) and cylinder ( 1.090.76 d , p=0.26 ) were unchanged .
cumulative post - ufcxl udva was unchanged , achieving 20/20 , 20/30 , and 20/40 in 25% , 88% , and 88% , respectively , compared with 13% , 63% , and 88% pre - ufcxl ( p=0.68 ) .
post - ufcxl cdva was unchanged ( p=0.93 ) with a gain of one line in two eyes , a loss of one line in one eye , and five eyes unchanged .
the efficacy index ( p=0.76 ) , safety index ( p=0.89 ) , kmax ( p=0.94 ) , and corneal irregularity index ( p=0.73 ) were also unchanged.conclusionpreliminary results with ufcxl for early ple are promising , demonstrating maintenance of visual accuracy , efficacy , safety , kmax , and cylinder , with much quicker recovery times than surface cxl . |
PubmedSumm119609 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: point - of - care ( poc ) is , essentially , the delivery of care wherever the patient may be and a point - of - care technology is defined as a technology that is used for bringing care to the patient rather than taking the patient to care . realizing the full potential of point - of - care technologies ( poct ) represents a critical factor in advancing overall health care by making the predictive , preemptive , preventive , and personalized care of the future accessible to all communities . to advance point - of - care , in 2006
the national institute of biomedical imaging and bioengineering ( nibib ) proposed a nationwide initiative to create a research network that would build multidisciplinary partnerships and expertise in the development of integrated systems that address unmet clinical needs at the point - of - care called the point - of - care technologies research network ( poctrn ) .
an april , 2006 workshop improving health care accessibility through point - of - care technologies sponsored by the nibib ; national heart , lung , and blood institute ( nhlbi ) ; and the national science foundation ( nsf ) assessed the clinical needs and opportunities for use of poct in primary care , the home , emergency medical services , and in developing countries , and highlighted the state - of - science in sensors and microsystems , low - cost imaging , non - invasive monitoring , and telehealth / informatics .
the creation of multidisciplinary partnerships was considered a key translational aspect for moving technologies from an early stage of development into clinical testing . since 2006
, the goal of the poctrn has been to develop technologies with clinical applications using a network model that enhances complementary strengths and builds multidisciplinary partnerships . to achieve this , each poctrn center funded by nibib performs or facilitates four core functions :
collaborates with physical , biochemical , and computational scientists , and with engineers on exploratory technology development projects.completes clinical needs assessments in areas anticipated to advance the field of point - of - care testing and disseminates this information to the technology development community.provides training to technology developers on clinical issues related to the development of point - of - care devices.provides an adequate administrative structure to ensure that each large complex center achieves its goals .
collaborates with physical , biochemical , and computational scientists , and with engineers on exploratory technology development projects . completes clinical needs assessments in areas anticipated to advance the field of point - of - care testing and disseminates this information to the technology development community .
provides training to technology developers on clinical issues related to the development of point - of - care devices . provides an adequate administrative structure to ensure that each large complex center achieves its goals .
the network also aims to drive the development of poct through collaborations that simultaneously merge scientific and technological capabilities with clinical need .
these collaborative efforts include :
utilizing clinical needs to direct technology development.leveraging expertise across centers to address a range of clinical needs and provide a systems focus.establishing partnerships to create a pipeline from clinical need to field testing of prototype devices.expanding the network to provide resources to the broader clinical and technology development communities . utilizing clinical needs to direct technology development .
leveraging expertise across centers to address a range of clinical needs and provide a systems focus . establishing partnerships to create a pipeline from clinical need to field testing of prototype devices . expanding the network to provide resources to the broader clinical and technology development communities .
an additional objective is to conduct parallel educational activities that advance evidence - based point - of - care practice in critical care , primary outreach and in low - resource environments , including global health care settings .
the network measures its success through the variety of center activities :
coordination of cross - center communication and collaboration to achieve network objectives.evaluation and guidance regarding funding of new technology development projects.informing members of individual center activities to leverage resources , expertise , and interests across the network.implementing mechanisms for center - to - center interactions.development of policies and procedures to be shared across centers.identification of common clinical needs.expertise to develop prototype
systems.establishment of clinical and industrial partnerships.coordination of education and training programs and other shared practices.community outreach.communication of the network s role in advancing point - of - care testing.dissemination of clinical needs information to the technology development community.increased awareness of poct.outcome studies and parallel funding .
evaluation and guidance regarding funding of new technology development projects . informing members of individual center activities to leverage resources , expertise , and interests across the network . implementing mechanisms for center - to - center interactions .
outcome studies and parallel funding . each awarded center serves to identify clinical needs in point - of - care testing and
communicate those needs to guide device design and appropriate clinical testing early in the development process .
centers also provide resources to both technology development and clinical communities and coordinate activities across their respective areas in the network .
solicitation to support specialized centers through a cooperative agreement ( u54 mechanism ) that covers a spectrum of multidisciplinary and translational research and development activities .
the initial funded centers focused their activities on emerging neurotechnologies , disaster readiness , and advancing point - of - care diagnostics for global health .
the point of care technology research center in primary care , managed by cimit ( consortium for improving medicine with innovation and technology ) , is a center - without - walls for the rapid transformation of emerging poct into commercially viable , clinically focused solutions for improving primary health care .
cimit was founded in 1998 and harnesses the power of multidisciplinary and multi - institutional collaboration to speed the translation of high - impact research into clinical practice and broader dissemination by commercially licensable opportunities .
the specific aims of the point of care technology research center in primary care are to :
apply cimit s innovation model to create clinically - driven point - of - care solutions that address critical areas of unmet need in primary health care.identify and assess unmet primary care needs and develop performance criteria where point - of - care technology solutions would have the highest impact.select and develop the most promising poct into proof - of - concept prototypes.test and evaluate prototype performance in simulated clinical environments and clinical living laboratories relative to clinical performance and implementation criteria.transition prototypes that meet performance specifications into commercially licensable or start - up company opportunities or work with companies to adapt their technologies for use in primary care.train and educate relevant stakeholders including clinicians , engineers , scientists , students and industry partners in the innovation process as it applies to meeting health care needs.disseminate
lessons learned and best practices in innovation methodology and process both nationally and internationally in collaboration with other poctrn centers .
apply cimit s innovation model to create clinically - driven point - of - care solutions that address critical areas of unmet need in primary health care .
identify and assess unmet primary care needs and develop performance criteria where point - of - care technology solutions would have the highest impact . select and develop the most promising poct into proof - of - concept prototypes .
test and evaluate prototype performance in simulated clinical environments and clinical living laboratories relative to clinical performance and implementation criteria .
transition prototypes that meet performance specifications into commercially licensable or start - up company opportunities or work with companies to adapt their technologies for use in primary care .
train and educate relevant stakeholders including clinicians , engineers , scientists , students and industry partners in the innovation process as it applies to meeting health care needs . disseminate
lessons learned and best practices in innovation methodology and process both nationally and internationally in collaboration with other poctrn centers .
primary care providers are at the frontlines of our health care system and serve as the first point of contact for care and as the referral pathway for specialty care . at the same time that the demand for care is increasing with an aging population and an increased burden of chronic disease , the pool of primary care providers is shrinking .
this imbalance in supply and demand constrains primary care capacity , limiting access and fragmenting care as patients and families seek out other points of entry , often more expensive and less interconnected , into the health care system .
the introduction of poct into primary care would increase the capacity of practices to care for more patients by eliminating inefficient testing turnaround delays and the need for post - visit communication of results and recommendations to patients , freeing up clinical time .
it is estimated that 55% of a typical primary care physician s day is spent outside of the examination room , primarily focused on follow - up and documentation of care for patients not physically present .
this administrative rework is not only time - consuming , but discontinuous care jeopardizes patient outcomes in that the start of effective therapy may be delayed or , even worse , abnormal results may not be communicated back to the primary care physician from the laboratory or to the patient by the physician , resulting in a serious failure to diagnose because of lack of follow - up .
for example , cimit has optimized its approach for maximizing potential clinical impact of innovations as a three - stage find , fund , and facilitate
process that supports development of a pipeline of ideas from early stage proof - of - concept to clinical implementation and commercialization . to support project teams in navigating the healthcare innovation cycle ( fig .
1 ) , the center uses a variety of integrated methods and processes that are referred to collectively as the cimit model of innovation .
finding significant unmet medical needs and identifying potential clinical collaborators is a critical ingredient in the innovation process and the starting point for the innovation journey .
the center supports a needs assessment core managed by the massachusetts general hospital ( mgh ) john d. stoeckle center for primary care innovation .
clinical involvement at all stages of the innovation process is key and so clinical collaborators must be an integral part of all projects funded by the center .
funding is awarded on a competitive , peer - review basis once the need has been established .
advancing to the next stage of the cycle , teams design potential solutions based on evaluating a range of technologies or by creating new ones ; robust prototypes can then be developed and tested ; and evidence is gathered to achieve regulatory approval . finally , to ensure success , the solution must be broadly disseminated so that it can become a new standard of care .
the poctrc funds projects in three stages : 1 ) innovation stage ( often called pilot , proof - of concept , or proof - of - principle ) , 2 ) acceleration stage ( proof - of - value , often called validation ) , and 3 ) a clinical adoption / diffusion stage . the center circulates a call - for - proposals for innovation awards on an annual basis and typically funds 4 - 6 proposals .
innovation awards are translational in nature and typically one year in duration , with budgets up to $ 100,000 ( direct costs ) with the objective of scientifically de - risking a novel idea by showing early - stage proof of concept , thereby justifying proceeding on to the proof - of - value stage to generate a viable candidate for further pre - commercial development . to date
, the center has funded 27 innovation awards at different levels of maturity across the development pipeline .
seven of these teams are developing multiplexed platform technologies for clinical laboratory testing from small blood samples with results delivered within 15 minutes at the time of the primary care visit .
projects with the potential for rapid transition to clinical implementation and hand - off to industry within 12 - 18 months are candidates for cimit s accelerator program and/or the program s healthcare communication course ( both are described below ) . in addition to funding projects that are pre - commercial , the center also offers a clinical adoption and diffusion award to assist primary care practices in adopting and adapting commercially available poct to demonstrate value and speed adoption in the primary care setting . four accelerator awards and two clinical adoption and diffusion awards
the percentage of awards to small companies has increased to represent approximately 80% of the award base consistent with the center s mission to rapidly advance innovations to impact patient care through commercialization .
facilitating the journey through the healthcare innovation cycle is never smooth ; many challenges are encountered at every point along the cycle .
the center has assembled a team of experts in primary care and laboratory medicine complementing the strong cimit network of seasoned experts in translational research to address these challenges .
late stage projects that are scientifically and technically de - risked and have well - understood market channels , but require further development and investment of money and/or business development expertise to attract interest from an entrepreneur or commercial entity to achieve initial market penetration , may be candidates for facilitation by mentors from the center s accelerator program , serial entrepreneurs who are former founders or ceos of medtech companies and who have an intimate understanding of the medical device and diagnostic markets .
these seasoned executives join projects essentially full - time to drive them to commercial success by working with project teams to develop and execute a complete plan that includes a go - to - market strategy as well as market , competitive , financial and intellectual property analysis .
funded teams may also participate in a 10-week healthcare commercialization craash ( commercialization results accelerator to advance solutions in healthcare ) course , taught by industry veterans and based on decades of experience from the coulter foundation , massachusetts institute of technology ( mit ) , yale , and cimit .
the program formalizes development of a tested business model through the process of validating business hypotheses .
teams receive 1:1 mentoring from successful healthcare entrepreneurs and group coaching from commercialization experts and investors .
other core resources include cimit s virtual collaboration platform ( colab ) , a systems engineering core , a clinical validation core , an education core and a medical device interoperability program .
cimit colab the virtual collaboration platform is a synthesis of best - in - class , secure , cloud - based tools with functionality designed to allow users to manage the activities of the center , and to support teams through the healthcare innovation cycle .
colab was used by the poctrn to develop a web portal for easy access to information common to all centers , including events , solicitations , clinical needs assessment , and prior awards .
the systems engineering core was developed based upon the recognition that new poct do not exist in isolation ; rather , they exist within ecosystems of other technologies and systems , and these systems influence their likelihood of success or failure and their effectiveness .
nibib and center leadership convened a workshop in 2013 to explore the future of point of care testing and technologies .
the clinical validation core provides a range of services , including clinical samples for testing , bench validation in a laboratory setting , and clinical trials in the mgh ambulatory practice of the future ( apf ) , as well as other primary care settings . as an example , the apf in collaboration with the mgh clinical laboratories published the results of a pilot study of implementation of a point - of - care testing satellite laboratory in a primary care practice .
findings demonstrated high patient / provider satisfaction , increased efficiency , and financial viability of the model , .
plug - and - play ( md pnp ) program , led by dr .
julian goldman , is an important resource for the center relative to the definition of device requirements and performance standards .
the program was established to lead the development and adoption of open standards and related technologies to facilitate widespread clinical use of medical device data and network - based medical device integration .
the center for future technologies in cancer care ( cftcc ) is located at boston university ( bu ) .
the cftcc comprises several cores that work together to identify clinical needs , assess new technologies , build prototypes and educate stakeholders .
the center focuses on a range of technologies for deployment along the continuum of care to improve early detection , enhance the lives of patients in care , monitor survivors , and support caretakers .
the specific aims of the cftcc are to :
enable and foster clinician / engineer partnerships.perform clinical needs assessments and impact analysis.fabricate alpha prototypes in the alpha prototyping core facility for center stakeholders.make fully functional prototypes for clinical testing in conjunction with the fraunhofer center for manufacturing innovation s ( fcmi ) beta prototyping facilities.provide training and networking opportunities for center stakeholders.promote poct for cancer nationally and internationally .
make fully functional prototypes for clinical testing in conjunction with the fraunhofer center for manufacturing innovation s ( fcmi ) beta prototyping facilities .
we have built an integrated multidisciplinary team consisting of engineers , clinicians , public health practitioners , and technology transfer experts .
this team evaluates technologies in various stages of development for their suitability across a range of primary care and non - traditional healthcare settings .
development , commercialization , and deployment of poc treatments for cancer has the potential to reduce healthcare costs by catching more cancers at earlier stages of progression , enabling treatment outside of specialized cancer centers , and monitoring at - risk patients remotely through mobile health strategies .
moving cancer treatments out of specialized centers and into local clinics or home care could significantly lower healthcare costs in many settings .
often patients have to travel long distances to receive treatments at cancer centers , or make repeated trips for monitoring over many months . in low - resource settings in the developing world
surgical treatments carry infection risks , and in many places there are not enough surgeons to treat all of the patients in need
. technologies like targeted ultrasound and light - based treatments could allow providers with less specialized training to treat more patients for less money .
tools for monitoring chemotherapy patients at home between treatments could eliminate travel and office visits .
mobile health strategies for collecting data about high - risk populations could lead to new interventions to directly impact cancer screening rates .
the center focuses on the identification , prototyping , and early clinical assessment of innovative poct for the treatment , screening , diagnosis , and monitoring of a range of cancers .
a major aspect of this effort involves assessing early stage technologies in terms of clinical needs , market demands , setting appropriateness , and commercialization strategies ( fig .
the center comprises an administrative core , a clinical needs assessment and impact analysis core , a training core , and a prototype development and testing core divided into two parts , the alpha and beta cores , which are both available to center stakeholders , depending on the stage of technology development .
the team evaluates technologies in various stages of development for their suitability across a range of primary care and non - traditional healthcare settings .
an important part of the poct design process is to move ideas from the lab bench into user - friendly formats . while presentations and drawings can be useful tools in communicating ideas , having a prototype device that a potential end user , manufacturer , or investor can hold in their hands is much more valuable .
the alpha prototype in the design phase is a critical time to work out potential bugs or incompatibilities in the system before large scale investments are made in beta prototypes .
the cftcc alpha core prototyping lab on the bu campus enables researchers ( from industry , academia , and medicine ) from all across the country to build rapid prototypes of their devices . the alpha core houses basic equipment for the prototyping of microfluidic and paperfluidic devices .
parts can be prototyped using standard photolithography and pdms processing with the assistance of core staff .
core staff will also make and ship small ( less than 10 ) batches of parts to investigators working on translating benchtop assays into microscale platforms .
the core can laser cut , hot emboss , and heat seal thermoplastic devices with microscale features .
other prototyping capabilities include xurography ( cutter - plotter ) , wax printing , and reagent spotting on plastic and paper devices .
finally , the core staff can work with developers of mobile applications to design user interfaces .
the beta prototyping core is housed at the fraunhofer center for manufacturing innovation in brookline , ma , which is co - located with the bu campus .
the beta core is tasked with fabricating prototypes that can be used in pre - clinical and feasibility testing .
the design of these work - like prototypes is often iterative and involves clinical and engineering collaborators .
the fcmi team has expertise in optical device design ( endoscopic tools ) , microfluidic chip fabrication , assay development , and instrumentation .
investigators with funded cftcc prototype projects are screened for fit with the beta core capabilities .
often projects transition from the lab to the beta core after a year of center funding .
the training core leads the cftcc efforts in outreach to the wider community of technology developers , researchers , clinicians , and patients and their advocates .
programs include seminars , workshops , and trainings aimed at promoting poct and transfer of those technologies out of the lab . educating test and device developers about regulatory requirements , reimbursements , planning for human subjects research , and managing intellectual property concerns are missions of the core .
all training activities are live streamed and archived . the clinical needs assessment ( cna ) core works in conjunction with the dana farber cancer institute to carry out and disseminate survey research aimed at determining where and when poct could make the most impact in patient care . over the last four years
, the cftcc has funded 17 prototyping projects , three fellowships , and several small exploratory projects in our alpha prototyping core .
the vast majority of these projects have secured follow on funding from federal and private sources .
the reach of the center is national with projects at bu , the university of california davis , the university of california berkeley , massachusetts general hospital ( mgh ) , the university of texas austin , michigan state university , the university of arizona , and the massachusetts institute of technology ( mit ) .
the cftcc conducts an open call for new projects in the fall of each year to fund 3 - 7 prototyping projects .
after one year , if projects have met their proposed milestones , they are encouraged to apply for follow - on funding for specific translational activities .
projects may also be referred to the beta core and receive in - kind services from that core to develop or enhance a prototype device .
these projects include several point - of - care tests for the early detection of cancer or monitoring of disease , mobile health applications to coordinate care and patient outreach , , and devices and tools to enable minimally invasive testing at lower level care facilities including in primary care .
the beta prototyping core has completed prototypes for researchers at the university of arizona , mit , bu , and for industry .
prototypes include a wearable device for breast cancer chemotherapy monitoring , microfluidic sample preparation modules , and an instrument to fabricate hydrogel reagents for high - throughput point - of - care screening tests . a specific focus of the center is on identifying clinical needs in high disease burden populations and funding new technologies that address those needs .
the cna core published a survey study conducted to determine the preferences for poct in cancer screening among primary care clinicians .
the cna also worked with an international group of scientists and clinicians working on point - of - care devices to identify barriers to translation in low resource settings and , in particular , west africa .
the training core has posted the assembled multimedia resources from all major outreach projects conducted during the past 4 years .
the cftcc website serves as a valuable resource for new funding opportunities for cancer researchers interested in poct , and for test and device developers interested in applications in cancer care .
we have hosted and co - hosted a semi - annual course called cancer care for engineers and scientists and workshops focusing on regulatory issues in addition to day - long science symposia . in 2016 ,
the course new directions in cancer care for nonspecialists : immunotherapy and resistance to therapy was well attended both in person and virtually .
this workshop was a full - day meeting for clinicians , engineers , and scientists to come together and learn about a very exciting new topic in cancer care .
the alpha prototyping core hosts annual hack - a - thon events each october at the bu engineering product innovation center ( epic ) .
in addition to the competition , this event continues to raise awareness of the center and its resources in the field of cancer care technologies .
the alpha prototyping core also participated in the camtech : global cancer innovation hack - a - thon in the spring of 2016 , and winners of this event were awarded alpha core time to generate their first prototype units for testing .
several of the hackathon participants are also working with the clinical needs assessment core to identify market opportunities for their new technologies .
there are over 110 million prevalent stds / year and 19.7 million incident stds in the u.s./year , with new estimates of health care costs at $ 15.6 billion .
costs for chlamydial infections are estimated at $ 516.7 million ; gonorrhea , $ 162.1 million ; hepatitis , $ 50.7 million ; hiv , $ 12.6 billion ; human papillomavirus , $ 1.7 billion , herpes simplex virus ( hsv-2 ) , $ 540 million ; syphilis , $ 39.3 million ; and trichomonas infections , $ 24.0 million .
have great potential to significantly play a role in addressing the epidemics of stds in resource constrained and poor countries .
stigma , privacy and confidentiality issues unique to std on top of issues of health inequity and health disparities in populations make stds optimal for poct , as well as home care tests or over - the - counter tests ( otc ) .
our mission is to drive the development of appropriate poct through collaborations that merge scientific and technological capabilities with clinical need .
the long - term goals of our center are to address the epidemics of sexually transmitted diseases ( stds ) in the u.s . and in resource - poor settings by development and better use of poct ,
the center is organized in the following manner :
1.an administrative structure to ensure that the large , complex center achieves its goals in a timely manner . to ensure each functioning component works smoothly together and
integrates with other centers in the nibib poctrn , our administrative component functions to accelerate a smooth transition along a pipeline from developmental prototype assays through in - house and pilot testing . in this coordinated manner
, we can assist with the logical development of point - of - care assays that are proven to have sufficient scientific merit and can progress towards eventual clinical trials and fda submission.2.a clinical needs assessments and health impact assessments component for clinicians , end - users , and other appropriate stakeholders , in order to advance and inform the field of point - of - care testing design , development , and utilization by disseminating this information to the technology development community , .3.a collaboration component staffed with physical scientists , biochemical scientists , computational scientists , and systems engineers providing support for exploratory technology for prototype development projects and industry for testing of more mature poct in beta and pilot evaluations to insure a logical progression of assays along a pipeline from the concept stage to the clinical testing stage ( fig .
4).4.a clinical evaluation component for very mature point - of - care assays by providing real world testing in clinics worldwide inclusive of resource - poor countries . in this way , we both enhance use of poct in these settings such as emergency departments , home testing , as well as advance end - user familiarity , clinical acceptance , and ultimately the use of such tests , resulting in measureable improved health outcomes especially for those settings experiencing health disparities and inequities.5.a developer training component to provide training across all career levels about clinical and process issues as well as needs related to the development of point - of - care devices in an iterative fashion , as well as to provide training for scientists in resource - poor settings and education of relevant stakeholders on the development and potential impact of poct.6.a subject matter expertise review component emphasizing clinical drivers of technology progression for introducing new or expanding existing point - of - care std technologies , through design assistance ( study , instrument , assay ) and operational feedback iterated to permit spiral development and allow for project off ramps in a go no - go manner , such that we insure that deliverables for each project are met .
center resources include :
1.diagnostic expertise and advice for developers of poct for stds , including guidance and the ability to provide clinical de - identified specimens in limited numbers to new developers.2.the ability to advertise solicitations for funding opportunities in the form of small grants for the development of poct for stds.3.conducting and providing needs assessments with clinicians and patients and follow - up training for industry for the sage development of poct for stds that can be accurate , timely , and simple.4.a laboratory facility to beta test point - of - care assays , using our archived de - identified clinical samples.5.the capacity to assist clinical sites in the collection and testing of preclinical trial assays in an early stage of maturity to guide their further refinement.6.access to testing sites in places outside the clinic , such as the internet , the emergency department , and foreign countries .
figure 4.center pipeline . an administrative structure to ensure that the large , complex center achieves its goals in a timely manner . to ensure each functioning component works smoothly together and
integrates with other centers in the nibib poctrn , our administrative component functions to accelerate a smooth transition along a pipeline from developmental prototype assays through in - house and pilot testing . in this coordinated manner
, we can assist with the logical development of point - of - care assays that are proven to have sufficient scientific merit and can progress towards eventual clinical trials and fda submission .
a clinical needs assessments and health impact assessments component for clinicians , end - users , and other appropriate stakeholders , in order to advance and inform the field of point - of - care testing design , development , and utilization by disseminating this information to the technology development community , .
a collaboration component staffed with physical scientists , biochemical scientists , computational scientists , and systems engineers providing support for exploratory technology for prototype development projects and industry for testing of more mature poct in beta and pilot evaluations to insure a logical progression of assays along a pipeline from the concept stage to the clinical testing stage ( fig .
4 ) . a clinical evaluation component for very mature point - of - care assays by providing real world testing in clinics worldwide inclusive of resource - poor countries . in this way , we both enhance use of poct in these settings such as emergency departments , home testing , as well as advance end - user familiarity , clinical acceptance , and ultimately the use of such tests , resulting in measureable improved health outcomes especially for those settings experiencing health disparities and inequities . a developer training component to provide training across all career levels about clinical and process issues as well as
needs related to the development of point - of - care devices in an iterative fashion , as well as to provide training for scientists in resource - poor settings and education of relevant stakeholders on the development and potential impact of poct . a subject matter expertise review component emphasizing clinical drivers of technology progression for introducing new or expanding existing point - of - care std technologies , through design assistance ( study , instrument , assay ) and operational feedback iterated to permit spiral development and allow for project off ramps in a go no - go manner , such that we insure that deliverables for each project
diagnostic expertise and advice for developers of poct for stds , including guidance and the ability to provide clinical de - identified specimens in limited numbers to new developers .
the ability to advertise solicitations for funding opportunities in the form of small grants for the development of poct for stds . conducting and providing needs assessments with clinicians and patients and follow - up training for industry for the sage development of poct for stds that can be accurate , timely , and simple .
a laboratory facility to beta test point - of - care assays , using our archived de - identified clinical samples .
the capacity to assist clinical sites in the collection and testing of preclinical trial assays in an early stage of maturity to guide their further refinement .
access to testing sites in places outside the clinic , such as the internet , the emergency department , and foreign countries .
1.emergency department- we have conducted studies in busy high - volume emergency department ( ed ) settings to evaluate performance and feasibility of integrating fda - approved poct for stds into clinical practice , with a focus on patient self - testing and use of tablet - based kiosks . we developed and optimized a kiosk - based platform for obtaining consent for hiv testing in the ed , and integrated that method into practice .
we evaluated an fda - cleared point - of - care test for trichomonas vaginalis ( tv ) , demonstrating high level of patient and provider acceptability of self - testing with tablet - guided facilitation , and showed excellent performance of the assay and high level of patient and provider concordance ( 98% ) , wherein the patient self - collected the vaginal sample , processed the sample following kiosk directions , and interpreted their own results.2.needs assessments component- although development of poct has been evolving for decades , the belief of if you build it , they will use it has been a critical barrier to the commercialization and adoption of these technologies .
we have conducted key informant interviews , focus group sessions among practitioners specializing in std diagnosis and testing , std poct researchers , laboratorians and developers , and patient end - users to determine what an ideal poct would look like with regard to setting , user requirements , device performance ( sensitivity and specificity ) , and device usability in terms of complexity and time requirement . we have extended our needs to adolescent medicine clinicians , ob - gyns , hiv providers , and primary care clinicians practicing in fqhcs who are required by the new affordable care act to provide std screening , diagnosis and treatment services.3.training component- while new technologies have been moving laboratory science into ever more exciting and amazing methods of disease detection , these new technologies still require a high level of laboratory skill and expensive equipment and reagents . our training component is embedded in the std / hiv prevention training center at johns hopkins university ( jhu ) .
the training center has endeavored to educate std point - of - care technology stakeholders about issues associated with developing diagnostics that will be practical , affordable , cost - effective , and still profitable to the developers .4.development of poct within the center
a.at the baltimore campus of the university of maryland , the center project with professor
chris d. geddes is developing low cost , ultra rapid , sensitive assays for chlamydia trachomatis and neisseria gonorrhoeae , to test them clinically , and then to commercialize the technology using the microwave accelerated metal enhanced technology ( mamef ) .b.at johns hopkins whitaker school of engineering , a team led by professor tza - huei wang and his jhu biomems group is developing a microfluidic device for delivering a low - cost and mobile nucleic acid amplification test ( naat ) for std detection .
dr . dong jin shin and colleagues developed a bioanalytic platform based on the principles of droplet magnetofluidics for the detection of chlamydia trachomatis with performances comparable to standard - of - care naat tests.c.collaboration with the cincinnati children s site provides access to a population of adolescent patients seeking primary , urgent , and emergency care at a large , urban , tertiary care academic medical center .
they have demonstrated the acceptability and effectiveness of self - testing for stds among women using a point - of - care std test ; the benefits of women learning their std results at the time of testing ; and the acceptability of self - collected vaginal swabs from women for stds , which allows women greater access to self - testing . we demonstrated that using privacy shelters , as well as use of a health van is an acceptable setting to men and women to collect genital samples for std testing .
poc testing resulted in improved antibiotic stewardship.5.std testing outside the clinic via internet recruitment
a.we have successfully translated our internet recruitment std screening program called iwtk into public health practice , which allows a participant to collect a sample at home and mail it to the center laboratory for testing with modernization of the site to be hipaa compliant and results accessed through a secure login with password protection so that the participant can obtain his / her results in a secure manner online .b.trichomonas home poc test .
our website developers revised the iwtk site to allow female participants to access a link to the home test research study for trichomonas ( tv ) . a questionnaire assessed acceptability and experience of the process for women participants .
the accuracy of the home test was compared to the gold - standard mail - in molecular test for tv .
one of the key findings was that over 80% of the participants would test themselves at home for tv if the rapid tv test were available over-the-counter.c.hiv home poc test- a new study has begun to increase hiv screening in adolescents , women and men with health inequity , in blacks , and especially in men who have sex with men ( msm ) , by promoting direct outreach to persons through the internet and smart phones by a ) the ability to order a self hiv test for performance at home and b ) providing a coupon on the iwtk website for a free hiv test at participating clinics , based on participant zip code.6.std testing in resource - limited settings- given the significant burden of stds in sub - saharan africa ( ssa ) , we established a site at the infectious diseases institute ( idi ) at makerere university college of health sciences in kampala , uganda .
we have focused our efforts on syphilis detection particularly in pregnant women , who have a prevalence of syphilis from 1 to 8% across ssa .
rapid treponemal lateral flow assays can be used to diagnose patients at the point - of - care .
both the trinity and sd bioline tests met the who standard for accuracy ( > 85% sensitivity ; > 95% specificity ) against the sequential algorithm .
the idi poc std site has also screened more than 15,000 pregnant women as part of a clinical trial to improve syphilis partner notification , testing , and treatment ( nct02262390 ) .
emergency department- we have conducted studies in busy high - volume emergency department ( ed ) settings to evaluate performance and feasibility of integrating fda - approved poct for stds into clinical practice , with a focus on patient self - testing and use of tablet - based kiosks
. we developed and optimized a kiosk - based platform for obtaining consent for hiv testing in the ed , and integrated that method into practice .
we evaluated an fda - cleared point - of - care test for trichomonas vaginalis ( tv ) , demonstrating high level of patient and provider acceptability of self - testing with tablet - guided facilitation , and showed excellent performance of the assay and high level of patient and provider concordance ( 98% ) , wherein the patient self - collected the vaginal sample , processed the sample following kiosk directions , and interpreted their own results .
needs assessments component- although development of poct has been evolving for decades , the belief of if you build it , they will use it has been a critical barrier to the commercialization and adoption of these technologies .
we have conducted key informant interviews , focus group sessions among practitioners specializing in std diagnosis and testing , std poct researchers , laboratorians and developers , and patient end - users to determine what an ideal poct would look like with regard to setting , user requirements , device performance ( sensitivity and specificity ) , and device usability in terms of complexity and time requirement . we have extended our needs to adolescent medicine clinicians , ob - gyns , hiv providers , and primary care clinicians practicing in fqhcs who are required by the new affordable care act to provide std screening , diagnosis and treatment services .
training component- while new technologies have been moving laboratory science into ever more exciting and amazing methods of disease detection , these new technologies still require a high level of laboratory skill and expensive equipment and reagents .
our training component is embedded in the std / hiv prevention training center at johns hopkins university ( jhu ) .
the training center has endeavored to educate std point - of - care technology stakeholders about issues associated with developing diagnostics that will be practical , affordable , cost - effective , and still profitable to the developers .
development of poct within the center
a.at the baltimore campus of the university of maryland , the center project with professor chris d. geddes is developing low cost , ultra rapid , sensitive assays for chlamydia trachomatis and neisseria gonorrhoeae , to test them clinically , and then to commercialize the technology using the microwave accelerated metal enhanced technology ( mamef ) .b.at johns hopkins whitaker school of engineering , a team led by professor tza - huei wang and his jhu biomems group is developing a microfluidic device for delivering a low - cost and mobile nucleic acid amplification test ( naat ) for std detection . dr .
dong jin shin and colleagues developed a bioanalytic platform based on the principles of droplet magnetofluidics for the detection of chlamydia trachomatis with performances comparable to standard - of - care naat tests.c.collaboration with the cincinnati children s site provides access to a population of adolescent patients seeking primary , urgent , and emergency care at a large , urban , tertiary care academic medical center .
they have demonstrated the acceptability and effectiveness of self - testing for stds among women using a point - of - care std test ; the benefits of women learning their std results at the time of testing ; and the acceptability of self - collected vaginal swabs from women for stds , which allows women greater access to self - testing . we demonstrated that using privacy shelters , as well as use of a health van is an acceptable setting to men and women to collect genital samples for std testing .
poc testing resulted in improved antibiotic stewardship . at the baltimore campus of the university of maryland ,
the center project with professor chris d. geddes is developing low cost , ultra rapid , sensitive assays for chlamydia trachomatis and neisseria gonorrhoeae , to test them clinically , and then to commercialize the technology using the microwave accelerated metal enhanced technology ( mamef ) . at johns
hopkins whitaker school of engineering , a team led by professor tza - huei wang and his jhu biomems group is developing a microfluidic device for delivering a low - cost and mobile nucleic acid amplification test ( naat ) for std detection . dr . dong jin shin and colleagues developed a bioanalytic platform based on the principles of droplet magnetofluidics for the detection of chlamydia trachomatis with performances comparable to standard - of - care naat tests .
collaboration with the cincinnati children s site provides access to a population of adolescent patients seeking primary , urgent , and emergency care at a large , urban , tertiary care academic medical center .
they have demonstrated the acceptability and effectiveness of self - testing for stds among women using a point - of - care std test ; the benefits of women learning their std results at the time of testing ; and the acceptability of self - collected vaginal swabs from women for stds , which allows women greater access to self - testing . we demonstrated that using privacy shelters , as well as use of a health van is an acceptable setting to men and women to collect genital samples for std testing .
std testing outside the clinic via internet recruitment
a.we have successfully translated our internet recruitment std screening program called iwtk into public health practice , which allows a participant to collect a sample at home and mail it to the center laboratory for testing with modernization of the site to be hipaa compliant and results accessed through a secure login with password protection so that the participant can obtain his / her results in a secure manner online .b.trichomonas home poc test .
our website developers revised the iwtk site to allow female participants to access a link to the home test research study for trichomonas ( tv ) .
the accuracy of the home test was compared to the gold - standard mail - in molecular test for tv .
one of the key findings was that over 80% of the participants would test themselves at home for tv if the rapid tv test were available over-the-counter.c.hiv home poc test- a new study has begun to increase hiv screening in adolescents , women and men with health inequity , in blacks , and especially in men who have sex with men ( msm ) , by promoting direct outreach to persons through the internet and smart phones by a ) the ability to order a self hiv test for performance at home and b ) providing a coupon on the iwtk website for a free hiv test at participating clinics , based on participant zip code .
we have successfully translated our internet recruitment std screening program called iwtk into public health practice , which allows a participant to collect a sample at home and mail it to the center laboratory for testing with modernization of the site to be hipaa compliant and results accessed through a secure login with password protection so that the participant can obtain his / her results in a secure manner online .
our website developers revised the iwtk site to allow female participants to access a link to the home test research study for trichomonas ( tv ) . a questionnaire assessed acceptability and experience of the process for women participants .
the accuracy of the home test was compared to the gold - standard mail - in molecular test for tv .
one of the key findings was that over 80% of the participants would test themselves at home for tv if the rapid tv test were available over - the - counter .
hiv home poc test- a new study has begun to increase hiv screening in adolescents , women and men with health inequity , in blacks , and especially in men who have sex with men ( msm ) , by promoting direct outreach to persons through the internet and smart phones by a ) the ability to order a self hiv test for performance at home and b ) providing a coupon on the iwtk website for a free hiv test at participating clinics , based on participant zip code .
std testing in resource - limited settings- given the significant burden of stds in sub - saharan africa ( ssa ) , we established a site at the infectious diseases institute ( idi ) at makerere university college of health sciences in kampala , uganda .
we have focused our efforts on syphilis detection particularly in pregnant women , who have a prevalence of syphilis from 1 to 8% across ssa .
rapid treponemal lateral flow assays can be used to diagnose patients at the point - of - care .
both the trinity and sd bioline tests met the who standard for accuracy ( > 85% sensitivity ; > 95% specificity ) against the sequential algorithm .
the idi poc std site has also screened more than 15,000 pregnant women as part of a clinical trial to improve syphilis partner notification , testing , and treatment ( nct02262390 ) .
finally , the technology exploration component ( filling the development pipeline and integration and facilitation of technology development ) works to seek out novel technologies and encourage their interaction with the center . up to three sub awards at $ 50,000 each are awarded per year from this component through open solicitations .
the purpose of these tactical awards is to support key studies which will help them win larger awards toward commercial development of poct .
solving many of today s unmet medical needs requires new models for successfully transforming healthcare .
the point - of - care technologies research network represents a new partnership - based model that supports and facilitates collaborations across disciplines , institutions , and geographic regions to successfully drive innovative solutions from concept to patient care .
the three centers within the network focus on commercially viable , point - of - care solutions for improving primary health care , the diagnosis and treatment of cancer , and the diagnosis of sexually transmitted diseases . as a network , centers provide resources to both technology development and clinical communities and coordinate activities with other centers . in this way ,
expertise , core resources , project support , and educational events are shared across centers , a process that is facilitated by frequent communication among center directors and program managers as well as the development of common policies and procedures across centers .
built on the success of this nibib initiative , future trans - nih activities that focus on the advancement of multiplexed and multi - use poct will serve to enhance multidisciplinary partnerships and center - center synergies while supporting further development of integrated systems to address unmet health care needs .
Output:
| to advance the development of point - of - care technology ( poct ) , the national institute of biomedical imaging and bioengineering established the poct research network ( poctrn ) , comprised of centers that emphasize multidisciplinary partnerships and close facilitation to move technologies from an early stage of development into clinical testing and patient use .
this paper describes the poctrn and the three currently funded centers as examples of academic - based organizations that support collaborations across disciplines , institutions , and geographic regions to successfully drive innovative solutions from concept to patient care . |
PubmedSumm119610 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: wegener 's granulomatosis or granulomatosis with polyangiitis ( gpa ) is a multisystem autoimmune disease of unknown aetiology .
its hallmark features include necrotizing granulomatous inflammation and pauci - immune vasculitis in small and medium - sized blood vessels of the respiratory tract and renal tract .
gpa is one of the anti - neutrophil cytoplasmic antibody ( anca)-associated vasculitides [ 2 , 3 ] .
the incidence and prevalence of gpa in the united kingdom is estimated at 10.2 and 250 cases per million population , respectively .
gpa has a spectrum of clinical presentations and more than 75% of patients will develop renal disease .
renal involvement manifests as a crescentic necrotizing glomerulonephritis , which may be associated with renal failure [ 5 , 6 ] .
current treatment recommendations in gpa depend on the severity and activity of disease , and include a combination of cyclophosphamide , glucocorticoids and in certain circumstances therapeutic plasma exchange [ 710 ] .
the rate of relapse after transplantation is approximately 0.09 per patient per year . in a study that ran from 1980 to 1995 , the course of 13 patients with end - stage kidney disease ( eskd ) due to gpa was described .
a post - kidney transplant relapse rate of 17.3% was derived by groups in sweden and the united states , combining the respective groups experience of 101 and 26 patients , respectively .
renal involvement occurred in 12 of 22 relapse cases ( 55% ) and resulted in graft loss or declining function in 4 of 12 .
this equates to approximately an 18% relapse rate . in general , reports of relapse rates and severity of anca vasculitis following kidney transplant are low .
here we describe two separate cases of gpa relapse in appropriately immunosuppressed renal transplant patients .
our first case initially presented aged 14 in 2001 with a two - week history of vague ill health , back pain and intermittent haematuria .
she was noted to have acute renal failure with both blood and protein in her urine ; creatinine was 280
she was commenced on high - dose intravenous methylprednisolone for three days followed by oral prednisolone and pulsed intravenous cyclophosphamide once per month for three months .
she required peritoneal dialysis for 34 weeks and was discharged , dialysis free with an estimated glomerular filtration rate of 24 ml / min/1.73 m. she remained on oral azathioprine as maintenance therapy .
her anti - proteinase 3 ( anti - pr3 ) level was < 5 iu / ml at the time of transplantation .
she was well for the following seven years with a baseline creatinine of 12 mol / l , maintained on tacrolimus , azathioprine and prednisolone . in 2009
the patient was noted to have an increased creatinine of 200 mol / l , with arthralgia and right - sided episcleritis .
her anti - pr3 antibody level was 26 iu / ml , increased from a baseline value of < 5 iu / ml . at this time she was on prednisolone 5
mg once per day , tacrolimus 2 mg twice per day and azathioprine 50 mg once per day .
this showed features of pauci immune necrotizing and crescentic glomerulonephritis , consistent with a recurrence of gpa ( fig . 1 , fig .
2 ) . her creatinine continued to rise , and her immunosuppression was further increased to include rituximab 1 g intravenously once per week for two weeks as treatment for relapse .
it was thought that further courses of cyclophosphamide would not be appropriate , given her previous exposure to this drug , and given the risk of infertility .
we also commenced a three - day course of intravenous methylprednisolone and changed her from azathioprine to mycophenolate .
this patient did not achieve remission ; her creatinine rose to 280 mol / l and her urine remained active .
she was commenced on therapeutic plasma exchange , receiving a total of five four - litre exchanges over ten days .
she was commenced on cyclophosphamide 15 mg / kg once per month for three months .
this regime was based on a modified version of the euvas ( european vasculitis study group ) protocol .
she achieved remission , and creatinine fell to 180 mol / l , with a normalisation of her urinary sediment .
3 ) . a 64-year - old lady presented with eskd in 2001 . her primary physician noted her to be hypertensive and to have a serum creatinine of 400 mol / l .
perinuclear anca ( panca ) was positive with myeloperoxidase ( mpo ) specificity at a titre of > 700 iu / ml .
the patient commenced haemodialysis three times per week , with a presumptive diagnosis of eskd secondary to panca - associated vasculitis .
she did not receive any specific systemic treatment , as she did not have any features of active vasculitis .
her anti - mpo antibody level was < 5 iu / ml at time of transplant .
she was discharged on maintenance tacrolimus 1.5 mg b.d . , and mycophenolate 500 mg b.d .
this was based on emerging evidence at the time of the potential benefits of a steroid avoidance immunosuppressant regime . in 2009
mol / l to 200 mol / l in the setting of an unresolving lower respiratory tract process with pulmonary infiltrates .
this was preceded by newly noted positive urinalysis , 3 + protein , 3 + blood . at this time she was on mycophenolate 250 mg b.d . and tacrolimus 0.5 mg b.d .
her presentation was associated with panca positivity , with an anti - mpo antibody level of 640 iu / ml . a transplant biopsy was performed which revealed pauci immune necrotizing and crescentic glomerulonephritis .
she was switched from mycophenolate to azathioprine , and was treated with pulsed intravenous methylprednisolone 1 g for three days .
it was felt this patient 's recurrence of gpa was due to her steroid - free immunosuppressive regime .
she was switched from maintenance low - dose mycophenolate to azathioprine 100 mg / day ; she was intolerant of higher doses of mycophenolate .
our first case initially presented aged 14 in 2001 with a two - week history of vague ill health , back pain and intermittent haematuria .
she was noted to have acute renal failure with both blood and protein in her urine ; creatinine was 280
she was commenced on high - dose intravenous methylprednisolone for three days followed by oral prednisolone and pulsed intravenous cyclophosphamide once per month for three months .
she required peritoneal dialysis for 34 weeks and was discharged , dialysis free with an estimated glomerular filtration rate of 24 ml / min/1.73 m. she remained on oral azathioprine as maintenance therapy .
her anti - proteinase 3 ( anti - pr3 ) level was < 5 iu / ml at the time of transplantation .
she was well for the following seven years with a baseline creatinine of 12 mol / l , maintained on tacrolimus , azathioprine and prednisolone . in 2009
the patient was noted to have an increased creatinine of 200 mol / l , with arthralgia and right - sided episcleritis .
her anti - pr3 antibody level was 26 iu / ml , increased from a baseline value of < 5 iu / ml . at this time she was on prednisolone 5
mg once per day , tacrolimus 2 mg twice per day and azathioprine 50 mg once per day .
this showed features of pauci immune necrotizing and crescentic glomerulonephritis , consistent with a recurrence of gpa ( fig . 1 , fig .
2 ) . her creatinine continued to rise , and her immunosuppression was further increased to include rituximab 1 g intravenously once per week for two weeks as treatment for relapse .
it was thought that further courses of cyclophosphamide would not be appropriate , given her previous exposure to this drug , and given the risk of infertility .
we also commenced a three - day course of intravenous methylprednisolone and changed her from azathioprine to mycophenolate .
this patient did not achieve remission ; her creatinine rose to 280 mol / l and her urine remained active .
she was commenced on therapeutic plasma exchange , receiving a total of five four - litre exchanges over ten days .
she was commenced on cyclophosphamide 15 mg / kg once per month for three months .
this regime was based on a modified version of the euvas ( european vasculitis study group ) protocol .
she achieved remission , and creatinine fell to 180 mol / l , with a normalisation of her urinary sediment .
her primary physician noted her to be hypertensive and to have a serum creatinine of 400 mol / l .
perinuclear anca ( panca ) was positive with myeloperoxidase ( mpo ) specificity at a titre of > 700 iu / ml .
the patient commenced haemodialysis three times per week , with a presumptive diagnosis of eskd secondary to panca - associated vasculitis .
she did not receive any specific systemic treatment , as she did not have any features of active vasculitis .
her anti - mpo antibody level was < 5 iu / ml at time of transplant .
she was discharged on maintenance tacrolimus 1.5 mg b.d . , and mycophenolate 500 mg b.d .
this was based on emerging evidence at the time of the potential benefits of a steroid avoidance immunosuppressant regime . in
mol / l to 200 mol / l in the setting of an unresolving lower respiratory tract process with pulmonary infiltrates .
this was preceded by newly noted positive urinalysis , 3 + protein , 3 + blood . at this time she was on mycophenolate 250 mg b.d . and tacrolimus 0.5 mg b.d .
her presentation was associated with panca positivity , with an anti - mpo antibody level of 640 iu / ml . a transplant biopsy was performed which revealed pauci immune necrotizing and crescentic glomerulonephritis .
she was switched from mycophenolate to azathioprine , and was treated with pulsed intravenous methylprednisolone 1 g for three days .
it was felt this patient 's recurrence of gpa was due to her steroid - free immunosuppressive regime .
she was switched from maintenance low - dose mycophenolate to azathioprine 100 mg / day ; she was intolerant of higher doses of mycophenolate .
these cases describe the rare recurrence of anca vasculitis / gpa in appropriately immunosuppressed transplant patients . in previous studies
, it was found that graft outcomes were more favourable if transplantation occurred at least a year post - induction of remission .
it was also found that the presence of circulating anca at the time of transplantation was associated with increased severity of vasculopathy in subsequent transplant biopsies .
the cases described above did not have these high - risk features . at the time of transplant
, both had undetectable levels of anca , and both were transplanted at least one year after remission .
this study also found that graft survival in those with an underlying diagnosis of anca - associated vasculitis was similar to graft survival in those with other causes of eskd .
relapse of anca vasculitis in non - transplant patients was noted to be more common in patients treated with mycophenolate than in patients treated with azathioprine .
although we can not directly extrapolate the findings of the improve trial to transplant patients , it does raise the possibility that patients with eskd secondary to anca vasculitis should be maintained on azathioprine instead of mycophenolate .
the two cases described above emphasise the importance of regular follow - up of transplant patients , and informs us that although recurrence of anca vasculitis in transplant patients is rare , it should remain on our list of differential diagnoses in allograft disfunction .
Output:
| backgroundgranulomatosis with polyangiitis ( gpa ) ( formerly known as wegener 's granulomatosis ) is a multisystem autoimmune disease of unknown aetiology .
renal disease manifests as a crescentic glomerulonephritis , with varying degrees of renal failure .
ten percent of patients progress to end - stage kidney disease .
relapse of gpa in renal transplant patients is rare , with a rate of 0.09 relapses per patient per year.patients and methodswe describe two cases of gpa relapse in immunosuppressed renal transplant patients.resultsthese patients presented with new - onset graft disfunction , having previously had an uncomplicated posttransplant course .
both patients were on appropriate doses of immunosuppressive agents at the time of relapse , with therapeutic target levels of tacrolimus .
we describe the background history and management of both patients.conclusionthe cases described inform us that although recurrence of anti - neutrophil cytoplasmic antibody vasculitis in transplant patients is rare , it should remain on our list of differential diagnoses in allograft disfunction . |
PubmedSumm119611 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: leptomeningeal carcinomatosis ( lmc ) is defined as a diffuse or multifocal malignant infiltration of the pia matter and arachnoid membrane .
it is clinically diagnosed in 510% of all cancer patients [ 1 , 2 ] .
the most commonly reported cancers associated with lmc are breast , lung , and hematological malignancies .
symptoms are related to increased intracranial pressure , hemispheric dysfunction , cranial neuropathies , and spinal roots dysfunction .
we report a case of lmc secondary to gastroesophageal junction cancer initially presenting with cauda equine syndrome .
we present the case of a 51-year - old right - handed male patient diagnosed with signet ring adenocarcinoma of the gastroesophageal junction .
nine months later , he complained of left hip pain followed by mild left leg weakness .
subsequently , the patient was admitted with intestinal obstruction . during admission , he had gradual worsening of the left leg weakness and the development of right leg weakness .
eight days following discharge , he presented to the emergency department with fecal incontinence and urinary retention requiring foley catheter insertion and worsening of his lower limb weakness .
two days later , he developed progressive bilateral facial weakness , slurring of speech , and swallowing difficulties .
his cranial nerve examination revealed facial diplegia , bilateral sensorineural hearing loss , and weak gag reflex .
he showed hypotonia of lower limbs , severe asymmetrical weakness , and absent lower limb reflexes .
1 ) which showed diffuse leptomeningeal enhancement surrounding the spinal cord and cauda equina and associated with extension of the enhancement of the nerve roots .
2 ) showed diffuse leptomeningeal enhancement most prominent at basal csf cistern and cerebellum with extension into the cerebellar sulci and surround the brain stem .
cerebrospinal fluid ( csf ) examination showed : protein = 648.3 mg / dl ( 1545 mg / dl ) , glucose = 7 mg / dl ( 4075 mg / dl ) , wbc = 39 cells / dl ( lymphocytes 5970% ) , and rbc = 1124 cells / dl .
repeat csf cytology showed malignant cells which is large atypical cells with enlarged nucleus and prominent nucleoli ( fig .
3 ) . immunohistochemistry the atypical cells are weakly positive for ck ae1/ae3 and negative for cd68 .
he had progressive worsening of his cranial neuropathies and died 10 days after hospital admission .
the most common encountered malignancies are breast 35% , lung 24% , and hematological malignancies 16% .
the development of lmc with gastrointestinal tumors is rare and most commonly reported with gastric cancer .
few case reports described the development of lmc with esophageal cancer and gastroesophageal junction tumors [ 3 , 4 , 5 , 6 , 7 , 8 , 9 ] .
the tumor cells disseminated to the leptomeninges occur via direct invasion , hematogenous spread , or perineural spread especially in head and neck cancer .
patients may present with features of increased intracranial pressure related to csf flow obstruction , neuronal dysfunction from metabolic competition for nutrients , and vascular alteration due to tumor growth .
symptoms can be divided into those resulting from hemispheric dysfunction , cerebellar dysfunction , cranial neuropathies , and spinal radiculopathies . in a study of 118 breast cancer patients with lmc , headache was the most common reported symptom ( 54% ) , followed by cranial neuropathies ( 42% ) , cerebellar signs ( 35% ) , paresis ( 26% ) , mental changes ( 19% ) , meningism ( 11% ) , seizure ( 9% ) , and radicular pain ( 7% ) .
the development of cauda equina syndrome secondary to lmc has been reported previously in a 66-year - old female patient with advanced ovarian cancer .
our patient normal imaging initially but subsequently it showed an evidence of diffuse leptomeningeal enhancement .
high clinical suspicion should be considered in any cancer patient presenting with radicular symptoms and features of cauda equina syndrome .
the presence of normal imaging studies does not rule out the presence of lmc . in the breast cancer lmc study by niwinska et al .
initial csf examination will be positive only in 50% of cases , but the yield will increase up to 90% after the third exam . in cancer patients with cauda equina syndrome and absence of structural lesions on imaging ,
lmc should be considered and further testing with study of the csf is required . to our knowledge , this is the first case of lmc secondary to gastroesophageal cancer presenting with cauda equina syndrome .
Output:
| leptomeningeal carcinomatosis ( lmc ) is a diffuse or multifocal malignant infiltration of the pia matter and arachnoid membrane .
the most commonly reported cancers associated with lmc are breast , lung , and hematological malignancies .
patients with lmc commonly present with multifocal neurological symptoms .
we report a case of lmc secondary to gastroesopha - geal junction cancer present initially with cauda equina syndrome . a 51-year - old male patient with treated adenocarcinoma of the gastroesophageal junction presented with left leg pain , mild weakness , and saddle area numbness .
initial radiological examinations were unremarkable .
subsequently , he had worsening of his leg weakness , fecal incontinence , and urine retention .
two days later , he developed rapidly progressive cranial neuropathies including facial diplegia , sensorineural hearing loss , dysarthria , and dysphagia .
mri with and without contrast showed diffuse enhancement of leptomeninges surrounding the brain , spinal cord , and cauda equina extending to the nerve roots .
cerebrospinal fluid cytology was positive for malignant cells .
the patient died within 10 days from the second presentation . in cancer patients with cauda equina syndrome and absence of structural lesion on imaging
, lmc should be considered . to our knowledge , this is the first case of lmc secondary to gastroesophageal cancer presenting with cauda equina syndrome . |
PubmedSumm119612 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: muscle biopsies ( 50100 mg ) were obtained from the vastus lateralis of lean ( bmi 22.4 0.9 kg / m ; n = 12 ) and extremely obese ( bmi 45.3 1.4 kg / m ; n = 9 ) women with the percutaneous needle biopsy technique .
satellite cells were isolated and cultured into myoblasts as previously described ( 18,19 ) . after reaching 70% confluency ,
cells were subcultured to examine the recombinant adenoviral overexpression of pgc-1 on fao , markers of mitochondrial content , and lipid accumulation as described below .
recombinant adenoviruses encoding mouse pgc-1 ( ad - pgc-1 ) or -galactosidase ( ad--gal ) were constructed , amplified , and purified as described previously ( 17 ) .
myoblasts were subcultured onto 6- and 24-well type i collagen - coated plates at densities of 80 and 20 10 cells per well , respectively . upon reaching 7080% confluence , differentiation to myotubes
was induced by switching the growth media to differentiation media ( dulbecco 's modified eeagle 's medium supplemented with 2% horse serum , 0.5 mg / ml bsa , 0.5 mg / ml fetuin , and 50 g / ml gentamicin / amphotericin b ) . on day five , myotubes were given fresh differentiation media ( no - virus control ) or transfected with either ad - pgc-1 or ad--gal ( control virus ) . to determine the appropriate adenoviral titer to use for metabolic experiments
, we initially performed a protein ( fig . 1 ) and mrna ( not shown ) dose - response curve .
ad - pgc-1 dose ( 5 10 plaque - forming units / ml ) was used to mimic the effects of endurance exercise ( 3.5-fold increase in pgc-1 protein over controls ) ( 20 ) and a
high ad - pgc-1 dose ( 1 10 plaque - forming units / ml ) used to represent a supraphysiological increase in pgc-1 ( approximately eightfold increase in pgc-1 protein over control ) .
twenty - four hours after transfection , the medium was removed and replaced with fresh differentiation media .
myotubes were harvested for respective experiments on day eight based on previous research ( 19 ) .
there were no obvious differences in the extent of myotube differentiation between lean and obese hskmc . on day eight of differentiation , myotubes were incubated at 37c in sealed 24-well plates containing differentiation media , 12.5 mmol / l hepes , 0.5% bsa , 1 mmol / l carnitine ,
either 100 mol / l or 500 mol / l sodium oleate ( sigma - aldrich , st .
louis , mo ) , and 1 ci / ml [ c ] oleate ( perkinelmer , ma ) for 3 h. following incubation , medium was assayed for co2 ( measure of complete oxidation ) , and radiolabeled acid soluble metabolites ( asm ) ( measure of incomplete oxidation ) as previously described ( 19 ) .
cells were washed twice with pbs , harvested in 600 l of 0.05% sds lysis buffer , and stored at 80c for subsequent determination of protein concentration and lipid esterfication . for determination of lipid esterfication
, 500 l cell lysate was added to 1:2 chloroform : methanol ( vol / vol ) .
after vortexing , 625 l chloroform was added , followed by the addition of 625 l deionized h2o .
the chloroform phase ( containing total lipids extracted ) was transferred to a clean glass tube and evaporated under a stream of 100% n2 .
samples were resuspended in 500 l of 2:1 chloroform : methanol . for the quantification of total lipids , 50 l of the sample
50 l of each sample was spotted onto oven - dried silica plates ( silica gel gf ; analtech , newark , de ) , and placed in a sealed tank containing solvent ( 60:40:3 heptane : isopropyl ether : acetic acid ) for 45 min .
plates were air - dried and scanned for the visualization of the bands representing triacylglycerol ( tag ) , diacylglycerol ( dag ) , and phospholipid ( pl ) .
cells were washed twice with pbs and trypsinized with trypsin - edta ( 0.05% trypsin and 0.02% edta ) .
total dna ( mitochondrial and nuclear ) was extracted from cells using a qiaamp dna minikit ( qiagen , valencia , ca ) and total dna quantified using the picogreen dna quantification kit ( molecular probes , eugene , or ) .
mtdna content was measured as relative copy number of mtdna per diploid nuclear genome using real - time pcr .
( 21 ) , detection of a 69-bp fragment of mtdna ( nucleotides 1491814986 ) and a 77-bp fragment of -globin were used as markers of mtdna and nuclear dna , respectively . primer and
probe sets were purchased from applied biosystems ( foster city , ca ) using sequences previously reported by menshikova et al .
real - time pcr was conducted using an abi prism 7900ht sequence detection system under conditions previously described ( 22 ) . the threshold cycle number ( ct )
mtdna was expressed as a relative copy number ( rc ) by expressing ct differences between -globin and mtdna as previously described ( 23,24 ) and based on the following calculations : rc = 2 and ct = ct-globin ctmtdna .
cells were washed twice with ice - cold pbs and harvested in 150 l lysis buffer ( 50 mmol / l hepes [ ph 7.4 ] , 1% triton x-100 , 10 mmol / l edta , 100 mmol / l nafl , and 12 mmol / l na pyrophosphate ) supplemented with protease and phosphatate inhibitors ( sigma - aldrich ) .
protein concentrations were determined from cell extracts using the bicinchoninic acid assay ( pierce biotechnology , rockford , il ) .
thirty micrograms of cellular protein were separated by sds - page and electrotransferred onto polyvinylidene difluoride membranes ( millipore , billerica , ma ) and probed overnight for either pgc-1 ( 1:500 ; cell signaling , beverly , ma ) , mitochondrial transcription factor ( mttfa ) ( 1:500 ; santa cruz biotechnologies , santa cruz , ca ) , or cytochrome c oxidase ( cox)iv ( 1:8,000 ; cell signaling ) .
comparisons between hskmc from lean and obese donors were performed with repeated - measures anova .
significant main effects and interactions were further analyzed using contrast - contrast tests when appropriate .
statistical significance was defined as a p value < 0.05 , and data are presented as means se .
recombinant adenoviruses encoding mouse pgc-1 ( ad - pgc-1 ) or -galactosidase ( ad--gal ) were constructed , amplified , and purified as described previously ( 17 ) .
myoblasts were subcultured onto 6- and 24-well type i collagen - coated plates at densities of 80 and 20 10 cells per well , respectively . upon reaching 7080% confluence , differentiation to myotubes
was induced by switching the growth media to differentiation media ( dulbecco 's modified eeagle 's medium supplemented with 2% horse serum , 0.5 mg / ml bsa , 0.5 mg / ml fetuin , and 50 g / ml gentamicin / amphotericin b ) . on day five , myotubes were given fresh differentiation media ( no - virus control ) or transfected with either ad - pgc-1 or ad--gal ( control virus ) . to determine the appropriate adenoviral titer to use for metabolic experiments , we initially performed a protein ( fig . 1 ) and
ad - pgc-1 dose ( 5 10 plaque - forming units / ml ) was used to mimic the effects of endurance exercise ( 3.5-fold increase in pgc-1 protein over controls ) ( 20 ) and a
high ad - pgc-1 dose ( 1 10 plaque - forming units / ml ) used to represent a supraphysiological increase in pgc-1 ( approximately eightfold increase in pgc-1 protein over control ) .
twenty - four hours after transfection , the medium was removed and replaced with fresh differentiation media .
myotubes were harvested for respective experiments on day eight based on previous research ( 19 ) .
there were no obvious differences in the extent of myotube differentiation between lean and obese hskmc .
on day eight of differentiation , myotubes were incubated at 37c in sealed 24-well plates containing differentiation media , 12.5 mmol / l hepes , 0.5% bsa , 1 mmol / l carnitine ,
either 100 mol / l or 500 mol / l sodium oleate ( sigma - aldrich , st .
louis , mo ) , and 1 ci / ml [ c ] oleate ( perkinelmer , ma ) for 3 h. following incubation , medium was assayed for co2 ( measure of complete oxidation ) , and radiolabeled acid soluble metabolites ( asm ) ( measure of incomplete oxidation ) as previously described ( 19 ) .
cells were washed twice with pbs , harvested in 600 l of 0.05% sds lysis buffer , and stored at 80c for subsequent determination of protein concentration and lipid esterfication . for determination of lipid esterfication
, 500 l cell lysate was added to 1:2 chloroform : methanol ( vol / vol ) .
after vortexing , 625 l chloroform was added , followed by the addition of 625 l deionized h2o .
the chloroform phase ( containing total lipids extracted ) was transferred to a clean glass tube and evaporated under a stream of 100% n2 .
samples were resuspended in 500 l of 2:1 chloroform : methanol . for the quantification of total lipids , 50 l of the sample
50 l of each sample was spotted onto oven - dried silica plates ( silica gel gf ; analtech , newark , de ) , and placed in a sealed tank containing solvent ( 60:40:3 heptane : isopropyl ether : acetic acid ) for 45 min .
plates were air - dried and scanned for the visualization of the bands representing triacylglycerol ( tag ) , diacylglycerol ( dag ) , and phospholipid ( pl ) .
cells were washed twice with pbs and trypsinized with trypsin - edta ( 0.05% trypsin and 0.02% edta ) .
total dna ( mitochondrial and nuclear ) was extracted from cells using a qiaamp dna minikit ( qiagen , valencia , ca ) and total dna quantified using the picogreen dna quantification kit ( molecular probes , eugene , or ) .
mtdna content was measured as relative copy number of mtdna per diploid nuclear genome using real - time pcr . as recommended by miller et al .
( 21 ) , detection of a 69-bp fragment of mtdna ( nucleotides 1491814986 ) and a 77-bp fragment of -globin were used as markers of mtdna and nuclear dna , respectively . primer and probe sets were purchased from applied biosystems ( foster city , ca ) using sequences previously reported by menshikova et al .
real - time pcr was conducted using an abi prism 7900ht sequence detection system under conditions previously described ( 22 ) . the threshold cycle number ( ct )
mtdna was expressed as a relative copy number ( rc ) by expressing ct differences between -globin and mtdna as previously described ( 23,24 ) and based on the following calculations : rc = 2 and ct = ct-globin ctmtdna .
cells were washed twice with ice - cold pbs and harvested in 150 l lysis buffer ( 50 mmol / l hepes [ ph 7.4 ] , 1% triton x-100 , 10 mmol / l edta , 100 mmol / l nafl , and 12 mmol / l na pyrophosphate ) supplemented with protease and phosphatate inhibitors ( sigma - aldrich ) .
protein concentrations were determined from cell extracts using the bicinchoninic acid assay ( pierce biotechnology , rockford , il ) .
thirty micrograms of cellular protein were separated by sds - page and electrotransferred onto polyvinylidene difluoride membranes ( millipore , billerica , ma ) and probed overnight for either pgc-1 ( 1:500 ; cell signaling , beverly , ma ) , mitochondrial transcription factor ( mttfa ) ( 1:500 ; santa cruz biotechnologies , santa cruz , ca ) , or cytochrome c oxidase ( cox)iv ( 1:8,000 ; cell signaling ) .
comparisons between hskmc from lean and obese donors were performed with repeated - measures anova .
significant main effects and interactions were further analyzed using contrast - contrast tests when appropriate .
statistical significance was defined as a p value < 0.05 , and data are presented as means se .
findings from the dose - response experiment for ad - pgc-1 are presented in fig .
1 . treatment of myotubes with ad--gal ( control virus ) had no effect on pgc-1 protein content compared with that on no - virus controls ( fig .
1a ) . in hskmc derived from lean and obese individuals , pgc-1 protein ( fig .
1a ) and mrna ( data not shown ) increased in a dose - dependent manner with increasing pgc-1 adenovirus titer ; there were no differences between pgc-1 protein content in hskmc from lean and obese individuals with or without overexpression .
1a , for subsequent experiments we selected the 1-ul dose ( 5 10 plaque - forming units / ml ) as pgc-1 protein content was increased by a magnitude similar to that reported with endurance - oriented exercise training ( 3.5-fold increase in pgc-1 protein over control ) ( 20 ) and the 2-l dose ( 1 10 plaque - forming units / ml ) to represent a supraphysiological increment ( approximately eightfold increase in pgc-1 protein over controls ) in protein content .
protein levels of mttfa and coxiv , indicators of mitochondrial biogenesis , also increased in a dose - dependent manner with pgc-1 adenovirus ( fig .
ad - pgc-1 overexpression in cultured myotubes ( hskmc ) from lean and obese donors .
a : pgc-1 protein content in no - virus controls ( nvc ) , ad--gal controls , and ad - pgc-1treated hskmc .
b : mttfa and coxiv protein content increased dose dependently with increasing pgc-1 viral titer in hskmc . to evaluate the role of pgc-1 in regulating skeletal muscle lipid oxidation , we treated myotubes from lean and obese donors with either low or high ad - pgc-1 for 24 h , followed by 3 h incubation with either 100 or 500 mol / l oleate . in all experiments ,
fao from the no - virus controls did not differ from that in the ad--gal controls ( data not shown ) .
2 . under control conditions ( low and high -gal ) , complete fao ( co2 production )
was consistently depressed by 30% in hskmc from obese individuals with either the 100 or 500 mol / l oleate incubation ( fig .
2a , overexpression of pgc-1 by 3.5-fold ( low dose ) resulted in an 30% increase in complete fao ( 100 mol / l oleate ) in hskmc derived from lean and obese donors .
the eightfold increase in pgc-1 protein ( high dose ) also increased complete fao in cells from both lean ( 64% ) and obese ( 70% ) donors at the 100 mol / l oleate concentration ( p < 0.05 ) ( fig .
although pgc-1 overexpression increased fao regardless of the category of the donor , absolute values for complete fao remained depressed in hskmc derived from obese compared with those in lean subjects under all conditions ( fig .
similar findings were obtained in response to the higher oleate concentration ( 500 mol / l ) with respect to differences between cell types and the effects of pgc-1 overexpression ( fig .
total fao , determined as the sum of incomplete ( [ c]asm ) and complete ( [ co2 ] ) oxidation did not differ between cell type under any conditions ( fig .
2c and d ) , and pgc-1 overexpression increased total oxidation in a dose - dependent manner .
total and complete fao were significantly higher at 500 mol / l oleate compared with 100 mol / l oleate in control and pgc-1treated cells ( p < 0.05 ) ( fig .
d ) . effect of pgc-1 overexpression on fao and oxidation efficiency in hskmc from lean ( ) and obese ( ) donors .
hskmc cultured from lean ( n = 12 ) and obese ( n = 9 ) donors was treated with either low- or high - dose recombinant ad--gal or pgc-1 and incubated with either 100 mol / l ( a , c , and e ) or 500 ( b , d , and f ) mol / l [ c ] oleate .
complete fao was measured from c - labeled incorporation into co2 ( a and b ) .
total fao ( c and d ) was measured as the sum of c - labeled incorporation into co2 and c - labeled incorporation into asms , with asm serving as an index of incomplete fao .
oxidation efficiency was determined as the ratio of asm to complete fao , represented as asm / co2 ( e and f ) , with higher values indicative of reduced efficiency .
data are expressed as means se and significant differences denoted at the p 0.05 level . * significant difference between lean and obese for that treatment .
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
significant increase in lean subjects with pgc-1 overexpression compared with control at the respective adenoviral doses . a ratio of incomplete ( [ c]asm ) to complete ( co2 ) oleate oxidation was calculated as an index of fao efficiency ( 14 ) . in control cells treated with 100
mol / l [ c]oleate , radiolabel incorporation into asm relative to co2 was approximately twofold higher in myotubes from obese compared with lean individuals ( p < 0.05 ) ( fig .
the high relative rate of incomplete oxidation in the obese compared with the lean group was retained regardless of the level of pgc-1 overexpression or oleate concentration ( fig .
pgc-1 overexpression increased the asm - to - co2 ratio by 55% ( p < 0.05 ) ; pgc-1 overexpression in cells from obese subjects had no effect on this ratio ( fig .
the asm / co2 ratio was significantly higher at 500 mol / l oleate compared with 100 mol / l oleate in control and pgc-1treated cells ( p < 0.05 ) ( fig .
control cells ( -gal ) from obese individuals had a greater rate of oleate incorporation into the glycerolipid pool in response to low ( 64% ) and high ( 42% ) oleate concentrations ( fig . 3a and b ) .
cells from obese individuals , regardless of treatment , consistently incorporated more lipids into the glycerolipid pool compared with hskmc from lean subjects ( fig .
pgc-1 overexpression increased esterification into the glycerolipid pool at both concentrations of oleate in both groups of subjects .
effect of pgc-1 overexpression on fatty acid incorporation in hskmc from lean ( ) and obese ( ) donors .
n = 8) donors were incubated with either 100 mol / l ( a , c , and e ) or 500 mol / l ( b , d , and f ) [ c ] oleate , and c - labeled incorporation into glycerolipid ( a and b ) , tag ( c and d ) , and dag ( e and f ) was determined .
data are expressed as means se and significant differences denoted at the p 0.05 level . * significant difference between lean and obese for that treatment .
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
f . under control conditions , cells from obese subjects had increased oleate incorporation into tag ( p < 0.05 ) ( fig .
3e ) in obese cells compared with lean cells when exposed to low oleate conditions .
oleate incorporation into pl did not differ between lean and obese control cells regardless of oleate concentration ( data not shown ; p > 0.05 ) . compared with the control condition ( -gal ) , pgc-1 overexpression increased oleate incorporation into tag ( p < 0.05 ) ( fig .
3c and d ) and pl ( data not shown ; p < 0.05 ) without affecting dag .
pgc-1 overexpression did not normalize intramyocellular lipid incorporation into storage in hskmc from obese subjects to that of the lean individuals under the same treatment ( fig .
the rate of oleate incorporation into glycerolipids ( specifically , tag and dag ) was higher when cells were exposed to the higher oleate concentration ( p < 0.05 ) ( fig .
lipid partitioning was estimated by determining the rate of lipid esterification relative to complete fao ; a higher ratio is indicative of increased partitioning toward storage .
myotubes from obese donors had a higher partitioning index compared with hskmc from lean donors ( p < 0.05 ) ( fig .
overexpression of pgc-1 at the low dose did not alter this ratio from the control condition , whereas high - dose pgc-1 overexpression ( approximately eightfold increase in pgc-1 protein ) decreased this ratio under low oleate conditions ( p < 0.05 ) ( fig .
pgc-1 overexpression does not normalize lipid partitioning rates between hskmc from lean ( ) and obese ( ) donors .
the partitioning of fatty acids between oxidative and storage pathways was evaluated by dividing the rate of oleate esterified into glycerolipid by the rate completely oxidized in response to either 100 mol / l ( a ) or 500 mol / l ( b ) [ c ] oleate in hskmc from lean ( n = 8) and obese ( n = 8) donors .
data are means se and significant differences denoted at the p 0.05 level . * significant difference between lean and obese for that treatment .
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
mtdna , coxiv , and mttfa protein content were depressed ( 27 , 35 , and 43% , respectively ; p < 0.05 ) ( fig .
the overexpression of pgc-1 protein by 3.5-fold ( low dose ) increased mtdna content by 27% in hskmc from lean and obese subjects , whereas increasing pgc-1 protein approximately eightfold increased mtdna content by 66 and 72% in myotubes from lean and obese individuals , respectively ( p < 0.05 ) ( fig .
overexpression of pgc-1 increased coxiv and mttfa protein content in a dose - dependent manner ( p < 0.05 ) ( fig .
5b and c ) . however , despite pgc-1 overexpression , mtdna , coxiv , and mttfa protein content still remained depressed in the cells from obese compared with lean donors under the same experimental treatment ( p < 0.05 ) ( fig .
pgc-1 increases mtdna ( a ) , coxiv protein ( b ) , and mttfa protein ( c ) in hskmc from lean ( ) and obese ( ) donors .
mtdna , n = 9 for lean and obese ; coxiv and mttfa , n = 8 for lean and obese .
data are expressed as means se and significant differences denoted at the p 0.05 level . * significant difference between lean and obese for that treatment .
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
6a and b ) or coxiv ( fig . 6c and d ) protein content , the decrement in fao evident with obesity ( fig .
pgc-1 overexpression had no effect on fao relative to mtdna ( p > 0.05 ) and decreased fao relative to coxiv protein content by 50% ( p < 0.05 ) ( fig .
fao does not differ between hskmc from lean ( ) and obese ( ) donors when normalized to indexes of mitochondrial content .
fao normalization to indexes of mitochondrial content were evaluated by dividing the rate of complete oleate oxidation from c - labeled incorporation into co2 ( fao ) by mtdna copy number per diploid nuclear genome ( a and b ) or by coxiv protein expression in arbitrary units ( c and d ) under both 100 umol / l ( a and c ) and 500 umol / l ( b and d ) oleate conditions .
fao / mtdna , n = 9 for lean and obese ; fao / coxiv , n = 8 for lean and obese .
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
findings from the dose - response experiment for ad - pgc-1 are presented in fig .
1 . treatment of myotubes with ad--gal ( control virus ) had no effect on pgc-1 protein content compared with that on no - virus controls ( fig .
1a ) . in hskmc derived from lean and obese individuals , pgc-1 protein ( fig .
1a ) and mrna ( data not shown ) increased in a dose - dependent manner with increasing pgc-1 adenovirus titer ; there were no differences between pgc-1 protein content in hskmc from lean and obese individuals with or without overexpression .
1a , for subsequent experiments we selected the 1-ul dose ( 5 10 plaque - forming units / ml ) as pgc-1 protein content was increased by a magnitude similar to that reported with endurance - oriented exercise training ( 3.5-fold increase in pgc-1 protein over control ) ( 20 ) and the 2-l dose ( 1 10 plaque - forming units / ml ) to represent a supraphysiological increment ( approximately eightfold increase in pgc-1 protein over controls ) in protein content .
protein levels of mttfa and coxiv , indicators of mitochondrial biogenesis , also increased in a dose - dependent manner with pgc-1 adenovirus ( fig .
ad - pgc-1 overexpression in cultured myotubes ( hskmc ) from lean and obese donors .
a : pgc-1 protein content in no - virus controls ( nvc ) , ad--gal controls , and ad - pgc-1treated hskmc .
b : mttfa and coxiv protein content increased dose dependently with increasing pgc-1 viral titer in hskmc .
to evaluate the role of pgc-1 in regulating skeletal muscle lipid oxidation , we treated myotubes from lean and obese donors with either low or high ad - pgc-1 for 24 h , followed by 3 h incubation with either 100 or 500 mol / l oleate . in all experiments ,
fao from the no - virus controls did not differ from that in the ad--gal controls ( data not shown ) .
2 . under control conditions ( low and high -gal ) , complete fao ( co2 production )
was consistently depressed by 30% in hskmc from obese individuals with either the 100 or 500 mol / l oleate incubation ( fig .
2a , overexpression of pgc-1 by 3.5-fold ( low dose ) resulted in an 30% increase in complete fao ( 100 mol / l oleate ) in hskmc derived from lean and obese donors .
the eightfold increase in pgc-1 protein ( high dose ) also increased complete fao in cells from both lean ( 64% ) and obese ( 70% ) donors at the 100 mol / l oleate concentration ( p < 0.05 ) ( fig .
although pgc-1 overexpression increased fao regardless of the category of the donor , absolute values for complete fao remained depressed in hskmc derived from obese compared with those in lean subjects under all conditions ( fig .
similar findings were obtained in response to the higher oleate concentration ( 500 mol / l ) with respect to differences between cell types and the effects of pgc-1 overexpression ( fig .
total fao , determined as the sum of incomplete ( [ c]asm ) and complete ( [ co2 ] ) oxidation did not differ between cell type under any conditions ( fig .
2c and d ) , and pgc-1 overexpression increased total oxidation in a dose - dependent manner . total and complete fao were significantly higher at 500 mol / l oleate compared with 100 mol / l oleate in control and pgc-1treated cells ( p < 0.05 ) ( fig .
d ) . effect of pgc-1 overexpression on fao and oxidation efficiency in hskmc from lean ( ) and obese ( ) donors .
hskmc cultured from lean ( n = 12 ) and obese ( n = 9 ) donors was treated with either low- or high - dose recombinant ad--gal or pgc-1 and incubated with either 100 mol / l ( a , c , and e ) or 500 ( b , d , and f ) mol / l [ c ] oleate .
complete fao was measured from c - labeled incorporation into co2 ( a and b ) .
total fao ( c and d ) was measured as the sum of c - labeled incorporation into co2 and c - labeled incorporation into asms , with asm serving as an index of incomplete fao .
oxidation efficiency was determined as the ratio of asm to complete fao , represented as asm / co2 ( e and f ) , with higher values indicative of reduced efficiency .
data are expressed as means se and significant differences denoted at the p 0.05 level . * significant difference between lean and obese for that treatment .
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
significant increase in lean subjects with pgc-1 overexpression compared with control at the respective adenoviral doses . a ratio of incomplete ( [ c]asm ) to complete ( co2 ) oleate oxidation was calculated as an index of fao efficiency ( 14 ) . in control cells treated with 100
mol / l [ c]oleate , radiolabel incorporation into asm relative to co2 was approximately twofold higher in myotubes from obese compared with lean individuals ( p < 0.05 ) ( fig .
the high relative rate of incomplete oxidation in the obese compared with the lean group was retained regardless of the level of pgc-1 overexpression or oleate concentration ( fig .
pgc-1 overexpression increased the asm - to - co2 ratio by 55% ( p < 0.05 ) ; pgc-1 overexpression in cells from obese subjects had no effect on this ratio ( fig .
the asm / co2 ratio was significantly higher at 500 mol / l oleate compared with 100 mol / l oleate in control and pgc-1treated cells ( p < 0.05 ) ( fig .
control cells ( -gal ) from obese individuals had a greater rate of oleate incorporation into the glycerolipid pool in response to low ( 64% ) and high ( 42% ) oleate concentrations ( fig . 3a and b ) .
cells from obese individuals , regardless of treatment , consistently incorporated more lipids into the glycerolipid pool compared with hskmc from lean subjects ( fig . 3a and b ) .
pgc-1 overexpression increased esterification into the glycerolipid pool at both concentrations of oleate in both groups of subjects .
effect of pgc-1 overexpression on fatty acid incorporation in hskmc from lean ( ) and obese ( ) donors .
n = 8) donors were incubated with either 100 mol / l ( a , c , and e ) or 500 mol / l ( b , d , and f ) [ c ] oleate , and c - labeled incorporation into glycerolipid ( a and b ) , tag ( c and d ) , and dag ( e and f ) was determined .
data are expressed as means se and significant differences denoted at the p 0.05 level . * significant difference between lean and obese for that treatment .
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
f . under control conditions , cells from obese subjects had increased oleate incorporation into tag ( p < 0.05 ) ( fig .
3e ) in obese cells compared with lean cells when exposed to low oleate conditions .
oleate incorporation into pl did not differ between lean and obese control cells regardless of oleate concentration ( data not shown ; p > 0.05 ) . compared with the control condition ( -gal ) ,
3c and d ) and pl ( data not shown ; p < 0.05 ) without affecting dag .
this was evident in hskmc from both lean and obese subjects ( fig . 3c
pgc-1 overexpression did not normalize intramyocellular lipid incorporation into storage in hskmc from obese subjects to that of the lean individuals under the same treatment ( fig . 3c and e ) .
the rate of oleate incorporation into glycerolipids ( specifically , tag and dag ) was higher when cells were exposed to the higher oleate concentration ( p < 0.05 ) ( fig .
lipid partitioning was estimated by determining the rate of lipid esterification relative to complete fao ; a higher ratio is indicative of increased partitioning toward storage .
myotubes from obese donors had a higher partitioning index compared with hskmc from lean donors ( p < 0.05 ) ( fig .
overexpression of pgc-1 at the low dose did not alter this ratio from the control condition , whereas high - dose pgc-1 overexpression ( approximately eightfold increase in pgc-1 protein ) decreased this ratio under low oleate conditions ( p < 0.05 ) ( fig .
pgc-1 overexpression does not normalize lipid partitioning rates between hskmc from lean ( ) and obese ( ) donors .
the partitioning of fatty acids between oxidative and storage pathways was evaluated by dividing the rate of oleate esterified into glycerolipid by the rate completely oxidized in response to either 100 mol / l ( a ) or 500 mol / l ( b ) [ c ] oleate in hskmc from lean ( n = 8) and obese ( n = 8) donors .
data are means se and significant differences denoted at the p 0.05 level . *
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
5 . mtdna , coxiv , and mttfa protein content were depressed ( 27 , 35 , and 43% , respectively ; p < 0.05 ) ( fig .
the overexpression of pgc-1 protein by 3.5-fold ( low dose ) increased mtdna content by 27% in hskmc from lean and obese subjects , whereas increasing pgc-1 protein approximately eightfold increased mtdna content by 66 and 72% in myotubes from lean and obese individuals , respectively ( p < 0.05 ) ( fig .
overexpression of pgc-1 increased coxiv and mttfa protein content in a dose - dependent manner ( p < 0.05 ) ( fig .
5b and c ) . however , despite pgc-1 overexpression , mtdna , coxiv , and mttfa protein content still remained depressed in the cells from obese compared with lean donors under the same experimental treatment ( p < 0.05 ) ( fig .
pgc-1 increases mtdna ( a ) , coxiv protein ( b ) , and mttfa protein ( c ) in hskmc from lean ( ) and obese ( ) donors .
mtdna , n = 9 for lean and obese ; coxiv and mttfa , n = 8 for lean and obese .
data are expressed as means se and significant differences denoted at the p 0.05 level . *
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
as presented in fig . 6 , when complete fao ( co2 production ) at either 100 or 500 mol / l oleate was expressed relative to mtdna ( fig .
6c and d ) protein content , the decrement in fao evident with obesity ( fig .
pgc-1 overexpression had no effect on fao relative to mtdna ( p > 0.05 ) and decreased fao relative to coxiv protein content by 50% ( p < 0.05 ) ( fig .
fao does not differ between hskmc from lean ( ) and obese ( ) donors when normalized to indexes of mitochondrial content .
fao normalization to indexes of mitochondrial content were evaluated by dividing the rate of complete oleate oxidation from c - labeled incorporation into co2 ( fao ) by mtdna copy number per diploid nuclear genome ( a and b ) or by coxiv protein expression in arbitrary units ( c and d ) under both 100 umol / l ( a and c ) and 500 umol / l ( b and d ) oleate conditions .
fao / mtdna , n = 9 for lean and obese ; fao / coxiv , n = 8 for lean and obese .
significant main effect comparing control ( -gal ) and pgc-1 overexpression ( ad - pgc-1 ) at the respective adenoviral doses .
the intent of the current study was to determine whether the low rates of skeletal muscle fao observed in obese humans could be linked to a lower mitochondrial content in skeletal muscle and , given the role of pgc-1 in stimulating mitochondrial biogenesis , to examine whether increasing pgc-1 by a physiologically relevant increment could mitigate the foregoing deficits .
hskmc was selected as the experimental model because myotubes established in culture from extremely obese donors display a reduction in fao that is quantitatively similar to that reported in skeletal muscle strips ( 60% ) ( 3 ) , muscle homogenates ( 50% ) ( 2 ) , and in vivo studies using c tracers ( 22% ) ( 5 ) or indirect calorimetry ( 40% ) ( 4 ) .
other reports have likewise demonstrated that interindividual variability in fat oxidation assessed in vivo in healthy young men was preserved in hskmc ( 25 ) .
2 ) further establish the utility of hskmc as a model for studying fuel metabolism in human skeletal muscle .
there is controversy whether the reduction in complete fao in human skeletal muscle observed with obesity can be attributed to the existing mitochondria being dysfunctional ( i.e. , altered morphology ) , the existing mitochondria being fully functional but expressed at a lower concentration with obesity , or a combination of both of these conditions ( 26 ) .
an important finding of the present study was that although complete fao and mitochondrial content were reduced in hskmc from extremely obese donors ( figs . 2 and 5 ) , when complete fao was normalized to indexes of mitochondrial content , the differences between lean and obese subjects were abolished ( fig .
the finding that the reduced complete fao in myocytes from obese donors is associated with reduced mitochondrial content ( fig .
6 ) suggests that the impairment in complete fao in human skeletal muscle with obesity may be attributed , at least in part , to a reduction in mitochondrial content ( fig .
this obesity phenotype is akin to characteristics exhibited by type 2 muscle fibers ; in support , a greater proportion of type 2 fibers has been reported with extreme obesity ( 27 ) , although it is not evident whether all traits of glycolytic tissue ( i.e. , contractile properties ) are retained in cell culture . while our data suggest that mitochondrial functionality remains intact with obesity , more extensive mitochondrial characterization ( i.e. , respiration data ) is needed to provide definitive conclusions . in support of our findings , holloway et al .
( 6 ) have reported that fao in mitochondria isolated from muscle biopsies was reduced with obesity when calculated on a whole - muscle basis ; however , when normalized to mitochondrial protein content , fao was equivalent in lean and obese .
the present findings add to the existing data ( 6 ) in two novel ways .
2 ) and associated reduction in mitochondrial content ( figs . 5 and 6 ) with obesity were evident even when mitochondrial content was manipulated via pgc-1 overexpression , indicating consistency .
second , to our knowledge this is the first study to demonstrate a reduction in mitochondrial content in primary human muscle cell cultures from obese donors . it has been proposed that characteristics evident in hskmc have a genetic origin , given that any phenotype is retained as the cells proliferate and differentiate independently of in vivo influences ( 11,25,28 ) .
the current data thus provide the novel information that the reduction in mitochondrial content and the accompanying decrement in fao in skeletal muscle from extremely obese subjects consist of a heritable or imprinted component .
master regulator coordinating mitochondrial biogenesis because elevating pgc-1 content activates critical downstream transcription factors , which effectively remodel the muscle cell to favor oxidative metabolism ( 17,2932 ) .
accordingly , in l6 muscle cells the overexpression of pgc-1 enhanced fao and increased the expression of genes involved in oxidative processes ( 17 ) ; an elevation in pgc-1 is also believed to be a critical factor accounting for the increased fao and mitochondrial content in skeletal muscle with exercise training ( 16,17 ) . in the present study , while pgc-1 overexpression increased fao and mitochondrial content independently of body composition , absolute values for complete fao and mitochondrial content remained depressed in the myocytes from obese subjects at both the physiological and supraphysiological pgc-1 doses ( figs . 2 and 5 ) .
this novel result indicates that skeletal muscle of obese individuals responds to signals triggered by pgc-1 ; however , the obese state appears to limit both mitochondrial biogenesis and oxidative capacity via mechanisms that are independent of pgc-1 abundance ( figs . 2 and 5 ) .
the differences between the lean and obese myocytes in indexes of mitochondrial content ( fig . 5 ) and fao ( fig .
2 ) were relatively consistent with and without ( control ) pgc-1 overexpression ; this suggests a possible reduction in another coactivator or mechanism involved with mitochondrial proliferation .
mttfa protein content , a transcription factor downstream of pgc-1 critical for mtdna replication ( 33 ) , mirrored the pattern of change seen in mitochondrial content ( fig .
5 ) , suggesting that the defect with obesity may involve this arm of pgc-1 coordination . a combination of variables such as pgc-1 cellular location ( cytoplasm vs. nucleus ) , posttranslational modifications ( i.e. , acetylation and phosphorylation ) , and pgc-1 binding to or activation of transcription factors could contribute to the mitochondrial phenotype of obese hskmc . given the complexity of mitochondrial biogenesis , mechanisms independent of pgc-1 could also explain the obesity - associated decrement in fao and mitochondrial content ( 34 ) .
although the precise mechanism(s ) are yet unknown , the present data indicate that extreme human obesity involves an intrinsic impairment in skeletal muscle mitochondrial biogenesis and content .
we previously reported that exercise training increased complete fao and improved oxidation efficiency ( co2 production / asm ) to equivalent absolute values in lean and formerly extremely obese individuals despite an initial decrement in fao and elevated asm production in the obese subjects ( 13 ) .
2 , increasing pgc-1 content by both physiological and supraphysiological increments did not abolish the difference in complete fao and oxidation efficiency between lean and obese subjects as opposed to the total normalization seen with exercise training ( 13 ) .
this finding further suggests that other exercise factors , in addition to an increase in pgc-1 content , account for the improvement in skeletal muscle fao with physical activity in obese individuals ( 13 ) . despite the reduced ability to completely oxidize lipid , obese cells exhibited similar rates of total oxidation , suggesting a downstream defect in the lipid oxidation pathway .
( 17 ) suggested that an elevated asm / co2 ratio , as observed in cells derived from obese donors ( fig .
it is plausible that this occurred in the present study and that products of oxidative metabolism accumulated when downstream metabolic pathways could not adjust appropriately .
in addition , obesity was linked to preferential partitioning of fa into the glycerolipid ( tag and dag ) pools ( fig .
3 ) . these abnormalities are clinically relevant because both incomplete fao and intramuscular lipid accumulation have been implicated as markers and perhaps mediators of insulin resistance in obese individuals ( 35,36 ) .
interestingly , pgc-1 overexpression increased fatty acid incorporation into tag but not dag ( fig .
this finding is consistent with a recent report showing that transgenic mice with muscle - specific overexpression of pgc-1 have increased muscle tag when fed a high - fat diet ( 37 ) . in this mouse model ,
pgc-1 overexpression resulted in upregulation of diacylglycerol aclytransferase and mitochondrial glycerol-3-po4 acyl - transferase , two enzymes involved in tag synthesis ; we speculate that similar mechanisms might be operative in the hskmc .
thus did not rescue the cells from the obese subjects in terms of returning the indexes of lipid storage ( figs . 3 and 4 ) to values seen in the cells from lean donors . in summary ,
skeletal muscle cells cultured from extremely obese donors exhibited depressed mitochondrial content , which could in turn be responsible for the diminished capacity to oxidize lipid and the preferential partitioning of lipid toward intramuscular storage with obesity .
this phenotype may consist of a heritable or imprinted component because it is proposed that characteristics expressed in hskmc have a genetic origin .
when pgc-1 was overexpressed in hskmc from lean and obese subjects , the mitochondrial phenotype of obesity persisted .
this finding suggests a molecular impairment in mitochondrial proliferation that occurs independent or downstream of pgc-1 expression .
additionally , pgc-1 overexpression did not fully recapitulate the effects of exercise training on fao in obese individuals , suggesting that additional mechanisms are involved with this intervention .
Output:
| objectiveto determine whether the obesity - related decrement in fatty acid oxidation ( fao ) in primary human skeletal muscle cells ( hskmc ) is linked with lower mitochondrial content and whether this deficit could be corrected via overexpression of peroxisome proliferator
activated receptor- coactivator-1 ( pgc-1).research design and methodsfao was studied in hskmc from lean ( bmi 22.4 0.9 kg / m2 ; n = 12 ) and extremely obese ( 45.3 1.4 kg / m2 ; n = 9 ) subjects .
recombinant adenovirus was used to increase hskmc pgc-1 expression ( 3.5- and 8.0-fold ) , followed by assessment of mitochondrial content ( mtdna and cytochrome c oxidase iv [ coxiv ] ) , complete ( 14co2 production from labeled oleate ) , and incomplete ( acid soluble metabolites [ asm ] ) fao , and glycerolipid synthesis.resultsobesity was associated with a 30% decrease ( p < 0.05 ) in complete fao , which was accompanied by higher relative rates of incomplete fao ( [ 14c]asm production/14co2 ) , increased partitioning of fatty acid toward storage , and lower ( p < 0.05 ) mtdna ( 27% ) , coxiv ( 35% ) , and mitochondrial transcription factor ( mttfa ) ( 43% ) protein levels .
pgc-1 overexpression increased ( p < 0.05 ) fao , mtdna , coxiv , mttfa , and fatty acid incorporation into triacylglycerol in both lean and obese groups .
perturbations in fao , triacylglycerol synthesis , mtdna , coxiv , and mttfa in obese compared with lean hskmc persisted despite pgc-1 overexpression . when adjusted for mtdna and coxiv content , fao was equivalent between lean and obese groups.conclusionreduced mitochondrial content is related to impaired fao in hskmc derived from obese individuals .
increasing pgc-1 protein levels did not correct the obesity - related absolute reduction in fao or mtdna content , implicating mechanisms other than pgc-1 abundance . |
PubmedSumm119613 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 35-year - old male , diagnosed with obsessive - compulsive disorder ( ocd ) for the past 5 years was prescribed on fluoxetine up to 80 mg / day .
he was receiving this treatment for the past 1 year with partial improvement of symptoms despite adequate compliance .
cognitive behavior therapy was not possible due to transportation inconvenience . due to the persistence of symptoms , despite a high dose of fluoxetine , augmentation with clomipramine ( up to 100 mg / day )
after few days of the addition of clomipramine , the patient had reported dark pigmentation over face localized to both malar eminences .
the dermatological consultation was sought for this hyperpigmentation ; a diagnosis of melasma was made .
his routine hemogram , thyroid function test , and serum cortisol levels were within normal limits .
due to poor tolerance to clomipramine ( excessive sedation and severe constipation ) , dose of clomipramine was reduced to 50 mg / day . due to the persistence of ocd symptoms ,
this resulted in improvement in ocd symptoms over next 3 months ; however , the skin pigmentation and severe constipation persisted .
clomipramine dose was reduced to 25 mg / day for next 2 months and persistence of constipation resulted in its stoppage .
assessment score on naranjo adverse drug reaction ( adr ) probability scale was six , which was suggestive of probable adr .
assessment on the world health organization - uppsala monitoring centre ( who - umc ) system for standardized case causality assessment also suggestive of probable adr with clomipramine .
in our patient , the pigmentation is confined to the malar eminences of the face , with sparing of rest sun - exposed areas of the body .
this adverse effect of clomipramine is not life - threatening , but can be a reason of concern from cosmetic sense . in our patient ,
clomipramine was not acceptable due to constipation and excessive sedation , although he was worried about melasma
. stoppage of clomipramine resulted in improvement of sedation , constipation as well as melasma .
causality assessment is an important evaluation to establish the link between an adverse event with a particular drug .
causality assessment has been done on naranjo adr probability scale and the who - umc system , which revealed probable adr ( i.e. , the adverse event followed exposure to drug and disappeared following drug discontinuation , it is unlikely attributable to disease or other drugs ) . in a study
, it was found that the prevalence of severe adr being 1.4% in general ; higher with the tricyclic antidepressant ( tca ) group and lower with monoamine oxidase inhibitors and selective serotonin reuptake inhibitors . among the tcas
allergic exanthematous cutaneous reactions are known with tcas . however , there is description of a single case of 60-year - old female suffering from depressive episode , who developed pigmentation over light exposed areas of the body with the use of clomipramine .
there are few case reports of such pigmentation with the use of imipramine , a congener of clomipramine .
this is probably the second case study , reporting the rare side effect of clomipramine .
Output:
| melasma is a hyperpigmented dermatological condition common in females .
drugs such as steroids , cosmetics , and photosensitizing agents are known to cause melasma .
we report here a case of an adult male with obsessive - compulsive disorder , receiving clomipramine , who developed melasma . |
PubmedSumm119614 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: research is pivotal in the practice and development of medicine . it helps to discover new evidence , provides impetus to further research , draws attention to areas of interest and is instrumental in improving and innovating patient care .
the results obtained from research can be made available to the medical community either through publication in relevant journals or presentation at various forums .
presentation at conferences can be either in poster or oral format , and aims for a rapid dissemination of the information to a large number of targeted professionals , stimulates discussion , encourages further research by young investigators , and is considered an important link between execution of a research protocol and publication of the completed work .
presentation of research to a wide audience in conferences may lead to a change in clinical practice and opinion affecting the patient care , and hence the quality of research presentations should be maintained . a well - accepted marker of quality of the research that is presented is its success to be published subsequently in a peer - reviewed journal . the publication rate of presentations has been used to assess quality of research output in various fields of medicine including anesthesia . the publication rate varies from 11% to 78% , typically hovering around 30 - 50%.[712 ] however , there is no data regarding the publication rate of research presented in anesthesia in an indian scenario .
the indian society of anaesthesiologists hosts the national annual conference ( isacon ) that is the primary conference of anesthesia in india .
the scientific committee of isacon selects papers to be presented at each annual conference after review of submitted abstracts .
this observational study aimed to assess the publication rate of research presentations made in the isacon and also compare it with that of the annual meeting of american society of anesthesiologists ( asa ) held in the same year . as secondary observations ,
the site and timing of the full - text publication , completeness of the abstracts submitted to the conference , and changes between the abstract as accepted for conference proceedings and its full - text publication were also noted .
the isacon publishes in print , abstracts of all poster and oral presentations made in the conference .
the official website of asa allows free access to abstracts of all presentations . using these respective resources we identified abstracts of the presentations made at isacon and asa meetings .
the mean time to publication after presentation has previously been noted to vary between 1.5 and 3 years , with a median of 18 months .
thus , we conducted the present study using the proceedings of the conferences held in the year 2009 .
the total number of abstracts of research presentations made at isacon and asa meetings in this year was 363 and over 1700 , respectively .
the archive of abstracts of asa meeting allows access to an individual abstract one at a time , making manual sorting of such a large number of abstracts extremely difficult . to allow for comparison with the smaller number of presentations at the isacon we randomly selected an equal number of abstracts from the asa 2009 including all specialities , using a computer generated random number table and numbered abstracts . for calculation of the publication rate
, we used a previous strategy to determine whether the presentation finally got published in a journal .
herein , key words from the title and names of the first and last authors from the abstract were entered into pubmed as well as google scholar databases .
key words were defined as the main elements in the title , and ranged from one to several in number .
names of first and last authors were used , since they are usually the one who have contributed most to the paper and are likely to be the senior ones respectively , and thus named on any final publication . to standardize the results of search process for full - text publication , only published papers that were similar with respect to hypothesis , study design , protocol , number of subjects and results of the published abstract were considered as a match . if the published paper included the data presented in the abstract , along with additional data , it was still considered a match .
at least two of the authors independently assessed the publications that were considered a match , to arrive at a consensus decision for accepting it as a full - text publication of the abstract .
if the initial search did not reveal a full - text publication , all the key words from the title were entered before declaring an abstract unpublished .
once matched as a full - text publication , the time of publication from its presentation was noted .
it was also recorded whether the journal , wherein published , was indexed with pubmed .
all abstracts , as published in the conference proceedings , were assessed for completeness by noting mention of aim , methods , quantitative results , conclusion , study design ( its specific mention ) , sample size ( subjects recruited ) , and statistical tests .
changes between abstract of the presentation and published paper with respect to the title , form ( original research / case report / observational ) , authorship ( number , order ) , number of study subjects , quantitative results , and conclusions were also noted .
the publication rate of abstracts from isacon and asa meetings was 19/363 ( 5% ) and 80/363 ( 22% ) , respectively .
percentage of full - text publications published in journals indexed with pubmed was 58% and 100% for the isacon and asa meetings , respectively .
of the 363 abstracts presented at isacon while 270 ( 74.4% ) were original research , 81 ( 22.3% ) were case reports , and 12 ( 3.3% ) were personal experiences or narratives . compared to this , there were no case reports among the asa meeting abstracts .
the median ( range ) time to publication as full - text articles was 12 ( 3 - 24 ) months and 14 ( 1 - 21 ) months for isacon and asa meetings , respectively . from among the published articles , 26% from isacon and 0.07% of asa
there was a difference in completeness of the abstracts accepted for presentation in the conferences [ table 1 ] .
abstracts complete with respect to inclusion of aim , statistical tests , quantitative results and conclusion were significantly higher in the asa meeting as compared with the isacon ( p < 0.05 ; table 1 ) . in contrast , the percentage of abstracts mentioning study design were greater from isacon meeting ( p < 0.05 ) ; and those with sample size and methods were similar between the two conferences [ table 1 ] . completeness of abstracts of presentations a similar percentage of the final full - text publications from isacon and asa meetings ( 84% and 85% , respectively ) differed from the initial abstract [ table 2 ] . with regard to the individual components , significantly higher percentage of publications from asa meeting had a change in the form , order of authors , results , and conclusions ( p < 0.05 , table 2 ) . the commonest change in the final manuscripts resulting from both conferences was a change in the authorship [ table 2 ] . the increase in number of authors ranged from 1 to 9 and 1 to 8 in manuscripts originating from presentations of isacon ( 68% ) and asa meetings ( 73% ) , respectively .
we searched both pubmed and google scholar for locating full - text publications of the presented abstracts so as to include both indexed as well as nonindexed journals .
previously , a publication rate of 31 - 43.6% has been noted from presentations made in international conferences in anesthesia .
the publication rates noted in our study for both , the indian isacon ( 5% ) and international asa meeting ( 22% ) are lower than the previous figures . for suitable comparison of the rate for isacon
, there is no previous data regarding publication rate from an indian conference in anesthesia .
however , publication rate from indian conferences held in other medical specialities note higher publication rates than isacon ; 16.5% in ophthalmology .
the publication rate of asa meeting is only for the randomly selected sample of abstracts .
low publication rates result from authors failing to write the full - text manuscript or its being rejected by a journal during peer review .
failure to write the manuscript could be related to several reasons including time constraints , the extra work required to achieve a full text publication , or a simple lack of motivation to achieve publication .
also , in a usual indian scenario , while a presentation may be required to attend and obtain reimbursement of expenses for the conference , a publication is not required for the same . several times the work is presented by students / residents who have changing interests or insufficient time , preventing production of complete manuscript .
the inclusion of a large number of case presentations in isacon ( 22.3% ) may also contribute to the lower publication rate . to publish case reports
is currently difficult , with most international journals having uniformly stepped down the space dedicated to case reports .
this is because case reports are now relegated to the lowest class of evidence - based research and also affect the journal s impact factor adversely .
although there are certain journals devoted to publishing case reports such as the journal of case reports , these are internet - based , open - access journals demanding a high publishing fees .
stringent conditions on presentation of case reports in isacon need to be applied , and only a limited percentage of total presentations should be allocated to them .
case reports that can convey novel management techniques or descriptions need to be considered . those with a beneficial outcome by applying previously described approaches in uncommon diseases should be specially desisted from .
other suggestions to increase publication rate from isacon include introduction of formal training in research methodology and bioethics , as well as scientific paper writing during graduate and post - graduate courses .
faculty members can be allocated structured time for research distinct from academic , clinical , and administrative responsibilities .
better infrastructure or support for research such as free access to journals and secretarial assistance should also be made available .
some of these are affirmative steps that can even be taken at departmental level without necessitating institutional policy decisions , making them feasible and sustainable . to augment the publication of research , ultimately ,
the will and efforts are to originate from all concerned including the authors . from among the published articles , 26% from isacon and 0.07% of asa
these could be presentations that were submitted for consideration for publication at the time of the conference , or those already published , the latter being highly undesirable .
a significantly lower percentage of abstracts from isacon were complete with regard to aim , statistical tests , quantitative results , and conclusions as compared with asa meeting [ table 1 ] . besides this quantitatively higher percentage of isacon abstracts being incomplete , there are certain qualitative differences .
there were a high number of abstracts from isacon that lacked quantitative results , i.e. , 177 of the 270 original research as compared with asa meeting ( 2/363 original research ) .
this may be because these studies may not have been completed by the time of submission for presentation .
the asa website includes the precondition of providing quantitative results and conclusions and puts a word limit for each specified section , whereas the guidelines in the isacon website are less rigorous .
it is also worrisome that two abstracts from isacon were accepted despite lack of aims or methods [ table 1 ] .
these findings suggest the need for a more rigorous peer review of the abstracts submitted to isacon for potential presentation .
a standardized protocol for screening and selection of abstracts needs to be put in place , that may help reduce any subjective bias on part of the reviewers . like certain other conferences ,
submission of a nonrefundable nominal fee may also help improve the quality of research being submitted to isacon .
a similar percentage of full - text publications from both conferences had changes made in comparison to components of the original abstract .
the commonest change between full - text publication and its abstract from conference proceedings was in the authorship , with an increase in authors ranging from 1 to 9 in isacon and 1 to 8 in asa meeting publications .
change in authorship between presentation and publication may be due to the inclusion of an additional author if there is further analysis of data involving another investigator , or removal of an author if their involvement in manuscript preparation is below standards set for authorship by peer - reviewed journals .
gift authorship that is prevalent may also explain the change in number or order of authorship .
the limitations of our study include the possibility of some articles still pending for publication , missing articles published in journals not either in google scholar or pubmed , and typographical errors in the proceedings of isacon or asa meeting , which may have lead to the article being unavailable on search .
also , since the computerized search for full - text articles was carried out manually the chances of human error can not be ruled out .
to conclude , the publication rate from isacon ( 5% ) is lower than that from asa meeting ( 22% ) .
abstracts submitted to isacon lack completeness with respect to central aspects of research such as mentioning of methods , statistical methods , quantitative results , and conclusions ; necessitating more rigourous guidelines and review prior to their acceptance . augmenting this quality check will also help to increase the publication rate eventually .
lastly , changes are common in published full - text manuscripts as compared with their presented abstracts , implying that the presentation of research at conferences such as isacon helps in its improvement and augments publication .
Output:
| background : to assess the quality of research presentations made in conferences , its success or failure to be published in a peer - reviewed journal is a well - accepted marker .
however , there is no data regarding the publication of research presentations made in indian conferences of anesthesiology.objective:the primary objective was to determine publication rate of research presented at the largest and best attended national conference in anesthesiology , the indian society of anaesthesiologists conference ( isacon ) , and also compare it with the rate from an international conference american society of anesthesiologists ( asa annual meeting ) held in the same year.materials and methods : all 363 abstracts presented as poster or podium presentations at the isacon , and an equal number of randomly selected abstracts presented at asa annual meeting were searched on pubmed and google scholar for their full - text publications in peer - reviewed journals using a standardized search strategy . as secondary observations ,
abstracts were assessed for completeness by noting certain components central to research methodology . also , changes between abstract of the presentation and published paper were noted with respect to certain components.results:the publication rate of presentations at isacon and asa meetings was 5% and 22% , respectively .
the abstracts from isacon lacked central components of research such as methods and statistical tests .
the commonest change in the full - text publications as compared with the original abstract from both conferences was a change in authorship.conclusion:steps are required to augment full - text publication of indian research , including a more rigorous peer review of abstracts submitted to isacon to ensure their completeness . |
PubmedSumm119615 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in the previous issue of critical care nathani and colleagues have assessed kl-6 , a specific marker of type 2 alveolar epithelial cell injury , as a biomarker in acute lung injury ( ali ) .
biomarkers allow identification of patients at risk of developing disease or can be used as surrogate measures for clinical outcomes .
additionally , measuring biological markers may be a valuable tool in understanding disease pathogenesis . in ali ,
the alveolar capillary barrier is disrupted and the alveolar epithelial cell function is critical to the recovery from ali / acute respiratory distress syndrome ( ards ) .
this knowledge provides a rationale for measurement of alveolar epithelial cell injury using surrogate biochemical measures such as kl-6 , as a biomarker of ali . in the study of nathani and colleagues ,
plasma and bronchoalveolar lavage samples were collected following inclusion and on day 4 from 30 ventilated ali patients , from 12 patients at risk of developing ali and from 10 nonsmoking volunteers free of respiratory disease the study therefore had the benefit of allowing the investigators to look at kl-6 both in physiological and pathological states .
the important findings from the study are that plasma kl-6 levels are increased in patients with ali , plasma kl-6 correlates with the severity of lung injury and plasma kl-6 is significantly elevated in nonsurvivors compared with survivors .
furthermore bronchoalveolar lavage kl-6 is elevated in patients with ali and is higher in nonsurvivors .
these findings extend the previous data showing kl-6 is elevated in plasma and epithelial lining fluid in ali . in relation to kl-6 in ali ,
questions that still remain to be answered include the specificity of the type 2 epithelial cell as the source of kl-6 as well as a need to confirm whether kl-6 elevation reflects epithelial cell injury , regeneration or secretion in response to inflammatory mediators .
in addition , mechanical ventilation is known to cause epithelial injury , and an important area in which biomarkers may be valuable is in the assessment of ventilator - associated lung injury .
increased surfactant protein d is associated with injurious ventilation strategies , and it would be interesting to know the effects of mechanical ventilation on kl-6 . regardless of these outstanding questions , nathani and colleagues ' work together with other data showing that elevated surfactant protein d , a type 2 epithelial cell product , is associated with a worse clinical outcome in ali / ards and that the receptor for advanced glycation end - products , an alveolar type 1 epithelial cell - associated protein , is increased in patients with ali implicates epithelial cell damage as an important determinant of outcome and implies the potential for alveolar epithelial cell biomarkers to predict outcome in ali .
further , these data support the central role of epithelial injury in the pathogenesis of ali .
notable limitations of all these surrogate biomarkers exist ; they do not directly measure epithelial function , and they require laboratory analysis and therefore can not be performed by a clinician at the bedside . additionally , there is no biomarker of epithelial function that reliably identifies patients at risk of ali who will develop ali .
the resolution of pulmonary oedema from the alveolar space , which is dependent on alveolar fluid clearance , is critical to the recovery from ali / ards .
although this can not be measured at the alveolus , the potential difference can be measured readily across the nasal epithelium .
measuring nasal potential difference is a simple noninvasive measurement easily undertaken repeatedly at the bedside . in an animal model , measurement of nasal potential difference correlated with alveolar fluid clearance .
this observation supports the hypothesis that nasal potential difference measurement may be a surrogate marker for alveolar epithelial function .
furthermore , premature infants with pulmonary oedema and patients susceptible to high - altitude pulmonary oedema have reduced nasal transepithelial sodium resorption , as measured by the baseline nasal potential difference , indicating that nasal potential difference measurement may be able to identify patients at risk of developing ali .
although further work validating such functional measures of epithelial activity is required , it is probable that as well as biochemical measures such as kl-6 , as demonstrated by nathani and colleagues , future biomarkers in ali will combine both biochemical and functional measures .
Output:
| studies have indicated that measuring biochemical measures of epithelial injury in plasma and alveolar fluid may be useful in predicting outcome in acute lung injury .
the present commentary briefly reviews the evidence supporting the use of these biochemical biomarkers of epithelial injury in acute lung injury , and in particular kl-6 , as well as their limitations .
the article additionally proposes the need for physiological markers of epithelial function to complement current biochemical biomarkers . |
PubmedSumm119616 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: autoimmune pancreatitis ( aip ) is a distinct type of pancreatitis with a presumed autoimmune etiology .
its clinical features , treatment , and prognosis are significantly different from those of non - aip chronic pancreatitis ( cp ) .
presently , epidemiological information about aip mainly comes from japan , south korea , the united states , and other countries .
the morbidity of aip is 2.2 per 100 000 population in japan . in north america , among cp cases ,
, it is estimated that there are thousands of patients with aip in china , but only few cases are reported because most aip patients in china have been misdiagnosed and consequently not correctly treated . in a report of 36 aip patients in china , 18 ( 50% )
cases were misdiagnosed as pancreatic cancer and 10 ( 28% ) as non - aip pancreatitis .
thus , further studies are needed to analyze the characteristics of aip in china and distinguish it from non - aip cp .
the participation of cd4+cd25 + regulatory t cells ( tregs ) in the pathogenesis of the igg4 reaction in aip has been proposed .
it was suggested that tregs might be involved in aip through in situ production of interleukin-10 ( il-10 ) and transformation growth factor ( tgf- ) , which could be followed by igg4 class switching and fibroplasia .
therefore , forkhead box p3 ( foxp3 ) , as a good marker of cd4+cd25 + tregs , was analyzed to investigate the significance of cd4+cd25 + tregs in type 1 aip .
it has been reported that il-17 plays a key role in the fibrosis of chronic inflammation .
increasing il-17 expression was also reported as being involved in the pathogenesis of igg4-related sclerosing sialadenitis .
type 1 aip is an igg4-related systematic autoimmune disease with dense fibrosis in the pancreas , but il-17 expression remains unclear in type 1 aip . in this study
, we analyzed the clinical features of type 1 aip , detected the immunohistochemical expressions of foxp3 and il-17 in type 1 aip , and compared them with non - aip cp to improve the understanding of aip and identify factors for differentiation of the 2 diseases .
because diagnosis of aip is primarily based on pathological features , clinically suspected type 1 aip and non - aip cp cases with pancreatic specimens were all reviewed at sun yat - sen memorial hospital from january 2000 to december 2013 .
the diagnosis of type 1 aip was according to icdc [ details described in ref .
the diagnosis of non - aip cp followed the diagnostic criteria in china and italy : ( 1 ) clinical manifestations : recurrent abdominal pain or acute pancreatitis ; ( 2 ) histopathological examination : pancreatic gland bubble destruction , pancreatic fibrosis , duct dilation , and cyst formation ; ( 3 ) imaging findings : pancreatic calcification or calculus pancreas growth or reduction , contour irregularity , irregular dilation of pancreatic duct , and pancreatic pseudocyst ; ( 4 ) laboratory tests : pancreatic exocrine insufficiency .
a definitive diagnosis of cp could be made with ( 2 ) or ( 3 ) and a diagnosis of suspected cp was made by ( 1 ) and ( 4 ) . only cases with a definitive diagnosis of cp
cases that were in accordance with the inclusion standard of the aip group were excluded from the non - aip cp group .
the following data of the 2 groups were collected and compared : ( 1 ) age and sex ; ( 2 ) symptoms like abdominal pain , obstructive jaundice , abnormal stool , weight loss , diabetes mellitus , and combination with other autoimmune diseases ; ( 3 ) serological data : -glutamyl transferase ( -gt ) , alkaline phosphatase ( alp ) , total bilirubin ( tbil ) , alanine aminotransferase ( alt ) , serum amylase ( samy ) , lipase ( lps ) , carbohydrate antigen 19 - 9 ( ca19 - 9 ) , serum globulin , and autoantibodies ; ( 4 ) examination results of computed tomography ( ct ) , magnetic resonance imaging ( mri ) , and magnetic resonance cholangiopancreatography ( mrcp ) ; and ( 5 ) histopathological features in the pancreas .
this study was approved by the ethics committee of sun yat - sen memorial hospital .
one paraffin block from each case was selected for immunohistochemical ( ihc ) staining for igg4 , foxp3 , and il-17 .
the ihc staining was performed as follows : serial sections of each sample were cut at 5 m , baked in an oven at 60c for at least 60 min , deparaffinized , rehydrated , and pretreated with citric acid at ph 6.0 .
all sections were incubated with normal non - immune goat serum for 15 min at room temperature .
sections were incubated overnight with the primary antibodies directly against igg4 ( rabbit polyclonal , diluted 1:500 , abcam , cambridge , uk ) , foxp3 ( rabbit polyclonal , diluted 1:500 , abcam , cambridge , uk ) , and il-17 ( rabbit polyclonal , diluted 1:500 , santa cruz , usa ) .
incubations with biotin - labeled goat secondary antibody ( abcam , cambridge , uk ) and streptavidin - horseradish peroxidase , both at room temperature for 15 min , were performed successively .
diaminobenzidine ( dab substrate kit , abcam , cambridge , uk ) was used to visualize the immunoreaction .
the ihc stains were examined to determine whether any igg4 + , foxp3 + , and il-17 + cells were present and , if so , in what numbers . the number of igg4 + cells was counted in 3 high - power ( 40 ) fields ( hpfs ) in the highest - density area of igg4 staining , and these 3 numbers were averaged to determine the greatest average density of igg4 + cells / hpf for each case .
the cells staining positive for foxp3 and il-17 were counted in 5 hpfs in the area of maximum density and averaged to 1 hpf .
univariate analyses were performed using 2-tailed t test and test ( or fischer s exact test when appropriate ) .
multivariate logistic regression analysis adjusted for age and sex was performed to evaluate an independent association among clinical features of type 1 aip vs. non - aip cp .
the data were analyzed using spss software version 13.0 ( spss inc , chicago , il ) .
because diagnosis of aip is primarily based on pathological features , clinically suspected type 1 aip and non - aip cp cases with pancreatic specimens were all reviewed at sun yat - sen memorial hospital from january 2000 to december 2013 .
the diagnosis of type 1 aip was according to icdc [ details described in ref .
the diagnosis of non - aip cp followed the diagnostic criteria in china and italy : ( 1 ) clinical manifestations : recurrent abdominal pain or acute pancreatitis ; ( 2 ) histopathological examination : pancreatic gland bubble destruction , pancreatic fibrosis , duct dilation , and cyst formation ; ( 3 ) imaging findings : pancreatic calcification or calculus pancreas growth or reduction , contour irregularity , irregular dilation of pancreatic duct , and pancreatic pseudocyst ; ( 4 ) laboratory tests : pancreatic exocrine insufficiency .
a definitive diagnosis of cp could be made with ( 2 ) or ( 3 ) and a diagnosis of suspected cp was made by ( 1 ) and ( 4 ) . only cases with a definitive diagnosis of cp
cases that were in accordance with the inclusion standard of the aip group were excluded from the non - aip cp group .
the following data of the 2 groups were collected and compared : ( 1 ) age and sex ; ( 2 ) symptoms like abdominal pain , obstructive jaundice , abnormal stool , weight loss , diabetes mellitus , and combination with other autoimmune diseases ; ( 3 ) serological data : -glutamyl transferase ( -gt ) , alkaline phosphatase ( alp ) , total bilirubin ( tbil ) , alanine aminotransferase ( alt ) , serum amylase ( samy ) , lipase ( lps ) , carbohydrate antigen 19 - 9 ( ca19 - 9 ) , serum globulin , and autoantibodies ; ( 4 ) examination results of computed tomography ( ct ) , magnetic resonance imaging ( mri ) , and magnetic resonance cholangiopancreatography ( mrcp ) ; and ( 5 ) histopathological features in the pancreas .
this study was approved by the ethics committee of sun yat - sen memorial hospital .
one paraffin block from each case was selected for immunohistochemical ( ihc ) staining for igg4 , foxp3 , and il-17 .
the ihc staining was performed as follows : serial sections of each sample were cut at 5 m , baked in an oven at 60c for at least 60 min , deparaffinized , rehydrated , and pretreated with citric acid at ph 6.0 .
all sections were incubated with normal non - immune goat serum for 15 min at room temperature .
sections were incubated overnight with the primary antibodies directly against igg4 ( rabbit polyclonal , diluted 1:500 , abcam , cambridge , uk ) , foxp3 ( rabbit polyclonal , diluted 1:500 , abcam , cambridge , uk ) , and il-17 ( rabbit polyclonal , diluted 1:500 , santa cruz , usa ) .
incubations with biotin - labeled goat secondary antibody ( abcam , cambridge , uk ) and streptavidin - horseradish peroxidase , both at room temperature for 15 min , were performed successively .
diaminobenzidine ( dab substrate kit , abcam , cambridge , uk ) was used to visualize the immunoreaction .
the ihc stains were examined to determine whether any igg4 + , foxp3 + , and il-17 + cells were present and , if so , in what numbers .
the number of igg4 + cells was counted in 3 high - power ( 40 ) fields ( hpfs ) in the highest - density area of igg4 staining , and these 3 numbers were averaged to determine the greatest average density of igg4 + cells / hpf for each case .
the cells staining positive for foxp3 and il-17 were counted in 5 hpfs in the area of maximum density and averaged to 1 hpf .
univariate analyses were performed using 2-tailed t test and test ( or fischer s exact test when appropriate ) .
multivariate logistic regression analysis adjusted for age and sex was performed to evaluate an independent association among clinical features of type 1 aip vs. non - aip cp .
the data were analyzed using spss software version 13.0 ( spss inc , chicago , il ) .
twenty - nine cases of type 1 aip and 20 cases of non - aip cp ( 6 alcoholic , 3 hyperlipidemia , 5 obstructive , and 6 idiopathic ) were enrolled at our institution from january 2000 to december 2013 . the clinical symptoms of type 1 aip and non - aip cp are shown in table 1 . in the type 1 aip group ,
the average age of type 1 aip was 54.8 years , older than that of non - aip cp ( 45.9 years ) .
abdominal pain was the most frequent symptom in type 1 aip ( 69.0% ) , followed by obstructive jaundice ( 62.1% ) and weight loss ( 34.5% ) .
obstructive jaundice was more common in type 1 aip than in non - aip cp ( 62.1% vs. 30.0% , p=0.042 ) .
three cases complicated with other autoimmune diseases were found in the type 1 aip group , 2 with sjgren syndrome and 1 with systemic lupus erythematosus ( sle ) .
by contrast , none of autoimmune disease was observed in the non - aip cp group .
the 2 groups did not show statistically significant differences in the frequencies of abdominal pain , abnormal stool , weight loss , and diabetes mellitus .
obstructive jaundice was associated with type 1 aip after multivariate analysis ( p=0.036 ; table 1 ) .
the serological data of the type 1 aip group compared with the non - aip cp group are shown in table 2 .
the frequencies of elevated -gt , tbil , lps , and ca19 - 9 levels in the type 1 aip group were higher than those in the non - aip cp group ( p=0.046 , 0.042 , 0.007 , and 0.019 , respectively ) .
there were no statistically significant differences in the frequencies of elevated alp , alt , and samy between type 1 aip and non - aip cp groups .
nineteen patients in the type 1 aip group were tested for igg , antinuclear antibody ( ana ) , anti - double - stranded dna ( anti - dsdna ) antibody , rheumatoid factor ( rf ) , and anti - sjgren s syndrome antigen - a / b ( anti - ssa / ssb ) antibodies .
ana was positive in 5 ( 26.3% ) patients , anti - dsdna antibody in 3 ( 15.8% ) patients , and rf in 1 ( 5.2% ) patient .
the tests of igg , ana , anti - dsdna antibody , rf , and anti - ssa / ssb antibodies were performed on only 3 patients in the non - aip cp group and all were in the normal range .
ct , mri , and mrcp were performed on all the type 1 aip and non - aip cp patients ( figures 1 and 2 ) .
diffuse or segmental enlargement of the pancreas with delayed enhancement was more frequent in type 1 aip than in non - aip cp ( 72.4% vs. 40.0% , p=0.038 ) .
by contrast , pancreatic atrophy , pancreatic pseudocyst , and pancreatic duct dilation were more common in non - aip cp than in type 1 aip ( p=0.050 , < 0.001 , and < 0.001 , respectively ) .
multivariate analysis showed that pancreatic atrophy and pancreatic duct dilation remained independent and significantly different associations between type 1 aip and non - aip cp ( p=0.047 and p=0.005 , respectively ) , but other variables lost their significance . because pathology testing is essential to diagnose aip , all the enrolled cases had pancreatic specimens taken : 19 resections and 10 biopsies in the type 1 aip group and 8 resections and 12 biopsies in the non - aip cp group .
pancreatic parenchymal atrophy and fibrosis were remarkable in the type 1 aip group and non - aip cp group ( figure 3 ) . in the type 1 aip group , extensive infiltration of lymphocytes was observed , distributed primarily along the medium- and large - sized pancreatic duct , and partially invading small veins within the lesion area ( figure 3c ) .
eosinophil infiltration was also observed in some cases of type 1 aip ( figure 3c ) . by contrast ,
ihc findings of igg4 , foxp3 , and il-17 in type 1 aip and non - aip cp groups are shown in figure 4 and in tables 4 and 5 .
compared with non - aip cp , igg4 + and foxp3 + cells were more frequent in type 1 aip ( both p<0.001 ) .
in addition , the average of il-17 + cells was 8.88.2 cells / hpf in type 1 aip , which was similar to that in non - aip cp ( 7.97.9 cells / hpf ; p=0.696 ) .
furthermore , correlation of igg4 with foxp3 and il-17 in the type 1 aip group was analyzed and the results are shown in figure 5 .
foxp3 + cell counts correlated closely with igg4 + cell counts in the pancreas of type 1 aip ( r=0.930 , p<0.001 ) . however , il-17 + cells had no correlation with igg4 + cells ( p=0.650 ) .
twenty - nine cases of type 1 aip and 20 cases of non - aip cp ( 6 alcoholic , 3 hyperlipidemia , 5 obstructive , and 6 idiopathic ) were enrolled at our institution from january 2000 to december 2013 . the clinical symptoms of type 1 aip and non - aip cp are shown in table 1 . in the type 1 aip group ,
the average age of type 1 aip was 54.8 years , older than that of non - aip cp ( 45.9 years ) .
abdominal pain was the most frequent symptom in type 1 aip ( 69.0% ) , followed by obstructive jaundice ( 62.1% ) and weight loss ( 34.5% ) .
obstructive jaundice was more common in type 1 aip than in non - aip cp ( 62.1% vs. 30.0% , p=0.042 ) .
three cases complicated with other autoimmune diseases were found in the type 1 aip group , 2 with sjgren syndrome and 1 with systemic lupus erythematosus ( sle ) .
by contrast , none of autoimmune disease was observed in the non - aip cp group .
the 2 groups did not show statistically significant differences in the frequencies of abdominal pain , abnormal stool , weight loss , and diabetes mellitus .
obstructive jaundice was associated with type 1 aip after multivariate analysis ( p=0.036 ; table 1 ) .
the serological data of the type 1 aip group compared with the non - aip cp group are shown in table 2 .
the frequencies of elevated -gt , tbil , lps , and ca19 - 9 levels in the type 1 aip group were higher than those in the non - aip cp group ( p=0.046 , 0.042 , 0.007 , and 0.019 , respectively ) .
there were no statistically significant differences in the frequencies of elevated alp , alt , and samy between type 1 aip and non - aip cp groups .
nineteen patients in the type 1 aip group were tested for igg , antinuclear antibody ( ana ) , anti - double - stranded dna ( anti - dsdna ) antibody , rheumatoid factor ( rf ) , and anti - sjgren s syndrome antigen - a / b ( anti - ssa / ssb ) antibodies .
ana was positive in 5 ( 26.3% ) patients , anti - dsdna antibody in 3 ( 15.8% ) patients , and rf in 1 ( 5.2% ) patient .
the tests of igg , ana , anti - dsdna antibody , rf , and anti - ssa / ssb antibodies were performed on only 3 patients in the non - aip cp group and all were in the normal range .
ct , mri , and mrcp were performed on all the type 1 aip and non - aip cp patients ( figures 1 and 2 ) .
diffuse or segmental enlargement of the pancreas with delayed enhancement was more frequent in type 1 aip than in non - aip cp ( 72.4% vs. 40.0% , p=0.038 ) .
by contrast , pancreatic atrophy , pancreatic pseudocyst , and pancreatic duct dilation were more common in non - aip cp than in type 1 aip ( p=0.050 , < 0.001 , and < 0.001 , respectively ) .
multivariate analysis showed that pancreatic atrophy and pancreatic duct dilation remained independent and significantly different associations between type 1 aip and non - aip cp ( p=0.047 and p=0.005 , respectively ) , but other variables lost their significance .
because pathology testing is essential to diagnose aip , all the enrolled cases had pancreatic specimens taken : 19 resections and 10 biopsies in the type 1 aip group and 8 resections and 12 biopsies in the non - aip cp group .
pancreatic parenchymal atrophy and fibrosis were remarkable in the type 1 aip group and non - aip cp group ( figure 3 ) . in the type 1 aip group , extensive infiltration of lymphocytes was observed , distributed primarily along the medium- and large - sized pancreatic duct , and partially invading small veins within the lesion area ( figure 3c ) . eosinophil infiltration was also observed in some cases of type 1 aip ( figure 3c ) . by contrast ,
ihc findings of igg4 , foxp3 , and il-17 in type 1 aip and non - aip cp groups are shown in figure 4 and in tables 4 and 5 .
compared with non - aip cp , igg4 + and foxp3 + cells were more frequent in type 1 aip ( both p<0.001 ) .
in addition , the average of il-17 + cells was 8.88.2 cells / hpf in type 1 aip , which was similar to that in non - aip cp ( 7.97.9 cells / hpf ; p=0.696 ) .
furthermore , correlation of igg4 with foxp3 and il-17 in the type 1 aip group was analyzed and the results are shown in figure 5 .
foxp3 + cell counts correlated closely with igg4 + cell counts in the pancreas of type 1 aip ( r=0.930 , p<0.001 ) .
however , il-17 + cells had no correlation with igg4 + cells ( p=0.650 ) .
since yoshida first proposed the concept of aip in 1995 , the awareness and understanding of aip has been increasing .
according to recent reports , aip is classified into 2 distinct types : type 1 lpsp and type 2 idcp .
in contrast , type 2 aip is mainly found in europe and america , and rarely in asia . in this study , we focused on the clinical features and expressions of foxp3 and il-17 in type 1 aip in china and compared them with non - aip cp to identify factors for differentiation of the 2 diseases . currently , type 1 aip is recognized as an igg4-related systematic autoimmune disease involving the pancreas and extrapancreatic organs ( liver , biliary systems , salivary glands , retroperitoneum , kidneys , lymph nodes , or thyroid gland ) .
sclerosing cholangitis was the most frequent extrapancreatic lesion , presenting obstructive jaundice and lower or upper bile duct stenosis . moreover , hepatobiliary system involvement usually presented elevated tbil , -gt , alp , and ca19 - 9 . in biochemical blood testing ,
3982% of cases were reported to be associated with an increase of tbil , -gt , and alp ; and 3559% of cases were associated with an increase of ca19 - 9 . elevated amy and lps were also reported in 3664% of cases , indicating pancreatic injury in type 1 aip . in our study , most aip patients had obstructive jaundice and elevated -gt , alp , tbil , ca19 - 9 , amy , and lps levels . compared with non - aip cp , elevated -gt , tbil , ca19 - 9 , and lps levels were more frequent in type 1 aip .
however , after multivariate analysis , all variables lost their significance , possibly because the sample was too small to have sufficient statistical power .
igg4 > 1350 mg / l indicates the diagnosis of type 1 aip , with sensitivity and specificity of 5280% and 97%98% , respectively .
the reported positive ratios of ana and rf are 60% and 2030% , respectively . in this study , 78.9% of type 1 aip cases
had increased serum igg ; 26.3% and 5.2% cases had ana and rf . because the clinical measurement of serum igg4 levels was not available in our hospital during the study , it was impossible to provide detailed information on serum igg4 levels . with increasing awareness of aip
diffuse or segmental enlargement with delayed enhancement ( sometimes associated with rim - like enhancement ) of the pancreas without pancreatic duct dilatation / cutoff was the characteristic change in aip .
additionally , aip often involves the bile duct and causes bile duct stenosis , especially in the pancreatic section .
our study found 34.5% of aip cases with diffuse pancreatic enlargement and 31.0% of cases with focal enlargement in the pancreatic head .
moreover , the diffuse or segmental enlargement of the pancreas was more frequent in type 1 aip than in non - aip cp ( 72.4% vs. 40.0% , p=0.038 ) .
in contrast , pancreatic atrophy , pancreatic pseudocyst , and pancreatic duct dilation were more common in non - aip cp than in type 1 aip .
however , we did not detect the capsule - like rim , which is the unique imaging feature of aip , reported in 25% cases .
pathological examination revealed that type 1 aip was characterized by dense lymphocyte infiltration , snowstorm - like fibrosis , occlusive phlebitis , and numerous igg4 + cell infiltrations [ 1925 ] .
dhall et al . reported that using a cutoff of 50 igg4-positive cells / hpf , the sensitivity and specificity for type 1 aip vs. other types of pancreatitis was 84% and 100% .
another recent study found high levels of igg4 staining ( > 10 igg4 + cells / hpf ) in 17 of 20 ( 85% ) aip pancreatic and extrapancreatic specimens compared with 1 of 175 ( 0.6% ) control specimens , and positive igg4 staining enabled a definitive diagnosis in 91% of aip patients . in our study , 37.9% cases had > 50 igg4 + cells / hpf and all the type 1 aip patients had > 10 igg4 + cells / hpf .
by contrast , in non - aip cp group , 45% cases had no igg+ cell infiltration , and others had < 10 igg+ cells / hpf .
, showing that numerous igg4 + cell infiltration was helpful to differentiate the diagnosis of type 1 aip and non - aip cp .
foxp3 is a specific marker of cd4+cd25 + tregs , which play a critical role in immune tolerance .
. a higher expression level of foxp3 mrna in tissue was observed in igg4-related sclerosing pancreatitis and cholangitis , as well as larger infiltrates of cd4+cd25 + treg cells at involved organs and increased numbers of cd4+cd25 treg cells in the blood .
furthermore , tregs can produce il-10 and tgf- , which could be followed by igg4 class switching and fibroplasia .
our results showed that foxp3 + cells were significantly more frequent in type 1 aip compared with non - aip cp . a positive correlation of foxp3 + with igg4 + cells was also observed .
these results suggest that foxp3 + cells might be involved in the pathogenesis of type 1 aip and can be helpful in distinguishing type 1 aip from non - aip cp .
il-17 is a proinflammatory cytokine mainly produced by th17 cells , which plays an important role in the fibrosis associated with chronic inflammation , multiple sclerosis , and rheumatoid arthritis .
il-17 can induce the production of many cytokine ( such as il-16 , tgf- , and granulocyte colony - stimulating factor ) , attract neutrophils , and cause massive inflammation and fibrosis [ 3032 ] . increasing il-17 expression
however , our study indicated that il-17 + cells in type 1 aip were similar to those in non - aip cp , perhaps because both type 1 aip and non - aip cp have marked fibrosis and il-17 is associated with the fibrosis of chronic inflammation . moreover , il-17 + cells had no correlation with igg4 + cells .
these results indicate that il-17 + cells might not be useful for differentiation between type 1 aip and non - aip cp .
furthermore , only cases with pathological specimens are included , which ensured the correct diagnosis , but could have excluded type 1 aip in cases without pathological specimens and cause selection bias . therefore , further prospective studies with larger sample size are needed to confirm the results of this study .
type 1 aip is a unique type of chronic pancreatitis and has distinctive symptoms , serological , imaging , and pathological characteristics , which could be used for differentiation from non - aip cp .
foxp3 + cells might be helpful to distinguish type 1 aip from non - aip cp .
Output:
| backgroundautoimmune pancreatitis ( aip ) is a distinct type of pancreatitis associated with a presumed autoimmune mechanism .
the aim of this study was to analyze the clinical features and expressions of forkhead box p3 ( foxp3 ) and interleukin-17 ( il-17 ) in type 1 aip in china and to identify factors for differentiation of aip from non - aip chronic pancreatitis ( cp).material / methodswe retrospectively reviewed pancreatic specimens with diagnosis of type 1 aip and non - aip cp at sun yat - sen memorial hospital in china from january 2000 to december 2013 .
the clinical symptoms , serological data , imaging findings , histopathology , and immunohistochemical findings of foxp3 and il-17 in the 2 groups were analyzed.resultstwenty-nine patients with type 1 aip and 20 patients with non - aip cp were enrolled .
obstructive jaundice was more common in type 1 aip than in non - aip cp ( 62.1% vs. 30.0% , p=0.042 ) .
the diffuse or segmental enlargement of the pancreas was more frequent in type 1 aip than in non - aip cp ( 72.4% vs. 40.0% , p=0.038 ) .
histopathology of type 1 aip presented dense lymphoplasmacytic infiltration , snowstorm - like fibrosis and abundant immunoglobulin ( ig ) g4 + cells .
foxp3 + cells were more frequently observed in type 1 aip than in non - aip cp .
il-17 + cell infiltration was similar between the 2 groups .
furthermore , a positive correlation was found between foxp3 + and igg4 + cell counts in the pancreas of patients with type 1 aip.conclusionstype 1 aip has distinctive symptoms , image , and pathological characteristics , which could be used for differentiation from non - aip cp .
foxp3 + cells might be helpful to distinguish type 1 aip from non - aip cp . |
PubmedSumm119617 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the relatively small and non - repetitive nature of microbial genomes , coupled with the rapid advancement of sequencing technology in the last decade , have led to the generation of a staggering amount of bacterial genome records .
the national center for biotechnology information ( ncbi ) genome database currently maintains genome records for over 3000 high quality reference and representative genome assemblies and another 50 000 incomplete assemblies .
the existing collections of genomes are just the beginning ; the earth microbiome project ( 1 ) http://www.earthmicrobiome.org ) is in the early stages of analyzing and cataloguing over 200 000 environmental samples from around the world , and estimates that this will result in the sequencing of 500 000 reconstructed microbial genomes ( 1 ) . making sense out of this abundance of data , while a daunting challenge , will generate a wealth of knowledge for the microbial and human genomic research community . for microbial genomes , as well as most other biological data ,
knowledge is distributed across resources that occupy the full spectrum from very large , broad coverage , centralized , major government - funded institutions such as ncbi ( www.ncbi.nlm.nih.gov/gene , ( 2 ) ) and uniprot ( www.uniprot.org , ( 3 ) ) to boutique , topic - focused databases like the odb3 database of prokaryotic operons ( www.http://operondb.jp/ , ( 4 ) ) , to the unstructured primary literature .
the ability to process data smoothly from across that spectrum would greatly increase the efficiency of microbial research giving the researcher the ability to explore questions , based on existing evidence - based data , before any experimentation .
what other microorganisms influence the persistence of an infection by a human pathogen such as chlamydia , and by what mechanism?. an expert may generate hypothetical answers to this question by blending their knowledge with information spread through the literature and various databases . as an example , the statements illustrated in figure 1 , originating from multiple sources , including primary literature ( 58 ) , and structured databases such as ncbi gene , uniprot , drugbank ( www.drugbank.ca/ , ( 9 ) ) and brenda ( http://www.brenda-enzymes.info/ , ( 10 ) ) , link together to yield the hypothesis that co - infection by prevotella spp .
, clostridiales spp .
and escherichia coli in the vaginal microbiome increase the persistence of infection through the generation of indole ( 6,11,12 ) , a key substrate in the tryptophan biosynthesis pathway .
experts , like caldwell and colleagues ( 6 ) , have done the experiments and the literature research to generate the hypothesis that there is a greater risk of clearance failure , leading to persistent infection that should be treated appropriately , when these other indole - creating microbes are present ( 6,8 ) .
figure 1.illustration of the complex network of interacting entities between human , chlamydial , and other microbial species in the urogenital microbiome .
when a human epithelial cell is infected by c. trachomatis , it responds by depleting the cell of l - tryptophan , an essential amino acid for chlamydial growth , through ifn- mediated expression of the tryptophan degrading enzyme indoleamine 2,3-dioxygenase ( ido)(orange)(5,6 ) .
ido degrades tryptophan to n - formylkynurenine , a tryptophan precursor that c. trachomatis is not capable of converting into tryptophan .
often this clears the infection , but episodically c. trachomatis rescues itself from this host defense by converting exogenous indole into l - tryptophan through gene expression regulated by its trp operon(8 ) .
several experiments support the hypothesis that the likely source of exogenous indole is from other microbes in a perturbed vaginal microbiome ; as part of l - tryptophan degradation via the pyruvate pathway .
microbes producing tryptophanase ( yellow ) , an enzyme that degrades l - tryptophan to indole and pyruvate are commonly found in the urinary tract of patients also presenting with bacterial vaginosis ( bv)(7 ) .
examples of indole producers , commonly associated with bv in the female urogenital tract include prevotella spp . , e. coli and clostridiales spp .
blue urls indicate the various resources that maintain the data . the arrows between entities indicate the properties used to define their relationships once aggregated in wikidata .
illustration of the complex network of interacting entities between human , chlamydial , and other microbial species in the urogenital microbiome .
when a human epithelial cell is infected by c. trachomatis , it responds by depleting the cell of l - tryptophan , an essential amino acid for chlamydial growth , through ifn- mediated expression of the tryptophan degrading enzyme indoleamine 2,3-dioxygenase ( ido)(orange)(5,6 ) .
ido degrades tryptophan to n - formylkynurenine , a tryptophan precursor that c. trachomatis is not capable of converting into tryptophan .
often this clears the infection , but episodically c. trachomatis rescues itself from this host defense by converting exogenous indole into l - tryptophan through gene expression regulated by its trp operon(8 ) .
several experiments support the hypothesis that the likely source of exogenous indole is from other microbes in a perturbed vaginal microbiome ; as part of l - tryptophan degradation via the pyruvate pathway .
microbes producing tryptophanase ( yellow ) , an enzyme that degrades l - tryptophan to indole and pyruvate are commonly found in the urinary tract of patients also presenting with bacterial vaginosis ( bv)(7 ) .
examples of indole producers , commonly associated with bv in the female urogenital tract include prevotella spp . , e. coli and clostridiales spp .
blue urls indicate the various resources that maintain the data . the arrows between entities indicate the properties used to define their relationships once aggregated in wikidata . by pulling these pieces of knowledge together into a common database , with defined connections between them ,
a list of the taxa involved can be generated as candidate answers to the above question with a single query . once this is achieved and new data is added , the network grows and the collective benefit grows as well .
the complicated and disordered is given order in a central container with a mechanism for sifting through it , giving the microbial researcher a powerful tool for making sense of the published data .
model organism databases such as the mouse genome database ( http://nar.oxfordjournals.org/content/43/d1/d726.short ) mouse genome informatis ( mgi ) ( http://www.informatics.jax.org ) , would greatly aid researcher s ability to unlock connections between microbes and the organisms they interact with .
however , such large data warehouses are typically maintained by expensive teams of data and domain experts .
the immense scale of microbial data is economically incompatible with this kind of centrally funded approach , and the same resolution would not be achieved . in one way or another , the greater scientific community , encompassing both active scientists and interested members of the general public
must be empowered to contribute their mental energy in a community - wide collaborative effort ( 13 ) . here
wikidata is a new , centralized , yet openly editable platform for semantic knowledge representation that is maintained by the wikimedia foundation ( the same entity that maintains all of the 200 + different language wikipedias ) . centralizing structured knowledge in this open database
generates the opportunity to distribute the labor of data curation across a far broader community than was before realistic . in doing so
, it offers a new approach to the knowledge integration problem that is ideally suited to the challenge of representing the exploding body of information about microbial genomics .
here , we describe the initial work of building a wikidata - based representation of microbial genetics .
a centralized resource for microbial genomics will need to capture a wide variety of different kinds of entities and relationships to support useful queries . rather than attempt to build a system that models all of this complexity up - front
, we are taking the approach of seeding the openly extensible wikidata database with the beginnings of this model and thus encouraging the broader community to see the opportunity to collaborate on its evolution .
its schema - free nature naturally supports data model changes and its open , wiki - based nature supports constructs such as
watchlists and wikiprojects that have proven effective in facilitating the attainment of community consensus over time in other open projects such as the genewiki ( 14 , 15 ) . on a technical level
it has no overarching schema to ordain what kind of data elements can be linked together .
in contrast to a standard relational model , this empowers database contributors to freely expand connections as they see fit .
the only constraints on the structure of the graph are socially imposed . to add new content to wikidata ,
would - be editors need to either use existing properties or make a request to the community that new properties be created .
property requests are openly discussed for a period of time until a consensus has been reached on their value to the system and how they should be applied .
this request process allows the community to control the emerging structure of the graph and reduce problems that might arise from completely unrestricted editing . as a starting point for seeding the collaborative creation of a centralized microbial database in wikidata ,
we established the structures needed to represent the entities and relations depicted in figure 1 . in the context of wikidata , this work amounts to the creation of a set of items and properties that are used to describe features of those items .
a wikidata item is defined by a unique identifier ( e.g. q131065 ) , a label ( i.e. chlamydia trachomatis ) , a description ( i.e. species of prokaryote ) and a set of claims about the item organized into statements ( figure 2 ) .
a statement consists of a triple with an item as the subject , a wikidata - defined property as the predicate ( i.e. taxon rank , property p105 ) , and another wikidata item or literal data value as the object .
optionally , a set of references can be added as evidence and provenance for the claim made by the triple , and qualifiers can specify the context where the claim is valid ( https://www.mediawiki.org/wiki/wikibase/data mode l / primer ) .
figure 2.example wikidata item . a wikidata item defined by its label , description and statements that provide annotations and create relationships with other items in the database .
example wikidata item . a wikidata item defined by its label , description and statements that provide annotations and create relationships with other items in the database .
the ontology of wikidata is determined by the set of properties that may be used to create claims about the items within it .
entities can be created at any time , but properties can only be created by elected administrators following community discussion . the properties needed to support our current data model are listed in table 1 .
it is worth noting that most of these properties are either generic ( i.e. subclass of ) or were defined by the molecular biology wikiproject ( https://www.wikidata.org/wiki/wikidata:wikiproject_molecular_biology ) before the outset of the present work on microbial genomes . likewise
, many requisite items , e.g. entities representing drugs and enzymes , were also present at the outset of the project and continue to be improved by members of the community .
already , wikidata is showing how an open system can evolve over time with subsequent efforts building directly on prior work .
table 1wikidate propertiesidnamevalue typep685ncbi taxonomy idstringp105taxon rankwikidata itemp171parent taxonwikidata itemp2249refseq genome idstringp1542cause ofwikidata itemp351entrez gene idstringp279subclass ofwikidata itemp703found in taxonwikidata itemp644genomic startstringp645genomic endstringp702uniprot idstringp637refseq protein idstringp702encoded bywikidata itemp688encodeswikidata itemp680molecular functionwikidata itemp681cellular componentwikidata itemp682biological processwikidata itemp361part ofwikidata itemp128regulateswikidata itemp1056productwikidata itemp2175medical condition treatedwikidata itemp2176drug used for treatmentwikidata item some of the general purpose properties such as product , part of , cause of and regulates are currently used to establish the connections in figure 1 , but are likely to be replaced or extended with more biology - specific relations ( such as precursor and substrate of ) over time .
the other aspects of the current model that are more specific to representing microbial data are depicted in figure 3 .
the basic framework of the microbial genetic data model in wikidata showing items and the statements that connect them .
item types are demarcated by label and color ( i.e. gene item = blue and protein item = orange ) .
data model template .
the basic framework of the microbial genetic data model in wikidata showing items and the statements that connect them .
item types are demarcated by label and color ( i.e. gene item = blue and protein item = orange ) . one key requirement for modeling microbial data
microbiome and genomic research require the ability to do both intra- and interspecies comparative analysis . to support this work
, our model follows a hierarchical taxonomy ranking scheme with the microbial species assigned to a wikidata item ( i.e. c.
trachomatis # q131065 ) defined by the core properties ncbi taxonomy id ( p685 ) ( 813 ) ,
since genome annotations are based on the genome assembly of the specific strain sequenced and that genome assembly has its own unique identifier ( i.e. ncbi refseq genome accession number ) , strain level distinction is critical in bacteria .
q20800373 ) include the same core properties as a species item , the refseq genome id ( p2249 ) , and are linked to the species item via the parent taxon
, the gene and protein must be kept as distinct entities , while maintaining their connections for queries down the line .
a microbial gene item contains the similar core properties of a human gene item , including entrez gene id ( p351 ) and subclass of ( p279 ) , but , found in taxon ( p703 ) was added to distinguish which strain / genome assembly this particular gene came from .
the gene links to its product item via the encodes ( p688 ) property and reciprocally , the protein item will link to the gene that encoded it by the encoded by ( p702 ) property .
core properties for microbial protein include refseq protein i d ( p637 ) , uniprot id ( p352 ) , found in taxon ( p703 ) and subclass of ( p279 ) .
functional annotations are downloaded from the uniprot protein record and included here as subclasses of the gene ontology terms , molecular function ( p680 ) , cellular component ( p681 ) and biological process ( p682).
given the data model depicted in figure 3 and encapsulated in the properties listed in table 1 , we have seeded wikidata with representative content for 21 species of bacteria totaling 43 694 gene and 37 966 protein items , from various public databases .
bot , a program for making automated edits in wikidata , with source code available at www.bitbucket.org/sulab/wikidatabots/src .
in addition , we manually established all of the wikidata items and relationships needed to realize the operon data structure in figure 1 .
this information can be accessed through the various apis offered by wikidata ( https://www.wikidata.org/w/api.php , https://query.wikidata.org/ ) . as an example
, a user can easily retrieve all genes , proteins , and gene ontology annotations for the two strains of chlamydia that are currently loaded using a wikidata sparql query ( figure 4 ) .
figure 4.sparql query for all microbial genes , proteins and associated gene ontology annotations in wikidata .
properties used : p351 = entrez_gene_id , p688 = encodes , p703 = found in taxon , p352 = uniprot_id , p171 = parent taxon .
note that the * operator on p171 * results in a recursive search for organisms that descend from wd : q10876 ( bacteria ) .
this query may be executed at https://query.wikidata.org/.
sparql query for all microbial genes , proteins and associated gene ontology annotations in wikidata .
properties used : p351 = entrez_gene_id , p688 = encodes , p703 = found in taxon , p352 = uniprot_id , p171 = parent taxon .
note that the * operator on p171 * results in a recursive search for organisms that descend from wd : q10876 ( bacteria ) .
this query may be executed at https://query.wikidata.org/. note that the query actually requests this information for all bacteria through the ?
taxa wdt : p171 * ( parent taxons ) wd : q10876 ( bacteria) aspect of the query . as more bacterial genomes are loaded by us or other groups , the same query will return more and more data . as another example , the following sparql query returns all operons , their regulators and their products ( figure 5 ) .
figure 5.sparql query for all operons , their regulators , the taxon that expresses them and their functional products in wikidata .
q139677 is the wikdata item for the class operon. properties used : p279 = subclass of , p527 = has part , p1056 = product , p128 = regulates , p688 = encodes , p703 = found in taxon .
this query may be executed at https://query.wikidata.org/.
sparql query for all operons , their regulators , the taxon that expresses them and their functional products in wikidata .
q139677 is the wikdata item for the class operon. properties used : p279 = subclass of , p527 = has part , p1056 = product , p128 = regulates , p688 = encodes , p703 = found in taxon .
this query may be executed at https://query.wikidata.org/. revisiting the example question illustrated in figure 1 regarding organisms that are likely to be related to the persistence of chlamydial infections , we can ask what microbes are located in the female urogential tract and capable of generating indole ( figure 6 ) . this query returns e.
coli iai39 , a bacterial strain commonly found in patients with a perturbed vaginal microbiome ( 7 ) .
this query implicates an additional microbe suspect in chlamydial evasion of the host immune response . with disease
drug mappings in wikidata , imported from the national drug file - reference terminology ( ndf - rt ) database ( 17 ) , queries that identify antibiotic compounds with action against e. coli , c. trachomatis or both are possible ( figure 7 ) .
these queries could inform an alternative treatment strategy that also targets the indole - producing bacteria in the vaginal microbiome , as was suggested by the original authors of the hypothesis ( 6 ) .
figure 6.sparql query for all organisms that are located ( p276 ) in the female urogential tract ( wd : q5880 ) and that have a gene with product ( p1056 ) indole ( wd : q319541 ) .
this query may be executed at https://query.wikidata.org/.
figure 7.sparql query for all drugs used for treatment ( p2176 ) for commensal e. coli infectious disease ( q18975220 ) , chlamydia infection ( q153356 ) and both e. coli and chlamydia infections with a venn diagram display of the results .
these queries may be executed at https://query.wikidata.org/.
sparql query for all organisms that are located ( p276 ) in the female urogential tract ( wd : q5880 ) and that have a gene with product ( p1056 ) indole ( wd : q319541 ) .
this query may be executed at https://query.wikidata.org/. sparql query for all drugs used for treatment ( p2176 ) for commensal e. coli infectious disease ( q18975220 ) , chlamydia infection ( q153356 ) and both e. coli and chlamydia infections with a venn diagram display of the results .
wikidata is certainly not a replacement for core data curation centers such as ncbi and uniprot .
but it could form the basis for a complementary , stable and cost - effective approach for capturing content that is either left trapped in the literature or represented only in small databases subject to the perils of funding cuts and general link rot . though the microbial queries listed above currently return only a small fraction of the relevant content that exists in the world
, the power of the wikidata approach is that our seedling database can be extended by anyone with the will to do so .
wikidata is now edited by > 15 000 active users and currently has over 15 million content pages ( https://www.wikidata.org/wiki/special:statistics ) .
because of its open structure , its change tracking features and its evidence - capturing data model , it encourages community participation at all levels .
while the community consensus building process can be slow and at times frustrating , it drives the stability and quality of wikidata content .
even government - backed institutions like ncbi and european bioinformatics institute ( ebi ) ( http://www.ebi.ac.uk/ ) are vulnerable to funding cuts depending on the political climate .
the unique connection between wikidata and all the wikipedias already make it one of the most well - known and easily discoverable knowledge bases in the world ( 19 , 20 ) .
data deposited here is far less likely to be lost , especially when care is taken to weave it into what already exists .
every item loaded to wikidata ( mediawiki foundation s third most active project ) becomes a fixed point in a stable , self - sustaining knowledge representation platform that anyone can add to , and anyone can help the network grow through sharing the benefits of their own expertise .
the open access , community - driven nature of wikidata contributes to its perpetuity , but the major enduring factor is its universal utility .
wikidata is a place for knowledge of any conceivable topic from surfing ( q159992 ) to bacteria ( q10876 ) .
this variety of topics generates community support that a domain - specific , funding - dependent database can not compete with .
in addition to support , wikidata creates the ability to link a surfboard ( q457689 ) to surfing ( q159992 ) , the sport ( p641 ) it is used in , or c.
trachomatis d / uw-3/cx ( q20800373 ) to pelvic inflammatory disease ( q558070 ) , a disease it is the cause of ( p1542 ) in humans ( q5 ) .
moreover , in principle , it allows microbial genetics data to be linked to data from related fields , including pharmacology and epidemiology .
these relationship examples highlight another powerful virtue of wikidata compared to other data storage platforms ; adding data to wikidata requires the use of meaningful properties for relating entities .
it is insufficient to simply state rdf : seealso as the link between two related entities ( as many major databases do in their resource description framework ( rdf ) ( https://www.w3.org/rdf/ ) representations ) .
a relationship between items can not be added without an appropriate property in place , requiring the data model to be defined prior to importing the data .
this process of creating properties through community discussion and consensus drives the development of their ontology up - front , rather than forcing the burden of integrating ambiguous content downstream to consumers .
although wikidata provides an excellent framework for housing some forms of data , it has some limitations .
it is a database of referenced claims about the world and should not , for example , be a repository for sequences or raw expression data .
there is no built - in reasoning in wikidata . unlike other semantic web implementations ,
e.g. those built using the owl ontology language ( 21 ) , the current wikidata system can not be used to infer new facts nor to automatically cdisrupted by edits from both well - intentioned editors and , at least theoretically , by malicious users ( though true vandalism has thus far not happened at detectable levels ) . in practice , system - level limitations on heck the logical consistency of statements .
editors can not be constrained from making claims that may break data models spread across multiple items . as an openly editable resource ,
it is possible for data to be data integrity checking are dealt with through the operation of user - generated bots that patrol wikidata seeking and correcting problems as they arise . in terms of inferring new facts based on what is represented in wikidata , it is possible to load all of its contents into external implementations that support this kind of reasoning via frequently updated exports of the entire database ( https://www.wikidata.org/wiki/wikidata : data base_download ) .
apart from limits on what content can be stored and what operations can be applied to that content , wikidata is also constrained in terms of user interface .
when users browse items online at https://wikidata.org , they are seeing one interface for viewing and editing items ranging from protein domains to dutch history museums .
while it is possible to use this interface to find useful information , e.g. all the connections that form the network of knowledge depicted in figure 1 can be clicked through , it is certainly not the most ideal human interface for this task . for developers ,
the sparql query interface provides the most effective way to access data . for end - users ,
these applications will support both effective information retrieval and visualization , but can also support direct curation of the content by domain experts .
even in consideration of these limits , wikidata is a tremendous potential platform for managing the process of collaboratively understanding microbial genomics . in support of this objective ,
our immediate next steps are to load the remaining 99 microbial reference genomes from ncbi ( http://www.ncbi.nlm.nih.gov/genome/browse/reference/ ) , encompassing bacteria that are the most studied and relevant to human health .
these items will form a foundation upon which we invite the microbial research community to collaboratively synthesize their knowledge as it evolves into the future .
in addition to loading this data , we are collaborating on the development of an extension to the web apollo genome browser that will allow genome annotations from wikidata to be viewed and edited directly within this popular tool ( 22 ) .
we see this as the first of many bioinformatics applications that can be enhanced by wikidata content and can enable expert users to contribute to its collaborative curation .
we invite and encourage the rest of the scientific community to join our cause in creating this universal microbial genomics resource .
we have shown that the aggregation of a subset of data enables powerful queries that demonstrate the potential of connecting data from fragmented sources into a centralized , well - defined structure .
in addition to data that can be collected from structured data sources and aggregated in wikidata by bot , a great deal of important information resides only in primary literature .
it is thus imperative that we engage the microbial research community to help build wikidata to its potential ; a centralized , semantic web compatible mechanism for making sense of mountains of microbial genetic data .
this work is supported by the national institutes of health under grant gm089820 , gm083924 , gm114833 and da036134 .
Output:
| the last 20 years of advancement in sequencing technologies have led to sequencing thousands of microbial genomes , creating mountains of genetic data . while efficiency in generating the data improves almost daily , applying meaningful relationships between taxonomic and genetic entities on this scale requires a structured and integrative approach .
currently , knowledge is distributed across a fragmented landscape of resources from government - funded institutions such as national center for biotechnology information ( ncbi ) and uniprot to topic - focused databases like the odb3 database of prokaryotic operons , to the supplemental table of a primary publication . a major drawback to large scale , expert - curated databases is the expense of maintaining and extending them over time .
no entity apart from a major institution with stable long - term funding can consider this , and their scope is limited considering the magnitude of microbial data being generated daily .
wikidata is an openly editable , semantic web compatible framework for knowledge representation .
it is a project of the wikimedia foundation and offers knowledge integration capabilities ideally suited to the challenge of representing the exploding body of information about microbial genomics .
we are developing a microbial specific data model , based on wikidata s semantic web compatibility , which represents bacterial species , strains and the gene and gene products that define them .
currently , we have loaded 43 694 gene and 37 966 protein items for 21 species of bacteria , including the human pathogenic bacteria chlamydia trachomatis . using this pathogen as an example
, we explore complex interactions between the pathogen , its host , associated genes , other microbes , disease and drugs using the wikidata sparql endpoint . in our next phase of development
, we will add another 99 bacterial genomes and their gene and gene products , totaling 900,000 additional entities .
this aggregation of knowledge will be a platform for community - driven collaboration , allowing the networking of microbial genetic data through the sharing of knowledge by both the data and domain expert . |
PubmedSumm119618 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: visual field assessment is a valuable test in the neuro - ophthalmology clinic for determining presence of visual field deficit , aiding localisation of pathological lesion , and for recording improvement , stabilization , or deterioration of the underlying condition .
static perimetry is often undertaken with the humphrey automated perimeter ( humphrey instruments , dublin , ca ) , whilst kinetic perimetry has most commonly been undertaken using the goldmann manual perimeter ( haag streit , switzerland ) .
both options , when directly compared , have been shown to reliably detect visual field loss [ 16 ] .
central static programmes such as the sita 30 - 2 strategy have been used most with humphrey perimetry in these studies . however , there is less information regarding the use of peripheral static programmes using humphrey perimetry . semiautomated kinetic perimetry ( skp )
has been further developed in recent years , most notably with the octopus 900 perimeter ( haag streit , switzerland ) .
assessment of the peripheral visual field in addition to assessment of the central field is often required in the evaluation of patients attending neuro - ophthalmology clinics . however , there is limited information available on the comparison of different peripheral visual field programmes .
thus , the purpose of this study was to directly compare skp using the octopus 900 perimeter to a peripheral static programme using the humphrey automated perimeter in a neuro - ophthalmology clinic .
a prospective cross - section study was undertaken with local ethical approval and in accordance with the tenets of the declaration of helsinki .
participants were not preselected for the study but were identified randomly ; that is , notes were taken consecutively from the list waiting for visual field assessment without prior knowledge of patient ability and cognition .
a selection bias existed in that the patients recruited to this study had been booked to an out - patient neuro - ophthalmology clinic for perimetry .
thus , there was an assumption that these patients had sufficient ability and cognition to undertake standard automated perimetry .
inclusion criteria were adult patients aged 18 years or older attending for visual field assessment , sufficient motor ability to sit at the perimeter unaided , able to press the response button , sufficient cognitive ability to understand and follow instructions for performing the test , willingness to undertake testing on both perimeters on the same day , and able to respond to both i4e and i2e target stimuli on octopus perimetry .
the exclusion criteria were patients with visual acuity less than 1.0 logmar , those unable to sit for the duration of perimetry assessment , follow instructions for performing the test , or too ill to complete the full assessment .
all patients underwent perimetry following full explanation of the purpose of the test and procedure . the full field 120 ( ff120 ) two zone programme was used as the peripheral static programme on the humphrey perimeter .
this programme consists of 120 stimulus locations with a higher density of locations in the nasal than temporal visual field .
for the purposes of standardisation and comparison in this study , a screening protocol was used for skp .
two stimuli of the same size ( 0.25 mm ) were used but of different intensity ( i4e , 1000 apostilbs and i2e , 100 apostilbs ) .
the peripheral visual field boundary and blind spot were assessed using a size i4e target .
a minimum of twelve vectors were assessed for the peripheral visual field and eight for the central visual field inclusive of vectors offset from the vertical and horizontal meridia moving centripetally , similar to previously reported testing strategies [ 7 , 8 ] . following assessment , the response points along each vector were joined to form the isopter for i4e and i2e targets , respectively . in addition , 56 static points ( 14 per quadrant ) were assessed within the central 30 degrees of the visual field using the i4e target ( figure 1 ) .
movement of the target on the octopus perimeter was set at 5/sec for determination of central and peripheral isopter boundaries and at 3/sec for determination of the blind spot boundary and quantification of boundaries of visual field defects .
the study protocol consisted of visual field assessment with both humphrey and octopus perimetry on the same day .
the order of testing was randomised as to which of the two assessment types was used first in order to take fatigue effect into consideration .
patients were assigned to one perimeter or another according to which perimeter was available for use at the time the patient was called for assessment . reliability was determined automatically by fixation loss and false positive and false negative responses on humphrey perimetry and by manually checking false positive and false negative responses on octopus perimetry .
poor reliability was deemed present with fixation losses and false positive and false negative responses of > 25% .
visual field results in both groups were assessed for presence or absence of visual field defects .
full ( normal ) visual fields by kinetic assessment were defined as visual field results with isopters for i4e and i2e falling within age - matched ranges and no focal defects within the isopter area ( apart from the blind spot in the temporal field ) .
visual field loss was defined as isopter boundaries constricted within the age - matched ranges which could be global constriction or a defect type .
defect types were classified according to a modified list based on those reported by pineles et al . and the ocular hypertension treatment study ( ohts ) and outlined in table 1 .
we added a category of functional visual field loss where the visual field defect followed a tubular or spiral pattern on testing .
one author assessed the results of octopus perimetry ( fr ) and the second author assessed the results of humphrey perimetry ( cn ) .
each reviewer was masked to patient identifiers and to the classification by the other reviewer .
further independent assessment of a sample of visual field results ( n = 36 ) was made by the third author ( mm ) who determined whether the paired humphrey and octopus results were a match or not . a direct comparison was made for octopus and humphrey perimetry results using the statistical package spss version 19 ( ibm spss statistics , usa ) .
bland - altman strategy was used to compare the differences between two independent measurements for duration of test versus the average test duration . when analysing the bland - altman results , we expected most of the differences to lie within 1.96 sd if normally distributed .
provided the differences within 1.96 sd would not be clinically important , we considered that the two methods can be used interchangeably .
we therefore set a clinical cutoff of within 1 minute as a clinically acceptable difference between perimeter test durations .
the chi - square test ( ) was used to evaluate correlation between detection of normal and abnormal test results by either perimeter .
kappa ( ) evaluation of agreement was used to correct the proportion of agreement between perimeters due to chance when evaluating intraobserver interpretation of visual field results .
a value of 1 was defined as perfect agreement , and a value of > 0.7 was deemed a strong agreement .
sixty - nine patients attending neuro - ophthalmology clinics underwent dual testing with humphrey ff120 and octopus skp perimetry during the same clinic visit .
five patients were subsequently excluded due to octopus perimetry being undertaken using a size iii4e target or i4e target only .
sixty - four remaining patients ( 113 eyes ) had diagnoses of posterior visual pathway pathology , anterior visual pathway pathology , functional impairment of visual field , and
thirty - one patients had diagnoses that were classed as neurological defects ( postchiasmal ) and 28 patients that were classed as ocular defects ( prechiasmal ) .
five patients had normal visual fields or nonspecific visual field defects classed as functional or spurious .
there were 29 females and 35 males with a mean age of 48 years ( sd 14 ) .
all patients were able to respond to both i4e and i2e target stimuli . on humphrey perimetry
the central and peripheral reference decibel level was a mean of 32.6 ( sd 2.4 ) .
the mean duration of assessment for skp was 4.54 minutes 0.18 compared to the mean duration for humphrey perimetry of 6.17 0.12 which was significantly different ( p = 0.0001 unpaired t test ) .
although the mean duration was higher for humphrey perimetry ( difference between means of 1.63 0.22 ) , bland altman analysis showed proportional change when the differences were compared between the two perimeters ( figure 2 ) .
the confidence intervals ranged from 5.25 to 2.01 minutes with differences exceeding our clinical cutoff of within 1 minute . with larger variances ,
skp showed longer test durations than humphrey perimetry ( 16 eyes ( 15% ) , table 3 ) .
80% of results ( 90 eyes ) were correctly matched for normal or abnormal visual fields using the i4e target versus humphrey ff120 ( table 4 ) , and 73.5% ( 83 eyes ) , correctly matched using the i2e target versus humphrey ff120 ( table 5 ) .
mismatch was due to the i4e isopter being classed as normal or showing only a partial defect or different defect to humphrey perimetry .
mismatch with the i2e target was due to the isopter being classed as normal , showing a different defect , partial defect , or being more constricted . in three eyes
only , the humphrey result was classed as normal while the octopus result was classed as showing a visual field defect . in all other discrepancies ,
the humphrey result was worse . when comparing the octopus field with combined i4e and i2e isopters ( i.e. , either or both targets detecting a defect ) to the humphrey result , a match for normal or abnormal fields was recorded in 87% ( 98 eyes ) .
three eyes ( 2.6% ) had normal humphrey results and abnormal octopus results , while three eyes ( 2.6% ) had normal octopus results and abnormal humphrey results .
the features of these match discrepancies are outlined in table 6 . on independent grading of a sample of results ,
80% of results ( 28 eyes ) were correctly matched for normal or abnormal visual fields using the i4e target versus humphrey ff120 ( table 7 ) , and 80% ( 28 eyes ) were correctly matched using the i2e target versus humphrey ff120 ( table 8) . when comparing the octopus field with combined i4e and i2e isopters to the humphrey result , a match for normal or abnormal fields was recorded in 83% ( 29 eyes ) .
the agreement between matching results by the first two authors versus independent matching by the third author was significant ( p = 0.0001 ) with 30 of 35 results being correctly matched ( = 0.8 ) . of the five results not correctly matched , each had been matched as abnormal for humphrey and octopus perimetry by the first authors but with a mismatch ( humphrey normal and octopus abnormal in four results , humphrey abnormal and octopus normal in two results ) by the third author .
for all comparisons , the humphrey result was classed as showing a worse field ( greater size of field defect ) in 38 eyes .
conversely , the octopus result was classed as showing a worse field in 20 eyes which was significantly less than humphrey perimetry , p = 0.001 ( test ) .
there was no significant difference for humphrey or octopus results being worse in abnormal visual field results due to either ocular or neurological causes ( p = 0.77 and p = 0.964 , respectively , test ) .
during humphrey ff120 perimetry there is an initial determination of central and peripheral threshold levels ( calculated in decibel values : db ) at the beginning of the test .
this is used to determine the individual 's reference hill of vision and stimuli are subsequently presented at the predetermined test locations at six decibel intensities higher than the expected threshold for each location .
a mean reference level of 32.6 db ( sd 2.4 ) was calculated for the humphrey results in this study .
thus , stimuli intensities would range from a mean of approximately 26 db . for octopus skp we used the i4e target to determine the peripheral boundary of the visual field and i2e for the central boundary .
calibration of the octopus with a background luminance of 31.4 apostilbs and 1000 apostilb maximum stimulus luminance results in a db value of 20 for the i4e target and 30 db for the i2e target .
notably , the decibel scale is not standardised across the humphrey and octopus perimeters as the maximum luminance varies between the two perimeters . on comparison of results ,
a correct match of visual field result was 80% for the i4e target and 73.5% for the i2e target on skp in comparison to the visual field result on humphrey perimetry .
furthermore , when both i4e and i2e isopters were compared , in conjunction with each other , to the humphrey result , a correct match was recorded for 87% of results .
thus , combined assessment of the peripheral and central field with octopus perimetry led to the more sensitive detection of visual field deficit
eight percent of comparisons both showed abnormal visual field results but lacking an accurate match of defect with abnormalities mainly relating to constriction of field versus a defect in different quadrants of the visual field .
three eyes ( 2.6% ) had normal humphrey results but corresponding octopus results showed peripheral superior defects ( all in cases of pituitary adenoma ) . in a further three eyes ( 2.6% )
normal octopus results were recorded but humphrey results showed abnormalities . it should be noted that in two results , the humphrey result showed involvement of spurious points or generalised constriction but in which no specific diagnosis of visual field type could be made .
thus , these results could represent normal visual fields in which the patient failed to make adequate responses to stimuli from time to time . given these comparisons of mismatch
, we did not feel that the octopus missed more defects than humphrey , or vice versa .
independent grading of a sample of visual field results provided similar match comparisons , and a strong agreement for matched results by the first two authors in comparison to the third author was found .
previous comparative studies have contrasted skp with static perimetry within the central 30 degrees in ocular diseases such as advanced glaucoma , optic neuritis , and optic nerve head drusen , with good comparisons and test - retest reliability .
furthermore , improved defection of visual field loss was obtained when both tests were used in conjunction with each other [ 14 , 13 ] .
similar comparisons for neuro - ophthalmic cases have been reported with equal reliability in 77% of eyes , and our results are similar to these with skp compared to humphrey ff120 peripheral static perimetry .
disadvantages of static perimetry have been reported as inaccurate location of lesion to the anterior visual pathway , failure to detect macular sparing hemianopia , and overestimation of visual field extent .
all matched visual field results , the humphrey results were graded as being more extensive than octopus results in 38 eyes , and the octopus results were graded as being more extensive than humphrey results in 20 eyes .
the difference of humphrey results being more extensive than octopus results was significant and might reflect the presence of statokinetic dissociation which has been defined as the static defect being larger than the kinetic defect [ 14 , 15 ] .
statokinetic dissociation has been reported as occurring as a physiological phenomenon and has been found to increase towards the periphery of the visual field and decrease towards the centre of the visual field .
we did not find statokinetic dissociation to be more prevalent in neurological versus ocular causes of visual field loss . a previous comparison of semi - kinetic perimetry versus automated central static threshold perimetry reported a median test duration of 13 minutes for the kinetic option and 11 minutes for the static option .
we found the opposite in our study with a mean test duration of 4.54 minutes for skp and 6.17 minutes for humphrey static perimetry .
this may reflect the different number of isopters and vectors assessed for octopus perimetry but also the use of a peripheral suprathreshold static programme rather than a central threshold static programme . on further evaluation of the individual test durations versus the average test duration
, there was a wide variability , and the humphrey test was not consistently longer than the octopus test .
although we used a screening assessment for octopus perimetry to standardise the initial outline of the visual field , we added more vectors to further define visual field defect boundaries ( as described in the methods ) .
the skp screening assessment also incorporated static assessment of the visual field similar to previous studies using goldmann perimetry with armaly - drance style strategies [ 7 , 8 ] .
thus , the octopus test became more detailed in the presence of more complex visual field defects .
this may explain the crossover of test duration evident on bland - altman analysis in which the octopus test duration was longer than the humphrey test duration in 16 eyes ( 15% ) .
the humphrey ff120 programme utilised a two zone strategy in which stimuli were recorded as either seen or unseen and would not provide any detailed information with respect to the depth of visual field defect . in these cases , it could be argued that octopus perimetry provides more detailed and informative evaluation of the visual field with better representation of the field defect in terms of its relative or absolute defect severity and which may be more representative of the individuals field defect that was shown by automated perimetry
. further evaluation of this aspect in conjunction with patient reported outcome measures for impact of visual field on activities of daily living and quality of life would be useful .
although the cases recruited to this study were representative of the types of pathology and visual field defects seen in our neuro - ophthalmology clinics , a larger sample of posterior versus anterior visual pathway defects would have allowed greater comparisons of differences between skp versus static perimetry .
our comparison of 28 patients with ocular pathology to 31 patients with neurological pathology did not show any significant differences
. a comparison of the ff120 peripheral strategy to a central threshold strategy would be useful to determine if the central threshold static programmes indicate the presence of visual field defects that may impinge more on peripheral than central visual field , such as in cases of pituitary adenoma .
this study demonstrates that the combined octopus i4e and i2e targets were more sensitive to detection of visual field loss than either target alone .
generally humphrey perimetry test duration was longer than octopus skp although this was not consistent for all tests .
when a more detailed evaluation with octopus skp was undertaken , this was at times longer than the humphrey assessment . in the absence of kinetic perimetry options in neuro - ophthalmology clinics , peripheral static suprathreshold programme options such as
octopus semi - kinetic perimetry utilising both the i4e and i2e targets provides detailed information of both the defect depth and size and may provide a more representative view of the actual visual field defect , particularly for more moderate to severe visual field defects .
Output:
| aim . to compare semikinetic perimetry ( skp ) on octopus 900 perimetry to a peripheral static programme with humphrey automated perimetry
. methods .
prospective cross - section study comparing humphrey full field ( ff ) 120 two zone programme to a screening protocol for skp on octopus perimetry .
results were independently graded for presence / absence of field defect plus type and location of defect .
results .
64 patients ( 113 eyes ) underwent dual perimetry assessment .
mean duration of assessment for skp was 4.54 minutes 0.18 and 6.17 0.12 for ff120 ( p = 0.0001 ) .
80% of results were correctly matched for normal or abnormal visual fields using the i4e target versus ff120 , and 73.5% were correctly matched using the i2e target versus ff120 . when comparing octopus results with combined i4e and i2e isopters to the ff120 result , a match for normal or abnormal fields
was recorded in 87% .
conclusions .
humphrey perimetry test duration was generally longer than octopus skp . in the absence of kinetic perimetry
, peripheral static suprathreshold programme options such as ff120 may be useful for detection of visual field defects .
however , statokinetic dissociation may occur .
octopus skp utilising both i4e and i2e targets provides detailed information of both the defect depth and size and may provide a more representative view of the actual visual field defect . |
PubmedSumm119619 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the online version of this article ( doi:10.1007/s11032 - 013 - 9929 - 6 ) contains supplementary material , which is available to authorized users .
supplementary material 1 ( pdf 29 kb ) supplementary material 2 ( pdf 87 kb ) supplementary material 3 ( pdf 299 kb )
Output:
| high fruit and wine quality combined with good climatic adaptation and disease resistance are essential objectives of grape breeding
. while several molecular markers are available for pyramiding resistance to fungal pathogens , molecular tools for predicting fruit composition are still scarce .
muscat flavor , caused by the accumulation of monoterpenoids in the berry , is an important target trait for breeding , sought after in both table grapes and wine .
four missense mutations in the vvdxs gene in grape germplasm have been shown to be tightly linked to muscat flavor . here
we present highly reproducible and breeder - friendly functional markers for each of the targeted polymorphisms developed by using either the multiplexed minisequencing snapshot method , the high - resolution melting ( hrm ) assay or the cleaved amplified polymorphic sequence system .
a total of 242 grapevine accessions were analyzed to optimize these different genotyping methods and to provide allele - specific markers for accurate selection of muscat flavor at early stages of grape breeding programs .
the hrm and the minisequencing snapshot multiplex assays allow for high - throughput automated screening and are suitable for large - scale breeding programs and germplasm characterization.electronic supplementary materialthe online version of this article ( doi:10.1007/s11032 - 013 - 9929 - 6 ) contains supplementary material , which is available to authorized users . |
PubmedSumm119620 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: aric is a longitudinal study of 15,792 adults aged 4564 years at enrollment in 19871989 in four communities : forsyth county , nc ; jackson , ms ( african americans only ) ; the northwestern suburbs of minneapolis , mn ; and washington county , md .
participants attended three subsequent examinations approximately every 3 years ( 19901992 ; 19931995 ; and 19961999 ) .
cardia is a longitudinal study investigating 5,115 african american and white men and women aged 1830 years at enrollment in 19851986 in four communities : birmingham , al ; chicago , il ; minneapolis , mn ; and oakland , ca .
participant recruitment was approximately balanced on age , sex , race , and education status at each community .
six subsequent examinations were conducted ( 19871988 , 19901991 , 19921993 , 19951996 , 20002001 , and 20052006 ) .
the offspring cohort of the framingham heart study began in 19711975 , enrolling 5,124 offspring and spouses of the offspring of the framingham heart study s original cohort .
they were next examined 8 years later and then about every 4 years through the seventh examination , followed by the eighth examination approximately 6.5 years later ( 20052008 ) .
initial eligibility criteria for these analyses included participants aged 3554 years old and nondiabetic ( defined as fasting blood glucose < 126 mg / dl , and no prior history of and not on medication for diabetes ) at their index or baseline examination ( as detailed below ) .
this yielded 12,119 participants : 8,170 from aric , 2,111 from cardia , and 1,838 from the framingham heart study .
participants were further excluded if they were not african american or white ( n = 30 ) ; failed to return for follow - up or did not have at least one follow - up visit to determine diabetes status ( n = 709 ) ; or at the index examination were either pregnant ( n = 12 ) , did not fast > 8 h ( n = 330 ) , or had missing data on systolic ( sbp ) or diastolic blood pressure ( dbp ) or any of the following cardiometabolic traits : fasting blood glucose , insulin , hdl cholesterol ( hdl - c ) , or triglycerides , waist circumference , or bmi ( n = 232 ) .
those excluded were more likely to be african american ( 40.5 vs. 23.4% ) , not finished high school ( 21.1 vs. 12.4% ) , have higher sbp ( mean 119 vs. 116 mmhg ) , and prevalence of hypertension ( 28.1 vs. 21.5% ) , consume more alcohol ( mean 4.8 vs. 3.8 drinks / week ) , and be a smoker ( 40.8 vs. 25.2% ) . for cardia and the framingham heart study offspring cohort , their fifth examination cycle ( conducted in 19951996 and 19911995 , respectively )
was considered the index examination , for an approximate follow - up period of 10 and 14 years , respectively .
these were chosen over prior examinations to ensure a more contemporary sample while allowing for sufficient follow - up of approximately 1 decade .
because the most recent aric exam occurred in 19961999 , its first examination ( conducted in 19871989 ) was considered the index examination , for 9 years of follow - up .
blood pressure was measured with participants seated after a 5-minute rest using a random - zero mercury sphygmomanometer in aric and cardia , and a standard mercury - column sphygmomanometer in the framingham heart study .
three mutually exclusive blood pressure categories were established : hypertension was defined if sbp 140 mmhg , dbp 90 mmhg , or reported use of antihypertensive medication ; prehypertension was defined as not having hypertension , and sbp 120139 mmhg or dbp 8089 mmhg ; normal included sbp < 120 mmhg and dbp < 80 mmhg and not using antihypertensive medication .
bmi was calculated as weight in kilograms divided by the square of height in meters .
waist circumference was measured at the level of the umbilicus in aric and the framingham heart study , and at the level of the smallest waist circumference in cardia .
self - reported information included race , education level , parental history of diabetes ( one or both parents with diabetes ) , smoking status , alcohol use , and physical activity .
participants were instructed to fast overnight before providing blood specimens for measuring glucose , lipid , and insulin levels .
participants were considered to have incident diabetes if any of the following was present at a follow - up examination : fasting blood glucose 126 mg / dl , casual blood glucose 200 mg / dl , or using insulin or oral hypoglycemic medication .
time - to - diabetes was estimated using a previously described method by duncan et al .
the incident date was estimated by linear interpolation using the glucose values at the ascertaining and previous examinations . for cases ascertained based on the use of diabetic medications , the time - to - diabetes
was estimated by using their fasting glucose at the earlier visit and a slope estimated using information from all diabetic subjects who had been unaware of their status ( because the fasting glucose at ascertainment for those who were on diabetic medication may have been affected by their knowledge of their diabetes status ) .
general linear models were used to compare characteristics by blood pressure categories after adjustment for age and sex ( regression models for continuous traits and poisson regression for categorical traits ) . in multivariable analyses ,
age - specific rates were first calculated and then weighted to the standard year 2000 u.s .
population to derive age - adjusted incidence rates by race , sex , and blood pressure category .
confidence intervals and trend tests across blood pressure category within race and sex groups were estimated using 2,000 bootstrap resamples .
a standard normal distribution in the rates was assumed because the bias between the sample population estimates and the mean of the bootstrap estimates was less than 1% .
proportional hazards models were fitted to assess the association of blood pressure category with incident diabetes .
tests for effect modification by sex were evaluated in race - specific models that adjusted for age and sex , whereas effect modification by race was tested in age- , race- , and sex - adjusted models .
nonproportionality of hazards over time was tested in race - specific models using time - dependent covariates for the blood pressure categories . for multivariable analyses ,
cox proportional hazards models were constructed to calculate the hazard ratio ( hr ) and 95% cis to compare incident diabetes across blood pressure categories , using normal blood pressure as the reference group . the base model adjusted for age and sex .
the third , considered our primary model , further adjusted for fasting glucose , hdl - c , and triglyceride .
fasting glucose was included to account for its potential confounding effect on blood pressure and incident diabetes because its levels were positively associated with increasing blood pressure categories in both race groups .
the fourth model included a longer list of cardiometabolic risk factors by also introducing fasting insulin and waist circumference . to directly compare the racial differences in the association of blood pressure and incident diabetes
, we also combined both races in multivariable analyses with race - specific blood pressure categories using normotensive whites as the referent group .
sensitivity analyses included constructing models with additional groups of covariates or varying the exclusion criteria .
the additional covariates included : current smoking , alcohol use , class of antihypertensive drugs , and physical activity level , as well as education level and parental history of diabetes .
finally , because those with higher blood pressure also tend to have higher fasting glucose level , which is a strong predictor of diabetes , we performed separate multivariable analyses after lowering our exclusion threshold for baseline fasting glucose to 110 mg / dl from 126 mg / dl ( i.e. , excluding individuals with borderline elevated levels at the index examination ) .
antihypertensive medications were classified into one of four categories : -blockers , thiazides , ace inhibitors or angiotensin - receptor blockers , or other single - agent medications .
combination or multiple medications were sorted into nonmutually exclusive categories ( for example , someone taking a -blocker and thiazide was included in each of those two drug classes ) .
therefore , each study s physical activity summary score ( sum of leisure , sport , and work activity scores in aric and cardia , and total physical activity in kilocalories over the past year in framingham ) was standardized ( mean = 0 , sd = 1 ) for analytic purposes . to achieve a normal distribution in the framingham physical activity score
initial eligibility criteria for these analyses included participants aged 3554 years old and nondiabetic ( defined as fasting blood glucose < 126 mg / dl , and no prior history of and not on medication for diabetes ) at their index or baseline examination ( as detailed below ) .
this yielded 12,119 participants : 8,170 from aric , 2,111 from cardia , and 1,838 from the framingham heart study .
participants were further excluded if they were not african american or white ( n = 30 ) ; failed to return for follow - up or did not have at least one follow - up visit to determine diabetes status ( n = 709 ) ; or at the index examination were either pregnant ( n = 12 ) , did not fast > 8 h ( n = 330 ) , or had missing data on systolic ( sbp ) or diastolic blood pressure ( dbp ) or any of the following cardiometabolic traits : fasting blood glucose , insulin , hdl cholesterol ( hdl - c ) , or triglycerides , waist circumference , or bmi ( n = 232 ) .
those excluded were more likely to be african american ( 40.5 vs. 23.4% ) , not finished high school ( 21.1 vs. 12.4% ) , have higher sbp ( mean 119 vs. 116 mmhg ) , and prevalence of hypertension ( 28.1 vs. 21.5% ) , consume more alcohol ( mean 4.8 vs. 3.8 drinks / week ) , and be a smoker ( 40.8 vs. 25.2% ) . for cardia and the framingham heart study offspring cohort , their fifth examination cycle ( conducted in 19951996 and 19911995 ,
respectively ) was considered the index examination , for an approximate follow - up period of 10 and 14 years , respectively .
these were chosen over prior examinations to ensure a more contemporary sample while allowing for sufficient follow - up of approximately 1 decade .
because the most recent aric exam occurred in 19961999 , its first examination ( conducted in 19871989 ) was considered the index examination , for 9 years of follow - up .
blood pressure was measured with participants seated after a 5-minute rest using a random - zero mercury sphygmomanometer in aric and cardia , and a standard mercury - column sphygmomanometer in the framingham heart study .
three mutually exclusive blood pressure categories were established : hypertension was defined if sbp 140 mmhg , dbp 90 mmhg , or reported use of antihypertensive medication ; prehypertension was defined as not having hypertension , and sbp 120139 mmhg or dbp 8089 mmhg ; normal included sbp < 120 mmhg and dbp < 80 mmhg and not using antihypertensive medication .
bmi was calculated as weight in kilograms divided by the square of height in meters .
waist circumference was measured at the level of the umbilicus in aric and the framingham heart study , and at the level of the smallest waist circumference in cardia .
self - reported information included race , education level , parental history of diabetes ( one or both parents with diabetes ) , smoking status , alcohol use , and physical activity .
participants were instructed to fast overnight before providing blood specimens for measuring glucose , lipid , and insulin levels .
participants were considered to have incident diabetes if any of the following was present at a follow - up examination : fasting blood glucose 126 mg / dl , casual blood glucose 200 mg / dl , or using insulin or oral hypoglycemic medication .
time - to - diabetes was estimated using a previously described method by duncan et al .
the incident date was estimated by linear interpolation using the glucose values at the ascertaining and previous examinations . for cases ascertained based on the use of diabetic medications ,
the time - to - diabetes was estimated by using their fasting glucose at the earlier visit and a slope estimated using information from all diabetic subjects who had been unaware of their status ( because the fasting glucose at ascertainment for those who were on diabetic medication may have been affected by their knowledge of their diabetes status ) .
general linear models were used to compare characteristics by blood pressure categories after adjustment for age and sex ( regression models for continuous traits and poisson regression for categorical traits ) . in multivariable analyses ,
age - specific rates were first calculated and then weighted to the standard year 2000 u.s .
population to derive age - adjusted incidence rates by race , sex , and blood pressure category .
confidence intervals and trend tests across blood pressure category within race and sex groups were estimated using 2,000 bootstrap resamples .
a standard normal distribution in the rates was assumed because the bias between the sample population estimates and the mean of the bootstrap estimates was less than 1% .
proportional hazards models were fitted to assess the association of blood pressure category with incident diabetes .
tests for effect modification by sex were evaluated in race - specific models that adjusted for age and sex , whereas effect modification by race was tested in age- , race- , and sex - adjusted models .
nonproportionality of hazards over time was tested in race - specific models using time - dependent covariates for the blood pressure categories . for multivariable analyses ,
cox proportional hazards models were constructed to calculate the hazard ratio ( hr ) and 95% cis to compare incident diabetes across blood pressure categories , using normal blood pressure as the reference group . the base model adjusted for age and sex .
the third , considered our primary model , further adjusted for fasting glucose , hdl - c , and triglyceride .
fasting glucose was included to account for its potential confounding effect on blood pressure and incident diabetes because its levels were positively associated with increasing blood pressure categories in both race groups .
the fourth model included a longer list of cardiometabolic risk factors by also introducing fasting insulin and waist circumference . to directly compare the racial differences in the association of blood pressure and incident diabetes , we also combined both races in multivariable analyses with race - specific blood pressure categories using normotensive whites as the referent group .
sensitivity analyses included constructing models with additional groups of covariates or varying the exclusion criteria .
the additional covariates included : current smoking , alcohol use , class of antihypertensive drugs , and physical activity level , as well as education level and parental history of diabetes .
finally , because those with higher blood pressure also tend to have higher fasting glucose level , which is a strong predictor of diabetes , we performed separate multivariable analyses after lowering our exclusion threshold for baseline fasting glucose to 110 mg / dl from 126 mg / dl ( i.e. , excluding individuals with borderline elevated levels at the index examination ) .
antihypertensive medications were classified into one of four categories : -blockers , thiazides , ace inhibitors or angiotensin - receptor blockers , or other single - agent medications .
combination or multiple medications were sorted into nonmutually exclusive categories ( for example , someone taking a -blocker and thiazide was included in each of those two drug classes ) .
therefore , each study s physical activity summary score ( sum of leisure , sport , and work activity scores in aric and cardia , and total physical activity in kilocalories over the past year in framingham ) was standardized ( mean = 0 , sd = 1 ) for analytic purposes . to achieve a normal distribution in the framingham physical activity score ,
nearly one - quarter ( 23.4% ) were african americans , all from aric and cardia .
mean age ( sd ) in years in cardia , aric , and framingham heart study were 37.7 ( 1.72 ) , 49.9 ( 3.15 ) , and 47.5 ( 5.00 ) , respectively ( supplementary table a ) .
table 1 shows that at baseline , within each race increasingly higher blood pressure categories were significantly associated with lower educational level , hdl - c , and physical activity scores , as well as older age , higher fasting glucose , triglycerides and insulin levels , and greater waist circumference , bmi , and alcohol consumption .
higher blood pressure was also associated with higher proportion of men , current smoker , and parental history of diabetes in whites .
overall , whites had more favorable profiles in blood pressure , adiposity , fasting glucose and insulin levels , prevalence of smoking , and education , whereas african americans had more favorable lipid levels .
age- and sex - adjusted means or proportions of baseline characteristics by race and blood pressure category * at baseline data are mean ( sd ) or percent , unless otherwise indicated .
bp , blood pressure ; dm , diabetes ; hs , high school ; wc , waist circumference . * blood pressure categories : normal , sbp < 120 and dbp < 80 mmhg and not using antihypertensive medication ; prehypertension , not hypertension and sbp 120139 or dbp 8089 mmhg ; hypertension , sbp 140 , dbp 90 mmhg , or using antihypertensive medication .
exponent of log transformed triglycerides , therefore is approximately the median of the untransformed distribution .
the sd is from the distribution of log ( triglycerides ) . p value from a simple linear contrast .
a higher z score means a greater physical activity level of that participant relative to others in the same study .
for example , a z score of 1.96 means that that participant was more physically active than 95% of the participants in that study . during median follow - up of 8.9 years , 14.6% ( n = 372 ; 239 women ) of african americans and 7.9% ( n = 657 ; 271 women ) of whites developed diabetes . within each race - sex group ,
age - adjusted rates were increasingly higher across baseline blood pressure categories , with the incidence lowest in the normal blood pressure group and highest in the hypertension group ( fig .
1 ) ( p values for trend : < 0.05 for african american men ; < 0.001 for other race - sex groups ) . the rates ranged from 2.8 per 1,000 person - years in normotensive white women to 28.9 per 1,000 person - years in hypertensive african american women .
age - adjusted rate of incident diabetes and 95% ci by baseline blood pressure category , sex , and race .
rate per 1,000 person - years , age - adjusted to the year 2000 standard population ; 95% ci from normal approximation after 2,000 bootstrap samples .
p values for trend all race and sex groups < 0.0001 , except for african american men , for which p value for trend was 0.0219 . normal blood pressure : sbp < 120 and dbp < 80 mmhg and not using antihypertensive medication ; prehypertension : not hypertension and sbp 120139 or dbp 8089 mmhg ; and hypertension : sbp 140 , dbp 90 mmhg , or using antihypertensive medication .
race - stratified multivariable analyses were performed because tests for race - by - blood - pressure - category interactions were significant ( p values - for - interaction for prehypertension and hypertension : 0.004 and 0.003 , respectively ) . within race - specific models ,
effect modification by sex was not present ( p values - for - interaction for prehypertension and hypertension : 0.68 and 0.92 in african americans , and 0.37 and 0.052 in whites , respectively ) ; therefore , sex - pooled models were used for all analyses . in models with interaction terms for study - by - blood - pressure - category ,
the age- and sex - adjusted hr for diabetes among african americans ( table 2 ) with hypertension was 1.95 ( 95% ci 1.502.54 ) , using normal blood pressure group as the referent ; the risk was not significant for prehypertension ( p = 0.23 ) .
after further adjusting for bmi , the diabetes risk associated with hypertension was attenuated but remained statistically significant ( hr 1.48 [ 95% ci 1.131.94 ] ) ; but when fasting glucose , hdl - c , and triglyceride levels were added , the effect was further attenuated and there was no longer a significant association ( 0.92 [ 0.701.21 ] ) .
hrs for the association of baseline prehypertension and hypertension with incident diabetes * using normal blood pressure ( sbp < 120 and dbp < 80 mmhg and not using antihypertensive medication ) as referent for comparing prehypertension ( not hypertension and sbp 120139 or dbp 8089 mmhg ) and hypertension ( sbp
diabetes during follow - up defined as fasting glucose 126 mg / dl , casual glucose 200 mg / dl , or use of diabetic drugs .
model 2 + fasting glucose , hdl , and triglycerides . among whites ( table 2 ) , after adjusting for age and sex , compared with normal blood pressure group , hypertension had a more than threefold increased risk of developing diabetes ( hr 3.26 [ 95% ci 2.703.94 ] ) , and prehypertension had a twofold increased risk ( 1.99 [ 1.642.41 ] ) .
these associations remained statistically significant , though attenuated , after also adjusting for bmi , fasting glucose , hdl - c , and triglyceride levels ( hr for prehypertension : 1.32 [ 95% ci 1.091.61 ] ; for hypertension : 1.25 [ 1.031.53 ] ) .
the race - specific results remained similar even when the modeling included additional baseline covariates ( first , waist circumference and fasting insulin ; then also antihypertensive drug class , smoking , alcohol , and physical activity ; and finally also education level and parental history of diabetes ) .
statistically significant associations between prehypertension or hypertension and incident diabetes were again observed in whites only ( supplementary table b ) . of note , in the multivariable analyses no antihypertensive drug class
was significantly associated with incident diabetes ( results not shown ) . in race - combined primary multivariable model ( i.e. , adjusting for age , sex , bmi , fasting glucose , hdl - c , and triglyceride ) using normotensive whites as referent , the hr ( 95% ci ) for developing diabetes in normotensive , prehypertensive , and hypertensive african americans were 2.75 ( 2.143.53 ) , 2.28 ( 1.762.95 ) , and 2.36 ( 1.932.90 ) , respectively , and in prehypertensive and hypertensive whites were 1.36 ( 1.121.65 ) and 1.33 ( 1.101.62 ) , respectively .
a similar pattern was observed after additionally adjusting for other differences in baseline characteristics : education , fasting insulin , waist circumference , smoking , alcohol , and parental history of diabetes ( results not shown ) .
when repeating our primary multivariable model after lowering the baseline exclusion glucose cut point to 110 mg / dl from 126 mg / dl , the significant associations persisted among whites ( hr for prehypertension : 1.42 [ 95% ci 1.111.82 ] ; hr for hypertension : 1.52 [ 1.171.98 ] ) . in african americans
, there was now a trend toward higher risk of diabetes in prehypertension group ( 1.18 [ 0.801.73 ] ) and a marginally statistically significant association in hypertension group ( 1.44 [ 1.012.05 ] ) , which was no longer significant after additionally adjusting for fasting insulin and waist circumference ( p value 0.062 ) . in a race - pooled multivariable model with baseline glucose
< 110 mg / dl and using normotensive whites as referent , the race - by - blood - pressure - category interaction terms were not significant ( p values > 0.395 ) .
nearly one - quarter ( 23.4% ) were african americans , all from aric and cardia .
mean age ( sd ) in years in cardia , aric , and framingham heart study were 37.7 ( 1.72 ) , 49.9 ( 3.15 ) , and 47.5 ( 5.00 ) , respectively ( supplementary table a ) .
table 1 shows that at baseline , within each race increasingly higher blood pressure categories were significantly associated with lower educational level , hdl - c , and physical activity scores , as well as older age , higher fasting glucose , triglycerides and insulin levels , and greater waist circumference , bmi , and alcohol consumption .
higher blood pressure was also associated with higher proportion of men , current smoker , and parental history of diabetes in whites .
overall , whites had more favorable profiles in blood pressure , adiposity , fasting glucose and insulin levels , prevalence of smoking , and education , whereas african americans had more favorable lipid levels .
age- and sex - adjusted means or proportions of baseline characteristics by race and blood pressure category * at baseline data are mean ( sd ) or percent , unless otherwise indicated .
bp , blood pressure ; dm , diabetes ; hs , high school ; wc , waist circumference . * blood pressure categories : normal , sbp < 120 and dbp < 80 mmhg and not using antihypertensive medication ; prehypertension , not hypertension and sbp 120139 or dbp 8089 mmhg ; hypertension , sbp 140 , dbp 90 mmhg , or using antihypertensive medication .
exponent of log transformed triglycerides , therefore is approximately the median of the untransformed distribution .
the sd is from the distribution of log ( triglycerides ) . p value from a simple linear contrast .
a higher z score means a greater physical activity level of that participant relative to others in the same study .
for example , a z score of 1.96 means that that participant was more physically active than 95% of the participants in that study .
during median follow - up of 8.9 years , 14.6% ( n = 372 ; 239 women ) of african americans and 7.9% ( n = 657 ; 271 women ) of whites developed diabetes . within each race - sex group ,
age - adjusted rates were increasingly higher across baseline blood pressure categories , with the incidence lowest in the normal blood pressure group and highest in the hypertension group ( fig .
1 ) ( p values for trend : < 0.05 for african american men ; < 0.001 for other race - sex groups ) . the rates ranged from 2.8 per 1,000 person - years in normotensive white women to 28.9 per 1,000 person - years in hypertensive african american women .
age - adjusted rate of incident diabetes and 95% ci by baseline blood pressure category , sex , and race .
rate per 1,000 person - years , age - adjusted to the year 2000 standard population ; 95% ci from normal approximation after 2,000 bootstrap samples .
p values for trend all race and sex groups < 0.0001 , except for african american men , for which p value for trend was 0.0219 .
normal blood pressure : sbp < 120 and dbp < 80 mmhg and not using antihypertensive medication ; prehypertension : not hypertension and sbp 120139 or dbp 8089 mmhg ; and hypertension : sbp 140 , dbp 90 mmhg , or using antihypertensive medication .
race - stratified multivariable analyses were performed because tests for race - by - blood - pressure - category interactions were significant ( p values - for - interaction for prehypertension and hypertension : 0.004 and 0.003 , respectively ) . within race - specific models ,
effect modification by sex was not present ( p values - for - interaction for prehypertension and hypertension : 0.68 and 0.92 in african americans , and 0.37 and 0.052 in whites , respectively ) ; therefore , sex - pooled models were used for all analyses . in models with interaction terms for study - by - blood - pressure - category ,
the age- and sex - adjusted hr for diabetes among african americans ( table 2 ) with hypertension was 1.95 ( 95% ci 1.502.54 ) , using normal blood pressure group as the referent ; the risk was not significant for prehypertension ( p = 0.23 ) .
after further adjusting for bmi , the diabetes risk associated with hypertension was attenuated but remained statistically significant ( hr 1.48 [ 95% ci 1.131.94 ] ) ; but when fasting glucose , hdl - c , and triglyceride levels were added , the effect was further attenuated and there was no longer a significant association ( 0.92 [ 0.701.21 ] ) .
hrs for the association of baseline prehypertension and hypertension with incident diabetes * using normal blood pressure ( sbp < 120 and dbp < 80 mmhg and not using antihypertensive medication ) as referent for comparing prehypertension ( not hypertension and sbp 120139 or dbp 8089 mmhg ) and hypertension ( sbp
diabetes during follow - up defined as fasting glucose 126 mg / dl , casual glucose 200 mg / dl , or use of diabetic drugs .
model 2 + fasting glucose , hdl , and triglycerides . among whites ( table 2 ) , after adjusting for age and sex , compared with normal blood pressure group , hypertension had a more than threefold increased risk of developing diabetes ( hr 3.26 [ 95% ci 2.703.94 ] ) , and prehypertension had a twofold increased risk ( 1.99 [ 1.642.41 ] ) .
these associations remained statistically significant , though attenuated , after also adjusting for bmi , fasting glucose , hdl - c , and triglyceride levels ( hr for prehypertension : 1.32 [ 95% ci 1.091.61 ] ; for hypertension : 1.25 [ 1.031.53 ] ) . the race - specific results remained similar even when the modeling included additional baseline covariates ( first , waist circumference and fasting insulin ; then also antihypertensive drug class , smoking , alcohol , and physical activity ; and finally also education level and parental history of diabetes ) .
statistically significant associations between prehypertension or hypertension and incident diabetes were again observed in whites only ( supplementary table b ) . of note , in the multivariable analyses no antihypertensive drug class
was significantly associated with incident diabetes ( results not shown ) . in race - combined primary multivariable model ( i.e. , adjusting for age , sex , bmi , fasting glucose , hdl - c , and triglyceride ) using normotensive whites as referent , the hr ( 95% ci ) for developing diabetes in normotensive , prehypertensive , and hypertensive african americans were 2.75 ( 2.143.53 ) , 2.28 ( 1.762.95 ) , and 2.36 ( 1.932.90 ) , respectively , and in prehypertensive and hypertensive whites were 1.36 ( 1.121.65 ) and 1.33 ( 1.101.62 ) , respectively .
a similar pattern was observed after additionally adjusting for other differences in baseline characteristics : education , fasting insulin , waist circumference , smoking , alcohol , and parental history of diabetes ( results not shown ) .
when repeating our primary multivariable model after lowering the baseline exclusion glucose cut point to 110 mg / dl from 126 mg / dl , the significant associations persisted among whites ( hr for prehypertension : 1.42 [ 95% ci 1.111.82 ] ; hr for hypertension : 1.52 [ 1.171.98 ] ) . in african americans , there was now a trend toward higher risk of diabetes in prehypertension group ( 1.18 [ 0.801.73 ] ) and a marginally statistically significant association in hypertension group ( 1.44 [ 1.012.05 ] ) , which was no longer significant after additionally adjusting for fasting insulin and waist circumference ( p value 0.062 ) . in a race - pooled multivariable model with baseline glucose
< 110 mg / dl and using normotensive whites as referent , the race - by - blood - pressure - category interaction terms were not significant ( p values > 0.395 ) .
middle - aged african americans and whites with higher blood pressure are more likely to develop diabetes than those with normal blood pressure . in african americans , the higher incidence of diabetes among hypertensive individuals may be explained by concomitantly greater adiposity and other cardiometabolic risk factors . in whites , the association of both prehypertension and hypertension with incident diabetes
regardless of baseline blood pressure status , african americans have a greater risk of developing diabetes than whites .
only one prior aric publication from a decade ago included substantial numbers of african americans when studying the relationship between blood pressure and new - onset diabetes ; however , race - specific results were not presented ( 6 ) .
we found significant race - by - blood - pressure - category interaction for incident diabetes in our primary analysis , thus needing separate analyses by race .
although after accounting for age- and sex - differences hypertensive african americans were more than twice as likely to develop diabetes as normotensive african americans , after further adjusting for baseline bmi , fasting glucose , hdl - c , and triglyceride levels , the effect size was greatly attenuated and no longer significant . for whites ,
our finding validates prior reports that high blood pressure is a risk factor for diabetes ( 4,5,9 ) .
this finding is in contrast to a recent paper from the san antonio heart study , where no association between prehypertension and diabetes was observed in 2,767 mexican americans and non - hispanic white participants after multivariable analysis ( 14 ) .
although their age- , sex- , and race - adjusted model of prehypertension was associated with incident diabetes , it was no longer significant after further adjusting for bmi , impaired glucose tolerance , insulin resistance and secretion , and family history .
however , the multivariable - adjusted odds ratio of incident diabetes for prehypertension versus normal blood pressure at 1.42 ( 95% ci 0.992.02 ) was comparable to that of our prehypertensive whites .
african americans generally have higher levels of cardiovascular risk factors than whites except for lipid profile ( 15,16 ) .
even after we accounted for these differences , the racial variation in the association between blood pressure and incident diabetes persisted .
however , when lowering the exclusion - criteria threshold for baseline fasting glucose to 110 mg / dl , the positive results in whites remained robust , whereas trends toward positive associations were newly observed in african americans . in a race - pooled model with this lower exclusion cutpoint and using normotensive whites as referent , the race - by - blood pressure - category interaction terms also became no longer significant .
taken together , this suggests that the null association from our primary analyses of african americans may have been largely driven by their higher overall baseline glucose levels .
although african americans are known to have greater risks of developing diabetes than whites , potentially modifiable factors including obesity , education , physical inactivity , smoking , alcohol , and dietary intake have accounted for only about half of the disparity ( 2 ) .
we further found that this disparity can not be explained by african americans higher prevalence of prehypertension and hypertension .
even after accounting for racial differences in several risk factors , their risk of diabetes remained higher than whites across all blood pressure categories .
notably , education is a limited proxy for socioeconomic status , and other measures such as income and healthcare access are needed .
higher fasting insulin levels may be one potential biological mechanism to explain the excess incidence of diabetes , though only in nonobese african american women ( 17 ) .
future studies should investigate additional factors such as insulin sensitivity , inflammation , and endothelial dysfunction , the pathways of which , like insulin resistance , are shared by hypertension and diabetes ( 13,1820 ) .
strengths of the present article include the large sample size , multiethnic sample , measured instead of self - reported blood pressure and blood glucose ; and extensive data on potential confounders .
first , as with all observational studies , residual confounding can not be ruled out .
second , the african american participants were only from aric and cardia . in aric ,
> 90% of the african americans were recruited from one site ( jackson , ms ) .
given the nonoverlapping age - range between aric and cardia participants , we did not test whether african americans differ between these studies .
though possible that the observed race - and - blood pressure interaction might have been confounded by racial differences in geographical distribution , cardia included balanced biracial cohorts from four other cities , making this concern less likely .
third , whether causal relationship exists and whether treating high blood pressure prevents diabetes are outside the scope of observational studies .
trials on prehypertension are few and none reported incident diabetes as an outcome ( 21,22 ) . for hypertension , several meta - analyses of antihypertensive drug trials that reported incident diabetes identified inhibitors of the renin - angiotensin system to lower the risk ( 23,24 ) .
in contrast , other antihypertensive drugs such as -blockers and diuretics were implicated as putative risk - promoting factors ( 6,25 ) .
moreover , drug trials have been inherently limited in their inability to distinguish any protective effects of blood pressure - lowering per se from any direct pharmacological effects on diabetes development . in summary ,
high blood pressure in middle age is associated with greater likelihood of developing diabetes . in african americans with hypertension , this association
both prehypertension and hypertension are associated with increased risk of developing diabetes beyond that explained by adiposity and other risk factors .
whether lowering blood pressure slows or prevents the onset of diabetes deserves further clinical investigation .
regardless of blood pressure status , african americans have greater risks of developing diabetes than whites .
future studies are also needed to determine the etiology for the excess risks in african americans .
Output:
| objectivewe examined the association between high blood pressure and incident type 2 diabetes in african americans and whites aged 3554 years at baseline.research design and methodswe combined data from the atherosclerosis risk in communities ( aric ) study , the coronary artery risk development in young adults ( cardia ) study , and the framingham heart study offspring cohort .
overall , 10,893 participants ( 57% women ; 23% african american ) were categorized by baseline blood pressure ( normal , prehypertension , hypertension ) and examined for incident diabetes ( median follow - up 8.9 years).resultsoverall , 14.6% of african americans and 7.9% of whites developed diabetes .
age - adjusted incidence was increasingly higher across increasing blood pressure groups ( p values for trend : < 0.05 for african american men ; < 0.001 for other race - sex groups ) .
after adjustment for age , sex , bmi , fasting glucose , hdl cholesterol , and triglycerides , prehypertension or hypertension ( compared with normal blood pressure ) was associated with greater risks of diabetes in whites ( hazard ratio [ hr ] for prehypertension : 1.32 [ 95% ci 1.091.61 ] ; for hypertension : 1.25 [ 1.031.53 ] ) , but not african americans ( hr for prehypertension : 0.86 [ 0.631.17 ] ; for hypertension : 0.92 [ 0.701.21 ] ) .
hrs for developing diabetes among normotensive , prehypertensive , and hypertensive african americans versus normotensive whites were : 2.75 , 2.28 , and 2.36 , respectively ( p values < 0.001).conclusionsin african americans , higher diabetes incidence among hypertensive individuals may be explained by bmi , fasting glucose , triglyceride , and hdl cholesterol . in whites ,
prehypertension and hypertension are associated with greater risk of diabetes , beyond that explained by other risk factors .
african americans , regardless of blood pressure , have greater risks of developing diabetes than whites . |
PubmedSumm119621 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: empowerment of women and improvement of their conditions and positions in the society are the salient issues to achieve mental health .
body image is one of the important psychological concepts , which has always been a concern for men and women .
body image is a subjective concept and one of the important concepts of self - image .
this image is a personal relationship that everyone has with his / her own body , in addition to a set of beliefs , perceptions , thoughts , feelings , and actions , which are related to the physical appearance of humans .
physical conception is rooted in scientific psychology and is a proactive , cognitive , and behavioral approach .
based on the cognitive behavioral theory of cash ( 1994 ) , the influencing factors on body image are derived from individual , environmental and behavioral factors .
the events that occurred in the past and present for each person are also involved in the formation of body image .
the dissatisfaction of many women of their bodies results from natural changes in the body such as genetic structure of the body , short stature in women compared with men , maturity , rapid growth of the body in adolescence , induced menstrual periods , process of aging , and other things that change ( short term or long term ) the body image and self - concept of the individual .
one of the major changes in women 's lives is pregnancy and childbirth , which is enjoyable for many women .
therefore , childbearing can be an opportunity to reduce their sensitivity to the attraction and beauty of their bodies , which leads to a period of tranquillity and relaxation about their body images .
however , women who do not experience pregnancy may feel that their bodies do not work properly .
one of the disturbing difficulties of women is infertility or the inability of the woman or man to have children .
brunner 's findings indicated that the diseases cause loss of control over the body , lead to the feeling of inadequacy in a person from the body , and create insecurity and negative body image . for infertile women ,
the inability to become pregnant and experience childbirth is considered as a kind of impairment caused by acquired , inherited , or congenital causes . however , infertility is not a disease , but it can cause major affective disorders . when married women do not have children until the age of 30 , they discover that they may have fertility problem and it is possible to find negative body image in them because they understand that they do not have the ability for childbearing . on the other hand , in infertile women with a poor body image , more psychological problems can be observed .
for example , this can be a cause of concern for sexual and physical attractiveness , general feeling of self - esteem , and general health .
meanwhile , these negative emotions are uninformed , but women still do combat with this issue mentally .
infertile women are deprived of pregnancy relaxation periods , and this issue is important from their psychopathological point of view . in the study of younesi and salajegheh , it has been reported that infertile women had more problems about body image compared with fertile women .
in contrast , khodakarami et al . have reported that women may pay less attention to their physical appearances , beauty , and body image due to the fear of an unknown future , the possibility of failure in the treatment of infertility and its consequences .
for example , a direct correlation has been found between feeding behavior and body image .
therefore , body image may impact behaviors such as sexual function too , because it is associated with the physical aspects- ( physical and sexual attraction ) and also with cognitive emotional aspects of women .
women worried about their physical appearance likely experience sexual dysfunction , since their sexual excitement depends on their sense of being charming to a large extent . on the other hand , in terms of sexual function and marital adjustment , the most important factor for women
is not only their ability for sexual activity but also the feeling and belief about body image and the status of their femininity . in a healthy marriage ,
the existence of a desirable sexual relationship to provide satisfaction to the partners has a fundamental important role in the success and stability of the family .
appropriateness and balance in the male and female sexual desires are among the most important causes of happiness and success of married life .
disregarding the sexual instinct in humans in most cases causes disturbance in marital relations and it has been observed that the main reason for 80% of marital discords has been sexual dissatisfaction of husbands and wives . on the other hand , when a couple realizes about their infertility , their body images of themselves may be corrupted and their sexual activities may be damaged .
infertility evaluation and using assisted reproductive techniques may have negative effects on the body image of the female and her emotions about her sexual value .
some researchers believe that body image in fertile women is partly associated with sexual function . in the study of pujols et al . , it was demonstrated that by having better body image in women , their sexual functioning and satisfaction had been more desirable . in the study of meltzer ( 2010 ) that aimed to determine body image , marital satisfaction , and the sexual satisfaction in couples
, it was found that whenever the body image was stronger , marital and sexual satisfaction was better .
the study of kilic et al . in patients with permanent ostomy indicated that in these patients , better body image is triggered stronger sexual relationship and greater marital adjustment . in contrast , knafo et al .
conducted a study on checking the relationship of body image satisfaction and sexual performance in women with disseminated sclerosis disease .
the obtained results showed that distress and concern regarding the body image were not associated with reduced sexual functioning .
considering the results of various studies about the influence of body image on sexual consequences as well as increased rate of problems caused by sexual and marital relationship issues , and also the lack of a study to investigate body image and its relationship with sexual function and marital adjustment in infertile women , it seemed that conducting a study in this field is necessary .
therefore , the researchers decided to study the body image in infertile women and its relationship with their sexual function and marital adjustment .
we hope that using the results of this study , policy makers could provide suitable treatment guidelines as well as appropriate counseling and educational programs to alleviate the sexual and marital problems of infertile women and also to improve their mental health .
this correlational study was carried out on 130 infertile women who referred to montaserieh research treatment infertility centre in mashhad , iran in 2011 .
the sample size calculation was carried out by conducting a pilot study on 20 eligible infertile women using correlation formula based on the correlation coefficient between body image and marital adjustment using 95% confidence interval and a power of 80% , and it was estimated that a sample size of 130 was needed for each group .
the participants who met the following criteria were included in the study : being able to talk in persian , having the ability to read and write , being in the age range of 2040 years , not being pregnant after a minimum of 1 year of unprotected sex , and having primary infertility confirmed by a gynecologist .
the exclusion criteria were : having undergone training or counseling sessions about sexual issues or marital relationships in the last month , having a history of medical illnesses or any physical , mental , and movement disabilities , being under treatment due to sexual dysfunction ( lack or loss of libido , sexual aversion , lack of sexual pleasure , fearing of having sex , sexual motivation disorder , vaginal dryness , orgasmic dysfunction , painful intercourse , vaginismus , or extreme sexual stimulation ) , taking medications to increase or decrease libido ( libido - enhancing drugs including ephedrine , caffeine , synarlyn , levothyroxine , danazol , herbal medicines like aphrodite and rose or damask rose fragrances , and libido - lowering medications such as spironolactone , hydrochlorothiazide , clofibrate , digoxin , propranolol , fluoxetin , haloperidol , clonidine , chlordiazepoxide , and methyl dopa ) , women with a history of aggression or sexual harassment , having undergone surgery in the past 6 months , having a mental illness , and drug use or alcohol consumption . to collect data , valid and reliable questionnaires including demographic and infertility - related data questionnaire , modified younesi body image questionnaire , rosen female sexual function index ( fsfi ) , and dyadic adjustment scale ( das ) were used .
body image assessment questionnaire was developed based on a six - point likert scale by george kelly mental structure method .
this questionnaire was validated in 2001 by younesi and colleagues in iran to measure the dimensions of body image .
the mentioned questionnaire had 66 questions with six subscales including the body during activity and when alone , the real body , the ideal body , the body as people see and know , the body as it is recognized by the spouse , and the body as it is known by the spouse 's family . in the body image assessment questionnaire ,
each question was rated with a minimum of one and a maximum of six points .
the maximum score that could be obtained in the questionnaire was 396 and the minimum score was 66 .
higher score indicated more positive or better body image and lower score demonstrated more negative body image .
this questionnaire was developed in 2000 by rosen and colleagues with 19 questions and six subscales including libido , sexual excitement , vaginal moisture , orgasm , painful intercourse , and sexual satisfaction .
the scores given were : 15 points for questions regarding the scope of libido , 05 points for sexual excitement , vaginal moisture , painful intercourse , and orgasm , and zero or 15 points for questions regarding sexual satisfaction .
the cut - off score of sexual function scale was 28 , and the minimum score for the total scale was considered 2 and the maximum was 36 . generally , higher scores indicated better sexual function .
it was used to assess four elements of adjustment including marital satisfaction , marriage coherence , agreement in marriage , and manifestation and expression of couples feelings and emotions .
this questionnaire had 32 questions with a maximum score of 151 and a minimum score of zero .
scores of less than 100 in this scale meant lower marital adjustment and scores above 100 indicated greater marital adjustment .
the validity of the modified questionnaire of body image assessment , women 's sexual function , and marital adjustment was determined by content validity method .
these tools were created by reviewing the most recent books and articles in the field of the study subject .
then , they were given to 10 experts for the needed evaluation and finally , the corrected comments were applied in the developed tools .
reliability of body image assessment questionnaire was approved by the internal consistency reliability method by calculating the cronbach 's alpha coefficient . which was = 0.92 , for women 's sexual function questionnaire = 0.79 , and for marital adjustment questionnaire = 0.92 .
for data collection , after obtaining the necessary permission from the montaserieh centre officials and after expressing the objectives and methods to the participants , the researcher obtained the consent of subjects and reassured them about confidentiality of the information ; they were explained that their participation in the study was completely voluntary and they could withdraw from the study whenever they wanted .
they were also assured that the research results would be published as a whole and in the format of study groups information , and individual results would be supplied if necessary , anonymous demographic characteristics .
demographic and infertility information questionnaire and marital adjustment scale were completed through subjects self - report . body image and sexual function questionnaires
data description was performed using frequency tables , graphs and mean indicators , median and standard deviation .
the followings tests were used for statistical analysis : pearson and spearman correlation coefficients to determine the relationship among the normal and abnormal quantity variables , independent t - test ( student 's t - test ) for the comparison of means of two - state quality variables , and analysis of variance ( anova ) and tukey post hoc test for the comparison of means of multi - complex variables ( normal quantitative and multimode qualitative variables ) to examine the pure relationship between the variables for direct and indirect effects of confounding variables on the main variables .
this study has been approved ( with the registration number of 89050 ) by the regional ethics committee of mashhad university of medical sciences , mashhad , iran .
ninety - eight women ( 75.4% ) were housewives . in terms of job categories of infertile women , 19 subjects ( 59.4% )
were involved in cultural educational fields and other occupational categories such as medical sciences , technical , and engineering .
thirty - eight women ( 29.2% ) had university degree , 43 subjects ( 33.1% ) had high school education , and the others had primary and middle school education .
forty - seven ( 36.2% ) infertile women 's spouses were self - employed , 40 ( 30.8% ) spouses were employees , and others were either workers or unemployed .
one hundred and six ( 81.5% ) infertile women lived only with their respective partner in one place and 106 ( 79.2% ) subjects lived in the town . in terms of housing status , 53 ( 40.8% ) women had a private home and 49 ( 37.7% ) had a rental property .
results of the study showed that 99 ( 76.2% ) infertile women had social and artistic outdoor activities ( other than their permanent jobs ) .
thirty - five ( 54.7% ) subjects attempted to increase or decrease their weight to remain fit .
the mean of body mass index ( bmi ) of the women was 20.87 3.71
. other results of the study showed that the mean length of marriage was 7 4.23 years .
the mean period of knowing about their infertility was 5.24 4.12 years and the mean duration of the infertility treatment was 4.1 3.95 years .
the cause of infertility in 61 cases ( 46.9% ) was female factor , in 49 cases ( 37.7% ) was male factor , and in the remaining was a combination of male and female factors or unknown .
forty - nine cases ( 38.0% ) were affected by sperm disorders and 43 cases ( 33.3% ) with ovulation disorders .
in addition , 74 ( 56.9% ) infertile women were quite promising about the success of their treatment and 100 ( 76.9% ) women were accompanied by their spouses in the process of infertility treatment .
one hundred and sixteen ( 89.2% ) of the women themselves and 115 ( 88.5% ) of their spouses had a great desire to have children .
the mean sexual function score was 27.23 3.8 and the mean score of marital adjustment was 113.8 19.73 . in terms of body image , 121 ( 93.1% ) infertile women had higher scores than the mean score ( 231 ) .
fifty - nine ( 45.4% ) infertile women had sexual function scores more than the cut - off point of 28 on the scale of women 's sexual functioning .
one hundred ( 76.9% ) women had high marital adjustment score ( above the cut - off score of 100 ) .
the results of pearson correlation test showed that there was a direct correlation between overall body image of infertile women with sexual function ( p < 0.001 , r = 0.4 ) .
spearman correlation test showed that there was a direct correlation between the subscales of ideal body image ( or desired ) with overall sexual function ( p = 0.04 , r = 0.2 ) .
pearson test showed a direct correlation between the subscales of body image , including the body when alone ( p < 0.001 , r = 0.305 ) , the real body ( p = 0.008 , r = 0.231 ) , the body that people think ( p < 0.001 , r = 0.330 ) , the body as it is recognized by the spouse ( p < 0.001 , r = 0.4 ) , and the body as it is known by the spouse 's family ( p < 0.001 , r = 0.360 ) , with sexual function [ table 1 ] .
relationship between body image subscales with sexual function in infertile women in addition , spearman correlation test showed that there was a direct correlation between overall body image with marital adjustment in infertile women ( p < 0.001 , r = 0.4 ) .
in addition , spearman test results showed that there was a direct correlation between body image subscales , including the body when alone ( p = 0.001 , r = 0.312 ) , the real body ( p = 0.004 , r
= 0.353 ) , the body that people think ( p = 0.016 , r = 0.211 ) , spouse 's imagination of the body ( p < 0.001 , r = 0.453 ) , and spouse 's family 's imagination of the body ( p < 0.001 , r = 0.402 ) , with marital adjustment in infertile women . therefore , by improving the body image subscales in infertile women
however , there was no relationship between the subscales of ideal body image with marital adjustment [ table 2 ] .
relationship between body image subscales with marital adjustment in infertile women pearson 's test results on the correlation between body image with sexual function subscales in infertile women showed that there was a direct correlation between body image with sexual arousal subscale ( p = 0.003 , r = 0.3 ) . according to the spearman test results
, there was a direct correlation between the body image and subscales of sexual desire or attraction ( p = 0.024 , r = 0.2 ) , vaginal moisture ( p = 0.001 , r = 0.215 ) , orgasm ( p < 0.001 , r = 0.37 ) , sexual satisfaction ( p < 0.001 , r = 0.34 ) , and dyspareunia ( p = 0.007 , r = 0.235 ) [ table 3 ] . relationship between body image with sexual function subscales in infertile women in this research , the correlation between body image with marital subscales in infertile women was also evaluated .
the results of pearson test showed that there was a direct correlation between the body image with the subscales of marital adjustment in terms of agreement and consent ( p < 0.001 , r = 0.335 ) .
spearman 's test results showed that there was a direct correlation between body image of infertile women with the subscales of satisfaction with life ( p < 0.001 , r = 0.315 ) , continuity of life ( p = 0.007 , r = 0.237 ) , and expressing emotions within the family environment ( p < 0.001 , r = 0.37 ) .
thus , with more positive body image in infertile women , the subscales of marital adjustment were found to be better [ table 4 ] .
the results of the present study showed that there was a direct correlation between body image with sexual function .
there was a direct correlation between the subscales of body image , ideal body ( or desired ) , the body when alone , the real body , the body that the people think , spouse 's imagination of the body , and spouse 's family 's imagination of the body , and sexual function .
several studies have confirmed the relationship between the body image with sexual function in different fields .
it could be compared to similar studies such as the study of pujols et al . that reviewed the relationship between sexual function , sexual satisfaction , and body image in healthy women , the study of seal et al .
on the relationship between body esteem and sexual function among healthy female students , and the study of hopkins investigating self - esteem , body image , and sexual awareness in 3050 year old unmarried women .
these studies investigated the role of body image in sexual function of healthy women . in some other studies
for instance , da silva et al . studied the effect of colorectal surgery on sexual function , body image , self - efficacy , and public health in women .
fobair et al . investigated body image and sexual problems in young women with breast cancer .
also , kilic et al . evaluated the effect of permanent ostomy on body image , self - esteem , marital adjustment , and sexual function and jun et al .
compared the impact of structured programs on the marital relationship , body image , and sexual function in women with breast cancer and healthy women .
the results of our study were congruent with the findings of the above - mentioned studies .
we argue that in the studies of da silva et al . , fobair et al . , kilic et al . , and jun et al .
, women suffered from various diseases which affected their body image ; but in our study , although the infertile women were apparently considered as healthy people , they might have the same mental emotional problems which could impact on their body image like other patients .
in addition , from the perspective of infertile women , due to impaired fertility , they may assume themselves as sick and think that there is a disorder in their body and , therefore , their body image is affected .
knafo et al . aimed at investigating the relationship of body image satisfaction with sexual function in 117 women with systemic sclerosis in their study and indicated that concerns about body image was not associated with reduced sexual function .
lack of consistency between our results and the findings of knafo et al . was probably because the women who suffered from systemic sclerosis due to their physical deformities were not satisfied with their bodies and , therefore , had no positive body image .
researchers believe that people with disabilities and physical deformities feel ashamed of their bodies and are affected by disorders in body image .
it is noteworthy that the beliefs of individuals about the deficits and physical deformities have two modes , i.e. either the persons are affected by the defect and it somehow results in adverse consequences in their life or they do not pay attention to body defects and problems and assume that there is no defect in their body , and therefore , the defect does not have a negative impact on their personal and social life .
the results obtained from the present study showed that with more positive body image , there was more favorable sexual function , while in the study of knafo et al . , despite the presence of physical defects and negative body image in women due to emotional psychological problems from the disease , they had more emotional feelings to their husbands and despite low body image , no change occurred in their sexual relationships .
in addition , the results of the present study showed that there was a direct correlation between body image and marital adjustment , i.e. more positive body image was associated with higher score of marital adjustment .
also , there was direct relationship between the subscales of body image , including the body when alone , the real body , the body that people think , spouse 's imagination of the body , and spouse 's family 's imagination of the body , and marital adjustment .
however , there was no relationship between marital adjustment and the subscale of ideal body .
meltzer and mcnulty , in a study to determine body image , marital satisfaction , and sexual satisfaction in women , and also kilic et al . and jun et al . in their studies concluded that more positive body image leads to better marital adjustment and intimacy .
the results of all three studies were consistent with the results of the present study .
in a study on the adult urban chinese women , concluded that women who had no good body image did not have a good relationship with their spouses .
showed in that study that the women who felt that their husbands had a pretty good idea about their bodies had a positive impression of their own bodies in addition to having better marital relationships . in the study of markey et al . on the role of spouses in the perception of body image satisfaction ,
it was reported that more satisfaction of women about their bodies had been caused when they felt that their spouses were also satisfied with their bodies and , therefore , this issue resulted in better marital relationships .
this finding was consistent with the results of the present study about direct relationship between the thought of the spouse about the body with marital adjustment in women . during the study ,
some variables could not be controlled by the researcher ; so , they are considered as limitations .
for example , stresses and concerns related to counseling , diagnosis , and treatment of infertility in the specialized infertility clinic of montaserieh might have an impact upon the subjects regarding how they respond to the questions . in this context , it has been tried to complete the questionnaires at a proper time with necessary mental preparation of the subjects . for proportional control of these restrictions , despite assuring subjects about the confidentiality of their information , in some cases they could not respond to the questions correctly .
also , personality differences of the subjects could affect the way they answer to the questions , which could not be controlled by the researcher .
therefore , it is suggested that the relationship between body image with sexual function and marital adjustment in different cultures of urban and rural communities should be explored in future research .
also , it is suggested to compare the relationship between body image with sexual function and marital adjustment in the general population and the infertile couples population who are undergoing ivf ( in vitro fertilization ) , iui ( intrauterine insemination ) , and other arts ( assisted reproductive technology ) .
also , comparing the body image of infertile couples with male and female factors and its impact on their sexual function and marital adjustment is also recommended for further research .
in the present study , a direct correlation was found between the body image with sexual function and marital adjustment . by improving the body image in infertile women , a better sexual function and higher marital adjustment
the results of this study can draw the attention of policy makers to develop and suggest training programs for the health professionals working in infertility clinics , specialized clinics for women , and psychology and family counseling clinics . also , it is recommended to assess body image , sexual function , and marital adjustment of infertile couples when they are admitted to any treatment or counseling center , in order to offer them appropriate training program to develop their positive body image , which in turn results in better sexual function and marital adjustment .
the results of this research could also contribute to the level of awareness and knowledge of teachers , students , and health care providers , who either work in general health centers or special infertility research centers , regarding the mental health of infertile women .
Output:
| background : body image is related to cognitive , emotional , and physical aspects of women 's life .
therefore , it is expected to have an important role in women 's sexual health and marital adjustment too .
this issue seems to be salient in infertile women who suffer from psychological consequences of infertility .
this study was conducted to investigate the relationship of body image with sexual function and marital adjustment in infertile women in 2011 in mashhad , iran.materials and methods : this correlational study was performed on 130 infertile women who referred to montaserieh infertility research centre in mashhad , iran .
subjects were selected using convenient sampling method . to collect data , valid and reliable questionnaires including demographic and infertility - related data tool , modified younesi body image questionnaire ,
rosen female sexual function index ( fsfi ) , and spanier dyadic adjustment scale ( das ) were used .
data analysis was performed by spss software using student 's t - test , correlation , analysis of variance ( anova ) , and tukey post - hoc test.results:the mean scores of body image , sexual function , and marital adjustment in women were 308.1 45.8 , 27.23 3.80 , and 113.8 19.73 , respectively . there was a direct correlation between overall body image and subscales of sexual function including sexual arousal ( p = 0.003 ) , sexual desire ( p = 0.024 ) , vaginal moisture ( p = 0.001 ) , orgasm ( p < 0.001 ) , sexual satisfaction ( p < 0.001 ) , and dyspareunia ( p = 0.007 ) .
a direct correlation was also observed between overall body image and subscales of marital adjustment including agreement and consent ( p < 0.001 ) , satisfaction with life ( p < 0.001 ) , continuity of life ( p = 0.007 ) , and expressing emotions within the family environment ( p < 0.001).conclusions : improved sexual function and marital adjustment in cases with higher body image provides evidence that one of the solutions to reduce sexual dysfunction and marital dispute in infertile women could be planning educational and counseling programs to improve women 's body image . |
PubmedSumm119622 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a nonhealing corneal ulcer is defined as an ulcer which does not show any indication of healing within two weeks , despite the administration of proper medical treatment .
suspicious causes of a nonhealing corneal ulcer include persistent infection , neurotrophic keratopathy , exposure keratopathy , dry eye , treatment toxicity , steroid use , and chronic conjunctival inflammation , such as ocular cicatricial pemphigoid .
once a corneal ulcer occurs and is left unattended , corneal melting , descemetocele , and corneal perforation can subsequently develop , leading to devastating consequences .
moreover , when a resistant corneal ulcer progressively develops , lamellar keratoplasty or penetrating keratoplasty is usually needed [ 4 , 5 ] . therefore , curing a resistant ulcer in its early stages is highly recommended .
amniotic membrane transplantation ( amt ) can be used to treat a superficial corneal ulcer . however , the efficacy of amt , or even repeated amt , in treating a nonhealing corneal ulcer is limited because the latter is usually associated with severe inflammatory response , which frequently causes corneal melting , earlier amniotic membrane dissolution , and deferred ocular surface epithelialization .
thus , reducing inflammatory cell infiltration and improving the local microenvironment may facilitate the healing of a resistant corneal ulcer .
inspired by the significant anti - inflammation effects of the epithelial cells and the successful clinical application of laser - assisted subepithelial keratectomy ( lasek ) , which makes an epithelial flap with alcohol and significantly prevents haze formation in the subepithelial area , we attempted to treat nonhealing corneal ulcers in this study with the use of active pedicle epithelial flap transposition combined with amt .
this study was approved by the institutional review board of shandong eye institute , qingdao , china , and conformed to the guidelines of the declaration of helsinki .
the medical records of patients who had undergone active pedicle epithelial flap transposition combined with amt for a nonhealing corneal ulcer between 1 march 2012 and 1 july 2015 were reviewed .
all of the patients had a history of eye hyperemia associated with pain and decreased vision .
the ulcers were from 2 to 5 mm in diameter and less than 1/3 of the corneal stroma in depth .
all ulcers were associated with corneal stroma melting and remained unhealed for 4 weeks despite the administration of medical treatment .
the study mainly focused on nonhealing sterile corneal ulcers , and all patients received corneal scraping , culture , and laser scanning confocal microscopy examination to exclude active infection , for example , a fungal , resistant bacterial , or acanthamoeba corneal ulcer .
the amniotic membrane ( am ) was prepared and preserved as previously reported , with minor modifications .
necrotic corneal tissue was removed from the base and wall of the ulceration , and then thermal cautery was applied to the ulcer to dry out its surface .
thereafter , an epithelial flap was constructed from the transparent cornea at the edge of the ulcer , near the limbus . for this procedure ,
obtaining a flap from the edge of ulcer ensures easy transposition , and taking a flap from the cornea near the limbus guarantees rapid healing of the epithelial defect resulting from making a flap .
in addition , a corneal epithelial scraper was used to create an epithelial flap without the use of alcohol to maintain epithelial cells activity .
briefly , the epithelial scraper was gently pressed onto the corneal surface to make a boundary of the flap shaped like the ulcer under the auxiliary arm of a caliper .
a pedicle , like a sprout , was preserved in the lateral or nasal portion of the epithelial flap .
the corneal epithelium was then carved following the boundary , with the depth confined to the epithelial layer . in this way ,
next , the flap was rotated to cover the epithelial nonhealing region of the ulcer . to maintain flap adhesion , fluid on the ocular surface
finally , a trephine was used to make an amniotic membrane of 14 mm in diameter , and the am patch was sutured onto the surface to cover the entire cornea using a continuous 10 - 0 nylon suture within 1 mm of the limbus ( figure 1 ) .
the primary diseases of nonhealing corneal ulcer in the study included herpes simplex keratitis ( hsk ) , corneal graft ulcer , and stevens - johnson syndrome ( sjs ) .
postoperatively , tobramycin and dexamethasone eye drops ( alcon , puurs , belgium ) were used 4 times daily for 1 - 2 weeks and then replaced with 0.1% fluorometholone eye drops ( santen , osaka , japan ) 4 times daily for approximately 1 - 2 months . for eyes with hsk ,
antiviral medication was applied topically and systemically with adjuvant corticosteroid eye drops [ 8 , 9 ] .
acyclovir eye drops ( wuhan wujing pharmaceutical co. , wuhan , china ) were used 4 times every day .
ganciclovir ophthalmic gel ( hubei keyi pharmaceutical co. , wuhan , china ) was used every night .
acyclovir was administered orally ( 8 mg / kg ) 3 times daily for 3 months . for eyes with prior corneal transplantation or stevens - johnson syndrome ,
1% cyclosporine eye drops ( huabei pharmaceutical co. , shijiazhuang , china ) were used 14 times daily .
the medical treatment was adjusted with the alleviation of symptoms and the dissolution of am .
corneal fluorescein staining was performed daily and the sutures were removed 13 weeks postoperatively when the am dissolved .
patients were examined daily for the first week , weekly for 4 weeks , and monthly thereafter .
ulcer healing time was observed by corneal fluorescein staining during the follow - up . the uncorrected visual acuity ( ucva ) , intraocular pressure ( iop ) , and corneal status were recorded .
laser scanning confocal microscopy was applied to determine the extent of local inflammation , and anterior segment optical coherence tomography ( as - oct ) was performed to visualize corneal tissue cicatrization proximal to the ulcer .
ucva before and after surgery was converted to the minimum angle of resolution ( log mar ) for calculation purposes and compared with student 's t - test
eleven patients ( 11 eyes ) with a nonhealing corneal ulcer who underwent the combined surgery were included in the study . of these , 7 were male and 4 were female , with an age range of 2968 years ( mean standard deviation , 58.1 11.4 ) .
the etiologies of the corneal ulcers included hsk ( 8 eyes ) , corneal graft ulcer ( 2 eyes ) , and sjs ( 1 eye ) .
the ulcers were less than 1/3 of the corneal stroma in depth and 25 mm in diameter and lasted for 16 months .
the site of ulcer in the 11 cases was on the pupillary zone in 5 eyes , on the inferior cornea in 5 eyes , and at the superior cornea in one eye .
these patients underwent various medical treatments ( antibiotics , antiviral medication , corticosteroids , growth factor , and bandage contact lens ) for 4 weeks . of these , 5 eyes received amt once and 1 eye received amt twice , but the ulcers remained unhealed ( table 1 ) . thereafter , active pedicle epithelial flap transposition combined with amt was performed , and patients were followed - up for 624 months ( 16.9 9.9 ) . after surgery ,
the corneal ulcers healed from 6 to 15 days ( 10.8 3.1 ) postoperatively with negative fluorescein staining . the epithelial defect that resulted from the construction of flap healed within 1 - 2 days ( 1.45 0.52 ) . following surgery ,
corneal opacity was alleviated during the follow - up , with variable effects on visual acuity ( va ) ( figure 2 ) .
an elevated iop ( 30 mmhg ) was present in 1 eye and controlled by medication within 3 days .
hsk recurrence was observed in 1 patient at 10 weeks and 14 months but without the occurrence of corneal ulcer .
corneal ulcer recurrence was noted in 1 eye ( after penetrating keratoplasty ) at 3 weeks postoperatively , resulting in a fungal infection and intractable corneal perforation .
the average preoperative and postoperative ucva were 1.70 log mar and 0.82 log mar , respectively .
the percentage of patients with ucva of < 0.05 decreased from 73% ( 8/11 eyes ) preoperatively to 9% ( 1/11 eyes ) postoperatively .
the va increased by at least one row ( maximum , six rows ) after surgery .
the difference in ucva pre- and postoperatively was statistically significant ( p = 0.001 ) ( table 2 ) .
the inflammatory cells were found to aggregate in the epithelium and basal membrane surrounding the epithelial nonhealing region of the ulcer by confocal microscopy prior to surgery .
inflammatory cell infiltration was noted to be greatly alleviated after surgery ( figure 3 ) . as - oct revealed that the surgical treatment had healed the corneal ulcer .
postoperatively , corneal stromal edema decreased , leaving a semitransparent and highly reflective region in the cornea ( figure 4 ) .
the management of nonhealing corneal ulcers is one of the most difficult challenges faced by ophthalmologists because only a few resistant ulcers can be cured solely by medication .
once the nonhealing corneal ulcer tends toward expansion and aggravation , devastating complications can subsequently develop . in the current study ,
the combination of active pedicle epithelial flap transposition and amt was found to be effective in promoting ulcer healing and yielding a good cosmesis . following the treatment ,
complete ocular surface epithelialization was achieved within an average of 10.8 days . initially understanding the underlying reasons for a deferred epithelial healing in this case series was necessary to achieve the most optimal therapeutic effect and recognize the involved mechanisms of the combined surgery in treating resistant corneal ulcers .
firstly , an abnormal or deficient basal membrane caused by corneal melting due to local inflammation hindered epithelial healing , resulting in defective cellular adhesion and recurrent breakdown of the epithelium . secondly , the inflammatory cells and stromal keratocytes in a distinct , preexisting inflammatory microenvironment restrained epithelial healing by secreting proinflammatory cytokines and proteolytic enzymes . in this study ,
the primary diseases of corneal ulcer were hsk , corneal graft ulcer , and sjs .
it is possible that many of the eyes affected by hsk or after keratoplasty had poor corneal sensation and the eyes with sjs had limbal stem cell pathology .
we believe that the mechanism behind the combined surgery in promoting ulcer healing is related to a comprehensive improvement in the corneal microenvironment through the use of an active epithelial flap .
since the introduction of lasek to refractive surgery in recent decades , epithelial flaps have successfully been used in subepithelial keratectomy by covering the excimer laser ablation area to reduce inflammation and scarring caused by photorefractive keratectomy [ 1113 ] .
it was shown in previous studies that many mediators produced or expressed in the corneal epithelium were effective in regulating inflammatory response and maintaining the homeostasis of the ocular surface , such as resolvin d1 , resolvin e1 , il1ra , netrin-1 , and unc5b . these factors reduced the recruitment of inflammatory cells , enhanced phagocytosis , and suppressed the secretion of proinflammatory cytokines [ 1418 ] .
it has been demonstrated in previous researches that active epithelial cells can markedly reduce ocular surface inflammation and relieve neurotrophic keratopathy [ 1921 ] .
the flap was obtained without the use of alcohol in the current study to preserve the activity of the epithelial flap as far as possible .
the active epithelial flap inhibited inflammatory cell infiltration in the inflamed tissue and reduced the quantity of proteinases and cytokines released into the inflammatory cornea . covering the ulcer with the active epithelial flap provided a relatively healthy substrate and microenvironment .
this facilitated epithelial migration , reinforced basal epithelial adhesion , and promoted ocular surface healing .
meanwhile , a decrease in the number of inflammatory cells was detected on confocal microscopy .
in addition , thermal cautery was helpful in astringing the melting tissue , gaining better adhesion of the epithelial flap , and ensuring a relative healthy basal membrane .
debridement of the necrotizing tissue around and on the ulcer base helped to improve the corneal microenvironment for ulcer healing .
by contrast , a replicating virus and/or severe local inflammatory response could damage the corneal basal membrane and disturb the normal epithelium repair process [ 8 , 22 ] . following surgery
, the topical administration of corticosteroids further suppresses the immune response , alleviating the stromal edema and improving the visual acuity .
of all the eyes , 5 eyes received amt once and 1 eye received amt twice .
after the application of a combination of active pedicle epithelial flap transposition and amt , all of these ulcers were successfully cured within a short time .
the results indicate that the epithelial flap might have a greater anti - inflammatory and prohealing effect than that of the amniotic membrane .
we speculated that it was the collaborative effect of the epithelial flap and amniotic membrane which inhibited inflammatory cell infiltration and facilitated a relatively healthy microenvironment for ulcer healing .
a high risk of immune rejection , epithelial defect , infection , graft melting , and corneal perforation is usually encountered when treating ulcers by corneal transplantation in patients with sjs or other immune diseases .
there is less possibility of the immune system being activated and more opportunity of gaining a favorable va prognosis by employing autogenic epithelial flap transposition in combination with amt , in addition to reconstructing the corneal surface at an early stage . in the current study , it was a considerable concern of the clinician whether or not the construction of an epithelial flap would aggravate the primary ocular disease .
the epithelial flap was obtained from the transparent cornea close to the limbus for all the eyes because the limbal stem cells are located in this position and taking a flap from here would assure rapid epithelialization .
the epithelial defect that resulted from making the flap healed 1.45 days postoperatively and no new region of epithelial defect was identified .
thus , active pedicle epithelial flap transposition combined with amt was a simple , safe , and effective treatment for nonhealing corneal ulcers .
the treatment of nonhealing sterile corneal ulcers was addressed in the current study but the same approach could not be expected to be effective in patients with recalcitrant corneal ulcers associated with active fungal or bacterial infection .
it is unknown whether the method should be delayed until all conventional treatment has failed or instead be considered earlier . although the outcome of combined surgery was good in the current study , a randomized , controlled study with a larger sample size is needed for further investigations .
the combination of active pedicle epithelial flap transposition and amt can reduce inflammatory response , promote epithelial healing , and restore useful vision in cases of nonhealing corneal ulcers .
Output:
| introduction . the objective was to evaluate the efficacy of active pedicle epithelial flap transposition combined with amniotic membrane transplantation ( amt ) in treating nonhealing corneal ulcers .
material and methods .
eleven patients ( 11 eyes ) with nonhealing corneal ulcer who underwent the combined surgery were included .
postoperatively , ulcer healing time was detected by corneal fluorescein staining .
visual acuity , intraocular pressure , surgical complications , and recurrence were recorded .
corneal status was inspected by the laser scanning confocal microscopy and anterior segment optical coherence tomography ( as - oct ) .
results .
the primary diseases were herpes simplex keratitis ( 8 eyes ) , corneal graft ulcer ( 2 eyes ) , and stevens - johnson syndrome ( 1 eye ) .
all epithelial flaps were intact following surgery , without shedding or displacement .
mean ulcer healing time was 10.8 3.1 days , with a healing rate of 91% .
vision significantly improved from 1.70 to 0.82 log mar ( p = 0.001 ) .
a significant decrease in inflammatory cell infiltration and corneal stromal edema was revealed 2 months postoperatively by confocal microscopy and as - oct .
corneal ulcer recurred in 1 eye .
none of the patients developed major complications .
conclusion .
active pedicle epithelial flap transposition combined with amt is a simple and effective treatment for nonhealing corneal ulcers . |
PubmedSumm119623 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: we review 4 patients with severe gbs and one patient with miller fisher syndrome ( mfs ) admitted to our institution from 2012 to 2013 .
all patients received very high - dose ivig ( total dose of at least 4 g / kg , equivalent to 2 standard treatment courses [ 2 g / kg ] ) administered over fewer than 14 days . all patients with gbs did not respond initially , prompting a second course of treatment ( table ) .
as this was a retrospective review of a small case series , institutional review board approval was not required .
all of the patients with non - o blood types ( 3/5 ) treated with very high - dose ivig developed clinically significant anemia requiring blood transfusion . when tested ( 2/3 cases ) , there was clear evidence of hemolysis ( positive direct antiglobulin test , low haptoglobin , high lactate dehydrogenase / bilirubin ) .
in addition , there were no other medical comorbidities or medications commonly implicated in causing autoimmune hemolytic anemia ( table ) .
patient 4 developed hematuria prior to discharge with normal hemoglobin and returned with massive hemolysis leading to pigmentary nephropathy and requiring hemodialysis .
patients with o blood type did develop anemia , but it was mild and clinically asymptomatic .
in addition , the patients with o blood type did not have evidence of hemolysis .
antibodies to blood group antigens ( a and b ) found in ivig due to pooling from donors with o type blood are proposed as the hemolytic mechanism in many prior observations .
the current industry standard antibody titers are < 1:64 for anti - a and < 1:32 for anti - b .
privigen , a commonly used liquid ivig formulation , currently has anti - a < 1:32 and anti - b < 1:16 .
however , the titers of anti - a and anti - b may vary within lots .
therefore , patients who are given higher doses of ivig will be exposed to higher levels of anti - a and anti - b antibodies .
although our patients received privigen , ha has been reported with use of many liquid ivig formulations .
antibodies to blood group antigens ( a and b ) found in ivig due to pooling from donors with o type blood are proposed as the hemolytic mechanism in many prior observations . the current industry standard antibody titers are < 1:64 for anti - a and < 1:32 for anti - b .
privigen , a commonly used liquid ivig formulation , currently has anti - a < 1:32 and anti - b < 1:16 .
however , the titers of anti - a and anti - b may vary within lots .
therefore , patients who are given higher doses of ivig will be exposed to higher levels of anti - a and anti - b antibodies .
although our patients received privigen , ha has been reported with use of many liquid ivig formulations .
we propose that risk of ivig - related ha is increased with high doses , significant in non - o blood types , and more likely to occur when administered over a short interval ( i.e. , < 2 weeks ) .
ha has not been frequently observed in patients receiving maintenance ivig , likely due to the lower dose , longer time intervals between infusions ( typically 34 weeks ) , and 23 week half - life of anti - a / b igg .
although all of our patients had gbs / mfs , ha has been reported in many other conditions treated with high - dose ivig such as postpolio syndrome , chronic inflammatory demyelinating polyneuropathy , myasthenia gravis , renal transplantation , and kawasaki disease .
the applicability of our findings is limited by a small number of cases , retrospective analysis , and hemolysis testing in only 2 of the 3 patients .
however , our findings raise relevant , novel considerations such as a possible maximum tolerated dose of ivig in a short time frame . in addition
, practitioners should exercise caution if considering escalating ivig dosages to > 2 g / kg in < 14 days .
hemoglobin and creatinine levels should be monitored closely during and after treatment with high - dose ivig ( up to 12 weeks ) to detect this untoward complication . in the literature
, nadir hemoglobin level seemed to occur within 2 weeks of treatment , commonly within 45 days .
if anemia occurs , testing should include direct antiglobulin test , peripheral blood smear , bilirubin , haptoglobin , lactate dehydrogenase , and reticulocyte count .
manufacturers should label anti - a and anti - b titers on their product and consider more stringent industry standards .
we propose that there is a maximal tolerated dose of ivig over a 2-week period , which is dependent on patient abo blood group and ivig 's anti - a / anti - b titers .
Output:
| objective : we describe an underrecognized side effect of high - dose iv immunoglobulin ( ivig ) , hemolytic anemia.background:there are no established guidelines on treating patients with guillain - barr syndrome ( gbs ) who relapse or do not improve after a standard course of treatment ( ivig or plasma exchange ) .
some centers will opt for a second course of the initial treatment .
there is an ongoing trial of a second course of ivig in patients with severe gbs.methods:we retrospectively reviewed 4 patients with severe gbs who received high - dose ivig .
one patient inadvertently received a high dose of ivig for miller fisher syndrome .
all patients received a total of at least 2 courses of the standard dose of ivig ( total > 4 g / kg ) .
we review their clinical course and side effects.results:all patients with non - o blood types developed clinically significant hemolytic anemia requiring blood transfusion.conclusion:hemolytic anemia may limit doses of ivig for treatment of severe gbs in patients with non - o blood types . |
PubmedSumm119624 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the effective administrators are those who dedicate themselves to success of the organization not showy presentation of their own achievements ( 1 ) .
while narcissism is a disordered sense of self - admiration ( 2 , 3 ) , self - confidence was always a necessary psychological need , which has recently changed into a critical economic need ( 2 ) .
nowadays , not only knowledge is required for the proper leading of an organization , but also qualities such as independence , self assurance , self - dependence , and inventions , all best outlined as self - confidence are mandatory ( 14 ) . according to the previous research , the inventive behavior of the manager is most depends on their communication within the professional environment ( 24 ) . despite general agreement on the importance of managers for provocation of personal new accomplishments , the literature is less congruent regarding the role of managers and new inventions .
these researches actually evaluate the effect of managers using outcome models ; that is , discarding outcomes related to invention and concentrating on those behaviors of managers that positively affected the efficacy ( 15 ) .
in other words , now we need many who bear at least some levels of self - confidence as the matter of economic progression .
the vital role of self - confidence is just as evident as the catastrophes resulting from its absence .
there are six virtues most valuable regarding development of self - confidence , which all a successful organization should actualize : informative life , self - acceptance , responsibility , assertiveness , directed life , and self - integration ( 16 ) .
if an individual or an organization represents positive attitudes about a behavior and believes in it , that behavior brings about positive outcomes ( 5 ) .
if an organization desires to achieve a prominent behavioral culture and brilliant self - confidence , it should consider at least seven basic principles : respect , responsibility and sources , acknowledgment and reward , relationships , icon presentation , and regeneration .
these principles are synergistically related and a greater outcome results if they concomitantly occur ( 4 , 7 ) .
self - confidence is a complex made of self - efficacy and self - esteem .
major life challenges include the ability to balance fiscal affairs , self - care , competent social interactions , and capabilities to overcome obstacles and persistently accomplish their visions ( 78 ) .
a productive self - confidence contains all these elements and its absence results in adverse effects on the physical and emotional state of a human being ( 89 ) .
those with low self - confidence usually judge themselves based on the current accidents and their negative sensations about themselves persist more than their positive perceptions do . a healthy self - confidence emanates from the ability of true evaluation of oneself . today , educational authorities , parents , financial and governmental leaders , all acknowledge the value of self - confidence in gaining success ( 8 , 1013 ) .
self - confidence is related to personality characteristics , capabilities , weaknesses , and other features of psychological order of the person .
self - confidence , in fact , is a reflection of foreign evaluations ( 8 , 1315 ) .
reviewing literature shows that self - confidence is a psychological concept formed during growth of an individual and may not be expeditiously changed .
authorities believe that both the inventive mind and self - confidence belong to acquired characteristics of a human being ( 35 , 1418 ) .
in fact , selfishness or more specifically narcissism is the preference of self to others ( 2 , 3 ) . while selfishness is a common trait , narcissism bears a psychodynamic nature ( 2 , 3 ) .
according to freund s analysis of this personality , disorder the confidence of the sufferer is limited only to the positive points to only accept positive points and reject weaknesses ( 3 ) .
they believe they are absolute and ideal without defects ( 24 ) . the aim of this study was to evaluate the relation between the self - confidence of nursing administrators and vocational satisfaction of the staff in the teaching hospitals of tums , tehran , iran .
this cross sectional study was a descriptive analytical study and performed over 6 months from may to november 2011 .
we collected the detailed list of 16 teaching hospitals under administration of tehran university of medical sciences early 2010 and gathered data via stratified randomized sampling scheme .
as there are only a few iranian studies on self - confidence of nursing administration and its correlation to vocational satisfaction of the staff , we arbitrarily choose the ratio of nursing administration self - confidence to vocational satisfaction of staff to be 50% and using the below formula for sample size calculation ,
n = z1 /22p(1-p)d2,where d was the accuracy ( 7% ) and for the =.05 we computed sample size as 196 and interviewed 200 individuals in each group of nursing administrators and staff .
the instrument for measurement was a questionnaire designed by researcher that containing demographic section and nursing administration self - confidence ( 56 items ) and vocational satisfaction ( 21 items ) sections using likert s 5-point scale .
however , before the start of the study the questionnaires were considered by colleagues and their comment were implemented to improve the quality of the questionnaires and the content validity found reasonable by them .
then , after collecting the data from 30 nursing administrators and 30 staff , the cranach s alpha was calculated on the corresponding questions and found to be 0.95 and 0.97 respectively , which are evidences of high reliability . after the data were collected , we used spss ( 17.0 ) for data entry and primary evaluation .
we scored the answers for both nursing administrators and staff and divided them into three groups as : 1 ) below 33% , 2 ) 33% to 67% and 3 ) above 68% .
the demographic characteristics of the nursing administrators and staff described as a table . also , the ratio of score of self - confidence of nursing administrators and vocational satisfaction of staff in the above three groups were computed and presented as a table .
after description of demographic features ratio of scores , the univariate analysis of the effects of personal factors on the self - confidence of nursing administration and vocational satisfaction of the staff was carried out . as the scores were grouped and were ranks we used non - parametric tests such as mann - whitney and kruskal - wallis . in addition , we used spearman s correlation of coefficient . in order to adjust for the effect of dependency of scores in the same department
the research ethics was approved by deputy of research of school of public health of tehran university of medical sciences .
we described the goal and nature of this study for nursing administrators as consent their questionnaires .
the age of 39.5% of administrators was between 3039 years and 9.5% were more than 50 years .
most of them were academically trained and had the bsc ( 47% ) or msc ( 49.5% ) degrees . in the staff group ,
the age of 38.5% of the staff was between 3039 years and 10% were over 50 years .
44.5% of them had academic degree as bsc and 8% had technician degree ( table 1 ) .
as the table 2 presents , the ratio of administrators with low self - confidence score was 32.5% , moderate score was 34.5% and high score was 33% .
furthermore , this table demonstrates that the satisfaction in the staff group was low in 35.5% , moderate in 27% , and high in 37.5% .
the mean sd of score value for self - confidence of managers and satisfactory of staff were 134.9 19.8 and 89.12 18.3 , respectively .
mean sd for self - confidence scores in men and women administrators were 140.3 20.1 and 132.63 19.4 , respectively ( p=0.016 )
. however , there was no significant difference between self - confidence score of administrators with different age ( p=0.69 ) , educational level ( p=0.11 ) , and organizational ranking ( p=0.35 ) .
thus , the results confer that the only effective factor in the self - confidence of administrators is their gender .
similarly , the satisfaction score was only related to the years of experience of staff ( p=0.03 ) in which satisfaction was lower among those with less than 10 years of experience .
in addition , there was insignificant relationship between satisfaction score of the staff and their sex ( p=0.19 ) , age ( p=0.13 ) , educational level ( p=0.28 ) , marital status ( p=0.11 ) , number of children ( p=0.31 ) , educational level of spouse ( 0.93 ) , and employment status of spouse ( p=0.46 ) .
as the distribution of both the satisfaction and self - confidence were not normal ( p<0.0001 and p<0.0004 respectively ) , therefore spearman correlation of coefficient was computed to analyze the correlation between these two variables .
preliminary analysis demonstrated a positive correlation between the two so as the higher the self - confidence the higher the staff satisfaction is ( p=0.037 ) .
then , it may be asked if this correlation is under influence of factors affecting either vocational satisfaction ( such as years of employment ) or self - confidence ( such as gender ) .
in fact , the staff employment history should significantly correlate with the self - confidence of the administrators and the latter gender should correlate with the staff satisfaction . however , this turned not to be the case for either the former ( p=0.82 ) or the latter ( p=0.10 ) .
it is worth mentioning that all the analysis was carried out without adjusting for the effect of sampling scheme , department effect , means looking at the possible effect of correlation of the variables as the administrators and staffs were from same department .
however , since adding this effect will always attenuate the correlations ( increase the p - value ) and as none of the univariate analysis was significant ; therefore the findings will remain the same .
then , only we need to look at the association of the self - confidence of the administrators and staff satisfaction in the presence of department effect . after adjusting for the effect of department in a random effect modeling ,
the p - value of the correlation between self - confidence and the staff satisfaction from 0.037 increased to 0.055 .
according to our findings , male administrators have more self - confidence than female administrators do .
in addition , we found that the employment experiment of the staff is a significant factor in their vocational satisfaction so that the higher the experience the more the satisfaction . after adjusting for department , the correlation between administration s self - confidence and the staff s vocational satisfaction was found not significant . in our previous study to assess self - confidence over managerial staff in the tehran university of medical sciences
the organizational ranking of a manager did not affect self - confidence as is seen in the current study .
in the previous study , we found a positive correlation between educational degrees of a manager ( more self - confidence with phd degree ) which was not repeated in the present study .
it is worth to note that there was no correlation between age groups and self - confidence .
furthermore , we found that there was a significant correlation between administrators self - confidence and the staff vocational satisfaction ( 19 ) .
our previous results about the correlation of administrators self - confidence and the staff vocational satisfaction are in contrast with the results of the present study .
this difference mainly results from the nature of the administration in the two studies : the previous study was done over the official managers while the current study is done over nursing field administration ( supervisor , matron , head nurse ) .
the evidence for the effect of organization on the self - confidence comes from previous studies , who demonstrate that self - confidence is under influence of the type of organization , its size , complexity and context ( 20 ) .
thus , the observed difference results from the different population . we could not find a similar study regarding this variable . however , there are studies illustrating the important role of self - confidence in determination of incentives and work dependent behaviors ( 1 , 913 ) .
many studies demonstrate significant and positive relation between self - confidence and person s efficacy ( 4 , 2122 ) the lee study in 2003 demonstrates the positive relation of the self - confidence and improved efficacy ( 21 ) .
heck et.al also found a positive relation between the quality of communications between managers and staff and self - confidence of administrators ( r=0.67 ) ( 22 ) . in 2003
lee showed that administrators self - confidence and the interactions of managers and staff are positively correlated ( r=0.67 ) ( 21 ) .
however , the current study shows that the administrators self - confidence not only adds nothing to improvement of the system situation but also results in the reduced staff satisfaction .
our study is performed in a medical organization while the referring studies were done over non - medical organizations . acknowledging this , there are studies demonstrating the negative correlation between the size of the organization and the administration s self - confidence ( 23 , 24 ) .
thus , type of the organization , its size , and complexity all affect the self - confidence of both the staff and administrators and may differentially influence their efficiency or satisfaction ( 21 ) .
the aforementioned considerations call the need for more studies in order to define the role of administrators self - confidence and staff satisfaction in the organizational efficiency of patient satisfaction . in other words , the findings from one organization
for instance , the results from our study on nursing administrator may not be expanded to non - medical managers or even medical official managers .
our research was a new subject , with limited resources . considering the lack of research in this area , the results from our study on nursing administrator
our study results are generated from public hospitals , which are located in tehran ; therefore , the generalization of the results to the other public hospitals in iran should be done cautiously , even though around 50% of these hospitals are operating in tehran .
similar studies in other parts of the country might improve the generalizability of this study .
in addition , other cross - sectional the studies are beneficial to monitor the ratio and the correlation between the self - confidence and vocational satisfaction .
our results demonstrate that gender and years of employment are the only factors affecting self - confidence and vocational satisfaction between the administration and staff respectively .
the staff employment history was not significantly correlates with the self - confidence of the administrators and the gender was not correlated with the staff satisfaction .
self - confidence in the administration was not significantly correlated with vocational satisfaction of the staff .
finally , we should emphasize that self - confidence , affect both the staff and administrators and may differentially influence their efficiency or satisfaction .
we recommend evaluating the policies , programs , and the processes that may result in improved self - confidence in both the staff and administration .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .
Output:
| backgroundself - confidence is a glorious feature of an effective administrator .
their main goal is the organizational success .
therefore , we approached this idea by evaluating the self - confidence of nursing administration in tehran university of medical sciences ( tums ) teaching hospitals and its relation to vocational satisfaction of the staff.methods:in a cross - sectional study , we interviewed 200 nursing administrators and 200 staff in different departments of the tums teaching hospitals using a standardized questionnaire to assess the self - confidence among nursing administrators and staff satisfaction .
data were entered in spss ( 17.0 ) and analyzed using this software and stata ( 11.0 ) using non - parametric tests and spearman s correlation of coefficient .
the significant level was set as p<0.05.results : of 200 nursing administrators 58 ( 29% ) were male and 142 ( 71% ) were female .
mean sd of the self - confidence score for the nursing administrators was 134.9 19.8 . among the staff 68 ( 34% )
were male and 132 ( 66% ) were female .
the mean sd of the vocational satisfaction for staff was 89.12 18.3 .
after considering the effect of departments in a regression model , the correlation between nursing administration s self - confidence and the staff s vocational satisfaction was found not significant ( p=0.055).conclusion : gender and years of employment were the only factors affecting self - confidence and vocational satisfaction between the nursing administration and staff respectively , which not significantly correlated after adjustment . |
PubmedSumm119625 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: malignant transformation may occur in mftthis malignant change denotes loss of heterozygosity in clyd genethe differentiation between bcc and immature te represents a diagnostic challenge
malignant transformation may occur in mft this malignant change denotes loss of heterozygosity in clyd gene the differentiation between bcc and immature te represents a diagnostic challenge trichoepithelioma ( te ) is a benign adnexal neoplasm .
lesions are rounded , skin - colored , firm papules or nodules , 2 - 8 mm in diameter .
they are located mainly on nasolabial folds , nose , forehead , upper lip , and scalp .
multiple familial trichoepithelioma ( mft ) is an autosomal dominant ( ad ) disorder beginning in childhood and progresses slowly .
a 38-year - old female presented with a 27 years history of asymptomatic , skin colored papules .
lesions were firm in consistency , ranging from 5 to 10 mms in diameter and were distributed on her face ; around eyes , on the nose , nasolabial folds and upper lip [ figure 1a and b ] .
patient 's father had similar lesions but there was no affection of other family members .
routine investigations including hemogram , urine analysis , liver and renal function tests were non contributary .
first patient presented by skin colored papules on : ( a ) periorbital region ( b ) nose , nasolabial folds and upper lip excisional biopsy of a representative lesion was done after taking patient consent .
histopathological examination of hematoxylin and eosin ( h and e)-stained sections revealed superficial dermal , well circumscribed , non capsulated , symmetrical lesion .
this lesion was formed of solid aggregates of uniform basaloid cells with peripheral palisading but lacked epidermal connection , pilar differentiation and retraction artifacts .
they were surrounded by a stroma with increased number of fibroblasts [ figure 2a ] .
cells were uniform , with large nuclei and scanty cytoplasm and lacked cytological atypia , mitoses or necrosis [ figure 2b ] .
aggregations of fibroblasts , representing abortive attempts to form papillary mesenchyme ( papillary mesenchymal bodies ) , were detected , that are characteristic of te [ figure 2c ] .
( a ) trichoepithelioma showing superficial dermal solid basaloid masses with peripheral palisading and lacked the epidermal connection , epithelial stromal retraction artifact , mitosis or cytologic atypia ( b ) an intrastromal cleft ( arrow ) was observed around the solid aggregates that were tightly encircled by fibroblasts ( h and e , 200 a and b ) ( c ) aggregations of fibroblasts , representing abortive attempts to form papillary mesenchyme ( papillary mesenchymal bodies ) ( arrow ) ( d ) foreign body granuloma ( arrows ) adjacent to a basaloid mass ( asterisk ) ( h and e , 400 c and d ) based on clinical and histopathological criteria , the diagnosis of immature te was reached .
however the presence of solid basaloid aggregates with peripheral palisading may lead to a misdiagnosis of bcc .
thus , we performed immunohistochemical ( ihc ) staining for bcl2 , cd10 , cd34 and androgen receptor ( ar ) antibodies .
both cd10 and cd34 stained the stromal cells but not the basaloid cells [ figure 3b and c ] .
both tumor cells and stroma did not show any ar immunoreactivity [ figure 3d ] .
trichoepithelioma ihc staining profile : ( a ) the outermost epithelial cells showed positivity for bcl2 ( arrows ) ( b ) cd10 stained the stromal cells but not the basaloid cells ( arrow ) ( c ) cd34 stained the stromal cells ( colored arrows ) but not the basaloid cells ( asterisk ) , it also stained blood vessel ( internal control ) ( black arrow ) ( d ) both tumor cells and stroma lacked any androgen receptor immunoreactivity ( immunoperoxidase 400 for a , b , c and d ) a 65-year - old male , the father of the first patient , was presented similarly by papulo - nodular lesions with the same distribution and morphology described in his daughter but larger in size [ figure 4a ] .
one month before reaching us , one of those nodules enlarged markedly to reach a size of 6 cm with repeated bleeding , ulceration and crustation [ figure 4b ] .
patient 's father presented by similar but larger lesions on ( a ) : periorbital region and nose with ulcerated crusted nodule on the left side of the nose ( b ) excisional biopsy was taken from a representative papule and incisional biopsy was taken from the enlarging nodule after taking patient consent . for the former biopsy , examination of h and e - stained sections and immunohistochemical - stained sections of the same antibodies revealed the same results as the first case .
for the latter biopsy , islands of basaloid cells extending from the epidermis to the dermis with peripheral palisading and prominent stromal epithelial retraction artifacts were observed .
immunohistochemical staining revealed that , the basaloid cells stained diffusely with bcl2 [ figure 5a ] , cd10 [ figure 5b ] and focally with ar antibodies [ figure 5c ] .
basal cell carcinoma ihc staining profile : ( a ) the basaloid cells stained diffusely with bcl2 .
( c ) cd34 immunostaining was negative in basaloid cells and fibrous stroma but stained the blood vessels ( internal control ) ( arrows ) .
( d ) androgen receptor stained the basaloid cells ( immunoperoxidase 400 for a , b , c and d )
a 38-year - old female presented with a 27 years history of asymptomatic , skin colored papules .
lesions were firm in consistency , ranging from 5 to 10 mms in diameter and were distributed on her face ; around eyes , on the nose , nasolabial folds and upper lip [ figure 1a and b ] .
patient 's father had similar lesions but there was no affection of other family members .
routine investigations including hemogram , urine analysis , liver and renal function tests were non contributary .
first patient presented by skin colored papules on : ( a ) periorbital region ( b ) nose , nasolabial folds and upper lip excisional biopsy of a representative lesion was done after taking patient consent .
histopathological examination of hematoxylin and eosin ( h and e)-stained sections revealed superficial dermal , well circumscribed , non capsulated , symmetrical lesion .
this lesion was formed of solid aggregates of uniform basaloid cells with peripheral palisading but lacked epidermal connection , pilar differentiation and retraction artifacts .
they were surrounded by a stroma with increased number of fibroblasts [ figure 2a ] .
cells were uniform , with large nuclei and scanty cytoplasm and lacked cytological atypia , mitoses or necrosis [ figure 2b ] .
aggregations of fibroblasts , representing abortive attempts to form papillary mesenchyme ( papillary mesenchymal bodies ) , were detected , that are characteristic of te [ figure 2c ] .
( a ) trichoepithelioma showing superficial dermal solid basaloid masses with peripheral palisading and lacked the epidermal connection , epithelial stromal retraction artifact , mitosis or cytologic atypia ( b ) an intrastromal cleft ( arrow ) was observed around the solid aggregates that were tightly encircled by fibroblasts ( h and e , 200 a and b ) ( c ) aggregations of fibroblasts , representing abortive attempts to form papillary mesenchyme ( papillary mesenchymal bodies ) ( arrow ) ( d ) foreign body granuloma ( arrows ) adjacent to a basaloid mass ( asterisk ) ( h and e , 400 c and d ) based on clinical and histopathological criteria , the diagnosis of immature te was reached .
however the presence of solid basaloid aggregates with peripheral palisading may lead to a misdiagnosis of bcc .
thus , we performed immunohistochemical ( ihc ) staining for bcl2 , cd10 , cd34 and androgen receptor ( ar ) antibodies .
both cd10 and cd34 stained the stromal cells but not the basaloid cells [ figure 3b and c ] .
both tumor cells and stroma did not show any ar immunoreactivity [ figure 3d ] .
trichoepithelioma ihc staining profile : ( a ) the outermost epithelial cells showed positivity for bcl2 ( arrows ) ( b ) cd10 stained the stromal cells but not the basaloid cells ( arrow ) ( c ) cd34 stained the stromal cells ( colored arrows ) but not the basaloid cells ( asterisk ) , it also stained blood vessel ( internal control ) ( black arrow ) ( d ) both tumor cells and stroma lacked any androgen receptor immunoreactivity ( immunoperoxidase 400 for a , b , c and d )
a 65-year - old male , the father of the first patient , was presented similarly by papulo - nodular lesions with the same distribution and morphology described in his daughter but larger in size [ figure 4a ] .
one month before reaching us , one of those nodules enlarged markedly to reach a size of 6 cm with repeated bleeding , ulceration and crustation [ figure 4b ] .
patient 's father presented by similar but larger lesions on ( a ) : periorbital region and nose with ulcerated crusted nodule on the left side of the nose ( b ) excisional biopsy was taken from a representative papule and incisional biopsy was taken from the enlarging nodule after taking patient consent . for the former biopsy , examination of h and e - stained sections and immunohistochemical - stained sections of the same antibodies revealed the same results as the first case .
for the latter biopsy , islands of basaloid cells extending from the epidermis to the dermis with peripheral palisading and prominent stromal epithelial retraction artifacts were observed .
immunohistochemical staining revealed that , the basaloid cells stained diffusely with bcl2 [ figure 5a ] , cd10 [ figure 5b ] and focally with ar antibodies [ figure 5c ] .
basal cell carcinoma ihc staining profile : ( a ) the basaloid cells stained diffusely with bcl2 .
( c ) cd34 immunostaining was negative in basaloid cells and fibrous stroma but stained the blood vessels ( internal control ) ( arrows ) .
( d ) androgen receptor stained the basaloid cells ( immunoperoxidase 400 for a , b , c and d )
clinically , this tumor occurs either as a solitary lesion without any familial association or as multiple lesions in mft .
lesions develop as firm , non - ulcerated , flesh - colored papules with a propensity for the face and rarely exceed 0.5 cm in size .
mft was initially described in 1892 under the names multiple benign cystic epithelioma and epithelioma adenoides cysticum . in most cases ,
ulceration may occur rarely . the gene associated with the familial type of te links to the short arm of chromosome 9 .
however , other reports documented defects of a tumor repressor gene on chromosome 16 , cyld . to date , 17 mutations of this gene have been described to be associated with mft .
males and females receive the gene equally , but because of lessened expressivity and penetrance in men , most patients are women .
te contains adenoid network or solid aggregates of basaloid cells , horn cysts , and abortive hair papillae .
. however , some lesions show relatively little differentiation towards hair structures with very few or even absent horn cysts .
histopathological differences observed between te and bcc te is a benign lesion that may be excised by a small margin of healthy tissue , thereby facilitating surgical repair ; however , bcc is a locally malignant tumor treated by excision of the lesion with 3 - 4 mm margins .
diagnosis may be assisted in a given case by clinical data , and the presence of hereditary transmission .
the distinction between bcc and immature te on histopathologic basis is quite difficult especially in small superficially shaved specimens .
bcl-2 expression has been found to be limited to the outermost basaloid cells in tumor nests of te and to be diffuse in bcc .
cd34 is considered to be a good candidate because the stroma is positive in te and negative in bcc .
more recent studies have shown ar expression in a number of mature epithelial structures and epithelial neoplasms including bcc .
in contrast , ar expression was absent in mature hair follicles or the few trichogenic neoplasms studied to date .
these findings suggested that ar expression might be a useful adjunct in the histologic differential diagnosis between bcc and te .
immunostaining markers that differentiate te and bcc malignant transformation of te to bcc is rare .
literature review showed that only 12 cases were reported up till now with the first case in 1959 .
malignant transformation denotes loss of heterozygosity in clyd gene in the 9p21 and 9q22 chromosomal regions .
matt et al . , had indicated that there is a common gatekeeper between te and bcc .
tan and his associates concluded that bcc arising on top of mft lesions may represent a novel contagious gene syndrome .
multiple treatment modalities had been suggested for te , including surgical excision and grafting , chemical peeling and co2 laser .
the first case had been treated by co2 laser . regarding the treatment of bcc in the second case , it had been surgically excised but he was not interested in treating te lesions .
we presented the thirty fourth case of mft and also the thirteenth case of malignant transformation of te to bcc.the histopathological and immunohistochemical differences between te and bcc were summarized and tabulated.we recommend the administration of the suggested immunohistochemical antibodies to differentiate between bcc and immature te .
we presented the thirty fourth case of mft and also the thirteenth case of malignant transformation of te to bcc .
we recommend the administration of the suggested immunohistochemical antibodies to differentiate between bcc and immature te .
Output:
| trichoepithelioma ( te ) is a benign tumor of follicular origin that presents as small , skin - colored papules predominantly on the face . when more than one family member is affected , the disease is known as multiple familial trichoepithelioma ( mft ) .
it is a rare autosomal dominant ( ad ) skin disease .
malignant transformation is very rare .
we present a case of mft in a female patient and her father with malignant transformation to basal cell carcinoma ( bcc ) in the father .
we summarized the main histological differential parameters between te and bcc and applied immunophenotyping for both by administration of bcl2 , cd34 , cd10 and androgen receptor ( ar ) antibodies . |
PubmedSumm119626 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: sertoli - leydig cell tumours ( sclts ) are rare sex - cord stromal tumors of the ovary .
retiform sclt 's are rare histological variant of sclt with an average age of presentation being 16 years . to the best of our knowledge
the retiform variant of sertoli leydig tumors reported so far are seen in less than 10 years of age .
we present a rare case of retiform variant of sclt 's presenting in a 42-year - old female .
a 42-year - old female presented with painless lump in the lower abdomen for 7 years .
largest measured 14 12 cm , smallest measured 3 3 cm . on cutting fleshy , firm tissue was found within the cyst wall [ figure 1 ] .
microscopic examination showed ovarian tumor with tubular , cord like pattern lined by bland cuboidal to columnar cells .
also seen is retiform pattern at few places and scattered cells with abundant eosinophilic cytoplasm suggestive of leydig cells .
leydig cells showed focal positivity for vimentin and negativity for leydig cells [ figures 7 and 8 ] .
histological diagnosis of retiform variant of sertoli leydig cell tumor of ovary stage 1 ( t1n0m0 ) was made .
the patient was followed up to 2 years , she did not have any complaints .
gross appearance of sertoli leydig cell tumor sertoli cells arranged in cords , sheets and aggregates ( he 100 ) retiform pattern in serrtoli- leydig tumor ( he 100 ) sertoliform cells with clear cytoplasm ( he 400 ) leydig cells showing eosinophilic cytoplasm ( he 100 ) sertoli cells showing atypia ( he 400 ) cytokeratin positivity in sertoli component of sertoli leydig cell tumor of ovary ( 100 ) vimentin positivity in leydig component of sertoli leydig cell tumor of ovary ( he 100 )
however , retiform sertoli - leydig cell tumors present in the average age of 16-year - old . clinically ,
non - virilised patients present with non - specific symptoms like abdominal mass , pelvic pain .
it is seen that 80% of the patients with ovarian slcts and virilising manifestations present with elevated serum levels of testosterone and androstenedione .
however , sclts are unilateral and are confined to ovary at the time of diagnosis .
computerised tomography ( ct ) , magnetic resonance imaging ( mri ) , and positron imaging tomography ( pet ) scans can provide us a better visualisation of the extra - ovarian or metastatic spread of the tumor .
well - differentiated slct have an average diameter of 5 cm whereas intermediate type and poorly differentiated types have an average diameter of 15 cm .
microscopically , they are divided into following categories :
well - differentiated or meyer type 1 : they constitute 11% of slct.intermediate type or meyer type 2 : they constitute 54% of slct.poorly differentiated ( sarcomatoid or undifferentiated or meyer type 3 ] : they constitute 13% of slct.sclt with heterologous elements like skeletal muscle , cartilage.retiform type ( 15% ) : they resemble rete of ovary or testes .
staging wise t1 means tumor limited to the ovaries , t2 means tumor involves one or both ovaries with pelvic extention , t3 means involvement of one or both ovaries with microscopically confirmed peritoneal metastasis outside the pelvis .
intermediate type or meyer type 2 : they constitute 54% of slct . poorly differentiated ( sarcomatoid or undifferentiated or meyer type 3 ] : they constitute 13% of slct .
staging wise t1 means tumor limited to the ovaries , t2 means tumor involves one or both ovaries with pelvic extention , t3 means involvement of one or both ovaries with microscopically confirmed peritoneal metastasis outside the pelvis .
a total abdominal hysterectomy is considered as the treatment of choice in patients with unfavourable findings like rupture , extra - ovarian spread , poorly differentiated neoplasm , heterologous mesenchymal differentiation .
post - operative chemotherapy , radiotherapy or a combination of both , may also be considered in the patients with above mentioned poor prognostic factors .
similarly the 5 year survival rates for stage 1 tumor is 95% and that for stage iii and stage iv is zero percent .
Output:
| sertoli - leydig cell tumors are the uncommon sex - cord stromal tumors of the ovary .
we report a case of 42-year - old female with retiform variant of sertoli - leydig cell tumour .
she presented with the complaint of mass in abdomen for 7 years .
ultrasound revealed bilateral ovarian mass suggestive of malignancy .
bilateral salpingo - oopherectomy with surgical staging was done .
the tumor was diagnosed as stage i retiform variant of sertoli - leydig cell tumor on histopathology and immunohistochemistry . |
PubmedSumm119627 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the term taxonomy is used to describe the classification of various things , so the term drug taxonomy refers to the science of listing and describing drugs , according to various properties , in a manner which allows easy comprehension and understanding of their usage .
traditionally , only pharmaceutical properties ( e.g. , chemical structure and pharmacodynamic and pharmacokinetic characteristics ) have been used to separate drugs into various groups .
increasingly , however , the end user ( i.e. , the patient s or community s perspective ) is considered when studying pharmacology [ 1 , 2 ] . in the present work ,
we provide a balanced , syncretic approach to insulin taxonomy , using both patient - centered and pharmacokinetic aspects , to craft a number - based classification of insulin regimes .
this article is based on previously conducted studies and does not involve any new studies of human or animal subjects performed by any of the authors .
endocrinology and diabetology textbooks provide comprehensive coverage of various insulin preparations and then utilize these to discuss different insulin regimes .
the current american diabetes association ( ada)/european association for study of diabetes ( easd ) 2015 guidelines use the terms basal , basal plus ,
premixed , split - mix , and intensive to describe insulin regimes .
other terms used for regimes involving 3 or more injections per day are multiple and intensified insulin therapy .
this drug - centered or pharmaceutical - based terminology served diabetology practitioners adequately in the past ; the corresponding taxonomic methodology was able to incorporate the limited insulin preparations available , which included both traditional and modern insulins .
this pharmaceutical classification of insulin regimes is not , however , syntaxic with the current emphasis on a patient - centered approach .
it must be reemphasized here that it is patient - centeredness which forms the basis for recent advances in drug development and improvements in treatment guidelines .
most patients of diabetes do not appreciate the pharmacodynamic or kinetic nuances of insulin preparations . what is more relevant to the person requiring insulin is the number of injections to be taken per day , the timing of administration , and the flexibility with which these timings can be adjusted . based upon these factors ,
it is important to craft a fresh synopsis of insulin regimes , using the number of injections per day as the framework for systematic study . at the same time
, such a classification system must address the nature of insulin preparations , whether basal , premixed , or prandial .
modern clinical trials are available which support the use of premixed insulin in once - daily and thrice - daily dosages , as opposed to the traditional twice - daily regime .
the basal insulins detemir and glargine often need to be prescribed twice daily in order to achieve adequate glycemic control .
innovative regimes utilizing combinations of rapid - acting and premixed / coformulated insulins with varying frequencies of administration have also been documented .
while a number - based terminology has already been proposed , it is inadequate to cover the current range of insulin preparations and the large number of regimens that they are used in . with the newer insulin analogues available , a modern , number - based classification is required .
table 1 lists the various insulin regimes and preparations as well as the frequency and timing of administration for each .
all regimes enumerated in this table are backed by randomized controlled trials , as shown in table 2.table 1insulin preparations that are currently on the market , along with the prescription patterns for themfrequency of injectionname of regimeninsulin preparations usedtiming of administration1 ( once a day)basalnph , idet , iglar , i glar u300at bedtime or the same time every daybasalidegat any time of the daypremixedbiasp , lispromixwith major mealcoformulationidegaspwith major mealbasal + glp1raideg + liraglutideiglar + lixisenatideat any time of the day2 ( twice a day)basalnph , idet , iglarat bedtime and in the morningpremixedbhi , biasp , lispromixwith major meals
coformulationideg aspwith major meals
basal plusbasal + prandialat bedtime + with major meal3 ( thrice a day)prandialregular , aspart , lispro , glulisinewith mealsbolus
coformulationaspart + idegaspwith meals4 or 5 ( four or five times a day)basal bolusany combination of basal and boluswith meals , and at bedtime or twice dailycsi ( continuous insulin infusion pump)alternative to multiple injection
antipodal meal ( i.e. , meals spaced roughly 12 h apart )
minimum 8-h gap between 2 dosestable 2prescription patterns of currently available insulin preparations , supported by evidence from various published clinical studiesinsulin preparation / frequency of injectionsonce a daytwice a daythrice a daymore than thrice a dayinsulin degludeczinman et al .
t1 dm patients ( n = 629 ) nananainsulin glargine u 300riddle et al .
edition i. t2 dm ( n = 807 ) yki - jarvinen et al . am diabetes assoc 2014
t1 dm ( n = 408 ) nanainsulin degludec + insulin aspartonishi et al .
intensify premix i. t2 dm ( n = 446 ) nanahirsch et al .
t2 dm ( n = 172 ) jia et al . lancet diabetes endocrinol 2015 .
t1 dm ( n = 26 ) insulin aspartmathieu et al . diabetes obes metab 2014 .
t2 dm ( n = 680 ) nanana
basal nph , glargine , detemir , degludec , bhi biphasic human insulin , biasp biphasic insulin aspart , lispromix biphasic insulin lispro , iasp insulin aspart , ideg insulin degludec , idegasp insulin degludec and insulin aspart , ideglira insulin degludec and liraglutide , lixilan lixisenatide and insulin glargine , idet insulin detemir , iglar insulin glargine , iglu insulin glulisine , nph neutral protamine hagedorn , prandial regular , lispro , aspart , glulisine , na not applicable insulin preparations that are currently on the market , along with the prescription patterns for them
antipodal meal ( i.e. , meals spaced roughly 12 h apart )
minimum 8-h gap between 2 doses prescription patterns of currently available insulin preparations , supported by evidence from various published clinical studies
basal nph , glargine , detemir , degludec , bhi biphasic human insulin , biasp biphasic insulin aspart , lispromix biphasic insulin lispro , iasp insulin aspart , ideg insulin degludec , idegasp insulin degludec and insulin aspart , ideglira insulin degludec and liraglutide , lixilan lixisenatide and insulin glargine , idet insulin detemir , iglar insulin glargine , iglu insulin glulisine , nph neutral protamine hagedorn , prandial regular , lispro , aspart , glulisine , na not applicable newer ultralong - acting basal insulins and coformulations of ultralong - acting insulin analogues with either rapid - acting insulin analogues , or with glp-1ra ( glucagon - like peptide-1 receptor agonists ) , have recently been introduced .
while these newer preparations are a combination of two preparations , they definitely do not fit into the earlier category of premixed insulins .
other molecules , such as pegylated lispro , are also in advanced stages of development , and will soon be available for clinical use .
basal insulins were initially thought to be used once a day . as nph , glargine , and detemir
do not provide adequate 24 h coverage , they may need to be used twice daily in certain patients , especially those with type 1 diabetes .
the novel ultralong - acting insulin degludec provides adequate 24-h glycemic control and can be used once daily at any time of the day .
these factors need to be reflected in an updated taxonomic profile of insulin . while basal insulins are able to achieve adequate fasting control in many cases , they are unable to provide prandial coverage .
initiation of a once - daily premix or coformulation with the major meal or meal with highest glycemic excursion allows control of postprandial glucose after one meal as well .
the frequency of administration of these insulin preparations can , if required , be intensified to twice or thrice daily .
while biphasic human insulin or premixed analogue insulin need to be administered at antipodal meals ( i.e. , meals spaced roughly 12 h apart ) , idegasp ( insulin degludec aspart ) may be administered at two consecutive meals , provided an 8-h gap is maintained . all of these patterns of use find a place in a number - based umbrella of insulin taxonomy , as opposed to the traditional regime classification , which proposes only twice daily use of premixed insulin .
if the twice - daily regime does not achieve 24-h euglycemia , intensive insulin therapy ( defined as that including 3 or more than 3 injections per day ) may be required in the form of either three premix insulin injections or a basal bolus regimen .
depending upon the needs of the patient , one can prescribe prandial insulin thrice a day ; premixed twice and prandial once ; or prandial twice and premixed / coformulation once . basal
bolus regimes involving 3 bolus doses and 1 or 2 basal doses can also be used in refractory patients and in type 1 diabetes .
the number - based taxonomy is able to include all of these regimes as subclasses ( table 1 ) , based upon published randomized controlled trials ( table 2 ) .
this arrangement makes it much simpler for the student to understand the subject of insulin pharmacotherapeutics .
it helps the practitioner to appreciate the versatility of insulin and the many ways in which this life - saving molecule can be used .
this system also allows the physician to choose the appropriate regime for a particular patient while following person - centeredness in letter and spirit . at the same time , choice of regime
should take biomedical factors such as severity of hyperglycemia , risk of hypoglycemia , and diabesity indices into account .
such a codification would promote appropriate choice of therapy based upon the individual s glucophenotype , motivation level , and psychosocial limitations , ease of use , and acceptance of insulin , by sensitizing the diabetes care professional to the patient s needs .
we therefore propose that future guidelines and recommendations utilize this person - centered arrangement of insulin regimes , rather than straitjacketing preparations according to traditional criteria .
Output:
| this article describes a number - based system for the classification of insulin regimes .
it utilizes a patient - centered variable ( number of injections per day ) and pharmacokinetic / dynamic characteristics to craft a taxonomic system that is able to incorporate all available insulin preparations and coformulations .
this framework of systematics is robust enough to include various molecules that have been recently developed .
it serves to enhance understanding of the subject , and facilitates the practical or clinical usage of theoretical knowledge .
we propose that number - based insulin taxonomic models should be used in clinical guidelines and recommendations rather than restricting ourselves to pharmaceutical - based classifications .
pubmed articles including both review articles and clinical trials published since the year 1990 were searched , to gather evidence and information on the various types of insulins available , and how they can be used , based on the number or frequency of injections prescribed per day . |
PubmedSumm119628 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: honey has been reported to show a significant antibacterial activity against a wide range of bacteria .
it has been demonstrated in many studies that the antibacterial effects of honey are attributed to its high osmolarity , low ph , hydrogen peroxide content , and other non - peroxide factors such as lysozyme , phenolic acids , and flavonoids .
the quality of honey is mainly determined by its sensorial , chemical , physical , and microbiological characteristics .
honey is a sweet and flavorful natural product which has been consumed for its high nutritive value and its contribution to human health that depend largely on the floral source .
these properties could be associated to honey 's high osmolarity , antibacterial properties , and antioxidant capacity . the antioxidant and antibacterial activity of honey , however , varies greatly depending on the honey floral source .
there are about 50 species in the tropical asia , africa , america , and the temperate regions . in flora iranica
, five species were listed for iranian plateau , namely zizyphus spina - christi , zizyphus oxyphylla nummularia , zizyphus oxyphylla jujuba , zizyphus oxyphylla mauritiana , and zizyphus oxyphylla . z. spina - christi l. known by the persian name
biological and pharmacological tests have shown antibacterial , antiviral , and antidiabetic effects of the extracts or fractions of the leaves of this plant .
the honey collected from the flowers of the sidr is in high demand by citizens for its medicinal qualities in addition to its excellent taste and fragrant smell .
the composition of active components in plants depends on various factors , particularly plant bio- and chemo type and climatic conditions .
consequently , it can be reasonably expected that honey properties from different locations are different .
newly identified honeys may have advantages over or similarities with known honey due to enhanced antimicrobial activity , local production ( thus availability ) , and/or greater selectivity against medically important organisms . on this basis ,
therefore , the aim of the present study was an in vitro evaluation of antibacterial effectiveness of ziziphus honey originating from the z. spina - christi l. tree ( tangestan , bushehr ) against listeria monocytogenes , salmonella typhimurium , escherichia coli , and staphylococcus aureus as foodborne pathogens .
s. aureus ( atcc 6538 ) and l. monocytogenes ( atcc 19118 ) as gram - positive and s. typhimurium ( atcc 14028 ) and e. coli ( atcc 25922 ) as gram - negative bacteria were used . for the antimicrobial activity measurement ,
first of all active cultures were generated by inoculating single colony of each bacterium into 5 ml sterile nutrient broth ( merck ) and incubated at 37c for 24 h. freshly synchronized cultures of bacterial strains from initial inoculums were prepared after 2 times overnight cultures ( 24 h ) of each bacterium by successively transferring 100 l of the vegetative cells into tryptic soy broth ( tsb , merck , nj , usa ) .
then the optical densities of the active freshly synchronized cultures were adjusted at 600 nm .
the broth cultures prepared in this way had a final culture density of approximately 10 colony forming unit ( cfu)/ml . this had been used as adjusted inoculum for all the further studies .
natural ziziphus honey was collected from tangestan apiaries in bushehr province , iran and stored in the dark at room temperature .
different concentrations of honey constituting 10% , 20% , 30 % , and 40% ( v / v ) were made using sterile nutrient broth . before ,
honey was placed in a 37c water bath to aid dissolving . the natural ziziphus honey in 10% , 20% , 30% , and 40% dilutions ( v / v ) were provided in nutrient broth medium as mentioned above .
then , 1 ml ( about 10 cfu / ml ) of each of bacteria separately added to 1 ml of each dilution of honey and incubated at 35c for 120 h. concurrently , a positive control by inoculating 1 ml of the microbial suspension into 1 ml of the nutrient broth and a negative control by adding 1 ml of the nutrient broth ( without bacteria ) to 1 ml of each dilution of honey were made .
total viable count enumeration of each sample was investigated after 0 , 24 , 72 , and 120 h postinoculation .
total viable count was carried out using the pour - plate method as described by harrigan .
all tests were performed in triplicate and were repeated 3 times to obtain reliable results .
statistical analysis of data was performed using analysis of variance ( anova ) and post - hoc tests ( scheffe and duncan ) by spss 16 software from ibm company .
s. aureus ( atcc 6538 ) and l. monocytogenes ( atcc 19118 ) as gram - positive and s. typhimurium ( atcc 14028 ) and e. coli ( atcc 25922 ) as gram - negative bacteria were used . for the antimicrobial activity measurement ,
first of all active cultures were generated by inoculating single colony of each bacterium into 5 ml sterile nutrient broth ( merck ) and incubated at 37c for 24 h. freshly synchronized cultures of bacterial strains from initial inoculums were prepared after 2 times overnight cultures ( 24 h ) of each bacterium by successively transferring 100 l of the vegetative cells into tryptic soy broth ( tsb , merck , nj , usa ) .
then the optical densities of the active freshly synchronized cultures were adjusted at 600 nm .
the broth cultures prepared in this way had a final culture density of approximately 10 colony forming unit ( cfu)/ml . this had been used as adjusted inoculum for all the further studies .
natural ziziphus honey was collected from tangestan apiaries in bushehr province , iran and stored in the dark at room temperature .
different concentrations of honey constituting 10% , 20% , 30 % , and 40% ( v / v ) were made using sterile nutrient broth . before ,
the natural ziziphus honey in 10% , 20% , 30% , and 40% dilutions ( v / v ) were provided in nutrient broth medium as mentioned above .
then , 1 ml ( about 10 cfu / ml ) of each of bacteria separately added to 1 ml of each dilution of honey and incubated at 35c for 120 h. concurrently , a positive control by inoculating 1 ml of the microbial suspension into 1 ml of the nutrient broth and a negative control by adding 1 ml of the nutrient broth ( without bacteria ) to 1 ml of each dilution of honey were made .
total viable count enumeration of each sample was investigated after 0 , 24 , 72 , and 120 h postinoculation .
total viable count was carried out using the pour - plate method as described by harrigan .
all tests were performed in triplicate and were repeated 3 times to obtain reliable results .
statistical analysis of data was performed using analysis of variance ( anova ) and post - hoc tests ( scheffe and duncan ) by spss 16 software from ibm company .
viable count enumeration of different concentrations of ziziphus honey ( 10% , 20% , 30% , and 40% ) was investigated after 0 , 24 , 72 , and 120 h postinoculation with any of the bacteria .
based on our result and statistical analysis using one - way anova , significant difference at different times between different concentrations of honey was observed about all the researched bacteria .
the results were expressed as means standard deviation log - transformed bacterial concentration ( cfu / ml ) .
figure 1 indicates antibacterial activity of ziziphus honey against s. aureus at different concentrations and times .
the results showed 3 - 7 log reduction of s. aureus in 30% and 40% concentration of honey , respectively , at different times .
also in post - hoc tests ( scheffe and duncan ) in 24 h of incubation was observed significant difference between the concentrations of 0% with the other concentrations of honey ( p < 0.05 ) . on the other hand , between the concentrations of 10% , 20% , and 30% showed no any significant difference ( p > 0.05 ) . in 120 h of incubation ,
the concentrations of 30% and 40% were observed significant difference compared to other concentrations ( p < 0.05 ) .
the statistical analysis showed no significant difference between 24 , 72 , and 120 h incubation on s. aureus in 40% dilution .
antibacterial activity of ziziphus honey against e. coli indicates 3 - 7 log reduction in different concentrations of honey , after 120 h of incubation [ figure 2 ] .
statistical analysis observed a significant difference between concentrations of 30% and 40% with other concentrations at 24 and 72
h of incubation ( p < 0.05 ) . based on the results , l. monocytogenes showed 2 - 5 log reduction in different concentrations of honey , after 72 and 120 h of incubation [ figure 3 ] .
also , a significant difference between different concentrations of honey with 0% concentration was observed at 72 and 120 h of incubation ( p < 0.05 ) .
the effect of ziziphus honey against s. typhimurium showed 1.5 - 6 log reduction in different concentrations of honey , after 72 and 120 h of incubation [ figure 4 ] ; also , a significant difference between different concentrations of honey with 0% concentration was observed at 72 and 120 h of incubation ( p < 0.05 ) .
statistical analysis between different concentrations indicated a significant difference between 30% and 40% concentrations of honey with other concentrations after 24 h of incubation ( p < 0.05 ) .
also , it showed no significant difference between 30% and 40% dilution on salmonella ( p > 0.05 ) .
the total results showed that ziziphus honey has a good antibacterial activity against these bacteria . in a comparative trial ,
antibacterial activity of ziziphus honey was higher after 120 h incubation , especially in 30% and 40% concentrations of honey .
growth curve of staphylococcus aureus in different dilutions ( 10% , 20% , 30% , and 40% ) in 0 , 24 , 72 , and 120 h growth curve of escherichia coli in different dilutions ( 10% , 20% , 30% , and 40% ) in 0 , 24 , 72 , and 120 h growth curve of listeria monocytogenes in different dilutions ( 10% , 20% , 30% , and 40% ) in 0 , 24 , 72 , and 120 h growth curve of salmonella typhimurium in different dilutions ( 10% , 20% , 30% , and 40% ) in 0 , 24 , 72 , and 120 h
these days , abundant use of antibiotics has resulted in widespread resistance ; with the development of novel antibiotics , alternative antimicrobial strategies are urgently needed .
honey has an extensive history to traditional human medicine use and also is an attractive ingredient for healthy foods .
it has been proposed that the healing effect of honey could be due to various physical and chemical properties .
the high osmolarity and acidity of honey are among the physical characteristics that contribute to its antibacterial activity .
hydrogen peroxide , volatiles , organic acids , flavonoids , beeswax , nectar , pollen , and propolis are important chemical factors that provide antibacterial properties to honey . in a study , shin and ustunol related the sugar composition of honeys from different floral sources to the growth inhibition of various intestinal bacteria .
thus , the floral source of honey plays an important role on its biological properties .
the composition of honey has been shown to depend largely on its floral source . in consequence
, it would not be surprising that the provenance of honey could determine its antibacterial properties . z. spina - chirsti plant has versed medicinal and nutritional values .
some useful phytochemicals that include flavonoids , tannins , lipids , terpenes , alkaloids , steroids , free sugar , and mucilage have been isolated from the plant .
this research is the first study to provide direct evidence for the efficacy of iranian ziziphus honey against these foodborne pathogens .
our data reveal that the foodborne pathogens tested were susceptible to ziziphus honey , although this honey was not able to produce complete inhibition of bacterial growth during 120 h incubation , but antibacterial activity was increased with additional concentration of honey and the microbial count showed about 3 - 7.5 log reduction after 120 h in most cases .
nzeako and hamdi in their study of six commercial honeys found that inhibition of s. aureus , e. coli , and pseudomonas aeruginosa did not occur at honey concentrations < 40% . in a research in saudi arabia , antimicrobial effects of different honey samples including sidr honey against multiresistant pathogens showed that the most sensitive pathogens were aspergillus nidulans , s. typhimurium , and staphylococcus epidermidis .
alandejani et al . showed effectiveness of sidr ( yemen ) and manuka ( new zealand ) honey on s. aureus and p. aeruginosa biofilms , respectively .
the bactericidal rates for the sidr and manuka honeys against methicillin - susceptible s. aureus , methicillin - resistant s. aureus , and p. aeruginosa biofilms were 63 - 82% , 73 - 63% , and 91 - 91% , respectively .
these rates were significantly higher than those seen with single antibiotics commonly used . in a research ,
hegazi investigated antibacterial activity of seven egyptian honeys and one saudi honey ( sidr ) against some bacteria .
he reported that the sidr honey was more effective against s. aureus and p. aeruginosa .
also , antimicrobial activity of three types of honey ( sidr , sunflower , and sunut ) was examined in sudan .
the sidr honey showed antimicrobial activity against s. aureus , p. aeruginosa , and klebsiella aerogenes , while e. coli showed high resistance .
other researchers have also found differences in susceptibility of microorganisms to ziziphus ( sidr ) honey produced in different countries . there is a great interest in controlling the growth or eliminating foodborne pathogens using natural antimicrobials .
if honey can slow or stop the growth of spoilage organisms or food pathogens , then its incorporation into foods as a preservative can be explored . in light of the enormous potential for application of honey , it is important that research continues not only into those honeys recognized as antibacterial , but also into other locally produced , as yet untested honeys .
therefore , it is recommended using ziziphus honey as a natural preservative and antibacterial agent and it may play an important role as antibacterial natural product .
however , further research could indicate whether ziziphus honey has potential as a preservative in foods and oral medications .
Output:
| background : honey has previously been shown to have wound healing and antimicrobial properties , but this is dependent on the type of honey , geographical location , and flower from which the final product is derived .
we tested the antimicrobial activity of a natural honey originating from the ziziphus spina - christi tree , against selected strains of bacteria .
ziziphus honey among more than a 100 verities of honey is known to have the greatest value of energy and minerals in it.materials and methods : the aim of this study was to determine the antibacterial activity of ziziphus honey in 10% , 20% , 30% , and 40% dilutions ( v / v ) against listeria monocytogenes , salmonella typhimurium , escherichia coli , and staphylococcus aureus .
viable count enumeration of the sample was investigated after 0 , 24 , 72 , and 120 h postinoculation with any of the bacteria using pour - plate method.results:the findings indicate that ziziphus honey was effective against these pathogenic bacteria . in a comparative trial , antibacterial activity of ziziphus honey was higher after 120 h incubation for each four bacteria in most dilutions .
the microbial count showed 3 - 7.5 log reduction comparing with control after 120 h.conclusions:therefore , it is recommended using ziziphus honey as a natural preservative and antibacterial agent .
also , it could potentially be used as therapeutic agents against bacterial infection particularly to the tested microorganisms . |
PubmedSumm119629 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| diphthamide , the
target of diphtheria toxin , is a unique posttranslational
modification on translation elongation factor 2 ( ef2 ) in archaea and
eukaryotes .
the biosynthesis of diphthamide was proposed to involve
three steps .
the first step is the transfer of the 3-amino-3-carboxypropyl
group from s - adenosyl - l - methionine ( sam )
to the histidine residue of ef2 , forming a c c bond .
previous
genetic studies showed this step requires four proteins in eukaryotes ,
dph1dph4 .
however , the exact molecular functions for the four
proteins are unknown .
previous study showed that pyrococcus
horikoshii dph2 ( phdph2 ) , a novel iron - sulfur cluster - containing
enzyme , forms a homodimer and is sufficient for the first step of
diphthamide biosynthesis in vitro . here
we demonstrate
by in vitro reconstitution that yeast dph1 and dph2
form a complex ( dph1-dph2 ) that is equivalent to the homodimer of
phdph2 and is sufficient to catalyze the first step in vitro in the presence of dithionite as the reductant .
we further demonstrate
that yeast dph3 ( also known as kti11 ) , a csl - type zinc finger protein ,
can bind iron and in the reduced state can serve as an electron donor
to reduce the fe - s cluster in dph1-dph2 .
our study thus firmly establishes
the functions for three of the proteins involved in eukaryotic diphthamide
biosynthesis . for most radical sam enzymes in bacteria ,
flavodoxins
and flavodoxin reductases are believed to serve as electron donors
for the fe - s clusters .
the finding that dph3 is an electron donor
for the fe - s clusters in dph1-dph2 is thus interesting and opens up
new avenues of research on electron transfer to fe - s proteins in eukaryotic
cells . |
PubmedSumm119630 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the prostamide bimatoprost 0.03% and the prostaglandin analogs travoprost 0.004% and latanoprost 0.005% are ocular hypotensive lipids , the newest class of drugs indicated for the lowering of intraocular pressure ( iop ) in patients with glaucoma and ocular hypertension .
these medications , administered once daily , have greater iop - lowering efficacy than the beta - blocker timolol.13 due to the importance of even small increments of iop reduction for preservation of visual function among those with glaucoma or ocular hypertension , patients who are not achieving sufficiently low iop with their current medications may benefit from trying a new regimen .
to avoid delay in determining the effect of such changes , a paired - eye comparison was used to assess the efficacy of prostaglandin / prostamide medications in patients who had uncontrolled or poorly controlled iop .
this retrospective chart review of patients participating in individual , within - practice , paired - eye , open - label comparisons included consecutive patients seen at a private practice clinic between september 2002 and may 2005 .
patients had a diagnosis of glaucoma or ocular hypertension and their iop had been uncontrolled in the investigator s clinical judgment .
patients had been clinically judged to be suitable candidates for therapy with agents of the prostamide / prostaglandin class .
the three medications studied in this evaluation were bimatoprost 0.03% ( lumigan ; allergan , inc . , irvine , ca ) , travoprost 0.004% ( travatan ; alcon laboratories , inc . ,
fort worth , tx ) , and latanoprost 0.005% ( xalatan , pfizer , inc .
patients were assigned to bimatoprost in one randomly assigned eye and another medication in the fellow eye .
the second medication was determined at random , except for patients who were already using one of the prostaglandin / prostamide analogs .
patients included in this evaluation were examined by the physician and had iop measured at the initial visit . per clinical routine , patients were scheduled for a follow - up visit 46 weeks later , when iop was measured and hyperemia or other side effects were recorded . at the follow - up visit , patients were asked about the eye drops in a general way such as , how are you doing with the new drops ? or
how are your new drops ? the physician then discussed with each patient the iop findings for each eye and other aspects of the treatment . after conferring with the physician , patients determined
in some cases , a reason for the patient s choice was noted in the chart .
patient charts were excluded from analysis if they had any ocular surgery between the initial and follow - up visit .
the main outcome measures of the chart review were mean change in iop from baseline , and percentage of patients choosing a particular medication for continued use .
unpaired t - tests were used to evaluate the statistical significance of iop changes from baseline within a treatment group , and paired t - tests were performed to determine statistical significance among treatment groups in the bilateral comparison .
a total of 91 patients participated in the paired - eye comparison . of these ,
36 were excluded from the chart review analysis ; 17 patients charts were not available at the time of data collection , seven did not have follow - up data , four did not have a confirmatory diagnosis , three did not receive bimatoprost in one of the eyes , two had eye surgery between the baseline and follow - up visit , two patients did not make a clear choice and proceeded to use both study agents , and one individual only used one of the comparative agents .
fifty patients received bimatoprost in one eye and travoprost in the other eye , and five patients received bimatoprost in one eye and latanoprost in the other eye .
bimatoprost was randomized to the right eye in 30 patients and to the left eye in 25 patients ; travoprost was randomized to the right eye in 22 patients and to the left eye in 28 patients ; and latanoprost was randomized to the right eye in three patients and to the left eye in two patients .
seventy - five percent of patients were taking at least one glaucoma medication , with 42% of patients on monotherapy and 35% ( 19/55 ) using two or more medications ( table 2 ) .
because the majority of patients ( 58% , 32/55 ) were using latanoprost prior to enrolling in the study ( table 2 ) , few participants were assigned to receive latanoprost during the study .
the median interval between the baseline and follow - up visits was 42 days ( mean 72.7 days ) , and 10 patients had their follow - up visit more than 90 days after the baseline visit .
data were obtained for all outcome measures for all patients , except for three patients receiving bilateral bimatoprost or travoprost , for whom iop - lowering data were not documented in the medical chart at the follow - up visit .
bimatoprost and travoprost significantly reduced iop from baseline during the study period ( figure 1 ) . for eyes receiving bimatoprost with documented iop measurement at baseline and at follow - up ( n = 52 ) , iop decreased by 2.7 mmhg ( standard deviation = 4.2 mmhg ) , a significant reduction ( p < 0.0001 ) versus baseline .
mean ( standard deviation ) baseline iop for bimatoprost - treated eyes was 19.8 4.9 mmhg ( range 1034 ) and dropped to 17.1 4.9 mmhg ( range 1937 ) at the end of the study period .
for travoprost - treated eyes with documented iop measurement at baseline and at follow - up ( n = 47 ) , iop was reduced from a baseline value of 19.4 4.1 mmhg ( range 1231 ) to 17.7 4.2 mmhg ( range 929 ) at the end of the study period , for a decrease of 1.7 mmhg ( p = 0.009 versus baseline ) .
the numeric magnitude of mean iop reduction with bimatoprost was larger than with travoprost ( 2.7 mmhg versus 1.7 mmhg decrease ) , but the difference did not reach statistical significance ( p = 0.230 ) . in eyes receiving latanoprost ( n = 5 ) ,
mean baseline iop was 19.6 4.7 mmhg ( range 1526 ) , and iop at follow - up averaged 16.2 2.5 mmhg ( range 1420 ) , for a reduction of 3.4 3.2 mmhg .
this difference was not statistically significant ( p = 0.077 ) , probably because of the small sample size . at the follow - up visit ,
the physician discussed the clinical outcomes with each patient , and each patient chose which medication they would prefer to continue using .
patients who received bimatoprost in one eye and travoprost in the fellow eye chose to continue with bimatoprost over travoprost by a factor of 2.4 to 1 ( figure 2 ) .
nearly seven of 10 patients chose bimatoprost ( 68% , 34/50 ) , 28% of patients ( 14/50 ) chose travoprost , and 4% ( 2/50 ) chose neither .
the two patients who chose neither option had used latanoprost prior to the study , and elected to continue with it afterwards . among the five patients who received bilateral bimatoprost or latanoprost , three chose to continue with bimatoprost , one chose latanoprost , and one chose neither ( this patient had been using travoprost prior to the study and chose to continue with it ) .
table 3 shows the primary factor that patients stated influenced their choice of medication . among the 15 patients who stated a reason , most ( 80% , 12/15 ) cited improvement in iop as the primary factor in their decision
. a majority of these patients ( 83% , 10/12 ) preferred bimatoprost over the agent they had used in the fellow eye .
other reasons offered by patients for determination of medication choice were pressure change plus better side effect profile , convenience , and price , cited by one patient each ( medications chosen were travoprost , and latanoprost , respectively ) .
no patients cited side effect profile as a primary influence on their medication choice .
looking at the entire study population analyzed ( n = 55 ) , hyperemia was reported by eight patients , with six reporting hyperemia in both eyes , one reporting hyperemia in the bimatoprost - treated eye only , and one reporting hyperemia in the travoprost - treated eye only .
a total of 91 patients participated in the paired - eye comparison . of these ,
36 were excluded from the chart review analysis ; 17 patients charts were not available at the time of data collection , seven did not have follow - up data , four did not have a confirmatory diagnosis , three did not receive bimatoprost in one of the eyes , two had eye surgery between the baseline and follow - up visit , two patients did not make a clear choice and proceeded to use both study agents , and one individual only used one of the comparative agents .
fifty patients received bimatoprost in one eye and travoprost in the other eye , and five patients received bimatoprost in one eye and latanoprost in the other eye .
bimatoprost was randomized to the right eye in 30 patients and to the left eye in 25 patients ; travoprost was randomized to the right eye in 22 patients and to the left eye in 28 patients ; and latanoprost was randomized to the right eye in three patients and to the left eye in two patients .
seventy - five percent of patients were taking at least one glaucoma medication , with 42% of patients on monotherapy and 35% ( 19/55 ) using two or more medications ( table 2 ) .
because the majority of patients ( 58% , 32/55 ) were using latanoprost prior to enrolling in the study ( table 2 ) , few participants were assigned to receive latanoprost during the study .
the median interval between the baseline and follow - up visits was 42 days ( mean 72.7 days ) , and 10 patients had their follow - up visit more than 90 days after the baseline visit .
data were obtained for all outcome measures for all patients , except for three patients receiving bilateral bimatoprost or travoprost , for whom iop - lowering data were not documented in the medical chart at the follow - up visit .
bimatoprost and travoprost significantly reduced iop from baseline during the study period ( figure 1 ) . for eyes receiving bimatoprost with documented iop measurement at baseline and at follow - up ( n = 52 ) , iop decreased by 2.7 mmhg ( standard deviation = 4.2 mmhg ) , a significant reduction ( p < 0.0001 ) versus baseline .
mean ( standard deviation ) baseline iop for bimatoprost - treated eyes was 19.8 4.9 mmhg ( range 1034 ) and dropped to 17.1 4.9 mmhg ( range 1937 ) at the end of the study period . for travoprost - treated eyes with documented iop measurement at baseline and at follow - up (
n = 47 ) , iop was reduced from a baseline value of 19.4 4.1 mmhg ( range 1231 ) to 17.7 4.2 mmhg ( range 929 ) at the end of the study period , for a decrease of 1.7 mmhg ( p = 0.009 versus baseline ) .
the numeric magnitude of mean iop reduction with bimatoprost was larger than with travoprost ( 2.7 mmhg versus 1.7 mmhg decrease ) , but the difference did not reach statistical significance ( p = 0.230 ) . in eyes receiving latanoprost ( n = 5 ) ,
mean baseline iop was 19.6 4.7 mmhg ( range 1526 ) , and iop at follow - up averaged 16.2 2.5 mmhg ( range 1420 ) , for a reduction of 3.4 3.2 mmhg .
this difference was not statistically significant ( p = 0.077 ) , probably because of the small sample size .
at the follow - up visit , the physician discussed the clinical outcomes with each patient , and each patient chose which medication they would prefer to continue using .
patients who received bimatoprost in one eye and travoprost in the fellow eye chose to continue with bimatoprost over travoprost by a factor of 2.4 to 1 ( figure 2 ) .
nearly seven of 10 patients chose bimatoprost ( 68% , 34/50 ) , 28% of patients ( 14/50 ) chose travoprost , and 4% ( 2/50 ) chose neither .
the two patients who chose neither option had used latanoprost prior to the study , and elected to continue with it afterwards . among the five patients who received bilateral bimatoprost or latanoprost , three chose to continue with bimatoprost , one chose latanoprost , and one chose neither ( this patient had been using travoprost prior to the study and chose to continue with it ) .
table 3 shows the primary factor that patients stated influenced their choice of medication . among the 15 patients who stated a reason , most ( 80% , 12/15 ) cited improvement in iop as the primary factor in their decision
. a majority of these patients ( 83% , 10/12 ) preferred bimatoprost over the agent they had used in the fellow eye .
other reasons offered by patients for determination of medication choice were pressure change plus better side effect profile , convenience , and price , cited by one patient each ( medications chosen were travoprost , and latanoprost , respectively ) .
no patients cited side effect profile as a primary influence on their medication choice .
looking at the entire study population analyzed ( n = 55 ) , hyperemia was reported by eight patients , with six reporting hyperemia in both eyes , one reporting hyperemia in the bimatoprost - treated eye only , and one reporting hyperemia in the travoprost - treated eye only .
patients with glaucoma or ocular hypertension who did not have sufficient iop control with their current medication regimens instilled bimatoprost in one eye and either travoprost or latanoprost in the other eye .
significant iop reductions were observed for bimatoprost- and travoprost - treated eyes , consistent with published results.14 relatively few studies have directly compared the efficacy of prostaglandin / prostamide glaucoma therapies . in a meta - analysis of all head - to - head randomized , investigator - masked direct comparisons of latanoprost , bimatoprost , and travoprost ,
bimatoprost was more efficacious at lowering iop than travoprost in the two direct comparisons identified ( involving 150 patients ) , and bimatoprost was found to be more efficacious than latanoprost in six head - to - head studies identified ( involving 460 patients).4 our study may not have been adequately powered to detect statistically significant differences among therapies .
however , for the two therapies where we detected a significant iop decline from baseline ( bimatoprost and travoprost ) , bimatoprost showed qualitatively greater iop reduction than travoprost , consistent with a report by holmstrom et al.4 an important limitation of this assessment was the fact that relatively few eyes were randomized to receive latanoprost . because nearly 60% of study participants had been receiving latanoprost prior to the study , only five patients received latanoprost as one of the comparators .
therefore , for these patients , the bilateral comparison was limited to travoprost and bimatoprost .
because of the small sample size , the results with latanoprost may be difficult to generalize .
use of a larger study population , or employment of a multiple - study site design in future trials may result in a patient population that is more evenly distributed among the cohorts .
it should be noted that our results are consistent with those of a large - scale real - world
study , in which more than 15,000 glaucoma patients on latanoprost were switched to bimatoprost in a nationwide health maintenance organization.5 in that study , patients switching to bimatoprost experienced statistically significant iop reduction , and few reverted to their previous medication.5 nonadherence to glaucoma treatment regimens is a significant problem , in large part because glaucoma is chronic , progressive , and symptom - free in its early stages.68 in the treatment practice described in this report , patients chose which medication to continue using after consulting with the physician .
physician partnership in medical decision - making is increasing as patients become more empowered through consumerism and access to independent information resources , such as the internet.9 a majority of patients in this study who gave a reason for their choice cited iop - lowering efficacy , as opposed to side effects or other aspects of the medication immediately perceptible to the patient .
our results , while preliminary , raise the intriguing question of whether patients who are involved in their medical decision - making might also have improved adherence to their glaucoma regimens .
after direct comparisons between glaucoma drugs trialed in each eye , patients preferred bimatoprost over travoprost by a factor of 2.4 to 1 . today s
physicians may wish to consider a simple bilateral trial such as ours for their glaucoma patients who are not achieving adequate iop control with their current medication regimens .
Output:
| objectiveto evaluate efficacy and patient preference retrospectively among intraocular pressure ( iop)-lowering prostamide and prostaglandin medications in a real - world clinical setting.methodschart review of patients with uncontrolled glaucoma or ocular hypertension seen at a private practice clinic ( n = 55 ) who received bimatoprost 0.03% once daily in one eye and either travoprost 0.004% or latanoprost 0.005% once daily in the fellow eye .
iop was evaluated at the initial visit and at a follow - up visit scheduled 46 weeks later . at the follow - up visit ,
each patient discussed the clinical results with their physician , chose which medication they preferred to continue using , and were queried regarding the reason for their choice .
this paired - eye comparison method is used routinely in clinical practice to assess clinical response and involve patients in decisions regarding treatment .
change in mean iop from baseline and patient medication choice were the outcome measures.resultsbimatoprost-treated eyes ( n = 52 ) had a mean iop reduction of 2.7 mmhg and travoprost - treated eyes ( n = 47 ) had an average decrease of 1.7 mmhg ( p = 0.230 ) .
bimatoprost significantly reduced mean iop ( from 19.8 mmhg at baseline to 17.1 mmhg at follow - up , p < 0.0001 ) , as did travoprost ( from 19.4 mmhg at baseline to 17.7 mmhg at follow - up , p = 0.009 ) .
latanoprost - treated eyes were excluded from the efficacy analysis due to small sample size ( n = 5 ) . for continued therapy , patients chose bimatoprost over travoprost by a factor of 2.4 to 1 .
of the 15 patients who gave a reason for their choice , 80% said their decision was based primarily on iop change.conclusionsbimatoprost and travoprost were efficacious in reducing iop among patients with uncontrolled glaucoma and ocular hypertension .
patients preferred bimatoprost over travoprost when trialed in fellow eyes . |
PubmedSumm119631 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: personalized medicine has gained a lot of attention in recent years with improved understanding of the contribution of genetic factors to benign and malignant diseases and responses to pharmacological interventions , and the availability of a wide spectrum of genetic tests at low costs .
although the term " personalized medicine " is often used to refer to individualizing care according to the genetic make - up of the patient , this term can be interpreted more broadly to mean " tailoring care to the individual patient characteristics " . in other words ,
personalized medicine can be interpreted as an approach to classify individuals into subpopulations that differ in their susceptibility to a particular disease , rate of disease progression , and response to specific treatments such that preventative or therapeutic interventions can be concentrated on those who will benefit , sparing expense and side effects for those who will not .
simply put , the goal of personalized medicine is to provide optimal care according to the individual patient 's disease characteristics , personal preference , comorbidities , and social circumstances such that maximum benefit can be derived while minimizing costs and adverse reactions .
substantial progress has been made in the treatment of hepatitis b in the last 15 years .
there are currently seven approved drugs for the treatment of hepatitis b : two formulations of interferon ( ifn ) - conventional and pegylated ifn ( peg - ifn ) , and five nucleos(t)ide analogues - lamivudine , telbivudine , adefovir , entecavir , and tenofovir .
these drugs can suppress hepatitis b virus ( hbv ) replication , decrease hepatic inflammation and fibrosis and even reverse cirrhosis , prevent complications of cirrhosis , and reduce the incidence of hepatocellular carcinoma ( hcc).1,2,3 however , currently approved drugs do not eradicate hbv and have low rates of clearance of hepatitis b e antigen ( hbeag ) and hepatitis b surface antigen ( hbsag ) and hcc continues to occur albeit at a lower rate . because currently available treatment has little or no effect on covalently closed circular dna , the template for transcription of hbv pregenomic rna and messenger rna and translation of viral proteins or on restoration of host immune response to hbv , viral relapse occurs in most patients when treatment is stopped .
thus , most patients require many years and often lifelong treatment to derive continued benefit .
long durations of treatment are associated with increasing risks of adverse reactions , antiviral drug resistance , costs , and nonadherence to medications .
thus , a major dilemma in hepatitis b treatment is when to initiate therapy . while all patients with chronic hbv infection are at risk of cirrhosis , liver failure and hcc , not all patients will experience these outcomes .
immune control of hbv with spontaneous loss of hbeag and hbsag can occur and patients can remain in remission for many years .
professional society guidelines provide frameworks for managing patients with hepatitis b but these guidelines have to be interpreted in the context of the individual patient 's clinical and social circumstances .
personalized management of hepatitis b can be applied based on prediction of the individual patient 's risk of cirrhosis and hcc to guide the frequency and intensity of monitoring including hcc surveillance and urgency of treatment .
it can also be applied to decisions on when to start treatment , which drug to use , and when to stop based on the individual patient 's disease characteristics , preference , comorbidities and other mitigating circumstances .
host , viral and environmental factors contribute to an hbsag - positive person 's risk of cirrhosis and hcc ( table 1 ) .
although several studies have identified genetic markers associated with increased risk of hbv - related hcc , these markers have not been validated in broad patient populations of diverse racial / ethnic origins infected with all hbv genotypes .
therefore , genetic markers have not yet been incorporated into prediction models for cirrhosis or hcc . during the past decade
, many models have been developed to predict the risk of cirrhosis or hcc in persons with chronic hbv infection .
some models incorporate many variables including blood test results such as hbv genotype , precore and core promoter variants that are not routinely available or clinical information such as alcohol and tobacco use that are unreliable unless the information is collected using standardized questionnaire .
table 2 summarizes three prediction models for hcc based on routinely available clinical and laboratory information : reach - b , cu - hcc , and gag - hcc.4,5,6,7,8 these models can be used to predict 5- and 10- year risk of hcc to guide the frequency of monitoring , the need for hcc surveillance , and the urgency of antiviral treatment . however , there are limitations to these models .
these models were derived from cohorts of patients with chronic hepatitis b in asia , who were predominantly infected with hbv genotypes b and c and who did not receive antiviral treatment .
thus , these models may not be applicable in other parts of the world where the prevalent hbv genotypes are different and where hbv infection is mostly acquired in adult life and not early childhood or in patients receiving antiviral treatment .
indeed , two studies of patients receiving antiviral treatment in europe found that performance of these scores , particularly the reach - b score was poor.9,10 by contrast , one study in hong kong showed that all three models accurately predicted which patients with chronic hepatitis b treated with entecavir will develop hcc.11 the american , asian - pacific and european liver association ( aasld , apasl and easl ) guidelines recommend that treatment decision should be made based on clinical status , serum hbv dna and alanine aminotransferase ( alt ) levels , hbeag status , and liver histology if available.12,13,14 all guidelines recommend starting treatment as soon as possible in patients with life - threatening liver disease : acute liver failure , decompensated cirrhosis or severe acute exacerbation of chronic hepatitis b regardless of hbv dna and alt levels .
these guidelines also recommend antiviral treatment for patients with compensated cirrhosis regardless of alt levels but there are minor differences in threshold hbv dna levels for initiating treatment .
all guidelines agree that treatment should be initiated in noncirrhotic patients with serum hbv dna levels greater than 20,000 iu / ml and persistently elevated alt levels and/or histologic evidence of moderate or severe inflammation or fibrosis .
however , cutoff values of hbv dna and alt and the need for liver biopsy or non - invasive assessment of liver fibrosis in determining treatment indications vary slightly among the guide - lines . because hbv dna and alt levels fluctuate during the course of chronic hbv infection , all guidelines agree that serial hbv dna and alt levels are more important than values at a single time point in making treatment decisions . furthermore , all guidelines recommend that patients who are not started on treatment should be monitored such that treatment may be initiated at a later time when hbv replication or liver disease becomes more active .
the aasld , apasl and easl guidelines are based on a combination of scientific evidence and expert opinion and experience .
these guidelines have not incorporated prediction models for cirrhosis or hcc into recommendations when or which patient should start treatment but incorporation of risk scores for hcc may be appropriate for asian patients particularly those in the gray zone .
the guidelines emphasize that patient age , family history of hcc , occupational requirements , plans to start a family ( for women ) , and patient preference should also be considered in making treatment decisions .
there are many settings when a patient 's medical or social circumstances warrant a personalized approach that may be " at odds " with the guidelines but appropriate for that patient .
for example , a 48 year old man who is hbeag - positive with serial alt 19 - 28 u / l and hbv dna 3,000,000 - 400,000,000 iu / ml with no evidence of cirrhosis would be considered to be in the immune tolerant phase and " not meet " criteria for treatment but starting this patient on treatment is appropriate because there is ample data showing that patients who remain hbeag - positive after age 40 and those who have serum hbv dna levels higher than 2,000 iu / ml after more than four decades of infection are at increased risk of cirrhosis and hcc.15,16 treatment would also be appropriate in a 32 year old surgeon who has the same disease characteristics if suppression of viremia is a prerequisite for permission to continue his profession as a surgeon and to perform surgical operations ( exposure - prone procedures ) .
treatment might also be appropriate in a 45 year old man who is hbeag negative with alt 25 - 35 u / l and hbv dna 1,800 - 9,500 iu / ml if he has several family members with hcc .
other examples of personalized approach being " at odds " with guidelines may involve a decision to defer treatment when guidelines would recommend treatment .
for example , a 35 year old woman who is hbeag - negative with alt 55 - 65 u / l and hbv dna 28,000 - 75,000 iu / ml with no evidence of cirrhosis may choose to defer treatment if she wishes to start a family and is concerned about the safety of anti - hbv medications on fetal development .
another patient with the same disease characteristics may choose to defer treatment if she does not have insurance coverage for medications , or has contraindications to using interferon and is unwilling to commit to many years of nucleos(t)ide analogue therapy .
selection of the first - line anti - hbv drug should be based on the safety and efficacy of the drug , risk of drug resistance , cost of the drug , and patient preference .
the main advantages of ifn include a finite duration of treatment and a higher rate of hbeag and hbsag loss but ifn has to be administered parenterally and is associated with a wide range of adverse reactions some of which can be serious .
entecavir , telbivudine and tenofovir have more potent antiviral activity , and entecavir and tenofovir have higher barriers to antiviral drug resistance .
all guidelines recommend initial treatment with peg - ifn , entecavir or tenofovir as monotherapy.12,13,14 because of cost concerns and the lack of access to tenofovir in some asian countries when the most recent version of the apasl guidelines were released , lamivudine , adefovir or telbivudine were also recommended as first - line drugs in treatment - nave patients.13 ifn is not recommended in patients with acute liver failure , decompensated cirrhosis or severe exacerbations of chronic hepatitis b but it may be used with caution in patients with compensated cirrhosis .
while guidelines consider peg - ifn , entecavir and tenofovir as equivalent first - line anti - hbv drugs , in clinical practice , entecavir and tenofovir are used much more often than peg - ifn even in patients with no contraindications to the use of ifn . the decision to choose a nucleos(t)ide analogue over peg - ifn
may be based on the patient 's preference for an oral drug with minimal adverse reactions over an injectable drug with many potential side effects but it may also be based on the physician 's beliefs and bias .
although cost - effectiveness studies have been performed , these analyses rely on many assumptions and decision on peg - ifn versus nucleos(t)ide analogues is complicated because the efficacy , tolerability , and duration of these two classes of drugs are very different and the costs of these medications vary widely from one country to another .
the first step in deciding which drug to use for treating hepatitis b is to choose between peg - ifn versus nucleos(t)ide analogue .
patients ' preference for route of administration ( injection versus oral ) , duration of treatment ( 1 year versus many years ) , and presence of medical / psychiatric comorbidities that contraindicate use of or decrease tolerance to ifn are the most important deciding factors .
a personalized decision on anti - hbv drug should also consider the likelihood of response . in this regard ,
the predictors of response to peg - ifn and nucleos(t)ide analogues are similar : high alt and low hbv dna levels are the most reliable predictors of response to both peg - ifn and nucleos(t)ide analogues .
thus , patients who are more likely to respond to peg - ifn are also more likely to respond to nucleos(t)ide analogues .
one predictor of response that is unique to peg - ifn is hbv genotype although this applies mainly to hbeag - positive patients .
hbeag - positive patients with genotype a hbv have significantly higher rates of hbeag and hbsag loss compared to patients with genotypes b , c or d.17 thus , hbeag - positive patients with genotype a hbv and no contraindications to use of ifn should be encouraged to receive peg - ifn .
interleukin-28b ( il28b ) polymorphism was shown to be a strong predictor of response to ifn - based therapy for hepatitis c but the association between il28b polymorphism and peg - ifn treatment of hepatitis b is inconsistent .
other factors may play a role in personalized decisions regarding choice of anti - hbv drugs .
for example , young patients may prefer a finite course of peg - ifn versus many years of nucleos(t)ide analogue treatment .
this is particularly true for young women contemplating to start a family in the next few years .
once a decision is made to treat with nucleos(t)ide analogues , the main considerations are cost and risk of antiviral drug resistance .
if cost is not a concern , tenofovir and entecavir are preferred as these drugs have markedly lower rates of drug resistance ( 0 - 1% after 5 - 6 years of continuous therapy)18,19 compared to lamivudine , adefovir or telbivudine .
tenofovir and entecavir have similary potency and barrier to antiviral resistance , and either drug may be used as first - line treatment in nucleoside - nave patients . because of a low risk of nephrotoxicity , entecavir is preferred in older patients , patients with baseline impaired renal function and those with other medical conditions such as hypertension or diabetes that would increase the risk of renal insufficiency .
although telbivudine had been reported to improve renal function,20 the high risk of antiviral drug resistance and the potential for other adverse reactions such as myopathy and polyneuropathy make this a poor choice as first - line treatment.21 tenofovir is effective in suppressing not only wild type hbv but also lamivudine , telbivudine or entecavir resistant hbv and to a slightly lesser extent adefovir resistant hbv ; therefore , it is a better choice for patients who had been previously treated with other nucleos(t)ide analogues .
tenofovir is also a preferred choice for women of reproductive age because of its safety record in pregnancy.22 aasld , apasl and easl guidelines recommend administration of peg - ifn for 48 - 52 weeks in both hbeag - positive and hbeag - negative patients.12,13,14 there is some variation in recommendations when nucleos(t)ide analogues can be stopped .
all guidelines recommend that in hbeag - positive patients , nucleos(t)ide analogues can be stopped when the patient has completed 6 - 12 months consolidation therapy after hbeag seroconversion .
the easl guidelines recommend continuing treatment until hbsag loss in patients with advanced fibrosis or cirrhosis to avoid flares associated with viral relapse .
the aasld and easl guidelines recommend that in hbeag - negative patients , nucleos(t)ide analogues should be continued until hbsag loss but the apasl guidelines stated that treatment may be withdrawn after completing at least two years treatment with undetectable hbv dna documented on three occasions six months apart .
all three guidelines recommend lifelong nucleos(t)ide analogue treatment in patients with cirrhosis before treatment unless they had compensated cirrhosis and had cleared hbsag .
in addition to pre - treatment factors , several studies have found decrease in hbsag level after 12 or 24 weeks of peg - ifn treatment to be better predictors of response .
specifically , a lack of or a small decline in hbsag level after week 12 or 24 of peg - ifn is associated with 85 - 95% negative predictive value of a response.23 these data suggest that a response - guided stop - rule may be used making peg - ifn therapy more attractive because patients who are unlikely to benefit can be spared from further side effects and costs .
a recent cost - effective study showed that response - guided peg - ifn therapy is the most cost - effective approach for hbeag - positive but not hbeag - negative patients.24 thus , hbeag - positive patients with no contraindications , particularly those with genotype a hbv , high alt and low hbv dna levels before treatment who are already predicted to have a high likelihood of response to peg - ifn may be further encouraged to have a trial of peg - ifn , treatment can be stopped after 12 weeks if decline in hbsag is inadequate . a caveat to this approach is that it has not been validated prospectively and different stop rules have been proposed by different authors and for different hbv genotypes .
for patients receiving nucleos(t)ide analogue therapy , the likelihood of achieving hbeag seroconversion is 40 - 50% and the likelihood of achieving hbsag loss is 0 - 10% after 5 years of continuous treatment.3 thus , more than half of the hbeag - positive patients and 95% of hbeag - negative patients will require more than 5 years of treatment .
a few studies found that while viral relapse ( redetection of hbv dna in serum ) occurs in all hbeag - negative patients who completed 2 - 5 years treatment and who stopped treatment before hbsag loss , clinical relapse with elevated alt and hbv dna levels > 2,000 iu / ml occurred in only 50% of patients.25,26 these data suggest that hbeag - negative patients who have completed > 2 years treatment may consider stopping treatment if they are unwilling to continue or unable to afford continued treatment . however , this personalized approach must be accompanied by a plan for close monitoring for at least 6 months after discontinuation of treatment such that treatment can be promptly resumed if necessary .
host , viral and environmental factors contribute to an hbsag - positive person 's risk of cirrhosis and hcc ( table 1 ) .
although several studies have identified genetic markers associated with increased risk of hbv - related hcc , these markers have not been validated in broad patient populations of diverse racial / ethnic origins infected with all hbv genotypes .
therefore , genetic markers have not yet been incorporated into prediction models for cirrhosis or hcc . during the past decade
, many models have been developed to predict the risk of cirrhosis or hcc in persons with chronic hbv infection .
some models incorporate many variables including blood test results such as hbv genotype , precore and core promoter variants that are not routinely available or clinical information such as alcohol and tobacco use that are unreliable unless the information is collected using standardized questionnaire .
table 2 summarizes three prediction models for hcc based on routinely available clinical and laboratory information : reach - b , cu - hcc , and gag - hcc.4,5,6,7,8 these models can be used to predict 5- and 10- year risk of hcc to guide the frequency of monitoring , the need for hcc surveillance , and the urgency of antiviral treatment . however , there are limitations to these models .
these models were derived from cohorts of patients with chronic hepatitis b in asia , who were predominantly infected with hbv genotypes b and c and who did not receive antiviral treatment .
thus , these models may not be applicable in other parts of the world where the prevalent hbv genotypes are different and where hbv infection is mostly acquired in adult life and not early childhood or in patients receiving antiviral treatment .
indeed , two studies of patients receiving antiviral treatment in europe found that performance of these scores , particularly the reach - b score was poor.9,10 by contrast , one study in hong kong showed that all three models accurately predicted which patients with chronic hepatitis b treated with entecavir will develop hcc.11
the american , asian - pacific and european liver association ( aasld , apasl and easl ) guidelines recommend that treatment decision should be made based on clinical status , serum hbv dna and alanine aminotransferase ( alt ) levels , hbeag status , and liver histology if available.12,13,14 all guidelines recommend starting treatment as soon as possible in patients with life - threatening liver disease : acute liver failure , decompensated cirrhosis or severe acute exacerbation of chronic hepatitis b regardless of hbv dna and alt levels .
these guidelines also recommend antiviral treatment for patients with compensated cirrhosis regardless of alt levels but there are minor differences in threshold hbv dna levels for initiating treatment .
all guidelines agree that treatment should be initiated in noncirrhotic patients with serum hbv dna levels greater than 20,000 iu / ml and persistently elevated alt levels and/or histologic evidence of moderate or severe inflammation or fibrosis .
however , cutoff values of hbv dna and alt and the need for liver biopsy or non - invasive assessment of liver fibrosis in determining treatment indications vary slightly among the guide - lines . because hbv dna and alt levels fluctuate during the course of chronic hbv infection ,
all guidelines agree that serial hbv dna and alt levels are more important than values at a single time point in making treatment decisions .
furthermore , all guidelines recommend that patients who are not started on treatment should be monitored such that treatment may be initiated at a later time when hbv replication or liver disease becomes more active .
the aasld , apasl and easl guidelines are based on a combination of scientific evidence and expert opinion and experience .
these guidelines have not incorporated prediction models for cirrhosis or hcc into recommendations when or which patient should start treatment but incorporation of risk scores for hcc may be appropriate for asian patients particularly those in the gray zone .
the guidelines emphasize that patient age , family history of hcc , occupational requirements , plans to start a family ( for women ) , and patient preference should also be considered in making treatment decisions .
there are many settings when a patient 's medical or social circumstances warrant a personalized approach that may be " at odds " with the guidelines but appropriate for that patient .
for example , a 48 year old man who is hbeag - positive with serial alt 19 - 28 u / l and hbv dna 3,000,000 - 400,000,000 iu / ml with no evidence of cirrhosis would be considered to be in the immune tolerant phase and " not meet " criteria for treatment but starting this patient on treatment is appropriate because there is ample data showing that patients who remain hbeag - positive after age 40 and those who have serum hbv dna levels higher than 2,000 iu / ml after more than four decades of infection are at increased risk of cirrhosis and hcc.15,16 treatment would also be appropriate in a 32 year old surgeon who has the same disease characteristics if suppression of viremia is a prerequisite for permission to continue his profession as a surgeon and to perform surgical operations ( exposure - prone procedures ) .
treatment might also be appropriate in a 45 year old man who is hbeag negative with alt 25 - 35 u / l and hbv dna 1,800 - 9,500 iu / ml if he has several family members with hcc .
other examples of personalized approach being " at odds " with guidelines may involve a decision to defer treatment when guidelines would recommend treatment .
for example , a 35 year old woman who is hbeag - negative with alt 55 - 65 u / l and hbv dna 28,000 - 75,000 iu / ml with no evidence of cirrhosis may choose to defer treatment if she wishes to start a family and is concerned about the safety of anti - hbv medications on fetal development .
another patient with the same disease characteristics may choose to defer treatment if she does not have insurance coverage for medications , or has contraindications to using interferon and is unwilling to commit to many years of nucleos(t)ide analogue therapy .
selection of the first - line anti - hbv drug should be based on the safety and efficacy of the drug , risk of drug resistance , cost of the drug , and patient preference .
the main advantages of ifn include a finite duration of treatment and a higher rate of hbeag and hbsag loss but ifn has to be administered parenterally and is associated with a wide range of adverse reactions some of which can be serious .
entecavir , telbivudine and tenofovir have more potent antiviral activity , and entecavir and tenofovir have higher barriers to antiviral drug resistance .
all guidelines recommend initial treatment with peg - ifn , entecavir or tenofovir as monotherapy.12,13,14 because of cost concerns and the lack of access to tenofovir in some asian countries when the most recent version of the apasl guidelines were released , lamivudine , adefovir or telbivudine were also recommended as first - line drugs in treatment - nave patients.13 ifn is not recommended in patients with acute liver failure , decompensated cirrhosis or severe exacerbations of chronic hepatitis b but it may be used with caution in patients with compensated cirrhosis . while guidelines consider peg - ifn , entecavir and tenofovir as equivalent first - line anti - hbv drugs , in clinical practice , entecavir and tenofovir
are used much more often than peg - ifn even in patients with no contraindications to the use of ifn . the decision to choose a nucleos(t)ide analogue over peg - ifn
may be based on the patient 's preference for an oral drug with minimal adverse reactions over an injectable drug with many potential side effects but it may also be based on the physician 's beliefs and bias .
although cost - effectiveness studies have been performed , these analyses rely on many assumptions and decision on peg - ifn versus nucleos(t)ide analogues is complicated because the efficacy , tolerability , and duration of these two classes of drugs are very different and the costs of these medications vary widely from one country to another .
the first step in deciding which drug to use for treating hepatitis b is to choose between peg - ifn versus nucleos(t)ide analogue .
patients ' preference for route of administration ( injection versus oral ) , duration of treatment ( 1 year versus many years ) , and presence of medical / psychiatric comorbidities that contraindicate use of or decrease tolerance to ifn are the most important deciding factors .
a personalized decision on anti - hbv drug should also consider the likelihood of response . in this regard , the predictors of response to peg - ifn and nucleos(t)ide analogues are similar : high alt and low hbv dna levels are the most reliable predictors of response to both peg - ifn and nucleos(t)ide analogues .
thus , patients who are more likely to respond to peg - ifn are also more likely to respond to nucleos(t)ide analogues .
one predictor of response that is unique to peg - ifn is hbv genotype although this applies mainly to hbeag - positive patients .
hbeag - positive patients with genotype a hbv have significantly higher rates of hbeag and hbsag loss compared to patients with genotypes b , c or d.17 thus , hbeag - positive patients with genotype a hbv and no contraindications to use of ifn should be encouraged to receive peg - ifn .
interleukin-28b ( il28b ) polymorphism was shown to be a strong predictor of response to ifn - based therapy for hepatitis c but the association between il28b polymorphism and peg - ifn treatment of hepatitis b is inconsistent .
other factors may play a role in personalized decisions regarding choice of anti - hbv drugs .
for example , young patients may prefer a finite course of peg - ifn versus many years of nucleos(t)ide analogue treatment .
this is particularly true for young women contemplating to start a family in the next few years .
once a decision is made to treat with nucleos(t)ide analogues , the main considerations are cost and risk of antiviral drug resistance .
if cost is not a concern , tenofovir and entecavir are preferred as these drugs have markedly lower rates of drug resistance ( 0 - 1% after 5 - 6 years of continuous therapy)18,19 compared to lamivudine , adefovir or telbivudine .
tenofovir and entecavir have similary potency and barrier to antiviral resistance , and either drug may be used as first - line treatment in nucleoside - nave patients . because of a low risk of nephrotoxicity , entecavir is preferred in older patients , patients with baseline impaired renal function and those with other medical conditions such as hypertension or diabetes that would increase the risk of renal insufficiency .
although telbivudine had been reported to improve renal function,20 the high risk of antiviral drug resistance and the potential for other adverse reactions such as myopathy and polyneuropathy make this a poor choice as first - line treatment.21 tenofovir is effective in suppressing not only wild type hbv but also lamivudine , telbivudine or entecavir resistant hbv and to a slightly lesser extent adefovir resistant hbv ; therefore , it is a better choice for patients who had been previously treated with other nucleos(t)ide analogues .
tenofovir is also a preferred choice for women of reproductive age because of its safety record in pregnancy.22
aasld , apasl and easl guidelines recommend administration of peg - ifn for 48 - 52 weeks in both hbeag - positive and hbeag - negative patients.12,13,14 there is some variation in recommendations when nucleos(t)ide analogues can be stopped .
all guidelines recommend that in hbeag - positive patients , nucleos(t)ide analogues can be stopped when the patient has completed 6 - 12 months consolidation therapy after hbeag seroconversion .
the easl guidelines recommend continuing treatment until hbsag loss in patients with advanced fibrosis or cirrhosis to avoid flares associated with viral relapse .
the aasld and easl guidelines recommend that in hbeag - negative patients , nucleos(t)ide analogues should be continued until hbsag loss but the apasl guidelines stated that treatment may be withdrawn after completing at least two years treatment with undetectable hbv dna documented on three occasions six months apart .
all three guidelines recommend lifelong nucleos(t)ide analogue treatment in patients with cirrhosis before treatment unless they had compensated cirrhosis and had cleared hbsag .
in addition to pre - treatment factors , several studies have found decrease in hbsag level after 12 or 24 weeks of peg - ifn treatment to be better predictors of response .
specifically , a lack of or a small decline in hbsag level after week 12 or 24 of peg - ifn is associated with 85 - 95% negative predictive value of a response.23 these data suggest that a response - guided stop - rule may be used making peg - ifn therapy more attractive because patients who are unlikely to benefit can be spared from further side effects and costs .
a recent cost - effective study showed that response - guided peg - ifn therapy is the most cost - effective approach for hbeag - positive but not hbeag - negative patients.24 thus , hbeag - positive patients with no contraindications , particularly those with genotype a hbv , high alt and low hbv dna levels before treatment who are already predicted to have a high likelihood of response to peg - ifn may be further encouraged to have a trial of peg - ifn , treatment can be stopped after 12 weeks if decline in hbsag is inadequate . a caveat to this approach is that it has not been validated prospectively and different stop rules have been proposed by different authors and for different hbv genotypes .
for patients receiving nucleos(t)ide analogue therapy , the likelihood of achieving hbeag seroconversion is 40 - 50% and the likelihood of achieving hbsag loss is 0 - 10% after 5 years of continuous treatment.3 thus , more than half of the hbeag - positive patients and 95% of hbeag - negative patients will require more than 5 years of treatment .
a few studies found that while viral relapse ( redetection of hbv dna in serum ) occurs in all hbeag - negative patients who completed 2 - 5 years treatment and who stopped treatment before hbsag loss , clinical relapse with elevated alt and hbv dna levels > 2,000 iu / ml occurred in only 50% of patients.25,26 these data suggest that hbeag - negative patients who have completed > 2 years treatment may consider stopping treatment if they are unwilling to continue or unable to afford continued treatment . however , this personalized approach must be accompanied by a plan for close monitoring for at least 6 months after discontinuation of treatment such that treatment can be promptly resumed if necessary .
personalized approach to treatment of hepatitis b should adapt practice guidelines to individual patient 's disease characteristics , personal preferences , medical comorbidities and social circumstances to determine when treatment should be started , which drug to use , and when to stop treatment , such that maximum benefit can be derived while minimizing costs and adverse reactions ( table 3 ) .
Output:
| there are seven approved drugs for treatment of hepatitis b. professional guidelines provide a framework for managing patients but these guidelines should be interpreted in the context of the individual patient 's clinical and social circumstances .
personalized management of hepatitis b can be applied based on prediction of the individual patient 's risk of cirrhosis and hepatocellular carcinoma to guide the frequency and intensity of monitoring and urgency of treatment .
it can also be applied to decisions regarding when to start treatment , which drug to use , and when to stop based on the individual patient 's disease characteristics , preference , comorbidities and other mitigating circumstances . |
PubmedSumm119632 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: congenital pouch colon ( cpc ) is an unusual abnormality in which a pouch - like dilatation of a shortened colon is associated with an anorectal malformation ( arm ) .
this report describes a girl with type - iii cpc and uterus didelphys with a septate vagina . at puberty , the child had primary amenorrhea that was found to be due to bilateral atresia of the cervix uteri .
similar findings in a girl with cpc have not been reported earlier in the literature .
a 3-month - old girl was brought with the absence of the anal opening and passage of urine and stools from a single perineal opening . on examination
, there was a single , fairly wide , perineal opening , and a clinical diagnosis of a persistent cloaca was made .
laparotomy revealed a type - iii cpc malformation with 8 cm of normal colon proximal to the distended colonic pouch that appeared to end in a colocloacal fistula .
the child had uterus didelphys with one fallopian tube and uterus flanking the distal portion of the colonic pouch and the colocloacal fistula on each side .
the fistula was ligated , subtotal excision of the colonic pouch with tubularization of its outer portion performed ( tubular colorraphy ) and an end - colostomy fashioned .
initial dissection by the posterior sagittal approach revealed a short but wide common channel ( around 2 cm long ) with a double vagina .
the anterolateral walls of the common channel were tubularized to reconstruct the urethra over an 8 fr . catheter . with the child in the supine - lithotomy position ,
a short segment of ileum was isolated , its upper end sutured to the margins of the double vagina and its lower end brought to the perineum . the colostomy was mobilized and brought down to the site of the neoanus .
the girl was lost to follow - up for 5 years and brought again with complaints of urinary and fecal incontinence .
the child had partial urinary incontinence ( ui ) with passage of urine in a stream a few times daily along with continuous dribbling of urine . on examination , the urethral and vaginal openings were separate and the vaginal opening was adequate in caliber .
a micturating cystourethrogram ( mcu ) showed a bladder of adequate capacity with a patulous bladder neck .
the parents were not willing for clean intermittent catheterization or any further surgical management for ui . at 11 years of age ,
the girl presented with primary amenorrhea and severe monthly cyclical pain in both flanks and the pelvis .
investigations were advised but the child was lost to follow - up for 3 years and brought again only when the symptoms had worsened considerably . a us of the abdomen and pelvis showed well - defined lobulated masses with cystic lesions in the pelvis and both adnexal regions .
magnetic resonance imaging ( mri ) scan of the abdomen and pelvis [ figure 1 ] showed 2 uteri and fallopian tubes that were distended and filled with blood and blood products .
poorly developed cervical tissue was seen and could be traced only to the right uterus .
mri scan of the pelvis showing the enlarged , distended uterine horns ( right more than left ) and adnexal structures ( arrow ) eua with cystourethroscopy showed a separate urethral orifice leading to a short urethra with a widely open bladder neck .
per - vaginal examination showed tense , hard masses on both sides in the pelvis .
laparotomy revealed dense pelvic adhesions , uterus didelphys with both uteruses distended with blood and blood products , bilateral endometrial cysts , and a large left hematosalpinx [ figure 2 ] .
the endometrial cysts were aspirated , the walls of the cysts were enucleated , and bilateral hysterectomy with left salpingectomy performed .
there was very poorly developed cervical tissue without a lumen on the right side and complete cervical atresia on the left side .
sections from one of the uterine horns showed endometriosis while those from the other horn were unremarkable .
photograph taken during surgery showing the distended uterine horns and the left fallopian tube and adnexal structures filled with blood and hemorrhagic cysts presently , at the age of 16 years , the girl is relieved from her complaints of cyclical abdominal and pelvic pain .
she is able to hold urine during the day for periods ranging from to 2 h but has severe nocturnal ui .
the child is dry after an enema for 4 - 5 h. the child is fairly well - adjusted psychologically .
although our study suggested that the anomalous clinical anatomy of cpc in girls as described by us was almost invariable , apart from a few exceptions,[46 ] other reports , including earlier ones from our center , have not consistently described the abnormal findings of the mullerian structures .
a likely reason is that in newborns and small infants , the anatomy of the external genitalia and perineum is not clear on clinical examination and endoscopic examination of the genitourinary tract is usually not feasible so that , as initially in our patient , the usual diagnosis would be that of a persistent cloaca .
the vast majority of reports , including large series , have recorded only the findings at the time of primary surgery , usually in the newborn , and not the results of any detailed examination , endoscopy , and/or investigations performed later .
the details of reconstruction of the lower genitourinary tract have also usually not been described .
there are very few reports of the obstetric implications of a double uterus and vagina ( uterus didelphys ) a finding that appears to be invariable in girls with types i - iii cpc .
however , a report suggested that 18% of patients with uterus didelphys had an obstructed hemivagina with hematocolpos .
in a recent review on the subject of gynecologic concerns in girls with arm , breech emphasized the role of vaginoscopy before puberty , preferably at the time of definitive repair of the arm .
vaginoscopy allows evaluation of the vaginal anatomy and can also document the appearance , development , and position of the cervices in the vaginas and the presence or absence of mucus at the ectocervix ( to infer patency ) .
antegrade / retrograde perturbation of the mllerian structures during any open or laparoscopic procedure for the arm can confirm patency of the outflow tract .
any underdevelopment of the mllerian structures can be detected by serial us starting soon after the onset of breast development .
if neglected , as in our case , onset of menarche in the presence of obstruction to the outflow tract may result in endometriosis , hematometra and/or hematocolpos , hematosalpinx , adnexal cysts , and chronic abdominal pain .
although in the past , hysterectomy was the treatment of choice for cervical atresia , current recommendations are suppression of menses with preservation of the uterus for pregnancy with reproductive assistance , or uterovaginal anastomosis .
a report of 18 cases of uterovaginal anastomosis in patients with cervical atresia reported six spontaneous pregnancies in four patients , and only one required cervical cerclage .
, managed a patient of vestibular fistula with the absence of vagina and cervical atresia by anastomosing a bowel graft directly to the uterus . in conclusion ,
our report emphasizes the need for a comprehensive evaluation and long - term management strategy for associated gynecologic anomalies in girls with cpc , especially with regard to the patency of the outflow tract .
uterus didelphys with a septate vagina appears to be invariable in girls with types i - iii cpc and needs to be assessed and managed appropriately with awareness of the possibility of obstetric complications in later life .
patency of the outflow tracts should be assessed at an early stage and serial us starting soon after breast development can assess the growth of both uteruses and any evidence of obstruction to the outflow tract so that early corrective treatment can be instituted .
Output:
| this report describes a girl with congenital pouch colon ( cpc ) , uterus didelphys with septate vagina , and a cloacal anomaly .
the girl underwent cloacal reconstruction at the age of 15 months .
subsequently , at puberty , the child had primary amenorrhea with severe cyclic abdominal pain due to endometriosis of both the uteruses and adnexal cysts with hematometra and hematosalpinx .
laparotomy with removal of both uteri and the left fallopian tube was performed .
both uteri had atresia of the cervix uteri .
this report emphasizes the need for comprehensive evaluation and a long - term management strategy for associated gynecologic anomalies in girls with cpc , especially with regard to patency of the outflow tract . |
PubmedSumm119633 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: solid pseudopapillary tumor ( spt ) of the pancreas has been variously designated as solid and cystic tumors , solid and papillary epithelial neoplasms , papillary cystic neoplasms , papillary cystic tumors , and frantz 's tumors .
the world health organization renamed this tumor as spt in the international histological classification of tumors .
spt represents a rare tumor that occurs most frequently in young women ( 90% ) .
although spt is considered an indolent lesion with a low malignant potential and a favorable prognosis after surgical resection , some cases of locally infiltrating and metastatic varieties , or recurrences after surgery , have been reported .
a 74-year - old woman was admitted to the hospital for fever and general weakness . on the computed tomography scan
, there was large abscess cavity showing partially septated cystic lesion with peripheral inflammatory hyperemia in the right hepatic lobe .
incidentally , a lobulated , 5 3.2 cm , heterogeneous pancreatic mass containing several intratumoral calcification and cystic change on the tail of the pancreas and a 6-cm , well - defined mass with heterogeneous contrast enhancement in the left lobe of the liver were detected ( fig .
1 ) . two months after conservative treatment for hepatic abscess , the abscess was completely resolved
. however , the mass in the left lobe of the liver remained unchanged and then ultrasound - guided liver biopsy was performed .
the tumor consisted of papillary neoplasm showing monomorphic polyhedral cells with hyalinized fibrovascular stalks , which was best classified as metastatic spt of the pancreas .
immunohistochemistry was positive for vimentin , antitrypsin , and neuron specific enolase . on the presumption of an spt of the pancreas with hepatic metastasis , the patient underwent radical antegrade modular pancreatosplenectomy with hepatic resection . on operation field
encapsulated masses , 6 5 cm and 5 4.5 cm in size , were found in the segment of the left liver and in the tail of the pancreas , respectively .
microscopically , the growth pattern of the pancreas tumor was heterogeneous , with a combination of solid and pseudocystic structures in varying proportions .
the tumor was composed of monomorphic polyhedral cells with hyalinized fibrovascular cores , thereby leading to the characteristic pseudopapillary appearance ( fig .
. however , perineural invasion and infiltration into the peripancreatic fat tissue could be seen .
the microscopic findings of the hepatic tumor were similar to the findings of the pancreatic tumor .
a final diagnosis of spt of the pancreas with metastasis to the liver was made .
spt is a rare neoplasm of the pancreas accounting for only 1 to 2% of all exocrine pancreatic tumors .
although spt occurs in young females and is generally considered to be low malignant potential , local recurrence or distant metastases can be found in a significant number of patients .
14.7% ( 43 of 292 ) were evaluated as malignant due to metastasis ( 22 of hepatic , lymph node metastasis or peritoneal dissemination ) or invasion into adjacent organs .
the prognosis for spts is excellent after curative resection ( more than 90% survival at 5 years ) .
metastasis develops in less than 15% of cases and among them hepatic metastasis is most common .
suggested that complete resection was associated with long - term survival even in the presence of metastatic disease . in
case report series , even patients with local recurrence as well as liver and peritoneal metastasis have experienced long - term survival [ 4 - 8 ] .
one study suggested that patient age tended to be older and the tumor size tended to be larger in metastasizing spt than in non - metastasizing spt .
invasion of blood vessels , perineural clefts and adjacent organs , a high degree of cellular pleomorphism and an elevated mitotic rate are considered to associated with metastasis .
nishihara et al . compared the histological features of metastasizing spt and non - metastasizing spt and reported that venous invasion , nuclear grade , and prominent necrobiotic nests are useful as histologic indicators for the malignant potential of spt .
the present patient was very old age and had an incidental detection of the disease .
microscopic findings showed focally - infiltrative and perineural invasion , while without lymph node metastasis and less than 5% of ki-67 positivity .
in conclusion , we report a case of pancreatic spt with synchronous hepatic metastasis , which appeared later in life .
preoperative diagnostic work - up is a cornerstone for surgical approach and complete resection should be considered for this potentially curative disease if operation is possible .
the literatures reported up to date , as well as our case , demonstrate an aggressive approach to this rare low - grade malignant tumor can result in long - term survival even in patients with local invasion and distant metastasis .
Output:
| solid pseudopapillary tumor of the pancreas is a rare tumor that affects young females with low malignant potential and good prognosis with more than 90% survival at 5 years .
metastasis is very rare .
we report the case of a 74-year - old female who had pancreatic solid - pseudopapillary tumor and synchronous hepatic metastasis . |
PubmedSumm119634 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the choroid plays several important functions within the eye , providing metabolic support to retinal pigment epithelium ( rpe ) and outer retina , contributing to the blood vascularization of the preliminary portion of the optic nerve and absorbing excess of light entering the retina and rpe thanks to the presence of melanocytes .
the choroid can not be excluded in the evaluation and understanding of the pathophysiological mechanisms responsible for diseases of the posterior segment .
many experiments and clinical studies have shown both retinal and choroidal altered blood flow in retinitis pigmentosa ( rp ) [ 13 ] .
clinically , the retinal vessels reduction is a pathognomonic finding in rp and the value of retinal blood flow measurement is significantly reduced in rp patients compared to that in healthy subjects . similarly in patients with rp , the ocular pulse amplitude ( opa ) , an indirect measure of choroidal perfusion , was significantly reduced in the advanced stages of the disease . however , the role that these perfusion abnormalities have in the pathogenesis of rp is still uncertain .
the recent development of the technique enhanced depth imaging ( edi ) [ 5 , 6 ] , which allows through the use of spectral domain oct obtaining detailed images of the choroid , has given substantial impetus to the study of the physiopathological role of choroid such as physiological variation with age and implication in pathogenic mechanisms .
in rp , the analysis of choroidal thickness has a double importance ; while it is an important additional factor for the understanding of the pathogenesis and course of the disease , it is an essential element in the evaluation of therapeutic perspectives , like retinal implants , gene therapy , and stem cells therapy .
retinitis pigmentosa is also a term that embraces a multitude of clinical conditions that have similar characteristics but differ for age of onset , course , and severity .
the aim of the study is to portray the most common syndromic form of rp , usher syndrome type 2 , analyzing the thickness of the choroid in correlation with disease stage and comparing values reported in literature on nonsyndromic rp and healthy subjects .
all patients were recruited from the hereditary retinal diseases service at the university eye clinic of san paolo hospital in milan between january and may 2014 .
they are part of a larger group of usher syndrome patients being evaluated at our clinic .
diagnosis of usher syndrome was confirmed by both clinical signs ( characteristic bone spicule pigmentation , optic disc pallor , retinal vessel attenuation , visual field constriction , flat electroretinographic waves , photoreceptor atrophy shown by oct , and bilateral sensorineural hearing loss ) and results of genetic analysis .
we considered for the present study patients with at least one homozygous mutation or two heterozygous mutations .
heterozygous mutations have been confirmed on the two alleles by segregation analysis ( table 1 ) .
all participants underwent a complete ophthalmologic examination including best corrected visual acuity ( bcva ) , intraocular pressure , axial length , automated visual field , and edi oct .
demographic data and medical history ( including the age of diagnosis of usher syndrome , the first symptoms onset , and the presence / absence of other members of the family affected by the same disease ) were collected using a questionnaire that all the patients were asked to complete before the inclusion in the study .
factors that have been demonstrated to influence choroidal thickness ( refractive error > 6 diopters and elongated axial length ) or poor oct scan quality ( media opacities , nystagmus ) were considered noninclusion criteria .
other exclusions included history of glaucoma or uveitis , prior ocular surgery ( excepted cataract surgery ) , systemic cardiovascular disease like hypertension , and diabetes .
we arbitrarily considered 3 stages of disease according to the parameters of visual acuity and visual field : stage 1 for patients with visual acuity better than 0.6 decimal or visual field mean defect less than 10 db , stage 2 for patients with visual acuity from 0.6 to 0.2 decimal or visual field mean defect from 10 to 20 db , and stage 3 for patients with visual acuity less than 0.2 decimal or visual field mean defect more than 20 db . visual field analysis was obtained using the 30 - 2 sita standard program of the humphrey visual field analyzer ( zeiss / humphrey systems , dublin , ca , united states ) .
examinations were performed using the best correction for near vision . for the purpose of the study mean defect ( md ) and pattern standard deviation ( psd ) values were considered .
axial length was measured using the iol master 500 biometer ( carl zeiss meditec , dublin , ca , united states ) .
the values used for the study were obtained from the mean of five consecutive measures .
retinal and choroidal imaging were obtained using spectralis hra and oct ( heidelberg engineering , heidelberg , germany ) .
edi oct technique , previously described by spaide and margolis [ 5 , 6 ] , allows detailed imaging of the choroidal layer . for the study we took single line scans of 30 composed of 100 averaged images using the automatic eye tracking software across the fovea both vertically and horizontally .
both retinal and choroidal measures were taken manually in a masked fashion by two experienced oct - readers as shown in figure 1 .
: from the inner border of the sclera to the outer border of the rpe vertically using the calipers of the heidelberg reader software subfoveally and at 500 mm intervals for 2.5 mm nasal , temporal , superior , and inferior to the centre of the fovea .
retinal thickness was taken in the same intervals vertically from the outer border of the rpe to the inner border of ilm .
horizontal spatial distribution of photoreceptor layer was manually measured using the calipers . also presence / absence of cystoid macular edema was considered .
only oct scans of good quality were used for the measures ( figure 1 ) .
first , we studied the correlation between choroidal thickness and retinal thickness in the foveal region with a series of predictors ( age , time from first symptoms , axial length , bcva , md , and psd as continuous variables , presence of photoreceptors , and presence of oedema as categorical variables ) .
all correlations were calculated using univariate mem models where a patient random effect was included to account for the covariance among observations from the same subject ( i.e. , two measurements from each patient , one for each eye ) .
secondly , we analyzed the effect of the age of the patients on the choroidal thickness at various distances from the fovea ( every 0.5 microns from 2.5 to 2.5 microns away ) on both temporal - nasal and superior - inferior axes . in this case
age and the site of measurement were treated as fixed effects ; a patient and an eye random effect were used to correct for the covariance among observations from the same patient and the same eye ( i.e. , multiple measurements from each eye of each patient ) .
finally , an interaction term was included to allow different slopes in the model at each site .
the different slopes were used to create a correlation map showing the effect of the age of the patient on the choroidal thickness at each site .
z - test analysis was used to compare our data on choroidal thickness in patients with usher syndrome type 2 with values of choroidal thickness in healthy and nonsyndromic rp patients as reported in published literature .
10 patients ( 20 eyes ) with clinical and genetic diagnosis of usher syndrome type 2 were included in the study ( 4 men and 6 women ) .
the mean age was 43.1 13.09 years ; the mean duration of disease was 17.8 12.28 years .
spherical equivalent ranged from 3.5 d to + 2.5 d and mean axial length was 23.59 1.29 mm ( table 2 ) .
mean subfoveal choroidal thickness ( sfct ) ( table 3 ) was 237.45 76.81 microns , with a mean choroidal thickness thinner 2.5 mm nasally than 2.5 mm temporally to the fovea ( 130.2 and 194.6 mm , resp . ) and 2.5 mm inferiorly than 2.5 mm superiorly to the fovea ( 200.1 and 219.75 mm , resp . ) .
the mean retinal thickness was thinner 2.5 mm temporally than 2.5 mm nasally to the fovea ( 199.9 and 223.85 mm , resp . ) and 2.5 mm inferiorly than 2.5 mm superiorly to the fovea ( 209.35 and 222.55 mm , resp . ) .
25% of the eyes ( 5/20 ) presented cme . in 15% of the eyes ( 3/20 )
photoreceptors outer segment layer was not detectable at oct . when detectable , the mean horizontal extension of photoreceptor layer ( concentric to the fovea ) was 264.7 148.71 microns .
sfct was significantly correlated with age : sfct decreases with age ( estimated coefficient 4.412 , pearson correlation coefficient 0.725 , p < 0.01 ) .
no statistically significant correlation was found between sfct and duration of disease , different stages of disease ( as evaluated with visual acuity and visual field parameters ) , retinal thickness , and axial length ( table 4 ) .
we then analyzed the correlation between choroidal thickness and age in each interval : figure 2 shows the intervals in which the correlation was significantly different from that of the fovea .
the intervals further away from the fovea were less correlated with age ( the values indicated with the asterisks ) .
choroidal thickness values from usher patients were compared with values reported in published literature for healthy subjects and nonsyndromic rp patients .
choroidal thickness in usher patients was significantly reduced when compared to healthy subjects ( p < 0.01 , z - test ) , while no difference was found when compared to choroidal thickness from nonsyndromic rp patients ( p = 0.72 ) .
our case control study showed that choroidal thickness is reduced in people with usher syndrome type 2 if compared to healthy subjects [ 5 , 6 , 9 , 10 ] .
our results confirmed those reported by dhoot et al . , who studied choroidal thickness in nonsyndromic rp using the same strategy to analyze oct images , by ayton et al . who studied nonsyndromic rp patients using a graphic software to analyze choroidal thickness in oct scans and by yoon and yu who used a different instrument of acquisition and analysis of oct scans .
both retinal vascularization and choroidal vascularization were reported to be significantly reduced in rp patients and in animal models of rp [ 1 , 3 , 4 ] : our observations can be considered a sign of this blood flow reduction .
recent studies demonstrated different visual acuity , visual field , and cone electroretinogram amplitude loss in usher syndrome patients if compared to nonsyndromic type of rp : comparison between our data and choroidal thickness values in nonsyndromic rp reported in literature could not explain these differences .
although previous studies reported that choroidal arteries and choriocapillaris under macular region fill more rapidly and intensely compared to other retinal locations , supporting the concept that thicker choroidal thickness under the fovea is due to macular higher metabolic request ; however , similarly to yeoh et al . and dhoot et al . , our study did not show any correlation between sfct and visual acuity .
we also could not find any correlation between sfct and presence / absence of outer retinal layer or macular edema
. a possible explanation of these data could be that edi oct technique does not allow distinguishing choriocapillaris , which represents about 10% of all choroidal thickness [ 15 , 16 ] , from the rest of choroidal volume .
first publications by spaide and margolis on choroidal thickness in healthy subjects reported a decrease of choroidal thickness with age [ 5 , 6 ] .
similarly our study found a statistically significant correlation : also in patients with usher syndrome type 2 sfct decreases with age . on the other hand ,
no correlation between sfct and duration of disease was found , in contrast with ayton 's previous report .
this observation could be due to the fact that it is difficult to establish the exact onset of the disease : for the majority of patients diagnosis follows symptoms onset and in addition to that considering that usher syndrome is a genetic disease the concept of duration of disease is not as relevant as chronological age .
interestingly in our usher syndrome study group the topographic choroidal thickness variation appears to be similar to topographic choroidal thickness variation previously reported in literature for healthy subject .
choroidal thickness was thinner in nasal than in temporal sector and in inferior than superior sector .
furthermore we evaluated the correlation between choroidal thickness and age in each topographic sector : as shown in figure 2 intervals far from the fovea resulted in being statistically less associated with age if compared to the fovea .
this fact could be reasonably explained by the fact that central retina , particularly the fovea , is the last involved with the degenerative process in rod - cone dystrophy . to our knowledge , the relationship between the thickness of the choroid in different regions of the macula and the correlation with topographic variations has not yet been described .
lack of correlation between choroidal thickness and axial length could be explained by the small number of patients studied and by the fact that we considered an exclusion criteria refractive error > 6 diopters . in conclusion
we have demonstrated in vivo choroidal thickness reduction in different topographic sectors in patients with usher syndrome type 2 .
these data are important not only for the comprehension of pathogenetic mechanisms in hereditary retinal diseases but also for the evaluation of therapeutic approaches
. a deep knowledge of residual choroidal blood flow and changes in choroidal vascularization would be necessary for both retinal implant and stems cells therapy .
limits of our study are represented by the small number of patients and the absence of a healthy and a nonsyndromic rp control group .
further studies will need to investigate the correlation between different type of rp , classified by genetic mutation , and choroidal changes .
new and more sophisticated oct techniques will allow better understanding of the role that the choroid plays in the pathogenesis of hereditary retinal diseases .
Output:
| to portray usher syndrome type 2 , analyzing choroidal thickness and comparing data reported in published literature on rp and healthy subjects .
methods .
20 eyes of 10 patients with clinical signs and genetic diagnosis of usher syndrome type 2 .
each patient underwent a complete ophthalmologic examination including best corrected visual acuity ( bcva ) , intraocular pressure ( iop ) , axial length ( al ) , automated visual field ( vf ) , and edi oct .
both retinal and choroidal measures were measured .
statistical analysis was performed to correlate choroidal thickness with age , bcva , iop , al , vf , and rt .
comparison with data about healthy people and nonsyndromic rp patients was performed .
results .
mean subfoveal choroidal thickness ( sfct ) was 248.21 79.88 microns .
sfct was statistically significant correlated with age ( correlation coefficient 0.7248179 , p < 0.01 ) .
no statistically significant correlation was found between sfct and bcva , iop , al , vf , and rt .
sfct was reduced if compared to healthy subjects ( p < 0.01 ) .
no difference was found when compared to choroidal thickness from nonsyndromic rp patients ( p = 0.2138 ) .
conclusions .
our study demonstrated in vivo choroidal thickness reduction in patients with usher syndrome type 2 .
these data are important for the comprehension of mechanisms of disease and for the evaluation of therapeutic approaches . |
PubmedSumm119635 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: nursing education aims to provide an appropriate level of knowledge and skills in nursing students .
improving the quality of nursing care requires obtaining high levels of knowledge and skills during nursing training period ( 1 ) .
however , skills acquisition is a complex process and needs students to acquire a combination of psychomotor , cognitive and affective skills and incorporate such skills with their theoretical knowledge , procedural skills and critical thinking .
several studies in different countries reported that nursing education does not always prepare its students for the demands of working as a professional registered nurse ( 2 , 3 ) .
newly graduated nurses may have weak practical skills , which can be a threat to patients safety ( 4 ) .
a meta - analysis concluded that clinical skills training in nursing had not led to deep learning ( 5 ) .
investigated student nurses experience of learning in clinical environments and reported similar findings ( 6 ) .
shah et al . studied the process of motor skill acquisition and reported that most students complain about their problems in transferring what they learned at clinical skills centers to the real clinical setting ( 7 ) .
several factors are involved , among them education methods play a crucial role ( 8) .
therefore , it is imperative for nurse trainers to use the best methods to promote learning and skill acquisition in their students ( 4 ) .
concept mapping is a modern educational strategy based on the ausubel s learning assimilating theory . according to ausubel , meaningful
learning occurs when newly learned materials can be linked to the information previously stored in the brain .
novak and govin defined concept mapping as a graphical method for presenting a set of concepts placed in a thematic framework ( 9 ) . in this perspective , we think and learn the concepts by linking new concepts to previously known concepts in a systematic manner ( 10 ) .
in fact , concept mapping is an active teaching method , which helps nurse educators to develop critical thinking and problem solving capabilities in graduates ( 11 ) .
several studies in the field of medical education used concept mapping in teaching theoretical courses ( 11 , 12 ) , teaching and evaluation of creativity skills ( 13 ) , teaching students to develop and record care plans ( 14 ) . however , most studies used grades and students academic achievement to measure the effect of concept mapping ( 15 ) . moreover , some studies had weaknesses in their design and methodologies .
adlaon compared the effect of a three - week teaching course using concept mapping and traditional teaching methods on students performance in responding multiple choice questions and reported that concept mapping was superior to traditional teaching method .
however , the short duration of intervention , the small sample size , the small numbers of concept maps used and the type of evaluation made the results difficult to be generalized ( 16 ) . in another study ,
reported that contradictory results of concept mapping technique might be attributed to small sample size , inappropriate gauges , non - random selection and lack of control group in different studies ( 17 ) .
most studies assessed the effects of concept mapping on students cognitive learning domain ( 18 , 19 ) and the effect of this method on students skill acquisition had not been assessed so far .
then , we can not generalize the results of these studies to the psychomotor domain .
this study was performed to compare the effects of training using concept mapping and traditional teaching methods on practical skills of nursing students .
this quasi - experimental pretest and post - test study was conducted on 70 students enrolled for the first time in a practical course on fundamentals of nursing .
the study was conducted in the second semester of the academic year 2013 - 2014 in the clinical skills center at tehran university of medical sciences ( tums ) .
the inclusion criterion was having no previous experience on concept mapping and direct observation of procedural skills ( dops ) methods .
an absence of more than three sessions from the training sessions was the exclusion criterion .
the sample size was calculated using the results of a previous study by karimi - moneghi et al .
in which s1 , s2 , 1 and 2 were respectively 1.5 , 1 , 16.2 , and 15.25 ( 20 ) .
then , with a type i error of 0.05 and a power of 0.80 , the sample size was estimated as 29 students for each group . however , we recruited 35 students with inclusion criteria in each group to compensate for possible attritions .
then , among a total of 140 students , 70 students with inclusion criteria who consented to participate in the study were recruited .
then , the students were randomly assigned in the intervention ( n = 35 ) or the control group ( n = 35 ) using a random numbers table ( figure 1 ) . before commencing the intervention , all the students were invited to the clinical skills center .
then , a pre - test was performed in both groups using the dops method .
afterward , each group was though 14 sessions of 45 minutes , two sessions per week , through either concept mapping ( intervention group ) or the traditional method ( control group ) .
a two - part instrument was used to collect data in this study including a demographic data form and a checklist for assessing the students skills in selected procedures .
the demographic data form consisted of questions regarding students age , gender , grade point average ( gpa ) , living location , marital status and the group in which the student was assigned to .
the checklist used to observe student s skills in selected practical procedures consists of 9 items regarding having comprehensive knowledge of the indications and the relevant anatomy , obtaining patient s consent for the procedures , implementing all required preparations before the procedures , implementing the aseptic techniques , the technical ability to perform the procedure , implementing the required nursing care after the procedures , appropriate using of communication skills , using essential ethical and professional conduct and the observer s overall opinion on student s performance .
all items scored on a 10-point likert scale ranged from zero to 9 , totaling a score of 0 to 81 for each skill .
farsi version of this instrument was also validated by eleven faculty members in zahedan nursing and midwifery college and presented appropriate content validity .
its reliability was also checked through internal consistency method and the cronbach s alpha was 0.94 ( 23 ) .
the intervention group was trained using concept mapping method followed by demonstrating relevant skills by instructors and students practices .
all maps were spider shaped so that the main concepts were in the middle of maps and sub - concepts were presented in the sides . in all maps ,
the teacher presented the material in a clockwise direction from the starting point . at the first session
, the intervention group was informed that special software would be used to teach them in this course .
after each session , every student was required to design a concept map of the whole proposed lecture for the next session individually ; then , at the beginning of the next session , a few concept maps prepared by the students were reviewed and feedback was given to them .
all training sessions of the intervention group were held on saturdays and sundays , at the clinical skills center of nursing school of tums . in this study , the instructor ( the second researcher drew concept maps using offline method in free - mind ( gnu general public license , java ) , based on the literature on websites and specialized instructions ( 23 ) .
the control group was also trained in 14 sessions using conventional method ( i.e. lecturing , demonstration and then students practicing ) .
the training sessions of this group were held on different days ( tuesdays and wednesdays ) to prevent exchanging the information about concept mapping between the two groups .
the curriculum of both groups was the same and the only difference was used teaching methods .
the skills taught included intradermal injection , subcutaneous injection , intramuscular injection , intravenous cannulation , intravenous injection , intravenous fluids preparation , nasogastric catheterization , feeding through a nasogastric catheter ( gavage ) , nasogastric lavage , oxygen therapy methods ( through nasal cannula and face mask ) , measuring the blood pressure , airway suctioning , tracheostomy care and dressing change .
the list of procedures was confirmed by the authorities in nursing school and the content validity of all concept maps were confirmed by 10 experienced nursing faculty members in the nursing school of tums .
four weeks after the last training session , dops functional test was conducted without previously informing in the clinical skills center for all students in the both groups .
two lecturers of the fundamentals of nursing course in nursing and midwifery school at tehran university of medical sciences ( who were trained on dops and how to observe the students using special checklists , but did not know anything about the project ) , conducted all testing procedures . before starting the testing
, all the students were gathered in a classroom and briefed about the dops and what should they do during the testing session .
each student was required to select three procedures ( i.e. cleaning , injection and sterilizing ) among several procedures already taught to them .
the name of procedure was written on pieces of paper and put in three boxes .
the students performed the selected procedures under direct observation of the aforementioned specialists who completed the dops checklists .
finally the mean of students ' scores was calculated for each individual skill and recorded at the top of the checklist .
the present study was approved by the institutional review board and the research ethics committee of tums .
all students were aware that they are under investigation and signed an informed consent at the beginning of study .
statistical analysis was performed using spss-13 software ( spss inc , chicago , il , usa ) .
independent samples t - test was used to compare the mean of procedural skills scores , the mean age and gpa of the two groups . paired t - test
was used to compare the mean scores on each group before and after the intervention .
chi - square test was used to compare gender differences and fisher s exact test for marital status and residential area of the two groups .
this quasi - experimental pretest and post - test study was conducted on 70 students enrolled for the first time in a practical course on fundamentals of nursing .
the study was conducted in the second semester of the academic year 2013 - 2014 in the clinical skills center at tehran university of medical sciences ( tums ) .
the inclusion criterion was having no previous experience on concept mapping and direct observation of procedural skills ( dops ) methods .
an absence of more than three sessions from the training sessions was the exclusion criterion .
the sample size was calculated using the results of a previous study by karimi - moneghi et al .
in which s1 , s2 , 1 and 2 were respectively 1.5 , 1 , 16.2 , and 15.25 ( 20 ) .
then , with a type i error of 0.05 and a power of 0.80 , the sample size was estimated as 29 students for each group . however , we recruited 35 students with inclusion criteria in each group to compensate for possible attritions .
then , among a total of 140 students , 70 students with inclusion criteria who consented to participate in the study were recruited .
then , the students were randomly assigned in the intervention ( n = 35 ) or the control group ( n = 35 ) using a random numbers table ( figure 1 ) . before commencing the intervention , all the students were invited to the clinical skills center .
then , a pre - test was performed in both groups using the dops method .
afterward , each group was though 14 sessions of 45 minutes , two sessions per week , through either concept mapping ( intervention group ) or the traditional method ( control group ) .
a two - part instrument was used to collect data in this study including a demographic data form and a checklist for assessing the students skills in selected procedures .
the demographic data form consisted of questions regarding students age , gender , grade point average ( gpa ) , living location , marital status and the group in which the student was assigned to .
the checklist used to observe student s skills in selected practical procedures consists of 9 items regarding having comprehensive knowledge of the indications and the relevant anatomy , obtaining patient s consent for the procedures , implementing all required preparations before the procedures , implementing the aseptic techniques , the technical ability to perform the procedure , implementing the required nursing care after the procedures , appropriate using of communication skills , using essential ethical and professional conduct and the observer s overall opinion on student s performance .
all items scored on a 10-point likert scale ranged from zero to 9 , totaling a score of 0 to 81 for each skill . the checklist for dops
farsi version of this instrument was also validated by eleven faculty members in zahedan nursing and midwifery college and presented appropriate content validity .
its reliability was also checked through internal consistency method and the cronbach s alpha was 0.94 ( 23 ) .
the intervention group was trained using concept mapping method followed by demonstrating relevant skills by instructors and students practices .
all maps were spider shaped so that the main concepts were in the middle of maps and sub - concepts were presented in the sides . in all maps ,
the teacher presented the material in a clockwise direction from the starting point . at the first session
, the intervention group was informed that special software would be used to teach them in this course .
after each session , every student was required to design a concept map of the whole proposed lecture for the next session individually ; then , at the beginning of the next session , a few concept maps prepared by the students were reviewed and feedback was given to them .
all training sessions of the intervention group were held on saturdays and sundays , at the clinical skills center of nursing school of tums . in this study , the instructor ( the second researcher drew concept maps using offline method in free - mind ( gnu general public license , java ) , based on the literature on websites and specialized instructions ( 23 ) .
the control group was also trained in 14 sessions using conventional method ( i.e. lecturing , demonstration and then students practicing ) .
the training sessions of this group were held on different days ( tuesdays and wednesdays ) to prevent exchanging the information about concept mapping between the two groups .
the curriculum of both groups was the same and the only difference was used teaching methods .
the skills taught included intradermal injection , subcutaneous injection , intramuscular injection , intravenous cannulation , intravenous injection , intravenous fluids preparation , nasogastric catheterization , feeding through a nasogastric catheter ( gavage ) , nasogastric lavage , oxygen therapy methods ( through nasal cannula and face mask ) , measuring the blood pressure , airway suctioning , tracheostomy care and dressing change .
the list of procedures was confirmed by the authorities in nursing school and the content validity of all concept maps were confirmed by 10 experienced nursing faculty members in the nursing school of tums .
four weeks after the last training session , dops functional test was conducted without previously informing in the clinical skills center for all students in the both groups .
two lecturers of the fundamentals of nursing course in nursing and midwifery school at tehran university of medical sciences ( who were trained on dops and how to observe the students using special checklists , but did not know anything about the project ) , conducted all testing procedures . before starting the testing , all the students were gathered in a classroom and briefed about the dops and what should they do during the testing session .
each student was required to select three procedures ( i.e. cleaning , injection and sterilizing ) among several procedures already taught to them .
the name of procedure was written on pieces of paper and put in three boxes .
the students performed the selected procedures under direct observation of the aforementioned specialists who completed the dops checklists .
finally the mean of students ' scores was calculated for each individual skill and recorded at the top of the checklist .
the present study was approved by the institutional review board and the research ethics committee of tums .
all students were aware that they are under investigation and signed an informed consent at the beginning of study .
statistical analysis was performed using spss-13 software ( spss inc , chicago , il , usa ) .
independent samples t - test was used to compare the mean of procedural skills scores , the mean age and gpa of the two groups . paired t - test
was used to compare the mean scores on each group before and after the intervention .
chi - square test was used to compare gender differences and fisher s exact test for marital status and residential area of the two groups .
for gender distribution , 58.1% of the students in the control group and 56.9% of the intervention group were females .
no significant difference was observed regarding demographic characteristics of the two groups ( table 1 ) .
gpa : grade point average table 2 presents students mean scores in three skills of cleaning , injection and sterilizing before and after the education . before education
, no significant differences were observed between the two groups in the three skills of cleaning ( p = 0.251 ) , injection ( p = 0.185 ) , and sterilizing ( p = 0.568 ) ( table 2 ) .
the students mean scores significantly increased after the education and the difference between pre and post intervention of the students mean scores were significant in the both groups at < 0.001 .
however , after education , in all three skills , the mean scores of the intervention group were significantly higher than the control group ( p < 0.001 ; table 2 ) .
to the best of our knowledge , this was the first study comparing the effect of concept mapping and traditional methods of skill teaching on nursing students learning in practical skills .
the study revealed that both methods could significantly increase the mean score of students at posttest
. however , students posttest mean scores were significantly higher in the group taught via concept mapping method .
our finding on positive effect of concept mapping on learning was in line with some previous studies such as van bon - martens ( 24 ) , gul and boman ( 25 ) and magnussen ( 26 ) , harrison and gibbons ( 27 ) , and gonzalez et al .
though not on psychomotor domain , all of these studies confirmed that concept mapping is superior to conventional methods in enhancing students learning in the cognitive domain .
although both teaching methods used in this study could enhance students learning , nurse teachers are responsible to find , develop and implement more effective methods on students learning
. this fact would be more important in the psychomotor domain that is more pertinent to patients safety and the quality of nursing services .
therefore , it is suggested to integrate concept mapping as an effective method in our conventional methods of skill teaching .
inconsistent with our findings , hsu and hsieh reported that although concept mapping had some positive effects on learning , the effect was not statistically significant ( 14 ) .
however , our study and several previous investigations showed that concept mapping would be effective if appropriately implemented .
concept mapping shows concepts in a hierarchical format from general to detail , such as a pyramid structure of information in long - term memory .
therefore , concepts learned via this way can remain for a long - term and increase learning significantly ( 9 ) .
concept mapping also allows students to understand the errors in theirs understanding of concepts and then would increase their motives to correct such errors ( 28 ) .
concept mapping combines the problem - oriented learning , critical thinking , self - directing learning and enhances students performance in the training group ( 29 ) .
scahill et al . also reported that concept mapping improves students learning and academic achievement with a positive effect on their attitudes ( 30 ) .
when a concept map is drawn by the students , they integrate their new knowledge with what they have learned previously .
this method may help students to easily classify their knowledge , make them coherent to make a deeper understanding .
this would assist students reaching higher levels of cognitive learning rather than memorizing a series of concepts .
this study showed that concept mapping was superior to conventional skill teaching methods . considering the results of this study ,
it is suggested to use concept mapping in teaching practical courses such as fundamentals of nursing .
to this end , nurse teachers should be trained to integrate concept mapping in their teaching and learning activities .
however , the nature of each course , instructor s mastery and types of learners can affect selecting teaching method .
this study was implemented in a small sample and compared the concept mapping with conventional methods .
therefore , it is suggested to perform studies using concept mapping in other practical courses in nursing and to compare it with other active teaching methods . in this study ,
the effect of intervention was assessed in the skill center not in the real clinical setting . therefore , investigating the effect of concept mapping on students competencies in real clinical setting is suggested .
Output:
| background : development of practical skills in the field of nursing education has remained a serious and considerable challenge in nursing education . moreover , newly graduated nurses may have weak practical skills , which can be a threat to patients safety.objectives:the present study was conducted to compare the effect of concept mapping and conventional methods on nursing students practical skills.patients and methods : this quasi - experimental study was conducted on 70 nursing students randomly assigned into two groups of 35 people .
the intervention group was taught through concept mapping method , while the control group was taught using conventional method .
a two - part instrument was used including a demographic information form and a checklist for direct observation of procedural skills .
descriptive statistics , chi - square , independent samples t - tests and paired t - test were used to analyze data.results:before education , no significant differences were observed between the two groups in the three skills of cleaning ( p = 0.251 ) , injection ( p = 0.185 ) and sterilizing ( p = 0.568 ) .
the students mean scores were significantly increased after the education and the difference between pre and post intervention of students mean scores were significant in the both groups ( p < 0.001 ) .
however , after education , in all three skills the mean scores of the intervention group were significantly higher than the control group ( p < 0.001).conclusions : concept mapping was superior to conventional skill teaching methods .
it is suggested to use concept mapping in teaching practical courses such as fundamentals of nursing . |
PubmedSumm119636 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: retinoblastoma is the most common intraocular tumor of childhood and accounts for 11% of all cancers that occur during the first year of life ( 1 ) . because treatments for retinoblastoma cure over 90% of patients , organ and vision preservation and the minimization of late treatment side - effects are important secondary treatment goals .
retinoblastoma had been treated by external beam radiotherapy ( ebr ) , and for many years this was the accepted treatment standard ( 2 - 7 ) .
however , greater knowledge of radiation induced morbidities and of secondary tumor risks after radiation therapy ( 8 , 9 ) have encouraged the use of primary chemotherapy plus conservative focal therapy over the past decade . despite the recent trend toward chemoreduction ( 10 - 13 ) , radiotherapy remains an excellent means of preserving vision in children ( aged > 1 yr ) with retinoblastoma , because the tumor is radiosensitive and routinely responds to radiotherapy .
moreover , technologic advances made in the radiation oncology enable more precise targeting for tumor , avoiding healthy tissues , and the risks of secondary nonocular cancer reduced .
brachytherapy ( 14 - 16 ) has been used for selected cases in expert hospitals , and stereotactic conformal radiotherapy ( 17 - 19 ) , and proton therapy ( 20 , 21 ) could also be considered components in the modern radiotherapy armamentarium for retinoblastoma .
however , available clinical data for stereotactic conformal therapy and proton therapy is limited . the korea cancer center hospital ( kcch ) has considerable experience of treating retinoblastoma in korea , and thus , we retrospectively reviewed our experiences of treating retinoblastoma patients with ebr , as initial treatment , to determine its long - term effects on subsequent tumor control , and its associated complication rates and prognostic factors .
in addition , we reviewed ebr and brachytherapy clinical data in the hope of providing guidelines regarding indications for radiation therapy in patients with retinoblastoma .
the medical records of all patients diagnosed as retinoblastoma who received ebr as an initial treatment at the kcch between july 1987 and june 1998 , were reviewed .
a total of 36 eyes in 29 patients with intraocular retinoblastoma underwent ebr as an initial treatment .
of these , 4 patients were excluded due to a short follow - up duration ( <3 yr ) .
patient details and data concerning tumor features , treatment parameters , and complications were collected by chart review .
briefly , the study subjects were 21 boys and 4 girls of median age at treatment commencement of 7.1 months ( range 7 weeks to 65 months ) .
the most frequent presenting finding was leukocoria in 16 patients ( 64% ) followed by strabismus in 6 ( 24% ) .
for the 21 patients with bilateral involvement , 28 eyes received external beam radiation , and 14 eyes were enucleated due to advanced disease without visual potential before ebr . of the 32 eyes
treated , 0 were of reese - ellsworth ( re ) group i , 5 were group ii , 16 were group iii , 4 were group iv , and 7 were group v ( 5 in re group va and 2 in re group vb ) .
treatment simulation was done for with patients under sedation while wearing a thermoplast head mask immobilization device .
all patients were treated in the supine position using a linear accelerator at a photon energy of 6 mv with compensating bolus as needed .
twenty patients ( 27 eyes ) were treated using opposed lateral fields alone ( mainly patients with bilateral disease ) , while five patients ( 5 eyes ) were treated using anterior and lateral wedged pair fields with no attempt to shield the lens . the most frequently used field size ( excluding half beam blocking ) was 44 cm , but field sizes ranged from 33.5 cm to 64 cm .
treatment doses ranged from 35 to 59.4 gy ( median 41.6 gy ) in fractions of 1.6 to 2.0 gy .
chemotherapy was usually administered for high stage contralateral tumors that had been enucleated to control microscopic tumors .
twenty - two patients received cyclophosphamide plus vincristine with or without doxorubicin at various doses and cycle numbers .
enucleation was performed in cases with definite tumor progression after additional treatment or due to a severe complication .
evaluations were performed at each follow - up to determine tumor sizes and visual acuities , and to detect new lesions and complications , such as , retinopathy , cataract , neovascular glaucoma , and midfacial hypoplasia .
in addition , we analyzed prognostic factors , such as , gender , age , and the re classification according to ocular survival using the log - rank test .
in addition , the relationship between re classification and visual acuity was analyzed using the t - test .
overall survival was calculated from ebr commencement to final follow - up or death , whereas ocular survival was calculated from ebr commencement to time of enucleation or final follow - up with an intact eye .
the medical records of all patients diagnosed as retinoblastoma who received ebr as an initial treatment at the kcch between july 1987 and june 1998 , were reviewed .
a total of 36 eyes in 29 patients with intraocular retinoblastoma underwent ebr as an initial treatment .
of these , 4 patients were excluded due to a short follow - up duration ( <3 yr ) .
patient details and data concerning tumor features , treatment parameters , and complications were collected by chart review .
briefly , the study subjects were 21 boys and 4 girls of median age at treatment commencement of 7.1 months ( range 7 weeks to 65 months ) .
the most frequent presenting finding was leukocoria in 16 patients ( 64% ) followed by strabismus in 6 ( 24% ) .
for the 21 patients with bilateral involvement , 28 eyes received external beam radiation , and 14 eyes were enucleated due to advanced disease without visual potential before ebr . of the 32 eyes
treated , 0 were of reese - ellsworth ( re ) group i , 5 were group ii , 16 were group iii , 4 were group iv , and 7 were group v ( 5 in re group va and 2 in re group vb ) .
treatment simulation was done for with patients under sedation while wearing a thermoplast head mask immobilization device .
all patients were treated in the supine position using a linear accelerator at a photon energy of 6 mv with compensating bolus as needed .
twenty patients ( 27 eyes ) were treated using opposed lateral fields alone ( mainly patients with bilateral disease ) , while five patients ( 5 eyes ) were treated using anterior and lateral wedged pair fields with no attempt to shield the lens .
the most frequently used field size ( excluding half beam blocking ) was 44 cm , but field sizes ranged from 33.5 cm to 64 cm .
treatment doses ranged from 35 to 59.4 gy ( median 41.6 gy ) in fractions of 1.6 to 2.0 gy .
chemotherapy was usually administered for high stage contralateral tumors that had been enucleated to control microscopic tumors .
twenty - two patients received cyclophosphamide plus vincristine with or without doxorubicin at various doses and cycle numbers .
enucleation was performed in cases with definite tumor progression after additional treatment or due to a severe complication .
evaluations were performed at each follow - up to determine tumor sizes and visual acuities , and to detect new lesions and complications , such as , retinopathy , cataract , neovascular glaucoma , and midfacial hypoplasia .
in addition , we analyzed prognostic factors , such as , gender , age , and the re classification according to ocular survival using the log - rank test .
in addition , the relationship between re classification and visual acuity was analyzed using the t - test .
overall survival was calculated from ebr commencement to final follow - up or death , whereas ocular survival was calculated from ebr commencement to time of enucleation or final follow - up with an intact eye .
median follow up was 150 months ( range 55 - 249 months ) , and the 10-yr ocular and overall survival rates were 75.4% and 92.3% , respectively ( fig .
of these , 7 eyes were enucleated and 2 were salvaged by cryotherapy and laser treatment ( table 1 ) .
one additional enucleation was performed due to phthisis bulbi ( patient no . 2 in table 1 ) .
therefore , ocular preservation was achieved in 24 of the 32 ( 75.4% ) eyes .
according to re classification , 4 of 5 eyes were retained in group ii , 13 of 16 in group iii , 2 of 4 in group iv , and 5 of 7 in group v. vision was preserved in 24 ( 75% ) out of 32 treated eyes . of the preserved 24 eyes , 9 ( 37.5% ) had a visual acuity better than 20/40 ; 5 ( 20.8% ) had an acuity worse than 20/40 but better than 20/200 , and 10 ( 41.7% ) had vision worse than 20/200 .
all the patients with visual acuity less than 20/200 presented with the involvement of the posterior pole , and showed macular degeneration following treatment .
records showed that 11 patients experienced a radiation - induced complication ; 6 had cataracts alone , 1 had retinal detachment alone and 4 had one more complications ( table 1 ) .
nine cataracts were recorded and removed when necessary , and vision restoration or improvement was achieved in all cases .
the median time to cataract development was 5 yr and 9 months ( range 13 to 125 months ) .
serous retinal detachment was detected in 3 eyes ; 2 were transient and reattached after 3 months and 6 months respectively .
an age of less than 13 months was found to be a significantly favorable factor of ocular survival by univariate analysis , but this was not confirmed by multivariate analysis .
no other prognostic factor was identified during this study ( table 2 ) , and in particular , no significant relationship was found between re classification and visual acuity .
ebr has a valuable role in the treatment of retinoblastoma , but radiation - induced secondary tumors jeopardize the role played by ebr in retinoblastoma .
large - scale cohort studies performed to quantify cancer risks in retinoblastoma treated by radiotherapy ( 9 ) have found that radiotherapy contributed significantly to the risks of developing brain , nasal cavity , and eye and orbit cancers .
notably , the risk of cancer of the nasal cavity increased by 1,364-fold in hereditary retinoblastoma treated by ebr .
external beam radiation is usually favored for the treatment of bilateral retinoblastoma , which is almost always hereditary , and thus , all possible efforts should be made to reduce the risk of secondary malignancies after radiotherapy .
a review of ebr technology revealed that the lateral field is usually used because it requires lower lens doses ( 2 - 7 ) . in most cases ,
however , reductions in doses administered to the orbital cavity , optic nerve , or cranial bone appear to be more important . recently , more meticulous techniques , such as , intensity modulated radiation therapy ( imrt ) and stereotactic hypofractionated radiation therapy , have been introduced , which administer lower doses of radiation to critical organs .
reisner et al . ( 7 ) compared several ebr techniques , that is , electron beam , the lateral 2 field and anterior - lateral 2 field techniques , and imrt , and found that imrt had an advantage over the other techniques , because it allowed greater dose reductions to the orbit and lacrimal gland , while maintaining therapeutic doses to the ora serrata retinae and vitreous .
recently , sahgal et al . ( 18 ) reported that stereotactic fractionated radiation therapy for localized tumor masses can achieve markedly lower doses to surrounding critical normal tissues than conventional radiation therapy .
furthermore , proton therapy ( 20 , 21 ) is also likely to reduce cranial bone radiation dose due to the radiation quality of the bragg peak .
brachytherapy ( 14 - 16 ) was introduced in the 1920 's to treat ocular tumors and reduce the exposure to normal tissue around tumors , and has been further developed in terms of new radioisotopes , implant designs , and techniques of placement .
table 3 details the ocular survival and cataract incidence rates of conventional radiation therapy techniques and brachytherapy ; it is worth noting that the radiation doses , fraction numbers , and beam delivery techniques used at different institutes over the last 20 yr has varied considerably .
the literature review revealed that ocular survival ranged from 38% to 84% ( median 73% ) for ebr , but from 60% to 95% ( median 79% ) for brachytherapy .
furthermore , radiation - induced cataract was found to be the most common complication of radiation therapy ; the incidence of cataract ranged from 22% to 41% ( median 28% ) for ebr and from 10% to 43% ( median 17% ) for brachytherapy .
however , it should be noted that because retinoblastoma is rarely encountered in infants , skilled treatment is required to obtain good outcomes after ebr and brachytherapy in the present study , we analyzed patient and ocular survivals , and long - term treatment toxicities .
our results , in terms of ocular survival and the incidence of cataract , compare well with those of other ebr series ( 22 - 25 ) .
long - term follow - up findings revealed that late radiation effects were milder than expected , and that favorable visual outcome had been maintained .
furthermore , ocular survival analysis by re classification , despite the limitations imposed by small patient numbers , showed that involved eyes with an re classification of 4 or 5 achieved 64% ocular survival , which indicates that radiation therapy should be considered before enucleation as primary or secondly treatment for even advanced retinoblastoma . in conclusion ,
our long - term results show that ebr has an important role to play in the avoidance of enucleation in retinoblastoma with small lesions or advanced lesions with vitreous seeding .
furthermore , non - conventional radiation therapies as brachytherapy , stereotactic radiotherapy , imrt , and proton therapy , are likely to reduce complication rates .
additional research is required to establish new indications for the various radiation therapy techniques available for the treatment of retinoblastoma .
Output:
| the authors reviewed their experiences of external beam radiotherapy ( ebr ) as an initial treatment in retinoblastoma patients to determine its long - term effect on subsequent tumor control and complications .
a total of 32 eyes in 25 patients that underwent ebr for retinoblastoma were reviewed retrospectively .
the patients consisted of 21 boys and 4 girls of median age at treatment of 7.1 months .
radiation doses ranged from 35 to 59.4 gy .
the 10-yr ocular and patient survivals were 75.4% and 92.3% , respectively .
nine of the 32 eyes progressed ; 7 of these were enucleated and 2 were salvaged by focal treatment . according to the reese - ellsworth classification , 4 of 5 eyes of group ii , 13 of 16 group iii eyes ,
2 of 4 group iv eyes , and 5 of 7 group v eyes were retained , and of the 32 eyes , 13 had visual acuity better than 20/200 .
eleven patients experienced a radiation - induced complication .
no patient developed a second malignancy during follow - up . despite the limited number of patients enrolled
, ebr may provide a mean of preserving eyeball and vision for some advanced lesions . |
PubmedSumm119637 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: vascular complications include hematoma , pseudoaneurysm , arteriovenous ( av ) fistula , thromboembolism , arterial laceration and infection3,4,9 ) .
it is important to know the risk of complications and how to avoid possible causes that may cause such problems .
the presence of an accessory renal artery is not uncommon variation , and this could function as the cause of unusual renal subcapsular hematoma .
a 54-year - old female was admitted to our hospital for the evaluation of unruptured cerebral aneurysm . she had a 5-year history of diabetes mellitus and hypertension .
eighteen months earlier , she had chest pain and underwent transfemoral cardiac angiogram at a different institute . since then , she had been taking aspirin 100 mg under the diagnosis of angina .
she was diagnosed as having multiple aneurysms in both the anterior communicating artery and in the paraclinoid portion of the internal carotid artery .
her blood pressure was 90/60 mm hg and the body temperature was 36.4. on physical examination , the abdomen was soft but tender on the left upper quadrant .
laboratory findings were white blood cell 6100/mm , hb 10.8 g / dl , platelets 174000/mm .
abdominal ct showed a left renal subcapsular hematoma in the lower pole portion ( fig .
six months later , her 64-cut multislice ct scan showed complete regression of the subcapsular hematoma ( fig .
2 ) . interestingly , in her three - dimensional angiogram , small accessory renal arteries supplying the lower pole of the kidney were found at both sides ( fig .
diagnostic cardiac angiography with transfemoral catheterization has 1 - 2% risk of major complications5 ) .
hematomas are usually located in the femoral puncture site , retroperitoneal space , intraperitoneal region , and abdominal wall3,4 )
. risk factors for cardiac catheterization hematoma formation are age older than 60 years , female , angioplasty instead of angiography alone , hypertension , thrombocytopenia , large - bore catheter size , operator inexperience , poor groin compression after sheath removal , high puncture site , peripheral vascular disease , and anticoagulant - thrombolytic therapy 3,4,9 ) .
neoplasm , bleeding tendency , vasculitis and infection are the causes of spontaneous bleeding . regarding iatrogenic causes , renal biopsy , extracorporeal lithotripsy , and anticoagulants are some sources .
the incidence of iatrogenic renal artery injury during the percutaneous transluminal angioplasty is about 6.5 - 22.8%1,3 ) .
stable wire position and j - shaped guide - wire could avoid these vascular injury1 ) .
there has been only one paper in english describing renal subcapsular hematoma after femoral artery catheterization3 ) . in that study
, they reported that calcified plaques in the aorto - renal junction may get dislodged during catheter or wire passage . after dislodging of plaques ,
renal subcapsular hematoma could form through the dissected vessel3 ) . typically , renal arteries branches at the level of the upper margin of the second lumbar vertebral body , 1 cm below the origin of the superior mesenteric artery6,7 ) .
one or two accessory renal arteries are found in about 23% , especially on the left side6,7,8 ) .
bilateral multiple renal arteries are found in 10% of the population7,10 ) . in our case ,
3 ) . multidetector computed tomography is a very useful tool in most cases for the visualization of abdominal organs and vascular structures2,10 ) .
left accessory renal artery branches at the level of the lower margin of the third lumbar vertebral body and supplies the lower pole of the kidney .
we used the introducing wire that was straight shape and 45 cm long ( radifocus introducer ii , terumo co. , tokyo , japan ) for sheath placement .
in small height person , relatively short distance from puncture site to opening of accessory renal artery could be possible .
we used the 150-cm - long , 0.035-inch nitinol hydrophilic guide - wire with 45-degree angled , 3.0-cm soft tip ( radifocus guide wire m , terumo co. , tokyo , japan ) .
the possibility of injury in the proximal portion of the left accessory renal artery during the wire insertion for sheath placement or the guide - wire passage around the level of the lower lumbar vertebral body was considered .
the right femoral approach is the most commonly used access site for percutaneous angiography . in the case of the right side femoral approach , the left side accessory renal artery supplying the lower pole is prone to accidental damage .
usually the right side accessory renal artery is located more distal than left and should be careful in case of left femoral puncture ( fig .
the previous report also involved a case of left lower pole subcapsular renal hematoma . furthermore
, we were able to detect calcified plaques which might be located in the accessory renal artery supplying the lower pole of the kidney3 ) .
accessory renal arteries are not rare and easy to be injured at the level of the lower lumbar vertebral body .
careful guide - wire passage under full visual inspection is important to avoid inadvertent vascular injury during percutaneous angiography .
Output:
| vascular complications after percutaneous angiography include hematoma , pseudoaneurysm , arteriovenous fistula , thromboembolism , arterial laceration and infection .
hematomas may occur in the groin , thigh , retroperitoneal , intraperitoneal , or abdominal wall .
a 54-year - old female underwent percutaneous transfemoral angiography for the evaluation of cerebral aneurysm .
renal subcapsular hematoma developed 3 hours after the procedure .
renal subcapsular hematoma after percutaneous angiography is very rare .
we investigated the possible causes of renal subcapsular hematoma . to avoid this rare complication ,
we need to perform guide - wire passage carefully from the beginning of the procedure under full visual monitoring . |
PubmedSumm119638 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: world health organization ( who ) estimated that over 237 million people required treatment for schistosomiasis in 2010 with estimates of up to an additional 779 million at risk globally .
schistosomiasis is endemic in 76 countries worldwide and besides malaria is the second important parasitic disease for public health .
of the 662 million people infected worldwide , 85% are from africa . in tanzania , schistosomiasis is highly endemic , and its prevalence varies from one region to another , with a prevalence of up to 80% in highly endemic areas .
intestinal schistosomiasis is caused by schistosoma mansoni , and infections are acquired by contact with freshwater containing parasite larvae .
the disease is hyper - endemic in the great lake regions of east africa , owing to the favorable habitat for snails of the biomphalaria genus , which are the intermediate host .
recent studies around lake victoria indicated that the prevalence in schoolchildren vary widely [ 8 - 12 ] .
found that 14% of 1-year - old children along the kenyan shores of lake victoria were s. mansoni positive , whereas odogwu et al . found a prevalence of 47.4% in children <3 years of age around lake victoria in uganda
the prevalence in school - aged children in these areas could be as high as 86 - 90% .
in children , schistosomiasis normally presents with generalized , non - specific signs and symptoms , making it difficult to identify disease - specific morbidity indicators and challenging to develop tools for assessing those indicators . over time
, morbidity may progress from subtle manifestations such as anemia , to severe , debilitating , and irreversible conditions such as growth stunting , impaired cognitive development , increased susceptibility to co - infection , decreased quality of life , exercise intolerance , infertility , portal hypertension , and liver failure [ 16 - 22 ] . who estimated that more than a billion people are chronically infected with soil - transmitted helminths ( sths ) .
ascaris lumbricoides , hookworms ( ancylostoma duodenale and necator americanus ) , and trichuris trichiura are the most common sth species with global prevalence of about 1,000 , 900 - 1,300 , and 500 million people , respectively [ 24 - 26 ] . as such , sth infections are still considered to be the most prevalent infections of mankind . nowadays
, sth has been classified among the most prevalent neglected tropical diseases ( ntds ) as they persist exclusively in the poorest populations .
findings from a study done among schoolchildren in a lake victoria shore line ward in tanzania showed that the prevalence of hookworms was the second to intestinal schistosomiasis . in kenya , the prevalence of sths is prominently attributed to a. lumbricoides , hookworms , and t. trichiura .
hookworm infections observed in the lake basin in both tanzania and kenya were similarly high , ranging from 37.0 - 42.5% . other studies in magu district , tanzania , reported a prevalence of ascariasis of < 1% , and handzel et al . reported in kenya 's nyanza province the prevalence of 22.9% and 17.9% for a. lumbricoides and
possible factors associated with sth infections among the studied children included age ( school - age ) , absence of toilet and piped water supply in the household , large family size ( 7 members ) , and not washing hands before eating and after defecation .
although helminths can infect all members of a population , there are specific groups who are more vulnerable and at a greater risk of infection . for schistosomes and sths ,
the most vulnerable groups are preschool children , school - aged children , and women of child - bearing age , including adolescent girls although much of the morbidity associated with infection can be reversed with the use of effective anthelmintic drug treatments .
preschool children and school - aged children including adolescents tend to harbor the greatest numbers of intestinal worms and schistosomes and as a result experience growth stunting and diminished physical fitness as well as impaired memory and cognition .
these adverse health consequences combine to impair childhood educational performance , reduce school attendance , with hookworms being well - known causes of anemia because of intestinal blood loss .
chemotherapy with praziquantel ( pzq ) is currently the mainstay of control , which is available at a low cost .
moreover , due to their geographical overlap between schistosomes and sth infections , they could be simultaneously treated with 2 drugs , albendazole and praziquantel . as such , the successful sth control programmes
have enormous benefits of improved nutritional and health status of the children , higher educational attainment , labor force participation , productivity , and income among the most vulnerable populations [ 42 - 44 ] .
an added externality is the impact that ntds have on hiv / aids , tuberculosis , and malaria .
several recent papers highlight the immunosuppressive features of helminths ( especially the sths , schistosomes , and filariae ) and their possible impact on promoting susceptibility to the big 3 diseases .
new data suggest that control of ntds could become a powerful tool for combating hiv / aids , tuberculosis , and malaria .
this paper presents data using a rapid assessment methodology to examine the prevalence of schistosomiasis and sth infections in schools around the tanzania perimeter of lake victoria .
the study area is located on the northwest of tanzania around lake victoria ( fig .
1 ) . it stretches from the southwest of the lake through south to the eastern side .
the area is comprised of kagera , mwanza , mara on the lake shore , and shinyanga about 60 km away from the lake .
the study area is bordered by uganda and rwanda in the north and west , respectively .
it is also bordered by tabora and manyara regions in the south and east , respectively .
the main ethinic groups are ; wahaya and wasubi in kagera region , wasukuma , wazinza , and wasumbwa in mwanza region , wajita , wakurya , and waluo in mara region , and again wasukuma and wasumbwa in shinyanga region .
much of the activities have a bearing to schistosomiasis and sth infections as they performed without protective gear in the area where the level of sanitation and hygiene is as low as in any poor resource settings
. collection of stool and urine specimens was done at the selected schools . each child
was given 1 stool container and 1 urine container on the first day and asked to bring the urine and stool specimens .
the smears were examined for hookworms and other helminth eggs or larvae within 1 hr after preparation in order to capture hookworm eggs before they hatch .
the egg counts on each of the 2 slides were added together and divided by 2 to get the mean number of egg counts for the 2 slides .
urine samples were collected after 10.00 a.m. to diagnose s. haematobium based on detection of eggs using the filtration technique .
urine samples were mixed thoroughly and 10 ml were drawn using a syringe and passed through the membrane where eggs were logged .
examination was done on site where detected eggs were counted and expressed as the number of eggs per 10 ml of urine .
data entry was done using dbase iv ( borland international , scotts valley , california , usa ) , and a double entry system was used for quality control .
data were transferred to stata version 8 software ( statacorp 2000 , college station , texas , usa ) for analysis .
analysis was done by generation of some frequency tables , cross tabulations , and calculation of the prevalence .
the ethical and scientific clearance was obtained from the medical research coordinating committee of the national institute for medical research before the implementation of the study .
the study team visited villages and schools where community leaders and teachers were respectively met and the objectives , procedure , and potential harm and benefits of the study were explained to them .
the leaders in turn convened meetings of the community members , and the same was explained to them before the consent to participate in the study was sought .
any participant would be free to withdraw from the study at any time of the study period when he or she felt to do so .
the decision to refuse or withdraw from the study would have no negative effect on the benefits provided during and after the study .
all subjects who would be found infected with schistosomes and intestinal helminths were treated following standard treatment guidelines using praziquantel and albendazole tablets .
participants were informed that information will be confidentially kept using code numbers instead of names of participants .
the study area is located on the northwest of tanzania around lake victoria ( fig .
1 ) . it stretches from the southwest of the lake through south to the eastern side .
the area is comprised of kagera , mwanza , mara on the lake shore , and shinyanga about 60 km away from the lake .
the study area is bordered by uganda and rwanda in the north and west , respectively .
it is also bordered by tabora and manyara regions in the south and east , respectively .
the main ethinic groups are ; wahaya and wasubi in kagera region , wasukuma , wazinza , and wasumbwa in mwanza region , wajita , wakurya , and waluo in mara region , and again wasukuma and wasumbwa in shinyanga region .
much of the activities have a bearing to schistosomiasis and sth infections as they performed without protective gear in the area where the level of sanitation and hygiene is as low as in any poor resource settings .
was given 1 stool container and 1 urine container on the first day and asked to bring the urine and stool specimens .
the smears were examined for hookworms and other helminth eggs or larvae within 1 hr after preparation in order to capture hookworm eggs before they hatch .
the egg counts on each of the 2 slides were added together and divided by 2 to get the mean number of egg counts for the 2 slides .
urine samples were collected after 10.00 a.m. to diagnose s. haematobium based on detection of eggs using the filtration technique .
urine samples were mixed thoroughly and 10 ml were drawn using a syringe and passed through the membrane where eggs were logged .
examination was done on site where detected eggs were counted and expressed as the number of eggs per 10 ml of urine .
data entry was done using dbase iv ( borland international , scotts valley , california , usa ) , and a double entry system was used for quality control .
data were transferred to stata version 8 software ( statacorp 2000 , college station , texas , usa ) for analysis .
analysis was done by generation of some frequency tables , cross tabulations , and calculation of the prevalence .
the ethical and scientific clearance was obtained from the medical research coordinating committee of the national institute for medical research before the implementation of the study .
the study team visited villages and schools where community leaders and teachers were respectively met and the objectives , procedure , and potential harm and benefits of the study were explained to them .
the leaders in turn convened meetings of the community members , and the same was explained to them before the consent to participate in the study was sought .
any participant would be free to withdraw from the study at any time of the study period when he or she felt to do so .
the decision to refuse or withdraw from the study would have no negative effect on the benefits provided during and after the study .
all subjects who would be found infected with schistosomes and intestinal helminths were treated following standard treatment guidelines using praziquantel and albendazole tablets .
participants were informed that information will be confidentially kept using code numbers instead of names of participants .
a total of 5,848 schoolchildren from 36 selected schools in the 4 regions of the lake victoria basin in tanzania were recruited for the study ( table 1 ) .
the same numbers of girls and boys aged between 7 and 16 years from class 1 to 7 were selected for the study .
intestinal schistosomiasis caused by s. mansoni was prevalent in 3 regions of kagera , mwanza , and mara .
urogenital schistosomiasis caused by s. haematobium was found in children from 3 regions of mwanza , mara , and shinyanga but not in kagera . among the 3 regions , the highest prevalence ( 16.7% )
the mean prevalence of both schistosomiasis and sths in all regions ranged from low to moderate ones ( table 1 ) . in kagera region
, all the common intestinal helminths , namely s. mansoni , a. lumbricoides , t. trichiura , and hookworm infections were prevalent ( table 2 ) .
bwina primary school in chato district recorded an extremely high prevalence of intestinal schistosomiasis of 86.5% followed by bunena in bukoba urban district with a prevalence of 16.8% , and other schools had a prevalence of less than 10% .
the highest prevalence was 71.4% at runazi school followed by kiziramuyaga 59.5% and bwanga 37.9% ( table 2 ) .
the prevalence of ascariasis was the highest at buzirayombo 33.3% , followed by bwanga 28.4% , bunena 25.6% , and kyenshama 25.6% ( table 2 ) .
the prevalence of trichuriasis in the region was relatively low with a mean of 1.5% where kiziramuyaga had the highest prevalence of 7.1% . in mwanza region ,
3 helminth species detected included s. mansoni , s. haematobium , and hookworms ( table 3 ) .
the highest prevalence of s. mansoni infection was recorded at nyamikoma primary school that registered 79.2% , followed by bungonya 63.1% and nyakaliro 63.0% ( table 3 ) .
bungonya primary school had the highest prevalence of hookworms of 36.9% followed by mwaginghi 34.0% and nyamikoma 21.3% .
the highest prevalence ( 32.2% ) of urogenital schistosomiasis was at bugogo primary school ( 32.3% ) , and mwaginghi and kigongo were the second with a prevalence of both 28.0% .
lumeji was the fourth with 21.3% prevalence while the rest of schools had prevalence less than 10% ( table 3 ) .
the distribution of schistosomiasis and sths in mara region was low relative to other regions ( table 4 ) .
s. mansoni was highly prevalent at mwisenge 36.1% , nyamitwebili 30.2% , gamasara 15.9% , and minigo 11.7% .
the prevalence was the highest ( 27.2% ) at guta a school followed by minigo 11.7% and bulamba 2.7% .
the prevalence of hookworms in mara region ranged from 2.4% at mwisenge to 19.3% at minigo primary school .
the prevalence of trichuriasis was the lowest of all the helminths in region . in shinyanga region ,
the highest prevalence ( 30.3% ) was noted at luhumbo school in shinyanga rural district seconded by 24.8% at songwa primary school in kishapu district .
intestinal schistosomiasis was not noted in the whole study areas , whereas the hookworm prevalence was low ; ranging from 0% at songwa school to 17.1% at bukomela school .
no ascariasis nor trichuriasis cases were noted at any of the schools in shinyanga region .
the results showed that generally the prevalence of s. mansoni , s. haematobium , and sths are considerably high in the study areas .
. however , the prevalence of s. mansoni in kagera region is very low with the exception of a few pockets in chato district which is currently in geita region .
this could be attributed to the fact that lake shores in kagera region are open instead of bays when wind blows make the waves splash the shores making the place an unconduncive habitat for snail intermediate hosts . moreover ,
some of the shores in kagera region are formed by escarpments thus deep and less habitable by the snails .
the situation is quite different from shores in chato district which is a bay thus most of its shores are not susceptible to strong winds .
the distribution of s. haematobium and s. mansoni along lake victoria is largely related to the distribution of the intermediate hosts . along the shore of the lake , members of the genus biomphalaria , the intermediate host for s. mansoni , are common with populations living along the lake shores and islands being highly affected by s. mansoni as the risk of infection increases .
apart from the fact that schistosomiasis is focal , the noted high prevalence of the disease in this district could be attributed to the presence of bays that experience less speedy winds and strong waves to the shores making the place unconduncive habitat for snails .
the highest prevalence of s. mansoni at bwina primary school in kagera region could be attributed to the location of the study site .
bwina ward is a thin peninsular with an average width of less than 2 km . as such ,
most of the area is surrounded by lake victoria water that is inhabited by biomphararia species .
bwanga and kiziramuyaga localities are close to the lake area that has small bays that are conduncive areas for the snail hosts
. the absence of urogenital schistosomiasis in kagera region could be due to the absence of ponds and streams , and the fact that no paddy cultivation is practiced in this area .
the prevalence of sth infections in kagera region was relatively higher than that in other regions .
this could be due to the difference in natural vegetations and gardens as a result of rain variations .
kagera is sunny and warm most of the year with cool evenings and rains occuring almost every morning from march through may .
sths are highly affected by surface temperature , altitude , soil type , and rainfall .
this has an implication of the region having the best breeding ground of sths as well as more people consuming semicooked vegetables that may carry helminth eggs . in mwanza region ,
the distribution of s. mansoni was similar to that of mara with more happenings close to the lake and s. haematobium on the hinterland .
the high prevalence of intestinal and urogenital schistosomisiasis in the study area was a function of the distance from lake victoria , the former being more prevalent at localities close to the lake , whilist the latter is more so away from it [ 52 - 54 ] .
moreover , in areas where the prevalence of s. haematobium was high , there was a significant prevalence of hookworms .
the findings are in line with other studies in magu district in mwanza region [ 10 - 12 ] .
the spatial distribution of s. haematobium is in accordance to the presence of ponds and streams as well as the wetness and warmth of the soil that are prerequisites for proliferation of the 2 helminths .
we could not easily establish why there were no ascaris or trichuris infections in mwanza and shinyanga regions that are situated in the middle of the study area .
difference in soil structure and texture as well as climate among the regions could be the reasons for the difference .
kagera region on the west bordering southern uganda and mara region on the west which borders western kenya have similar prevalence of the sths as compared to mwanza and shinyanga regions .
the prevalence of hookworm infections , 34% at mwaginghi in kwimba district , and 21.7% at nearby nyamikoma location in magu district , was similar to an ealier report in the same area . despite the fact that mara region is closer to the western province in kenya with similar types of sth infections
this study recoded a mean regional prevalence ranging from 1% to 8% whereas studies in kenya s nyanza province reported the prevalence of 22.9% and 17.9% for a. lumbricoides and t.
the high prevalence of intestinal schistosomiasis at mwisenge and nyamitwebili schools were associated with their being very close to the lake shore .
the high prevalence of urogenital shistosomiasis at guta a and minigo could be ascribed to paddy fields , that are good habitats for the snail intermediate host of s. haematobium , that were enormous in the sourounding areas . in mara region ,
moreover , in areas where schistosomiasis was high , there was a significant prevalence of hookworms .
this association was reported elsewhere ; these findings are in line with that from magu district in mwanza region and in western kenya .
as expected , the prevalence of intestinal schistosomiasis was extremely low in shinyanga region that is more than 150 km away from the lake but had the highest prevalence of urogenital schistosomiasis .
the results showed that schistosomisasis and 3 sths infections are co - endemic in lake victoria basin in tanzania with a high probability of polyparasitism in the study participants .
the prevalence of s. mansoni , s. haematobium , and sths ranged from low to moderate in most parts of the study area .
intestinal schistosomiasis was prevalent along the lake victoria shores and decreased with distance from it .
conversely , the prevalence of urogenital schistosomiasis increased with distance from the lake . from the study findings
this could be given in a participatory manner so that each member gets engaged in the learning process especially through peer educators .
second , study teams need to conduct regular research in order to control incidence and reinfection rates in the area by carrying out regular treatment exercises .
third , community - based provision of adequate safe water supply and sanitation facilities are imperative .
water supply could be done through construction / drilling of wells at each sub - village , institutions , and health facility .
Output:
| the objectives of this study was to conduct a survey on schistosomiasis and soil - transmitted helminth ( sth ) infections in order to come up with feasible control strategies in lake victoria basin , tanzania .
depending on the size of the school , 150 - 200 schoolchildren were recruited for the study .
duplicate kato - katz stool smears were prepared from each child and microscopically examined for schistosoma mansoni and sths .
urine specimens were examined for schistosoma haematobium eggs using the filtration technique .
after the survey , mass drug administration was done using praziquantel and albendazole for schistosomiasis and sths infections , respectively .
a total of 5,952 schoolchildren from 36 schools were recruited for the study and had their stool and urine specimens examined . out of 5,952 schoolchildren ,
898 ( 15.1% ) were positive for s. mansoni , 754 ( 12.6% ) for hookworms , 188 ( 3.2% ) for ascaris lumblicoides , and 5 ( 0.008% ) for trichuris trichiura .
out of 5,826 schoolchildren who provided urine samples , 519 ( 8.9% ) were positive for s. haematobium eggs .
the results revealed that intestinal schistosomiasis , urogenital schistosomiasis , and sth infections are highly prevalent throughought the lake basin .
the high prevalence of intestinal and urogenital schistosomisiasis in the study area was a function of the distance from lake victoria , the former being more prevalent at localities close to the lake , whilst the latter is more so away from it .
control of schistosomiasis and sths in the study area requires an integrated strategy that involves provision of health education to communities , regular treatments , and provision of adequate safe water supply and sanitation facilities . |
PubmedSumm119639 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: linkage analyses performed in the early 1990s and centered on early onset alzheimer s disease families identified the only fully penetrant mutations known to date to be involved in this disease .
three genes were found to carry these mutations : app , psen1 and psen2 ( amyloid beta ( a4 ) precursor protein , presenilin 1 , and presenilin 2 ) .
additionally , a strong risk factor was also identified through family studies : the e4 allele of apoe ( apolipoprotein e ) was found to increase the risk for alzheimer s disease in different populations [ 14 ] . after these findings
traditional approaches to the study of mendelian diseases relied on genetic linkage studies ( a powerful tool to detect the chromosomal location of disease genes which is based on the observation that genes that reside physically close on a chromosome remain linked during meiosis ) .
these studies involved large multi - generational pedigrees and needed the availability of multiple affected and unaffected individuals for testing . .
when such families were available , genetic markers would be used to determine which areas of the genome only the affected individuals shared .
this would provide evidence regarding the location of the causative gene , after which , dna sequencing , usually be means of the sanger method ( based on the selective incorporation of chain - terminating dideoxynucleotides by dna polymerase during in vitro dna replication ) would be performed to pinpoint the actual mutation .
although a powerful approach , that has yielded many substantive findings , genetic linkage studies have a number of drawbacks that limit its utility : 1 ) large pedigrees are , in many cases , not available for study , particularly for late - onset diseases , where older generations have often died and descendants have not yet reached the age at onset ; 2 ) the markers used to perform linkage , although dispersed throughout the genome , were usually in the hundreds , meaning that regions of linkage were very extensive and generally containing tens to hundreds of genes , having a clear impact on the costs of follow - up by sequencing ; 3 ) the amount of time required to study a single family using this approach was quite significant , usually several months to years .
more recently , the development of genome - wide genotyping and second - generation sequencing technologies has drastically changed the approaches used to study mendelian disorders .
diseases presenting an autosomal recessive pattern of inheritance are well suited for autozygosity analysis ( performed by high - density whole genome genotyping ) and whole exome sequencing . in some cases , diseases presenting an autosomal dominant pattern of inheritance can now be studied by analyzing the exome variability in one or two affected family members without the need for linkage analyses .
although linkage analyses will be valuable and in some cases essential , isolated exome sequencing analyses in small families with neurological diseases already resulted in many significant findings .
over 20 genetic loci with low risk effects for alzheimer s disease have been identified by gwas ( table 1 ) .
these studies assess common genetic variability at the genome level between large groups of cases and controls .
each of the loci identified contributes modestly to the risk of developing the disease , but new polygenic models are currently being investigated to try and establish more accurately who will develop alzheimer s disease .
common variant hypothesis of human disease ( for a description of gwas in human disease refer to ) and the identification of the specific variant(s ) and true effect(s ) on the development of ad can only be achieved with fine mapping and functional analyses of each locus .
it is also important to note that these loci seem to be part of a few biological pathways , indicating that these pathways , although it is currently not clear how , have an essential role in the pathobiological processes occurring in alzheimer s disease .
three main pathways can be identified : the immune system and inflammatory responses ; cholesterol and lipid metabolism ; and endosomal vesicle recycling [ 7 , 9 ] .
for instance , neuropathological analyses of ad brains and functional assays connecting the amyloid beta protein to the complement pathway activation have given consistent evidence of the involvement of several complement cascade factors in the pathogenesis of this disease [ 10 , 11 ] .
another example is sorl1 ( sortilin - related receptor with a - type repeats ) , which has been extensively studied in ad due to its role in app metabolism .
sorl1 modulation of the app metabolism partially occurs in the endosomal pathway as part of a unique regulatory pathway for the control of neuronal protein transport .
however , it has not been possible to undoubtedly associate variability in this gene to ad before the application of gwas to the study of late onset alzheimer s disease ( load - alzheimer s disease occurring after 65 years of age ) . over 15 case - control association studies of sorl1
have produced positive , negative and trend associations between genetic variability at this gene and the risk of ad in different populations ( alzgene assessed on april 2014 : http://goo.gl/xsrrl6 ) .
the initial gwas did not show a significant association between ad and the sorl1 locus .
a significant association was only established in the recent meta - analysis using data from more than 70,000 people .
the contradictory initial case - control reports may have been caused by different inclusion criteria used , with only cohorts tightly controlled for ethnicity achieving significance . also important to substantiate the association of this gene with ad was the identification of potentially pathogenic mutations in french early - onset ad ( eoad alzheimer s disease occurring before 65 years of age ) cases . in this
study the authors performed exome sequencing in 14 autosomal dominant eoad index cases without mutations on the known ad genes and identified sorl1 mutations in 5 patients ( 1 nonsense mutation and 4 missense ) , which were not found in healthy controls . in a replication sample , including 15 autosomal dominant eoad cases , they identified 2 other novel mutations resulting in a total of 7 mutations in 29 cases . although independent replications and segregation analyses are still needed , these results indicate a potential pathogenic causative effect of sorl1 mutations in ad .
the ability to sequence the whole genome , or more frequently , the whole exome of patients has led to a renewed interest in the study of mendelian forms of diseases and family studies .
consequently , the potential contribution of rare genetic variants with strong effects in complex phenotypes like alzheimer s disease is currently under analysis .
these technologies , when applied to a large enough number of cases and controls , also have the potential to identify moderate risk factors with lower allele frequencies in the population than the ones identified by gwas .
variants with rare / moderate allele frequencies usually confer a greater risk for disease when compared with common variants due to purifying selection : high - risk alleles contributing to early - onset diseases may reduce reproductive fitness and consequently be driven to low frequencies . even though high risk alleles are rare in the population , these can be very informative by implicating genes with strong etiologic and biological roles in disease .
these genes are usually the basis for functional genetic studies and considered important targets for the development of novel therapies [ 19 , 20 ] .
extended families are an extremely valuable asset for genetic studies since the same chromosomal segments recur in relatives .
when studying late onset disorders it is frequently difficult to identify such families and by studying a large number of these families it seems more and more plausible that no other fully penetrant dominant genes like app and the psens genes are to be found in alzheimer s disease . some of these families will likely have private mutations as the cause of their pathological processes .
by studying rare recessive diseases we have recently been able to uncover significant genetic factors involved in common disorders like alzheimer s and parkinson s diseases [ 21 , 22 ] . by performing autozygosity and exome sequencing analyses in turkish dementia families we identified trem2 homozygous mutations causing frontotemporal dementia .
trem2 had previously been associated with nasu - hakola disease , a rare autosomal recessive form of dementia presenting with bone cysts .
inbred ( and frequently isolated ) populations are ideal for the study of disease genetics .
inbreeding can increase the incidence of rare recessive disorders and isolated populations have an allelic load mostly derived from the alleles present in the population founders .
rare recessive alleles with an effect in disease risk or causation tend to be located within long genomic regions of homo - zygosity .
these long stretches of loss of heterozygosity can be easily assessed using snp arrays ( fig .
1 ) . this figure represents the results from an illumina infinium whole - genome genotyping assay as visualized in genomestudio .
it shows homozygosity mapping for three siblings ( two affected by dementia and one unaffected ) .
each blue dot represents one individual marker or single - nucleotide polymorphism ( snp ) . for each snp
, a low b allele frequency indicates that the individual is a homozygote for the a allele ; intermediate values mean they are a heterozygote and high b allele frequency means that they are a homozygote for the b allele .
this example shows a region of chromosome 4 ( vertical blue area ) in which the affected siblings present a large ( over 7 mb ) homozygous region that is not shared by the unaffected family member .
this finding suggests the possibility that a disease - causing homozygous mutation may be present in this genomic region .
this strategy combining autozygosity analysis with exome sequencing allowed us to identify trem2 mutations in cases presenting with an atypical phenotype to that previously associated with the gene .
the 3 cases we identified by exome sequencing would have never had the trem2 gene sequenced by standard methods because of the atypical presentation .
this clearly represents the power of whole - exome and whole genome sequencing in the establishment of molecular diagnoses .
the identification of mutations in genes previously associated with different phenotypes has been a consistent finding from the application of exome sequencing to neurological disorders .
these results are critical to the understanding of the biological processes underlying these diseases by uncovering shared pathways [ 2527 ] .
although load does not exhibit obvious recessive inheritance , recessive alleles may play a role as genetic risk components in this form of the disease .
an excess of runs of homozygosity and larger homozygous tracts have been reported in load cases when compared to controls [ 28 , 29 ] . in early - onset familial ad one mutation in app ( p.a673v ) has been reported to cause disease only in the homozygous state , whereas heterozygous carriers are unaffected , which is consistent with a recessive mendelian trait of inheritance .
the heritability for load is estimated to be between 62 and 81 % and for eoad between 92 and 100 % .
dominant causing mutations do not account for all this heritability and the belief that only highly penetrant dominant ad - causing mutations are in the basis of eoad is inconsistent with epidemiologic data that found apparent autosomal dominant transmission in approximately only 10 % of all eoad cases , leaving the majority of eoad unexplained .
we have previously used whole - genome genotyping arrays to study two siblings from an israeli family consisting of seven siblings from a first - cousin marriage . at the time of the clinical study the mother was 90 years old with mild gait difficulties but otherwise healthy , and particularly presenting no cognitive loss .
in this family we catalogued all the large regions of homozygosity shared between the two affected siblings and crossed this information with the genes known to have a possible role in ad .
we are currently applying exome sequencing to follow up on these results and pinpoint the mutation causing ad in this family .
other ad families presenting with apparent autosomal recessive patterns of inheritance are starting to be described in the literature and we expect the study of recessive alleles in ad to have significant results in the near future .
following from the fact that our initial application of exome sequencing to the study of neurological diseases consistently identified mutations in genes previously associated with different phenotypes . and particularly after the identification of trem2 homozygous mutations causing frontotemporal dementia , we extended the genetic analyses of this gene to other forms of dementia .
interestingly , when studying ad cases and controls we identified a heterozygous rare variant ( p.r47h ) that was significantly associated with an increased risk ( or>3 ) for the development of ad .
this was the first gene to be identified with a moderate risk effect on the disease since the association of the e4 allele of apoe was established for ad [ 22 , 34 ] .
taken together these results clearly show that the study of recessive forms of rare neurological diseases can not only have a direct impact in the families where mutations are found , but can also have an impact on more common forms of diseases by contributing to the identification of risk alleles and , consequently , to a greater understanding of the pathobiological pathways underlying these disorders .
trem2 is a transmembrane glycoprotein , consisting of an extracellular immunoglobulin - like domain , a transmembrane domain , and a cytoplasmic tail , which associates with dap12 , also known as tyrobp .
the association between these two proteins is required for its signaling function and it triggers the activation of immune responses in different immune cells .
trem2 is known to control two streams of signaling to regulate the reactive microglial phenotype .
one of these streams regulates phagocytosis and is associated with enhanced phagocytic pathways ( which could be relevant to the removal of cell debris and the clearance of amyloid proteins in alzheimer s disease ) .
this stream also regulates the alternative activation state of microglia , which is thought to be protective .
the other signaling stream suppresses inflammatory reactivity and involves the repression of cytokine production and secretion [ 3537 ] .
we believe that a reduced function of trem2 is key to the pathogenic effect of the risk variants associated with alzheimer s disease .
trem2 is another gene known to be involved in inflammatory responses and the association found with alzheimer s disease corroborates the involvement of immunological pathways in this disease .
this has led to an increased interest in the study of microglia ( the immune cells in the brain ) in these disorders . in ad ,
microglial cells are attracted to -amyloid plaques , produce elevated levels of proinflammatory cytokines and reactive oxygen species , and exhibit a change in morphology .
interestingly , another ad risk gene ( cd33 ) has recently been shown to inhibit microglial uptake and clearance of -amyloid .
the analysis of the mendelian families with alzheimer s disease led to the identification of app and presenilin mutations and the formulation of the amyloid cascade hypothesis . until recently , this was the overarching hypothesis for nearly all attempts to develop therapeutics for the disease .
these are ongoing but have had rather limited success as yet [ 41 , 42 ] .
the identification of the loci from gwas and of trem2 by sequencing has highlighted two other pathways , which may have therapeutic potential : the first is the innate immune system and microglia activation / inflammation and the second is brain cholesterol metabolism .
this latter pathway has been long suspected because of the association of apoe with disease , but has become even clearer with the identification of abca7 as an alzheimer locus .
both of these target pathways had been suspected before , but the identification of specific genes directly involved in pathogenesis will no doubt facilitate their closer examination .
we are now in an unprecedented position to study genetic variability in mendelian and complex diseases due to the technologies developed in the last decade .
the challenges ahead include the analyses of large datasets resulting from studies of cases and controls but also the integration of these analyses with family studies .
the assessment of alzheimer s disease families will most likely reveal a small number of new fully penetrant genes , but will be essential for the identification of novel moderate risk factors .
collecting large cohorts of well - characterized samples will be essential to accurately dissect the molecular foundations of each locus associated with ad in order to understand its genuine contributions .
Output:
| the analyses of genetic factors contributing to alzheimer s disease ( ad ) and other dementias have evolved at the same pace as genetic and genomic technologies are developed and improved .
the identification of the first genes involved in ad arose from family - based studies , but risk factors have mainly been identified by studies comparing groups of patients with groups of controls .
the best outcomes have been heavily associated with the capacity of interrogating genetic variability at the genome level without any particular a priori hypothesis . in this review
we assess the role of genetic family studies in alzheimer s disease and other dementias within the current status of dementias and , particularly , ad s genetic architecture . |
PubmedSumm119640 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: recent clinical studies have shown that treatment with angiotensin ii type 1 ( at1 ) receptor blockers or angiotensin - converting enzyme ( ace ) inhibitors protects against the development of insulin resistance in hypertensive patients and new onset of diabetes in at - risk patients , indicating that the renin - angiotensin system ( ras ) especially tissue ras may contribute to the regulation of glucose metabolism [ 14 ] .
these functional local rass have been found in diverse organ systems such as the pancreas [ 68 ] , heart [ 9 , 10 ] , kidney , vasculature , adipose tissue [ 13 , 14 ] , and skeletal muscle .
the ( pro)renin receptor ( ( p)rr ) cloned in 2002 was reported to be expressed in various tissues .
its ligand , prorenin , is known to be activated without catalytic conversion into mature renin when combining with the ( p)rr and alters the activation of extracellular signal - regulated kinase 1/2 ( erk1/2 ) [ 6 , 7 , 16 , 17 ] .
although aliskiren theoretically will block such prorenin - dependent ang generation , an alternative way to suppress this ang source is the infusion of the ( p)rr blocker called the handle region peptide ( hrp ) .
its effectiveness in vivo is controversial , in part because of a wide variety of doses that has been applied , ranging from 0.1 mg / kg per 28 days to 1.0 mg / kg per day [ 18 , 19 ] .
moreover , the monosodium glutamate- ( msg- ) induced obese rat is a model associated with insulin resistance that may occur without the presence of type 2 diabetes , depending on the age at which the animals are studied .
the administration of msg to newborn rats results in distinctive lesions in hypothalamic arcuate nucleus ( arc ) neurons .
the neuronal loss impairs insulin and leptin signaling and impacts energy balance as well as pituitary and adrenal activity .
this study aimed to determine the effect of hrp with a large dose of 1 mg / kg / d on glucose status in the msg rats .
all animal protocols were approved by the ethics committee of shantou university medical college . timed pregnant sprague - dawley rats
neonatal male rats were injected subcutaneously with either 4 mg / g of msg ( sigma aldrich , mo , usa ) or nacl ( 1.87% solutions ) as control .
the control group of rats was given normal diet , whereas all of the msg rats were given high - energy diet ( 445.5 kcal/100 g , slaccas , shanghai , china ) .
at age of 8 weeks , the msg - treated rats were divided into 4 groups including the msg - control group ( msg group , n = 6 ) , hrp treated group ( msg - hrp group , n = 6 ) , losartan treated group ( msg - l group , n = 6 ) , and losartan and hrp cotreated group ( msg - hrp - l group , n = 6 )
. then ( day 0 and day 15 ) osmotic minipumps ( 2ml4 alzet , ca , usa ) were implanted subcutaneously under isoflurane anesthesia to infuse vehicle ( saline ) or hrp ( nh2-rillkkmpsv - cooh , chinapeptides , shanghai , china , 1 mg / kg per day , for the msg - hrp and msg - hrp - l group ) .
the rats of msg - l group and msg - hrp - l group were given drinking water with 0.45 g / l losartan ( merck , hangzhou , china ) .
oral glucose tolerance test ( ogtt ) was performed after 16 h overnight fasting .
glucose ( 2 g / kg ) was administered orally , and a small amount of blood ( about 100 ml ) was collected from the tail vein at 0 , 30 , 60 , and 120 min for insulin ( elisa , cusabio , wuhan , china ) and glucose measurement immediately with a glucometer ( johnson & johnson , new brunswick , usa ) . for insulin tolerance test ( itt ) , after 4 h of fasting , rats were given an intraperitoneal injection of 0.5 u / kg human insulin ( novo nordisk , tianjin , china ) , and glucose was measured immediately with a glucometer at 0 , 15 , 30 , and 90 min .
sbp was measured in triplicate on separate occasions throughout the day , using the tail - cuff method ( kent scientific copporartion , connecticut , usa ) before the animals were sacrificed . at 12 weeks of age ,
body weight and length were measured , and lee 's index was calculated according to the formula : lee 's index = weight ( g)31000/length ( cm ) . after the performance of ogtt and itt , rats were sacrificed using pentobarbital sodium with the dose of 50 mg / kg weight .
blood samples from puncturing heart were collected into edta tubes for the measurement of plasma ang - ii concentration .
the pancreas was rapidly dissected out and bisected longitudinally , with one half snap frozen in liquid nitrogen and stored at 80c before use , and the other half fixed in 4% paraformaldehyde and embedded in paraffin .
four - micron paraffin sections were prepared from 4% paraformaldehyde - fixed , paraffin - embedded rat pancreas .
sections were stained with 0.1% sirius red ( sigma aldrich , mo , usa ) in saturated picric acid ( picrosirius red ) for 1 h and mounted .
the ratio of stained area to the area of whole islet was calculated using the computer - imaging software ipp6.0 .
the expressions of the -cell marker insulin and -cell marker glucagon were examined by immunohistochemistry using insulin antibody ( 1 : 1,000 ; santa cruz , tx , usa ) and glucagon antibody ( 1 : 100 ; santa cruz , tx , usa ) , respectively .
after washing , a secondary antibody ( 1 : 500 , biotin - conjugated goat anti - rabbit igg ; boster , wuhan , china ) was applied for 30 min at room temperature .
the ratio of stained area ( -cell mass and -cell mass ) to the area of whole islet was calculated using ipp6.0 .
the values were obtained from three islets in each section obtained from six rats in each group .
proliferation of intraislet was assessed by immunohistochemical staining for proliferating cell nuclear antigen ( pcna ) using pcna antibody ( 1 : 100 ; santa cruz , tx , usa ) .
specific immunohistochemical staining was detected using the streptavidin horseradish peroxidase and dab as the chromogen .
semiquantitative assessment of intraislet proliferation was performed by determining the number of pcna - positive cells per islet section .
pancreatic tissue was obtained and homogenized with tris - hcl buffer ( ph 7.0 ) .
nadph oxidase activity was assayed using cytochrome c ( genmed , shanghai , china ) . for assessing subunit of nadph oxidase p in islet sections ,
staining was performed for p ( 1 : 100 ; santa cruz , tx , usa ) .
after washing , a secondary antibody ( 1 : 500 , biotin - conjugated goat anti - rabbit igg ; boster , wuhan , china ) was applied for 30 min at room temperature .
the average gray - scale intensities of cells staining positively were measured by ipp 6.0 .
about 100 mg pancreas tissue was homogenized in 50 mmol / l tris buffer ( ph 7.4 ) , 150 mol / l nacl , 1% triton x-100 , 1% sodium deoxycholate , 0.1% sds , and some inhibitors with a homogenizer on the ice and then centrifuged at 12000 rpm for 15 min at 4c .
the concentration of ang - ii was measured by elisa ( cusabio , wuhan , china ) and the results were corrected by the protein concentration .
the msg - l group and the msg - hrp - l group had lower body weight than the msg group ( p < 0.05 ) .
body length was decreased in the msg group compared with the con group and had no significant difference among msg rats received different treatment .
lee 's index and celiac adipose tissue wet weight , reflecting the extent of obesity , were increased in the msg group compared with the con group .
the systolic blood pressure tended to increase in the msg group but had no statistical difference .
the msg - l group and msg - hrp - l group had obviously lower systolic blood pressure than the msg group ( p values were both < 0.01 ) .
serum ang - ii concentration had no significant difference between the con group and the msg group and was increased obviously in the msg - hrp - l compared with the msg group and the con group ( p values were both < 0.01 ) .
the response of blood glucose to ogtt at week 12 of the experimental period was shown in figures 1(a ) and 1(b ) .
the blood glucose was higher in the msg - hrp group than the con group at 30 min after glucose load .
the blood glucose in the msg - hrp group and the msg - hrp - l group were both higher than the con group at 60 min after glucose load ( p values were < 0.01 and 0.05 , resp . ) and msg - hrp group was higher than the msg - l group ( p < 0.05 ) .
the blood glucose in the con group was lower than the other four groups 2 h after glucose load and msg - l group lower than the msg - hrp group ( p < 0.05 ) .
the area under the curve ( auc ) of blood glucose in the con group was lower than the msg group , msg - hrp group , and msg - hrp - l group ( p values were < 0.05 , < 0.01 , and < 0.01 , resp . ) and had no statistical difference with the msg - l group , whereas the msg group was lower than the msg - hrp group ( p < 0.05 ) and the msg - l group was lower than the msg - hrp group and the msg - hrp - l group ( p values were both < 0.05 ) .
the response of serum insulin concentration to ogtt was shown in figures 1(c ) and 1(d ) .
the serum insulin concentration of the con group at fasting status , 30 minutes and 60 minutes after glucose load , and the auc of insulin were higher than the other four groups .
the auc of insulin in the msg - l group was higher than the msg - hrp group ( p < 0.05 ) .
insulin sensitivity was evaluated according to itt and the results were shown in figure 2 .
the decreased rate of blood glucose was smaller in the msg group compared with the con group at 30 min after insulin injection ( p < 0.01 ) .
treatment with hrp , losartan , and both hrp and losartan had higher decreased rate of blood glucose when compared with the msg group ( p values were all < 0.05 ) .
islets cell and cell were marked by insulin antibody and glucagon antibody , respectively , according to immunohistochemistry . to quantify the change of -cell mass and -cell mass , the ratios of stained respective area of insulin and glucagon to the area of whole islet were calculated by ipp6.0 and the results were shown in figure 3 .
the -cell mass in pancreas islets was reduced in msg rat when compared with con group ( p < 0.05 ) .
treatment with hrp , losartan , and both increased -cell mass when compared with the msg group ( p values were < 0.05 , < 0.01 , and < 0.01 , resp . ) . for the -cell mass ,
treatment with losartan and both losartan and hrp reduced -cell mass when compared with msg group ( p values were both < 0.01 ) .
cells staining positively for the pcna marker in pancreatic islets were shown in figure 4 .
the number of the pcna - positive staining cells was counted in the central area ( 70% of the central area of islet ) and the peripheral area ( 30% area of the peripheral area of islets ) of the islets according to ipp6.0 .
most pcna - positive staining cells were distributed in the periphery of the islets and were in accordance with the location of cell . compared with con group ,
the number was increased in the msg group ( con versus msg : 12.15 7.23 and 95.00 9.04 , p < 0.01 ) .
treatment with hrp had not changed the number of pcna - positive staining cells ( 90.25 12.37 ) , whereas treatment with losartan decreased the number obviously ( 22.92 3.76 , compared with msg group , p < 0.01 ) .
treatment with both hrp and losartan decreased the number obviously ( 43.35 14.25 , compared with msg group , p < 0.01 ) .
there was no statistical difference for the pcna - positive staining cells in the central of the islets .
the proteins of the pancreas tissue were extractted , and ang - ii was measured by elisa ( figure 5 ) .
pancreas local ang - ii was obviously increased in the msg group compared with the con group ( p < 0.01 ) .
the msg rats received treatment of hrp , losartan , and both hrp and losartan decreased the level of local ang - ii obviously compared with the msg group ( p values were all < 0.01 ) .
fibrosis of the pancreatic islets was evaluated according to picrosirius staining ( figure 6 ) and the ratio of stained area to the area of whole islets was calculated .
the ratio was significantly increased in msg group ( 61.5% 8.92% ) when compared with the con group ( 28.36% 6.84% ) .
the msg rats received losartan ( 34.0 % 7.42% ) and both losartan and hrp
( 35.6% 6.32% ) treatment decreased the ratio obviously when compared with the msg group ( p values were both < 0.01 ) , whereas the msg rats received hrp treatment ( 53.0% 7.56% ) had no statistical difference with the msg group .
immunostaining of p in the pancreatic islets in five groups of animals was shown in figures 7(a)7(e ) and the average gray - scale intensities were shown in figure 7(f ) .
the immunostaining of p increased in the msg group when compared with the con group ( p < 0.05 ) .
treatment with losartan , hrp , and both decreased the average gray - scale intensities of immunostaining of p ( p values were < 0.05 , < 0.01 , and < 0.01 , resp . ) .
nadph oxidase activity in pancreatic tissue was increased in msg rats when compared with the control group .
treatment with losatan , hrp , and both decreased the nadph oxidase activity in pancreatic tissue ( compared with msg group , p values were all < 0.01 ) . increased nadph oxidase activity was strongly correlated with levels of local ang - ii in pancreatic tissues ( r = 0.665 , p < 0.01 ) .
a large injection of sodium l - glutamate into newborn sd rats generated necrosis of neuronal cells of the ventromedial nucleus and arcuate nucleus in the hypothalamus , and as a result , the rats developed polyphagia , obesity , and energy regulation barriers [ 2225 ] .
our results showed that msg rats given high - energy diet from 3 weeks age to 12 weeks led to obesity , insulin resistance , and elevated blood glucose level after glucose load .
however , levels of insulin releasing after glucose load just reached about half of the normal sd rats . the results above demonstrated that msg rat was a model with insulin resistance and -cell impairment .
nemeroff et al . showed that msg rats had smaller endocrinic organs such as pituitary , testis , ovarian , adrenal , and lower levels of thyroid hormone and gave us a cue that -cell impairment may be a result of dysplasias of pancreas islets .
although serum insulin concentration was obviously lower than the normal sd rats , the msg rats had elevated blood glucose after glucose load but kept normal fasting blood glucose at age of 12 weeks and may due to relative low levels of antergic hormone of insulin such as glucocorticoids and thyroid hormone .
the characteristic of glucose status of the msg rats supplied us with an ideal model for the study .
showed that the rat pancreas expressed the major ras component genes , notably angiotensinogen and renin , required for intracellular formation of angiotensin ii .
and lam and leung testified the presence of the at1 receptor , at2 receptor , angiotensinogen and ( pro)renin in the human cell of the islets .
our results showed that ( pro)renin , angiotensinogen , and ( p)rr were detected in pancreatic islets , and the level of local ang - ii was independent of system ang - ii .
the components of local ras are responsive to various physiological and pathophysiological stimuli such as hyperglycemia and lead to aggravation of islets functions in turn [ 2833 ] .
activation of pancreatic local ras increased in different type 2 diabetes animal models including db / db mice , zdf rats , and oletf rats .
our results showed that level of pancreatic local ang - ii was remarkedly increased in msg rats .
pretreatment of isolated db / db islets with losartan before the addition of angiotensin ii ( 100 nmol / l ) not only completely rescued glucose - induced insulin secretion but also tended to increase insulin release to an even higher level .
treatment with perindopril or irbesartan treatments significantly improved first - phase insulin secretion in zdf animals .
liskiren decreased body weight and plasma glucose level and increased plasma insulin level in a fed condition .
our results showed that losartan increased the levels of insulin releasing after glucose load and decreased auc of blood glucose .
much to our surprise , hrp improved insulin sensitivity but had not increased insulin releasing and had not improved glucose status .
the maintenance of the specialized architecture of the pancreatic islet and normal -cell mass is important for continuing function .
candesartan increased -cell mass and increased staining intensity of insulin in pancreas islets of db / db mice .
treatment with aliskiren restored the -cell mass to a similar level to that in nondiabetic normal ( c57bl/6j ) mice .
our results indicated that losartan increased -cell mass and decreased -cell mass in accordance with the results of insulin releasing test .
the regulation of islet cell apoptosis and proliferation is important in maintaining normal ratio of -cell mass and -cell mass .
our results showed pcna - positive staining cells distributed in the periphery of the islets in accordance with cells in msg rats .
losartan but not hrp decreased the pcna - positive staining cell and may be the reason why hrp had not improved glucose status of the msg rats .
pancreatic islets are highly susceptible to oxidative injury , owing to low endogenous antioxidant activity .
blockade of the ras with perindopril or irbesartan significantly reduced staining for nitrotyrosine in zdf rats .
candesartan decreased staining intensity of components of nad(p)h oxidase , p , gp , and those of oxidative stress markers in -cell of db / db mice .
treatment with losartan , hrp , and both decreased the average gray - scale intensities of immunostaining of p and nadph oxidase activity in pancreatic tissue .
the results above supported the notion that ras inhibitors improve islets functions by decreasing activity of oxidative stress .
both perindopril and irbesartan reduced expression for collagen i and iv protein in zdf rats . islet fibrosis and the expression of tgf- with its downstream signal molecules were significantly reduced in the pancreas of oletf ramipril - treated group than in control group .
[ 35 , 36 ] demonstrated that hrp decreased the expression of collagen i and iii in the heart and collagen iv in the kidney in spontaneously hypertensive rats , hrp had not improved status of islets fibrosis in msg rats . from the above we can conclude that hrp and losartan had some similar effects on islets in msg rats .
losartan decreased level of local ang - ii , increased -cell mass , and decreased the activity of oxidative stress .
hrp had no effect on the -cell mass and proliferation of islet cells and had not improved status of islets fibrosis in msg rats
. these difference may be due to the specially interaction of renin , prorenin , and ( p)rr .
renin is an aspartyl protease that cleaves angiotensinogen into angiotensin i , the rate - limiting reaction in the cascade generating angiotensin .
both renin and its inactive precursor , prorenin , can bind to the ( p)rr . the ( p)rr is a true receptor that is able to activate intracellular signaling , and ( p)rr bound prorenin is enzymatically active as a result of a conformational change without cleavage of the prosegment . as a blocked of ( p)rr , hrp decreased local level of ang - ii , and in the end , oxidative stress was decreased as it is ang - ii dependant . however , whether the activation of erk1/2 mapk pathway which was related to proliferation and fibrosis was blocked by hrp needs further investigation .
in summary , on the one hand , both losartan and hrp decreased levels of pancreatic local ang - ii and nadph oxidase activity as well as its subunits p. on the other hand , losartan but not hrp decreased -cell mass and number of pcna - positive cells located periphery of the islets and decreased picrosirius red stained area in islets .
hrp ameliorating insulin resistance but not -cell functions leads to hyperglycemia in the end in male msg rats , and the dual characters of hrp may partly account for the phenomenon .
Output:
| handle region peptide ( hrp ) , which was recognized as a blocker of ( pro)renin receptor ( ( p)rr ) , may block the function of ( p)rr .
the aim of this study was to investigate the effect of hrp with a large dose of 1 mg / kg / d on glucose status in the rats treated neonatally with monosodium l - glutamate ( msg ) . at the age of 8 weeks
, the msg rats were randomly divided into msg control group , hrp treated group with minipump ( msg - hrp group ) , losartan treated group ( msg - l group ) , and hrp and losartan cotreated group ( msg - hrp - l group ) and fed with high - fat diet for 4 weeks .
losartan but not hrp increased the levels of insulin releasing and ameliorate glucose status although both losartan and hrp improved insulin sensitivity . on the one hand , both losartan and hrp decreased levels of pancreatic local ang - ii and nadph oxidase activity as well as its subunits p22phox . on the other hand , losartan but not hrp decreased -cell mass and number of pcna - positive cells located periphery of the islets and decreased picrosirius red stained area in islets .
hrp ameliorating insulin resistance but not -cell functions leads to hyperglycemia in the end in male msg rats , and the dual characters of hrp may partly account for the phenomenon . |
PubmedSumm119641 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a modified gyrb cdna fragment was generated as previously described ( 10 ) and ligated at the 3 end of a human l - selectin cdna ( 11 ) via an xbai site introduced at the l - selectin translation - termination codon .
all constructs were verified by dna sequencing , subcloned into the pmt-2 expression vector ( provided by genetics institute , cambridge , ma ) , and used to transfect 300.19 cells ( 12 ) .
transfected cells were selected in rpmi 1640 medium containing 10% calf serum and g418 ( 1 mg / ml ; sigma chemical co. , st .
multiple clones of transfected cells expressing similar cell - surface levels of wild - type l - selectin or l - selectin gyrb fusion proteins were identified by immunofluorescence staining with flow cytometry analysis .
cells were washed once with rpmi 1640 medium before incubation at 37c for 25 min ( unless indicated otherwise ) in rpmi 1640 containing either 0.1% dmso or the indicated amounts of coumermycin and novobiocin ( in 0.1% dmso ; sigma chemical co. ) . after washing with ice - cold pbs without ca / mg ,
the cells were divided and incubated with biotin - labeled ppme ( 5 g / ml ) in pbs containing either ca/ mg or 10 mm edta . after a 30-min incubation on ice , fitc - labeled avidin was added to visualize phosphomanan monoester core complex ( ppme ) binding as previously described ( 3 , 4 ) , with staining assessed immediately by flow cytometry as in fig .
ca - dependent ppme - binding was calculated by subtracting the mean linear fluorescence channel number for background staining ( in 10 mm edta ) from the mean value of fluorescence staining in the presence of ca .
antibiotic treatment did not change the mean fluorescence intensity of background staining .
for ligation with antibody , cells ( 2 10 cells / ml in flow medium , pbs containing ca / mg and 0.5% bsa ) were incubated with lam1 - 101 or lam1 - 118 mabs ( 10 g / ml ) at room temperature for 15 min . in vitro rolling experiments
were as previously described ( 13 ) using a transformed human umbilical vein endothelial cell ( huvec ) line ( ea.hy926 , provided by dr .
cora - jean edgell , university of north carolina at chapel hill ; reference 14 ) that was transfected with an 1,3fucosyltransferase - vii cdna ( fucosyltransferase vii , provided by dr .
brent weston , university of north carolina at chapel hill ) . transfected ea.hy926 cells were grown to confluence on 25-mm circular glass coverslips and mounted in a parallel - plate flow chamber .
flow medium was drawn through the chamber at a rate of 804 l / min with a syringe pump ( harvard apparatus , natick , ma ) , which generates an estimated wall shear stress of 1.85 dynes / cm .
cells ( 10 cells / ml ) were perfused through the chamber for a 10-min period .
cell rolling was observed using an inverted phase - contrast microscope ( olympus corporation , lake success , ny ) and videotaped using a ccd video camera ( hitachi denshi , ltd
. , tokyo , japan ) with a supervhs video recorder ( model svo-9500md ; sony corporation of america , new york , ny ) and an attached time - date generator ( microimage video sales co. , bechtelsville , pa ) .
interacting cells ( tethering and rolling ) were determined by analysis of videotapes in which four fields ( 0.16 mm ) on a video monitor were counted at 14 random time points throughout the flow period
. for calculating velocities , the distance each cell traveled between two time points was measured , converted into actual distance , and divided by the elapsed time .
a modified gyrb cdna fragment was generated as previously described ( 10 ) and ligated at the 3 end of a human l - selectin cdna ( 11 ) via an xbai site introduced at the l - selectin translation - termination codon .
all constructs were verified by dna sequencing , subcloned into the pmt-2 expression vector ( provided by genetics institute , cambridge , ma ) , and used to transfect 300.19 cells ( 12 ) .
transfected cells were selected in rpmi 1640 medium containing 10% calf serum and g418 ( 1 mg / ml ; sigma chemical co. , st .
multiple clones of transfected cells expressing similar cell - surface levels of wild - type l - selectin or l - selectin gyrb fusion proteins were identified by immunofluorescence staining with flow cytometry analysis .
cells were washed once with rpmi 1640 medium before incubation at 37c for 25 min ( unless indicated otherwise ) in rpmi 1640 containing either 0.1% dmso or the indicated amounts of coumermycin and novobiocin ( in 0.1% dmso ; sigma chemical co. ) . after washing with ice - cold pbs without ca / mg ,
the cells were divided and incubated with biotin - labeled ppme ( 5 g / ml ) in pbs containing either ca/ mg or 10 mm edta . after a 30-min incubation on ice
, fitc - labeled avidin was added to visualize phosphomanan monoester core complex ( ppme ) binding as previously described ( 3 , 4 ) , with staining assessed immediately by flow cytometry as in fig .
ca - dependent ppme - binding was calculated by subtracting the mean linear fluorescence channel number for background staining ( in 10 mm edta ) from the mean value of fluorescence staining in the presence of ca .
cells were treated with dmso , coumermycin , and/or novobiocin as described above . for ligation with antibody ,
cells ( 2 10 cells / ml in flow medium , pbs containing ca / mg and 0.5% bsa ) were incubated with lam1 - 101 or lam1 - 118 mabs ( 10 g / ml ) at room temperature for 15 min . in vitro rolling experiments were as previously described ( 13 ) using a transformed human umbilical vein endothelial cell ( huvec ) line ( ea.hy926 , provided by dr . cora - jean edgell , university of north carolina at chapel hill
; reference 14 ) that was transfected with an 1,3fucosyltransferase - vii cdna ( fucosyltransferase vii , provided by dr .
brent weston , university of north carolina at chapel hill ) . transfected ea.hy926 cells were grown to confluence on 25-mm circular glass coverslips and mounted in a parallel - plate flow chamber .
flow medium was drawn through the chamber at a rate of 804 l / min with a syringe pump ( harvard apparatus , natick , ma ) , which generates an estimated wall shear stress of 1.85 dynes / cm .
cells ( 10 cells / ml ) were perfused through the chamber for a 10-min period .
cell rolling was observed using an inverted phase - contrast microscope ( olympus corporation , lake success , ny ) and videotaped using a ccd video camera ( hitachi denshi , ltd . ,
tokyo , japan ) with a supervhs video recorder ( model svo-9500md ; sony corporation of america , new york , ny ) and an attached time - date generator ( microimage video sales co. , bechtelsville , pa ) .
interacting cells ( tethering and rolling ) were determined by analysis of videotapes in which four fields ( 0.16 mm ) on a video monitor were counted at 14 random time points throughout the flow period . for calculating velocities ,
the distance each cell traveled between two time points was measured , converted into actual distance , and divided by the elapsed time .
whether the cytoplasmic domain of l - selectin enhances ligand binding through oligomerization was tested directly by assessing the functional activity of induced cell - surface l - selectin dimers . although not previously tested for inducing dimerization of transmembrane proteins , the exogenous dimeric antibiotic coumermycin can cross - link and activate cytoplasmic raf-1gyrb fusion proteins by simultaneously binding two gyrb subunits ( 10 ) .
cdnas encoding l - selectin and a gyrb subunit were fused ( l - gb ) and expressed in 300.19 cells ( fig .
1 ) , an l - selectin negative leukemia cell line that positions l - selectin at microvillus tips when expressed ( 9 ) .
the interaction of l - selectin with its ligand was assessed using a multivalent mannose-6 phosphate - rich polysaccharide mimetic , ppme , which can be labeled to assess l - selectin binding activity without the influence of other adhesion receptors ( 3 , 15 ) .
cells expressing l - gb or wild - type l - selectin bound ppme similarly ( fig . 2 a , top ) .
coumermycin treatment significantly increased the ppme binding activity of l - gb expressing cells by three- to five - fold but had no effect on wild - type l - selectin bearing cells ( fig .
edta inhibited ppme binding by all cells , consistent with the involvement of l - selectin 's calcium - dependent lectin domain .
treatment of cells with the l - selectin function - blocking mab , lam1 - 3 , also blocked ppme binding ( data not shown ) .
coumermycin enhancement of ppme binding by l - gb cells was dose dependent , maximal at 0.9 m coumermycin , rapid , and sustained ( fig .
pretreatment of l - gb cells with novobiocin , the monomeric coumermycin analogue ( 10 ) , completely eliminated the coumermycin - induced effect ( fig .
coumermycin - induced dimerization did not increase l - gb expression levels or induce l - selectin endoproteolytic release from the cell surface ( fig .
2 e ) , whereas phorbol esters induced l - gb and wild - type l - selectin endoproteolytic release similarly ( data not shown ) .
coumermycin - induced l - selectin dimerization in l - gb cells did not generate transmembrane signals leading to upregulated intercellular adhesion over a 24-h time period .
although the molecular explanation for why cross - linking l - selectin with some mabs induces potent homotypic adhesion while coumermycin does not induce homotypic adhesion is not known , cross - linking l - gb or wild - type l - selectin on expressing cells with appropriate anti
l - selectin mabs induced potent homotypic adhesion ( data not shown ) as previously described ( 16 ) .
therefore , coumermycin - induced dimerization of l - gb resulted in enhanced l - selectin binding activity specific for its ligand mimetic , ppme , which provides a mechanistic explanation for leukocyte activation rapidly upregulating l - selectin functional activity ( 3 ) .
the physiological importance of l - selectin dimerization for leukocyte / endothelial interactions was assessed using in vitro flow chambers that mimic vascular flow conditions in vivo .
l - selectin supports leukocyte rolling on a monolayer of transformed huvec that express l - selectin ligand(s ) ( 14 , 17 ) .
both l - gb and wild - type l - selectin mediated a basal level of 300.19 cell rolling ( fig .
3 , a and c ) , but neither cell type arrested on these huvec monolayers due to the absence of other operable adhesion molecules expressed by this cell line ( data not shown ) .
mediated rolling of cells on huvec monolayers was significantly enhanced ( by > 700% , p < 0.002 , n = 3 experiments ) by coumermycin treatment , which was competitively inhibited by novobiocin pretreatment ( fig .
all rolling on huvec monolayers was completely blocked by the lam1 - 3 mab ( fig .
3 , a and c ) . remarkably , coumermycin treatment also significantly lowered rolling cell velocities by 35% , from a median ( sem ) rolling velocity of 272 9 to 175 12 m / s ( p < 0.001 ; n = 3 , fig
therefore , l - selectin dimerization markedly increased the number of leukocytes rolling under conditions of physiologic shear stress . to further verify that l - selectin dimerization enhances its functional activity ,
a panel of igg mabs was screened to identify those that cross - linked l - selectin extracellular domains in a functionally appropriate configuration while not blocking ligand binding or inducing transmembrane signals ( 16 ) .
of 32 mabs screened , the lam1 - 118 mab reactive with the short consensus repeat domains of l - selectin fit these criteria . lam1 - 118 mab treatment of wild - type l - selectin or l - gb bearing cells significantly increased the frequency ( 310 and 350% increase , respectively ; p < 0.01 ) of cells interacting with huvec monolayers under physiologic flow conditions ( fig . 3 c ) .
this was consistent with an increase in high endothelial venule binding by lymphocytes pretreated with this mab ( 16 ) .
as with coumermycin treatment of l - gb cells , lam1 - 118 mab treatment significantly lowered rolling cell velocities by 35% , from a median ( sem ) of 266 3 to 172 6 m / s ( p < 0.001 , n = 3 ; fig .
lam1 - 118 mab treatment of wild - type l - selectin bearing cells lowered rolling cell velocities similarly ( data not shown ) .
lam1 - 118 mab treatment of l - gb or wild - type l - selectin transfected cells did not increase or decrease receptor expression levels ( data not shown ) , and did not induce homotypic adhesion of 300.19 cells ( 16 ) .
furthermore , treatment of wild - type or l - gb l - selectin bearing cells with lam1 - 101 , an isotype - matched mab that binds the epidermal growth factor like / short consensus repeat domains of l - selectin , had no significant effect on cell attachment or rolling velocities ( fig .
neither 300.19 cells alone nor wild - type l - selectin expressing cells treated with the lam1 - 3 mab showed any detectable interaction with the huvec monolayers ( fig
therefore , coumermycin - mediated cross - linking of l - selectin cytoplasmic domains and mab - mediated cross - linking of the l - selectin extracellular domains both generated identical results under physiological flow conditions .
l - selectin binds its ligands with rapid association and dissociation rates , which results in a minimal shear stress threshold requirement for the initiation and maintenance of leukocyte rolling ( 1821 ) . despite the coumermycin- induced increase in l - selectin binding activity ,
both coumermycin - treated and -untreated l - gb cells required shear stress for the promotion of l - selectin dependent interactions since no tethering or rolling was observed below wall shear stresses of 0.75 dynes / cm ( fig .
4 ) . nonetheless , coumermycin - treated l - gb cells interacted with huvec monolayers at a significantly greater frequency compared with untreated l - gb cells at shear stresses between 0.75 and 3.0 dynes / cm ( fig .
thus , l - selectin dimerization influences rolling velocity and receptor detachment rates as opposed to selectin localization to the tips of microvilli , which appears to promote cell capture ( 57 ) .
l - selectin dimerization may retard the dissociation of selectin bonds , which would enhance the lifetime of l - selectin binding to its endothelial ligand(s ) and promote leukocyte tethering to endothelium during rolling . that inducing l - selectin dimerization by either coumermycin or mabs can enhance
l - selectin adhesion is consistent with a model in which the transient activation- enhanced adhesive function of l - selectin results from receptor dimerization .
however , these results do not exclude other mechanisms for transiently enhancing the adhesive function of l - selectin and do not necessarily prove that l - selectin dimerization is a physiologic process .
nonetheless , the formation of cell - surface dimers may also provide a mechanistic explanation of why l - selectin mediated tethers operate at high shear forces ( 22 ) .
thus , the rapid upregulation of l - selectin binding activity after leukocyte activation and l - selectin dimerization may stabilize l - selectin bonds under shear force , which facilitates the formation of a second receptor / ligand bond before the first one breaks during rolling .
multivalent l - selectin binding would also distribute the tensile force applied on each tether among several l - selectin / ligand bonds .
therefore , l - selectin 's cytoplasmic domain and cytoskeletal associations may be required for its oligomerization within the cell membrane , providing it with strong resistance to shear stresses . whether dimerization also regulates p- and e - selectin function is unknown , although p - selectin isolated from activated platelets is found in a tetrameric configuration , which facilitates its binding activity in vitro ( 23 ) .
since leukocyte rolling may involve multivalent binding ( 22 ) , rapid oligomerization of l - selectin would favor the formation of multivalent bonds with its low affinity endothelial cell ligands ( 24 ) .
consistent with this notion , l - selectin ligands consist of multimeric sialylated and sulfated oligosaccharides appropriately presented by mucin scaffolds ( 1 ) . as such , oligomerized l - selectin molecules may interact cooperatively with ligands presenting multiple low affinity oligosaccharide binding sites that are optimally stabilized by multivalent bonding .
this is consistent with the many animal lectins that dramatically increase their affinity for carbohydrate ligands by combining multiple oligosaccharide binding sites in each lectin polypeptide ( 25 ) .
however , in the case of l - selectin the generation of multimeric binding by receptor oligomerization may provide a rapid means for upregulating adhesion receptor function with leukocyte activation .
in addition , dimerization may be particularly important when l - selectin or its ligands are expressed at low site densities ( 26 ) .
therefore , this study supports the notion that selectin oligomerization is of primary physiologic significance and is likely to directly influence leukocyte migration and entry into sites of inflammation .
moreover , the coumermycin gyrb dimerization strategy is likely to be useful for studying other transmembrane proteins and adhesion molecules that share the property of being functionally upregulated in response to cellular activation .
generation of l - selectin expressing cell lines . ( a ) structure of l - selectin and the l - selectin gyrb ( l - gb ) fusion protein containing the entire l - selectin protein in - frame with the nh2-terminal 24-kd subdomain of the b subunit of bacterial dna gyrase ( gyrb ) .
domains : egf , epidermal growth factor like ; scr , short consensus repeat ; tm , transmembrane ; cyto , cytoplasmic . ( b ) cell - surface expression of wild - type l - selectin or l - gb in stably - transfected 300.19 cells and wild - type l - selectin expression by human blood lymphocytes .
cells were isolated and stained with fitc - conjugated lam1 - 116 mab specific for l - selectin ( solid line ) or an isotype - matched , nonbinding control mab ( dashed line ) as previously described ( 16 ) .
fluorescence histograms from flow cytometry analysis are on a three - decade log scale and are representative of results from at least five experiments .
coumermycin - induced changes in ppme binding activity by l - gb expressing 300.19 cells .
( a ) immunofluorescence analysis of ppme binding by cells expressing wild - type l - selectin or l - gb , before and after treatment with 0.9 m coumermycin .
after coumermycin treatment , the cells were incubated with ppme in the presence of either ca or edta , and ppme binding was assessed by fluorescence staining and flow cytometry analysis with results shown on a three - decade log scale .
these results represent those obtained in at least five experiments with the l - gb clone shown ( fig
. 1 b ) and are representative of results obtained with two independent clones of l - gb transfected cells .
( b ) dose response of coumermycin - induced ppme binding in l - gb cells .
values represent the mean fold increase in ppme binding relative to untreated cells obtained in four experiments .
asterisk indicates significant differences between treated and untreated samples , p < 0.01 , student 's t test .
( c ) time kinetics of coumermycin - induced ppme binding by l - gb transfectants .
the cells were treated with 0.9 m coumermycin for the indicated amounts of time before ppme staining .
cells were first treated with medium or the indicated amounts of novobiocin at 37c for 15 min .
coumermycin ( 0.9 m final ) was then added with ppme binding assessed 25 min later .
l - gb cells were incubated in media containing dmso ( 0.1% ) , 0.9 or 9.0 m coumermycin at 37c for the indicated time periods .
( a ) effect of coumermycin and novobiocin treatments on the number of l - gb cells rolling on a huvec monolayer in an in vitro flow chamber assay .
values represent the number of l - gb cells interacting with huvec monolayers in a 0.16-mm field .
( b ) effect of coumermycin ( 0.9 m ) on rolling velocities of l - gb cells interacting with a huvec monolayer .
each symbol represents the velocity of an individual cell plotted in rank order with median ( 50% ) velocities indicated by horizontal and vertical lines .
( c ) effect of anti l - selectin mabs on the number of wild - type or l - gb cells rolling on huvec monolayers .
l - selectin mabs on the rolling velocities of l - gb cells interacting with huvec monolayers .
a and c values are mean sem of results obtained in three experiments , and b and d values are representative of results obtained in three experiments .
l - selectin dimerization enhances leukocyte attachment and rolling on endothelial cells under physiologic flow .
wall shear stress was varied at 1-min intervals by changing the flow rate through the flow chamber .
asterisk indicates coumermycin - treated cells that were significantly different from untreated cells , p < 0.05 . values represent means sem of results from three experiments .
Output:
| l - selectin binding activity for its ligand expressed by vascular endothelium is rapidly and transiently increased after leukocyte activation . to identify mechanisms for upregulation and assess how this influences leukocyte
/ endothelial cell interactions , cell - surface dimers of l - selectin were induced using the coumermycin gyrb dimerization strategy for cross - linking l - selectin cytoplasmic domains in l - selectin cdna - transfected lymphoblastoid cells .
coumermycin- induced l - selectin dimerization resulted in an approximately fourfold increase in binding of phosphomanan monoester core complex ( ppme ) , a natural mimic of an l - selectin ligand , comparable to that observed after leukocyte activation . moreover , l - selectin dimerization significantly increased ( by 700% ) the number of lymphocytes rolling on vascular endothelium under a broad range of physiological shear stresses , and significantly slowed their rolling velocities . therefore , l - selectin dimerization may explain the rapid increase in ligand binding activity that occurs after leukocyte activation and may directly influence leukocyte migration to peripheral lymphoid tissues or to sites of inflammation .
inducible oligomerization may also be a common mechanism for rapidly upregulating the adhesive or ligand - binding function of other cell - surface receptors . |
PubmedSumm119642 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the ev surveillance system in south korea consists of 62 clinics ( 8 primary clinics , 14 secondary hospitals , and 40 tertiary hospitals located nationwide ) managed by pediatric physicians ( figure ) . during 2009 ,
a total of 2,427 cases of viral disease were reported to the korea centers for disease control and prevention through a web - based system .
in addition , an experienced neurologist ( w .- s.r . ) collected detailed clinical information about , and results of imaging studies of , patients reported to have central nervous system ( cns ) involvement .
we monitored the patients until they were discharged or for 3 weeks if duration of hospitalization was > 3 weeks .
patient outcome was classified into 1 of 4 groups ; no sequelae ( neurologic dysfunction without dependency ) , mild sequelae , severe sequelae ( neurologic dysfunction requiring assistance ) , or death . geographic distribution of clinics participating in enterovirus surveillance , south korea , 2009 .
pcr ( rt - pcr ) by using taqman technology ( applied biosystems , foster city , ca , usa ) .
briefly , viral rnas were extracted by using the magnetic bead based viral nucleic acid purification protocol described by boom et al .
subsequently , 1-step real - time rt - pcr was performed by using a dual - labeled fluorogenic ev - specific probe and primers designed on the basis of previous data ( 8) . for genotyping , seminested rt - pcr was used to amplify part of the viral protein ( vp ) 1 gene of ev , based on the korea centers for disease control and prevention protocol for detection of pan - ev , and sequencing analysis for vp1 amplicon was performed by using automatic sequencer and dnastar software package ( 9 ) . in 2009 ,
ev was detected in 461 ( 19% ) of all patients and in 321 ( 66% ) of patients with suspected hfmd and herpangina .
samples from 331 ( 72% ) of the 461 ev - seropositive patients were available for genotyping ( table 1 ) .
in addition , we found 112 cases of hfmd with cns complications ( meningitis or encephalitis ) ; ev was detected in 95 ( 85% ) and ev71 in 92 ( 82% ) case - patients .
furthermore , ev71 was detected in 2 of the 187 case - patients in which meningitis without hfmd or herpangina was diagnosed .
mean ( sd ) patient age was 46 ( 29 ) months ( range 1 month12 years ) ; 12 ( 13% ) patients were < 1 year of age .
initial diagnoses were viral meningitis ( 60 patients ) , encephalitis ( 20 ) , acute cerebellar ataxia ( 12 ) , acute transverse myelitis ( 1 ) , and guillain - barr syndrome ( 1 ) . rash and fever
median leukocyte count was 111 cells / mm ( interquartile range 48318 cells / mm ) , mean ( sd ) protein level was 43 ( 18 ) mg / dl , and mean ( sd ) glucose level was 69 ( 13 ) mg / dl .
of the 32 ( 34% ) patients who underwent magnetic resonance imaging of the brain , 24 ( 75% ) had normal results , 4 ( 13% ) had meningeal enhancement on t1-enhanced imaging , and 4 ( 13% ) had high signal intensity at the brainstem or cerebellum on t2-weighted or fluid - attenuated inversion recovery imaging .
all brain parenchymal lesions were located in the brainstem or cerebellum , and the 4 patients with brain lesions subsequently experienced ataxia .
ev71 was found in 72 ( 92% ) of 78 lower gastrointestinal tract samples , 37 ( 60% ) of 62 upper respiratory tract samples , and 2 ( 5% ) of 37 csf samples . on the basis of sequence analysis , c4a , with high similarity to strains from china in 2008 ,
was a dominant serotype of ev71 ( 76% ) ; and c1 was found in 2 patients and c5 in 1 patient .
the partial vp1 sequences of korean ev71 strains were registered in genbank ( hm443164644 ) , and viral genetic identity belonged to c4a genotype , which was not a prevailing genotype in the previous reports of other asian pacific countries .
* hfmd , hand - foot - and - mouth disease ; ev71 , enterovirus 71 ; prc , people s republic of china ; na , not available .
the severity of , and case - fatality rate for , ev71 infection in our population were relatively low compared with those of previous reports in which the case - fatality rate ranged from 10% to 26% ( 12 ) .
in contrast , the predominant genotype in our patients was c4 , particularly c4a , which has been prevalent in china since 2008 ( 11 ) .
the case - fatality rate also was low in china , with 3 patients dying of the 1,149 reported with ev71 infection ( 11 ) .
therefore , the virulence of the c4a genotype may be milder than that of other genotypes .
possible explanations include the transient presence of the virus in csf , a lower viral load in csf , and use of an ev pcr assay that had not been optimized to detect ev71 . in our population , the csf profile of ev71 infection appeared to be broadly similar to that of other cases of viral encephalitis or meningitis .
thus , analyzing the csf of patients with suspected ev71 infection may provide minimal information .
several studies have shown that ev71 infection rate was most common during the warmer season ( 15 ) . in our study , the seasonality of ev71 infection initially was similar to that of previous reports .
however , the prevalence of ev71 infection decreased drastically in august , the warmest month in south korea . a possible reason for this difference could be that in 2009 , influenza pandemic ( h1n1 ) 2009 affected south korea ; with the first death caused by it in south korea reported in august .
as a consequence , personal hygiene practices , such as handwashing and covering one s cough or sneeze , were emphasized to prevent virus spread .
considering the transmission route of ev71 infection , the emphasis on personal hygiene may thus have hindered the spread of ev71 , as well as of the influenza virus .
we report 94 cases of pcr - confirmed ev71 infection with cns involvement , including 2 deaths , and provide additional clinical and virologic information about ev71 .
we confirmed that ev71 commonly involved the brainstem and cerebellum , and therefore ataxia is not uncommon in ev71 infection with cns involvement .
in addition , our study supports the hypothesis that the severity of and case - fatality rates for ev71 infection may differ by genotype or subgenotype of ev71 .
Output:
| we assessed neurologic sequelae associated with an enterovirus 71 ( ev71 ) outbreak in south korea during 2009 .
four of 94 patients had high signal intensities at brainstem or cerebellum on magnetic resonance imaging .
two patients died of cardiopulmonary collapse ; 2 had severe neurologic sequelae .
severity and case - fatality rates may differ by ev71 genotype or subgenotype . |
PubmedSumm119643 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: cronkhite - canada syndrome ( ccs ) is a rare nonfamilial polyposis syndrome characterized by two kinds of marked epithelial disturbances .
the first is epidermal manifestations including alopecia , onychodystrophy , and hyperpigmentation , and the second is gastrointestinal tract expressions involving hamartomatous polyps of the juvenile type . usually , ccs colon polyp has been known as a benign neoplasm , but the possibility of serrated adenoma associated with malignant neoplasm was reported in some japanese cases . in south korea ,
13 ccs cases have been studied until now , yet there was no case accompanied by the colon cancer .
the authors diagnosed a ccs patient who was accompanied with multiple polyps in the stomach , the small bowel and the whole colon . throughout the endoscopic colon polypecotmy , adenocarcinoma in situ along with tubular adenoma and serrated adenoma
this is the first case of ccs associated with colon cancer and serrated adenoma in south korea , so we report here with a literature review .
a 72-year - old male complained of chronic diarrhea and weight loss of 10 kg in 1 month .
he took a colonoscopy examination at a private clinic showing multiple colonic polyps of varying sizes .
there were no abnormalities in his past medical and family history such as gastrointestinal polyposis or colorectal cancer .
he had been drinking about 1.5 bottles of soju ( korean liquor ) every day for 20 years .
he was showing chronic signs of illness , but his vital signs were relatively stable .
he was 164.3 cm tall and weighed 47 kg ( body mass index , 17.4 ) .
his physical examination revealed mild hair loss and hair pull test showed that more than 10 hairs were pulled out ( fig .
also , all fingernails of both hands were dry , cracked , and transformed ( fig .
a peripheral blood test showed a hemoglobin level of 13.1 g / dl , hematocrit 38.2% , and evidence of megalocytes with mean corpuscular volume of 105.2 fl , mean corpuscular hemoglobin of 36.1 pg , and mean corpuscular hemoglobin concentration of 34.3% .
iu / l , an alanine aminotransferase of 24 iu / l , total protein level of 5.5 g / dl , albumin level of 3.4 g / dl , total bilirubin level of 0.6 mg / dl , calcium level of 8.6 mg / dl , blood urea nitrogen ( bun ) level of 10 mg / dl , creatinine level of 0.8 mg / dl , na / k
/ cl / co of 139/4.3/104/27 meq / l , and serum carcinoembryonic antigen level of 5.8 ng / ml . the esophagus was normal in gastroscopy , but several hundred strawberry - like polyps of varying sizes ( 0.5 to 2.5 cm ) were observed in the stomach ( fig .
the number and sizes of the polyps increased in the distal stomach than in the proximal stomach .
rapid urease test ( campylobacter - like organism , clo test ) showed positive result and the stool helicobacter pylori ag were also positive .
the duodenum was covered with multiple small hyperemic polypoid lesions and numerous tiny polyps on whole small bowel were also observed by capsule endoscopy , but these were not confirmed histologically ( fig .
thousands of little grape - like polyps that were less than 10 mm in size and some colon polyps of more than 1 cm in size were observed during colonoscopy .
small scale - like hyperemic mucosa under the size of 1 mm was observed without normal mucosa in the terminal ileum .
these colon polyps were resected by endoscopic method , and the pathologic results confirmed colon cancer ( adenocarcinoma in situ ) ( fig .
most of them were inflammatory polyps containing lamina propria , and proliferated tortuous and cystic dilated glands were observed ( fig .
however , adenocarcinoma in situ with background low grade tubular adenomas was confirmed in one of them ( fig .
3b , c ) . also , another polyp showed serrated architecture and cytological dysplasia of the crypts , corresponding to serrated adenoma ( fig .
prednisolone of 40 mg / day was administered , and the dosage was reduced by 5 mg every week .
h. pylori eradication ( proton pump inhibitor , amoxicillin , and metronidazole combination therapy for 2 weeks ) was performed and the follow - up clo test was negative . at 4 months follow - up , although the patient appeared to have improved , hundreds of 0.5 to 2.5 cm - sized hyperplastic gastric polyps were not improved compared to the previous endoscopic findings . in the follow - up colonoscopy , numerous colon polyps were still discovered in the whole colon .
additional colon polypectomy was performed and the pathologic results confirmed inflammatory polyps and tubular adenoma .
since cronkhite and canada described the first two cases in 1955 , the number of reported cases has increased to more than 400 over the last decade in the world .
the male - to - female ratio was 1.3:1 and 80% of the patients were over 50 years of age at the time of presentation.1 the characteristic two features of ccs are gastrointestinal polyposis and ectodermal changes that consist of alopecia , nail dystrophy , and hyperpigmentation .
ccs usually evolves rapidly over several months and mild gastrointestinal and nutritional deficiency symptoms progress to substantial weight loss and general edema .
ectodermal changes are usually observed several weeks or months after gastrointestinal symptoms have begun and then two or more of the cutaneous triad appear in most patients.2 until now , etiological studies have been limited because of very low incidence rate . unlike many other polyposis syndromes , familial patterns of inheritance have not been identified in ccs .
the japanese author of the largest series described mental stress such as psychological suffering or family problems and physical fatigue as the important precipitating factors for their patients.3 the unique sequential involvement of two epithelial tissues suggests that potentially reversible derangements in epithelial cell - to - cell signaling or maturation may play a pivotal role in initiating the syndrome .
although no experimental evidence has validated this hypothesis , the observation that sulindac administration led to regression of ccs polyps may be interpreted as consistent with this mechanism.4 the efficacy of corticosteroids provides the strongest evidence to suggest an inflammatory cause for ccs . a recent provocative report described the infiltration of immunoglobulin g4 ( igg4)-producing plasma cells in half of the ccs polyps studied in seven affected individuals .
the authors of this report speculated that ccs was an intestinal manifestation of igg4-related autoimmune disease.5 the diagnosis of ccs depends on clinical manifestations .
important baseline blood results include serum electrolyte ( e.g. , calcium , magnesium , potassium , and zinc ) , bun , creatinine , albumin , and total protein levels , as well as the prothrombin time and/or the activated partial thromboplastin time and complete blood count .
upper gastrointestinal series along with small bowel follow through is used to evaluate polyps in the stomach and small bowel .
wireless capsule endoscopy has recently been used to visualize the abnormal mucosal appearance throughout most of the small bowel .
the universal histologic finding is hamartomatous polyps of the juvenile type throughout the gastrointestinal tract without typically involving the esophagus .
polyps are noted in the small bowel in approximately one half of all patients , most often in the duodenum and terminal ileum .
mucosal changes are characterized by intact surface epithelium , edematous chronically inflamed lamina propria , and proliferated tortuous glands .
some of glands are cystically dilated and filled with proteinaceous fluid or inspissated mucus.1 adenomatous changes and carcinoma can occur from hamartomatous polyps in almost 15% of affected patients.6,7 with the increasing observation of gastric and colorectal cancer in patients with ccs , various hypothesizes about this association have been suggested . in literature review
, serrated adenoma has been reported in high prevalence in ccs associated with colorectal cancer .
a japanese group reported that 40% serrated adenomatous polyps in ccs were detected and it was significantly higher compared with about 1% incidence of non - ccs patient 's gastrointestinal polyps .
therefore , they proposed the possibility of a serrated adenoma - carcinoma sequence underlying some ccs.7 our present case is a ccs where serrated adenoma was discovered together with colon cancer .
so we think that there is a possibility of a serrated adenoma - carcinoma sequence in this ccs patient .
when the histological findings of 13 south korean ccs cases were analyzed , most cases had hamartomatous polyps or inflammatory polyps and only one case showed tubular adenoma ( table 1).8 - 19 however , in our case , adenocarcinoma in situ accompanying by dysplasia and tubular adenomas were discovered .
there was no evidence - based medicine or systematic investigations of medical and surgical interventions for ccs treatment .
usually , available management includes nutritional support , administration of zinc , acid suppression , cromolyn sodium , corticosteroid , and eradication of h. pylori . in one case ,
the successful use of nonsteroidal anti - inflammatory drugs to regress ccs polyps was described,4 but many anecdotal reports support the use of corticosteroid.20 however , the number of data supporting corticosteroid use are insufficient , so it is difficult to accept that as a recommendation . in the 13 ccs cases reported in south korea
, small bowel work - up was performed by small bowel series , computed tomography enterography or capsule endoscopy and examination of h. pylori infection was carried out by clo test in only one case .
methylprednisolone and prednisolone were administered in four cases ( 30% ) ( table 1).8 - 19 in one case , they reported antibiotic treatment ( tetracycline ) for diarrhea and another case was treated with h. pylori eradication ( table 1).8 - 19 in the present case , we tried medical treatment with endoscopic polypectomy .
a 40 mg of prednisolone was started and was reduced by 5 mg every week .
the prognosis has not been good . a 5-year mortality rate of 55% was reported and malnutrition , hypoalbuminemia , repetitive infection , sepsis , heart failure , and gastrointestinal bleeding were considered as the causes of death.8 there is no guideline for follow - up and surgical treatment
. however , we think that a follow - up endoscopic polypectomy can be considered as a follow - up method when there is the possibility of cancer , as in our case .
Output:
| cronkhite - canada syndrome ( ccs ) is a rare nonfamilial polyposis syndrome characterized by epithelial disturbances both in the gastrointestinal tract and in the epidermis .
the pathologic finding of the polyp is usually a hamartomatous polyp of the juvenile type ; however , the possibility of serrated adenoma associated malignant neoplasm was reported in some japanese cases .
up till now in south korea , 13 ccs cases have been reported , but there was no case accompanied by the colon cancer .
we report the first case of ccs associated with malignant colon polyp and serrated adenoma in korea . a 72-year - old male patient who complained of diarrhea and weight loss
was presented with both hands and feet nail dystrophy , hyperpigmentation , and alopecia .
endoscopic examination showed numerous hamartomatous polyps from the stomach to the colon .
the pathologic results confirmed colon cancer and serrated adenoma .
helicobacter pylori eradication and prednisolone was used .
thus , the authors report this case along with a literature review . |
PubmedSumm119644 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: antiretroviral therapy ( art ) suppresses efficiently the replication of human immunodeficiency virus type 1 ( hiv-1 ) to undetectable levels with standard techniques in most treated patients , but there is still an ongoing low - grade replication in most or all patients .
also , immune activation is a central feature of progressive hiv-1 infection [ 24 ] , and although the degree of immune activation is decreased during art , it is not normalized .
this is especially important since studies suggest that the remaining immune activation may cause organ damage , for example , an increased risk for cardiovascular diseases and possibly neurocognitive dysfunction [ 5 , 6 ] .
the gastrointestinal ( gi ) immune system seems to play a central role in the pathogenesis of immune activation .
the early dramatic depletion of cd4 + t cells from the gut mucosa may drive immune activation , as this mucosal immune damage impairs the normal barrier function and allows increased translocation of bacterial products from the gut lumen into the circulation . we and others have shown that microbial translocation is present in hiv-1 infection through increased plasma lps levels in subjects with progressive disease and that the levels are decreased by art [ 911 ] . furthermore , we and others have implied that the alarmin high - mobility group binding 1 protein ( hmgb1 ) modulates hiv-1 replication in vitro and contributes to the activation of immune system [ 1214 ] .
thus , plasma hmgb1 levels are elevated in hiv-1-infected patients and reduced with effective art [ 11 , 15 ] .
hmgb1 is released from damaged or necrotic cells to the extracellular milieu , in which it may act as a potent proinflammatory marker by stimulating cytokine expression in monocytes and endothelial cells [ 16 , 17 ] .
hmgb1 per se does not seem to have a pro - inflammatory activity [ 18 , 19 ] but has a high affinity to form complexes with other molecules such as lps and cpg - dna .
these complexes are likely to bind to various receptors , including tlr4 and tlr9 , and promote a large variety of inflammatory and immunological responses [ 20 , 21 ] .
the aim of our study was to explore whether complexes of hmgb1 and tlr ligands , such as flagellin , could synergistically induce hiv-1 replication in a promonocytic cell line .
all research involving human participants has been conducted according to the principles expressed in the declaration of helsinki .
patients gave their informed written consent and the study protocol was approved by the regional ethics committee in stockholm , sweden ( dnr 2005/3:10 ) .
lipopolysaccharide ( lps ) and ( phorbol-12-myristate-13-acetate ) pma were obtained from sigma ( st .
louise , mo , usa ) , il-1 from r&d systems ( minneapolis , mn , usa ) , and cpg - odn type b ( odn2006 ) , purified flagellin ( s.typhimurium ) , and anti - flagellin ( flic ) antibodies from invivogen ( san diego , ca , usa and abcam , cambridge , uk ) .
recombinant hmgb1 ( hm-116 ) was purchased from hmgbiotech ( milan , italy ) or from r&d systems ( minneapolis , mn , usa ) .
we also used recombinant hmgb1 that was a kind gift from professor helena erlandsson - harris cmm / ki , stockholm .
u1 cells , a subclone derived from u937 cells , were obtained through the aids research and reference reagent program ( niaid , nih ) .
the u1 cells are chronically infected with hiv-1 and are characterized by low constitutive levels of virus expression that can be upregulated by several cytokines and phorbol esters .
the cells were maintained in rpmi medium ( gibco ) supplemented with 10% fetal calf serum , glutamine , and antibiotics .
cells were seeded at 200 000 cells / ml in 96-well plates and complexes / tlr - ligands / controls were added and incubated for 48 or 72 hours .
patients ( n = 51 ) given art , followed at the department of infectious diseases , karolinska university hospital , stockholm , and 19 healthy controls were included .
patients ' recruitment was based on sample availability as well as virologic response after 2 years of art .
thirty - three individuals had undetectable viral load and 18 had detectable viraemia ( nonresponders ) after 2 years of treatment .
the age and sex distribution of the patients and controls was similar ( median age 38 years , 52% women ) .
briefly , necrosis was induced in peripheral blood mononuclear cells ( pbmcs ) from healthy donors ( 30 10 cells / ml ) by exposing the cells to six cycles of freezing and thawing .
cell debris was removed by centrifugation and the supernatant was passed through a 0.2 m membrane and collected .
the concentration of hmgb1 in necrotic extracts was 40 g / ml , as estimated by immunoblot ( data not shown ) .
furthermore , 250 l of necrotic extract was incubated with polyclonal anti - hmgb-1 antibodies ( abs ) from abcam ( cambridge , uk ) .
immune complexes were removed by adding 25 l of sepharose a / g to the extract , incubated for 1.5 hours at 4c , and centrifuged . the supernatant was collected and the procedure was repeated again with 25 l sepharose for 1 hour at 4c .
necrotic extract or hmgb1was mixed with the tlr - ligands , lps , cpg - odn , il-1 , and flagellin in pbs in different concentrations and incubated for 16 hours at 4c .
the suboptimal stimulatory concentrations ( capable to trigger hiv replication from u1 cells ) of necrotic extract as well as lps , flagellin , cpg - odn , and il-1 were estimated in a series of experiments ( data not included ) .
complexes were also mixed and denatured by heating at 95c for five minutes to verify the stimulatory effect of complex formation on u1 cells .
equal volumes of necrotic cell extracts , hmgb1-depleted necrotic cell extracts , as well as recombinant hmgb1 proteins were resolved on 1020% tris / glycine gel and transferred onto nitrocellulose membrane ( invitrogen , carlsbad , usa ) .
the membranes were then incubated overnight with anti - hmgb1 abs at 1 : 2000 dilution .
the following day , the membranes were incubated 1 h with horseradish - peroxidase ( hrp- ) conjugated secondary antibody ( ge , healthcare ) , raised against rabbit igg at 1 : 10,000 dilution .
approximately 1.88 g of recombinant flagellin was twofold serially diluted ( 4 series ) and subjected to gel electrophoresis on 1020% precasted sds - page gel ( invitrogen ) in tris / glycine / sds buffer .
similarly , bacterial extracts of flagellated e. coli strain o126:h2 and aflagellate e. coli o21:h-(ccug catalog number 11425 and 11326 , kind gift from professor andrej weintraub , clinical microbiology / ki , stockholm ) that were prepared freshly from an overnight inoculation were also resolved on sds - page gel as described previously .
the proteins were then electroblotted onto iblot gel transfer stacks nitrocellulose membranes , using the iblot dry blotting system ( invitrogen ) , as recommended by the manufacturer . after blocking the nitrocellulose membranes for 1 hour in blocking buffer ( pbs supplemented with 0.05% tween and containing 10% nonfat milk ) , the blots were probed with primary antibodies overnight at 4c with a slow agitation . as primary antibody , serum from hiv-1-infected or control subjects
diluted 1 : 1000 , monoclonal , or polyclonal anti - flagellin abs was used .
the following day , the membranes were washed with pbs containing 0.05% ( vol / vol ) tween and bound antibodies were then detected by using hrp - conjugated secondary abs ( pierce ) against human igg in 1 : 10,000 dilution .
protein bands were visualized by chemiluminescence ( thermo scientific ) . to confirm the protein bands ,
two immunoblotted membranes from hiv-1-infected patients and control subjects were stripped off and reprobed with mouse monoclonal antibody directed against flagellin .
bound antibodies were then detected by using an hrp - conjugated secondary antibody , raised against mouse ( dako ; 1 : 4.000 ) .
antibody titers against flagellin , measles , and total igg levels were assessed by elisa .
an in - house anti - flagellin - specific igg elisa was developed using purified flagellin monomers from s. typhimurium ( invivogen ) .
it has been previously shown that human sera have a similar recognition pattern of flagellin monomers whether isolated from flagellated e. coli or s. typhimurium . briefly
, microwell plates ( mwp ) were coated overnight with purified flagellin from s. typhimurium ( 25 ng / well ) .
the following day , plasma samples from hiv-1-infected and control subjects diluted 1 : 1000 were applied to wells coated with flagellin .
after incubation and washing , the mwps were incubated with hrp - conjuggated anti - human igg . for total igg elisa ,
the enzygnost measeles virus igg elisa kit ( behring , germany ) was utilized for quantification of antimeasles antibodies .
plasma hiv-1 rna levels ( cobas amplicor test roche molecular systems ; usa ; detection limit 40 copies / ml ) and t - cell counts ( flow cytometry ) were evaluated as part of clinical routine .
supernatants were collected at indicated time points and tested for the presence of hiv p24 antigen with architect i2000 hiv-1 ag / ab combo detection system ( abbott diagnostics , abbott park , il , usa ) .
the p24 concentration was calculated based on the several standard dilutions of p24 protein included in each run .
differences between groups were analysed with the mann - whitney u - test , and intragroup changes from baseline to the end of the study were evaluated by wilcoxon test .
jonckheere - terpstra test was used for trend analyses and correlation analyses were performed using the spearman method .
the statistical analyses were performed with spss software , version 15.0 ( spss inc , chicago , usa ) .
to determine the impact of an endogenous signal , associated with cell injury , on hiv-1 replication , we generated soluble necrotic extracts from healthy donors pbmcs .
additionally hmgb1-depleted extracts were obtained by immune depletion utilizing specific anti - hmgb1 antibodies ( figure 1(a ) ) . in the initial experiment ,
the u1 cells were exposed to necrotic extract , hmgb1-depleted extract , and pma , respectively .
the hiv p24 antigen concentration in the cell supernatants was measured after 72 hours ( figure 1(b ) ) .
the levels of viral replication were approximately 2-fold higher after stimulation by necrotic extract compared to the mock cells ( p = 0.002 ) .
the stimulation with pma gave a 10-fold higher viral replication than stimulation with necrotic extract .
notably , addition of necrotic extract depleted of hmgb1 did not result in an increase of viral replication , as compared to the controls , suggesting that hmgb1 crucially contributes to the stimulatory effect of the necrotic extract .
thereafter , we stimulated the u1 cells with necrotic extract , tlr ligands ( lps , flagellin , cpg - odn ) , and il-1 alone or with the complexes of necrotic extract and the tlr ligands or il-1. notably , stimulation with all the tlr ligands , in combination with necrotic extract , resulted in a higher viral replication than stimulation with necrotic extract or tlr ligands alone ( figure 2 ) .
hence , stimulation with lps , cpg - odn and il-1 in complexes with necrotic extract resulted in a 1.52-fold - increased viral replication compared to each component alone , whereas flagellin in combination with necrotic extract resulted in a 7-fold increased replication compared to flagellin alone and a 13-fold - increased replication compared to necrotic extract alone .
the preheating of complexes prior incubation with cells resulted in abrogation of stimulatory signal , implying that the active compound relies on intact protein structure ( data not included ) . in order to explore
if hmgb1 could mimic the synergistic effects of necrotic extract - tlr ligands , we challenged the u1 cells with complexes consisting of hmgb1 and bacterial substances .
indeed , stimulation with microbial products ( lps , flagellin , or cpg - odn ) in combination with hmgb1 resulted in a higher viral replication than stimulation with hmgb1 or tlr ligands alone ( figures 3(a)3(c ) ) .
stimulation with lps , flagellin , and cpg - odn in combination with hmgb1 resulted in a 1.52-fold - increased viral replication compared to each component alone , although the stimulatory effect was not as prominent as with tlr ligands in combination with necrotic extract .
it is known that immune response to flagellin is mediated by tlr5 . to investigate whether anti - tlr5 antibodies could block the inducing effects of flagellin , we first preincubated u1 cells with anti - tlr5 antibodies and subsequently added the necrotic extract complexed with flagellin .
flagellin in combination with hmgb1-depleted extract gave a 3-fold - increased viral replication compared to depleted extract alone , whereas flagellin in combination with necrotic extract gave a 4-fold increase compared to necrotic extract alone ( figure 3(d ) ) .
preincubation of u1 cells with anti - tlr-5 antibodies before addition of necrotic extract - flagellin complexes resulted in a dose - dependent inhibition of this stimulatory effect ( p for trend < 0.001 ) .
encouraged by the in vitro data we aimed to evaluate whether flagellin is a potentially important antigen in vivo during hiv-1 infection .
therefore , serum samples from hiv-1-infected patients and control subjects were used to measure the level of flagellin - specific antibodies by western blot analysis . when diluted 1 : 1000 , all of the sera samples from the hiv-1-infected patients analyzed exhibited easily detectable bands that recognized the first two dilutions of flagellin derived from s. typhimurium ( figure 4(a ) , upper panels ) . a relative increase in flagellin - specific igg in hiv patients
in contrast , in only one control subject ( cs#2 ) flagellin was detected faintly at the highest dilution ( figure 4(a ) , lower panels ) .
although semiquantitative analysis of detected bands was not performed , the levels of flagellin - specific igg observed were in all cases strikingly elevated in hiv-1-infected patients
. similar pattern of anti - flagellin igg was observed when plasma instead of sera was used . in order to address the specificity of the flagellin igg
, we subjected the bacterial lysates from flagellated and aflagellate e. coli to protein separation on the sds - page gel .
the western blotting with hiv-1 serum ( as a primary antibody ) showed similar pattern as when the polyclonal anti - flagellin antibody was used confirming that the specificity of the antibodies was not limited to the recombinant protein ( figure 4(b ) ) .
furthermore , we used the anti - flagellin elisa to evaluate the levels of flagellin igg in plasma of hiv-1-infected patients before and after two years of art . at baseline
significantly elevated levels of flagellin antibodies were found in hiv-1-infected patients as compared to controls ( p < 0.001 ) ( figure 5(a ) ) .
this difference persisted ( p < 0.001 ) when the flagellin antibodies were adjusted to the total igg ( figure 5(b ) ) , suggesting that the elevation of flagellin antibodies was not due to hypergammaglobulinemia .
moreover , analysis of antimeasles antibodies in 10 patients with severe immune deficiency ( cd4 + t - cell counts 200 ) supported that the elevation of the flagellin antibodies was not caused by polyclonal activation supplementary table 1 ( see supplementary material available online at doi:10.1155/2012/263836 ) .
the levels of flagellin igg , total igg , and the ratio flagellin igg / total igg were significantly reduced after two years of art for the whole group ( p < 0.001 , p = 0.03 , and p < 0.001 , resp .
additionally a significant reduction of flagellin igg levels was observed also when the patients were subdivided into those with successful art and the nonresponders who had remaining low levels of viral replication two years after initiating the art ( p = 0.009 ; p = 0.001 , resp . ) .
the total igg levels after art did not decrease in nonresponders as they did in successfully treated patients ( p < 0.001 ) ( data not shown ) .
we found no correlation between the levels of flagellin igg and the viral load nor the cd4/cd8 t - cell counts .
in contrast , among the subgroup of 42 patients in whom we had earlier analysed hgmb1 and lps in plasma , significant correlations were found between the levels of flagellin igg and lps ( r = 0.32 ; p = 0.02 ) as well as between the flagellin igg / total igg ratio and lps ( r = 0.25 ; p = 0.007 ) ( data not shown ) .
microbial translocation has been described in different conditions like inflammatory bowel disease , neutropenia , and chronic viral infections [ 6 , 24 ] . in hiv-1 infection
, the proof for the translocation of bacterial products is based mainly on lps data [ 9 , 11 , 25 , 26 ] .
however , the original observation that increased lps levels were associated with both activated memory cd8 + t cells and enhanced ifn- levels implies the involvement of other factors .
we therefore hypothesized that hmgb1 could be such a link between the microbial products and hyperinflammation .
mounting evidence shows that hmgb1 does not act alone but forms stable potent proinflammatory complexes with other molecules , such as bacterial products or single stranded dna [ 1820 , 28 ] .
since we have earlier shown that hmgb1 alone activates latent hiv-1 replication in vitro , we decided to expand our analysis to the effect of hgmb1 in complexes with bacterial products . here
, we present that hmgb1 in complex with the tlr ligands ( lps , cpg - odn , flagellin ) and il-1 induce viral replication in a promonocytic cell line , u1 cells .
the data obtained with both the hmgb1 derived from necrotic extract as well as recombinant protein yielded similar results , although the stimulatory signals associated with necrotic hmgb1 were more potent .
this is not surprising as other endogenous danger signals should be anticipated in this process .
the reduction of the stimulatory effect by depletion of hgmb1 also supports our hypothesis that hmgb1 is an important component of these complexes .
these in vitro findings brought our attention to flagellin as a potent activator of hiv-1 replication alone or in complexes with hmgb1 .
bacterial flagellins are present in all motile bacteria and play an important role in mediating gut inflammation associated with infection by enteric pathogens or in inflammatory bowel diseases . their proinflammatory activity is exerted mainly through tlr5 [ 30 , 31 ] .
it has been recently demonstrated that flagellin is the major antigen activating innate and adaptive immune response in intestinal inflammation observed in crohn 's disease [ 32 , 33 ] .
disruption of the intestinal barrier promotes translocation of flagellated commensal bacteria across the epithelium driving the activation of innate immune cells residing in the lamina propria .
this phenomenon results also in abnormal exposure of immune cells to flagellin , a process that may influence the balance and function of the different t - cell subsets present in the gut - associated immune system ( galt ) and promote inflammation [ 29 , 34 ] .
the contribution of flagellin to immune activation during hiv-1 infection has been anticipated , but the data are scarce . thus , exposure of pbmcs to flagellin resulted in activation of t cells predominantly of central memory and effector memory phenotype . moreover , flagellin is able to induce hiv-1 gene expression in resting memory cd4 + t cells that are considered as a key cellular hiv-1 reservoir in infected individuals .
our in vitro and in vivo findings are clearly in line with the hypothesis of an important role of flagellin in hiv-1 pathogenesis .
thus , we demonstrated that flagellin complexes are able to significantly stimulate the hiv-1 replication , at least from cells of monocytic origin .
furthermore , our finding that elevated levels of anti - flagellin igg are present in hiv-1-infected individuals anticipates that this observation has in vivo implications .
hence , we show not only presence of elevated levels of flagellin antibodies before the initiation of art but also a reduction after two years of art suggesting decreased exposure to the antigen probably due to partial restoration of gut - blood barrier [ 25 , 37 ] .
the hypergammaglobulinemia present during the hiv-1 infection can not be solely responsible for the elevation of flagellin igg levels as the normalisation to the igg did not influence the results .
an elevated adaptive immune response to flagellin has been previously observed in conditions associated with gut barrier dysfunction such as crohn 's disease and short bowel syndrome [ 23 , 24 ] and relates to the severity of crohn 's disease .
also , kamat et al . reported recently the presence of a subgroup of anti - flagellin antibodies ( anti - cbir1 ) in 4/26 hiv-1-infected patients with cd4 + t - cells counts < 300 cells / ul and high lps levels . the cbir1 flagellin has been identified as an immune dominant flagellin in crohn 's disease and linked to clostridia species .
interestingly a recently presented work has shown alterations in bacterial composition of microbiota during hiv-1 infection with significantly lower ratio of clostridia taxa in faeces obtained from hiv-1-infected patients as compared to controls .
although our assay is based on the recognition of salmonella typhimurium flagellin which spans the two well conserved n- and c - terminal domains of flagellin enabling us the detection of broader range of flagellin antibodies , additional studies are needed to determine the antibody specificity . furthermore , our results deserve future studies of adaptive flagellin immune response in a larger cohort of hiv-1-infected individuals . in summary ,
the novelty of our findings is that the bacterial products and hmgb1 form active complexes which can efficiently not only create a proinflammatory milieu but also directly trigger viral replication in infected cells .
this synergistic effect may require lower levels of the interacting substances when present in complexes , as suggested by others .
we also report that flagellin has to be considered as a microbial product that can contribute to the immune activation during the hiv-1 infection .
the formation of hmgb1/tlr ligand complexes has direct implications on immune activation , particularly in late stage of disease , where cell destruction and necrosis are dominant phenomena due to cd4 + t - cell loss , opportunistic infections , and other pathological conditions .
Output:
| objective . we hypothesized that hmgb1 in complex with bacterial components , such as flagellin , cpg - odn , and lps , promotes hiv-1 replication .
furthermore , we studied the levels of antiflagellin antibodies during hiv-1-infection . methods .
chronically hiv-1-infected u1 cells were stimulated with necrotic extract / recombinant hmgb1 in complex with tlr ligands or alone .
hiv-1 replication was estimated by p24 antigen in culture supernatants 4872 hours after stimulation .
the presence of systemic anti - flagellin igg was determined in 51 hiv-1-infected patients and 19 controls by immunoblotting or in - house elisa .
results .
flagellin , lps , and cpg - odn induced stronger hiv-1 replication when incubated together with necrotic extract or recombinant hmgb1 than activation by any of the compounds alone . moreover ,
the stimulatory effect of necrotic extract was inhibited by depletion of hmgb1 .
elevated levels of anti - flagellin antibodies were present in plasma from hiv-1-infected patients and significantly decreased during 2 years of antiretroviral therapy . conclusions .
our findings implicate a possible role of hgmb1-bacterial complexes , as a consequence of microbial translocation and cell necrosis , for immune activation in hiv-1 pathogenesis .
we propose that flagellin is an important microbial product , that modulates viral replication and induces adaptive immune responses in vivo . |
PubmedSumm119645 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: fragile x syndrome ( fxs ) is the most common mental disorder caused by a cgg trinucleotide amplification on xq27.3 in the 5 untranslated region of fmr1 gene cloned and named in 1991 , which suppresses production of fragile x mental retardation protein ( fmrp ) [ 1 , 2 ] .
fmrp is widely expressed in neuron and glia in brain and acts as an interactor , regulating mrna shuttling , translational control , and synaptic plasticity in copious encephalic regions which are responsible for cognition , emotions , and memory . in fxs individuals ,
compared to attention deficits and hyperactivity which were common in childhood but declined remarkably throughout adolescence and adult years , the morbidity of anxiety remains high with impaired ability of information process .
it is consistent with the common viewpoint that anxiety is a long - lasting response to danger signals that are either from immediate circumstances or from vague indications of ill - defined events . in short ,
anxiety is derived from anomalous regulation of fear . in addition , as one major mood disorder associated with fxs , anxiety occurs with premutation ( alleles between 55 and 200 cgg repeats ) or full mutation ( alleles that exceed 200 cgg repeats ) in both genders and affects limbic system and neocortex [ 4 , 5 ] .
specifically , limbic system and paralimbic system participate in formation and maintenance of anxiety associated with fxs which mainly involve amygdala , prefrontal cortex ( pfc ) , insula , cingulate cortex , temporal cortex , and hippocampus , etc . .
insula is found to be the location where 5-httlpr ( 5-hydroxytryptamine transporter linked polymorphic region ) might cause anxiety .
the hypofunction of prefrontal cortex and anterior cingulate cortex supports the top - down control mechanisms of anxiety process in affected individuals .
the frontostriatal deficits and the dysfunction of the frontoparietal network are proposed to be critical for anxiety processing of external stimuli , etc . [ 9 , 10 ] .
besides the complicated neural network with abnormal expression of fmrp , the dysgenesis of dendritic spine also significantly influences the synaptic plasticity which accounts for anxiety disorders associated with the development of fxs . and
dysfunctional circuits could lead to abnormal spines and vice versa , so it is difficult to figure out which one comes first . because of intricate involvement of proteins regulated by fmrp in synaptic plasticity through maintenance of spine shape and dynamics , the two defects are arguably inseparable . in the present review
, we explored how structure and function coordinately work to promote the anxiety process in fxs and emphasized the selective and monolithic modulation model of the progression .
plasticity is considered as a critical process in pain , learning , memory , emotion , cognition , and so on [ 11 , 12 ] .
substantial evidences have demonstrated that structural changes coordinated with functional changes induce synaptic plasticity , in which ltp and ltd are reciprocally modified by spine density and morphology in fmr1-knockout ( ko ) mice [ 1316 ] . taken together ,
change of plasticity induced by defects in spine morphology or neural circuits is significantly involved in the process of anxiety in fxs [ 16 , 17 ] . on the one hand , it is a significant symbol that the affected individuals have increased quantity of longer dendritic spines .
also , it has been reported that spines were altered in very young fmr1-ko mice , although spine alterations disappear in adolescent mice and reappear in adult [ 20 , 21 ]
so far , these observations were acquired in traditional areas , while high - level cognitive regions had not received enough attention . comparative study in more brain regions of fmr1-ko mice
fmrp plays a vital role in activity - dependent synapse elimination , as well as in spine stabilization , to increase the cell - autonomous spine density [ 18 , 24 ] .
for example , in mouse model of fxs , spine density and morphology are altered in an age- , region- , and cell type - specific pattern ( table 1 ) . on the other hand , it is widely acknowledged that ltp and ltd are molecular mechanisms underlying cognition and emotion .
previous studies showed enhanced metabotropic glutamate receptor- ( mglur- ) ltd and impaired cortical ltp in fmr1-ko mice .
group i mglurs are linked to translational activation in neurons and stimulate rapid synthesis of fmrp at synapses .
due to the link of mglurs with fmrp , mglur - dependent ltd was enhanced in hippocampus [ 2527 ] and cerebellum in fmr1-ko mice . moreover ,
cortical ltp is known to be impaired in learning and fear / anxiety memory , including both mglur - dependent and nmdar - dependent ltp . and
it is expectable that deficits in mglur - dependent ltp and non - mglur - dependent ltp in the anterior cingulate cortex and amygdale were correlated with anxiety - like behaviors of fxs [ 13 , 2830 ] .
interestingly , the activation of mglur5 is involved in the late phase ltp ( l - ltp ) and synaptic depotentiation .
this plasticity induced by mglurs is not simply the alteration of synaptic strength but the change of inducibility of later synaptic plasticity , which suggests that the activation of mglur5 regulates the transport and function of nmda receptor [ 30 , 31 ] .
furthermore , fmrp induced by activation of mglur5 could be the common molecular mechanism of these phenomena by regulation of transport of nmda and ampa receptors [ 3133 ] .
these results suggest that the lack of fmrp may impair ltp and attenuate cortical network recruitment . together
, the loss of fmrp may participate in cortical ltp deficits via ampa receptors internalization at postsynaptic neuron . taken together ,
dysgenesis of dendritic spine and deficits of synaptic plasticity result in the formation of anxiety in fxs mouse models . spine density and morphology
have an alteration by an age- , region- , and cell type - specific manner . also , the defect in spine maturation and pruning is correlated to dysfunction of neural circuits and deficits of synaptic plasticity . on the other hand ,
thus , the ampa receptor internalization , the inheritable rescue of mglur - ltd , and the rescue of the specific dendritic spine might share the common mechanistic basis . in brief ,
dendritic spine dysgenesis and defects in synaptic plasticity promote each other in a structure - function interdependent manner .
in human genetics , the cgg expansion in the promoter region , which includes the cpg island of fmr1 gene , is hypermethylated and provokes the silencing of the transcription of the fmr1 gene , leading to the absence of fmrp , while in the ko mouse model , it is the classical gene knockout effects that result in the silence of fmr1 gene and the loss of fmrp , synaptic function , and plasticity .
what is more , recent laboratory studies have provided increasing evidence for the role of fmrp in translational suppression via ribosomal stalling and microrna [ 57 , 58 ] . and
more evidence about the characteristic of fmrp , a polyribosome - associated rna - binding protein , reveals more profound mechanisms relevant to abnormal synaptic plasticity .
furthermore , fmrp does not regulate single synapse ; instead , it regulates cell - to - cell connectivity .
specifically , at synapses involved in specific situation , two neurons are simultaneously removed , retained , or matured , where fmrp ultimately cause dysfunctional consequences .
there are two main theories illustrating the interaction of fmrp and neuronal activity in the cortical circuits .
the anomalous functions of mglurs - dependent synaptic plasticity have been observed in hippocampus of fmr1-ko mice [ 26 , 59 , 60 ] .
activity - dependent synthesis of fmrp in enduring forms of synaptic plasticity may be induced via exaggerated mglur - ltd in hippocampal neurons , while the initiation of long - term potentiation ( ltp ) is a qualitatively different functional consequence of group i mglur - stimulated protein synthesis at the synapses of hippocampus where ltd can be induced [ 25 , 29 ] .
besides , the mglur theory proposes that stimulation of group i mglur induces local mrna translation , resulting in novel protein synthesis that subsequently enhances the internalization of ampa receptors [ 61 , 62 ] .
this model predicts that , in absence of fmrp , the increased translation of a subset of mrnas disturbs receptor internalization dynamics and then exaggerates internalization of ampa receptors and weakens the synapse .
what is more , independent protein synthesis mglur - ltd in fmr1-ko mice suggests that in absence of fmrp , proteins that are significant for the maintenance of mglur - ltd are already largely present at the synapses .
overall , the mglur theory presents a well - defined mechanism of anxiety in fxs by all accounts : higher density of spines and more immature spines which lead to deficits and anxiety - like behavioral phenotypes in fxs .
the mglur - ltd theory was considered as the main theory of psychological symptoms associated with fxs [ 26 , 61 ] . moreover ,
the mglur theory has directed research towards the preclinical mechanisms underlying fxs and led to the effective novel therapeutic strategies [ 31 , 6366 ] . from the further intracellular perspective
, the phosphorylation of fmrp influences the translation of target mrnas because unphosphorylated fmrp is associated with actively translating polyribosomes while phosphorylated fmrp is associated with inactive polyribosomes . by and large ,
there are three signaling pathways downstream of mglur5 affecting translation : the pi3k - mtor , the mek - erk - mnk1 , and the camkiv - creb pathways .
activation of mammalian mtor cascade results in the phosphorylation of protein phosphatase 2a ( pp2a ) and s6 kinase and mrna translation rapidly .
besides , a thesis reported enhanced ras - pi3k signaling input induced by the activation of glua1 enriches the mtor signaling pathway .
thus , the overactivated mtor signaling pathway in the hippocampus might play a prominent role in fxs .
however , no analogy is reported to compare the relationship between nmda and mtor signaling .
also , it has been demonstrated that camp responsive element - binding protein ( creb ) contributed to the regulation of fmrp by group i mglurs and was closely linked to anxiety [ 55 , 69 ] .
therefore , the main three signaling pathways work together downstream of mglur5 to influence the protein synthesis , synaptic plasticity , and anxiety - like behaviors ( figure 1 ) .
what is more , the camp theory was proposed as a supplement to mglur theory .
apparently it is a potential shortcoming in the context of the mglur theory ; ca and pkc are both part of the gq cascade , which are able to regulate certain ac isozymes and disrupt normal function .
also , there are evidences that cyclic amp and mglur interact with each other because g protein has the potential to act through a network of multiple overlapping messengers .
furthermore , the fact that mglur inhibitors rescue camp deficits in fxs and presumably downstream of excessive mglur activity supports the idea that the two theories operate in series .
importantly , fmrp is broadly expressed in gabaergic neurons , indicating that it is involved in normal interneuron maturation and function modulation .
indeed , it is significant that gaba can modulate neurotransmitter release in an autocrine or paracrine fashion , via mechanisms at presynaptic gabaa and gabab receptors [ 74 , 75 ] .
for example , on the presynaptic side , where fmrp is also expressed [ 76 , 77 ] , the expression of gaba - synthesizing enzyme gad in fmr1-ko mice is found increased or decreased [ 73 , 7881 ] , with the change relying on the brain region examined . in summary ,
gabaergic signaling is essential for regulating neuronal migration , maturation , and circuit formation . and defects in the gabaergic system are , therefore , likely to have profound effects on neuronal development and circuit function in fxs . currently , a better understanding of early developmental alterations in gabaergic system in fxs would be reckoned as the crucial insight into the nature of the fxs brain , as well as valuable information about key pharmacological targets .
furthermore , in mature neurons , the ionotropic gabaa receptors mediate postsynaptic hyperpolarization via intracellular cl influx , while gabab receptors activation likewise hyperpolarizes the postsynaptic membrane by activating g - protein - coupled inwardly rectifying k channels .
in addition to its role as a postsynaptic inhibitory neurotransmitter , distinct mechanisms modulate neurotransmitter release at presynaptic gabaa and gabab receptors [ 74 , 75 ] .
meanwhile , over behavioral effects , gabaa receptors seem to affect more short - term plasticity , seizures , learning and memory deficits , and poor motor skills on a repetitive task and hyperactivity features [ 42 , 82 , 83 ] . and
for instance , papers have reported stx209 , a gabab agonist , might improve neurobehavioral function and satisfying effects were obtained in a phase 2 trial [ 42 , 82 ] .
it also worth noting that the role of gaba in the developing cns is dynamic and variable between brain regions .
therefore , the same gabaergic effectors that helped adult patients could have adverse effects in developing individuals based on the function of gaba in particular brain regions at specific developmental time periods .
overall , both abnormal mglurs and gaba synaptic plasticity play significant synergistic roles in the formation of anxiety .
the gabab receptor may serve as the functional link between both pathways , as this metabotropic receptor regulates glutamate release at glutamatergic synapses . in fxs patients , a reduced release of gaba from the gabaergic terminals to the presynaptic gabab receptors may induce a reduced inhibition of neurotransmitter spillover , which in turn activates mglur signaling .
activation of group i mglurs enables mobilization of endocannabinoids in the postsynaptic neuron and negatively modulates gaba release through a mechanism known as depolarization - induced suppression of inhibition ( dsi ) [ 86 , 87 ] ( figure 2 ) .
these mechanisms require increased neuronal activity , which exists in brain circuitry of fmr1-ko mice .
therefore , in consideration of endocannabinoid mobilization in the fxs , the loss of fmrp may selectively affect specific inhibitory circuits . in the developing and mature brain
, it is critical for cortical excitatory neurons to be proper synchronized at behaviorally relevant frequencies [ 8992 ] . and
thus , alteration of mglur signaling in this specific type of interneuron is likely to have wide - reaching effects in developing and mature cortical networks and needs to be further explored .
how ltp deficits and enhanced ltd are temporally and spatially coordinated with each other in different regions remains to be determined . from the intrinsic modulation perspective
, it has been showed that fmrp would suppress the translation stimulated by neuronal activity and generate neuronal feedback responses to activity at the neuron level .
adding to suppression of translation by mirna and stalled polyribosomes , synaptic regulation , which involves glutamate receptor signaling , gaba receptor signaling in neurons , and intracellular pka , pkc , camp , and pi3k signaling pathways , also implicates fmrp .
on the one hand , mglur and nmda subtypes , as fmrp targets , have diverging structure and features , determining diverse downstream signaling targets , as described before . besides , the initial
role of fmrp associated with its transcripts targets needs more attention . from stimulated receptors on neurons
to intracellular signaling , it could be conclusive that fmrp selectively regulates the expression of components of the erk and mtor signal transduction pathways in different brain areas .
for example , activating glua1 results in the downstream ras - pi3k signaling in hippocampus which shares ras protein with mtor signaling . and these signalings convert receptor activity into translational output .
taken together , it seems that fmrp associated with its target transcripts directly regulates translational control of the pre- and postsynaptic proteome and synaptic plasticity in different brain areas .
considering the primary and secondary procedures , the process should be examined at different times of the nucleus modulation , mrna , or proteome life - cycle .
previously , it has been proposed that rna interference and stalled polyribosomes implicate fmrp . as for now , mirna family , including mir-125b , mir-132 , and mir-196a , were found to be relevant to the regulation .
furthermore , using moloney leukemia virus ( mov10 ) to unfold the structured argonaute 2 ( ago2 ) through rnai and adenosine - to - inosine rna - editing [ 96 , 97 ] proposed novel perspectives to explore the widely unknown target rnas and associated regulation pathways . meanwhile , recently , a sensational work reported that cdh1-anaphase - promoting complex ( apc ) and cdc20-anaphase - promoting complex control the morphogenesis of axons and dendrites and synaptic plasticity .
cdh1-apc and fmrp are components of a novel ubiquitin signaling pathway that regulates mglur - ltd in brain in terms of cell cleavage or neuronal development .
together , an original work reported that the drosophila fragile x homolog ( dfmr1 ) biochemically interacted with the adenosine - to - inosine rna - editing enzyme dadar [ 96 , 97 ] . and
all this work may propose an original view of nucleus modulation of fmrp and consummate the cognition of fmrp 's interactor role on dna , mrna , and stalled polyribosomes levels .
therefore , we can conclude that the cleavage and differentiation of neuron , involving gene editing , rnai , and stalled polyribosomes are integrated and implicated patterns . and just these manners interfere with the diverse synaptic plasticity between hippocampus and other regions .
generally , anxiety is caused not only by connate factors but also by self - regulation of brain homeostasis . during propofol sedation
, fxs subjects have significantly decreased the rates of cerebral protein synthesis ( rcps ) in brain as a whole , cerebellum , and parts of cortex , which also suggests changes in synaptic signaling can balance increased rates of cerebral protein synthesis ( rcps ) in fxs .
also , considerable laboratory research has accumulated copious evidences based on the changes of synaptic plasticity associated with anxiety .
however , there also exist contradictory and promising fields to explore : while further data linking these morphological changes to the functional modifications underlying anxiety process were relatively lacking in fxs , a potential entry point to it is the bdnf - trkb signaling .
also , given the respective importance of ampars and the rho gtpases in functional and morphological plasticity , the exploration of interactions between these two signaling pathways may provide a mechanism to illustrate these changes.short-term plasticity ( stp ) is widely believed to play a key role in synaptic information transmission by optimizing the neural output in response to specific patterns of neuronal activity . although it was identified that presynaptic actions in hippocampus are mediated by the large conductance ca activated k ( bk ) channel together with the interaction of fmrp ,
further study is needed.in recent years , the development of ipscs ( induced pluripotent stem cells ) technology is emerging flourishingly .
a typical example is that generation of naive / ground state fxs - ips cells with reactivated fmr1 successfully figure out a mechanism of transcriptional silencing . in this mechanism ,
fmrp might direct binding the rna - induced silencing complex ( risc ) on the fmr1 transcript and lead to production of 2226 nt cgg fragments .
and then it facilitates fmr1 methylation and silencing by directing histone modifying proteins to the locus .proteins play a complicated role in organisms extensively . lately , a sensational study published in science firstly reported that rqc2 can promote alanine and threonine synthesizing uncompleted protein without the manipulation of dna and mrna .
meanwhile , this peculiar phenomenon may also occur in fxs because of its specific stalled polyribosomes . or maybe some special proteins having homogeneous functions remain to be explored . while further data linking these morphological changes to the functional modifications underlying anxiety process were relatively lacking in fxs , a potential entry point to it
also , given the respective importance of ampars and the rho gtpases in functional and morphological plasticity , the exploration of interactions between these two signaling pathways may provide a mechanism to illustrate these changes .
short - term plasticity ( stp ) is widely believed to play a key role in synaptic information transmission by optimizing the neural output in response to specific patterns of neuronal activity .
although it was identified that presynaptic actions in hippocampus are mediated by the large conductance ca activated k ( bk ) channel together with the interaction of fmrp , further study is needed . in recent years , the development of ipscs ( induced pluripotent stem cells ) technology is emerging flourishingly .
a typical example is that generation of naive / ground state fxs - ips cells with reactivated fmr1 successfully figure out a mechanism of transcriptional silencing . in this mechanism ,
fmrp might direct binding the rna - induced silencing complex ( risc ) on the fmr1 transcript and lead to production of 2226 nt cgg fragments .
and then it facilitates fmr1 methylation and silencing by directing histone modifying proteins to the locus .
proteins play a complicated role in organisms extensively . lately , a sensational study published in science firstly reported that rqc2 can promote alanine and threonine synthesizing uncompleted protein without the manipulation of dna and mrna .
meanwhile , this peculiar phenomenon may also occur in fxs because of its specific stalled polyribosomes . or maybe some special proteins having homogeneous functions remain to be explored .
synaptic plasticity reveals flexibility and codes capacity of neuronal networks . in fxs , the absence of fmrp perturbs the balance in array of diverse plastic mechanisms of synaptic plasticity in a developmental and regional dependent way .
and along anxiety process , a very close structure - function relationship exists between spines and neuronal activity : synaptic strength , synaptic forms of plasticity involved in learning and memory , and activity - dependent plasticity . from the morphology and structural perspectives ,
increased density of longer immature spines may induce the synaptic plasticity and may result from the loss of fmrp in multiple interlaced brain areas . on the point of molecular mechanisms
underlying alterations of synaptic plasticity , the proteins encoded by fmrp target mrnas indicate a high level of control over the balance of activity - dependent translation in synaptic plasticity .
first , mglur and nmdar - dependent synaptic plasticity are altered in fxs mouse models [ 45 , 62 ] .
specifically , this dysregulation of processes involves downstream of gp i mglur signaling and ampa receptor internalization , gaba release , and regulation of mglurs and gaba via endocannabinoid .
second , fmrp regulates the expression of components of the erk and mtor signal transduction pathways selectively , but not in only one way ( table 2 ) . finally , gene editing , endogenous rnai , and stalled polyribosomes may influence the internal regulation of synaptic plasticity . or just this integrated regulation , not single targets , facilitates the pathological progression of plasticity and anxiety - like behavior in fxs .
Output:
| fragile x syndrome ( fxs ) is an inheritable neuropsychological disease caused by expansion of the cgg trinucleotide repeat affecting the fmr1 gene on x chromosome , resulting in silence of the fmr1 gene and failed expression of fmrp .
patients with fxs suffer from cognitive impairment , sensory integration deficits , learning disability , anxiety , autistic traits , and so forth .
specifically , the morbidity of anxiety in fxs individuals remains high from childhood to adulthood . by and large ,
it is common that the change of brain plasticity plays a key role in the progression of disease .
but for now , most studies excessively emphasized the one - sided factor on the change of synaptic plasticity participating in the generation of anxiety during the development of fxs .
here we proposed an integrated concept to acquire better recognition about the details of this process . |
PubmedSumm119646 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a single examination does not fulfill all the functions of assessment , such as assessing knowledge , comprehension , skills , motivation , and feedback .
written examinations ( essays and multiple choices ) test cognitive knowledge , which is only one aspect of the competency .
structuring of questions and assessment through highlighting on objectivity has been emphasized and gained importance in the practical evaluation .
the objective structured practical examination ( ospe ) is now an accepted tool in the assessment of practical skills in both pre- and para - clinical subjects . however , there are no strict or limiting guidelines on the types of scenario that are used in the ospe examinations . in the uk , the usa , canada , and indeed most reputable colleges of medicine , the ospe is the standard mode of assessment of competency , clinical skills , and counseling sessions satisfactorily complementing cognitive knowledge testing in essay writing and objective examination .
several universities adopted a similar pattern of practical evaluation , which is un - uniform and largely subjective .
biochemistry departments in many medical schools have been using the ospe as an assessment method for assessing students performance in laboratory exercises .
the marks awarded generally reflect only the global performance of the candidate and are not based on demonstration of individual competencies . in the university examination , there used to be frequent complaints from external examiners insisting that the existing examination pattern is tedious and time - consuming .
the ospe is a versatile multipurpose evaluative tool that can be utilized to evaluate students in practical assessment .
it is comprised of several stations in which examinees are expected to perform a variety of practical tasks within a specified time period against criteria formulated to the practical skill , thus demonstrating competency of skills and/or attitudes .
ospe has been used to evaluate those areas most critical to perform by students , such as the ability to obtain / interpret data , solve the problem , teach , and communicate .
any attempt to evaluate these critical areas in the old - fashioned practical examination will seem to be assessing theory rather than simulating practical performance .
an earlier innovation in this regard is the objective structured clinical examination ( osce ) later extended to the ospe described in 1975 and in greater detail in 1979 by harden and his group .
these methods with some modifications have stood the test of time and have largely overcome the problems of the conventional clinical / practical examinations mentioned earlier . in view of this
, we tried the system of ospe for the assessment of practical in the subject of biochemistry for the first time .
if the assessment pattern consists of a variety of methods that demand understanding of the subject matter , this problem can be solved to some extent . to test the earlier observation
that a single exam does not fulfill all the functions of assessment , such as assessing knowledge , comprehension and skills , motivation , and providing feedback , we developed an evaluation system .
we undertook this study to evaluate whether ospe could be a method of learning and assessment of practical skills in biochemistry and to explore the student , to determine student satisfaction regarding the ospe as a method of assessment of laboratory exercises and to explore the faculty perception of ospe as a learning and assessment tool .
the first m.b.b.s students admitted for 2011 - 2012 batch of medical college were the subjects for the study .
after successfully completing the syllabus pertaining to the topic on identification of unknown abnormal constituents in urine in practical and unknown abnormal constituents in urine in theory , ospe notification was announced 30 days in advance .
this study was undertaken to determine the reliability and student satisfaction regarding the ospe as a method of assessment of laboratory exercises in biochemistry before implementing it in the forthcoming university examination . before administering this tool for evaluation ,
all the staff members involved in designing and conducting ospe were trained by attending an " workshop on ospe / osce " conducted by medical education unit , medical college .
ready - made and peer agreed upon check list formed the basis of assessment in procedure station .
structured questions were formed for question stations and key answers for the same were also prepared .
since the assessment was being carried out for the first time , the students were oriented toward such a system in advance before administering the tool .
each station was designed such that the task could be completed comfortably within 5 min .
coefficient of reliability of questions administered was done by calculating cronbach 's alpha . a questionnaire on various components of the ospe
however , 49 students on an average achieved > 75% , 52 students achieved between 65% and 75% , and 29 students scored between 50% and 65% .
average scores of students the mean scores of each station and the score obtained by calculation of cronbach 's alpha for testing the internal consistency of the questions administered are depicted in table 1 .
student feedback analysis of response to various aspects of ospe is depicted in table 2 .
feedback from faculty on ospe as an evaluation system has been shown in table 3 .
the mean scores of each station and the score obtained by calculation of cronbach 's alpha for testing the internal consistency of the questions administered student feedback analysis of response to various aspects of objective structured practical examination feedback from faculty on objective structured practical examination as an evaluation system feedback on most appreciated aspects about objective structured practical examination by students
over the years , increasing experience with the procedure has led to the use of ospe not merely as an evaluation tool but as a teaching method .
this has largely been attributable to the feedback that ospe gives both to students and teachers . among 150 students in 1 m.b.b.s ( 2011 - 12 ) batch
, four students could not attend due to their personal reasons . of the 146 students , 101 students performance was highly satisfactory , who scored > 65% of marks on an average .
however , 16 students did not manage to get even 50% of average marks as their performance was equally poor in both performance and question stations .
evaluated marks of question station and check list of procedure station were made available to the students , who appreciated what they achieved and identified and where they need to improve .
feedback given by students was constructive and showed high acceptance , which are presented in table 2 .
ninety - nine percent of students believed that ospe helps them to improve and 81% felt that this type of assessment fits in as both learning and evaluation tools .
however , 65% of students expressed that ospe to be introduced partially in the final exams .
a vast majority of students enjoyed ospe because of its objectivity , more student assessment in less time , and uniformity .
however , 60% of faculty agreed upon the use of ospe in both formative and summative evaluations .
the university examination is conducted in both forenoon and afternoon sessions for 6 consecutive days . in the university examination ,
students used to complain about the irrelevant questions asked by the examiners and also the subjectivity of the examination .
they used to complain that the questions asked in the performance exercises varied in difficulty , giving rise to much variation in the scores . here
, ospe was adopted with the intention of restricting the examination only in the forenoon sessions , thereby reducing the total time , to make the assessment uniform for all students , and also to reduce the stress of students by making them go through only one round of examination instead of two rounds .
the scoring is objective , since standards of competence are pre - set and agreed check lists are used for scoring .
a large number of students can be tested within a short time . from the students point of view
this study reveals the importance of the role of students in developing new assessment tool .
this type of assessment serves as a tool for testing multiple dimensions of student performance because it tests both skills as in performance exercises and knowledge as in ospe .
our findings correlate with the earlier findings that multiple choice questions test more of factual recall .
nevertheless , if framed properly , multiple choice questions could be used to assess different levels of intellectuality .
our results agree with the earlier findings that a single type of assessment alone does not meet all the criteria for evaluating student performance .
it also helps teachers to think about innovative methods of teaching and evaluation to improve the relevance of biochemistry and to modify question format to improve relevance and comprehension of questions in the succeeding exams .
, we found that ospe was more objective , measured practical skills better , and eliminated examiner bias .
student feedback reflects that such assessment helps them to improve as it is effective both as teaching and evaluation tools .
faculty participated in organizing ospe felt that such exercises can be given frequently for formative evaluation before introducing it in summative evaluation .
we have outlined the features of the evaluation system followed in our setup , and based on the feedback , we consider that it would help students to develop different learning skills and make them better learners .
experience and experimentation will inevitably result in the refinement of the ospe as a tool for learning and evaluation .
however , in the current situation , it may not be realistic to expect its inclusion in the formal summative evaluation schedule of universities .
however , it is feasible in view of the tremendous advantages that it offers , to include the formative ( day to day ) assessment of students to improve their clinical competence and to derive an objective score for internal assessment .
Output:
| background : undergraduate medical examination is undergoing extensive re evaluation with new core educational objectives being defined .
consequently , new exam systems have also been designed to test the objectives .
objective structured practical examination ( ospe ) is one of them.objectives:to introduce ospe as a method of assessment of practical skills and learning and to determine student satisfaction regarding the ospe .
furthermore , to explore the faculty perception of ospe as a learning and assessment tool.materials and methods : the first m.b.b.s students of 2011 12 batch of medical college , kolkata , were the subjects for the study .
ospe was organized and conducted on identification of unknown abnormal constituents in urine .
coefficient of reliability of questions administered was done by calculating cronbach 's alpha . a questionnaire on various components of the ospe
was administered to get the feedback.results:16 students failed to achieve an average of 50% or above in the assessment . however , 49 students on an average achieved > 75% , 52 students achieved between 65% and 75% , and 29 students scored between 50% and 65% .
cronbach 's alpha of the questions administered showed to be having high internal consistency with a score of 0.80 .
ninety nine percent of students believed that ospe helps them to improve and 81% felt that this type of assessment fits in as both learning and evaluation tools .
faculty feedback reflected that such assessment tested objectivity , measured practical skills better , and eliminated examiner bias to a greater extent.conclusion:ospe tests different desired components of competence better and eliminated examiner bias .
student feedback reflects that such assessment helps them to improve as it is effective both as teaching and evaluation tools . |
PubmedSumm119647 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: an ongoing outcomes follow - up project with a prospective inception cohort in western canada was started in 1996 . as described previously , infants were identified at the time of complex cardiac surgery and were followed prospectively.11 in this study , we included all infants aged 6 weeks who were admitted to the pediatric intensive care unit after surgery for complex chd ( defined as requiring cardiopulmonary bypass ) at the stollery children s hospital between september 1996 and february 2009 .
demographic , preoperative , intraoperative , and postoperative variables that were previously agreed on were collected prospectively.11 chromosomal abnormalities were identified by routine karyotype and analysis for del22q11.2 in all infants and as clinically indicated up to age of follow - up .
sepsis was defined as a positive blood culture that was treated for at least 5 days with intravenous antibiotics .
potential skin contaminants in the blood culture ( coagulase - negative staphylococci , aerococcus spp , micrococcus spp , corynebacterium spp , propionibacterium spp , viridians group streptococci , or bacillus spp [ not b. anthracis])12 required 2 positive blood cultures or 1 positive blood culture associated with fever or hypothermia , abnormal white blood cell count , and increase in inotrope score on the day of the culture .
the patients with potential skin contaminants in the blood culture were identified as those with a gram - positive organism grown from the culture .
all of these patients had their charts reviewed retrospectively to confirm the above criteria ; sepsis was confirmed in 41 of 57 ( 72% ) and ruled out in the others .
pragmatically , our definition of sepsis was meant to include children with clinical sepsis ( ie , had an indication for the clinician to perform blood culture and to decide to treat with intravenous antibiotics for at least 5 days ) with bacteremia and did not capture children that may have had clinical sepsis without proven bacteremia .
we were able to review all required charts to confirm the criteria , and we cross - checked them with our hospital infection control nosocomial bacteremia database .
long - term follow - up was performed , with parental or guardian consent , during the respective follow - up visits at the tertiary site of origin .
the follow - up study and database were approved by the institutional health research ethics board .
outcomes assessments were completed at a mean of 55 months ( sd 6 ; median 54 months , interquartile range 51 to 59 months ) of age .
pediatric psychologists administered the wechsler preschool and primary scale of intelligence , revised ( 38 children tested prior to 2002 ) and third edition ( 358 children tested from 2002 onward ) , to obtain the full - scale intelligence quotient ( fsiq ) , the performance intelligence quotient ( piq ) , and the verbal intelligence quotient ( viq ) and administered the beery - buktenica developmental test of visual motor integration ( vmi ) , fifth edition ; the results of the adaptive behavior assessment system , second edition ( abas - ii ) were obtained at the respective referral institutions.1316 the preschool version of abas - ii is a parent / caregiver - completed questionnaire to provide comprehensive , norm - referenced assessment of adaptive skills for children aged 0 to 5 years .
the general adaptive composite ( gac ) score from the abas - ii is used to assess adaptive function in children .
all scores have a normative population mean of 100 and sd of 15 , and higher scores indicate better performance ; a score < 70 is 2 sd below the mean and is expected in 2.27% of the normative population .
continuous variables are presented as mean ( sd ) , and categorical variables are presented as counts ( percentages ) . to screen for variables associated with the outcome variables , we used univariate regression models and included the following a priori specified variables from the respective perioperative time periods : demographic ( gestational age , birth weight , socioeconomic status,17 sex , chromosomal abnormality , and single ventricle anatomy ) , preoperative ( 5-minute apgar score , year of surgery ) , intraoperative ( cardiopulmonary bypass time , aortic cross - clamp time , and deep hypothermic circulatory arrest used ) , postoperative ( day 1 highest lactate , day 1 inotrope score,18 day 1 highest creatinine , day 1 highest base deficit , and the time for lactate to fall to 2
mmol / l ) , and all perioperative time periods ( seizures , cardiopulmonary resuscitation , dialysis , sepsis , and extracorporeal membrane oxygenation [ ecmo ] anytime up to age 4 years ) . to screen for variables associated with neurocognitive outcomes , we used univariate regression models .
multiple linear regression models consisted of variables found approaching significance at p0.10 in the univariate analysis and after screening for multicollinearity ; they are presented as regression coefficients with 95% cis and 2-sided p values .
the regression coefficient represents the average change in the outcome for each unit increase in the explanatory ( predictor ) variable .
multiple cox proportional hazards regression analysis for mortality by 4.5 years included variables that were significant at p0.10 in the corresponding univariate analysis and after screening for multicollinearity , and they are presented as hazard ratios with 95% cis and 2-sided p values .
low counts for some variables did not allow validation of the proportionality assumption in cox models .
multicollinearity was assessed using pearson correlation for continuous variables and , when at least 1 of the variables was binary , using spearman correlation ; pairs of variables with a correlation > 0.7 were declared collinear , and only 1 was entered into the multiple model according to clinical and statistical significance.19 using variance inflation factor as a regression diagnostic measure did not change the findings for collinearity.19 the statistical modeling is exploratory , investigating the effect of prespecified clinically and biologically important variables ( sepsis and ecmo ) while controlling for other potentially predictive confounding variables ( those found significant on univariate analyses ) .
we hypothesized that sepsis and ecmo would be associated with outcomes on multivariable analyses based on previous studies.19,20,21 statistical analyses were performed using sas version 9.3 ( sas institute ) .
the primary outcomes for this study were the intelligence quotient ( fsiq , piq , viq ) outcomes in survivors .
outcomes assessments were completed at a mean of 55 months ( sd 6 ; median 54 months , interquartile range 51 to 59 months ) of age .
pediatric psychologists administered the wechsler preschool and primary scale of intelligence , revised ( 38 children tested prior to 2002 ) and third edition ( 358 children tested from 2002 onward ) , to obtain the full - scale intelligence quotient ( fsiq ) , the performance intelligence quotient ( piq ) , and the verbal intelligence quotient ( viq ) and administered the beery - buktenica developmental test of visual motor integration ( vmi ) , fifth edition ; the results of the adaptive behavior assessment system , second edition ( abas - ii ) were obtained at the respective referral institutions.1316 the preschool version of abas - ii is a parent / caregiver - completed questionnaire to provide comprehensive , norm - referenced assessment of adaptive skills for children aged 0 to 5 years . the general adaptive composite ( gac )
all scores have a normative population mean of 100 and sd of 15 , and higher scores indicate better performance ; a score < 70 is 2 sd below the mean and is expected in 2.27% of the normative population .
continuous variables are presented as mean ( sd ) , and categorical variables are presented as counts ( percentages ) . to screen for variables associated with the outcome variables , we used univariate regression models and included the following a priori specified variables from the respective perioperative time periods : demographic ( gestational age , birth weight , socioeconomic status,17 sex , chromosomal abnormality , and single ventricle anatomy ) , preoperative ( 5-minute apgar score , year of surgery ) , intraoperative ( cardiopulmonary bypass time , aortic cross - clamp time , and deep hypothermic circulatory arrest used ) , postoperative ( day 1 highest lactate , day 1 inotrope score,18 day 1 highest creatinine , day 1 highest base deficit , and the time for lactate to fall to 2
mmol / l ) , and all perioperative time periods ( seizures , cardiopulmonary resuscitation , dialysis , sepsis , and extracorporeal membrane oxygenation [ ecmo ] anytime up to age 4 years ) . to screen for variables associated with neurocognitive outcomes , we used univariate regression models .
multiple linear regression models consisted of variables found approaching significance at p0.10 in the univariate analysis and after screening for multicollinearity ; they are presented as regression coefficients with 95% cis and 2-sided p values .
the regression coefficient represents the average change in the outcome for each unit increase in the explanatory ( predictor ) variable .
multiple cox proportional hazards regression analysis for mortality by 4.5 years included variables that were significant at p0.10 in the corresponding univariate analysis and after screening for multicollinearity , and they are presented as hazard ratios with 95% cis and 2-sided p values .
low counts for some variables did not allow validation of the proportionality assumption in cox models .
multicollinearity was assessed using pearson correlation for continuous variables and , when at least 1 of the variables was binary , using spearman correlation ; pairs of variables with a correlation > 0.7 were declared collinear , and only 1 was entered into the multiple model according to clinical and statistical significance.19 using variance inflation factor as a regression diagnostic measure did not change the findings for collinearity.19 the statistical modeling is exploratory , investigating the effect of prespecified clinically and biologically important variables ( sepsis and ecmo ) while controlling for other potentially predictive confounding variables ( those found significant on univariate analyses ) .
we hypothesized that sepsis and ecmo would be associated with outcomes on multivariable analyses based on previous studies.19,20,21 statistical analyses were performed using sas version 9.3 ( sas institute ) .
the primary outcomes for this study were the intelligence quotient ( fsiq , piq , viq ) outcomes in survivors .
there were 502 consecutive infants enrolled in the inception cohort at the time of cardiac surgery at age 6 weeks .
demographics included 315 ( 63% ) male patients , 160 ( 32% ) with single ventricle anatomy , 49 ( 10% ) having ecmo at any time up to age 4.5 years , and 45 ( 9% ) with chromosomal abnormality .
perioperative sepsis occurred in 97 patients ( 19% ) overall and in 76 of 396 survivors ( 19% ) with 4.5-year follow - up . by 4.5 years of age
, there were 91 deaths ( 18% ) , and 396 of 411 survivors ( 96% ) had neurocognitive follow - up completed ( figure ) .
regarding mortality , 31 ( 6.2% ) and 86 ( 17% ) patients had died at 30 days and 2 years , respectively .
there was no evidence of collinearity between sepsis and ecmo at any time ( correlation 0.03 , p = 0.48 ) .
the mean neurocognitive outcomes in survivors at 4.5 years of age included fsiq 90.6 ( sd 18.6 ) , viq 90.8 ( sd18.6 ) , piq 91.4 ( sd 19.2 ) , vmi 89.7 ( sd 16.7 ) , and gac 89.6 ( sd 18.1 )
. scores < 70 on both fsiq and gac occurred in 43 patients ( 10.9% ) ; therefore , the neurocognitive outcomes shifted to the left of the normative population , with more than expected having scores > 2 sd below the mean .
description of the cohort of 502 patients having cardiac surgery in early infancy ecmo indicates extracorporeal membrane oxygenation ; fsiq , full - scale intelligence quotient ; gac , general adaptive composite ; iqr , interquartile range ; piq , performance intelligence quotient ; viq , verbal intelligence quotient ; vmi , beery - buktenica developmental test of visual motor integration .
perioperative sepsis occurred in 97 patients , 29 preoperatively , 75 postoperatively , and 7 both pre- and postoperatively . in the sepsis subgroup , 12 of 97 ( 12% ) had ecmo and 11 of 97 ( 11% ) had chromosomal abnormalities .
of the 76 sepsis survivors , 5 ( 7% ) had ecmo and 7 ( 9% ) had chromosomal abnormality .
flow diagram of the inception cohort and analyses for mortality and neurocognitive outcomes . on multiple cox proportional hazards
regression analysis , sepsis was not and ecmo was associated with mortality by 4.5 years ( hazard ratio 1.9 ; 95% ci 1.17 to 3.18 ; p = 0.01 ) ( table 2 ) .
univariate and multiple cox proportional hazards regressions for death at 4.5 years in 502 patients having cardiac surgery in early infancy cpb indicates cardiopulmonary bypass ; cpr , cardiopulmonary resuscitation ; ecmo , extracorporeal membrane oxygenation ; hr , hazard ratio .
mean fsiq , piq , and viq scores at 4.5 years of age for the 76 sepsis survivors were 84.8 ( sd 17.5 ) , 84.8 ( sd 17.6 ) , and 85.8 ( sd 17.7 ) , respectively ; these scores are statistically significantly lower than the respective scores in the rest of the cohort ( 92 [ sd 18.6 ] , p = 0.002 ; 93 [ sd 19.3 ] , p = 0.001 ; and 92 [ sd 18.6 ] , p = 0.009 ) .
univariate and multivariable predictors of the fsiq , viq , and piq outcomes are given in tables3 and 4 , respectively .
chromosomal abnormality was associated with worse scores on all of these outcomes on multivariable analyses .
ecmo anytime in the first 4 years was also strongly associated with worse scores on all of these outcomes on multivariable analyses ; for fsiq , the regression coefficient was 13.6 ( 95% ci 21.3 to 5.9 ; p = 0.001 ) .
sepsis perioperatively was associated with piq and viq , with a trend toward significance for fsiq ( p = 0.058 ) on multivariable analyses .
the regression coefficient for sepsis was strongest for piq ( 5.31 ; 95% ci 9.84 to 0.78 ; p = 0.022 ) .
other variables associated with 2 iq outcomes on multivariable analyses included socioeconomic status , single ventricle anatomy , and sex .
post hoc exploration for an interaction between sepsis and single ventricle anatomy found that interaction terms were not statistically significant .
univariate linear regressions for full - scale intelligence quotient , performance intelligence quotient , and verbal intelligence quotient at 4.5 years of age in 396 survivors of cardiac surgery in early infancy ecmo indicates extracorporeal membrane oxygenation ; fsiq , full - scale intelligence quotient ; piq , performance intelligence quotient ; viq , verbal intelligence quotient .
multivariable linear regressions for full - scale intelligence quotient , performance intelligence quotient , and verbal intelligence quotient at 4.5 years of age in 396 survivors of cardiac surgery in early infancy r indicates the variability in the outcomes scores accounted for by the model .
ecmo indicates extracorporeal membrane oxygenation ; fsiq , full - scale intelligence quotient ; piq , performance intelligence quotient ; viq , verbal intelligence quotient .
univariate and multivariable predictors of the secondary outcomes of vmi and gac are given in tables5 and 6 .
ecmo anytime in the first 4.5 years was also strongly associated with worse scores on multivariable analyses , with regression coefficients of 13.4 ( 95% ci 20.1 to 6.7 ; p<0.001 ) and 12.7 ( 95% ci 20.3 to 5.0 ; p = 0.001 ) for vmi and gac , respectively .
other predictors on multivariable analysis for gac included birth weight and sex and for vmi included birth weight and single ventricle anatomy .
univariate linear regressions for general adaptive composite of the adaptive behavioral assessment system and visual motor integration at 4 years of age in 396 survivors of cardiac surgery in early infancy ecmo indicates extracorporeal membrane oxygenation .
multivariable linear regressions for general adaptive composite and visual motor integration at 4 years of age in 396 survivors of cardiac surgery in early infancy r indicates the variability in the outcomes scores accounted for by the model .
post hoc , we explored whether excluding children who had ecmo at any time in the first 4.5 years would change the results for the primary outcomes .
we hypothesized that ecmo could mask other predictors that may be important in determining outcomes .
there was no evidence of collinearity between sepsis and ecmo ( correlation 0.03 , p = 0.48 ) . excluding children who had ecmo did not significantly change the results for any of the primary outcomes ( data not shown ) .
sepsis remained a predictor of viq and piq , and the trend for fsiq remained ( p = 0.079 ) on multivariable analyses .
the only new association on multivariable analysis was between socioeconomic status and piq ( regression coefficient 0.14 ; 95% ci 0.01 to 0.28 ; p = 0.039 ) .
there were 502 consecutive infants enrolled in the inception cohort at the time of cardiac surgery at age 6 weeks .
demographics included 315 ( 63% ) male patients , 160 ( 32% ) with single ventricle anatomy , 49 ( 10% ) having ecmo at any time up to age 4.5 years , and 45 ( 9% ) with chromosomal abnormality .
perioperative sepsis occurred in 97 patients ( 19% ) overall and in 76 of 396 survivors ( 19% ) with 4.5-year follow - up . by 4.5 years of age
, there were 91 deaths ( 18% ) , and 396 of 411 survivors ( 96% ) had neurocognitive follow - up completed ( figure ) .
regarding mortality , 31 ( 6.2% ) and 86 ( 17% ) patients had died at 30 days and 2 years , respectively .
there was no evidence of collinearity between sepsis and ecmo at any time ( correlation 0.03 , p = 0.48 ) .
the mean neurocognitive outcomes in survivors at 4.5 years of age included fsiq 90.6 ( sd 18.6 ) , viq 90.8 ( sd18.6 ) , piq 91.4 ( sd 19.2 ) , vmi 89.7 ( sd 16.7 ) , and gac 89.6 ( sd 18.1 )
. scores < 70 on both fsiq and gac occurred in 43 patients ( 10.9% ) ; therefore , the neurocognitive outcomes shifted to the left of the normative population , with more than expected having scores > 2 sd below the mean .
description of the cohort of 502 patients having cardiac surgery in early infancy ecmo indicates extracorporeal membrane oxygenation ; fsiq , full - scale intelligence quotient ; gac , general adaptive composite ; iqr , interquartile range ; piq , performance intelligence quotient ; viq , verbal intelligence quotient ; vmi , beery - buktenica developmental test of visual motor integration .
perioperative sepsis occurred in 97 patients , 29 preoperatively , 75 postoperatively , and 7 both pre- and postoperatively . in the sepsis subgroup , 12 of 97 ( 12% ) had ecmo and 11 of 97 ( 11% ) had chromosomal abnormalities .
of the 76 sepsis survivors , 5 ( 7% ) had ecmo and 7 ( 9% ) had chromosomal abnormality .
flow diagram of the inception cohort and analyses for mortality and neurocognitive outcomes . on multiple cox proportional hazards
regression analysis , sepsis was not and ecmo was associated with mortality by 4.5 years ( hazard ratio 1.9 ; 95% ci 1.17 to 3.18 ; p = 0.01 ) ( table 2 ) .
univariate and multiple cox proportional hazards regressions for death at 4.5 years in 502 patients having cardiac surgery in early infancy cpb indicates cardiopulmonary bypass ; cpr , cardiopulmonary resuscitation ; ecmo , extracorporeal membrane oxygenation ; hr , hazard ratio .
mean fsiq , piq , and viq scores at 4.5 years of age for the 76 sepsis survivors were 84.8 ( sd 17.5 ) , 84.8 ( sd 17.6 ) , and 85.8 ( sd 17.7 ) , respectively ; these scores are statistically significantly lower than the respective scores in the rest of the cohort ( 92 [ sd 18.6 ] , p = 0.002 ; 93 [ sd 19.3 ] , p = 0.001 ; and 92 [ sd 18.6 ] , p = 0.009 ) .
univariate and multivariable predictors of the fsiq , viq , and piq outcomes are given in tables3 and 4 , respectively .
chromosomal abnormality was associated with worse scores on all of these outcomes on multivariable analyses .
ecmo anytime in the first 4 years was also strongly associated with worse scores on all of these outcomes on multivariable analyses ; for fsiq , the regression coefficient was 13.6 ( 95% ci 21.3 to 5.9 ; p = 0.001 ) .
sepsis perioperatively was associated with piq and viq , with a trend toward significance for fsiq ( p = 0.058 ) on multivariable analyses .
the regression coefficient for sepsis was strongest for piq ( 5.31 ; 95% ci 9.84 to 0.78 ; p = 0.022 ) .
other variables associated with 2 iq outcomes on multivariable analyses included socioeconomic status , single ventricle anatomy , and sex .
post hoc exploration for an interaction between sepsis and single ventricle anatomy found that interaction terms were not statistically significant .
univariate linear regressions for full - scale intelligence quotient , performance intelligence quotient , and verbal intelligence quotient at 4.5 years of age in 396 survivors of cardiac surgery in early infancy ecmo indicates extracorporeal membrane oxygenation ; fsiq , full - scale intelligence quotient ; piq , performance intelligence quotient ; viq , verbal intelligence quotient .
multivariable linear regressions for full - scale intelligence quotient , performance intelligence quotient , and verbal intelligence quotient at 4.5 years of age in 396 survivors of cardiac surgery in early infancy r indicates the variability in the outcomes scores accounted for by the model .
ecmo indicates extracorporeal membrane oxygenation ; fsiq , full - scale intelligence quotient ; piq , performance intelligence quotient ; viq , verbal intelligence quotient .
univariate and multivariable predictors of the secondary outcomes of vmi and gac are given in tables5 and 6 .
ecmo anytime in the first 4.5 years was also strongly associated with worse scores on multivariable analyses , with regression coefficients of 13.4 ( 95% ci 20.1 to 6.7 ; p<0.001 ) and 12.7 ( 95% ci 20.3 to 5.0 ; p = 0.001 ) for vmi and gac , respectively .
other predictors on multivariable analysis for gac included birth weight and sex and for vmi included birth weight and single ventricle anatomy .
univariate linear regressions for general adaptive composite of the adaptive behavioral assessment system and visual motor integration at 4 years of age in 396 survivors of cardiac surgery in early infancy ecmo indicates extracorporeal membrane oxygenation .
multivariable linear regressions for general adaptive composite and visual motor integration at 4 years of age in 396 survivors of cardiac surgery in early infancy r indicates the variability in the outcomes scores accounted for by the model .
post hoc , we explored whether excluding children who had ecmo at any time in the first 4.5 years would change the results for the primary outcomes .
we hypothesized that ecmo could mask other predictors that may be important in determining outcomes .
there was no evidence of collinearity between sepsis and ecmo ( correlation 0.03 , p = 0.48 ) . excluding children who had ecmo did not significantly change the results for any of the primary outcomes ( data not shown ) .
sepsis remained a predictor of viq and piq , and the trend for fsiq remained ( p = 0.079 ) on multivariable analyses .
the only new association on multivariable analysis was between socioeconomic status and piq ( regression coefficient 0.14 ; 95% ci 0.01 to 0.28 ; p = 0.039 ) .
first , perioperative sepsis , defined as a positive blood culture not due to a contaminated specimen and treated with intravenous antibiotics for at least 5 days , was associated with adverse long - term viq and piq ( and with a trend to adverse fsiq ; p = 0.058 ) outcomes on multivariable analyses .
second , ecmo at any time in the first 4.5 years of life was associated with adverse outcomes on all fsiq , viq , piq , vmi , and gac scores on multivariable analyses .
third , these associations on multivariable analyses were found after controlling for other prespecified contributors to adverse outcomes , including severity of illness ( eg , lactate , inotrope score ) , demographics ( eg , birth weight , sex , socioeconomic status , chromosomal abnormality , single ventricle anatomy ) , and other perioperative events ( eg , deep hypothermic circulatory arrest , cardiopulmonary resuscitation , seizures ) .
in fact , several of these variables were also associated with some of the adverse neurocognitive outcomes on multivariable analyses , including birth weight , socioeconomic status , single ventricle anatomy , and chromosomal abnormality .
of particular importance , sepsis was the only consistently identified , potentially modifiable variable associated with the neurocognitive outcomes on multivariable analyses .
the only other potentially modifiable variables associated with neurocognitive outcomes on multivariable analyses reflected early postoperative severity of illness : postoperative time for lactate to fall 2 mmol / l and postoperative day 1 inotrope score were associated with adverse viq and gac , respectively .
the finding of the association between sepsis and adverse neurocognitive outcomes on multivariable analyses is consistent with the adult literature14 and strengthens the existing pediatric literature59 by using a large sample size in a prospective inception cohort ( n = 396 survivors ) , a high rate of follow - up ( 96% of survivors followed to 4.5 years of age ) , a detailed neurocognitive assessment done with validated standardized testing,1316 and adjustment for many potentially confounding variables . that sepsis is a potentially modifiable predictor of adverse outcomes is supported by literature on the prevention of sepsis in the critical care environment.22,23
this is also important because sepsis is increasingly common in the pediatric intensive care unit.2426 the finding of the association between ecmo and adverse neurocognitive outcomes on multivariable analyses has been suspected before but , to our knowledge , has not been confirmed in a large cohort , adjusting for potential confounders.20,21 a recent review found that neurocognitive outcomes after ecmo in children has been examined in only a few small studies , often without detailed neurocognitive assessment and/or comparison to control groups with similar demographics and surgery.20 this study has limitations .
first , it is an observational study , and we can not claim a cause - and - effect relationship between predictors and outcomes .
second , our definition of sepsis requiring a positive blood culture may have missed many cases of nonbacteremic sepsis . in addition
, we can not confirm that all of our patients had the systemic inflammatory response syndrome , part of the definition of sepsis , because we did not record temperature , respiratory rate , heart rate , or white blood cell count for all of the included children .
third , although patients were enrolled and had variables recorded prospectively , the confirmation of blood culture results was done retrospectively .
fourth , the rates of perioperative blood culture positive sepsis were high.27 hospital - acquired infection rates in pediatric patients undergoing surgical correction of chd has been reported to be 16% , with bloodstream infection rates of 5% to 10%.27 fifth , a small number of the children at the beginning of the study were tested with an earlier edition of the wechsler preschool and primary scale of intelligence test for neurocognitive outcomes .
data collection for this study extended for over 11 years , during which time the intelligence test was revised .
the option of continuing with the outdated test was rejected based on the principle of using the up - to - date version . with no difference between the means ( sds ) of the 2 editions within the normative population and within a previously published cohort from our group
, we proceeded to include all children in the cohort.28 sixth , sepsis was not associated with ecmo ; it is possible that the severity of the underlying chd and residual cardiac lesions , postoperative complications including cardiac arrest and low cardiac output , and our definition of sepsis not capturing many children with clinical sepsis ( ie , without bacteremia ) may have confounded any impact of sepsis on need for ecmo .
finally , because this study explored the predictors of outcome in a large cohort of children , all of whom had surgery in early infancy for chd , we can not comment on outcomes or predictors of outcomes in children with chd who did not have surgery in early infancy .
nevertheless , the multivariate analyses done controlled for prespecified potential predictors of outcome identified in previous studies,11 and the criteria used to confirm blood culture results were prespecified and objective , modified from the centers for disease control and prevention definitions.12 furthermore , we included a group of infants at high risk for sepsis , having complex surgery for chd at age 6 weeks , requiring many days of pre- and postoperative intensive care , and often having central venous lines and intubation for much of that time.27 importantly , the high rate of sepsis suggests that known systems and interventions to prevent nosocomial infections have the potential to improve long - term neurocognitive outcomes in these children.22,23 the association of sepsis with adverse neurocognitive outcomes may be an underestimate , given that many cases of nonbacteremic sepsis likely occurred .
our statistical approach was to use multivariable analyses to explore for predictors of outcome while adjusting for clinically ( sepsis and ecmo ) and statistically ( on univariate analysis ) important potentially confounding variables . in a large prospective inception cohort of patients having complex cardiac surgery early in infancy
, we found that perioperative sepsis was associated with adverse neurocognitive outcomes on multivariable analyses .
having received ecmo at any time in the first 4 years of life was also found to be strongly associated with adverse neurocognitive outcomes on multivariable analyses .
nosocomial perioperative sepsis is a potentially modifiable variable , and these data highlight the importance of infection control practices in intensive care .
the complex pediatric therapies follow - up program has been supported over the years by alberta health , the stollery children s hospital , and the glenrose rehabilitation hospital . the women and children s health research institute has funded acute care data collection starting in 2014 .
these funding agencies had no role in the design and conduct of the study ; collection , management , analysis or interpretation of the data ; preparation , review , or approval of the manuscript ; or the decision to submit the manuscript for publication .
Output:
| backgroundwe aimed to determine whether sepsis is associated with neurocognitive outcomes 4.5 years after congenital heart disease surgery in early infancy.methods and resultsa secondary analysis from a prospective inception cohort included all children having congenital heart disease surgery done at 6 weeks of age with cardiopulmonary bypass at the western canadian referral center from 1996 to 2009 .
follow - up at the referral center determined the primary outcomes at 4.5 years with full - scale , performance , and verbal intelligence quotients on the wechsler preschool and primary scale of intelligence .
perioperative variables were collected prospectively , and confirmation of blood culture positive sepsis was done retrospectively .
multiple linear regression models for neurocognitive outcomes and multiple cox proportional hazards regression for mortality were determined .
sepsis occurred in 97 of 502 patients ( 19% ) overall and in 76 of 396 survivors ( 19% ) with 4.5-year follow - up . by 4.5 years
, there were 91 ( 18% ) deaths , and 396 of 411 survivors ( 96% ) had follow - up completed .
extracorporeal membrane oxygenation was associated with worse scores on all neurocognitive outcomes on multivariable regression ; the association between extracorporeal membrane oxygenation and full - scale intelligence quotient had a regression coefficient of 13.6 ( 95% ci 21.3 to 5.9 ; p = 0.001 ) .
sepsis perioperatively was associated with performance and verbal intelligence quotients , with a trend for full - scale intelligence quotient ( p = 0.058 ) on multivariable regression .
the regression coefficient for sepsis was strongest for performance intelligence quotient ( 5.31 ; 95% ci 9.84 to 0.78 ; p = 0.022 ) .
sepsis was not but extracorporeal membrane oxygenation was associated with mortality by 4.5 years.conclusionsperioperative sepsis and extracorporeal membrane oxygenation were associated with adverse neurocognitive outcomes on multivariable regression .
quality improvement to prevent sepsis has the potential to improve long - term neurocognitive outcomes in infants after surgery for congenital heart disease . |
PubmedSumm119648 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: hypertension is an important worldwide public - health challenge because it is one of the most common chronic conditions [ 1 , 2 ] .
the prevalence of hypertension in sub - saharan africa is between 12.5 and 26.9% . in 2005
the world health organization stepwise approach to surveillance of noncommunicable diseases risk factors established prevalence of hypertension in cte d'ivoire to 21.7% .
hypertension is a major risk factor for cardiovascular ( cv ) disease [ 57 ] .
it remains an important cause of coronary heart disease , cerebrovascular disease , peripheral artery disease , and heart failure .
age is the most powerful risk factor for hypertension , death , and cardiovascular death .
the worldwide increase in the elderly population ( age 65 years ) is associated with concurrent increases in prevalence of systemic hypertension and morbidity and mortality from vascular complications of hypertensive disease .
recently , numerous large clinical trials have provided evidence of the benefits of reducing bp in the elderly .
meta - analysis of clinical trials showed that treatment of hypertension in older adults is as beneficial as that in younger adults [ 11 , 12 ] .
it is well established now that the treatment of hypertension in elderly patient was associated with a reduction in the rate of fatal or nonfatal stroke , a reduction in the rate of death from stroke , a reduction in the rate of death from any cause , a reduction in the rate of death from cardiovascular causes , and a reduction in the rate of heart failure [ 12 , 13 ] .
it was in this context that we undertook the present study at institute of cardiology of abidjan , the single university hospital managing cardiovascular diseases in cte d'ivoire .
this study aims to describe characteristics , risk factors , treatment and control of blood pressure of elderly hypertensive patients .
we undertook a retrospective descriptive study involving patients seen at the outpatient clinics of the institute of cardiology of abidjan .
the study population was hypertensive elders ( aged at least 65 years ) with a regular followup at the institute of cardiology of abidjan within one year .
this series includes patients who had been on an initial treatment upon referral to our center .
we used the definition and classification hypertension standards of the european society of hypertension ( esh ) and the european society of cardiology ( esc ) .
we have separated the systolic - diastolic hypertension from isolated systolic hypertension and from isolated diastolic hypertension .
the data collected were age , sex , blood pressure at initial presentation and during the followup ( one month , 2 months , 3 months , 6 months , 1 year or last presentation ) , the coexistence of other cardiovascular risk factors , the impact of hypertension , and the treatment modalities .
the following additional cv risk factors were document when present : current smoking , dyslipidaemia , diabetes , and obesity .
dyslipidaemia was defined according to our biochemistry laboratory standard when the level of total cholesterol was > 2 g / dl , ldl - cholesterol > 1.4 g / dl , or hdl - cholesterol < 0.4 g / l .
new diabetic patients detected at institute of cardiology of abidjan were diagnosed based on the standard value in our laboratory , fasting plasma glucose > 1.26 g / dl on repeated measurement .
the overall management of diabetes was coordinated by the individual patient 's physician and not by the cardiology staff of institute of cardiology of abidjan .
echocardiogram was frequently performed , and the results were included in the data collection . finally , when other tests were seldom performed ( e.g. , albuminuria , microalbuminuria , the fundscopy , and 24-hour ambulatory blood pressure ) , they were not used for analysis .
the esh and esc categorization of total risk as low , moderate , high , and very high added risk has the merit of simplicity and was , therefore , chosen for risk stratification .
. blood pressure control was defined as a treated blood pressure < 140 mmhg systolic and < 90 mmhg diastolic and was ascertained by direct measurement of blood pressure .
during the study period , 2575 hypertensive black africans patients have had a regular follow - up of at least one year . among these patients ,
the mean age was 73.1 5.3 years ( range 6598 years ) , 59% were female . at first presentation blood pressure
it was mostly systolic - diastolic hypertension ( 51.8% ) and isolated systolic hypertension ( 38.5% ) .
mean blood pressure was 169.4 28.4 mmhg for systolic , 95.3 15.7 mmhg for diastolic , and 74.1 22.8 mmhg for pulse pressure .
blood pressure of men was not significantly different from that of women ( table 2 ) .
overall , patients were diagnosed with hypertension for an average of 4 6.7 years ( range 147 ) at the time of their initial assessment in our clinics .
the mean follow - up duration in ica was 3 1.8 years ( range 1 to 18 years ) .
isolated cardiac complications were the most frequent ( 37.9% ) . the cardiovascular risk factors other than hypertension and the results of target organ damage are reported in table 1 .
the recorded anomalies were a left ventricular diastolic dysfunction ( 39.2% ) , hypertensive cardiomyopathy ( 32.1% ) and minor lesions ( slight valve regurgitation , valvular sclerosis , valvular calcification ) ( 19.6% ) .
application of the cardiovascular risk stratification according to the european guideline for the management of arterial hypertension identified a very high added risk in 82.1% , a high added risk in 4.8% , a moderate add risk in 7.5% and a low add risk in 5.7% .
in addition to lifestyle changes , 93.5% of patients received antihypertensive drugs ( table 2 ) . of those on treatment for high blood pressure , the most common agents used were diuretics in 63.5% , followed by blockers of the renin - angiotensin system ( ras ) in 61.3% ( either angiotensin converting enzyme inhibitors or angiotensin receptor blockers ) , calcium antagonists ( 31.6% ) , -blockers ( 19% ) , and centrally acting sympatholytics ( 4.5% ) .
antihypertensive drugs were used in monotherapy or combination ( table 3 ) . as a monotherapy ,
the most prescribed drug class was calcium antagonists ( 36.3% ) , followed by ras blocker ( 32% ) .
polytherapy ( more than 2 antihypertensive drugs including fixed - dose combination drugs ) was used for 67% of patients on treatment for hypertension .
the most common combination of drugs among those taking 2 agents was ras blockers plus diuretics ( 69.8% ) .
diabetic patients as well as those with kidney failure have received significantly more ras - blockers for the treatment of hypertension than other patients ( p = 0.03 for diabetic and p = 0.04 for renal failure ) . between the first and the last visit , blood pressure decreased significantly ( table 3 ) .
it was for systolic blood pressure by 15.9 mmhg , diastolic blood pressure by 8.2 mmhg , and pulse pressure by 7.6 mmhg .
the sex ( p = 0.88 ) , age ( p = 0.48 ) , duration of treatment of hypertension ( p = 0.13 ) , the number of consultation ( p = 0.13 ) , and the duration of hypertension ( p = 0.27 ) did not influence the control of blood pressure .
hypertension was best controlled with multiple drugs therapy ( 1.7 drugs for controlled patients as compared to 1.4 for to uncontrolled patients , p < 0.001 ) .
pulse pressure was significantly lowered in females ( p = 0.03 ) ( table 4 ) .
this study found that a significant proportion of patients ( 33% ) who visit the ica are elderly . in the elderly a significant part of hypertension
is represented by systolic hypertension . increased arterial stiffness may increase cardiovascular morbidity and mortality because of an elevation of systolic blood pressure ( sbp ) , which raises left ventricular afterload , and because of a decrease in diastolic blood pressure ( dbp ) , which alters coronary perfusion .
elevated pp is a powerful independent predictor of cardiovascular end points in the elderly [ 1518 ] . according to skurnick et al . , the pp levels of women were lower than those of men in early adulthood and higher in older ages .
but in our study , although the difference was not statistically significant , the pp of men was higher than women 's pp .
moreover , under hypertension treatment , the pp of women had significantly regressed compared to men 's .
as has been previously described , it is suggested that black africans present more severe forms of arterial hypertension and a greater risk of target organ damage [ 2023 ] .
overall , uncontrolled blood pressure remains the main factor for target organ damage more frequently in sub - saharan africa compared to western countries .
the main benefits of antihypertensive treatment are blood pressure lowering per se , largely independent of the drugs employed .
diuretics , -blockers , calcium antagonists , and ras blockers can adequately lower blood pressure , significantly improving cardiovascular outcome .
several properties of the thiazide - type diuretics have led to them being recommended as first - line therapy in older adults with uncomplicated stage 1 hypertension . at low doses ( < 25 mg / day of hydrochlorothiazide or equivalent ) , these agents have been demonstrated in randomized controlled trials to reduce mortality , stroke , and cardiovascular events in the older hypertensive population . there is good synergy with agents of different classes ( ras - blockers and calcium antagonists ) and most importantly in the elderly ; these drugs preferentially lower sbp relative to dbp . in our study , diuretics have been widely prescribed .
ras - blockers were also widely prescribed because of comorbidities such as diabetes , left ventricle hypertrophy or kidney failure , situations that required a preferential indication of ras - blockers .
furthermore , hyvet recommended the addition of a ras - blocker in the event of insufficient control of bp .
the ras - blocker diuretic combination was by far the most used in our study . in monotherapy ,
significant reductions in stroke risk in older hypertensive patients were demonstrated in the systolic hypertension europe and china trials [ 27 , 28 ] .
furthermore , results from patients with very high cardiac risk enrolled in accomplish trial demonstrated the superiority of an acei - calcium antagonists ( amlodipine ) combination over an ace - thiazide combination with regard to a decrease in cardiovascular events despite comparable bp - lowering effects . in most cases ,
if blood pressure is more than 20/10 mmhg above the target bp , treatment should be initiated with two antihypertensive drugs . in our study , hypertension was best controlled with multiple drugs therapy .
one should certainly not hesitate to use more than one antihypertensive drug even in elderly patients if the target blood pressure is not reached .
control rate of hypertension ( 42.6% ) was acceptable in our sub - saharan african context .
there is no information on treatment tolerance , particularly on orthostatic hypotension occurrence in the elderly often polymedicated patients .
also in these elderly patients with high cardiovascular risk , it would be interesting to describe cardiovascular events occurred during the year - long or more followup .
furthermore , the control rate of hypertension obtained does not reflect the reality of the management of hypertension in cte d'ivoire .
patients who were regularly monitored for at least one year showed probably best treatment adherence .
despite the classical reduced life expectancy in sub - saharan african population because of various illnesses , numerous elderly people exist .
the control rate of hypertension was significant , mostly at the cost of combination therapy .
Output:
| background .
since the treatment of hypertension is beneficial for the elderly , we have undertaken this study that aims to evaluate the management of hypertension in elderly patient in cte d'ivoire .
methods .
a retrospective study was conducted among 854 hypertensive elderly patients of abidjan cardiology institute who were followed for a minimum of one year , between january 2000 and december 2009 .
results .
the patients mean age was 73.1 5.3 years , and 59% were women .
at the first presentation , it was mostly systolic - diastolic hypertension ( 51.8% ) and isolated systolic hypertension ( 38.5% ) . mean blood pressure was 169.4 28.4 mmhg for systolic , 95.3 15.7 mmhg for diastolic , and 74.1 22.8 mmhg for pulse pressure .
pulse pressure was 60 mmhg in 80.4% . according to the european guidelines stratification of the cardiovascular risk - excess attributable to high blood pressure
, 82.1% of the sample had a very high added risk .
the pharmacological therapy was prescribed in 93.5% .
more than 66% of patients were receiving 2 antihypertensive drugs including fixed - dose combination drugs .
the most common agents used were diuretics ( 63.5% ) followed by angiotensin - converting enzyme inhibitors or angiotensin receptor blockers in 61.3% .
the most common agents used for monotherapy were calcium antagonists .
when 2 drugs were used , diuretics and angiotensin - converting enzyme inhibitors or angiotensin receptor blockers were the most common .
blood pressure control was achieved in 42.6% .
conclusion .
the control of elderly hypertension can be effective in sub - saharan africa .
he required at least two antihypertensive drugs to meet the recommended blood pressure target . |
PubmedSumm119649 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in the case of older adults over 65 years of age , physiological changes caused by aging
lead to much greater vulnerability with regard to safety issues compared to younger age
groups1 . due to physiological changes
resulting from aging , elders face a 10 times greater risk of falls than those in other age
groups6 .
falls can happen in all age
groups , but they especially occur in 1/3 of elders aged 65 or above , and about 50% of elders
who have experienced falls experience recurrences2 ,
3 . in more severe cases ,
elders lose
independence in daily living because of aftereffects and declines in physical body
functions4 .
it has been reported that
the fear of such experiences influences daily living activities and mobility and that 4070%
of elders face limitation in daily living due to this fear5 .
safely participating in meaningful daily living activities requires high - level , appropriate
visual processing .
although the visual perceptual skills of elders have a large impact on
their daily living activities , there are still inadequacies in medical prevention systems
and organized healthcare systems for elders , such as the early diagnosis and treatment of
visual perceptual disorder6 . position balance ability and most behaviors that occur in daily living
are associated with
visual perception7 , and impairments in
cognitive functioning affect the balance maintenance ability and physical body integration
of elders , acting as a risk factor for falls8 .
balance is an essential element of functional activity , and balance
ability is regarded as a critical factor involved in elders daily living9 .
therefore , this study selected a group of
older adults at risk for falls and another of those not at risk for falls and evaluated
their visual perceptual and cognitive functioning to check for a mild visual perceptual
disorder unnoticed by them or their guardians .
next , the study aimed to compare the elders
balance maintenance ability , cognitive functioning , fall efficacy , and visual perceptual
functioning , and to examine how these were correlated .
this study was conducted from september 1 , 2014 , to march 30 , 2015 . in order to carry out
the research using survey contents and assessment report measurements , all details of this
study s procedures
were submitted to the science research council of inje university , which
approved the study protocol .
this research was carried out on 116 elders aged 65 or above who use d seniors welfare
center and y senior citizen center in busan .
subjects were divided into a group of 64 elders
at risk for falls and a group of 52 elders not at risk for falls using balance maintenance
ability evaluation tools the berg balance scale and the one - legged stance test as well as a
measurement tool on their knowledge of falls and whether or not they had experienced falls
more than once over the past year . for the group at risk for falls , elders who could act in accordance with instructions ,
stand on their own , and walk for more than 10 m without outside help
were selected from
those capable of independent daily living10 . before beginning the research , its overall
content and expected
effects were explained carefully to the elders , and only those who voluntarily consented
participated .
frequency analysis was performed using descriptive statistics for the general
characteristics of the two subject groups , and t - tests were applied to analyze differences
in balance maintenance ability , cognitive ability , fall efficacy , and visual perceptual
functioning .
in addition , pearson correlation analysis was applied to examine the
relationships among balance maintenance ability , cognitive ability , fall efficacy , and
visual perceptual functioning .
to classify elders based on whether or not they were at risk for falls , subjects scoring
less than 22 out of 30 on the falls knowledge measurement tool , 45 out of 56 on the berg
balance scale , and 5 seconds on the one - legged stance test , were classified as being at risk
for falls .
the results are in table 1table 1.knowledge of falls , berg balance scale , one - legged stance testcategorieselderly at risk of falls(n=64)elderly ( n=52)m sdm sdknowledge of fall18.8 2.6 * 22.8 1.6*berg balance scale39.7 2.3 * 42.9 4.3*one - legged stance test : open(s ) 2.0 0.9 * 5.3 2.1*one - legged stance test : off(s ) 0.8 0.8 * 2.8 0.9*values are mean sd , * significant difference ( p<0.05 ) .
values are mean sd , * significant difference ( p<0.05 ) the cognitive functioning scores of the two groups as measured by the mmse - kc and moca - k
are in table 2table 2.mmse-kc , moca - k scorecategoriesitem elderly at risk of falls ( n=64)elderly ( n=52)m sdm sdmmse - kctime orientation 3.5 1.53.7 0.8place orientation3.2 0.7 * 4.0 1.1*registration ( three words)2.8 0.42.9 0.1attention and calculation ( sam cheon ri gang san)1.2 1.3 * 3.0 1.1*recall ( three words)0.7 0.9 * 1.4 1.2*naming1.3 0.8 * 2.3 0.7*three - stage command1.8 1.02.3 0.9copying interlocking pentagons0.6 0.40.5 0.5abstract thinking1.5 0.51.5 0.4total score17.2 5.3 * 22.1 3.8*moca - kvisuospatial / executive1.9 0.8 * 2.8 0.7*naming2.5 0.62.2 0.8attention2.4 1.13.7 1.1language2.2 0.72.3 0.5delayed recall1.7
4.319.3 2.3values are mean sd , * significant difference ( p<0.05 ) , and the fall efficacy scores of the two groups measured by the fes - k are
shown in table 3table 3.fes-k scorem sdelderly at risk of falls ( n=64)27.5 7.2*elderly ( n=52)39.6 3.8*values are mean sd , * significant difference ( p<0.05 ) . finally , the visual perceptual function scores of the two groups are in table 4table 4.mvpt-3 scoreelderly at risk of falls ( n=64)elderly ( n=52)m sdm sdvisual short term memory 12.9 0.9 * 4.9 1.1*visual closure 14.0 1.0 * 6.5 2.1*spatial orientation1.4 0.8 * 3.0 0.7*figure ground1.1 0.7 * 2.2 0.9*visual closure 21.6 0.9 * 2.4 0.8*visual short term memory 21.3 0.81.5 1.1raw score26.5 2.7 * 34.8 5.4*standard score55.0 0.0 * 62.3 6.7*values are mean sd , * significant difference ( p<0.05 ) .
values are mean sd , * significant difference ( p<0.05 ) values are mean sd , * significant difference ( p<0.05 ) values are mean sd , * significant difference ( p<0.05 ) furthermore , the correlations among berg balance scale , one - legged test , mmse - kc , moca - k ,
fes - k , and mvpt-3 scores are shown in table
5table 5.correlations among balance maintenance ability , cognitive function , falls
efficacy , and visual perceptual skillbbsolst ( open)olst ( close)mmse -kcmoca -kfes -kmvpt -3bbsolst ( open)0.432**olst ( close)0.205 * 0.588**mmse - k0.207 * 0.459**0.512**moca - k0.366**0.522**0.568**0.762**fes - k0.298**0.575**0.585**0.549**0.632**mvpt-30.349**0.624**0.485**0.442**0.518**0.506**values are mean sd , * significant difference ( p<0.05 ) , * * significant difference
( p<0.01 ) .
bbs : berg balance scale ; olst : one - legged stance test ; mmse - kc : mmse in
the korea version of the cered assessment packet ; moca - k : korean version of the
montreal cognitive assessment ; fes - k : korea falls efficacy scale ; mvpt : motor - free
visual perception test .
values are mean sd , * significant difference ( p<0.05 ) , * * significant difference
( p<0.01 ) .
bbs : berg balance scale ; olst : one - legged stance test ; mmse - kc : mmse in
the korea version of the cered assessment packet ; moca - k : korean version of the
montreal cognitive assessment ; fes - k :
falls in older adults are closely related to balance maintenance ability , cognitive
functioning , and visual perceptual functioning . however , there are not enough studies
examining the visual perception of elders or examining the correlations between falls or
balance and visual perception . on the berg balance scale , both groups of older adults at risk for
falls and those not at
risk for falls had low scores ( below 45 ) , and both groups also scored low with 5 seconds on
the one - legged stance test ; both of these results indicate that they were at risk for falls .
park s research compared score differences between two groups of stroke patients , one with
and one without fear of falls .
there were significant differences between the two groups in
the berg balance test and the one - legged stance test , but there was no significant
difference in the fall efficacy criterion .
the results of this paper support those of the
present study regarding the balance maintenance ability test carried out to classify older
adults regarding their fall risk but do not agree with the results of the present study
regarding the falls efficacy criterion11 . in this research , both groups showed a significant correlation of r=0.349 between their
scores on the berg balance scale and the mvpt-3 test .
there were significant correlations
between the scores on the one - legged stance test with eyes open and the mvpt-3 test
( r=0.624 ) and between the scores on the one - legged stance test with eyes closed and the
mvpt-3 test ( r=0.485 ) .
measuring the balance maintenance ability of elders helps to evaluate their ability to lead
a safe life in their given environment , and physical stability and visual perceptual skills
are important for this12 .
this research used the mvpt-3 test to evaluate the elders visual perceptual functioning .
according to the results , all subjects at risk for falls demonstrated very low - level visual
perceptual functioning with an average raw score of m=26.53 ( sd=2.7 ) and standard score of
m=55.00 ( sd=0.0 ) .
although subjects not at risk for falls had higher scores than those at
risk for falls , these scores also showed their weak functioning .
this indicates that
community elders not at risk for falls also had a decline in visual perception due to normal
aging processes . according to kim s research that analyzed mvpt raw scores to look into the overall visual
perception conditions of community elders , elders in their 50s and 80s
were all within the
normal range , but elders in their 60s and 70s had lower scores than the normal range13 .
this means that healthy elders who have
never received hospital treatments for visual perceptual disorder may have a visual
perceptual disorder or decline in visual perceptual skills due to aging that they or their
guardians have not noticed .
the mvpt-3 raw scores of this study were low for both older
adults at risk for falls and those not at risk for falls ; this result supports the present
study , providing further evidence that even healthy elders may have a visual perceptual
disorder or decline in visual perceptual ability that they or their guardians may not have
noticed , as in previous research .
cognitive functioning in this research was measured using the mmse - kc and the moca - k , and
subjects had low scores in both tests , indicating severe cognitive disorder and mild
cognitive disorder , respectively .
this shows that there is a severe decline in the community
elders cognitive functioning , which can also influence falls .
the mmse - kc and mvpt-3 test scores had a significant correlation at r=0.442 , and the moca - k
and mvpt-3 test scores had a significant correlation at r=0.518 .
visual perception can be
defined as an entire process of accepting and recognizing visual simulation14 , and with a visual perception disorder , it
is difficult to perceive objects and identify the mutual relation between objects in a
space . moreover ,
the average fall efficacy
scores ( m=25.57 , sd=7.2 ) of subjects at risk for falls were relatively low while of those
not at risk for falls had higher average scores ( m=39.69 , sd=3.8 ) .
these results support
those of resnick , luisi , and vogel s research , which was conducted on elders residing in
facilities and demonstrated that fall efficacy of subjects who experienced falls was
significantly lower than in those who did not experience falls , showing that older adults at
risk for falls have a great fear of falls9
. such fear of falls causes a lack of confidence , decreases physical
activities , and reduces the independent daily living of elders10 .
for the korean fall efficacy test , this research demonstrated significant correlations
between balance maintenance ability , cognitive functioning , and visual perceptual function
of elders .
the falls efficacy test can be used clinically as a tool to predict elders fall
risk in advance , thereby preventing falls .
in addition , visual perceptual functions training
should be reviewed to check whether it can improve visual perceptual function , balance
maintenance ability , and cognitive functioning .
the limitations of this research are that it recruited study subjects of high age groups
from a local community senior citizen center , and it is difficult to generalize the results
to elders living in an active community .
Output:
| [ purpose ] this research aims to identify the relationships among visual perceptual
skills , cognitive functioning , and fall efficacy of older adults based on whether they are
at risk for falls .
[ subjects and methods ] subjects included 116 older adults over 65 years
of age who use d seniors welfare center and y senior citizen center in busan metropolitan
city .
all research subjects were classified based on balance maintenance ability
evaluation and whether or not they had experienced falls more than once .
those with scores
below the cut - off standard were selected as a group of older adults at risk for falls .
an
mvpt-3 test was used to assess visual perceptual skill , mmse - kc , and moca - k tests to
assess cognitive function , and the fes - k falls efficacy test to classify subjects as
either at risk for falls or not . [ results ] after comparing scores for visual perceptual
skills , cognitive functioning , and fall efficacy , subjects at risk for falls showed
significantly lower scores than did those not at risk . [ conclusion ] the study found that
there are significant differences in balance ability , visual perceptual skill , cognitive
functioning , and fall efficacy between older adults at risk for falls and those not at
risk . |
PubmedSumm119650 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: it is the fourth most common form of cancer in the us and the third leading cause of cancer - related death in the western world . in patients with localized disease ,
standard treatment includes surgical resection of the tumor , followed by adjuvant chemotherapy in case of regional lymph node metastases .
though curative treatment options are increasingly available in case of metastatic disease , treatment in this situation is still most often palliative . in case of metastatic disease ,
median overall survival without chemotherapy is approximately 8 months , with a 1-year survival of 34% .
when 5-fluorouracil / leucovorin ( 5-fu / lv ) or the equally effective and toxic oral 5-fu prodrug capecitabine is combined with irinotecan or oxaliplatin and bevacizumab , the median survival increases to more than 20 months , with a 1-year survival of 74% [ 2 , 3 , 4 , 5 , 6 ] . following first - line treatment with folfox or capox , irinotecan is frequently used as second - line therapy .
irinotecan ( cpt-11 ) is a prodrug that requires activation by carboxylesterases to yield the potent topoisomerase i inhibitor sn-38 that inhibits dna double strand replication and cell division .
well - known side effects of irinotecan are the result of the induction of an acute cholinergic syndrome and include rhinitis , increased salivation , miosis , lacrimation , diaphoresis , flushing , and intestinal hyperperistalsis .
this cholinergic activity is caused by binding of irinotecan to the active site gorge of acetylcholinesterase resulting in its subsequent functional inhibition .
here , we describe the case of a patient with metastatic rectal carcinoma who received second - line therapy with irinotecan and developed isolated transient dysarthria following each administration of irinotecan .
although we are aware of the reports of 7 patients experiencing this unique and isolated toxic effect , our case is the 1st to include online supplementary video and speech recordings ( www.karger.com/doi/10.1159/000336156 ) [ 8 , 9 , 10 , 11 , 12 , 13 ] .
a 46-year - old male was referred to our outpatient clinic because of metastatic rectal cancer .
one year earlier he was treated with neoadjuvant capecitabine - based chemoradiotherapy and a low anterior resection in another hospital .
six months later , he was treated with radiofrequency ablation and transarterial chemoembolization because of liver metastases . as this procedure
was complicated by sepsis , ischemia of the left liver lobe and abscesses , his clinical condition at that time impeded the use of adjuvant chemotherapy .
unfortunately , new liver metastases , lymph node metastases , and an adrenal metastasis developed over the next months .
after referral to our department , first - line palliative chemotherapy ( 3-weekly : i.v .
oxaliplatin 130 mg / m day 1 ; oral capecitabine 1,000 mg / m b.i.d .
unfortunately , progressive disease developed after a total of 10 cycles . after a therapy - free interval of 2 months , second - line chemotherapy with irinotecan ( i.v .
standard premedication included atropine ( 0.25 mg s.c . ) , dexamethasone ( 10 mg i.v . ) and ondansetron ( 8 mg i.v . ) .
a neurologist confirmed that the dysarthria , which resolved spontaneously within 24 h , was not accompanied by any other neurological symptom apart from the known nci - ctc grade 1 peripheral polyneuropathy that resulted from prior oxaliplatin exposure .
mr imaging of the brain , including diffusion weighted imaging , did not show any structural or perfusion abnormalities ( fig .
as ondansetron and dexamethasone had also been used previously in combination with first - line chemotherapy in this patient , these agents could not be responsible for the observed dysarthria .
a causative role of atropine was excluded by administering atropine premedication ( 0.25 mg s.c . )
2 h prior to the administration of irinotecan ; dysarthria did not occur after atropine alone , while subsequent administration of irinotecan again induced dysarthria .
acoustic analyses ( see video and speech recordings ) performed by an experienced speech therapist and otolaryngologist indicated a reduced capacity in fine - tuning of motor functions of the tip of the tongue and a minimal reduction in the power of speech at labiodental contact . also , a reduction in sound coordination was found predominantly for consonants generated by the tip of the tongue .
for example , notable changes were observed in the cluster / str / in stretch , destroy , and stranger requiring a coordinated activity of the tip of the tongue and in practice requiring a rapid relatively large movement of the tongue .
the patient experienced the dysarthria as only slightly bothersome and , apart from alopecia , he experienced no other toxicity .
after an initial radiological response , treatment with irinotecan was stopped after 9 cycles because of progressive disease ( fig .
speech is based on the fast and varied contractions of oral- , pharyngeal- , and laryngeal muscles .
dysarthria is caused by a motility disorder of these muscles caused by upper motor neuron lesions of the cerebral hemispheres or lower motor neuron lesions of the brain stem , but can also result from disruption of the integrated action of upper motor neurons , basal ganglia , and cerebellum .
no other neurological signs or symptoms were noted and radiological evaluation ( conventional and diffusion - weighted mri ) showed no abnormalities , which is in line with previously reported cases .
analyses by an otolaryngologist and speech therapist indicated that the dysarthria predominantly affected consonants generated by the tip of the tongue , and although the anatomical level of these disturbances can not be determined with certainty , it is believed to originate centrally at the level of the brainstem .
the exact pathogenesis of irinotecan - induced dysarthria is still unknown , but several possible mechanisms have been put forward .
gomez et al . reported a case in which tremors and ataxia preceded the development of dysarthria during the third and subsequent cycle of an irinotecan - containing chemotherapy regimen and suggested that the use of atropine could prevent progression to dysarthria .
notably , however , this preventive effect of additionally administered atropine was not observed in our case or in the case reported by hamberg .
this difference could be related to differences in the dose of irinotecan , which was substantially lower in the case reported by gomez et al .
atropine itself was not responsible for the observed toxicity as we found that its sole administration to the patient did not result in dysarthria . because an earlier study demonstrated that the pharmacokinetics of irinotecan were not different in patients developing dysarthria , the isolated dysarthria can not be explained by differences in systemic clearance of irinotecan .
irinotecan increases cholinergic activity by binding to the active site gorge of acetylcholinesterase resulting in its functional inhibition .
because of its innervation of tongue muscles , the hypoglossal nerve plays an important role in speech and its overstimulation or damage can cause dysarthria . as the density of cholinergic receptors is relatively high in brainstem nuclei and the application of cholinergic agents results in a large increase in hypoglossal nerve activity compared to e.g. phrenic nerve activity [ 15 , 16 ] , we believe that the occurrence of isolated dysarthria in patients treated with irinotecan could be related to this apparent intrinsic increased sensitivity of hypoglossal nerve activity to cholinergic stimulation .
unfortunately , we could not directly test this hypothesis because of progressive disease in our patient . in future cases
, the use of pharmacological functional mri or pet scans with n-[c]-methyl-4-piperidyl acetate to measure acetylcholinesterase activity could be helpful in elucidating the pathophysiology of irinotecan - induced isolated dysarthria [ 17 , 18 ] . in conclusion ,
selective irinotecan - induced dysarthria is an unusual and impressive entity , which can occur within minutes of irinotecan infusion .
it is potentially related to a relative cholinergic oversensitivity of neurons in the area of the nucleus of the hypoglossal nerve .
though atropine can decrease cholinergic symptoms , it has not been conclusively shown to prevent the occurrence of dysarthria .
of note , as symptoms were fully reversible in all cases reported to date ( in a period differing from 15 min to several hours [ this case , 12 , 13 ] ) and did not increase in severity upon readministration of irinotecan , awareness of this phenomenon is critical in order to prevent unnecessary cessation of a potentially effective anticancer chemotherapeutic agent .
Output:
| colorectal carcinomas are among the most common tumor types and are generally treated with palliative chemotherapy in case of metastatic disease . here , we describe the case of a 46-year - old patient with metastatic rectal carcinoma who received second - line therapy with irinotecan and developed isolated transient dysarthria ( with normal mr imaging of the brain ) following each administration of irinotecan . neurological and logopedical evaluation revealed that the dysarthria predominantly resulted from a reduced capacity in fine - tuning of motor functions of the tip of the tongue and a minimal reduction in the power of speech at labiodental contact . as hypoglossal nerve activity has been reported to be especially susceptible to cholinergic stimulation and irinotecan can cause cholinergic side effects by binding to and inactivating acetylcholinesterase , we suspect this mechanism to be responsible for irinotecan - induced dysarthria . |
PubmedSumm119651 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: human adult gut microbiota is estimated to consist of up to 100 trillion microorganisms , comprising at least 500 different species , mostly anaerobic bacteria .
although the advent of modern molecular microbiological methods has expanded the degree of bacterial detection from stool samples , it does not allow for the phenotypic description of new living species .
consequently , there has been renewed interest in culture methods . a new taxonomic approach known as taxonogenomics
this polyphasic strategy combines phenotypic characteristics , the matrix - assisted laser desorption / ionization time - of - flight mass spectrometry ( maldi - tof ms ) spectrum , and the analysis and comparison of the complete genome sequence . since the creation of the genus clostridium in 1880 ,
while species belonging to the family clostridiaceae are mainly associated with the commensal digestive flora of mammals and can be commonly found in the environment , some are major human pathogens , including toxigenic clostridium botulinum , peptoclostridium difficile , clostridium tetani and clostridium perfringens
.
, strain gd3 (= csur p1929 = dsm 100334 ) as the type strain of c. phoceensis sp .
this strain was isolated from the gut microbiota of a 28-year - old healthy french man as part of a culturomics study aiming at individually cultivating all bacterial species from a stool sample . here
the sample was collected as part of a research study on the human gut microbiota .
the study was approved by the institut fdratif de recherche 48 ( agreement no . 09 - 022 , marseille , france ) , and the patient 's consent was obtained .
the sample was stored at 80c in la timone hospital ( marseille , france ) .
the colonies obtained were identified using maldi - tof ms , ( bruker daltonics , leipzig , germany ) and analysed using a microflex spectrometer ( bruker ) , leading to the protein spectrum being obtained .
subsequently , 16s rrna was sequenced and the sequence was matched using blast ( basic local alignment search tool ) against the national center for biotechnology information database .
dna was extracted using the ez1 tissue extraction kit ( qiagen , hilden , germany ) , and sequences were aligned using chromaspro 1.6 ( technelysium , south brisbane , queensland , australia ) .
five growth temperatures ( ambient , 28 , 37 , 45 and 56c ) were tested under anaerobic ( genbag anaer ) microaerophilic atmospheres ( genbag microer ) ( biomrieux , marcy ltoile , france ) and aerobic condition on 5% sheep 's blood agar ( biomrieux ) .
colonies were obtained after thermal shock for 20 minutes at 80c in an anaerobic blood culture bottle ( bactec lytic/10 anaerobic / f ) supplemented with 5% sheep 's blood at 37c .
gram staining , motility , catalase and oxidase were determined as described by lagier et al .
.
sporulation was tested using a thermal shock on bacterial colonies ( diluted in phosphate - buffered saline ) for 10 minutes at 80c .
the biochemical characteristics were tested using api 50ch , api zym and api 20a strips ( biomrieux ) .
two samples were prepared with 2 mg of bacterial biomass from several culture plates .
two samples were prepared with approximately 2 mg of bacterial biomass per tube collected from several culture plates .
gc / ms analyses were carried out as described by dione et al .
.
briefly , fames were separated using an elite 5-ms column and monitored by mass spectrometry ( clarus 500-sq8s ; perkinelmer , courtaboeuf , france ) . a spectral database search was performed using ms search 2.0 operated using the standard reference database 1a ( national institute of standards and technology , gaithersburg , md , usa ) and the fame mass spectral database ( wiley , chichester , uk ) .
individual cells of c. phoceensis strain gd3 were captured using a tecnai g20 electron microscopy ( fei company , limeil - brevannes , france ) .
a color gram 2 kit ( biomrieux ) was used to perform the gram coloration observed with a 100 oil - immersion objective lens using the dm1000 photonic microscope ( leica , wetzlar , germany ) , .
the organism was selected for sequencing because it had been isolated from a healthy person for the first time and on the basis of its 16s rrna similarity , phylogenetic position and phenotypic differences with other members of the genus clostridia .
the genbank accession number is cvug01000000 and consists of 10 scaffolds with a total of 16 contigs .
the genomic dna of clostridium phoceensis gd3 was sequenced on the miseq sequencer ( illumina , san diego , ca , usa ) using the mate - pair strategy .
the gdna was barcoded in order to be mixed with 11 other projects using the nextera mate - pair sample prep kit ( illumina ) .
the mate - pair library was prepared with 1.5 g of genomic dna using the nextera mate - pair illumina guide .
the gdna sample was simultaneously fragmented and tagged using a mate - pair junction adapter .
the pattern of the fragmentation was validated on an agilent 2100 bioanalyzer ( agilent technologies , santa clara , ca , usa ) with a dna 7500 lab chip .
the dna fragments ranged in size from 1 to 10 kb , with an optimal size of 4.490 kb .
no size selection was performed , and only 600 ng of tagmented fragments were circularized .
the circularized dna was mechanically sheared to small fragments with an optimal size of 938 bp on the covaris s2 device in microtubes ( covaris , woburn , ma , usa ) .
the library profile was visualized on a high sensitivity bioanalyzer labchip ( agilent technologies ) , and the final library concentration was measured at 4.457
after a denaturation step and dilution at 15 pm , the pool of libraries was loaded onto the reagent cartridge and then onto the instrument along with the flow cell .
automated cluster generation and sequencing run were performed in a single 39-hour run in a 2 251 bp ; 6.1 gb of total information was obtained from a 653k / mm cluster density , with a cluster passing quality control filters of 96.1% ( 12 031 000 clusters ) . within this run , the index representation for c. phoceensis gd3 was determined to 9.32% .
the 1 121 200 paired reads were filtered according to the read qualities .
these reads were trimmed , then assembled by spdes software . finally , the draft genome of c. phoceensis gd3 consisted of ten scaffolds with 16 contigs and generated a genome size of 3.4 mb with 59.32% g+c content .
open reading frames ( orfs ) were predicted using prodigal with default parameters , although the predicted orfs were excluded if they spanned a sequencing gap region .
the predicted bacterial protein sequences were searched against the genbank database and the clusters of orthologous groups ( cogs ) databases using blastp .
the trna genes were found using the trnascanse tool , while rnammer was used to find ribosomal rnas and blastn against the genbank database .
lipoprotein signal peptides and the number of transmembrane helices were predicted using signalp and tmhmm respectively .
artemis was used for data management , and dna plotter was used to visualize genomic features . to estimate the mean level of nucleotide sequence similarity at the genome level
, we used homemade average genomic identity of orthologous gene sequences ( agios ) software .
maldi - tof ms failed to identify the strain gd3 , so its mass spectrum was added to the bruker database ( fig . 1 ) .
to improve identification , 16s rrna sequencing was performed , and the access number in 16s rrna embl - ebi ( european molecular biology laboratory
the highest value of nucleotide sequence similarity was observed with flavonifractor plautii ( 97% ) , the phylogenetically closest species . c. phoceensis strain gd3 is a gram - negative ( fig .
2 ) , spore - forming , nonmotile , strictly anaerobic bacterium that has no catalase and oxidase activities , measuring 1.8 m in length and 0.5 m in diameter ( fig . 3 ) .
the sporulation test was positive ; the organism grows at 45c in anaerobic conditions . using the api zym gallery , c. phoceensis exhibits esterase ( c4 ) , phosphatase acid , naphthol - as - bi - phosphohydrolase and -glucosidase activities . when using the api 20a gallery , a positive reaction was only observed for d - glucose ( table 1 ) .
of the antibiotics tested , c. phoceensis was found to be sensitive to amoxicillin , amoxicillin
the predominant cellular fatty acids of c. phoceensis strain gd3 are hexadecanoic acid ( 16:0 ; 33.1 1.7% ) , 9-octadecenoic acid ( 18:1n9 ; 24.3 0.6% ) , octadecanoic acid ( 18:0 ; 20.0 0.1% ) , 9,12-octadecadienoic acid ( 18:2n6 ; 8.6 0.1% ) , 11-octadecenoic acid ( 18:1n7 ; 5.5 0.5% ) , tetradecanoic acid ( 14:0 ; 4.7 0.8% ) and trace amounts ( less than 1% ) of heptadecanoic acid , 9-hexadecenoic acid , pentadecanoic acid , 15-methyl - hexadecanoic acid , 14-methyl - hexadecanoic acid , 10-heptadecenoic acid , 13-methyl - tetradecanoic acid and 12-methyl - tetradecanoic acid ( table 2 ) .
a phylogenetic tree highlighting the position of clostridium phoceensis gd3 relative to other type strains within the order clostridiales is provided in fig .
the genome of the c. phoceensis strain gd3 is 3 453 562 bp long with 59.32% g+c content .
a total of 3320 genes were predicted , of which 3264 were protein - coding genes and 56 were rna genes ( three genes are 5s rrna , one gene is 16s rrna , one gene is 23s rrna and 51 genes are trna genes ) .
a total of 227 genes ( 6.95% ) were identified as orfans . the remaining genes ( 28.92% )
the properties and statistics of the genome are summarized in table 3 and fig .
the distribution of genes into cogs functional categories is presented in table 4 and fig .
we made some brief comparisons against nine genomes : intestinimonas butyriciproducens strain er1 ( genbank accession no .
jpjd01000000 ) , flavonifractor plautii atcc 29863 ( agck01000000 ) , clostridium leptum dsm 753 ( abcb02000000 ) , clostridium cellulosi dg5 ( nz_lm995447 ) , ethanoligenens harbinense yuan-3 ( nc_01482 ) , oscillibacter valericigenes
sjm18 - 20 ( nc_016048 ) , clostridium viride dsm 6836 ( nz_jhzo01000000 ) , eubacterium siraeum v10sc8a ( fp929059 ) and pseudoflavonifractor capillosus atcc 29799 ( nz_aaxg02000000 ) .
the draft genome sequence of c. phoceensis is smaller than those of pseudoflavonifractor capillosus , oscillibacter valericigenes , flavonifractor plautii , clostridium cellulosi and intestinimonas butyriciproducens ( 3.45 , 4.24 , 4.47 , 3.81 , 5.68 and 3.57 mb respectively ) , but larger than those of clostridium viride , ethanoligenens harbinense , clostridium leptum and eubacterium siraeum ( 2.41 , 3.01 , 2.82 and 2.84 mb respectively ) .
the g+c content of c. phoceensis is smaller than those of flavonifractor plautii ( 59.32 and 61.07% respectively ) but larger than those of pseudoflavonifractor capillosus , oscillibacter valericigenes , clostridium viride , ethanoligenens harbinense , clostridium leptum , eubacterium siraeum , clostridium cellulosi and intestinimonas butyriciproducens ( 59.11 , 53.19 , 49.28 , 55.56 , 50.25 , 45.13 , 42.07 and 58.44% respectively ) .
the gene content of c. phoceensis is smaller than those of pseudoflavonifractor capillosus , oscillibacter valericigenes , flavonifractor plautii , clostridium cellulosi and intestinimonas butyriciproducens ( 3264 , 4829 , 4723 , 4278 , 5171 and 3529 respectively ) but larger than those of clostridium viride , ethanoligenens harbinense , clostridium leptum and eubacterium siraeum ( 2321 , 2701 , 2482 and 2211
c. phoceensis has a similar distribution of genes into cogs categories with the most of the compared species ( fig . 4 )
however , clostridium cellulosi was overrepresented for all the categories , and clostridium viride was overrepresented for category z ( cytoskeleton ) . in addition , clostridium phoceensis shared 846 , 884 , 492 , 562 , 482 , 717 , 634 , 407 and 842 orthologous genes respectively with intestinimonas butyriciproducens , flavonifractor plautii , clostridium leptum , clostridium cellulosi , ethanoligenens harbinense , oscillibacter valericigenes , clostridium viride , eubacterium siraeum and pseudoflavonifractor capillosus ( table 5 ) .
of these species , the orthologous genes shared ranged from 365 between eubacterium siraeum and clostridium viride to 1079 between flavonifractor plautii and intestinimonas butyriciproducens .
compared to other species , c. phoceensis exhibited agios values ranging from 56.64 with ethanoligenens harbinense to 71.58 with flavonifractor plautii .
on the basis of taxonogenomic analyses , we propose clostridium phoceensis sp . nov . , strain gd3 (= csur p1929 = dsm 100334 ) , as the type strain of c. phoceensis sp .
this strain was isolated from the gut microbiota of a 28-year - old healthy french man .
adj . , from phoceensis referring to phocea , the greek name of the city which founded marseille , where it was isolated ) is a gram - negative nonmotile bacillus whose individual cell size is 1.8 m in length and 0.5 m in diameter .
strain gd3 is catalase and oxidase negative , and its optimal growth temperature is 45c , but it also grows weakly at 37c .
biochemical analyses showed positive reactions of c. phoceensis for d - glucose and produced esterase ( c4 ) , phosphatase acid , naphthol - as - bi - phosphohydrolase and -glucosidase enzymes . c. phoceensis was sensitive to amoxicillin , amoxicillin
its predominant cellular fatty acids are hexadecanoic acid ( 16:0 ; 33.1 1.7% ) , 9-octadecenoic acid ( 18:1n9 ; 24.3 0.6% ) , octadecanoic acid ( 18:0 ; 20.0 0.1% ) , 9,12-octadecadienoic acid ( 18:2n6 ; 8.6 0.1% ) , 11-octadecenoic acid ( 18:1n7 ; 5.5 0.5% ) and tetradecanoic acid ( 14:0 ; 4.7 0.8% ) .
strain gd3 , whose csur and dsmz numbers are respectively csur p1929 and dsm 100334 , was identified from the stool sample of a 28-year - old healthy french man .
Output:
| clostridium phoceensis sp . nov .
, strain gd3 t (= csur p1929 = dsm 100334 ) is the type strain of c. phoceensis sp . nov .
, a new species within the genus clostridium .
this strain was isolated from the gut microbiota of a 28-year - old healthy french man .
c.
phoceensis is a gram - negative , spore - forming , nonmotile , strictly anaerobic bacterium .
we describe its complete genome sequence and annotation , together with its phenotypic characteristics . |
PubmedSumm119652 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: primary cutaneous malignant melanoma ( cmm ) is an increasingly frequent malignancy in the white population of western countries .
the tumour size is closely associated with cell proliferation including the size of the growth fraction [ 2 , 3 ] . in recent years
, some progress has been reached in the understanding of primary genetic alterations involved in the cmm initiation [ 46 ] . the following neoplastic progression is accompanied or supported by other additional genetic mutations .
many oncogenes , tumour suppressor genes , and altered signalling pathways have been identified [ 711 ] . thus , following the initial malignant thigmotropism step , a variety of subsequent mutations occur promoting the cmm invasiveness . some of these changes are probably involved in the rise of potential for metastasis .
the malignant cells prone to metastasize but still in contact with the primary tumour are currently not identifiable under the microscope .
although some specific cmm subtypes are clinically and histopathologically distinct , these features do not commonly exhibit independent prognostic value . despite a wealth of information
, the prognostic indicators for the progression of primary cmm currently remain the tumour depth and proliferation , as well as the presence or absence of ulceration and micrometastases .
the diversity of cmm presentations allows to establish a classification providing insight into cmm epidemiological data and their molecular counterparts [ 14 , 15 ] .
in addition , the translation of cmm molecular biology to relevant clinical correlates and novel therapies has made significant progress over the past few years [ 6 , 9 , 10 ] .
gene expression profiling of human cancers , in particular cmm , allows for a unique insight into the genes intimately involved in the neoplastic process .
clinical and genomic evidence suggests that the metastatic potential of a primary cmm may be dictated by prometastatic events that have additional oncogenic capability .
the homeobox gene family and its subset represented by hox genes , and their related proteins represent , a cluster of molecules that are likely involved in the potential for metastasis expressed by some cancer cells including cmm cells .
the homeodomain is a four--helix helix - loop - helix dna binding motif , and its flanking sequences provide either activating or repressing functions for target gene transcription [ 18 , 19 ] .
these homeogenes are organized in four multigene clusters named a , b , c , and d mapped on chromosomes 2 , 7 , 12 , and 17 . each cluster is composed of 9 to 11 hox genes .
any hox gene is part of a family of dna sequences involved in a series of transcription factors affecting tissue development and cell differentiation .
hox proteins are present in nuclei and they direct dna - protein and protein - protein interactions .
the most common mutation in human cmm braf ( v600e ) activates the serine / threonine kinase braf and causes excessive activity in the mitogen - activated protein kinase ( mapk ) pathway .
braf ( v600e ) mutations are also present in benign melanocytic naevi , highlighting the importance of additional genetic alterations in the genesis of malignancies .
such changes include recurrent copy number variations that result in the amplification of oncogenes . for certain amplifications ,
the large number of genes in the interval has precluded an understanding of the cooperating oncogenic events .
the present coverage of peer - reviewed articles revisits the salient aspects of aberrant expression of hox genes in human cmm .
they appear highly conserved during evolution from simple organisms to vertebrates including humans [ 18 , 19 ] . in humans ,
hox proteins are crucial for skin morphogenesis , involved in the control of axial patterning , and responsible for hereditary malformations and some cancers including cmm . during ontogenetic development hox gene expression appear - tumour - stage related and tissue or region specific .
their relative position on chromosomes is connected to their expression domains along the anterior - posterior axis of the central nervous system .
in addition , hox genes coding for transcription factors is involved in the process of neoplastic progression including cmm [ 1822 ] .
they vary according to the histopathologic type and progression stage of the neoplasm including metastasis .
the location of the primary cmm on the body is unrelated to the aberrant hox expression .
hox - a1 is an oncogene playing a pivotal role in human cancers by stimulating cell proliferation , anchorage - independent cell growth , and loss of contact inhibition . in addition , hox - a1 and -a2 expression was higher in cmm with distant metastases compared to cmm without metastases [ 16 , 22 ] . of note ,
hox - a5 downregulates angiogenesis by mitigating the activity of proangiogenic genes and upregulating the expression of antiangiogenic genes .
the expression of hox - a11 and -a13 was reported to be higher in cmm than in melanocytic naevi .
hox - a11 expression was further more altered in metastatic cmm than in the pt1-t3 nonmetastatic tumours .
hox - b9 aberrant expression was reported to be higher in cmm than in melanocytic naevi .
hox - b13 appeared overexpressed in cmm with distant metastases than in cmm without metastases .
hox - b7 was reported to be overexpressed in proliferative cmm cells [ 27 , 28 ] . the bone morphogenetic protein ( bmp)-4 is overexpressed in cmm cells leading to the induction of basic fibroblast growth factor ( bfgf ) mediating cmm cell migration .
this biological pathway starts with the reduced expression of the micro - rna mir-196 in cmm cells compared to nonneoplastic melanocytes .
it is particularly activated by increasing hox - b7 transcription factor levels [ 27 , 28 ] .
an inverse relationship was established in the patterns of expression of hox - b7 and the promyelocytic leukemia zinc finger ( plzf ) protein , which acts as a suppressor .
hence , hox - b7 and plzf are functionally independent and their coupled deregulation may account for most if the alterations found in cmm .
there is an aberrant expression of genes located near the hox - c locus corresponding to hox - c10 , c11 , and c13 .
it results in alterations in integrins , icam-1 , n - ras , il-1a , il-6 , and tnf- .
hox - c4 was apparently overexpressed in cmm with distant metastases compared to cmm without metastases .
hox - c13 aberrant expression was higher in metastatic cmm compared to pt1-t3 nonmetastatic tumours [ 22 , 31 ] .
microrna ( mirna)-196a appeared to negatively regulate the expression of the transcription factor hox - c8 [ 32 , 33 ] .
hox - d3 is involved in regulating cell - cell interactions in cmm , as well as the motile and invasive behaviours of cmm cells . by contrast
hox - d12 and -d13 were reported to be expressed in cmm at a higher level than in melanocytic naevi [ 22 , 33 ] .
this finding is in line with a study on 79 tumour tissue types in which significant differences were reported between specific normal tissues and the corresponding neoplasms exhibiting an increase in hox - d13 expression .
compared to primary cmm , their metastases commonly express higher levels of genes including mage , gpr 19 , bcl2a1 , mmp14 , sox5 , bvb1 , and rgs20 .
the transition from non - metastatic to metastatic expression of hox activation levels occurs as the cmm increases in thickness .
the transition in gene expression appears to occur at different thicknesses for different cmm genes .
this critical transition timing for the emergence of the metastatic phenotype is a key moment in the evolution of cmm .
tumour oncogenes include spp-1 , mitf , cited-1 , gdf-15 , c - met , and hox loci .
suppressor genes include pitx-1 , cst-6 , pdgfrl , dsc-3 , pou2f3 , clca2 , and st7l .
hox genes are transcriptional regulators , which modulate embryonic morphogenesis and pathological tissue remodelling in adults via regulation of genes associated with cell - cell or cell extracellular matrix ( ecm ) interactions
. members of the hox family of homeodomain - containing transcription factors are deregulated in cmm .
the homeodomain is capable to bind to specific dna sequences , including promoters of other hox genes , and to enhance or inhibit transcription .
alteration of such a complex network controlling cell proliferation contributes to the multistep process underlying the onset of neoplasia .
indeed , alterations of specific groups of hox genes are associated with neoplastic transformation in different tissues including the breast , kidney , lymphoid organ , colon , lung , thyroid , bladder , prostate , and skin . accordingly , identifying the hox expression levels is expected to have a diagnostic value and to establish the prognosis of the neoplasm under consideration .
it has been suggested that hox genes contribute to cmm transformation and progression via the basic fibroblast growth factor ( bfgf ) , which promotes an autocrine loop in cmm and is one of the major angiogenic factors .
the molecular mechanisms and the possible genetic dysfunction underlying this process remain obscure , but the intervention of hox genes is likely .
the gene expression profiling of primary , nonmetastatic and metastatic cmm has resulted in the identification of several genes that are centrally involved in the progression and metastatic potential of cmm . among these mechanisms , homeoproteins represent transactivating factors issued from hox genes that regulate a series of gene expression [ 18 , 19 ] .
some alterations in specific hox genes are activated during various malignant transformations . the regulatory function of hox genes is possibly mediated by crucial growth factor genes . after the identification of the genes encoding several adhesion molecules , such as cytotactin , n - cam [ 40 , 41 ] , and l - cam , as target genes for homeoproteins , it was shown that bfgf was the first growth factor involved in the complex network underlying hox gene effects on cell proliferation and differentiation .
the autocrine bfgf production by cmm cells sustains tumoural growth as an early event in cmm progression .
other autocrine loops are likely involved in the same process and implicate diverse cytokines , growth factors , and receptors .
hox activation possibly boosts the rate of proliferation of cmm or represents a critical step in the progression and metastatic processes .
the intervention of hox gene dysfunction in the metastatic cmm switch is supported by the absence of such altered function in melanocytic naevi and primary non - metastatic cmm .
the search for new molecular markers that allow to select the tumour cell clones with respect to their aggressiveness and their ability to metastasize is certainly one of the most important future goals in cmm biomedical research .
several molecules , such as antisense oligonucleotide ( aso ) and interfering rna ( irna ) , were shown to be possibly capable to interact with crucial genes involved in the altered proliferation of the neoplastic cells [ 34 , 45 ] .
Output:
| the homeobox family and its subset of hox gene products represent a family of transcription factors directing dna - protein and protein - protein interactions . in the embryo , they are central regulators in cell differentiation during morphogenesis . a series of genes of the four hox gene clusters a , b , c , and d were reported to show aberrant expressions in oncogenesis , particularly in cutaneous malignant melanoma ( cmm ) .
they are involved in cell proliferation and progression in the cmm metastatic path .
we present relevant peer - reviewed literature findings about the aberrant expression of hox genes in cmm .
the number of cmm cell nuclei exhibiting aberrant hox protein expression appears correlated with tumour progression . |
PubmedSumm119653 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the mortality rate following neurosurgical treatment of an unruptured cerebral aneurysm varies from 0.4% to 1.5% , and age of the patient and size and location of the aneurysm are generally accepted factors that affect surgical outcome.9 ) for achievement of acceptable surgery - related morbidity and mortality rates , neurosurgeons strive for precise aneurysmal neck clipping , careful confirmation of branches or perforators that were not clipped together , and maintenance of flow in the parent artery to prevent ischemic accidents .
atherosclerotic changes in the intracranial artery and in part of the aneurysm result in diminished flexibility of the vessel itself , which not only makes the surgery difficult to perform but can also result in unexpected ischemic complications such as thromboembolism and vessel occlusion.2 ) in the current study , we analyzed and reported the clinical features of atherosclerotic intracerebral aneurysms treated at our center .
cases of 262 patients who underwent aneurysmal neck clipping surgery at our center between june 2004 and november 2010 were analyzed retrospectively .
we reviewed intraoperative videos ; microscopic photographs ; pre- and post - operative findings of computed tomography angiogram ( cta ) , magnetic resonance angiogram ( mra ) , and digital subtraction angiogram ( dsa ) ; and medical and surgical records .
we divided the patients into two groups : the atherosclerotic group ( ag ) with atherosclerotic appearance of vessels , and the non - atherosclerotic group ( nag ) without atherosclerosis .
the criteria for atherosclerotic aneurysm were assessed according to the surgeons ' intraoperative findings , either retrospectively or prospectively .
atherosclerotic changes in the vessel or aneurysm walls were identified as follows : ( 1 ) yellowish and/or whitish spotty appearance of the vessel and/or aneurysm ; ( 2 ) surgical confirmation of a definite decrease in elasticity of the wall , with or without a color change of the vessel ( fig .
atherosclerosis types were divided according to the following categories based on the position of the atherosclerotic changes : ( 1 ) parent artery and aneurysm neck ; ( 2 ) aneurysm neck ; ( 3 ) aneurysm neck and dome ; ( 4 ) aneurysm dome .
location in the parent artery was defined as atherosclerotic change within 5 mm from the neck of the aneurysm .
clinical outcome was determined according to scoring and changes on the glasgow outcome scale ( gos ) .
the outcome was determined as favorable if the gos score was either unchanged , regardless of the preoperative status , or improved to a gos score of 4 - 5 .
an outcome was considered unfavorable if there was deterioration to a gos score of 1 - 3 .
in addition , the occurrence of new postoperative ischemia was assessed with a head computed tomography ( ct ) scan .
the postoperative ct was analyzed for territory infarction or perforator infarction in relation to the clip position .
to evaluate the difference between the ag and nag , the variables of clinical characteristics , aneurysmal characteristics , and surgical procedures between the two groups were compared using univariate methods ( the two - sample t - test , fisher 's exact test , and pearson 's chi - square test ) .
medcalc ( version 13 , medcalc software bvba , ostend , belgium ) was used for analysis , and a p value less than 0.05 was considered statistically significant for all statistics .
cases of 262 patients who underwent aneurysmal neck clipping surgery at our center between june 2004 and november 2010 were analyzed retrospectively .
we reviewed intraoperative videos ; microscopic photographs ; pre- and post - operative findings of computed tomography angiogram ( cta ) , magnetic resonance angiogram ( mra ) , and digital subtraction angiogram ( dsa ) ; and medical and surgical records .
we divided the patients into two groups : the atherosclerotic group ( ag ) with atherosclerotic appearance of vessels , and the non - atherosclerotic group ( nag ) without atherosclerosis .
the criteria for atherosclerotic aneurysm were assessed according to the surgeons ' intraoperative findings , either retrospectively or prospectively .
atherosclerotic changes in the vessel or aneurysm walls were identified as follows : ( 1 ) yellowish and/or whitish spotty appearance of the vessel and/or aneurysm ; ( 2 ) surgical confirmation of a definite decrease in elasticity of the wall , with or without a color change of the vessel ( fig .
atherosclerosis types were divided according to the following categories based on the position of the atherosclerotic changes : ( 1 ) parent artery and aneurysm neck ; ( 2 ) aneurysm neck ; ( 3 ) aneurysm neck and dome ; ( 4 ) aneurysm dome .
location in the parent artery was defined as atherosclerotic change within 5 mm from the neck of the aneurysm .
clinical outcome was determined according to scoring and changes on the glasgow outcome scale ( gos ) .
the outcome was determined as favorable if the gos score was either unchanged , regardless of the preoperative status , or improved to a gos score of 4 - 5 .
an outcome was considered unfavorable if there was deterioration to a gos score of 1 - 3 .
in addition , the occurrence of new postoperative ischemia was assessed with a head computed tomography ( ct ) scan .
the postoperative ct was analyzed for territory infarction or perforator infarction in relation to the clip position .
to evaluate the difference between the ag and nag , the variables of clinical characteristics , aneurysmal characteristics , and surgical procedures between the two groups were compared using univariate methods ( the two - sample t - test , fisher 's exact test , and pearson 's chi - square test ) .
medcalc ( version 13 , medcalc software bvba , ostend , belgium ) was used for analysis , and a p value less than 0.05 was considered statistically significant for all statistics .
among 262 patients who underwent aneurysm clipping surgery at our center between june 2004 and november 2010 , atherosclerotic aneurysms were found in 67 patients , representing approximately 25.6% of all patients undergoing aneurysm clipping surgery .
the mean age of the patients with atherosclerotic aneurysms was 60.0 9.0 years ( mean sd , range : 38 - 74 ) , among whom 27 were males and 40 were females .
the mean age of the remaining 195 patients without atherosclerotic aneurysms was 54.2 11.3 years ( mean sd , range : 21 - 79 ) , among whom 64 were males and 131 were females ( table 1 ) .
a total of 73 lesions were identified among the atherosclerotic aneurysms ; of these , 48 lesions were ruptured and the remaining 25 were unruptured . among the non - atherosclerotic aneurysms ,
205 lesions were identified ; of these , 143 and 62 were ruptured and unruptured , respectively . among the atherosclerotic aneurysms ,
43 were found in the middle cerebral artery ( mca ) , 18 were found in the internal carotid artery ( ica ) , and 12 were found in the anterior cerebral artery ( aca ) . among the non - atherosclerotic aneurysms ,
93 were found in the mca , 40 were found in the ica , and 72 were found in the aca ( table 1 ) . a significant difference in aneurysm location was observed between the two groups ( p = 0.012 ) .
when the vessels with atherosclerotic changes were visualized intraoperatively , sites of the changes varied considerably .
atherosclerotic changes were observed in the parent artery and aneurysm neck in 24 cases , in the aneurysm neck in 21 cases , in the aneurysm neck and dome in 17 cases , and in only the aneurysm dome in 11 cases ( table 2 ) . out of 73 atherosclerotic aneurysms ,
14 were clipped with multiple permanent clips ; however , remnant neck and clip slippage were later observed in six and four cases , respectively . among 205 surgeries for non - atherosclerotic aneurysms ,
multiple clippings were performed in 34 cases , remnant neck was found in five cases , and clip slippage occurred in four cases .
comparison of the two groups showed a statistically significant difference in the variable of intentional remnant neck ( table 3 ) .
we then subdivided the specific surgical steps in the atherosclerotic aneurysm group ; there were 15 cases of specific surgical steps in the group with atherosclerotic change in the parent artery and aneurysmal neck . among them , multiple clippings were performed in seven cases , remnant neck was found in four cases , and clip slippage occurred in three cases , with only one case of wrapping . in another group ,
atherosclerotic change on the aneurysmal neck , multiple clippings were performed in six cases , remnant neck was found in two cases . in the other group , atherosclerotic change on the aneurysmal neck and dome , multiple clippings were performed in one case and clip slippage occurred in one case ( table 4 ) . in review of the postoperative outcomes of patients in the ag ,
47 patients had gos score of 4 - 5 and 20 patients had gos score of 1 - 3 .
one patient expired because of a territory infarction . in the ag , postoperative ischemic lesions developed in five patients ; two of these patients had a total territory infarction ( fig .
2 ) and three patients had a perforator infarction related to the site of the operated lesion . in the nag , five patients had infarctions in small subcortical regions . however , all patients in the nag who developed postoperative infarctions recovered completely from their neurologic deficits .
among 262 patients who underwent aneurysm clipping surgery at our center between june 2004 and november 2010 , atherosclerotic aneurysms were found in 67 patients , representing approximately 25.6% of all patients undergoing aneurysm clipping surgery .
the mean age of the patients with atherosclerotic aneurysms was 60.0 9.0 years ( mean sd , range : 38 - 74 ) , among whom 27 were males and 40 were females .
the mean age of the remaining 195 patients without atherosclerotic aneurysms was 54.2 11.3 years ( mean sd , range : 21 - 79 ) , among whom 64 were males and 131 were females ( table 1 ) .
a total of 73 lesions were identified among the atherosclerotic aneurysms ; of these , 48 lesions were ruptured and the remaining 25 were unruptured . among the non - atherosclerotic aneurysms ,
205 lesions were identified ; of these , 143 and 62 were ruptured and unruptured , respectively . among the atherosclerotic aneurysms ,
43 were found in the middle cerebral artery ( mca ) , 18 were found in the internal carotid artery ( ica ) , and 12 were found in the anterior cerebral artery ( aca ) . among the non - atherosclerotic aneurysms , 93 were found in the mca , 40 were found in the ica , and 72 were found in the aca ( table 1 ) . a significant difference in aneurysm location
when the vessels with atherosclerotic changes were visualized intraoperatively , sites of the changes varied considerably .
atherosclerotic changes were observed in the parent artery and aneurysm neck in 24 cases , in the aneurysm neck in 21 cases , in the aneurysm neck and dome in 17 cases , and in only the aneurysm dome in 11 cases ( table 2 ) .
out of 73 atherosclerotic aneurysms , 14 were clipped with multiple permanent clips ; however , remnant neck and clip slippage were later observed in six and four cases , respectively . among 205 surgeries for non - atherosclerotic aneurysms ,
multiple clippings were performed in 34 cases , remnant neck was found in five cases , and clip slippage occurred in four cases .
comparison of the two groups showed a statistically significant difference in the variable of intentional remnant neck ( table 3 ) .
we then subdivided the specific surgical steps in the atherosclerotic aneurysm group ; there were 15 cases of specific surgical steps in the group with atherosclerotic change in the parent artery and aneurysmal neck . among them , multiple clippings were performed in seven cases , remnant neck was found in four cases , and clip slippage occurred in three cases , with only one case of wrapping . in another group , atherosclerotic change on the aneurysmal neck , multiple clippings were performed in six cases , remnant neck was found in two cases . in the other group ,
atherosclerotic change on the aneurysmal neck and dome , multiple clippings were performed in one case and clip slippage occurred in one case ( table 4 ) .
in review of the postoperative outcomes of patients in the ag , 47 patients had gos score of 4 - 5 and 20 patients had gos score of 1 - 3 .
one patient expired because of a territory infarction . in the ag , postoperative ischemic lesions developed in five patients ; two of these patients had a total territory infarction ( fig .
2 ) and three patients had a perforator infarction related to the site of the operated lesion . in the nag , five patients had infarctions in small subcortical regions . however , all patients in the nag who developed postoperative infarctions recovered completely from their neurologic deficits . no statistical difference in development of ischemic complications
recently , treatment of cerebral aneurysms has been developing at a rapid pace , and a number of studies have reported good clinical outcomes of aneurysm surgeries . however , flamm et al .
reported that the presence of plaque in an aneurysm can be a predictive factor for unexpected complications during aneurysm surgery.3 ) other researchers have also examined the importance of atherosclerotic aneurysms . in 1999 , ohno et al .
reported atherosclerotic changes in six patients ( 10% ) among 30 patients with cerebral aneurysms.8 ) similarly , in 2003 , grigorian et al .
reported atherosclerotic changes in 81 patients ( 26.7% ) among 333 patients with aneurysms.4 ) in our study , 67 ( 25.6% ) of the 262 patients with aneurysms had atherosclerotic aneurysms .
atherosclerosis is a well - known pathological condition that generally affects the arterial blood vessels . as a degenerative process
, atherosclerotic changes result from deposition of plasma lipids , connective tissues , and local or circulating cells over the intima of the blood vessels , which leads to narrowing of the vessel lumen.7 ) the restorability of such atherosclerotic vessels is limited because of a resultant decrease in elasticity and increase in rigidity of the vessel.10 ) during aneurysm surgery , if the aneurysmal neck has atherosclerotic changes , problems such as incomplete neck clipping and narrowing of the lumen of the parent artery may occur.8 ) in particular , narrowing of the lumen of the parent artery may be an important cause of postoperative ischemic events . regarding aneurysm location , szelenyi et al .
reported that among patients with atherosclerotic aneurysms , ten had aneurysms in the ica , five had aneurysms in the anterior communicating artery , and 19 had aneurysms in the mca.9 ) ohno et al .
reported that six patients among seven patients with atherosclerotic changes in the aneurysmal neck had mca aneurysms.8 ) in our study , 43 patients among the 73 patients with atherosclerotic aneurysms had aneurysms in the mca .
reported that eight cases among 34 atherosclerotic aneurysm cases had atherosclerotic changes in the parent vessel , aneurysm dome , or aneurysm neck , respectively , and 11 cases had changes in both the aneurysm dome and neck.9 ) in our study of 73 cases , the sites of atherosclerotic change were as follows : both parent artery and aneurysm neck in 24 ( 32.9% ) , aneurysm neck in 21 ( 28.8% ) , both aneurysm neck and dome in 17 ( 23.3% ) , and aneurysm dome in 11 ( 15.0% ) .
these findings are not relevant to the findings reported in the papers mentioned earlier . regarding the postoperative prognosis of patients with atherosclerotic aneurysms , szelenyi et al .
reported that 27 of 34 atherosclerotic aneurysm patients had a good clinical outcome , increasing to 30 patients at six months .
postoperatively , four patients had an unfavorable outcome , and at the six - month follow - up , only three patients had an unfavorable outcome.9 ) in our series , 47 patients had a favorable outcome , 20 patients had an unfavorable outcome , and , unfortunately , one patient expired . the most likely explanation for the higher rate of unfavorable clinical outcomes in our series as compared with that of szelenyi et al .
is that the latter study included only unruptured aneurysms , whereas we included 48 cases of ruptured aneurysms .
reviews of other studies have found that the frequency of morbidity in patients with atherosclerotic aneurysms is higher than in patients with non - atherosclerotic aneurysms , approximately 14% and 6.8% , respectively.2)3)6 ) in atherosclerotic aneurysms , the atherosclerotic wall might increase the occurrence of thromboembolic events , or its rigidity might lead to occlusion of perforators within the aneurysm vicinity during surgery.1)5 ) szelenyi et al .
reported that in six patients with atherosclerotic aneurysms , a small residuum of the aneurysm neck was intentionally left .
in addition , in patients with atherosclerotic aneurysms , temporary vessel occlusion and multiple repositioning of the permanent clip were performed more often than in patients with non - athe rosclerotic aneurysms .
although the application of more than one permanent clip and wrapping occurred more often in patients with atherosclerotic aneurysms , this did not reach statistical significance in their study.9 ) it is expected that clip placement in atherosclerotic aneurysms requires more surgical steps compared with non - atherosclerotic aneurysms .
this is supported by our finding that the intraoperative observation of atherosclerosis showed significant correlation with a higher percentage of multiple positioning of a permanent clip .
clip placement might be hampered by a rigid atherosclerotic wall such that aneurysm obliteration due to sliding of the clip off the aneurysm dome is not complete or that the parent vessel or perforating branches are occluded ( fig .
one solution to this problem is aneurysm obliteration with multiple clips.8)9 ) furthermore , as in our study , avoidance of the region of the atheroma could promote effective clip placement and prevent parent artery occlusion .
in the surgical repair of aneurysms , the incidence of ischemia , which is irreversible or severe , might be greater in atherosclerotic than in non - atherosclerotic aneurysms .
careful manipulation and a thorough understanding of atherosclerotic vessels during neck clipping surgery can prevent ischemic accidents resulting from parent artery stenosis or perforating artery occlusion and yield satisfactory surgical results .
in addition , multiple clips might be applied to atherosclerotic aneurysms for effective obliteration and the aneurysm neck might be left to avoid a region of atheroma .
Output:
| objectiveatherosclerotic cerebral aneurysms are known to increase occurrence of thromboembolic events and occlusion of perforator vessels intraoperatively due to pathological changes in the vessels themselves . in the current study
, we analyzed the points to be considered during surgery for atherosclerotic cerebral aneurysms and the postoperative results.materials and methodswe retrospectively reviewed the medical records , radiological results , and surgical records , including intraoperative video recordings and photographs , of 262 patients who underwent cerebral aneurysm surgery .
we then performed a detailed analysis of aneurysm features , surgical methods , and clinical outcomes.resultsamong 278 aneurysms in 262 patients , 73 aneurysms in 67 patients showed atherosclerotic features ( atherosclerotic group , ag ) , and 205 aneurysms in 195 patients showed no evidence of atherosclerosis ( non - atherosclerotic group , nag ) . in the ag , clipping with multiple permanent clips was performed in 14 aneurysms , and clip slippage was found in four cases .
six ag cases had a remnant neck after clipping , which was significantly more frequent than in the nag ( p < 0.05 ) .
clinical outcomes and surgery - related complications did not differ significantly between the two groups.conclusionin the surgical repair of aneurysms , the incidence of ischemia , which is irreversible or severe , might be greater in atherosclerotic than in non - atherosclerotic aneurysms . in addition , multiple clips might be applied to atherosclerotic aneurysms for effective obliteration and an aneurysm neck might be left to avoid a region of atheroma . |
PubmedSumm119654 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: preeclampsia is the most frequently encountered medical complication of pregnancy , causing considerable maternal and fetal morbidity and mortality ( 1 ) .
preeclampsia affects approximately 5% of all pregnancies and in up to 10% to 20% of nulliparous women ( 2 ) . despite intensive studies ,
placental ischemia caused by the inadequate endometrial invasion of trophoblast and endothelial damage is considered to play a crucial role in the pathogenesis of preeclampsia ( 3 , 4 ) .
the failure of communication between trophoblast cells and decidual immune cells in the placenta , results in poor placentation which leads to poor remodeling of spiral arteries , systemic inflammatory response , dysfunctional maternal endothelium , poor placental oxygenation and hypoxic conditions .
these events precede the clinically recognizable symptoms of maternal disease , such as hypertension , proteinuria and edema ( 5 ) .
interleukin10 ( il-10 ) is a potent pleiotropic cytokine , located on chromosome 1q31 - 32 , consisting of five exons and four introns .
it has the dual ability of immunosuppression or immunostimulation via the production of pro - inflammatory cytokines by the inhibition of t - helper 1 ( th1 ) lymphocytes and stimulation of b lymphocytes and th2 lymphocytes , and thus downregulates the inflammatory response ( 6 ) .
various single nucleotide polymorphisms ( snps ) have been described in the il-10 promoter region , both of distal and proximal promoter regions , with functional significance ( 7 ) .
genotypic variations in the human interleukin-10 ( il-10 ) promoter accounts for marked inter - individual variations in il-10 production and may influence individual susceptibility to autoimmune diseases .
the g / a polymorphism at position -1082 has been linked to high / low il-10 production status . in view of the above
, we aimed to evaluate the role of il-10 ( -1082 g / a ) gene promoter polymorphism in the etiology of preeclampsia .
a total of 88 pregnant women with preeclampsia and 100 women with normal pregnancy attending the gynecological unit of government maternity hospital were considered for the present study during the year 2011 - 12 .
information regarding the demographic features such as age , marital history , parity , gestational age , family history , consanguinity , etc were obtained from all the subjects with the help of a standard proforma questionnaire .
the patients showing blood pressure > 130/90 mm hg on two occasions , 6 hr apart , and onset of proteinuria > 2 + by dip stick test in urine sample were considered as preeclamptic and those who showed blood pressure > 150/100 mm hg and proteinuria > 3 + by dipstick test in urine sample were considered as patients with severe preeclampsia .
women with no complications throughout their gestational period , like infections , fetal anomalies , hypertension and diabetes were considered as the control subjects .
patients with previous history of intrauterine fetal deaths and other complications were not considered for the study . the venous blood ( 5 ml )
was collected from all the participants for biochemical and molecular analysis and aliquoted in plain and edta vacutainers .
the genomic dna was extracted from the samples using salting out method described by lahiri et al .
the isolated dna was subjected to a standard amplification refractory mutation system polymerase chain reaction ( arms - pcr ) ( 9 ) .
briefly , two complementary reactions were established for each allele consisting of target dna : allele specific arms primers ( fg for g allele and fa for a allele ) and the common primer ( cf ) .
the primers used are as follows : a common ( cf ) anti - sense primer 5-gta agc ttc tgt ggc tgg agt c-3 ; ( fg ) sense 5-aac act act aag gct tct ttg ggt g-3 g - primer ; ( fa ) sense 5-aac act act aag gct tct ttg ggt a-3. the optimized reaction conditions consisted of 40 ng of genomic dna in a reaction volume of 15 l containing 1x reaction buffer , 1.5 m mgcl2 , 30 m of each dntp , 0.16 m of each primer , and 0.3 u of taq dna polymerase .
the cycling conditions were as follows : an initial denaturation at 94c for 4 min , followed by 35 cycles at 94c for 30 s , 61c for 20 s , and 72c for 30 s. the final extension step was at 72c for 6 min .
the pcr products were separated by electrophoresis on an agarose gel ( 2% ) stained with ethidium bromide .
results were cross - checked with internal positive ( 796 bp of hla gene ) and negative controls ( millipore water ) .
ten percent of the samples were randomly taken , and the assay was repeated and found no bias in the genotyping .
genotype distribution in the control and case groups were compared with values predicted by hardy - weinberg equilibrium using test .
discrete variables were expressed as counts ( % ) and were compared by the test .
odd ratios ( or ) and their 95% confidence intervals were used to measure the strength of association between il-10 gene polymorphism and preeclampsia .
a total of 88 pregnant women with preeclampsia and 100 women with normal pregnancy attending the gynecological unit of government maternity hospital were considered for the present study during the year 2011 - 12 .
information regarding the demographic features such as age , marital history , parity , gestational age , family history , consanguinity , etc were obtained from all the subjects with the help of a standard proforma questionnaire .
the patients showing blood pressure > 130/90 mm hg on two occasions , 6 hr apart , and onset of proteinuria > 2 + by dip stick test in urine sample were considered as preeclamptic and those who showed blood pressure > 150/100 mm hg and proteinuria > 3 + by dipstick test in urine sample were considered as patients with severe preeclampsia .
women with no complications throughout their gestational period , like infections , fetal anomalies , hypertension and diabetes were considered as the control subjects .
patients with previous history of intrauterine fetal deaths and other complications were not considered for the study .
the venous blood ( 5 ml ) was collected from all the participants for biochemical and molecular analysis and aliquoted in plain and edta vacutainers . serum and plasma
the genomic dna was extracted from the samples using salting out method described by lahiri et al .
the isolated dna was subjected to a standard amplification refractory mutation system polymerase chain reaction ( arms - pcr ) ( 9 ) .
briefly , two complementary reactions were established for each allele consisting of target dna : allele specific arms primers ( fg for g allele and fa for a allele ) and the common primer ( cf ) .
the primers used are as follows : a common ( cf ) anti - sense primer 5-gta agc ttc tgt ggc tgg agt c-3 ; ( fg ) sense 5-aac act act aag gct tct ttg ggt g-3 g - primer ; ( fa ) sense 5-aac act act aag gct tct ttg ggt a-3. the optimized reaction conditions consisted of 40 ng of genomic dna in a reaction volume of 15 l containing 1x reaction buffer , 1.5 m mgcl2 , 30 m of each dntp , 0.16 m of each primer , and 0.3 u of taq dna polymerase .
the cycling conditions were as follows : an initial denaturation at 94c for 4 min , followed by 35 cycles at 94c for 30 s , 61c for 20 s , and 72c for 30 s. the final extension step was at 72c for 6 min .
the pcr products were separated by electrophoresis on an agarose gel ( 2% ) stained with ethidium bromide .
results were cross - checked with internal positive ( 796 bp of hla gene ) and negative controls ( millipore water ) .
ten percent of the samples were randomly taken , and the assay was repeated and found no bias in the genotyping .
genotype distribution in the control and case groups were compared with values predicted by hardy - weinberg equilibrium using test .
discrete variables were expressed as counts ( % ) and were compared by the test .
odd ratios ( or ) and their 95% confidence intervals were used to measure the strength of association between il-10 gene polymorphism and preeclampsia .
a total of 88 pregnant patients with preeclampsia and 100 controls with normal pregnancy were included in this study .
the demographic characteristics of patients and controls revealed a significant difference with respect to age ( p=0.0013 ) , number of children ( p=0.0076 ) and blood pressure ( p= 0.0001 ) . however , there was no variation with regard to mode of delivery , fetal growth and edema .
the genotypic distribution of -1082 g / a il-10 polymorphism are illustrated in table 1 .
the frequencies of the genotypes gg , ga and aa , were 17.8% , 41.09% and 41.09% in patients with preeclampsia , and 25% , 28% and 47% in controls , respectively .
there was no statistical difference in the distribution of genotypic or allelic frequencies between the patient and control groups ( test power=0.66 ) for gg vs. aa ( or=0.814 , 95% ci=0.36181.834 ) , gg vs. ga+aa ( or=0.65 , 95% ci=0.30671.370 ) , ga vs. gg+aa ( or=0.5574 , 95% ci=0.29431.056 ) , aa vs. ga+gg ( or= 1.271 , 95% ci=0.6902.338 ) and g allele vs. t allele ( or=0.97 , 95% ci= 0.621.5 ) .
preeclampsia is the most common pregnancy - specific complication that still ranks as one of the major obstetric problems .
preeclampsia syndrome is described as excessive maternal inflammatory responses , perhaps directed against foreign fetal antigens that induce a chain of events including surface trophoblast invasion , defective spiral artery remodeling , placental infarction and release of pro - inflammatory cytokines and placental fragments in the systemic circulation .
a normal pregnancy is accompanied by an inflammatory response which produces a state of mild systemic inflammation , completed with activation of multi - components of inflammatory network .
these inflammatory changes may progress to the point of circulatory decompensation and endothelial dysfunction , resulting in one or more pregnancy complications , including preeclampsia ( 10 , 11 ) .
current theories regarding the immune response in preeclampsia focus on the phenomenon of t - cell differentiation into two types of helper cells : type 1 ( th1 ) and type 2 ( th2 ) .
t - helper type 1 cells produce pro - inflammatory cytokines and are involved in cell - mediated immunity , while t - helper type 2 cells produce anti - inflammatory , immuno - suppressor cytokines and are involved in b - cell humoral immunity ( 12 ) .
( 13 ) first proposed the hypothesis that th1 responses are suppressed in normal pregnancy to prevent immune rejection of fetus . in preeclampsia
an imbalance in the th1/th2 ratio has been proposed with deviation towards th1 response ( 14 , 15 ) .
th1 type cytokines , such as tnf- , ifn- and il-2 , are pro - inflammatory cytokines which induce trophoblastic apoptosis , and restrain differentiation of trophoblast .
th2 type cytokines , such as il-10 , are anti - inflammatory cytokines , and act as autocrine inhibitors of cytotrophoblast invasion in the uterine wall .
roth and fisher stated that high concentrations of il-10 reduces the tropho - blast invasion which in turn is a major cause of preeclampsia ( 16 ) .
thus , the role of il-10 in the immune response is to inhibit the production of various pro - inflam - matory cytokines produced by a large number of different immune cells ( 17 ) .
the inter - individual differences in il-10 production are largely under genetic control ; 5075% of the variation can be explained by genetic factors as demonstrated in twin studies ( 18 , 19 ) .
it is also plausible that intrauterine cytokine milieu and balance of vascular factors may modulate the effects of hypoxic levels of oxygen .
hypoxia affects the cytokine balance by reducing interleukin il-10 production and inducing il-6 and il-8 in placenta and trophoblast ( 20 ) .
. carried out a study on patients with preeclampsia and indicated that the -1082a allele confers a two - fold increase in transcriptional activity of the il-10 promoter compared to the g allele ( 21 ) .
there was marked inter - individual variation in il-10 production by peripheral blood mononuclear cells in vitro , with no consistent effect of genotype .
the present study revealed no association of il-10 -1082 polymorphism in patients with preeclampsia compared to the controls .
( 23 ) in white women demonstrated a significant association of il-10 genotype and allele frequency between controls and patients . on the contrary ,
( 26 ) in australian population demonstrated that even though the il-10 genotype was aa , there was no significant lowering of il-10 levels in maternal serum but when observed in placental tissue revealed a significant decrease in il-10 concentration in placenta proving that il-10 plays an important role in the placental formation .
most of the studies have either shown a significant association with a allele or no association with neither of the alleles . the latest meta - analysis conducted by xie et al .
( 27 ) , also concluded no association between il-10 -1082a / g , and preeclampsia .
in conclusion , the present study suggests that the il-10 -1082 promoter polymorphism is not a major genetic regulator in the etiology of preeclampsia in the studied ethnic group
Output:
| backgroundpreeclampsia is a pregnancy - specific syndrome that may be life - threatening , especially to the fetus .
several causes have been reported that may have a possible role in the development of the disorder . interleukin-10
affect maternal intravascular inflammation , as well as endothelial dysfunction .
the aim of this study was to investigate the association between il-10 g-1082a polymorphism and preeclampsia.methodsa total of eightyeight pregnant women with preeclampsia and 100 women with normal pregnancy attending the gynecological unit of government maternity hospital , petlaburz , hyderabad , india , were considered for the study . a standard amplification refractory mutation system ( arms )
pcr was carried out for genotyping il-10 g-1082a promoter polymorphism in all the participants .
genotypic distribution of the control and patient groups were compared with values predicted by hardy - weinberg equilibrium using 2 test .
odd ratios ( or ) and their respective 95% confidence intervals were used to measure the strength of association between il-10 gene polymorphism and preeclampsia.resultsthe frequencies of il-10 g-1082a genotypes , gg , ga and aa , were 17.8% , 41.09% and 41.09% in women with preeclampsia and 25% , 28% and 47% in the controls respectively .
there was no significant difference in the distribution of genotypes and alleles of il-10 g-1082a between the two groups ( test power=0.66).conclusionthe present study suggests that the il-10 g-1082a gene promoter polymorphism is not a major genetic regulator in the etiology of preeclampsia . |
PubmedSumm119655 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: bartonella species are gram - negative , facultative intracellular bacilli , and the genus includes more than 20 species or subspecies . among these species and subspecies ,
bartonella henselae is the primary species that causes human illnesses , including lymphadenopathy , bacteremia , bacillary angiomatosis , and other localized infections .
cat bites and the scratching of flea - bite sites are thought to be the main routes of transmission to humans and cats .
there have been several reports of bartonella infection in korea . in one study , among 31 patients with cervical lymphadenopathy , 21 ( 67.7% ) and 20 ( 64.5% ) patients had positive serologic results for b. henselae and b. quintana , respectively . using polymerase chain reaction ( pcr ) analysis ,
the prevalence of bartonella infection was found to be 0 - 44.1% in animals [ 2 - 5 ] and 0 - 19.1% in arthropod vectors [ 3 , 5 , 6 ] .
infection in both cats and cat fleas are high in korea [ 3 , 5 , 6 ] , it is rather surprising that there have been only 5 case reports of cat - scratch disease [ 7 , 8 ] and 1 case report of b. quintana endocarditis published .
all these previously reported cases were diagnosed using pcr . to our knowledge , no case of culture - proven bartonella bacteremia has been reported thus far in korea .
bacteremia has been known to occur , typically in immunocompromised patients . however , with advanced diagnostic methods , such as the use of a novel growth medium , b. henselae bacteremia is increasingly identified in immunocompetent patients .
we report a case of culture - proven b. henselae bacteremia in a patient presenting with fever of unknown origin ( fuo ) .
a 73-year - old woman was admitted to our hospital for evaluation of fever . the patient had diabetes mellitus that had been managed with oral hypoglycemic agents for 10 years .
six years previously , the patient underwent an orthopedic operation involving the insertion of internal fixation due to a right ankle fracture .
one week later , the patient visited the emergency room of our hospital for evaluation of fever . at that time , her body temperature was 39. to identify the cause of the fever , laboratory tests were conducted , which revealed the following : hemoglobin level , 12.9 g / dl ; white blood cell ( wbc ) count , 5,120/mm ; platelet count , 164,000/mm ; aspartate aminotransferase level , 47 iu / l ; alanine aminotransferase level , 56
iu / l ; alkaline phosphatase level , 228 iu / l ; c - reactive protein ( crp ) level , 131.6 mg / l ; and erythrocyte sedimentation rate , 22 mm / h .
blood culture grew coagulase - negative staphylococcus in 1 of the 2 sets , which was dismissed as a contaminant .
the patient refused to be admitted to hospital ; therefore , oral amoxicillin - clavulanate was prescribed .
thus , the patient was admitted to our division on may 22 , 2009 . on admission
, she had a body temperature of 39.0 , a pulse rate of 90/min , a respiration rate of 18/min , and blood pressure of 120/80 mmhg .
her wbc count had increased to 9,930/mm , her platelet count to 189,000/mm , and her crp level to 179.2 mg / l .
other laboratory results , including repeated blood culture , revealed no significant changes . to determine the cause of the headache ,
ceftriaxone was administered empirically for 5 days , followed by a combination of ceftriaxone and doxycycline for 6 days .
owing to her persistent fever , vancomycin and doxycycline were substituted on hospital day ( hd ) 16 , and as a result , her fever decreased to 37.5 the next day . on hd 23 , serologic test results for q fever , which were analyzed at the korea centers for disease control and prevention , were positive at titers of 1:64 for immunoglobulin ( ig ) m and 1:1,024 for igg in a blood specimen taken on hd 7 .
the treatment regimen was changed to a combination of doxycycline and hydroxychloroquine to target the possible chronic q fever , and the fever reduced to below 37. the patient was discharged on hd 29 , and followed up at the opd on july 3 , 2009 . at this follow - up visit , antibody titers to q fever were 1:32 and 1:2,048 for igm and igg , respectively .
we performed cell culture or shell vial culture assays routinely for all patients with fuo .
edta - treated whole blood ( 0.3 ml ) obtained at admission was inoculated onto a monolayer of ecv304 cells grown in a tissue culture flask ( 25 cm ) .
the inoculated blood was washed with phosphate buffered saline 24 h later , and the culture was maintained in m199 medium ( gibco brl , gaithersburg , md , usa ) supplemented with 10% heat - inactivated fetal bovine serum ( gibco brl ) in a humidified atmosphere containing 5% co2 at 37. media were changed every 3 to 4 days without subculture .
nine days after subculture onto a blood agar plate , small transparent colonies were observed ( fig .
1b ) . to identify the isolated bacterium , conventional pcr targeting the 16s-23s rrna intergenic spacer ( its ) region of bartonella species was performed , followed by sequencing , as described previously .
the pair of primers used for the amplification of the its gene were 16sf ( 5'-agaggcaggcaaccacggta-3 ' ) and 23si ( 5'-gccaaggcatccacc-3 ' ) .
the sequence alignment of the pcr product was 960 characters long ( genbank accession number : jq638927.1 ) .
pair - wise comparison using blast ( national institutes of health , bethesda , md , usa ) revealed that the isolate was most like b. henselae houston-1 strain ( maximum pairwise identity score : 98% ) .
instead , cell culture , direct inoculation of blood specimens onto agar plates , or the use of bartonella alpha proteobacteria growth medium must be used to successfully cultivate the bacterium . however
, these culture techniques are seldom used in korean hospitals , and hence , isolation of the bacterium has never been reported .
if isolated , the pathogen can then be used for further study . the isolate described above
in addition , one cause of false - negative results obtained using an indirect immunofluorescent assay ( ifa ) is thought to be the variation in antigenic expression between b. henselae strains .
ifa is thought to be more sensitive if a locally isolated strain is incorporated into the panel of strains used as antigens .
therefore , pcr has been used for patients with clinically suspected bartonella infection , who usually exhibit lymphadenopathy or have a history of exposure to cats or dogs .
the 5 cases of b. henselae lymphadenitis documented in korea were diagnosed in this manner .
serologic tests have low sensitivity , yield inconsistent results in some patients , and are subject to significant cross - reactivity with other pathogens .
for example , in the present case , the seropositivity for q fever was thought to be due to cross - reaction with bartonella species antigens .
although co - infection with coxiella burnetii and b. henselae can not be excluded , our previous experience with a scrub typhus case found a false - positive result for c. burnetii .
in addition , a report revealing occasional false - positive results for c. burnetii in bartonellosis leads us to disregard the positive serologic results for c. burnetii .
the drawbacks of serologic testing had rendered them unavailable in most korean hospitals and referral centers , with the exception of the korea centers for disease control and prevention .
pathologic examination using silver staining methods has been used to diagnose bartonella lymphadenopathy , but is not useful in the diagnosis of bacteremia .
although bartonellosis is an important cause of fuo , previous studies of fuo in korea have not evaluated bartonellosis .
therefore , the level of clinical suspicion of bartonellosis in patients with fuo is lower than that in patients with lymphadenopathy .
in addition , clues suggesting bartonellosis , such as contact with cats or insects , are often lacking , which makes diagnosis more difficult . furthermore , bartonella infection in elderly persons frequently presents with atypical manifestations and is not accompanied by lymphadenopathy ; thus , this diagnosis is often disregarded .
screening by laboratory tests is necessary for diagnosing bartonellosis in patients with prolonged fever , even in those lacking the characteristics usually associated with bartonellosis .
exposure to cats or possibly dogs is a risk factor , but many patients with bartonellosis do not report exposure to pet animals . instead , because bartonella dna has been detected in various arthropod vectors including ticks and mites , patients may become infected via these vectors . given that b. henselae can cause persistent infection , recrudescence may be an alternative explanation , though the patient did not have a history of bartonellosis .
the patient in the present report was successfully managed with a combination of doxycycline and chloroquine , although this treatment 's efficacy against b. henselae bacteremia is unproven .
a combination of doxycycline and gentamicin is recommended for bartonella endocarditis , and azithromycin and rifampin in combination have been used in some patients with b. henselae bacteremia .
although the effects of chloroquine in the treatment of bartonellosis are currently not known , its effect has been established in other intracellular bacterial infections such as q fever and whipple 's disease . in these diseases , chloroquine enhances the antimicrobial efficacy of doxycycline through the alkalization of acid vesicles such as phagosomes .
although b. henselae does not proliferate in acidic vesicles , in the present case , the addition of chloroquine to doxycycline seemed to be more efficacious in controlling the fever than doxycycline alone ( ceftriaxone and doxycycline , vancomycin and doxycycline ) .
therefore , chloroquine may potentiate the antibiotic effect in bartonella infection via a mechanism other than alkalization of phagosomes
. further evaluation of the efficacy of adding chloroquine to doxycycline is needed . in summary , we have reported a case of culture - proven b. henselae bacteremia in a patient who presented with fuo .
this case suggests that bartonellosis should be included in the list of differential diagnoses in fuo , even in patients lacking the common characteristics of cat - scratch disease . because the characteristic findings of bartonellosis are frequently absent in elderly persons with this disease , screening by laboratory tests
Output:
| bartonella henselae causes cat - scratch disease , bacteremia , and various focal infections . despite the worldwide occurrence of b. henselae infections , reports in humans
are rare in korea .
the clinical manifestation of all 5 previously reported cases was lymphadenopathy . herein , we report a case of bacteremia in a woman who presented with prolonged fever
. b. henselae was isolated from a blood specimen by cell culture .
conventional polymerase chain reaction amplification and sequencing of the 16s-23s rrna intergenic space region confirmed the isolate to be b. henselae .
the patient had no underlying immunocompromising conditions and no recent exposure to animals .
she was successfully managed with a combination of doxycycline and hydroxychloroquine . |
PubmedSumm119656 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: influenza is potentially fatal in the elderly , as it can be complicated by pneumonia and other serious diseases in this subpopulation . in several studies ,
influenza vaccination in the elderly has been reported to reduce influenza - associated mortality by 3954% and pneumonia - associated hospitalization by 2773% 13 .
the commonly encountered adverse reactions to seasonal influenza vaccine are redness , pain and/or swelling at the injection site , which are reported to occur in 20% of all vaccine recipients .
these adverse reactions are generally mild , the majority occurring within 48 h of vaccination and resolving within 2 or 3 days 4,5 . although rare systemic adverse reactions , such as guillain barre syndrome and acute disseminated encephalomyelitis , are known to occur a few days to a few weeks after vaccination , the incidence rates of these reactions are extremely low . given that influenza - associated mortality is 30150 per 100,000 persons each year , it has been concluded that the benefits of the vaccine exceed the risks 6,7 .
an 80-year - old man received influenza vaccination in the deltoid muscle area of the left upper arm . on the evening of day seven after the vaccination , he noticed trembling of his left hand for 10 min . at that time
he then went to bed as usual . in the morning on day eight after the vaccination
, his family discovered that he had urinated in his bed and vomited in his sleep .
because he did not respond to their calls , he was brought to our hospital by ambulance .
the physical findings on arrival at the hospital were as follows : glasgow coma scale e4v3m6 , blood pressure 116/79 mmhg , pulse rate 79/min ( regular ) , peripheral arterial oxygen saturation by pulse oximetry 97% ( room air ) , respiratory rate 16/min , and body temperature 37.3c .
the hematological findings were as follows : white blood cell ( wbc ) count 10,400/l ( neutrophils : 79.8% ) , serum creatine kinase ( ck ) 1272
iu / l , and serum c - reactive protein ( crp ) 2.39 mg / dl .
head computed tomography ( ct ) revealed no abnormal findings that could explain the impaired consciousness . by the time the patient arrived at the hospital ,
, there was no relapse of the impaired consciousness , and neither head magnetic resonance imaging ( mri ) nor electroencephalography revealed any abnormalities . on day two of hospitalization ,
iu / l and 3.95 mg / dl , respectively ) , and redness and swelling were observed in the left shoulder region . on day three of hospitalization ,
the fever and the redness of the left shoulder resolved , and the hematological findings revealed a decreasing trend of the wbc count and serum ck . however , because the swelling in the left shoulder was almost unchanged , ct and mri were performed .
contrast - enhanced ct of the left shoulder joint ( fig.1 ) revealed swelling and an increase in area of the surrounding subcutaneous adipose tissue in the left deltoid muscle , and mri of the left shoulder joint ( fig.2 ) revealed muscle swelling and inflammatory changes around the left deltoid muscle .
although there seemed to be a tendency toward improvement of the general condition and hematological findings , oral administration of nonsteroidal anti - inflammatory drugs and intravenous infusion of sulbactam / ampicillin were started on day four of hospitalization , considering the possibility of a complicating bacterial infection at the inflamed site .
axial contrast - enhanced computed tomography ( ct ) of the shoulder showing the low density area , in the left deltoid muscle , with slightly enhanced the marginal region ( arrow ) .
( a ) axial t1-weighted mr image , ( b ) axial t2-weighted mr image , ( c ) axial t2-weighted fat - saturated mr image of the shoulder showing increased t2-weighted signal in left deltoid muscle and subcutaneous fat tissue ( arrow ) , which might suggest focal inflammatory changes .
in japan , in the 1970s , it was reported that intramuscular injection of antipyretics and antimicrobial drugs caused quadriceps contracture in as many as 3600 patients . since then , there has been a tendency to avoid administration of drugs by intramuscular injection .
thus , almost all vaccines , including influenza vaccine , with the exception of human papillomavirus vaccine , are administered by subcutaneous injection . as compared to intramuscular injection ,
subcutaneous injection is considered to be more likely to cause local adverse reactions ( pain , erythema , induration , etc . )
thus , even adjuvant - containing vaccines that contain a substance to enhance the immune responses to the administered antigens are not used in japan , with the objective of preventing adverse reactions . according to reports on the adverse reactions after influenza vaccination by the japanese ministry of health , labour and welfare , the majority of cases of local reactions are reported within 2 days of vaccination .
a summary report based on surveys conducted in 13,386 vaccine recipients over a period of 12 years shows that there were only eight vaccine recipients who developed local reactions 1 week or more after vaccination .
unlike our patient , however , none of the eight vaccine recipients had any systemic reaction 9 .
on the other hand , inactivated vaccines are administered by intramuscular injection abroad . according to several studies , local reactions to intramuscular injection
are considered to be mild , in general , and to mainly occur within 2 days of vaccination , similar to the case in japan 1013 .
the adverse reactions include events caused by errors in vaccination procedures and events occurring by coincidence , in addition to allergic reactions to vaccine preparations .
thus , it is considered to be extremely difficult to prove a causal relationship between a serious adverse reaction and a vaccine preparation . in our patient , a causal relationship with the vaccination was strongly suspected based on the temporal course and muscle swelling corresponding to the vaccination site . in most cases , allergic reactions to vaccine preparations
are immediate hypersensitivity reactions mediated by immunoglobulin e antibody , that occur within a few minutes to a few hours after the vaccination 14 .
however , allergic reactions may be caused not only by the vaccine antigen , but also by residual egg protein , preservative , buffer and other components , and depending on the components responsible , delayed - type hypersensitivity reactions may also occur . in general , hypersensitivity reactions such as contact dermatitis due to thimerosal , which is a preservative contained in vaccines , are reported to be delayed - type hypersensitivity reactions occurring 210 days after vaccination 15 . while our patient was receiving influenza vaccination every year , in the current year , it was possible that the vaccine was administered by intramuscular injection . given that the myositis occurred 1 week after the influenza vaccination , we assumed that thimerosal contained in the vaccine administered by intramuscular injection might have been responsible for the delayed - type hypersensitivity reaction .
however , it has also been reported that currently , there are no differences in safety among thimerosal - free or thimerosal - containing vaccine 16 .
events associated with the vaccination procedure include infection with viruses or bacteria at the puncture site .
it was assumed that the impaired consciousness in this patient was not caused by encephalitis , but was a result of a symptomatic seizure triggered by fever , based on the following reasons : the short duration of the impaired consciousness , absence of abnormal findings on head ct , head mri and electroencephalography , and presence of a history of intracranial hemorrhage . in regard to bacterial infection , a case of necrotizing fasciitis at the vaccination site after influenza vaccination has been reported previously 17 . in our patient ,
the blood culture result was negative , and defervescence and a trend toward improvement in the hematological findings were observed even prior to the administration of the antibiotic therapy .
however , vaccination should still be recommended , in view of their clinical benefits and the very small incidence of serious adverse reactions .
meanwhile , we consider that adverse reactions which occur should be examined to identify their causes and be properly classified in order to promote the safe use of vaccines .
Output:
| key clinical messagewe report a case of an elderly man who developed myositis of the deltoid muscle 8 days after influenza vaccination .
adverse reactions to influenza vaccine are generally immediate reactions .
however , delayed - type hypersensitivity reactions , although rare , can occur after routine influenza vaccination . |
PubmedSumm119657 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the spiritual dimension of humans has a multidimensional and complex nature with cognitive , emotional , and behavioral aspects .
the emotional dimension of spirituality mixes with individual hope , love and dependence , internal peace , comfort , support , and experiences .
behavioral aspects include inner spirituality and personal beliefs that are spliced with the outside world .
in fact , spiritual care manifests in caring and nurturing in the spirit of individual such that attention to physical , intellectual , emotional , and spiritual dimensions is highly important to keep health and promote spiritual care .
the terms spirituality and religion are used interchangeably , but they have different meanings for most individuals . while religion is considered as a particular set of beliefs in an organized group , spirituality is considered a personal feeling of peace , purpose , relation with others , and beliefs about life .
spirituality is beyond colors , features , and geographical borders , and unifies the person with other people around the world and with god .
religion is a bridge for spirituality such that religion contributes to a meaningful feeling of spirituality by encouraging people to use thought methods , feelings , and behaviors .
spirituality is the nature of humans that gives meaning to life and accompanies people in their life journey . developing spiritual relationships with the infinite power gives individuals the confidence that a strong power always supports them .
these individuals deal with accidents calmly by relying on their faith and belief and suffer less from stress and anxiety .
spirituality increases the coping ability of an individual against diseases and improves the speed of recovery .
although spiritual dimensions have considerable effects on different aspects of human life and providing spiritual care is one of the duties of nurses , it is not fully considered .
understanding this dimension of patients is very important for nurses since nursing is a profession which looks at all dimensions of the patient , and spiritual care is an indispensable part and the core of holistic care .
the holistic view requires that nurses consider individuals as biological , psychological , and social creatures with a core ( of spirituality ) .
therefore , nurses are expected to accept the spiritual care of patients and establish appropriate relationships with patients .
competence is defined as a set of traits and characteristics which form the basis for optimal performance .
the dimensions of competence relate to knowledge , skill , attitude , communication , management , motivation , education , culture , ethics , spirituality , research and information technology , and working with devices .
the competence of a nurse is effective in guaranteeing the quality of care services provided for patients and their satisfaction , and a key factor in the competition intense world for the survival of hospitals .
spiritual care is a set of skills used in the professional field or nursing process which include therapeutic relationships between the nurse and patients , being accessible for patients , active listening , showing empathy , providing religious facilities for patients with certain religious beliefs , helping patients , etc .
spiritual competence in spiritual care refers to a set of skills which are used in the clinical nursing processes .
if nurses become aware of their spiritual condition , they will be aware of the spiritual state of their patients .
this awareness and spirituality in nurses is a prerequisite for creating commitment in the spiritual care process .
in fact , for communicating patients with tension , nurses should become aware of their spiritual life . according to the standards
although nurses are aware of the importance of spiritual care , studies show that it is not adequately provided .
based on different studies , there is a close relationship between nurses ' internal spirituality and attention and the tendency for providing spiritual care .
this means that the higher the internal spirituality of a nurse , the more spiritual care he or she will provide for patients . because spiritual care needs understanding the spiritual ideas of patients and recognizing their intellectual needs , it is expected that nurses develop their knowledge and understanding in this regard . to provide complete and suitable services for patients by preserving human and ethical virtues
, it is necessary to consider spiritual dimension as an important dimension which has a significant influence on individual health .
the nurses ' perception of spirituality can directly influence how they behave , deal with their patients , and communicate with them in providing spiritual care .
the importance of nurses ' abilities to understand their own perception of spirituality before assessing the spiritual needs of others has to be stressed .
first , nurses believe that spiritual care is a part of their role , but most of them are confused about how to include it in clinical practice .
second , nurses in all levels of clinical work feel that they are not ready for spiritual care .
third , spiritual care may be defined in different ways and nurses should have their specific definition for providing acceptable care .
studies have shown that spiritual care - a central element of holistic and multidisciplinary care - is not often included in practice .
since we live in a country in which we believe in a supreme being and worship god , our nurses should have a higher understanding of their competence for presenting spiritual care , as spiritual care needs competence in nursing .
this study was conducted to determine the perception of nurses of their competence in providing spiritual care for patients .
this study was conducted to determine the perception of nurses of their competence in providing spiritual care for patients .
the study population was all nurses who were working as a nurse or a nursing manager in one of the medical - educational centers of tabriz university of medical sciences ( head nurse , supervisor , and director of nursing care ) and had study criteria ( at least 1 year work experience and university degree ) . to determine sample size ,
multistage random sampling was used , and the suitable assignment was used for allocation to wards .
therefore , after selecting hospital , samples were chosen randomly considering number of nursing staff in different wards of hospitals . to gather data ,
then , researcher referred to selected wards and after explaining the purpose and delivered questionnaires to nurses in there different shifts to complete .
data were entered into spss software version 13 ( spss inc . , chicago , il , usa ) and were analyzed . to gather data from demographic questionnaire and spiritual care competence scale ( sccs )
content validity of persian version was done by experts ' opinion such that the scale was delivered to ten faculty members of nursing to study questions regarding ease , being clear and relevant .
reliability and validity were measured by khalaj et al . in 2013 , and cronbach alpha of questionnaire was 0.77 and for subscales was 0.650.85 .
this scale has 27 questions with 5 point likert scale ( 1 strongly disagree , 2 disagree , 3 neutral , 4 agree , 5 strongly agree ) which is divided to 6 categories individual support and consultation with patient ( 6 questions 16 ) , being professional and improving quality of spiritual care ( 6 questions , 712 ) , attitude toward religious states ( 4 questions , 1316 ) , communication ( 2 questions , 1718 ) , evaluating and implementing spiritual care ( 6 questions , 1924 ) and referral to experts ( 3 questions , 2527 ) .
the data were analyzed using descriptive statistics ( frequency , percent , mean , and standard deviation [ sd ] ) and inferential statistics ( independent t - test , one - way anova test , pearson , and spearman correlation tests ) . in all statistical tests ,
the significance level ( p < 0.05 ) was considered . before implementing the study ,
required information and rights of participants were given to research units and confidentiality of responses was emphasized .
furthermore , results showed that there was significant difference score of nurses ' understanding from their competence in spiritual care in hiring and workshop ( p < 0.05 ) and in other cases ( gender , marital status , shift , income , and position ) , there was no significant difference ( p > 0.05 ) . based on the findings ,
mean sd conception of nurses from their competence in provision spiritual care was 95.2 14.5 .
questionnaire has minimum 27 score and maximum 135 score such that below 64 is low spiritual competence , 6498 indicates average spiritual care , and above 98 shows high spiritual competence [ table 1 ] . comparing mean scores of nurses ' perception from their competence in providing spiritual care in term of demographic characteristics results of the study for each category in competence questionnaire for spiritual care was significantly higher than average .
individual support , professionalism , evaluating , and implementing spiritual care categories includes 6 questions in 5 point likert scale from 1 to 5 ; therefore , their score range was between 6 and 30 with mean 18 .
providing spiritual care for patients is influenced by personal , cultural , and educational factors .
moreover , those who provide spiritual care should have spiritual and ethical competence . the findings of this study showed that the scores for nurses ' spiritual care competence were between 38 and 135 , with a mean of 95.2 14.5 , which indicates that the perception of nurses of providing spiritual care for patients is average .
most nurses who participated in this study gained an average score . in another study , the mean spiritual care competence of nurses was 97.5 13.6 which is consistent with our study .
of course , these results are expected for our society which has religious and spiritual values .
however , there is a need for promoting spirituality in nurses . on the other hand , religious attitudes in iran may be effective on responses to the questions of the scale , and individuals might be evaluated themselves in higher level .
the results of the present study showed that the mean score for each category of the sccs was higher than average .
the highest score was related to religious state of the patient which indicated that nurses respect the beliefs of patients even if their beliefs were different from theirs .
the lowest score was observed for the referral category , and most nurses stated that they did not have the required knowledge .
the communication score was 7.8 ( 1.4 ) , and most nurses stated that their shifts were busy and they did not have enough time for establishing relationships with patients . a study conducted by pesut on
freshman and senior nursing students showed that communication has the most important role in providing spiritual care .
narayanasamy and wen ( 2001 ) considered the causes of this inattention to be the vague role of spirituality in nursing , the nonscientific nature of spirituality , environmental factors , and lack of suitable relationships between patients and nurses .
although studies on the perception of nurses of their competence in providing spiritual care for patients are very limited , several studies have been conducted on other aspects of spiritual care .
sabsevari et al . showed that the students ' competence of spiritual care was higher than that of nurses , which may be caused by the higher knowledge of students compared to nurses regarding spiritual care . on the other hand
, nursing students did not have to deal with issues such as work pressure , lack of time , and routine programs .
wong et al . studied the perception of 429 chinese nurses in relation with spiritual care for patients and reported that nurses have a positive perception of spiritual care .
they concluded that religious beliefs and education of nurses promote their perception of spirituality and spiritual care .
stated that there is a relationship between nurses ' spirituality and their performance in providing spiritual care .
it seems that there is a relationship between spiritual care and performance and competence , and further research is recommended in this regard . in studying the relation between scores of spiritual care competence and individual characteristics of nurses , a significant difference was observed in hiring type and participation in ethics workshops which are consistent with the results of sabzevari et al .
participating in ethics workshops and receiving education on the concept of spirituality and becoming aware of others ' views about spirituality helps nurses to achieve a higher level of spiritual perception , improve their attitude toward spirituality and spiritual care , develop their skills in recognizing patients ' spiritual needs , and providing spiritual care .
in addition , in iran 's health system , nurses with the employment status of plan are newly graduated nurses with little work experience .
sufficient work experience seems to increase maturity both for critically evaluating one 's own nursing philosophy and providing expert care .
although differences were observed in the scores of spiritual care competence regarding the level of education and work shifts of nurses , they were not significant based on the t - test . regarding the relation between participation in ethics workshops and spiritual care competence , it is suggested that nursing management provides conditions for the participation of nurses in educational courses including continuous education , workshops , and conferences for spiritual care .
according to the findings , although the spiritual care competence of nurses is average , promoting and increasing the spiritual capacity and spiritual care competence in education and training of nurses are useful tactics which must be considered by nursing curriculum designers .
one of the limitations of the present study was that it was conducted only on nurses of tabriz university of medical sciences , and its results are not generalizable to the larger society of nurses in iran .
qualitative studies can be promising in clarifying the nurses ' experiences with spiritual care for patients and their competence .
the findings provide preliminary insights into the nurses ' perception of spirituality and the development of spiritual care in iran .
one of the limitations of the present study was that it was conducted only on nurses of tabriz university of medical sciences , and its results are not generalizable to the larger society of nurses in iran .
qualitative studies can be promising in clarifying the nurses ' experiences with spiritual care for patients and their competence .
the findings provide preliminary insights into the nurses ' perception of spirituality and the development of spiritual care in iran .
Output:
| background : spiritual care is an important part of health - care provision .
spiritual care can improve patients ' health .
one of the requirements for providing appropriate spiritual care for patients is having the required competence.aim:this study was conducted to investigate the perception of health - care providers of their own competence in providing spiritual cares for patients hospitalized in medical - educational centers of iran.subjects and methods : this study is a cross - sectional , analytical research conducted on 555 nurses of medical - educational centers in tabriz , iran , in 2014 .
data were collected using a two - part questionnaire including demographic information and the spiritual care competence scale .
data analysis was performed using descriptive ( frequency , percentage , mean , and standard deviation ) and inferential ( independent t - test , pearson , spearman , anova with tukey test ) statistics in spss software version 13.results:results showed that the mean score for nurses ' perception of their competence in providing spiritual care for patients was average , that is , 95.2 14.4 .
mean score of nurses ' perception of their competence in providing spiritual care in each aspect was significantly higher than average ( p < 0.05 ) .
the highest score was related to individual support and consulting with patients , that is , 21.1 ( 4.0 ) , and the lowest score was related to reference to experts , that is , 9.5 ( 2.3 ) .
the type of employment and participation in workshops had significant relationships with nurses ' perception of their competence for providing spiritual care ( p < 0.05).conclusion : the findings indicate that authorities and policymakers should take steps in planning for nurses ' training for promoting their competence in providing spiritual care for patients ; therefore , holding workshops is necessary . |
PubmedSumm119658 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: venoarterial extracorporeal membrane oxygenation ( va - ecmo ) can maintain hemodynamic stability in the absence of an intrinsic cardiac rhythm or effective cardiac output and provide excellent mechanical circulatory support in such urgent or emergent situations .
va - ecmo has been shown to be effective in patients with secondary cardiac failure due to drug overdose ( 1,2 ) .
although va - ecmo is a strong tool in such patients , several complications , including infection , can occur .
we herein report the rare appearance of a vegetation in a patient treated with va - ecmo .
a healthy teenage japanese girl was admitted to our hospital after experiencing out - of - hospital cardiac arrest .
she had attempted to commit suicide by taking 4,950 mg of disopyramide and 12 mg of flunitrazepam , which was prescribed to her mother ( she was diagnosed with paroxysmal atrial fibrillation ) .
effective cardiopulmonary resuscitation was promptly commenced , and a laryngeal mask was inserted by paramedics .
she was intubated , and sinus rhythm with wide qrs was restored after the administration of adrenaline 3 mg and atropine 1 mg as adjuvants .
a large - volume gastric lavage followed by activated charcoal was performed to eliminate the drugs . despite medical therapy with intravenous catecholamine ,
her cardiac function deteriorated with the left ventricular ejection fraction decreasing to 13% . to provide mechanical cardiopulmonary support , the patient was cannulated for va - ecmo into the right femoral artery ( 17 fr cannula ) and vein ( 21 fr cannula ) percutaneously using the seldinger technique .
an intra - aortic balloon pump ( iabp ) and catheter for continuous hemodiafiltration ( chdf ) and direct hemoperfusion were introduced into the left femoral artery and left internal jugular vein , respectively . the activated clotting time
subsequently , the electrocardiography ( ecg ) improved to narrowing of the qrs complexes . the next day
, transthoracic echocardiography ( tte ) showed that her cardiac function had gradually improved without any valvular abnormalities ( fig .
the patient was weaned from va - ecmo , the femoral artery and venous cannulae were surgically removed and the cannulation sites were repaired .
blood cultures were subsequently performed , and vancomycin was administered . after obtaining the blood culture results , which were positive for methicillin - sensitive staphylococcus aureus ( s. aureus ) , we switched the antibiotic to cefazolin . despite intravenous antibiotics , the fever persisted and the c - reactive protein level and white blood cell count increased to 28.95 mg / dl and 17,200/l , respectively .
ten days later , tte showed a large mobile and solid mass attached to the apical part of the left ventricular apex without any valvular abnormalities ( fig .
a diagnosis of endocarditis associated with sepsis due to s. aureus , and an oscillating intracardiac mass documented by an echocardiogram was made according to the modified duke 's criteria ( 3 ) .
gentamicin was subsequently added as a standard therapy of infectious endocarditis , and the patient underwent urgent surgery ( fig .
a pedunculated mass originating from the apex of the left ventricle was exposed and excised with a substantial portion of the normal myocardium ( fig .
after the operation , the patient was treated for 4 weeks with intravenous antibiotics ( 2 weeks of vancomycin ( 2 g / day ) , and 2 weeks of cefazolin ( 4 g / day ) and gentamicin ( 180 mg / day ) , which were suitable for methicillin - sensitive s. aureus after the pathologic specimen confirmed s. aureus ) and had an excellent clinical response .
b : a parasternal long - axis view showing a large vegetation attached to the apical part of the left ventricle . a : the arrow shows a vegetation that developed from the left ventricular endocardium .
bleeding , hemolysis , and infection are common complications that contribute to va - ecmo - related morbidity and mortality .
the overall infection rates in temporary mechanical circulatory support are as high as 30 - 40% ( 3 ) .
immobilization , a poor nutritional status , and indwelling catheters and tubes are all likely to contribute to the high incidence of infection .
the risk of endocarditis is largely confined to patients with prolapse , thickened valve leaflets ( > 5 mm ) , and mitral regurgitation ( 4 ) .
we considered three important factors in the development of vegetation at the apex of the left ventricle .
a healthy cardiac endothelium is generally resistant to frequent bacteremia caused by daily activities ( 5 ) .
sepsis itself ( direct bacterial activity , particularly from s. aureus ) also causes endothelial damage ( 6 ) .
the apex is easily injured when the coronary flow is decreased because it is in a peripheral area .
the third factor is circulation using va - ecmo , especially in patients with cardiac arrest .
va - ecmo allows gas exchange and hemodynamic support while the blood is pumped from the venous system close to the right atrium on the atrial side ( femoral artery ) .
therefore , during cardiac arrest , little blood flow reaches the left ventricle , which makes it easy to form a vegetation in the left ventricle . the vegetation formed in the apex of the left ventricle in our patient .
prophylactic antibiotics are not always administered prior to cannulation in urgent cases , as the focus is on saving the patient 's life . additionally , the patient was afebrile 2 days after cannulation .
the administration of antibiotics should be considered in cases in which repeat cannulation is required . in conclusion , we herein reported a patient with infective endocarditis in which a vegetation formed at the apex of the left ventricle .
our findings showed that prophylactic antibiotics should be administered to patients treated with va - ecmo .
Output:
| a healthy teenage japanese girl was admitted to our hospital after experiencing out - of - hospital cardiac arrest .
she had attempted to commit suicide by taking 4,950 mg of disopyramide and 12 mg of flunitrazepam .
mechanical cardiopulmonary support was started with percutaneous cannulation of the femoral vessels .
several days later , a blood culture tested positive for staphylococcus aureus .
transthoracic echocardiography showed a large mobile and solid mass attached to the apical part of the left ventricle . to the best of our knowledge ,
the anatomical location of a pedunculated mass originating from the apex is a rare condition . |
PubmedSumm119659 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: neuropeptides are a subclass of peptides
that can function as neuromodulators ,
neurotransmitters and hormones and have a critical role in many biological
processes such as growth , learning , memory , metabolism and neuronal
differentiation and disorders such as depression , parkinson s
disease , and eating and sleeping disorders .
most neuropeptides range in length from 3 to 40 amino
acids and are produced by a complex post - translational processing .
this processing includes removal of a signaling peptide , cleavage
of precursor prohormones at basic amino acids ( k and r ) , removal of
c - terminal basic amino acids by carboxypeptidases , and post - translational
modifications ( ptms ) .
mass spectrometry ( ms ) is a well - established technology to
identify
proteins and peptides .
the shotgun proteomics implementation of the
bottom - up approach relies on the direct protease digestion ( typically
with trypsin ) with subsequent separation of the peptides in the first
lc separation step for tandem mass spectrometry ( ms / ms ) . in a subsequent
step ,
the resulting digested peptides are subjected to tandem mass
spectrometry ( ms / ms ) to generate ms / ms spectra .
database searching
is a common approach to identify peptides and , consequently , proteins
from ms / ms spectra .
the overall
strategy of database searches is to pair observed and theoretical
or predicted spectra .
the observed spectra arise from ms / ms experiments
and the theoretical spectra are the result of in silico prediction based on the known sequence of potential peptides in
a database .
most databases include proteins that have been empirically
confirmed or predicted from genome sequence assemblies and/or est
libraries .
database search programs use different algorithms
and , thus , differ
in the capability to identify peptides . comparing the performance
of mascot , sequest , sonar , x!tandem and spectrum mill , 15% of human
serum and plasma ms / ms spectra
similarly , on average 34% of the proteins from
normal human ovarian epithelium was identified by mascot , omssa , sequest
and x!tandem . out of 1837 human histone
ms / ms spectra ,
inconsistencies among programs
in peptide identification have been attributed to differences in the
matching algorithms although simulated spectra have not been used
to assess the performance of the programs .
the same ms / ms database
search programs used to identify proteins
and peptides in general are also used to identify neuropeptides . however , the extrapolation of the performance of these programs
to identify neuropeptides is not straightforward . first , the goals
are different when characterizing proteins via shotgun proteomics
and for a typical neuropeptide measurement . in a proteomics experiment ,
the proteins are digested into peptides via an enzyme and then the
goal is to identify unique peptides from the protein with high enough
confidence that the existence of the protein can be inferred .
higher
numbers or more unique peptides identified translate to higher evidence
supporting the presence of the protein in the sample . on the other
hand , neuropeptides already exist in the sample as endogenous peptides
prior to sample preparation or enzymatic degradation .
consequently ,
each individual neuropeptide requires the precise identification of
the exact form of the peptide .
the second distinctive feature is that
the length of neuropeptides tends to be small and , thus , precise short
sequence matches tend to be less statistically significant than the
matches of potentially many or longer peptide products from shotgun
proteomics .
short lengths limit the statistical significance of the
match of the peptide to a database and thus the capability to detect
peptide matches beyond a user - defined statistical threshold .
a third
distinctive feature is that neuropeptides may result from cleavages
by multiple proteases .
thus , the standard ms digestion model to generate
peptides from proteins is not exactly applicable to neuropeptides
because many of these may lack additional basic amino acids or result
in smaller peptides .
consequently , the digestion model may not identify
the correct peptide and fail to distinguish between shorter and longer
forms of the same peptide .
the fourth distinctive feature is that
the proteins and peptides under consideration are synthesized as inactive
precursors , that are converted to their mature forms by protein convertases
( pcs ) resulting in bioactive proteins and peptides . generally , these endoproteases cleave the precursor substrates
at the c - terminal side of single , paired , or tetra basic amino acid
residues including arginine or lysine . subsequently the c - terminal
basic residues of protein / peptide intermediates
are eliminated by specialized carboxypeptidases leading to the mature
peptides .
these peptides may undergo
additional post - translational modifications including c - terminal amidation ,
n - terminal acetylation , glycosylation , sulfation , and phosphorylation
prior to the formation of the final bioactive peptides .
this specialized processing is not modeled by
protein identification programs used in shotgun proteomics . in summary , the goal in prohormone peptide ms studies is to identify
individual and typically small peptides , and not to use the presence
of unique peptides to infer the presence of a larger protein .
after
all , the presence of the protein angiotensinogen is not as important
as detecting the forms of angiotensin present as each form ( whether
angiotensin i , ii or iii ) implies something different . because of
these differences in goals , the need to characterize the exogenous
peptides in a sample creates a different set of factors that has a
unique and still uncharacterized impact on the performance of the
different protein search algorithms to identify neuropeptides .
sample preparation , instrumental and algorithmic settings need
to be tailored to minimize the influence of sample complexity and
dynamic range , typically observed in neuropeptide studies .
these settings
can result in peaks selected for ms / ms representing chimeras that
contain more than one peptide with similar mass - to - charge ( m / z ) values .
for example , from a single 875.79 m / z precursor peak , both the prosaas big len peptide
( 1744.964 da with charge state + 2 ) and rhombex-40 peptide ( 2623.345
da with charge state + 3 ) have been identified .
a least one peptide is expected to be identified in these
chimera spectra due to the difference in charge states .
a more challenging
situation occurs when the peptides in a chimera have similar theoretical
mass and identical charge state .
prevalence of chimera events that
can lead to inaccurate identification has been estimated to range
between 11 and 50% of the ms / ms trypsin - digested spectra .
no large - scale , systematic study of the strengths and weaknesses
of database search programs to identify neuropeptides and other potential
peptides resulting from prohormone processing have been reported .
the unique characteristics of these peptides , compared to peptides
resulting from a tryptic digest justify the evaluation and recommendation
of database programs and algorithms that best support the identification
of neuropeptides .
the aims of this study were : ( 1 ) to compare the
relative advantages of three complementary open - source search methods :
omssa , x!tandem and crux to accurately identify prohormone peptides
including neuropeptides ; ( 2 ) to evaluate the impact of ms factors
such as charge on neuropeptide identification ; and ( 3 ) to offer guidelines
to obtain the most comprehensive and accurate survey of the peptides
in a sample .
a comprehensive set of prohormone
and peptide sequences were compiled
from our two public repositories , neuropred ( http://neuroproteomics.scs.illinois.edu/neuropred.html ) and swepep ( http://www.swepep.org ) , and complemented with information from uniprot ( http://www.uniprot.org ; release 2011_01 ) .
neuropred
was also used to predict the most likely and potentially cleaved peptides
from 92 mouse prohormones . the final database consisted of 7850 peptides that ranged in length
from 5 to 255 amino acids including experimentally confirmed neuropeptides
and predicted peptides ( table 1 ) .
peptides from mouse prohormones were used to simulate
the observed
or query spectra and generate the corresponding search or target database .
the rationale for matching the observed data to the same counterpart
in the database without the addition of a decoy database is 3-fold .
first , a decoy database does not assist in determining if the algorithms
can correctly match the spectra to the correct target .
rather a decoy
database provides a general measure of confidence among the matches .
second , the simulated data share the same quality and thus the addition
of decoy mass spectra does not aid in addressing quality differentials
in the present study .
a reverse
decoy spectra of a short peptide has higher likelihood to be present
in nature than that of a longer peptide , thus biasing the objective
of these spectra to help assess the probability of a random match .
the lack of known spectra with no target database entry prevented
the comparison of performance across programs using receiver operating
characteristics curves . among the database search programs available ,
these programs were selected because they are open
source and this allows the investigation of the code , computation
of matching scores and the algorithmic specifications .
these three
programs were compiled using the default settings and run on the same
computer ( a 3.00 ghz intel x9650 processor ) .
these three programs
compute a score indicator of the similarity
( e.g. , correlation ) between the query and database spectra .
the score is then used to compute an e - value ( expected value or expected number of database matches
by chance with scores equal or higher than the one observed ) or p - value ( the probability that the match between the query
and target sequences is due to chance ) .
the programs differ on the
algorithm used to identify and score the matches and statistical significance
indicator of each match .
crux ( version 1.37 released on december
22 , 2011 ) is an alternative
implementation of the sequest algorithm .
peptide identification relies on searching a collection of spectra
against an indexed sequence database , and returning a collection of
peptide - spectrum matches ( psms ) .
crux option to calculate p - values from a weibull distribution of the cross - correlation
scores was used in this study .
although
this approach is computationally intensive , this strategy maximizes
sensitivity or true positive rate through the ability to identify
peptides regardless of the quality of the spectra at the expense of
higher rates of false positives or mismatches .
x!tandem ( http://www.thegpm.org/tandem ; version 2010.12.01.1
released on december 01 , 2010 ) was developed to optimize speed and
to minimize the computational requirements .
the algorithm preprocesses the observed spectra to remove noise
and technical artifacts , processes database peptide sequences with
cleavage reagents , post - translational and chemical modifications and
scores the peptide matches between the observed and predicted spectra .
the scores are converted to hyperscores and
the distribution of hyperscores of all matches is used to translate
the hyperscore of each match into an e - value . the open mass spectrometry search algorithm ( omssa ; version 2.1.7
released on june 15 , 2010 ; http://pubchem.ncbi.nlm.nih.gov/omssa ) centers on optimizing the speed of database searching approach .
the scoring of each match assumes that the number
of matches between observed and predicted peaks for a peptide sequence
follows a poisson distribution .
the lambda ( or average ) parameter
of the poisson distribution is calculated as a function of the fragment
ion tolerance , the number of predicted and observed peaks and the
neutral mass of the precursor ion .
omssa provides e- and p - values based on the dimensions of the target
database .
simulated spectra were used to compare the performance
of the three
database search programs .
there are three advantages of simulating
the observed peptides to be queried against a database .
first , the
use of simulated mass spectra overcomes the limited number of neuropeptides
with mass spectra information of comparable quality obtained using
the same or similar technologies .
second , the analysis of simulated
mass spectra that share the same quality level allows benchmarking
the database search programs irrespectively of sample or data quality
issues including low mass accuracy , noise and low signal - to - noise
ratio .
third , simulated mass spectra offers an absolute control of
the peptides that should be detected and accurate evaluation of the
number of true positives ( detected and correctly identified peptides ) ,
false positives ( detected but incorrectly identified peptides ) and
false negatives ( missed peptides ) .
ideal uniform spectra that
have either + 1 , + 2 , and + 3 peptide charge
states were simulated for each peptide precursor ion in the target
database . for each peptide charge status , only + 1 charged b- and y - product ions ( b- and y - ion series ) were simulated with equal intensity .
neutral losses of a water ( 18 da ) and/or ammonia ( 17
da ) were simulated when the ion contained either one of four water
losing amino acids ( ser , thr , glu , asp ) or ammonia losing amino acids
( arg , lys , gln , asn ) .
neutral losses from b- and y - ion series occurred regardless of position of these amino
acids in the ions .
complementary scenarios of neutral mass loss
and ion availability
conditions were simulated across the three peptide charge states and
searched against the database to investigate the impact of these situations
on the identification of neuropeptides .
the simulated query scenarios
included : 1)all b- and y - ion series including all neutral mass losses due to water
and ammonia .
this scenario constitutes the baseline for comparison.2)only the possible b- and y - ion series excluding neutral mass
losses.3)only the possible b - ion series including all neutral mass losses.4)only the possible y - ion series including all neutral mass losses.5)random 50% of b- and y - ion series including all neutral mass losses.6)random 25% of b- and y - ion series including all neutral mass losses.7)only scoring the b - ion series from b- and y - ion spectra
including all neutral mass losses.8)only scoring the y - ion series from b- and y - ion spectra
including all neutral mass losses .
all b- and y - ion series including all neutral mass losses due to water
and ammonia .
this scenario constitutes the baseline for comparison . only the possible b- and y - ion series excluding neutral mass
losses . only the possible b - ion series including all neutral mass losses . only the possible y - ion series including all neutral mass losses .
only scoring the b - ion series from b- and y - ion spectra
including all neutral mass losses . only scoring the y - ion series from b- and y - ion spectra
including all neutral mass losses .
the performance of the database search programs to identify
peptides
from chimera spectra was investigated .
chimera representation was
achieved by combining the simulated spectra from peptides that have
similar theoretical mass values and have the same charge state .
only
peptides that were correctly identified by the three algorithms at e- or p - value < 0.01 with a single peptide
simulated with all neutral losses and ions were used .
the resulting
peptides were grouped such that the maximum difference in the theoretical
mass of each group was within 0.4 da .
individual spectrum was
simulated for each peptide including all the b- and y - ion series , neutral losses and + 1 peptide charge state .
chimera spectra were generated for each mass group by merging these
individual simulated peptide spectra into a single spectrum using
the average theoretical precursor mass for the precursor ion m / z value .
the peptide identification
search programs omssa , x!tandem and
crux were evaluated using comparable algorithmic specifications and
excluding ptms .
the default values of the programs were used in addition
to the following specifications : ( 1 ) precursor ion tolerance : 1.5
da ; ( 2 ) product or fragment ion tolerance : 0.3 da ; ( 3 ) no fixed or
variable modifications ; ( 4 ) whole protein ( omssa )
or enzyme : custom cleavage site ( x!tandem and crux )
to prevent cleavage since the detection of neuropeptides does not
involve protease digestion ; ( 5 ) peptide length : 5255 residues ;
( 6 ) peptide ion charge : + 1 , + 2 , + 3 ; ( 7 ) product ion charge : default
values ; ( 8) no complete or partial modifications ; and ( 9 ) peptide
mass : monoisotopic . for comparison purposes , crux probability
scores ( ranging from
0 to 1 ) , x!tandem e - values ( ranging from 1
10 to 1 10 ) and omssa e - values ( ranging from 1 10 to
1 10 ) were transformed using a base 10 logarithm .
the match or hit with lowest e- or p - value among all hits per input spectrum
the 1
10 threshold based on a 1% bonferroni correction
( 0.01/7850 = 1.27 10 1
10 ) was used to determine if the match was significant
while accounting for multiple testing .
the overall significance and
the correctness of the matched sequence
of the simulated query - to - target matches were used to assess the capability
of each search algorithm to detect neuropeptides and other prohormone
peptides .
this evaluation step allowed discrimination between obvious
and dubious , yet correct , peptide identifications .
a peptide match
was deemed to be significant if the detection signal ( e.g. , e- or p - value ) was lower ( more significant )
than a 1 10 threshold . this stringent threshold
aimed to minimize the number of false peptide identifications because
the percentage of matches that could be considered by chance ( false
positives ) is less than a 1% bonferroni corrected significance threshold .
there were three outcomes for each simulated spectra : the neuropeptide
correctly matched the simulated peptide ( true positive ) , incorrectly
matched ( false positive ) or failed to match ( false negative ) . a lower
threshold e- or p - value < 1
10 was also investigated because neuropeptides
tend to be short and thus true positives from the database matching
process are unlikely to generate extreme e- or p - values .
table 2 summarizes the results from the
three search methods across three peptide charge states .
most peptides
( approximately 7764 out of 7850 peptides across charges when all ions
are available ) were identified by these three programs regardless
of e- or p - value level . among the
7764 peptides correctly matched by all three programs ,
7022 were detected
by all three programs followed by omssa and x!tandem ( 385 peptides ) ,
omssa alone ( 302 peptides ) , omssa and crux ( 7 peptides ) at e- or p - value < 1 10 meanwhile 48 peptides were detected at e- or p - value > 1 10 by all three
programs .
thus , among the peptides detected by all programs regardless of statistical
significance , omssa detected these peptides with higher statistical
significance , followed by x!tandem and last crux ( table 2 ) .
correctly matched peptide regardless
of e- or p - value level on all three ,
two or one of the database search programs .
missing columns ( omssa+crux ,
x!tandem , omssa ) are columns with 0 in all rows .
all : omssa , x!tandem and crux ; oc : only omssa and crux e- or p - value < 1 10 ; ox : only omssa and x!tandem e - value < 1
10 ; xc : only x!tandem and crux e- or p - value < 1 10 ; o : only omssa e - value <
1 10 ; n : no program e- or p - value <
1 10 . missing columns ( xc and x within
omssa+x!tandem+crux , x in x!tandem+crux ) are columns with 0
in all rows .
simulated query
scenarios : b + y ions + neutral
mass loss : match using
all b- and y - ion series including
neutral mass losses ; b + y ions
- neutral mass loss : match using all b- and y - ion series excluding neutral mass losses ; b ions + neutral mass loss : match only using the b - ion series including neutral mass losses ; y ions
+ neutral mass loss : match only using the y - ion series
including neutral mass losses ; 50% ions + neutral mass loss : match
only using random 50% of all ions including neutral mass losses ; 25%
ions + neutral mass loss : match only using random 25% of all ions
including neutral mass losses .
crux was the only program that detected all peptides
regardless
of significance level ( table 2 ) . across charges ,
approximately one peptide was detected by crux and x!tandem reaching e- or p - value < 1 10 .
approximately 85 peptides were detected by omssa and crux only
but , of these , only approximately two peptides reached e- or p - value < 1 10 and this was in crux .
from 23550 simulated spectra ( 7850 peptides
3 peptide charge
states ) , omssa , x!tandem and crux had 23548 ( 99.9% ) , 22932 ( 97.4% )
and 23139 ( 98.3% ) correct identifications ( true positives ) at e- or p - value < 1 10 . at e- or
p - value < 1
10 , omssa , x!tandem and crux had 23281 ( 98.9% ) ,
22117 ( 93.9% ) and 20890 ( 88.7% ) true positive results , respectively .
the similar performance of the programs at the less significant threshold
reiterates the findings summarized in table 2 that the crux algorithm provides lower significance results .
our
results are consistent with previous reports of a higher number of
spectra matched by omssa than by x!tandem .
figure 1 includes a venn diagram depicting
the peptides correctly identified by the three database search programs
for charge state 3 using information from all ions .
insights into
the features that are differentially accommodated by the assumptions
and models used by each database search algorithm were drawn from
the investigation of the peptides that were not identified by all
three programs .
venn diagram depicting the common and distinct true positive
peptides
identified from the three database search programs , x!tandem , omssa ,
and crux with peptide charge state + 3 using ( a ) all ion information ;
( b ) only y - ion series information ; ( c ) only b - ion series information .
the length of the peptide had an impact on the statistical significance
of the match in all the programs .
the majority of the 109 ( 1% ) charge
+ 1 peptides that were identified ( using b and y ions and including neutral mass loss ) by all three programs
and reached e - value < 1 10 in at least one program were five amino acids long peptides . figure 2 depicts the relationship between the log10 transformed e- or p - values on
peptides across peptide length .
overall the correlation between the
length of the query sequence and log10 transformation of
the e- or p - values for omssa , crux
and x!tandem was 0.1% , 86.8% and 46.7% , respectively although the
relationship was nonlinear .
comparison of omssa , crux , and x!tandem log10 ( e- or p - values ) averaged
across peptide
length and precursor charge states for all peptides and ( inset ) magnified
for peptides up to 60 amino acids in length .
there was a gradual increase in the number of peptide
matches that
have p - value < 1 10 with increased peptide length in crux although only peptides 46
amino acids long and higher surpassed this threshold .
examination
of the relation between query length and log - transformed e - values showed rapid increases up to 11 and 15 amino acids long peptides
in omssa and x!tandem , respectively , before the log - transformed e - values stabilized .
in contrast , the crux log - transformed p - values showed a gradual increase up to approximately 50
amino acids before the log - transformed p - values started
to stabilize .
consistent with our findings , small peptides between
600 and 700 da tend to be missed .
a similar
effect of peptide length on the distribution of the maxquant program p - scores between target and decoy database was observed . in that study , peptides with less than 15 amino
acids had a higher likelihood of being incorrectly matched than peptides
with 15 or more amino acids .
the increase in e - values with decreasing peptide
length is due to the corresponding increase in the number of expected
matches by chance .
the mean of the underlying poisson distribution
used by omssa decreases with smaller peptides resulting in larger e - values due to the increased probability of a random match .
in particular
, the detection of short peptides by omssa is negatively
influenced by the tendency of small peptides to exhibit neutral mass
losses .
for peptides less than 12 amino acids , the correlations of
log - transformed e- or p - values between
omssa and x!tandem , omssa and crux , and x!tandem and crux were 78% ,
63% and 52% , respectively .
this result also indicates that the selected
threshold was more stringent in crux and x!tandem than for omssa .
no program correctly detected five amino acids long peptides at e- or p - value < 1 10 .
omssa and x!tandem correctly detected all peptides longer than
7 and 11 amino acids , respectively at e - value <
1 10 , when all ions were available excluding
neutral mass loss .
crux was the only program able to correctly match
all peptides although only 12 peptides with less than ten amino acids
had p - values < 1 10 . at p - value
< 1 10 , 33% , 64% , 75% , 87% , 98% , 99% and 100% of the 5 , 6 , 7 , 8 , 9 , 10 ,
and 11 amino acids long peptides were detected with crux .
this result
suggests that the significance calculation in crux is more stringent
than in the other two programs .
the positive association between the
fraction of peptides detected and peptide size is partly due to the
number of weibull samples because with 100 permutations only 61 of
the peptides with charge state + 1 had p - value <
1 10 threshold ( results not shown ) .
consequently ,
adding further weibull samples especially for small peptides may increase
the significance levels by providing more accurate density estimation .
x!tandem was not able to correctly detect the 85 peptides that
were five amino acids long which accounted for 1% of all peptides .
across the different scenarios evaluated ( ion availability , etc . ) ,
most of these peptides were not detected ( 80% ) and the rest were incorrectly
identified ( mismatched ) .
x!tandem was able to correctly match at e - value < 1 10 peptides at
least ten amino acids long , and 94% of the peptides that were seven
amino acids long and all peptides that were at least eight amino acids
long were detected at e - value < 1 10 threshold , when all ions were available including
neutral mass loss .
similarly , the performance of omssa was also influenced
by peptide size because most peptides at least ten amino acids long
were detected at e - value < 1 10 . however , 100% , 27% , 6% , and 1% of the peptides five , six , seven
and eight amino acids long , respectively , did not reach significance
in omssa .
the statistical significance of the x!tandem matches
was inferred
using the lowest scores from the matches .
consequently , the significance
values assigned by x!tandem is negatively influenced when there are
insufficient matches to provide an accurate estimate of the x!tandem
score .
at the other computational extreme , crux uses resampling to
provide a statistical significance value for each peptide identified .
resampling consists of random permutations of the peptide sequence
that are subsequently matched to the database and scored .
the implementation
of resampling in crux is with replacement , which potentially allows
the same sequence to be repeatedly sampled .
this event is more likely
with shorter peptides and high resampling specifications . unlike crux
and x!tandem ,
the omssa e - value is derived from the
assumption that the number of matches can be represented by poisson
distribution and does not depend on the matches or generated sequences
although it relies on the database size .
the omssa formulation is
also dependent on peptide size so that small peptides tend to be on
the lower bound of significance due to the smaller proportion of ion
matches than larger peptides .
for example , if the poisson mean is
equal to one , then the probability of zero ion matches is 0.37% .
the few
detection failures in this study were investigated using omssa because
the e - value calculation offers more sensitivity .
five neuropeptide sequences were not first ranked peptides in omssa
across all simulated conditions .
four of the peptides are processed
from the highly homologous oxytocin - neurophysin 1 and vasopressin - neurophysin
2-copeptin prohormones .
these peptides were further reduced to two
sets of peptides after consideration of ambiguous cleavage sites that
lead to two possible peptides within the homologue .
the simulated
spectra of the b- and y - ions without
neutral mass loss were similar between these peptides with the maximum
difference being 19.9 m / z and occurring
at the b6 ion .
another mismatch occurred
with a penk ( uniprot i d p22005 ) peptide due to the multiple occurrences of the
met - enkephalin in a longer peptide . for simulated charge states + 1
and + 2 including neutral mass loss , a mismatch occurred between the
two met - enkephalin peptides located at the c- and n - terminal .
due
to the similarity in sequence and e - values , these
peptides were treated as homeometric peptides and were considered as correct matches . unlike x!tandem and
crux , omssa failed to detect the peptide for all three charge states
and a neutral mass loss for one peptide , a chromogranin b peptide
( positions 592 to 652 ) predicted by the neuropred mouse model . also ,
omssa had one mismatch ; a secretogranin ii peptide ( positions 475
to 547 ) from a neuropred nonmammalian model matched to neurotensin
( positions 87 to 156 ) with charge state + 3 and neutral mass loss at
an e - value > 60 .
this suggests a
weakness ( or lower sensitivity ) of the omssa algorithm to accommodate
neutral mass losses .
examination of both peptides indicated that 54%
of the amino acids in each sequence were prone to lose water ( 28%
of the amino acids ) and ammonia ( 25% of the amino acids ) . as a result
approximately 2/3 of the ions can include neutral mass losses and
omssa was not able to distinguish the series with and without neutral
losses .
combining identifications that were significant in at
least two
programs improves the average identification rate across all three
charge states from 89% to 94% when all ions were available for scoring
and including neutral mass loss . using a consensus approach , as has
been advocated in the identification of proteins , can improve peptide identification because the probability
of all programs incorrectly identifying a peptide is equal to or less
than probability of the least accurate program being incorrect . while
this consensus approach assists in the correct identification of peptides ,
it is less suitable to the goals of the present study because the
individual programs helps us to understand the particular distributional
features of the prohormone peptide population of mass spectra relative
to protein database searches and recommends the best tools for particular
neuropeptides .
for example , a closer inspection of the few peptides
( 5% ) that were not consistently identified across programs revealed
that these peptides were correctly matched by at least crux and omssa
although exhibited low scores , irrespectively of the programs , due
to the small size of these peptides ( ranging between 5 and 11 amino
acids long ) .
this result suggests that for these few neuropeptides
all three programs have comparable disadvantages but have complementary
strengths and weaknesses to detect neuropeptides . the performance of the three programs in the identification of peptides
when all ions from both series are available including and excluding
neutral mass losses in the simulated spectra is summarized in table 3 for charge state + 1 and in supporting information tables 1 and 2 for all charge states .
the inclusion of neutral mass losses in the simulated query spectra
had minor influence on the overall detection of peptides across the
programs .
the average percentage of peptides that were detected at e- or p - value < 1 10 including neutral mass loss over all charge states was 98.3% , 94.4%
and 89.5% in omssa , x!tandem , and crux , respectively . the average
percentage of peptides that were detected at e- or p - value < 1 10 excluding neutral
mass loss over all charge states was 98.9% , 93.9% and 88.6% in omssa ,
x!tandem , and crux , respectively . the opposite trend observed in omssa
relative to the other two programs may be due to the extremely high
percentage of peptides already identified including or excluding neutral
mass loss .
the percentage of peptides detected at low or nonsignificant
values was five- and 10-fold higher in x!tandem and crux relative
to omssa , respectively .
for these peptides , inclusion of neutral mass
loss improved the detection of peptides at low or nonsignificant levels
in omssa and x!tandem by 1% and have the opposite effect in crux .
peptide detection by crux or omssa was not largely affected by neutral
mass loss .
the inclusion of neutral mass loss noticeably influenced
the significance levels of x!tandem matches that were already highly
significant ( e - value < 1 10 ) .
significance threshold ( t ) for matched
to be considered significant at e- or p - value < 1 10 . including or excluding neutral mass
losses .
unmatched : the program
does not
provide a match with the program setting .
mismatched : the program provided
an incorrect match . percentage
of the matches that have e- or p - value < 1 10 . the impact of neutral mass loss on peptide detection
depended on
the charge state . at the stringent threshold e - value
< 1 10 , peptides that have precursor
charge state + 1 had more significant matches ( 93% ) than precursor
charge state + 3 ( 81% ) in omssa . this difference decreased with less
stringent thresholds and at the e - value < 1
10 threshold the difference in detection was only
1% between charge states + 1 and + 3 .
this may be partially explained
by the assumption that + 2 product ions are present in precursor charge
state + 3 and higher spectra but not present in charge state + 1 spectra .
this assumption results in a higher number of
possible ions and a consequently a lower significant e - value even if the spectra lacks these highly charged product ions .
a
summary of the performance of the three programs in the identification
of peptides when only b - ion series , y - ion series , random 50% of all ions , and random 25% of all ions are
available including neutral mass losses , respectively for charge state
+ 1 is presented in table 4 .
likewise , supporting information tables 3 , 4 , 5 , and 6
report the performance of the three programs for all three charge
states .
the percentage of correct identifications across all programs
was 87% , 88% , 85% and 68% when b - ion series , y - ion series , random 50% and random 25% of the ions were
available , respectively .
the proportion of unidentified peptides in
all programs was 8% , 6% , 7% and 14% , when b - ion series , y - ion series , random 50% and random 25% of the ions were
available , respectively . significance threshold ( t ) for matched to be considered significant at e- or p - value < 1 10 .
b- , y - ion series , 50% , or 25% of the ions
in the query are available .
mismatched : the program provided
an incorrect match . percentage
of the matches that have e- or p - value < 1 10 .
the lower percentage of peptides identified in scenarios
that had
50% and 25% of the ions available was mainly due to a poorer performance
of x!tandem regardless of the charge state .
the minimum length for
a peptide to be detected at significance e - value
< 1 10 were 13 , 15 , 14 , and 81 amino
acids for the y - ion series , b - ion
series , 50% ions and 25% ions available , respectively , compared to
ten amino acids when all ions were available .
these trends are likely
to be related to the number of ions that can potentially be available
rather than the percentage of ions available .
missing ions also
impacted the detection of peptides by omssa .
on average , 65 peptides across all three charge states were undetected
when only 25% of all ions were available .
these peptides were between
five and eight amino acids long and only peptides with more than 25
amino acids had e - value < 1 10 .
there was a tendency for the number of undetected peptides
by omssa to increase with increasing charge state when only 50% of
ions were available .
this result is consistent with the observed trend
in the presence of neutral loss simulation and suggests that the presence
of neutral loss , rather than the absence of 50% of ions , was the factor
driving the lower detection rate .
however , when only 25% of the ions
were available , charge state + 1 peptides were four times more likely
to be undetected relative to higher charge states .
these results indicate
that the absolute number of ions present is potentially more critical
to the omssa algorithm than the relative percentage of ions available .
overall , these findings highlight a diminishing return on accurate
identification for additional ions used by omssa , with the detection e - value threshold dependent on the precursor charge state .
longer peptides are expected to generate more ions , suggesting that
the omssa scoring system based on the actual number of mass spectra
peak matches needs to account for the overall peptide length .
this
adjustment is important for neuropeptides because the goal is identifying
each form of these oftentimes short peptides . missing ions on
the query
had minor influence on the identification
and significance level of the peptides in crux , unlike in omssa and
x!tandem ( table 4 ) .
venn diagrams depicting
the peptides correctly identified at e- or p - value < 1 10 by all three
database search programs , x!tandem , omssa , and crux using information
from all ions or only y- or b - ion
series for peptide charge state + 3 is depicted in the top , bottom
left and bottom right corners of figure 2 ,
respectively .
figure 2 highlights that overlap
among all three programs ( particularly between omssa and x!tandem ) ,
and the ability of omssa to identify peptides scored at e - value < 1 10 .
the lesser overlap between
programs when either one of the ion series is considered , stresses
the relative advantage of crux when only b - ion series
were available , and of omssa and x!tandem when only y - ion series were available for peptide identification .
figure 3 presents the venn diagrams depicting the peptides
identified at e- or p - value <
1 10 by all three database search programs
using only 50% ( left venn diagram ) or 25% ( right venn diagram ) of
all ion information for peptides with charge state + 3 .
the previous
venn diagrams center on peptides detected at high significance levels
and ignore the strength of crux to detect small peptides that have
low p - values .
venn diagram depicting the common and
distinct peptides identified
by all three database search programs with peptide charge state + 3
using only ( a ) 50% or ( b ) 25% of all ion information .
the venn diagrams highlight the increasing detrimental
impact of
missing ions on the performance of x!tandem .
the simulation of the
random proportion of ions represents one type of incomplete fragmentation
that is an important component of the differences between programs
in peptide identification .
peptides can
be identified by the programs when incomplete fragmentation provided
sufficient ions are present especially for large peptides .
the challenge
for these programs centers in assigning an appropriate significance
threshold since most of the peptides were correctly matched regardless
of program used .
the low impact of relative ion availability on crux
is possibly due to the lack of resampled peptides that share similar
ion patterns .
the omssa e - values even increased with
fewer ions available because the e - value computation
assumes that all possible ions are present . at e - value
< 1 10 threshold , 17.3% and 6.9% of
all correct peptide identifications did not reach significance threshold
in random 25% and 50% proportion of ions , respectively , relative to
1.7% when all ions were available including neutral mass loss .
a possible explanation is that with fewer ions present ,
the score of the correct match is insufficiently different from the
score of incorrect matches with all ions , both leading to a low score
and potentially mismatches .
the search
time of the three database search programs was a function of the number
of neuropeptides in the search database .
this computational comparison
is empirical and that the database search can be easily computed in
parallel because the experimental spectra can be independently analyzed .
the computational time to evaluate all 7850 peptides
x!tandem returned results the fastest
( averaged 23 cpu seconds ) , followed by crux with no p - value calculation ( 3.8 more time than x!tandem ; averaged 89
cpu seconds ) followed by omssa ( 5.3 more than x!tandem ; averaged
123 cpu seconds ) .
the crux p - value calculation adds
considerable time due to the permutation - based approach to assess
the statistical significance of the database match .
this approach
requires the generation and scoring of dummy sequences to obtain the
weibull density for each match . the computation of p - values for 100 and 1000 dummy sequences required over 1 and 13 h
of cpu time , respectively .
the increase in time is linear on the number
of sequences evaluated such that each sequence took approximately
47 cpu seconds .
this resampling test approach is not limited to crux
and a comparable increase in time would occur when this approach is
used with x!tandem and omssa . an alternative approach to improve the speed of peptide matches
offered by some programs is to search only one ion series .
table 5 summarizes the performance of omssa and x!tandem
in terms of number of peptides unmatched , mismatched or correctly
matched at various significance levels by ion series scored for charge
state + 1 . supporting information tables
7 and 8
summarize the performance of the database search programs
across match significance levels when the b- and y - ion series were scored , respectively for charge states
+ 1 , + 2 and + 3 . supporting information table
9 reports the number of peptides identified at e - value
< 1 10 by both or either program . significance threshold ( t ) for matched to be considered significant at e- or p - value < 1 10 .
unmatched : the program
does not
provide a match with the program setting .
mismatched : the program provided
an incorrect match . percentage
of the matches that have e- or p - value < 1 10 . scoring only one of the ion series was noticeably
detrimental to
peptide detection for both omssa and x!tandem .
the y - ion series provided a higher detection rate than the b - ion series at e - value < 1 10 .
the number of mismatched and unmatched peptides when one series
was scored increase substantially in omssa compared to x!tandem .
omssa
had more false positive and false negative results when scoring only
one ion series .
the number of correctly matched peptides at e - value > 1 10 was higher
in
x!tandem than in omssa and at e - value < 1
10 was higher in omssa than in x!tandem when either
ion series was used for scoring .
overall , the number of correctly
matched peptides regardless of e - value was higher
in omssa than in x!tandem when either ion series was used for scoring .
the major reason for weaker performance of x!tandem when scoring one
ion series was that the peptides had less significant e - values than when scoring both ion series .
scoring using only y - ion series resulted in fewer unmatched peptides ( difference
of 34 ) , mismatched peptides ( difference of 12 ) and peptides with less
significant e - values ( 98% of peptides with the e - value < 1 10 ) in omssa .
in both programs ,
higher charge states were associated with slightly
poorer peptide detection with scoring based on the y - ion series being less affected than on the b - ion
series .
the length of the peptide was also critical when one
ion series
was used to score the matches between the query and target database
mass spectra .
the minimum length among the detected peptides was 10
and 13 amino acids in omssa and x!tandem , respectively , compared to
six amino acids when both ion series were scored .
the median length
of the correctly identified peptides with both programs using the b- and y - ion series was 83 and 76 amino
acids , respectively .
also , the median length of the missed ( false
negative ) peptides in both programs was seven and six amino acids
when the b- and y - ion series were
used , respectively .
this result reflects the issues of correctly identifying
small peptides at e - value < 1 10 .
chimera spectra is a likely phenomenon in peptidomics measurements ;
this occurs when multiple peptides coelute in the same lc fraction
and each peptide present contributes to the observed peaks in the
tandem ms spectra , usually when the peptides are similar to each other .
as neuropeptides span many orders of magnitude in concentration dynamic
range , chimera spectra can be caused by peptides at vastly different
levels . to evaluate the performance of the programs when
spectra from
multiple coeluted peptides are present , peptides that have similar
mass and are likely to coelute were identified . of the 7649 peptides
identified by all programs at e- or p - value < 1 10 , 2049 peptides had at
least one other peptide with theoretical mass 0.4 da .
these
peptides were split into 945 groups each including at least two peptides
within a theoretical mass range or tolerance within group . of these ,
804 ,
126 , 12 , and 3 groups included 2 , 3 , 4 , and 5 peptides , respectively .
table 6 summarizes the number of peptides
identified from chimera spectra with precursor charge state + 1 , all
ions are available and including neutral mass losses by x!tandem ,
omssa and crux .
crux had the best performance and x!tandem generally
failed to identify peptides from chimera spectra regardless of the
threshold used . at e- or p - value
< 1 10 threshold , omssa ,
x!tandem and
crux , correctly identified 81% , 43% and 99% of peptides , respectively .
of these , crux only had three unmatched peptides at p - value < 10 meanwhile x!tandem only reported
one peptide in the chimera spectra unless the other matches had the
same score .
omssa had a correct match rate similar to crux at e - value < 1 10 and lower at e - value < 1 10 threshold .
a further decrease in the accuracy of peptide identification in chimeras
was observed in small peptides for x!tandem and crux . at e- or p - value
< 1 10 threshold , the correct identifications by x!tandem and crux were
39.1% and 98.5% in peptides less than 20 amino acids in length , and
37.6% and 91.8% in peptides less than 10 amino acids in length , respectively .
reported that mascot correctly identified peptide a in 87% of chimera
spectra containing 50% of peptide a and 50% of peptide b. number of peptides simulated in
a chimera spectra .
percentage
of correctly matched
peptides with an e- or p - value <
1 10 .
percentage of correctly matched
peptides with an e- or p - value <
1 10 .
the present study demonstrated that although
most neuropeptides
and prohormone peptides with ideal ms / ms spectra can be identified
using standard database search methods , a careful assessment of the
accuracy of the match is still required .
furthermore , the search must
be optimized for the specific biological context , here prohormone
cleaved neuropeptides .
the results from the present study indicate
that the correct identification
of peptides based on a single threshold across all spectra is challenging
even when provided with ideal spectra and target database .
a major
component of this challenge was the scoring and assignment of a single
significance threshold for all peptides .
this problem is exacerbated
when analyzing experimental data because the quality of the data and
the specifications of the program have a large impact on the accuracy
of peptide identification .
crux was the only program able to correctly
match all the peptides regardless of p - value . the e- and
p - values rapidly become more significant
with increasing peptide length before stabilizing at approximately
50 amino acids in crux and 13 amino acids in omssa and x!tandem . of
the three programs , crux
is better suited to detect short peptides
although the p - value calculation in crux is more
stringent .
the typically short prohormone peptides have less significant e- or p - values because of the higher number
of expected matches by chance .
overall , results indicated the need
to optimize the scoring and associated e- or p - value calculation in database searches for neuropeptides
and small peptides . a straightforward approach that does not require
program modifications is to accept less significant matches for short
peptides meanwhile keeping more significant thresholds for longer
peptides .
the peptide length that was associated with stabilization
of e- and p - values ( 50 amino acids
in crux and 13 for omssa and x!tandem ) offer a good start .
most
small peptides were detected by one or two programs ( crux
or omssa ) and thus the program consensus approach advocated for protein
identification is not well suited to identify small peptides .
crux
had the best performance in the identification of peptides from chimera
spectra and when ions were missing , omssa provided the most significant e - values ; meanwhile , x!tandem returned results fastest for
peptides detected by all programs . a comprehensive evaluation
of the impact of multiple factors on
peptide identification was undertaken .
additional simulations can
help to assess the importance of other aspects of ms / ms on peptide
identification .
the evaluations performed
in this study assumed that the peptides had ideal uniform spectra
to avoid additional confounding factors .
different peptide ion fragmentation
methods ( e.g. , cid , hcd , etd ) have different abilities to fragment
that affect the performance of the database search tools .
additional studies can consider the impact of
the fragmentation method and ptms on the ability to identify neuropeptides .
also , the identification of peptides using spectrum - to - spectrum search
tools has been proposed in recent years .
a study of the performance of spectrum - to - spectrum searches when
applied to small prohormone peptide identification needs to be undertaken .
Output:
| neuropeptide identification in mass spectrometry experiments
using
database search programs developed for proteins is challenging . unlike
proteins
, the detection of the complete sequence using a single spectrum
is required to identify neuropeptides or prohormone peptides .
this
study compared the performance of three open - source programs used
to identify proteins , omssa , x!tandem and crux , to identify prohormone
peptides . from a target
database of 7850 prohormone peptides , 23550
query spectra were simulated across different scenarios .
crux was
the only program that correctly matched all peptides regardless of p - value and at p - value < 1 102 , 33% , 64% , and > 75% , of the 5 , 6 , and 7
amino
acid - peptides were detected .
crux also had the best performance in
the identification of peptides from chimera spectra and in a variety
of missing ion scenarios .
omssa , x!tandem and crux correctly detected
98.9% ( 99.9% ) , 93.9% ( 97.4% ) and 88.7% ( 98.3% ) of the peptides at e- or p - value < 1 106 ( < 1 102 ) , respectively . omssa and
x!tandem outperformed the other programs in significance level and
computational speed , respectively .
a consensus approach is not recommended
because some prohormone peptides were only identified by one program . |
PubmedSumm119660 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in addition to transmission of genetic information from dna to proteins , rna is capable of performing a wide range of biological functions in cells , including catalysis , genetic control and molecular recognition ( 1 ) . because the functions of rnas are largely determined by their diverse three - dimensional ( 3d ) structures , tools capable of efficiently and accurately comparing two rna 3d structures are important in computational structural biology .
currently , several popular and useful tools of aligning two rna 3d structure have been proposed based on heuristic approaches , such as sara ( 2,3 ) , iparts ( 4 ) , setter ( 5,6 ) and rass ( 7,8 ) .
both sara and iparts align two rna 3d structures by using a similar approach , which reduces the 3d structures into one - dimensional ( 1d ) sequences according to some local structure features in the nucleotide backbone conformation ( i.e. backbone unit vectors used in sara and backbone pseudo - torsion angles used in iparts ) and then applies traditional sequence alignment algorithms to align the resulting 1d sequences ( 24 ) . as to setter , it divides the rna 3d structure into non - overlapping local structural units , called generalized secondary structure units ( gssus ) , and then obtains their structural alignment by using a comparison method based on a distance measured by rmsd ( root mean square deviation ) transformation between all possible pairs of gssus ( 5,6 ) .
rass develops a method based on elastic shape analysis , which treats the structures of rnas as 3d curves with their 1d nucleotide sequence encoded on additional three dimensions , so that the structural alignment of two rnas is performed in a joint sequence - structure space of six dimensions ( 7,8 ) .
the method we used to implement iparts ( 4 ) is the so - called structural alphabet ( sa)-based approach , which uses an sa of 23 letters to reduce rna 3d structures into 1d sequences of sa letters and applies traditional sequence alignment to these sa - encoded sequences for determining their global or local similarity .
in fact , the accuracy performance of our iparts largely depends on the quality of the sa , which was constructed from a list of 117 rna 3d structures using the pseudo - torsion angles of their nucleotide backbones .
it has been shown that for rnas , two pseudo - torsion angles ( and ) are sufficient to describe the backbone conformation of each nucleotide ( 9 ) . actually , during the last 5 years after the introduction of our iparts , several hundreds of new rna 3d structures have been determined and already deposited in the pdb / ndb databases ( 10,11 ) .
these newly determined rna 3d structures should benefit us to improve the accuracy of our iparts by constructing a new and sufficiently high quality sa .
in addition , as was reported in the study of rass ( 7,8 ) , both 1d nucleotide sequences and 3d structures of rnas need to be taken into account when determining their functions , because 1d sequence carries side chain information of nucleotides , 3d structure carries the backbone geometry information of nucleotides and both types of information are different and can play important roles in determining rna functions . in this study , we have re - implemented our previous tool iparts as a new web server named iparts2 ( meaning iparts version 2 ) by constructing a totally new sa , which consists of 92 elements with each element carrying both information of base ( 1d ) and backbone geometry ( 3d ) for a representative nucleotide , from a representative and sufficiently non - redundant list of 876 atomic - resolution rna 3d structures with 65154 nucleotides in total ( 12 ) .
this sa is significantly different from the one used in iparts , because the latter , constructed by using 117 crystal rna structures with 9527 nucleotides , consists of only 23 elements , each of which carries only the backbone geometry information of a representative nucleotide . like in iparts
, we also equip iparts2 with two capabilities of aligning two rna 3d structures : ( i ) global alignment that can be used to determine their overall structural similarity and ( ii ) local alignment that can be used to find their locally similar substructures .
it is worth mentioning here that the function of local alignment in iparts2 is unique when compared with other tools sara , setter and rass , because they all provide the function of global alignment only . for validation
, we have used a benchmark dataset fscor with 419 rna 3d structures to test our iparts2 and compare the accuracy performance of its global alignment with its previous version iparts , as well as other popular tools sara , setter and rass .
our experimental results have finally shown that our current iparts2 indeed outperforms its previous version iparts and also achieves better accuracy than sara , setter and rass in rna alignment quality and function prediction .
in this study , we have implemented iparts2 by using an improved sa - based algorithm as follows .
first , 63402 non - terminal nucleotides from the rna 3d hub non - redundant list ( version 1.89 ) of 876 rna 3d structures ( 12 ) were classified into 23 conformation clusters according to their backbone pseudo - torsion angles .
next , 23 capital letters were used to represent the center nucleotides of these 23 clusters and for each letter , four different background colors were further used to separately represent four possible base types a , g , c and u of the corresponding center nucleotide . as a result , we constructed an sa of 92 elements with each element ( a letter on a colored background ) carrying both information of backbone geometry ( letter ) and base ( background color ) for a representative nucleotide . finally , the sa was used to reduce input rna 3d structures into 1d sa - encoded sequences and a traditional sequence alignment , such as global alignment ( without penalty to end gaps ) ( 13 ) or local alignment ( 14 ) , was applied to them for determining their global or local similarity .
in addition , for the accuracy of aligning two sa - encoded sequences , the statistical method proposed by henikoff and henikoff ( 15 ) was applied to derive a blosum - like substitution matrix that can reward more similar sa - encoded sequences with high scores .
we refer the reader to the supplementary data for the details of the above improved sa - based algorithm .
it is worth mentioning here that the local alignment algorithm we used to implement iparts2 is slightly different from the one used in iparts , because we further utilized the technique mentioned in ( 16 ) to modify the local alignment algorithm such that the local alignments returned by iparts2 are non - intersecting , where two alignments are said to be non - intersecting if they do not have a match or mismatch in common .
usually , non - intersecting local alignments of rna structures are more of practical interest to the user .
currently , iparts2 can be accessed by an easy - to - operate web interface as illustrated in figure 1 .
it provides the user two kinds of alignments for comparing two rna 3d structures : ( i ) global alignment for determining their whole structural similarity , and ( ii ) local alignment for finding common similar substructures .
basically , iparts2 takes as input two rna 3d structures , each of which can be either a pdb / ndb i d or a pdb file uploaded by the user , their chain ids if they have multiple chains , and optionally the starting and ending residue numbers of substructures to be aligned .
if required , the user can run iparts2 by modifying the default settings of all the parameters , including alignment method ( whose default is global alignment ) , gap open and extension penalties ( whose default values are 9 and 1 , respectively ) , and number of suboptimal alignments ( at least one ) . in the output page ,
next , iparts2 continues to show its running time , as well as its alignment results , including structural alignment score ( sas ) ( refer to the experimental results section for its definition ) between input rna 3d structures with corresponding raw score in parentheses , number of aligned nucleotide pairs , rmsd and optimal / suboptimal alignments of their sa - encoded sequences and corresponding rna sequences . note that each letter in the aligned sa - encoded sequences is displayed with a colored background , which indicates the base type ( a , g , c or u ) of the corresponding nucleotide .
finally , iparts2 shows a jsmol graphical display ( without installing java plugin ) of aligned rna 3d structures , so that the user can visually view , rotate and enlarge the 3d structures of input rna molecules and their structural superposition and download their alignment and pdb files . note that in the jsmol visualization , end - gap residues in global alignment or non - aligned residues in local alignment are displayed in light colors .
first , we tested iparts2 by running its global alignment on a benchmark dataset called fscor and evaluated its accuracy in function assignment by comparing its receiver operating characteristic ( roc ) curve with those obtained by iparts ( 4 ) and other existing popular tools , including sara ( 2,3 ) and setter ( 5,6 ) .
the fscor dataset originally proposed in ( 3 ) contains 419 rna 3d structures that are classified into 168 functional classes .
we ran all the tools mentioned above locally by aligning all 87571 pairs of rna 3d structures in the fscor dataset . to take the quality of the structural alignments into account ,
the roc curves of all the tools were computed based on a geometric match measure called sas , which is defined to be ( rmsd 100)/(number of aligned nucleotide pairs ) ( 17,18 ) , instead of native alignment score .
the reason is that , as suggested in ( 18 ) , a better structural alignment should match more residues and also have lower rmsd , and the geometric match measure sas is better than the native alignment score to separate good structural alignments from less good ones .
two rna structures in the fscor dataset are said to be functionally identical if they have the same deepest scor classification ( i.e. their geodesic distance d = 0 ) or functionally similar if they differ at least in the deepest scor classification ( i.e. d 2 ) . to obtain the roc curve of each tool ,
the alignments of all pairs of rna structures computed by the tool are sorted by their sas values .
a threshold of sas is then varied between the minimum and maximum of the sorted sas values for producing the points of the roc curve . for a fixed threshold ,
all pairs of aligned rna structures whose sas values are above the threshold are assumed positive and all below it negative .
moreover , the pairs assumed positive are counted as true positives ( tp ) if they are functionally identical ( d = 0 ) or similar ( d 2 ) and false positives ( fp ) otherwise ; the pairs assumed negative are counted as true negatives ( tn ) if they are functionally non - identical ( d > 0 ) or dissimilar ( d > 2 ) and false negatives ( fn ) otherwise .
the point of the roc curve corresponding to the fixed threshold is then produced by plotting its tp rate tp/(tp + fn ) on the y - axis and its fp rate fp/(fp + tn ) on the x - axis . as a result
, the roc curves for all the evaluated tools mentioned above are displayed in figures 2 and 3 for d = 0 and d 2 , respectively .
these experimental results have shown that our iparts2 outperforms its previous version iparts and other tools sara and setter for the function assignment in the fscor dataset , because iparts2 has the highest auc values of 0.914 and 0.772 for d = 0 and d 2 , respectively .
roc curves for d = 0 based on the sas values of all aligned pairs of rna 3d structures in the fscor dataset , where the auc values of iparts , sara , setter and iparts2 are 0.861 , 0.883 , 0.843 and 0.914 , respectively .
note that the auc value of rass computed by using the 67006 pairs of rna 3d structures is 0.892 .
roc curves for d 2 based on the sas values of all aligned pairs of rna 3d structures in the fscor dataset , where the auc values of iparts , sara , setter and iparts2 are 0.740 , 0.761 , 0.713 and 0.772 , respectively .
note that the auc value of rass computed by using the 67006 pairs of rna 3d structures is 0.758 .
next , we also compared the capabilities of iparts , sara , setter and iparts2 for the function assignment with rass ( 7,8 ) using the fscor dataset . as mentioned before , rass is a recently developed tool of comparing two rnas by considering both information of their sequences ( bases ) and 3d structures ( backbone geometry ) .
when running rass on the fscor dataset , however , we noticed that for 20565 pairs among 419 rna 3d structures , rass was not able to provide their structural alignments so that their sas values were not able to be computed .
therefore , for a fair comparison of all the evaluated tools , we calculated their roc curves only using those 67006 pairs of rna 3d structures whose structural alignments were able to be provided by rass .
in this situation , iparts2 still performs better than all other tools , including rass , according to the auc values of their roc curves ( refer to supplementary figures s5 and 6 ) . for the results of additional experiments , we refer the reader to the supplementary data .
finally , for the running time comparison of all the tools mentioned before , we used five datasets containing two or more rna 3d structures of various lengths as follows : ( i ) five trna structures ( 1ehz : a , 1h3e : b , 1i9v : a , 2tra : a and 1yfg : a ) with an average length of 76 nucleotides , ( ii ) three ribozyme p4-p6 domains ( 1gid : a , 1hr2:a and 1l8v : a ) with an average length of 157 nucleotides , ( iii ) two domains v of 23s rrna ( 1ffz : a and 1fg0:a ) with an average length of 496 nucleotides , ( iv ) two 16s rrna ( 1j5e : a and 4v4q : aa ) with an average length of 1522 nucleotides and ( v ) two 25s rrna ( 4v7r : b1 and 4v7r : d1 ) with an average length of 3396 nucleotides .
the average running times of all the tools were obtained by running them with their default parameters on local machine with intel cpus with 3.4 ghz and 32 gb of ram under linux system . as shown in table 1 , setter is the fastest tool among all the five tools .
however , our iparts2 , as well as iparts , outperforms both sara and rass , and it can finish its alignment job in several seconds up to a couple of minutes .
in this study , we have re - implemented our previous tool iparts into a new web server iparts2 by constructing a totally new sa of 92 elements , with each element carrying both information of base ( 1d ) and backbone geometry ( 3d ) for a representative nucleotide . according to our experimental results on a benchmark dataset
, iparts2 indeed outperforms iparts and also achieves better accuracy than other popular tools , such as sara , setter and rass , in rna alignment quality and function prediction .
therefore , iparts2 can serve as a useful tool for aligning two rna 3d structures , which can further provide insight into structural and functional properties of rnas .
ministry of science and technology of taiwan [ most104 - 2221-e-007 - 027-my2 , in part ] .
funding for open access charge : ministry of science and technology of taiwan [ most104 - 2221-e-007 - 027-my2 ] .
Output:
| since its first release in 2010 , iparts has become a valuable tool for globally or locally aligning two rna 3d structures .
it was implemented by a structural alphabet ( sa)-based approach , which uses an sa of 23 letters to reduce rna 3d structures into 1d sequences of sa letters and applies traditional sequence alignment to these sa - encoded sequences for determining their global or local similarity . in this version , we have re - implemented iparts into a new web server iparts2 by constructing a totally new sa , which consists of 92 elements with each carrying both information of base and backbone geometry for a representative nucleotide .
this sa is significantly different from the one used in iparts , because the latter consists of only 23 elements with each carrying only the backbone geometry information of a representative nucleotide .
our experimental results have shown that iparts2 outperforms its previous version iparts and also achieves better accuracy than other popular tools , such as sara , setter and rass , in rna alignment quality and function prediction .
iparts2 takes as input two rna 3d structures in the pdb format and outputs their global or local alignments with graphical display .
iparts2 is now available online at http://genome.cs.nthu.edu.tw / iparts2/. |
PubmedSumm119661 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: polycystic liver disease ( pld ) is a genetic inherited entity associated with polycystic renal disease due to mutations in pkd1 or pkd2 genes .
surgical intervention is needed in cases presenting with massive hepatomegaly , or when complications such as cyst rupture , infection , hemorrhage or jaundice occur .
obstructive jaundice is a rare finding usually associated with secondary causes rather than external cyst compression of the bile ducts .
although there are reports in the literature of cyst - associated jaundice [ 4 , 5 ] our experience suggests that a thorough workup to exclude secondary causes such as gallstones and malignancy is mandatory .
she complained of chronic dull pain , satiety , weight loss , dyspnea and physical disability .
the patient had had clay - coloured stools and dark urine the last two weeks before admission .
physical examination revealed a large non - tender abdominal mass and no signs of chronic liver disease such as splenomegaly or ascites .
liver function tests were compatible with obstructive jaundice , with total bilirubin 8.07 mg / dl ( normal range < 1 mg / dl ) , with direct predominance ( 7.51 mg / dl ) and elevation of alkaline phosphatase ( 337 u / l , normal range 50136u / l ) and -gt ( 404 u / l , normal range 1585 u / l ) .
ca19 - 9 value was 224 u / ml ( normal range 037 u / ml ) .
ultrasound examination of the abdomen showed multiple liver cysts ranging from 1.2 to 13 cm in diameter and dilated intrahepatic biliary ducts . computed tomography ( ct )
scan was performed using the standard protocol for hepatobiliary disease evaluation ( slice thickness 35 mm , arterial - portal venous and delayed phases after contrast administration ) .
percutaneous drainage of the hilar cysts was performed to confirm that subsequent fenestration or enucleation will resolve jaundice .
however the persistence of cholestasis and the mild dilatation of intrahepatic bile ducts in the post drainage ct evaluation ( fig .
the patient underwent magnetic resonance imaging and magnetic resonance cholangiopancreatography ( mri - mrcp ) that was compatible with the presence of possible neoplasmatic infiltration at the distal common bile duct , since duct compression was not marked enough to justify intrahepatic biliary dilatation and furthermore the distal segment of the common bile duct was not evident ( fig .
the abrupt termination of the middle segment of the common bile duct was indicative of neoplastic infiltration .
the postoperative period was uneventful and the patient was discharged on the 9th postoperative day . at six - month follow - up
autosomal dominant polycystic disease is genetically heterogeneous , with mutations in two distinct genes predisposing to the combination of renal and liver cysts ( ad - pkd1 and ad - pkd2 ) .
furthermore , davila et al . reported a second gene ( sec6 ) related to pld .
the disease is more frequent in women , and hepatic cysts can increase dramatically in number and size through the child - bearing years of early and middle adult life .
the cysts in pld can also increase in size and number during pregnancy or simultaneously with the use of exogenous female steroid hormones .
in one study it was shown that the use of estrogen in women with autosomal dominant polycystic kidney disease may selectively increase the severity of hepatic cystic disease .
usually patients suffer from chronic dull abdominal pain , satiety , weight loss , dyspnea , physical disability and descensus .
jaundice may rarely exist due to compression of the common bile duct by the cysts . in our experience , including this case , obstructive jaundice is usually associated with a co - existing underlying pathology such as gallstone disease or malignancy . in pld , liver failure or complications of advanced liver disease
are rare . even with marked hepatosplenomegaly and portal hypertension , liver function is well preserved .
thus jaundice is uncommon and requires further exploration to exclude benign or malignant disease . in our case
other authors have reported co - existing choledocholithiasis and other complications of pld causing obstructive jaundice . in case of jaundice , standard pre and post contrast
mri sequences are necessary to establish the presence of an underlying malignancy that may be suggested by the biliary dilatation seen at mrcp .
mrcp is also helpful to estimate the intraductal extent of tumor infiltration , facilitating surgical planning .
ercp can also help to confirm the cause of jaundice , presenting the further advantage of performing brushing or biopsy .
the presence of the cholangiocarcinoma in the distal common bile duct , as was shown on imaging in our case , led the surgical team to perform a successful pylorus - preserving pancreatoduodenectomy with dominant liver cysts enucleation , which was considered the best therapeutic option for the patient .
cholangiocarcinoma is the most common primary malignancy of the bile ducts and accounts for 1550% of obstructing bile duct tumors .
factors that predispose to the development of cholangiocarcinoma include ulcerative colitis , primary sclerosing cholangitis , choledochal cysts , caroli disease , polyposis syndromes of the colon and clonorchis sinensis infestation .
cholangiocacinomas are generally classified as intrahepatic ( peripheral ) lesions , hilar lesions , and distal ductal tumors .
if no tumor mass is seen , diagnosis of hilar cholangiocarcinoma can be made by the presence of high - grade intrahepatic bile duct dilatation and the absence of right and left hepatic duct union .
if the neoplasm is located at a lower level , as in our case , at the point of obstuction the duct will terminate abruptly or there may be associated eccentric thickening of bile duct wall [ 11 , 12 , 13 ] .
the reason of the nonvisibility of the cholangiocarcinoma on ct images in our patient could be attributed to cyst superimposition obscuring the lesion and to the infiltrative type of the neoplasm , as was proven on histopathology , characterized by the absence of tumor mass .
mrcp is essential for the accurate estimation of obstruction level and the depiction of the characteristic morphologic features of stenosis or obstruction ( abrupt termination of the bile duct as in our case ) .
because of their intrinsic high tissue contrast and multiplanar capability , mri and mrcp are able to detect and preoperatively assess patients with cholangiocarcinoma , investigating all involved structures such as bile ducts , vessels and hepatic parenchyma .
the main reason for surgical / imaging discrepancy is represented by the microscopic diffusion along the mucosa and in the perineural space .
it should also be emphasized that the presence of multiple cystic liver lesions superimposed on the biliary ducts , displacing or distorting them , may obscure the presence of a cholangiocarcinoma . on the other hand ,
false - negative results are also encountered with ercp washing or brushing in some patients due to the submucosal tumor growth .
intrahepatic cholangiocarcinoma occurs rarely in patients with multiple liver cysts and tumor origin from cysts after in situ transformation of the epithelium has been shown in some cases [ 15 , 16 , 17 , 18 ] .
the prognosis of cholangiocarcinoma associated with pld is very poor and distant metastases are common .
the possibility of cholangiocarcinoma should be considered in any patient with autosomal dominant polycystic kidney disease with significant abnormal liver function tests .
after extensive review of the literature , it appears that coexistence of pld with distal common bile duct cholangiocarcinoma as in our case has not been reported so far .
these consist of cyst hemorrhage , rupture , infection , uterine prolapse due to displacement , obstructive jaundice , portal hypertension , transudative and exudative ascites and budd - chiari syndrome [ 19 , 20 ] .
surgery is indicated in most cases , as medical treatment has failed to show any efficacy .
use of somatostatin to block the secretin - induced secretion by hepatic cysts failed to demonstrate any significant effect on hepatic cyst growth size .
cyst aspiration with sclerosis , open or laparoscopic cyst fenestration , combined hepatic resection and fenestration or liver transplantation are possible treatment options .
aspiration combined with ethanol instillation to induce sclerosis of the cyst lining epithelium can be effective in patients with a few dominant cysts ( type i pld few large cysts > 7 cm ) .
cyst fenestration can be performed in patients with more diffuse pld ( type ii pld
patients with small cysts throughout the liver have a greater risk of persistence and recurrence of symptoms .
combined hepatic resection and fenestration is more effective in reducing the hepatic mass and gastric compression .
recurrence rates vary significantly in the literature with high postoperative morbidity rates ( 38100% ) .
this procedure offers an additional advantage in the case of massive hepatomegaly and severe symptoms of gastric compression .
resection addresses the problem of liver mass , but poses a significant risk of biliary ductal injury , vascular compromise , and liver insufficiency because cysts markedly distort the intrahepatic anatomy .
postoperative morbidity is related to the presence of temporary ascites , pleural effusion and biliary leakage . in particular , ascites has been troublesome due to continued cyst secretion from residual fenestrated cysts , disruption of intrahepatic lymphatics and partial venous outflow obstruction .
candidates for combined resection / fenestration should have at least two adjacent liver segments not involved by cysts and normal liver function .
these patients should be also managed by experienced hepatobiliary surgeons at institutions with advanced intensive care and interventional radiological and gastroenterology support .
liver transplantation has been performed in rare cases when the above - mentioned interventions were not an option . in patients who harbour diffuse pld , orthotopic liver transplantation is effective , but inherently assumes the risks of long - term immunosuppression and rejection .
orthotopic liver transplantation is indicated for patients with progressive pld after resection / fenestration , patients with concurrent liver dysfunction and renal failure , and patients with diffuse pld without segmental sparing .
jaundice presents infrequently in this group of patients , unless a secondary cause exists . in such situations
a thorough diagnostic workup is mandatory to exclude the coincidence of benign or malignant disease .
Output:
| although jaundice rarely complicates polycystic liver disease ( pld ) , secondary benign or malignant causes can not be excluded . in a 72-year - old female who presented with increased abdominal girth , dyspnea , weight loss and jaundice , ultrasound and computed tomography confirmed the diagnosis of pld by demonstrating large liver cysts causing extrahepatic bile duct compression .
percutaneous cyst aspiration failed to relief jaundice due to distal bile duct cholangiocarcinoma , suspected by magnetic resonance cholangiopancreatography ( mrcp ) and confirmed by endoscopic retrograde cholangiopancreatography ( ercp ) .
coexistence of pld with distal common bile duct cholangiocarcinoma has not been reported so far . |
PubmedSumm119662 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: one of the six main strategies recommended by the world health organization ( who ) ( mpower ) for controlling the epidemic of tobacco use was providing smoking cessation services for individuals who are dependent upon tobacco .
according to article 14 of the who framework convention on tobacco control , these services should be up - to - date and available at very low cost through a comprehensive health system .
there is a wide array of smoking cessation therapies that include nicotine replacement therapy ( nrt ) , zyban , champix , and behavioral interventions that do not rely on pharmacological support , cold turkey , acupuncture , hypnotism , group therapy , and booklet .
electronic nicotine delivery systems ( ends ) , of which electronic cigarettes ( ecs ) are the most common prototype , are devices that do not burn or use tobacco leaves , but instead vaporize a solution inhaled subsequently by the user .
the main constituents of this solution , in addition to nicotine , are propylene glycol , with or without glycerol and flavoring agents .
ends solutions and emissions may contain additional chemicals , some of them are considered to be toxicants . a primary intention of manufacturing this device was to allow use in public places where smoking is forbidden .
extensive advertising and promotion included the argument that these devices would pose little risk due to passive exposure . to date , a most impressive number 460 types of this device have been designed and marketed with additional types continually in development .
however , disadvantages and side effects have been reported in many articles , and the unfavorable effects of its secondhand vapor have been demonstrated in many studies . even after massive advertisements claiming the usefulness of these devices for quitting smoking , several studies found that ecs were not successful as a vehicle for smoking cessation . meanwhile
, some studies indicated short - term effects in reducing the smoking - related harms .
this trend has continued during more recent years . although there are still scientific documents indicating deleterious effects of these devices , no unified position against these devices has been established . despite a lack of support from scientific communities such as the pulmonary associations of europe and the usa and who , usage of this device are increasing steadily , especially among teenagers and nonsmoking young adults . the current study was designed and conducted to investigate and review all scientific published literature in recent years regarding ecs and to present a simple conclusion about their effects on quitting smoking and respiratory health .
all the pubmed articles containing one of these words : electrical cigarette , ec , e - cigarette , ends in their title were gathered and reviewed by an expert panel .
a checklist of the year of publication , number of articles , number of citations , and the conclusions of the articles was created and included the categories of effective and harmless ; ineffective and harmful ; and inability to draw conclusions . in the expert panel meeting , it was suggested to accept related articles ( at least their abstracts ) and also it was agreed to reject unpublished and duplicate articles and also opinion papers , which were seemingly irrelevant .
articles were reviewed separately by two expert researchers who were trained and adjusted to reach a desired agreement for rating the articles . to check the reliability and inter - rater reliability ,
the inter - rater reliability was 76% before discussion ; any discrepancies in answers were discussed and a consensus was achieved on subsequent review . after the training and pilot assessment , the researchers were ready to do the literature search .
the first report of the researchers was observed again by the principal investigator , who determined when the assistants were ready to work alone .
subsequently , the researchers selected and categorized the articles according to the following criteria : total number of articles , the number of articles whose had conclusion supported ecs as effective for quitting smoking and not harmful without side effects on respiratory health ; the number of articles whose conclusions did not support these devices as effective for quitting smoking and/or harmful or with some side effects on respiratory health ; and the number of articles without any definite conclusions . again to assess the reliability of each assistant , 10% of the articles were selected randomly and the recorded results were compared by the principal investigator .
the panel summed the number of supporting and not supporting articles to determine the scores as a simple quantitative review scale for ecs effects on respiratory health .
one hundred and forty - nine articles were found in pubmed up to september 2014 , the first one in 2009 and 4 , 6 , 15 , 37 , and 86 articles were published in the following years , respectively .
one hundred and thirty - seven ( 91.9% ) articles had attainable abstracts or full texts .
sixty - eight of the 137 had no clear result or on smoking cessation and presented news regarding ecs and called for a further investigation regarding its effects [ figure 1 ] .
twenty - four articles supported the device as an effective and nonharmful method for tobacco cessation .
forty - five articles did not support the use of the device due to side effects and lack of success in tobacco cessation efforts . based on table 1 ,
there were 21 more articles ( 65.2% ) that concluded ecs were not effective for quitting smoking or had some side effects on respiratory health .
the study in selection steps frequency of electronic cigarettes articles based on published year and the result obtained
a general question about electric cigarettes is whether this is an ineffective device or a proper treatment for smoking cessation . for other tobacco control methods
heydari et al . in a comparative study on tobacco cessation methods demonstrated the use of nrt , champix , and zyban in combination with educational interventions as the most recommended method , but the e - cigarette , in contrast , received a score of only one among 25 articles in which 14 articles were without a clear result , six were supportive articles , and five were not supportive
. however , in the current study , ecs received a 21 score . in this study , we considered suitable methods for tobacco cessation , which received higher scores based on supportive best evidence . in recent years , the number of articles regarding ecs has increased noticeably and even doubled yearly , but the central finding is that in comparison with some other quit methods , the supportive articles are much fewer . in light of the paucity of reliable scientific support ,
it is probable that ecs can act as an escape from ongoing campaigns such as the who framework convention on tobacco control in 177 countries and additional established campaigns against smoking and preserve dependence on nicotine .
three different studies of corey et al . in usa and lee et al . in korea and goniewicz and
zielinska - danch in poland showed that there were an increasing usage of ecs among smokers and nonsmokers with a excessive use of cigarette smoking .
a recent survey conducted in britain demonstrated that the use of ec among adults had risen in 2014 .
recently , the transnational tobacco companies have entered the ends market , and some of them are aggressively competing with the independent e - cigarette companies to gain market share .
meanwhile , in iran , we had no study about the prevalence of using ecs , but two studies showed that ends was not a recommended method employed for cigarette quitting by physicians and smokers .
the provisional agenda of the 6 conference of the parties to the who framework convention on tobacco control in moscow in 2014 demonstrated that only a few studies have examined whether the use of ends is an effective method for quitting tobacco smoking , and evidence is limited and does not allow firm conclusions to be reached .
furthermore , it has been clearly mentioned that ecs were not recommended for smoking cessation by the who and any other scientific agency , so more investigation is needed in this regard .
enough evidence to suggest that ecs are effective for quitting smoking is lacking , as is the evidence for the lack of their harm for respiratory system and thus being alternatives for smoking .
a potential limitation of any review ( including ours ) is the possibility of publication bias .
a potential limitation of any review ( including ours ) is the possibility of publication bias .
Output:
| background : in recent years , electronic cigarettes ( ecs ) have been heavily advertised as an alternative smoking device as well as a possible cessation method .
we aimed to review all published scientific literature pertaining to ecs and to present a simple conclusion about their effects for quitting smoking and respiratory health.methods:this was a cross - sectional study with a search of pubmed , limited to english publications upto september 2014 .
the total number of papers which had ecs in its title and their conclusions positive or negative regarding ecs effects were computed .
the number of negative papers was subtracted from the number of positive ones to make a score.results:of the 149 articles , 137 ( 91.9% ) were accessible , of which 68 did not have inclusion criteria .
in the 69 remaining articles , 24 studies supported ecs and 45 considered these to be harmful . finally , based on this evidence , the score of ecs ( computed result with positive minus negative ) was 21.conclusion : evidence to suggest that ecs may be effective and advisable for quitting smoking or a safe alternative for smoking is lacking and may instead harm the respiratory system .
however , further studies are needed . |
PubmedSumm119663 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: we report a case of hairy cell leukemia ( hcl ) initially misdiagnosed as plasma cell dyscrasia due to various clinical , morphological and immunophenotypic confounders .
in a patient diagnosed of marrow plasmacytosis and serum monoclonal protein elsewhere and referred to our hospital , morphological evaluation of bone marrow aspirate smears and trephine biopsy , immunophenotyping , and molecular testing ( brafv600e mutation ) were done .
clinically , the patient was asymptomatic ; bone marrow revealed plasmacytosis , mastocytosis , and lymphocytosis with a few hairy cells .
immunophenotyping showed features of hcl with aberrant cd10 expression and a large subclone of cd19 cells .
a diagnosis of hcl with reactive plasmacytosis and mast cell hyperplasia was made and confirmed by immunophenotyping and molecular studies .
hematopathologists must be aware of various confounding factors and should judiciously use flow cytometric and molecular studies for attaining a proper diagnosis of hcl
. we also report a very rare immunophenotypic aberrancy ( cd 19 negativity ) in hcl .
hairy cell leukemia ( hcl ) is an uncommon yet unique hematolymphoid neoplasm exhibiting a characteristic cytomorphology , immunophenotype , and well defined molecular features .
it accounts for 2% of all lymphoid leukemias.1 typically , it presents with splenomegaly , pancytopenia , and monocytopenia ; and shows a characteristic immunophenotype .
the cells are universally cd19 with co - expression of cd25 , cd11c , cd103 and cd123 .
patients of hcl can present with a spectrum of different clinical and pathological characteristics often puzzling a clinician or a pathologist .
however , the clinical and pathological findings often complement each other to clinch the diagnosis of hcl .
a correct diagnosis is mandatory as specific therapy in the form of purine analogues can provide long - term remissions in such patients.2 we present a case of hcl with atypical clinical and laboratory features confounding the primary hematological abnormality .
a 69-year - old male with no known co - morbidities presented with complaints of breathlessness on exertion for 15 days .
91g / l , total leukocyte count ( tlc ) 2.310/l , and platelet count 122 10/l ] with the nadir absolute neutrophil count ( anc ) of 252/l .
he was subjected to bone marrow evaluation which revealed plasmacytosis ( plasma cells 10% ) .
a serum protein electrophoresis ( spep ) performed subsequently , showed m - spike ( 0.3g / dl ) , though no immunofixation studies were done .
he was referred to our center for further evaluation of suspected plasma cell dyscrasia . on the assessment at our center
his pancytopenia recovered ( hb-112 g / l , tlc-3.2 10/l , anc-1.4 10/l , platelets-522 10/l ) . a repeat bone marrow examination was performed to evaluate suspected plasma cell dyscrasia .
bone marrow aspirate ( bma ) revealed 5% plasma cells ; however showed 36% larger lymphoid cells with clumped chromatin and a moderate amount of pale basophilic cytoplasm .
a few cells had grooved / reniform nucleus or cytoplasmic projections ( figure 1a ) .
trephine biopsy showed an interstitial infiltrate , typical of hairy cell leukemia ( figure 1b , c ) along with an increase in mast cells confirmed by mast cell tryptase immunohistochemistry ( figure 1d ) .
multiparametric flow cytometry ( figure 2 ) was performed on the bma using four / six color antibody panels by lyse - wash - stain method ( antibodies from bd biosciences , san jose , ca ) .
a minimum of one lakh events was acquired on dual laser bd facs canto ii and analyzed using bd facs diva software .
bright cd19 low side scatter events ( 5.3% of viable gated leucocytes ) were gated which were positive for cd10 , cd20 , cd22 , cd79b , surface ig , cd25 , cd11c , cd103 , and cd123 .
serendipitously , we found a large subclone of cells ( 15% of viable gated leucocytes ) expressing exactly the same immunophenotype markers except for cd19 , indicating its loss of expression from hairy cells .
the fluorochrome related technical issues were ruled out as the cells showed similar profile using both anti - cd19pecy7 and anti - cd19apc - h7 ( clone sj25c1 , bd biosciences ) .
the cd19 negative cells had an immune profile exactly similar to cd19+ve cells and revealed expression of hairy cell markers along with cd20 , cd22 , cd79b , cd45 , and cd10 .
the plasma cells ( cd38/cd138/cd19/cd81/cd56 and no light chain restriction figure 2 ) and mast cells ( cd117/cd33/cd2/cd25 ) showed normal immunophenotype indicating reactive plasmacytosis and mast cell hyperplasia .
a diagnosis of hairy cell leukemia with atypical features ( cd19 negative subclone , cd10 positivity , reactive plasmacytosis and mast cell hyperplasia ) was made which was subsequently confirmed by amplification - refractory mutation system polymerase - chain - reaction ( arms - pcr ) for braf v600e mutation ( figure 1e ) .
the patient remained asymptomatic , and his laboratory parameters remained normal ; not warranting purine analogue therapy .
a 69-year - old male with no known co - morbidities presented with complaints of breathlessness on exertion for 15 days .
91g / l , total leukocyte count ( tlc ) 2.310/l , and platelet count 122 10/l ] with the nadir absolute neutrophil count ( anc ) of 252/l .
he was subjected to bone marrow evaluation which revealed plasmacytosis ( plasma cells 10% ) .
a serum protein electrophoresis ( spep ) performed subsequently , showed m - spike ( 0.3g / dl ) , though no immunofixation studies were done .
he was referred to our center for further evaluation of suspected plasma cell dyscrasia . on the assessment at our center
his pancytopenia recovered ( hb-112 g / l , tlc-3.2 10/l , anc-1.4 10/l , platelets-522 10/l ) . a repeat bone marrow examination was performed to evaluate suspected plasma cell dyscrasia .
bone marrow aspirate ( bma ) revealed 5% plasma cells ; however showed 36% larger lymphoid cells with clumped chromatin and a moderate amount of pale basophilic cytoplasm .
a few cells had grooved / reniform nucleus or cytoplasmic projections ( figure 1a ) .
trephine biopsy showed an interstitial infiltrate , typical of hairy cell leukemia ( figure 1b , c ) along with an increase in mast cells confirmed by mast cell tryptase immunohistochemistry ( figure 1d ) .
multiparametric flow cytometry ( figure 2 ) was performed on the bma using four / six color antibody panels by lyse - wash - stain method ( antibodies from bd biosciences , san jose , ca ) .
a minimum of one lakh events was acquired on dual laser bd facs canto ii and analyzed using bd facs diva software .
bright cd19 low side scatter events ( 5.3% of viable gated leucocytes ) were gated which were positive for cd10 , cd20 , cd22 , cd79b , surface ig , cd25 , cd11c , cd103 , and cd123 .
serendipitously , we found a large subclone of cells ( 15% of viable gated leucocytes ) expressing exactly the same immunophenotype markers except for cd19 , indicating its loss of expression from hairy cells .
the fluorochrome related technical issues were ruled out as the cells showed similar profile using both anti - cd19pecy7 and anti - cd19apc - h7 ( clone sj25c1 , bd biosciences ) .
the cd19 negative cells had an immune profile exactly similar to cd19+ve cells and revealed expression of hairy cell markers along with cd20 , cd22 , cd79b , cd45 , and cd10 .
the plasma cells ( cd38/cd138/cd19/cd81/cd56 and no light chain restriction figure 2 ) and mast cells ( cd117/cd33/cd2/cd25 ) showed normal immunophenotype indicating reactive plasmacytosis and mast cell hyperplasia .
a diagnosis of hairy cell leukemia with atypical features ( cd19 negative subclone , cd10 positivity , reactive plasmacytosis and mast cell hyperplasia ) was made which was subsequently confirmed by amplification - refractory mutation system polymerase - chain - reaction ( arms - pcr ) for braf v600e mutation ( figure 1e ) .
the patient remained asymptomatic , and his laboratory parameters remained normal ; not warranting purine analogue therapy .
hcl is a unique b - cell non - hodgkin lymphoma ( nhl ) characterized by splenomegaly , cytopenias affecting two or more lineages and morphologically by typical hairy cells .
though the majority of cases have this typical presentation , there are scenarios in which the clinical , morphological or immunophenotypic features are atypical , leading to diagnostic confusion .
the case presented here exemplifies this intriguing situation where the patient on evaluation for a lower respiratory tract infection was found to have cytopenias , had no palpable splenomegaly and the bone marrow showed only a few hairy cells along with confounders in the form of plasmacytosis and mastocytosis .
all these together with a minor quantity of serum m protein led to initial misdiagnosis .
however , its absence should not exclude a diagnosis of hcl.3 and more importantly , a changing trend has been observed in the symptomatology of hcl over the past 30 years .
number of cases are being diagnosed at an early stage with a less marked splenomegaly.4 a co - existence of plasma cell myeloma with hcl as well as the development of myeloma in patients with hcl has been reported in the literature.5 at times , plasma cell myeloma / leukemia may mimic hcl also.67 clonal plasma cells were excluded by flow cytometry and spep studies .
the initial report of small monoclonal band in spep from outside our institute might represent a transient monoclonal gammopathy , as has been reported previously with several infections.89 however , a wrong interpretation could not be conclusively resolved in the absence of immunofixation studies .
the association of mast cell hyperplasia with hcl has been well characterized by macon et al.10 this has been attributed to the angiogenesis and further progression of the disease , confirmed by a latter study.11 there has also been a case report of systemic mastocytosis associated with a clonal hematopoietic non - mastcell lineage disease ( sm - ahnmd ) where the coexisting neoplasms were of both lymphoid and myeloid origin.12 our case shows a striking mast cell hyperplasia , however , a systemic mastocytosis has been ruled out based on immunophenotype studies .
immunophenotype aberrancies have been well described in hcl , like negativity for cd103 or cd25 ; and positivity for cd10 or cd23.13 in our case , the cells showed positivity for cd10 , and there was a subclone with absence of cd19 expression . while cd10 expression is relatively common ( 526% of cases ) and explained by alternate origin of leukemic cells from germinal center,13 the absence of cd19 expression in hcl has not been previously reported in the literature .
cd19 plays an important role in b - cell growth and differentiation and its expression increases as a b - cell matures .
this characteristic is often the basis of using it in flow cytometry as a gating marker for the diagnosis and for minimal residual disease ( mrd ) testing in various b - cell malignancies .
in fact , of all the b - nhls , hcl cases show the maximum level of expression of cd19.14 the abnormal immunophenotypic pattern should be borne in mind while performing the mrd analysis during follow - up . an alternate marker ( cd20 )
a hematopathologist must be aware of these confounding factors and must deal such cases with a high index of suspicion and a supportive armamentarium of flow cytometry and molecular studies .
Output:
| objectiveswe report a case of hairy cell leukemia ( hcl ) initially misdiagnosed as plasma cell dyscrasia due to various clinical , morphological and immunophenotypic confounders.methods and resultsin a patient diagnosed of marrow plasmacytosis and serum monoclonal protein elsewhere and referred to our hospital , morphological evaluation of bone marrow aspirate smears and trephine biopsy , immunophenotyping , and molecular testing ( brafv600e mutation ) were done .
clinically , the patient was asymptomatic ; bone marrow revealed plasmacytosis , mastocytosis , and lymphocytosis with a few hairy cells .
immunophenotyping showed features of hcl with aberrant cd10 expression and a large subclone of cd19neg cells .
a diagnosis of hcl with reactive plasmacytosis and mast cell hyperplasia was made and confirmed by immunophenotyping and molecular studies.conclusionhematopathologists must be aware of various confounding factors and should judiciously use flow cytometric and molecular studies for attaining a proper diagnosis of hcl .
we also report a very rare immunophenotypic aberrancy ( cd 19 negativity ) in hcl . |
PubmedSumm119664 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: one common procedure to translate a tooth in the dental arch is sliding it along an arch - wire , which is associated with advantages such as decreased clinical treatment time , patient satisfaction , and three - dimensional control of tooth movements .
however , a frictional force between the bracket and wire is unavoidable in the sliding procedure , with higher forces required to overcome it , in turn resulting in the anchorage control and creating some risks . in orthodontic treatments ,
when the tooth - bonded brackets move along the wire , friction results from the load naturally applied on contact points .
friction accompanies all sliding techniques and is considered an uncontrolled factor . in sliding techniques , tipping , and
the application of a load on the tooth , tipping movements begin and an angle develops between the wire and the bracket 's slot ; when the angle reaches a certain critical range , a contact is made between the wire and bracket edges , consequently producing adhesion between the two metallic bodies .
then , the wire is subjected to a slow notching and plastic deformation ; all these procedures lead to the inhibition of continuous tooth movements with numerous stops during tooth translation . overcoming this
, obstacle requires excessive orthodontic forces of approximately 40 - 60% . at the same time , the increased forces increase the risk of anchorage loss , which is a major problem in orthodontic treatment .
some techniques have been developed to overcome this problem , such as use of wires of different metals , shapes , and sizes , as well as application of extra - oral forces or use of temporary implants .
furthermore , the use of nanoparticles , invented in the 1990s , has been emphasized to decrease frictional forces between two metallic surfaces as excellent solid lubricants . in order to utilize this characteristic of nanoparticles to decrease friction during orthodontic treatments , orthodontic wires or brackets
( 2008 ) coated 0.019 inch 0.025 inch orthodontic wires with inorganic fullerene - like nanoparticles of tungsten disulfide ( ws2 ) and showed significantly reduced frictional forces on wires .
( 1995 ) reported reduced friction after coating nickel - titanium ( niti ) wires with nanoparticles of ws2 in the laboratory .
furthermore , stainless steel ( ss ) orthodontic wires were subjected to significantly decreased frictional forces when coated with nanoparticles of carbone nitride ( cnx ) as suggested by wei et al .
( 2008 ) demonstrated a reduction in the frictional coefficient of zinc oxide ( zno)-coated ss substrates in vacuum .
appropriate benefits of nanoparticles are related to the followings :
rolling effects that cause two surfaces to slide on each other due to the spherical shape of the particlesnanoparticles serve as spacers , preventing the contact between the two opposing surfacesthird - body material transfer , which only occurs when the nanoparticles are released from the coated surfaces by electrolysis and transfer to the opposing metal ( bracket ) .
rolling effects that cause two surfaces to slide on each other due to the spherical shape of the particles
nanoparticles serve as spacers , preventing the contact between the two opposing surfaces third - body material transfer , which only occurs when the nanoparticles are released from the coated surfaces by electrolysis and transfer to the opposing metal ( bracket ) . in the first stage of sliding , when there is no angle between the slot and wire , nanoparticles act as spacers and decrease the number of surface irregularities which come in contact with each other , leading to a reduced lower coefficient of friction .
however , when an angle is created between the bracket and the wire , and the binding process is developed , nanoparticles are released and a solid lubricant film is formed on sliding surfaces . in the higher load applications ,
the saliva is pushed out of the gap between the wire and the slot completely and it is only the solid lubricant film of nanoparticles , which decreases frictional forces and allows sliding to occur . obviously , future clinical use of coated wires will depend on safe biocompatibility tests according to accepted procedures .
considering possible toxicity of ws2 , new self - lubricating coatings , in which metals other than ws2 have been used , should be prepared and analyzed .
the aim of the present study was to assess the effect of zno spherical nanoparticle coatings on reducing frictional forces in sliding tooth movements .
in this in vitro study , 80 orthodontic wires of 0.016 inch and 0.019 inch 0.025 inch ( american orthodontics , usa ) were used with and without zno nanoparticle coating .
the studied devices included 40 ss brackets of the upper right centrals in 0.022 standard system ( ultratrimm , dentaurum , germany ) , 40 ss brackets of the upper right centrals in 0.018 standard system ( ultratrimm , dentaurum , germany ) , forty 0.016 inch ss straight wires ( american orthodontics , usa ) with and without spherical zno nanoparticle coating as well as 40 rectangular 0.019 inch 0.025 inch ss straight wires ( american orthodontics , usa ) with and without spherical zno nanoparticle coating .
furthermore , a universal testing machine ( huns field test equipment , h5k model ; england ) was used to exert tensile and sliding movements between the wires and brackets . in order to coat
wires with zno nanoparticles , the wires were first stored in an ultrasonic bath of ethanol solution for 30 min at 30c .
then , 0.1 g of zno nanoparticles was added to the experimental tube containing ethanol solution and transferred to the water bath at 80c after mixing .
nanoparticles were evenly distributed in the ethanol solution , followed by immersion of the wires in the solution separately [ figure 1 ] .
different time intervals were selected for coating the wires with zno nanoparticles ( 10 , 15 , 20 , 30 , 40 , 50 , and 60 min ) .
sem images of the wires confirmed zno nanoparticle coating in this method [ figure 2 ] . furthermore , a pilot study and assessment of frictional forces showed that the time interval of 10 min was the best choice for nanoparticle coatings .
soaking of the wires in the solution for nanoparticle coating sem of a wire coated with zinc oxide the friction force calculations during the sliding procedure were performed after nanoparticle coatings and preparation of wires .
central tooth brackets were bonded using a cyanoacrylate adhesive to an aluminum plate with a special bracket - mounting device in a fixed position .
then , the aluminum plate was fastened with screws to a notch created on a special device designed for bracket carrying .
then , it was attached to the base of a universal testing machine . in order to create an identical condition for all the specimens ,
the aluminum plate was positioned in three different notches angulated at 0 , 5 and 10 to the long axis of the device , using a special screw holding instrument for the simulation of the 2-order bends .
orthodontic wires were connected to the brackets by means of an elastomeric module ( dentaurum ) .
the upper end of the wire was inserted into a tension load cell of the universal testing machine , and a 150-g weight was connected to the lower end of the wire .
the wires were then pulled through the bracket at a cross - head speed of 0.5 mm / s for 25 s while , the frictional forces were calculated by means of the universal testing machine [ figure 3 ] .
all the friction forces measured during this study were of kinetic type as no calculations were carried out at the baseline ; however , after 0.1 s the friction values were calculated .
friction measurements by means of a universal testing machine the mean and standard deviation of friction forces in each system , angulation and nanoparticle coating status were computed .
three - way anova was used to analyze the effects of angulations , orthodontic systems and coating status on friction forces .
two- and three - group comparisons were carried out using student 's t - test and one - way anova , respectively ; in addition , a post hoc tukey test was used for two - by - two comparisons .
three - way anova showed that all the studied factors , including wire type ( p < 0.0001 ) , the angle between the bracket and wire ( p < 0.0001 ) , and coated versus uncoated wires ( p < 0.0001 ) , significantly affected the friction force ; i.e. , significantly different values of friction resistance were calculated regarding these variables . in 0.016 inch wires ,
the frictional force was estimated to be 1.5668 0.107 and 2.56 0.3401 n for the coated and uncoated wires in all the angles of the brackets and wires , respectively , suggesting significant reductions in friction ( 39% ) following zno nanoparticle coating ( student 's t - test : p < 0.0001 ) . in 0.019 inch
0.025 inch wires of 0.022 bracket system , the frictional forces were 1.6912 0.18868 and 3.4485 0.32389 n for the coated and uncoated wires , respectively , in all three angles , showing substantial decrease ( 51% ) after zno nanoparticle coating ( student 's t - test : p < 0.0001 ) [ table 1 ] .
means , standard deviations and standard errors of frictional forces at different degrees in 0.016 inch wires , a significant reduction of friction force ( 32.48% ) was observed at 0 for the zno - coated versus uncoated wires ( student 's t - test : p < 0.0001 ) . at 5 angle ,
friction force on the coated versus uncoated wires exhibited a significant reduction of 41.48% ( student 's t - test : p < 0.0001 ) . at 10 angle , a significant decrease in the friction force ( 41.23% ) was demonstrated for coated versus uncoated wires ( student 's t - test : p < 0.0001 ) [ figure 4 ] .
mean frictional force of 0.016 inch wire at 0 , 5 and 10 in 0.019 25 wires of 0.022 ss straight system , a statistically significant decrease in frictional force ( approximately 52.17% ) was observed at 0 angle for the zno - coated versus uncoated wires ( student 's t - test : p < 0.0001 ) . at 5 angle , the frictional force in zno - coated versus uncoated wires showed a significant reduction of 51.96% ( student 's t - test : p < 0.0001 ) . at 10 angle ,
a statistically significant decrease in frictional forces ( 48.99% ) was observed for the coated versus uncoated wires ( student 's t - test : p < 0.0001 ) [ figure 5 ]
. means , standard deviations , and standard errors of frictional forces are presented in table 1 in each wire system , angulation and zno - coated or uncoated status .
mean frictional force of 0.019 inch 0.025 inch wire at 0 , 5 and 10 at combined coated and uncoated wires of 0.018 systems , the frictional force was 1.8528 0.427
n at 0 angle , 2.054 0.548 n at 5 angle , and 2.2835 0.61
statistically , significant increases were observed in frictional forces with the increasing angles between the brackets and wires ( one - way anova : p < 0.002 ) . as shown by tukey multiple comparisons test ,
the frictional force was differently reported at 0 and 10 angles ( p < 0.001 ) while it was not so between 0 and 5 angles ( p = 0.22 ) or 5 and 10 angles ( p = 0.14 ) . at both coated and uncoated wires of 0.022 systems ,
n at 0 , 5 and 10 angles , respectively . slight and insignificant increases in frictional forces were found with increasing angles in this system ( one - way anova : p = 0.109 ) .
the total frictional forces were 2.0634 0.55829 and 2.5698 0.92098 n in 0.016 inch and 0.019 inch 0.025 inch wire systems in three angles or coated and uncoated conditions .
wires of 0.019 inch 0.025 inch system showed significantly higher frictional forces compared to 0.016 inch system ( student 's t - test : p < 0.0001 ) .
their chemical and physical characteristics are substantially different from the same materials of larger sizes . along with the hypothesis suggesting frictional force reduction between orthodontic wires and brackets after coating with nanoparticles
, we evaluated the effect of zno nanoparticle coating of wires on decreasing frictional forces .
the results showed a significant decrease in kinetic friction resistance to sliding in the zno - coated wires at different angles and both orthodontic systems of 0.018 and 0.022 .
the mean total frictional force in both wires and systems were estimated to be 1.629 n for coated and 3.0043 n for uncoated wires , demonstrating a reduction of 46% following nanoparticle coating .
the frictional force significantly decreased to 32.48% , 41.48% and 41.23% at 0 , 5 and 10 angles , respectively , following zno nanoparticle coating on 0.016 inch wires compared to the same uncoated wires .
in addition , the mean friction resistance significantly decreased by 52.17% , 52.96% , and 48.99% at 0 , 5 and 10 angles , respectively , after zno nanoparticle coating on 0.019 inch 0.025 inch wires compared to the same uncoated wires .
the mean frictional forces in 0.019 inch 0.025 inch wires showed 51% of reduction after nanoparticle coating .
furthermore , the mean frictional forces in 0.016 inch wires showed 39% of reduction after coating .
the mechanism by which the friction force is reduced after nanoparticle coating has been explained by rapoport et al .
( 2003 ) and cizaire et al . during the first phase , when there is no angle between the bracket slot and the wire , i.e. , when the bracket slot translates parallel to the wire , nanoparticles act as spacers decreasing the number of surface irregularities which come into contact with each other , leading to a decreased friction coefficient . as the angle between the slot and wire increases , the force increases at the edges of the slot , resulting in more friction resistance at the uncoated wire . at this point
, some nanoparticles seem to exfoliate resulting in dry lubrication of the sliding process on the wires coated with nanoparticles .
when the two materials are made of ss , like the uncoated wires , the friction coefficient increases with time , possibly due to the tribochemical reactions leading to oxidation .
when the nano sheets are subjected to higher forces at interfacial areas , the sliding takes place between these thin sheets of the exfoliated nanoparticles at the interfaces , consequently reducing the coefficient of friction .
in addition , zno nanoparticles act as a protection against the oxidation of metal surfaces , consequently decreasing friction resistance .
( 2000 ) concluded that decreased coefficient of friction after zno coating is related to their nanostructure properties which increase lubricating characteristics of the surfaces by participating in their plastic deformation and reducing friction in turn .
2011 ) demonstrated , using x - ray diffraction spectroscopy , that crystally preferred orientation of zno nanoparticles had a significant effect on their low frictional properties .
( 2008 ) studied the friction resistance of 0.019 inch 0.025 inch orthodontic wires after coating with fullerene - like nanoparticles of ws2 and showed substantial reduction of frictional forces after nanoparticle coating , somehow similar to our findings .
( 2006 ) showed that coating with fullerene - like ws2 nanoparticles significantly reduces arch - wire friction with the possible alleviation of the adverse complications of orthodontic treatment .
these studies were carried out using fullerene - like nanoparticles of ws2 which is somehow different from zno nanoparticles used in the present study , though their effects on decreasing friction resistance were similar .
one advantage of zno particles compared to ws2 is their biocompatibility with and safeness for human tissues .
zno is not able to create a lubricious surface in powder or compact disc forms ; however , nanostructure zno is capable of developing lubricious surfaces with a friction coefficient of 0.2 .
it seems that nanoparticle coatings on ss brackets and wires lead to reduced frictional resistance due to the removal of corrosion factors , too . in the present study ,
all the frictional forces were of kinetic type as no measurements were carried out at baseline and rather , all the calculations were performed after 0.1s .
some argue that as the movement takes place and the applied forces overcome the static friction resistance , calculation of static friction becomes more important than kinetic friction .
some others suggest a study of kinetic frictional force in the tooth sliding movements . during space closure procedures ,
in addition , overcoming static friction can not lead to tooth movement and it is the biologic resistance of periodontium that plays an important role .
furthermore , the limitations of simulating kinetic friction assessments are fewer than static friction calculations . regarding the above - mentioned arguments , kinetic friction was measured in the present study .
due to the positive effects of nanoparticle coatings on decreasing frictional forces between orthodontic wires and brackets , the coatings can be applied to other orthodontic appliances and materials , such as conventional brackets and self - ligating systems and to initial treatment of flexible wires like niti arches . with the improvement of coating methods and their approval for use in the oral cavity , friction during orthodontic treatments
can significantly decrease , resulting in better anchorage control with the consequent reduced treatment time and risk of root resorption . however , further studies are required to assess cellular toxicity of nanoparticles or their effect on different organs in order to approve their safety .
following zno nanoparticle coating , the frictional force between brackets and wires significantly decreased in all the angulations and systems .
due to the positive effects of zno nanoparticle coating on decreasing frictional forces , these nanoparticles might offer a novel opportunity to significantly reduce friction during tooth movement and the consequent better anchorage control , reduced treatment time and risk of root resorption .
Output:
| background : in the sliding technique , the reduced frictional forces are associated with rapid tooth movements and better control of the anchorage . recently , wire coating with different nanoparticles has been proposed to decrease frictional forces .
this in vitro study was carried out to coat stainless steel ( ss ) wires with zinc oxide ( zno ) nanoparticles in order to determine the effect of this coating on friction between wires and orthodontic brackets.materials and methods : eighty 0.016 inch and 0.019 inch 0.025 inch ss wires with and without zno nanoparticles were used in 80 orthodontic brackets ( 0.018 and 0.022 systems ) .
the coated wires were analyzed by sem and x - ray diffraction ( xrd ) observations .
kinetic friction between the wires and orthodontic brackets were calculated using a universal testing machine .
frictional forces were statistically analyzed using three - way anova , one - way anova , student 's t - test and tukey multiple comparison tests.results:coating with zno nanoparticles significantly influenced frictional force values ( p < 0.0001 ) . in 0.019 inch
0.025 inch wires , the frictional forces were 1.6912 0.18868 and 3.4485 0.32389 n in the coated and uncoated wires respectively , ( 51% reductions ) . in the 0.016 inch wires ,
the friction values were estimated to be 1.5668 0.10703 and 2.56 0.34008
n in the coated and uncoated conditions , respectively , ( 39% reductions).conclusion : due to the positive effects of zno nanoparticle coating on decreasing frictional forces , these nanoparticles might offer a novel opportunity to significantly reduce friction during tooth movement . |
PubmedSumm119665 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: composite transposons are common mobile genetic elements ( mges ) responsible for the dissemination of genes responsible for bacterial adaptation and survival including those conferring antibiotic resistance and xenobiotic degradation ( nojiri , shintani and omori 2004 ; bennett 2008 ) .
they consist of two insertion sequences ( iss ) that flank a segment of dna , which can transpose as a whole unit ( including the two flanking is elements ) and the active is element alone can also transpose out from the unit .
recently , another mechanism for the translocation of dna within an is26-based composite transposon was described ( harmer , moran and hall 2014 ; harmer and hall 2015 ) .
a single copy of the is element is excised together with flanking dna to form a circular molecule . to distinguish this from
conventional transposition of is elements , the transposing region was called a translocatable unit ( tu ) .
this molecule can be formed by two different mechanisms : intramolecular replicative transposition and conservative transposition by excising out from the composite transposon ( fig .
most of the dna segments reported to be found on tus are antibiotic resistance genes , such as the kanamycin resistance gene in is26-apha1a tu and tetracycline resistance gene in is1216-tet(s ) tu ( ciric et al .
2014 ; harmer and hall 2015 ) . the structures of composite transposons and tus .
the composite transposons consist of two is elements ( blue box ) flanking dna segment ( green box ) .
the purple and red arrows represent the binding site of the dna primers for the amplification of composite transposon and tus , respectively .
previously , studies on composite transposons and tus focused on cultivable bacteria . however , most of the bacteria in environmental samples have not yet been cultured in the laboratory . for example
, more than 700 bacterial species have been identified in human oral cavity , but less than half of them can be cultivated ( wade 2011 ) .
human oral metagenomic dna was used to screen for composite transposons and tus , as several tus were found in oral bacteria , including streptococcus oralis and s. infantis ( ciric , mullany and roberts 2011 ; ciric et al .
2014 ) the aim of this work is to determine whether composite transposons and tus could be detected through pcr in metagenomic dna . to do this ,
pcr primers were designed to amplify dna flanked by is elements to check for the presence of composite transposons in oral metagenomic dna .
then , another set of primers was designed to determine if tus derived from these putative composite transposons were present .
saliva samples were collected from 11 healthy males and females from department of microbial diseases , university college london ( ucl ) eastman dental institute as described previously ( tansirichaiya et al .
all of the volunteers did not receive any antibiotic treatment for at least 3 months , and gave the written consent prior to the sample collection .
the saliva collection and processing procedures were approved by the ucl ethics committee ( project number 5017/001 ) and are described previously ( tansirichaiya et al .
the amplifications on the human oral metagenome were performed with the primers listed in table s1 ( supporting information ) .
the pcr reaction was carried out with an initial denaturation at 94c for 3 min , following by 35 cycles of ( i ) denaturation at 94c for 1 min ( ii ) annealing at 50c65c for 30 s and ( iii ) extension at 72c for 3 min for standard pcr , 10 min for long pcr and 5 min for q5 pcr , and final extension at 72c for 10 min .
the standard pcr reaction was contained 15 l of 2x biomix red ( bioline , london , uk ) , 50100 ng of dna template , 0.2 m of each primer and molecular grade water ( sigma , dorset , uk ) up to 30 l . the long pcr reaction contained 0.25 l of takara ex taq ( 5 units/l ) ( takara bio , saint - germain - en - laye , france ) , 4 l of dntp mixture ( 2.5 mm each ) , 5 l of 10x ex taq buffer , 0.2 m of each primer , 50100 ng of dna template and molecular grade water up to a total volume of 50 l . q5
pcr reaction consisted of 12.5 l q5 high - fidelity 2x master mix ( neb , hitchin , uk ) , 0.2 m of each primer , 50100 ng of dna template and molecular grade water up to a total of 25 l .
pcr amplicons were visualized by gel electrophoresis on 1% agarose gel stained with gelred nucleic acid stain ( biotium , cambridge , uk ) .
pcr products were purified by using either the qiaquick pcr purification kit or the qiaquick gel extraction kit ( qiagen ) , following the manufacturer 's protocols .
the purified products were subsequently cloned into the pgem - t easy vector ( promega , southampton , uk ) and transformed into escherichia coli -select silver efficiency competent cells ( bioline ) by heat shock .
bertani ( lb ) agar containing 100 g / ml ampicillin , 40 g / ml x - gal and 0.4 mm iptg , and incubated overnight at 37c . by using the blue - white screening , the white colonies ( containing inserts )
were subcultured into 5 ml of lb broth containing 100 g / ml ampicillin and incubated overnight in 37c shaker .
the plasmid isolation was performed by using qiaprep spin miniprep kit ( qiagen ) , as per the manufacturer 's instruction .
the inserts containing in each plasmid were sequenced using m13 forward and m13 reverse primers at the beckman coulter genomics ( genewiz , essex , uk ) with an abi 3730xl . if the initial sequencing reaction can not cover the sequences of the inserts , extra primers were designed and used for additional sequencings .
the analysis of sequencing results was performed with bioedit software version 7.2.0 ( http://www.mbio.ncsu.edu/bioedit/bioedit.html ) .
if the insert was sequenced using multiple primers , the sequences were assembled with cap contig function within the software ( huang 1992 ) .
the vector sequences were initially trimmed from the sequences by using vecscreen analysis tool ( http://www.ncbi.nlm.nih.gov/tools/vecscreen ) and identified for the primer binding sites .
the sequences were then analyzed by using blastn and blastx for the matching with the sequences in the databases , isfinder for the identification of is element and clustal omega for the alignment of the sequences ( altschul et al .
the sequences of all composite transposons ( cta1 to cta5 ) were submitted to the dna database with the accession numbers from kx305930 to kx305934 .
twelve is elements were selected for the screening of composite transposons , including those of the is26 family ( is26 , is240 , is257 and is1216 ) , is elements found in streptococcus spp .
( the most prevalent bacteria in oral cavity ) ( is861 , is1161 , is1167 , is1381 and is1548 ) , and is elements commonly associated with plasmids and transposons ( is3 , is256 and is1485 ) ( kreth , merritt and qi 2009 ; clewell et al .
prior to the detection of composite transposons , the presence of each is element in oral metagenomic dna was determined by designing the pcr primers to amplify the iss .
the amplicons of the expected size were sequenced to confirm the results . among 12 is elements
, the sequencing results showed that 6 of them were confirmed to be present in the extracted oral metagenome , these were is26 , is257 , is1216 , is1161 , is1167 and is1485 .
the amplicons from this pcr amplification could be either the dna segment flanked by two iss of a composite transposon or the dna segment carried by a tu structure .
after the screening , five different putative composite transposon amplicons ( cta15 ) were identified , four were is1216-based amplicons and another was an is257-based amplicon ( table 1 and table s1 , supporting information ) .
the first amplicon ( cta1 ) contained two potential orfs : one predicted to encode a small multidrug resistance protein ( qrg ) and the other a hypothetical protein ( similar to nad diphosphatase ) .
it had 99% nucleotide identity to the is1216 composite transposon found on tn6087 of streptococcus oralis f.mi.5 ( ciric , mullany and roberts 2011 ) .
the second amplicon ( cta2 ) was similar to the first one , but it was missing 229 bp of the gene predicted to encode the hypothetical protein and a region between qrg and the flanking is1216 .
the is elements and orf in the dna segment are shown in blue and green , respectively .
the dash boxes , arrow boxes and dotted lines represent the regions that are not present compared to the sequences in the database .
the next structure ( cta3 ) was similar to part of plasmid pil5 and plasmid pbl1 from lactococcus lactis subsp .
the main part of this structure ( 84% of the query ) had 98% nucleotide identity with orf14 , 15 and partial orf16 from plasmid pil5 , encoding a transposase , a universal stress - like protein and a mn / fe transporter - like protein , respectively .
the matching part of pbl1 plasmid to this structure was an iss1-like element with 100% nucleotide identity . by analyzing the orf14 and the iss1-like element with isfinder , they both were matched to is1216 with 100% similarity .
another structure ( cta4 ) , which was similar to the cta3 , was also identified , but it had an additional 2329 bp compared to cta3 .
the extra nucleotides were the rest of orf16 sequences missing from cta3 , and a transposase gene orf17 from pil5 .
sequencing analysis showed that the kanamycin resistance gene , knt , and a truncated rep gene were flanked by transposase genes .
it had 99% identity to part of plasmid sap079a from staphylococcus aureus ( mcdougal et al .
both partial transposase genes were matched to is257 ( 100% and 99% nucleotide identity ) .
as each of amplicons described above may have formed from a tu template , another set of primers were designed to amplify outward from the dna segments between the flanking iss ( fig .
the verification pcr was carried out by using biomix red and additionally using highly processive q5 polymerase .
this was to make sure that the amplicons were not a result of an early fall - off of the polymerase , leaving partial amplicons that could themselves act as primers in subsequent round of pcr .
tus were detected in pcrs carried out with primers designed from the dna segments within cta2 and cta4 ; amplicons of the expected size were confirmed as containing a single entire copy of is1216 by dna sequencing ( fig .
schematic of the products from the tu confirmation pcr of the sample ( a ) cta2 and ( b ) cta4 .
the is elements and orf in the dna segment are shown in blue and green , respectively .
by designing the primers to read outward from is elements , five different putative composite transposons were identified from human oral metagenomic dna , each containing different genes predicted to be involved in environmental adaptation . the qrg gene in samples cta1 and
cta2 was predicted to encode a small multidrug resistance protein that confers resistance to cetyltrimethylammonium bromide ( ctab ) , a cationic antiseptic ( ciric , mullany and roberts 2011 ) . for the sample cta5
this protein was shown to confer resistance by catalyzing the transfer of a nucleotidyl group to the 4'-hydroxyl group of the aminoglycoside resulting in inactivating kanamycin drug ( pedersen , benning and holden 1995 ) .
a gene ( uspa ) predicted to encode a universal stress protein was found in samples cta3 and cta4 .
the precise biological function of uspa remains unknown , but it was shown that the levels of uspa are elevated during a variety of stress conditions including heat , oxidant exposure , nutrient starvation and exposure to antibiotics including polymixins and cycloserine ( kvint et al .
2003 ; nachin , nannmark and nystrom 2005 ) .
it was hypothesized to function in the reprogramming of cells toward defense and escape by enhancing the cell 's capacity to withstand stresses and modulating activities related to motility and adhesion ( nachin , nannmark and nystrom 2005 ) . by designing another set of primers to determine the presence of tus based on each amplicon
, we confirmed that cta2 and cta4 were likely to be present as small circular molecules as the entire predicted single copy of the expected is element could be amplified . in order to control for pcr artefacts that may result from short primer extension within a chromosomally located composite transposon , we used the highly processive q5 dna polymerase that confirmed the results of the biomix red pcr .
the lack of positive results for the tu pcr of cta1 , cta3 and cta5 ( which contained similar sized direct repeats ) demonstrates that pcr artefacts are unlikely .
this is the first time that tus were detected in metagenomic dna and also the first time that the stress adaptation gene uspa was found on a tu .
there is a possibility that the tu amplicon could have arisen if the entire composite transposon was repeated in the host genome ; however , we think that this is unlikely due to the inherent instability of large repeated units of mobile dna .
the studies on tus are still in an early stage , and there are only a small number of identified examples .
reports on the integration and excision of tus are based on is26 composite transposons .
it was shown that is26 tu preferred to integrate with a preexisting is26 element via a conservative reaction catalyzed by the tnp26 transposase , rather than a replicative transposition to a new site ( harmer , moran and hall 2014 ) .
an intact transposase gene was shown to be important for the integration and excision of the tus ( harmer , moran and hall 2014 ; harmer and hall 2015 ) .
recently , it was shown that reca - dependent homologous recombination could also mediate the integration of a tu ; however , it is not a major factor because it occurs at least two orders of magnitude lower efficiency than the reaction catalyzed by tnp26 ( harmer and hall 2016 ) .
tus are similar to another recently described mge , called an unconventional circularizable structure ( ucs ) ( palmieri , mingoia and varaldo 2013 ) .
ucss can be excised from a replicon that contains two direct repeats ( drs ) flanking a dna segment . after excision
, it results in a non - replicative circular structure containing the dna segment and one of the drs .
the movement of tus and ucss can both occur in reca - deficient bacteria , suggesting that homologous recombination is not essential for their formation and insertion ( azpiroz , bascuas and lavia 2011 ; harmer , moran and hall 2014 ) .
the difference between ucs and tu is that ucs has no recombinases gene to catalyze their insertion reactions ( palmieri , mingoia and varaldo 2013 ) .
this pcr strategy to detect tus can also be applied to ucss by designing the primers based on the drs of the ucss . as it was shown that the is6 family of composite transposons can transpose either as a whole unit of composite transposons or as tus
, the resistance genes associated with them may then have more chance to be transposed and spread in bacterial population ( harmer and hall 2016 ) . furthermore , composite transposons are often located on other mges such as plasmids and conjugative transposons , which can also facilitate their horizontal gene transfer . if the excised tus do not integrate into a replicon , they will presumably be lost from the population during cellular replication . however , in sample cta5 , we found a truncated rep gene on a putative is257 composite transposon .
this raises the possibility that tus can facilitate the movement of rep genes between dna molecules further adding to the complexity of mge biology .
indeed , there are some possible structures representing such rep containing tu insertion reactions such as repa - repc that is flanked by is26 on tn6029 ( reid , roy chowdhury and djordjevic 2015 ) and repb located next to is1216 on tn6079 ( de vries et al .
2011 ;
, we have determined that a metagenomic approach can be used to recover both composite transposons and tus from oral metagenome by performing pcr amplification with dna primers based on the is elements .
due to the fact that the primers were designed based on the is elements , using this approach could also amplify novel genes carried by those composite transposons .
this method might also be a more promising approach for the detection of the tus in metagenome , as these small circular molecules are likely to be rare and therefore could be missed , or not assembled by metagenomic sequencing .
Output:
| a composite transposon is a mobile genetic element consisting of two insertion sequences ( iss ) flanking a segment of cargo dna often containing antibiotic resistance ( ar ) genes .
composite transposons can move as a discreet unit .
there have been recently several reports on a novel mechanism of movement of an is26-based composite transposon through the formation of a translocatable unit ( tu ) , carrying the internal dna segment of a composite transposon and one copy of a flanking is . in this study , we determined the presence of composite transposons and tus in human oral metagenomic dna using pcr primers from common is elements .
analysis of resulting amplicons showed four different is1216 composite transposons and one is257 composite transposon in our metagenomic sample .
as our pcr strategy would also detect tus , pcr was carried out to detect circular tus predicted to originate from these composite transposons .
we confirmed the presence of two novel tus , one containing an experimentally proven antiseptic resistance gene and another containing a putative universal stress response protein ( uspa ) encoding gene .
this is the first report of a pcr strategy to amplify the dna segment on composite transposons and tus in metagenomic dna .
this can be used to identify ar genes associated with a variety of mobile genetic elements from metagenomes . |
PubmedSumm119666 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: beta - catenin - dependent signaling pathways play essential roles in various cellular processes and in normal tissue homeostasis . although -catenin was primarily known as a central component of the canonical wnt signaling , several other signaling pathways like those mediated by tyrosine kinases , pi3-kinases , and heterotrimeric g proteins can also regulate -catenin function .
the regulation of -catenin by these signaling pathways is probably through the inhibition of the enzymatic activity of gsk-3. the proposed mechanism is that the activation of the above signaling pathways leads to phosphorylation ( at serine 9 ) and , therefore , inactivation of gsk-3. the inhibition of gsk-3 may result in protein stabilization and , thus , cellular accumulation of -catenin .
for example , we have reported that the activation of the gq class of heterotrimeric g - proteins in xenopus oocytes or in hek293tcells leads to the inhibition of gsk-3 and cellular accumulation of -catenin .
the cellular accumulation of -catenin can result in the translocation of this protein into the nucleus . in the nucleus ,
-catenin interacts with the tcf / lef transcription factors and , therefore , regulates the transcription of many genes involved in diverse cellular processes , including proliferation , differentiation , migration , and apoptosis .
in addition , -catenin has an important role in maintaining epithelial tissues by interacting with the e - cadherin cell - cell adhesion protein .
given the critical role of -catenin in different cellular processes , the abnormal function of this protein has been observed in animal developmental disorders and also in several human diseases , including human malignancies . the role of -catenin - mediated signaling in colon cancer has been intensively investigated , and it has been well known that upregulation of -catenin oncogenic activities occurs in more than 85% of the sporadic forms of colon cancer and in almost all patients with familial adenomatous polyposis . in patients with colon cancer ,
the upregulation of -catenin is mainly due to the truncating mutations of the tumor suppressor , the apcgene , although in some patients stabilizing mutations of -catenin itself or inactivating mutations of axin have been reported .
since the upregulation of the -catenin protein is an early event in colon cancer , the functional blockade of this protein for the prevention or treatment of colon cancer is a valuable clinical approach .
we had previously observed a reduction in -catenin - mediated gene expression when the protein was produced at very high cellular concentrations . to find out the reason , we primarily used immunostaining methods ; and during our immunofluorescence microscopy experiments in hek293 t cells
, we noticed that the transfection of the cells with larger amounts of the -catenin plasmid resulted in the formation of rod - shaped -catenin protein aggregates . in summary , in this paper , for the first time , we report that -catenin can form visible protein aggregates when expressed at high levels in hek293 t cells .
the -catenin aggregate formation in the hek293 t cells was predominantly observed in the cell nucleus , suggesting that aggregate formation can negatively affect the transcriptional activity of -catenin .
in total , 2 10 hek293 t cells were seeded in each well of 6-well plates and grown at 37c , 5% co2 in dmem supplemented with 10% fbs and antibiotics ( 100 g / ml of streptomycin and 100 units / ml of penicillin ) . at 60% confluency ,
the medium was replaced with a fresh medium containing 25 g / ml of chloroquine phosphate ( ipca laboratories , india ) ; and 2 hours later , the cells were transfected with various amounts of the -catenin expression plasmid .
six hours after transfection , the medium was changed to a medium lacking chloroquine phosphate ; and 48 hours later , the cells were harvested .
protein concentration and western blotting experiments were performed as described previously . in order to study the quantity and cellular localization of the -catenin protein
the experiments were performed as described previously . for the measurement of the expression of -catenin target genes
, the cells were harvested 48 hours post - transfection with trypsin / edta ( 0.53 mm of edta and 0.05% [ w / v ] trypsin in pbs ) and washed twice with cold pbs .
total rna was extracted from the cell pellets using the rnx - plus kit ( cinnagen , tehran , iran ) as described by the supplier .
thereafter , 2 g of rna was treated with 1 u of dnase i in a total volume of 10 l at 37c for 30 minutes .
the dnase enzyme was inactivated in 2.5 mm of edta at 65c for 10 minutes , and then the reaction was used for reverse transcription by adding 200 u of reverse transcriptase enzyme ( fermentas ) , 1x rt buffer , 20 u of ribolock rnase inhibitor , 1 mm of dntp mix , and 0.2 g of a random hexamer primer , in a total volume of 25 l .
pcr amplification was performed on 1 l of the reverse transcription reaction using 30 pmol of each primer and 2.5 u of taq polymerase in a total volume of 25 l .
the amplification protocol involved denaturation at 95c for 60 seconds , annealing ( gapdh at 59c , cyclin d1 at 57c , and luciferase at 62c ) for 60 seconds , and extension at 72c for 60 seconds .
the 30 cycles of pcr were followed by a final extension at 72c for 10 minutes .
the pcr products were separated on a 1% agarose gel and visualized by ethidium bromide .
the results of the rt - pcr experiments were then quantified with the imagej software .
oligonucleotide primers for reverse transcriptase - pcr reactions f : forward primer ; r : reverse primer the gene expression results are presented as mean standard error .
the analysis of variance ( anova ) test was used to compare the means of the gene expression levels between the different treated groups .
in total , 2 10 hek293 t cells were seeded in each well of 6-well plates and grown at 37c , 5% co2 in dmem supplemented with 10% fbs and antibiotics ( 100 g / ml of streptomycin and 100 units / ml of penicillin ) . at 60% confluency ,
the medium was replaced with a fresh medium containing 25 g / ml of chloroquine phosphate ( ipca laboratories , india ) ; and 2 hours later , the cells were transfected with various amounts of the -catenin expression plasmid .
six hours after transfection , the medium was changed to a medium lacking chloroquine phosphate ; and 48 hours later , the cells were harvested .
in order to study the quantity and cellular localization of the -catenin protein , we used indirect immunofluorescence microscopy .
for the measurement of the expression of -catenin target genes , the cells were harvested 48 hours post - transfection with trypsin / edta ( 0.53 mm of edta and 0.05% [ w / v ] trypsin in pbs ) and washed twice with cold pbs .
total rna was extracted from the cell pellets using the rnx - plus kit ( cinnagen , tehran , iran ) as described by the supplier .
thereafter , 2 g of rna was treated with 1 u of dnase i in a total volume of 10 l at 37c for 30 minutes .
the dnase enzyme was inactivated in 2.5 mm of edta at 65c for 10 minutes , and then the reaction was used for reverse transcription by adding 200 u of reverse transcriptase enzyme ( fermentas ) , 1x rt buffer , 20 u of ribolock rnase inhibitor , 1 mm of dntp mix , and 0.2 g of a random hexamer primer , in a total volume of 25 l .
pcr amplification was performed on 1 l of the reverse transcription reaction using 30 pmol of each primer and 2.5 u of taq polymerase in a total volume of 25 l .
the amplification protocol involved denaturation at 95c for 60 seconds , annealing ( gapdh at 59c , cyclin d1 at 57c , and luciferase at 62c ) for 60 seconds , and extension at 72c for 60 seconds .
the 30 cycles of pcr were followed by a final extension at 72c for 10 minutes .
the pcr products were separated on a 1% agarose gel and visualized by ethidium bromide .
the results of the rt - pcr experiments were then quantified with the imagej software .
oligonucleotide primers for reverse transcriptase - pcr reactions f : forward primer ; r : reverse primer
spss , version 16 , was used to analyze the results statistically . the analysis of variance ( anova ) test was used to compare the means of the gene expression levels between the different treated groups .
we had previously noticed that the overexpression and production of the -catenin protein at very high cellular levels leads to a decrease in the expression of the -catenin target genes ( saghaeian jazi and a. najafi , unpublished results ) . to find out the reason , we first studied the cellular -catenin protein by immunostaining methods .
hek293tcells were transfected with increasing amounts of an expression plasmid harboring the -catenin cdna , and then the cellular levels of -catenin were measured by western blotting .
as was expected , the cells produced more -catenin protein when transfected with greater amounts of the plasmid ( figure 1a ) .
when immunofluorescence microscopy was used , fluorescent rod - like bodies were clearly seen in some cells ( figure 1b ) .
the aggregate structures were not observed in the absence of the -catenin antibody , suggesting that -catenin forms protein aggregates at high concentrations ( figure 1b ) . hek293
t cells were seeded in duplicate and transfected with different amounts of the -catenin plasmid ( the number on top of each panel ) .
one group of cells was used for western blotting experiments to measure -catenin protein levels ( a ) and the other group was used for immunofluorescence staining of -catenin ( b ) .
the lowest panel represents the cells transfected with 3 g of the -catenin plasmid , but the primary antibody was omitted from the staining protocol to test the specificity of the -catenin antibody .
the expression of the gapdh protein was used as a loading control for the blot shown in figure 1a .
the rod bodies varied in length , and they were mainly seen in the cell nucleus ( figure 2a ) .
it was also observed that the precipitates of the -catenin aggregates could be recovered by centrifugation .
nuclear extracts were isolated from the cells and centrifuged at 63000 g to separate soluble and insoluble forms of the -catenin protein .
the 2fractions , after protein measurement , were used for western blotting experiments with the -catenin antibody ( figure 2b ) . as is shown in this figure ,
the amount of both soluble and insoluble forms of -catenin increased when higher concentrations of the -catenin plasmid were used for cell transfection .
it is likely that these -catenin protein aggregates had different sizes and only the heavier ones were precipitated during centrifugation .
( a ) fitc ( left ) and dapi ( middle ) staining of a hek293 t cell , overexpressing -catenin .
the figure shows that the -catenin protein aggregates predominantly formed in the cell nucleus ( the arrow ) .
( b ) hek293 t cells were transfected with increasing amounts of the -catenin plasmid ; and 48hours after transfection , the cells were harvested and fractionated as described in reference 16 .
we then considered whether -catenin aggregates were present in physiological conditions or whether they were only the result of overexpression experiments .
. therefore , the -catenin proteins in these cells were carefully examined by immunofluorescence microscopy , but there was no indication of protein aggregation ( figure 3 ) .
since the -catenin aggregate structures were mainly formed in the cell nucleus , we asked whether this could have any effect on the expression of -catenin target genes .
the upregulation of cyclin d1 in response to the activation of the canonical wnt/-catenin signaling has been considered by many laboratories , including ours . therefore , we chose cyclin d1 as a native cellular -catenin - responsive gene .
we also used luciferase under the control of -catenin - tcf / lef binding regulatory elements ( ptopflash ) , as a -catenin - responsive reporter gene . as we intended to test the -catenin
transcriptional activity more directly , we used rt - pcr experiments to measure the luciferase gene expression .
the transcription of the above genes in the cells transfected with different amounts of the -catenin - encoding plasmid was measured . as is shown in figure 4 ,
compared to that of the cells transfected with an empty vector , the transcription of the cyclin d1 and luciferase genes was upregulated ( 1.5 to 2-fold ) in the cells transfected with 0.5 g of the b - catenin plasmid .
interestingly , the transfection of the cells with 1.5 g of the plasmid either did not change or led to a decrease in the expression of the cyclin d1 and luciferase genes and the use of 3.0 g of the -catenin plasmid for cell transfection generally resulted in a further decrease in gene expression ( figure 4 ) .
interestingly , in some experiments , the transfection of the cells with 3.0 g of the -catenin plasmid lowered the transcription of the cyclin d1 and luciferase genes below the basal level ( figure 4 ) .
it is worth mentioning that we observed some degree of variability in the gene expression results , which may have been due to the difference in the efficiency of cell transfection from one experiment to another . collectively , the results of these experiments suggest that -catenin is transcriptionally active only up to certain cellular levels and higher concentrations of this protein have a negative effect on the transcription of the target genes , perhaps due to the formation of inactive protein aggregate structures .
rt - pcr experiments were performed to measure the expression of the cyclin d1 and luciferase genes in hek293 t cells transfected with varying amounts of the -catenin plasmid . to measure the luciferase gene , we also transfected the cells with 0.5 g of the reporter , top flash plasmid .
the gene expression level was significantly different between the groups evaluated by the anova test ( p=0.01 ) .
the result of a western blot experiment measuring the corresponding -catenin protein levels is shown below the chart .
we had previously noticed that the overexpression and production of the -catenin protein at very high cellular levels leads to a decrease in the expression of the -catenin target genes ( saghaeian jazi and a. najafi , unpublished results ) . to find out the reason , we first studied the cellular -catenin protein by immunostaining methods .
hek293tcells were transfected with increasing amounts of an expression plasmid harboring the -catenin cdna , and then the cellular levels of -catenin were measured by western blotting .
as was expected , the cells produced more -catenin protein when transfected with greater amounts of the plasmid ( figure 1a ) .
when immunofluorescence microscopy was used , fluorescent rod - like bodies were clearly seen in some cells ( figure 1b ) .
the aggregate structures were not observed in the absence of the -catenin antibody , suggesting that -catenin forms protein aggregates at high concentrations ( figure 1b ) . hek293
t cells were seeded in duplicate and transfected with different amounts of the -catenin plasmid ( the number on top of each panel ) .
one group of cells was used for western blotting experiments to measure -catenin protein levels ( a ) and the other group was used for immunofluorescence staining of -catenin ( b ) .
the lowest panel represents the cells transfected with 3 g of the -catenin plasmid , but the primary antibody was omitted from the staining protocol to test the specificity of the -catenin antibody .
the expression of the gapdh protein was used as a loading control for the blot shown in figure 1a .
the rod bodies varied in length , and they were mainly seen in the cell nucleus ( figure 2a ) .
it was also observed that the precipitates of the -catenin aggregates could be recovered by centrifugation .
nuclear extracts were isolated from the cells and centrifuged at 63000 g to separate soluble and insoluble forms of the -catenin protein .
the 2fractions , after protein measurement , were used for western blotting experiments with the -catenin antibody ( figure 2b ) . as is shown in this figure ,
the amount of both soluble and insoluble forms of -catenin increased when higher concentrations of the -catenin plasmid were used for cell transfection .
it is likely that these -catenin protein aggregates had different sizes and only the heavier ones were precipitated during centrifugation .
( a ) fitc ( left ) and dapi ( middle ) staining of a hek293 t cell , overexpressing -catenin .
the figure shows that the -catenin protein aggregates predominantly formed in the cell nucleus ( the arrow ) .
( b ) hek293 t cells were transfected with increasing amounts of the -catenin plasmid ; and 48hours after transfection , the cells were harvested and fractionated as described in reference 16 .
we then considered whether -catenin aggregates were present in physiological conditions or whether they were only the result of overexpression experiments .
. therefore , the -catenin proteins in these cells were carefully examined by immunofluorescence microscopy , but there was no indication of protein aggregation ( figure 3 ) .
since the -catenin aggregate structures were mainly formed in the cell nucleus , we asked whether this could have any effect on the expression of -catenin target genes .
the upregulation of cyclin d1 in response to the activation of the canonical wnt/-catenin signaling has been considered by many laboratories , including ours . therefore , we chose cyclin d1 as a native cellular -catenin - responsive gene .
we also used luciferase under the control of -catenin - tcf / lef binding regulatory elements ( ptopflash ) , as a -catenin - responsive reporter gene . as we intended to test
the -catenin transcriptional activity more directly , we used rt - pcr experiments to measure the luciferase gene expression . the transcription of the above genes in the cells transfected with different amounts of the -catenin - encoding plasmid was measured . as is shown in figure 4 ,
compared to that of the cells transfected with an empty vector , the transcription of the cyclin d1 and luciferase genes was upregulated ( 1.5 to 2-fold ) in the cells transfected with 0.5 g of the b - catenin plasmid .
interestingly , the transfection of the cells with 1.5 g of the plasmid either did not change or led to a decrease in the expression of the cyclin d1 and luciferase genes and the use of 3.0 g of the -catenin plasmid for cell transfection generally resulted in a further decrease in gene expression ( figure 4 ) .
interestingly , in some experiments , the transfection of the cells with 3.0 g of the -catenin plasmid lowered the transcription of the cyclin d1 and luciferase genes below the basal level ( figure 4 ) .
it is worth mentioning that we observed some degree of variability in the gene expression results , which may have been due to the difference in the efficiency of cell transfection from one experiment to another . collectively , the results of these experiments suggest that -catenin is transcriptionally active only up to certain cellular levels and higher concentrations of this protein have a negative effect on the transcription of the target genes , perhaps due to the formation of inactive protein aggregate structures .
rt - pcr experiments were performed to measure the expression of the cyclin d1 and luciferase genes in hek293 t cells transfected with varying amounts of the -catenin plasmid . to measure the luciferase gene , we also transfected the cells with 0.5 g of the reporter , top flash plasmid .
the gene expression level was significantly different between the groups evaluated by the anova test ( p=0.01 ) .
the result of a western blot experiment measuring the corresponding -catenin protein levels is shown below the chart .
beta - catenin is a multifunctional protein which regulates different cellular activities . as a component of cell adherens junctions
, -catenin physically interacts with the cell membrane protein , e - cadherin , to stabilize the epithelial tissues .
in addition , as a signaling protein , nuclear -catenin interacts with the tcf / lef transcription factors to regulate the expression of many cellular genes encoding very important proteins , including growth factors , transmembrane receptors , and transcription factors .
a list of these genes is available at the wnt - signaling homepage ( www.stanford.edu/~rnusse/wntwindow.html ) . for years
, -catenin has been the focus of research by scientists in the field of developmental biology , cancer biology , and cell and molecular biology .
beta - catenin was primarily known as a central component of the canonical wnt signaling . upon interaction between some wnt ligands and their cognate receptors ,
the canonical wnt signaling becomes activated and leads to the chemical and functional modification of a protein complex ( destruction complex ) , which is involved in the regulation of -catenin cellular stabilization .
the activation of the canonical wnt signaling blocks gsk-3-mediated -catenin phosphorylation at a few serine or threonine residues located at the n - terminal segment of the protein .
the phosphorylation of -catenin at these sites makes this protein susceptible to the proteasome degradation system , thereby decreasing the stabilization and cellular accumulation of -catenin .
interestingly , the natural oncogenic mutants of -catenin carry mutations in the gsk-3 phosphorylation sites and these mutants are much more resistant to proteolysis and are , thus , dominantly active .
the growth , proliferation , and survival of some human cancer cells are dependent on -catenin function , and the deregulation of this protein has been observed in some human cancers .
the oncogenic function of -catenin has been highlighted in colorectal cancers since most patients carry genetic and epigenetic alterations leading to the upregulation of -catenin function . in this paper
, we showed that the overexpression of -catenin in hek293 t cells might cause this protein to form aggregate structures .
we also showed that the -catenin aggregate structures were mainly formed in the cell nucleus ( figure 2 ) .
this was an interesting observation because it could be a mechanism for our previous finding that -catenin had a lower transcriptional activity at very high cellular concentrations .
we repeated gene expression experiments and , consistent with previous results , observed that the transcription of cyclin d1 was decreased when the cells were transfected with a higher amount of the -catenin - encoding plasmid ( e.g. 3.0 g for each well of a 6-well plate ) ( figure 4 ) .
the decrease was also observed for the luciferase gene in the topflash plasmid ( figure 4 ) . in this construct ,
the luciferase gene is under the control of 3repeats of a -catenin - tcf / lef - binding element .
these results suggest that -catenin aggregate formation could functionally block -catenin - dependent gene expression .
at least 2 other research groups have also noticed -catenin aggregates in cells having large amounts of this protein , and the protein regions necessary for the formation of such aggregates have been mapped .
the most important region appears to be the armadillo repeat domain of -catenin since the expression of the proteins that bind to this domain ( e.g. n - cadherin , tcf-4 , and apc ) can block the formation of aggregates . the formation of -catenin aggregates has been reported in several cell lines , including pc12 , mdck , and nih3t3 . here
, we showed that -catenin aggregates were also able to form inhek293tcells , suggesting that the formation of these aggregate structures could occur in many cells .
other laboratories have also discovered that -catenin aggregates are mainly found in cell nucleus , and it has been suggested that vinculin and lef-1 are also present with -catenin in the aggregates .
an important question is whether -catenin can form aggregate structures at normal and physiological concentrations . in normal cells ,
-catenin is mainly found at the cell membrane ( as a component of cell adherens junctions ) and its intracellular concentrations is very low .
however , some cancer cells have increased the intracellular protein levels of -catenin which provide them with growth and proliferative advantages .
an appropriate example is the invasive sw480 colon cancer cell , which carries easily detectable amounts of intracellular -catenin ( figure 3 ) .
however , we did not find any indication of -catenin aggregate formation in sw480 cells ( figure 3 ) .
this was expectable , because if -catenin formed aggregate structures in the sw480 cells , this protein could not function as a potent oncogene in these cells .
it is very interesting to know whether the cells like sw480 have a mechanism to block -catenin aggregates .
it is also likely that -catenin protein levels in sw480 cells do not reach those levels to form protein aggregates . among the hek293 t cells transfected with 0.5 g of -catenin encoding plasmid
, we found cells which had -catenin protein levels apparently higher than those of the sw480 cells , but these cells did not have visible aggregate structures ( figure 1b ) .
the results shown in this paper only demonstrate that -catenin forms protein aggregation at very high cellular concentrations , but they do not measure the cellular levels of this protein which initiate protein aggregation . a stable transfection of hek293 t cells with -catenin , followed by a selection of different clones expressing different amounts of -catenin , might create a more defined direction toward estimating the -catenin concentrations required for aggregate formation .
the formation of protein aggregates has been observed in several neurodegenerative diseases . in general ,
protein aggregation is toxic to cells because the aggregate structures can functionally block important cellular proteins .
there are several studies indicating that the downregulation of the wnt/-catenin signaling pathway is involved in the pathogenesis of some neurodegenerative disorders , including amyotrophic lateral sclerosis , alzheimer s disease , and huntington s diseases .
beta - catenin aggregate formation might be one of the mechanisms for the wnt/-catenin signaling deficiency in neurodegenerative diseases .
interestingly , pinto and colleagues used nsc34 cells stably expressing the enzyme superoxide dismutase-1 ( as an in vitro model ) to study wnt/-catenin signaling in the neurodegenerative disease , amyotrophic lateral sclerosis .
the authors suggested that the decrease in the wnt/-catenin pathway - dependent gene expression in the nsc34 cells was probably due to the cellular aggregation of -catenin .
as was mentioned above , deregulation of -catenin activity has been observed in several human cancers and also in other human diseases , including neurodegenerative disorders .
accordingly , further research is warranted with a view to establishing whether the aggregation of this protein is biologically relevant .
in summary , in this paper , we report that -catenin can form visible protein aggregates when expressed at high levels in hek293 t cells , re - emphasizing the possible biological significance of this phenomenon . the -catenin aggregate formation in the hek293tcells
was predominantly observed in the cell nucleus , suggesting that aggregate formation can negatively affect the transcriptional activity of -catenin .
Output:
| background : the canonical wnt signal transduction ( or the wnt/-catenin pathway ) plays a crucial role in the development of animals and in carcinogenesis .
beta - catenin is the central component of this signaling pathway .
the activation of wnt/-catenin signaling results in the cytoplasmic and nuclear accumulation of -catenin . in the nucleus , -catenin interacts with the tcf / lef transcription factors and , therefore , participates in the upregulation or downregulation of some important genes involved in diverse cellular activities .
in addition , -catenin is a critical component of the cadherin - mediated cell adherens junction .
we had previously noticed that very high cellular concentrations of -catenin had a negative effect on the transcriptional activity of this protein and , therefore , the aim of this study was to find a mechanism for this negative interaction.methods:cell fractionation , western blotting , and immunofluorescence microscopy experiments were performed to measure -catenin protein levels and -catenin cellular localization in hek293tcells transfected with various amounts of a -catenin - encoding plasmid . also , total rna was extracted from the cells and used for reverse transcriptase - pcr experiments to measure the expression of the -catenin target genes .
spss , version 16 , was used to analyze the results statistically.results:we demonstrated that overexpression of -catenin led to the formation of rod - shaped protein aggregates .
the aggregate structures were mainly formed in the cell nucleus and were heavy enough to be isolated by centrifugation .
beta - catenin aggregate formation was accompanied by a decrease in the expression of the -catenin target genes used in this study.conclusion:since deregulation of -catenin function occurs in several human diseases , including cancer and neurological disorders , the results of this paper further support the possible biological and clinical significance of -catenin aggregate formation . |
PubmedSumm119667 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: although it has been
known for five decades that guanine - rich nucleic
acids can form four - stranded structures , research into quadruplex
dna has rapidly escalated in recent years .
one reason for continued
interest is the demonstration that telomeres can and do fold into
quadruplex structures in vivo .
shortening of telomeres on chromosomal
replication is considered to be a major cause of senescence , and cancer
cells have been shown to generate an immortal phenotype by upregulating
telomerase .
the activity of telomerase is inhibited
by the presence of g - quadruplexes , leading
to the possibility of novel anticancer agents that work by binding
to and stabilizing such quadruplexes .
a second reason for interest
is the observation that quadruplexes
are found not only in telomeres but also in other parts of the genome .
typically they are found in upstream promoters and in some
cases have been shown to perform a regulatory function on downstream
genes .
quadruplexes are also formed by rna and again are likely to have
regulatory roles on translation . for
all these reasons , there is considerable interest in finding small
molecules that bind to quadruplexes and stabilize them and that could
act as markers for their presence . over the past few years ,
it has become abundantly clear that guanine - rich
sequences can fold into quadruplexes in many different ways .
a given sequence can also fold differently depending
on solution conditions , including counterions ( potassium or sodium ) ,
molecular crowding , and dehydration .
a case
in point is the human telomere sequence , hts , d[ag3(ttag3)3 ] , which has been observed in several conformations .
this plasticity makes it all the more important to identify small
molecules that bind specifically to particular conformations and stabilize
them , especially if the function and dysfunction of quadruplexes in
normal and abnormal cellular function are to be delineated . despite this importance
only four x - ray structures involving an intramolecular quadruplex
have been reported , all of which involve the all - parallel conformer
with the ligand end - stacking on terminal g - tetrads .
although , as outlined above ,
telomere sequences can take up a range of topologies , virtually all
the other reported structures also involve ligands bound to all - parallel
conformers , comprising tetramolecular or bimolecular quadruplexes .
indeed , given this paucity of data and the range of potential telomeric
conformer targets , it has been suggested that the design of small
molecules to stabilize g - quadruplexes should also be directed toward
ligands that selectively target antiparallel and hybrid type g - quadruplex
folding topologies .
the structural data
obtained for small molecules bound to non all - parallel quadruplex
conformers indicate that these telomeric structures could be targeted
through specific interactions .
for example the crystallographic structures
of disubstituted aminoalkylamidoacridine derivatives bound to the
dimeric antiparallel g - quadruplex formed from the oxytricha
nova telomere sequence d(g4t4g4 ) reveal that while these structures display the expected
end - stacking interaction , they also feature a second distinctive motif :
the acridine moiety threads through the t4 diagonal loop . as part of a program to
develop luminescent metal complexes as
sequence and structure specific dna binding substrates , we have studied the quadruplex binding properties of dinuclear ruthenium(ii )
complexes containing the tetrapyrido[3,2-a:2,3-c:3,2-h:2,3-j]phenazine ( tpphz ) ligand . although the central tpphz ligand
in such complexes is planar , the octahedral coordination geometry
about the ruthenium centers gives rise to a
these
studies have revealed that both [ { ru(bipy)2}2tpphz ] , 1 , and [ { ru(phen)2}2tpphz ] , 2 , ( where bipy = 2,2-bipyridine ,
phen = 1,10-phenanthroline ) , figure 1 , bind
to quadruplex dna with high affinities ( > 10 m ) . ( a ) structures of complexes studied .
( b )
the two possible enantiomers
of each of the metal centers in 1 and 2 .
( c ) schematic of the two diastereomers of 1 and 2 relevant to this study : left ; right . both these complexes display a
dna light - switch
effect , being essentially nonemissive in aqueous solution until dna
binding induces a several orders of magnitude increase in their ru
tpphz mlct - based luminescence .
uniquely , the
emission and binding affinities of 1 and 2 are sensitive to dna structure .
while groove binding to all duplexes
produces a relatively weak emission at > 675 nm , binding to quadruplexes
produces more complex emission changes .
intense blue - shifted luminescence
( 630 nm ) and high affinity binding is observed only when the
complex binds to antiparallel quadruplex structures containing external
diagonal loops at least three bases in length .
the presence of shorter
lateral loops limits binding affinities by several orders of magnitude
and results in negligible emission .
this
difference in luminescence output means that , despite the only modest
selectivity in binding affinities , quadruplex structures can be detected
in the presence of duplex dna .
indeed , this concept has been illustrated
by recently reported cell studies with these complexes .
fascinatingly , in cellulo studies reveal
that , while 1 is only taken up by fixed cells , 2 is actively transported
into live cells .
confocal microscopy studies confirm
that 2 is a selective luminescent stain for heterochromatin .
furthermore , 2 displays distinctive noncolocalized multiple
emission peaks , whose wavelengths are consistent with those obtained
through in vitro studies , indicating that the complex is an in cellulo
probe of dna structure . until now ,
these studies have used racemic mixtures of complexes 1 and 2 . however , recently the qu group have
shown that the -enantiomer of a nonemissive dinuclear
nickel(ii ) triple helicate complex displays a strong binding preference
for specific quadruplex structures over duplex dna , while sugiyama and co - workers have demonstrated that a chiral helicene
macrocycle can enantioselectively recognize quadruplex dna .
furthermore , recent spectroscopic , crystallographic , and nmr studies on mono-
and dinuclear ru(dppz ) ( dppz = dipyrido[3,2-a:2,3-c]phenazine ) systems with duplex
dna have also illustrated the importance of chirality in such interactions .
in light of these studies ,
we discuss the dna binding preferences
of enantiopure samples of 2 and also report nmr - based
studies designed to delineate the structural details of quadruplex
binding by 1 and 2 , followed by further
rationalization of the results based on molecular dynamics ( md ) simulations
in water .
in
previous studies ,
we have found that the luminescent binding response of rac-1 and rac-2 to duplex
and quadruplex dna is effectively identical . in both cases ,
binding
to duplex dna produces a 60-fold increase in emission , while binding
to quadruplex produces a > 150 times increase in blue - shifted emission .
furthermore comparisons of kb values for rac-1 and rac-2 revealed they are almost identical within experimental error . in the study reported herein , the interaction
of enantiomerically pure complexes -2 and
-2 with duplex and quadruplex dna was investigated
through luminescence titrations using calf thymus dna ( ct - dna ) ( supporting information figure s01 ) and the human
telomere sequence ( hts ) d[ag3(ttag3)3 ] ( figure 2 ) .
typical data for the luminescence response
of -2 , -2 , and
an unresolved diastereomeric
mixture of 2 to the progressive addition of the unimolecular
hts quadruplex d[ag3(ttag3)3 ] .
conditions :
10 mm kh2po4/k2hpo4 , 1
mm k2edta , 200 mm kcl , ph 7.0 , 298 k , [ complex ] = 7 m .
the cd spectrum of the hts
sequence in uncrowded k solutions confirmed that it adopts
an antiparallel basket conformation ( supporting
information figure s02 ) , which is consistent with previous
observations by reniuk et al .
nmr and cd spectra of hts in 100 mm nacl are similar to those reported
by wang and patel and indicate that the
structure remains an antiparallel basket .
characteristics for
the interaction of ct - dna with either enantiomer
in aqueous buffer solutions were found to be very similar .
both show
a very similar increase in steady - state luminescence , which is identical
within experimental error to the changes observed for an unresolved
diastereomeric mixture ( see supporting information ) .
indeed , fits of the data to standard binding models lead to estimates
of binding affinities that are almost identical to those previously
reported for the unresolved mixture ( kb = 4.40 10 m ) , although it
does appear that the binding affinity of -2 is slightly higher than that of -2 ( table 1 ) .
by contrast , titrations of enantiomerically
pure 2 with hts produced clear differences in the luminescent
response
of -2 and -2 .
addition of hts to -2 led to increases
in emission that were around 20% larger than those observed for an
unresolved diastereomeric mixture .
more fascinatingly , -2 displayed a much smaller emission response than either -2 or the unresolved solution mixture : at binding saturation ,
the steady - state emission intensity of -2 is 6-fold less than that of -2 ( figure 2 ) . because the binding - induced light - switch effect
observed for these complexes is due to transfer from a polar bulk
aqueous environment into a less polar binding environment , these data
indicate that bound -2 is much more solvent
accessible than -2 , thus implying structural
differences in the binding complexes with hts for the two diastereomers .
fits of the luminescence changes to a simple one set of identical
binding sites model offers further evidence to support this hypothesis ,
as the binding affinity of -2 is around
40 times higher than that of -2 ( table 1 ) .
the diastereomeric mixture contains 25% -2 , 25% -2 , and 50% -2 , yet its emission intensity is roughly 85% the intensity
of pure -2 .
this is almost exactly the
value expected if -2 has the same emission
intensity as -2 .
the results therefore
suggest that -2 binds in the same way as
-2 , i.e. , that for binding to hts ,
chirality is possible at one end of the ligand but not both .
as discussed before , addition of 2 ( as a racemic mixture
or as pure enantiomers ) gives rise to hypochromic and bathochromic
shifts in uv vis spectra , indicative of stacking of the aromatic
rings against dna base pairs .
a stacking mode of binding is also indicated
by the strongly enhanced luminescence and the blue - shift of approximately
30 nm , which we have shown only occurs when the ligand is strongly
shielded from solvent .
shielding to this
extent can only arise when the ligand is covered by quadruplex loops :
in other words , it implies stacking over a tetrad plane and shielding
by loops , rather than groove binding .
furthermore , the markedly greater
increase in luminescence for bound -2 implies
significantly better shielding from solvent for this isomer .
further
evidence for this hypothesis was obtained by nmr studies to provide structural insights
into the effects observed in our optical studies , the binding of 1 and 2 to hts was further investigated using
a combination of nmr spectroscopy and simulated annealing coupled
with restrained molecular dynamics simulations for structure determination .
assignments of the folded quadruplex before addition of any complex
are given in the supporting information ( table
s1 ) .
on addition of -2 to
hts , severe line broadening of dna signals was observed by nmr , mainly
from the lateral loop end ( red dots , bottom end of figure 3 ) .
this implies that the ligand is binding at this
end and causing structural perturbations concomitant with binding ,
which occur on a time scale in the millisecond range .
unfortunately ,
this is a common observation in studies of dna / ligand interactions
and it makes structure determination of the complexes difficult by
severely reducing the information content of spectra . by contrast ,
addition of the more tightly binding -2 produced less severe relaxation - induced broadening although enough
to abolish intermolecular noes .
chemical shift changes occurred at
both ends of the quadruplex , and intramolecular noes were broadened
and lost at both ends .
it therefore appears that whereas -2 binds mainly at the lateral loop end , -2 binds at both ends . taken together with the luminescence
data ,
the implication is that binding of -2 at the diagonal loop end ( top end of figure 3 ) is accompanied by a high degree of shielding of the ligand from
solvent .
this in turn implies that the ligand is stacked onto the
tetrad underneath the diagonal loop . the antiparallel basket formed by hts .
the colors show the residues
still present ( green ) , missing ( red ) , and possible exchange doublet
( yellow ) , upon addition of -2 .
all attempts to alter the solution conditions so
as to bring back
intermolecular noes were unsuccessful .
the absorption and emission response of this
complex to hts binding is very similar to that of 2 :
in particular , the enhancement and blue - shifting of its luminescence
are very similar , indicating analogous modes of binding .
these studies were carried out on a diastereomeric
mixture as this had the advantage that both putative binding sites
could be potentially investigated in a single experiment .
addition
of 1 to hts gave rise to chemical shift changes
at both ends of the quadruplex .
there was broadening of signals throughout ,
which led to a general reduction in the intensities of intramolecular
noes , although the largest effects were seen at the lateral loop end
( table 2 ) .
however , gratifyingly , a large number
of new intermolecular noes could be seen to the ligand ( figure 4 ) . selected sections of
spectra showing the new crosspeaks identified
upon addition of a diastereomeric mixture of 1 to the
hts sequence . in free solution ,
nmr
resonances from the four symmetry - related
positions of 1 have identical chemical shifts . however ,
in the presence of hts , most signals were split into four , in some
cases with fairly large chemical shift changes .
the increased complexity
made it impossible to assign the ligand signals in the complex to
individual positions and meant that , although we were able to observe
20 intermolecular noes in the complex , we were only able to assign
the nucleotide signals ( table 2 ) .
analysis
of the noes reveals that they are not compatible with
a single structure for the complex , because 13 derive from contacts
at the diagonal loop end and seven from contacts at the lateral loop
end . on the basis of the discussion above ,
, we expect -1 to bind mainly at the lateral loop end and -1 ( and probably also -1 ) mainly
at the diagonal loop end .
as anticipated , the noes at the diagonal loop end are
consistent with 1 binding under the diagonal loop .
the experimentally
observed noes from the lateral loop end were used to calculate structures
for both -1 and -1 bound at the lateral loop end using restrained simulated annealing .
the structure generated for -1 is shown
in figure 5 and has no violations of the noe
constraints greater than 0.5 .
molecular dynamics - based structure of
-1 bound to the lateral loop end of hts ,
generated using experimentally
observed noes for the interaction . while the tpphz ligand stacks on top of the tetrad bases ,
this
interaction is reinforced by electrostatics :
the positively charged
ruthenium centers are located at the edge of the tetrad close to the
anionic phosphate backbone .
there is little perturbation to the quadruplex
structure , with slight movement of the lateral loops to accommodate
the ligand .
bases in the loops partially shield the tpphz rings , as
expected from the luminescence .
there is little direct contact between
the bipy ligands and the quadruplex , and therefore both the
and complexes bind in a similar way , with similar energies .
the observed noes were also used to calculate a structure for the
complex bound at the diagonal loop end .
the
bipy rings fit neatly against the phosphate backbone making close
van der waals contact .
the diagonal loop holds the tpphz in place
and shields it from solvent , as expected from the luminescence data .
molecular
dynamics - based structure of -1 bound to
the diagonal loop end of hts , generated using experimentally
observed noes for the interaction . left : illustrating the bipy ring
at front left parallel to the dna backbone .
right : showing how the
5 end of the dna backbone ( front center ) moves to avoid the
ligand .
molecular dynamics - based structure of -1 bound to the diagonal loop end of hts , generated using experimentally
observed noes for the interaction .
by contrast , attempts to use the same noes to calculate a
structure
with -1 bound at the same site result in
a very high - energy state ( roughly 10 times higher ) . in this structure ,
one end of the ligand is able to fit straightforwardly , by displacing
the terminal nucleotide of the quadruplex dna chain ( figure 7 ) .
however , in this calculation , the other end of
the ligand does not displace the dna backbone .
instead , the calculation
generates a number of physically impossible solutions , of which the
lowest energy is shown in figure 7 : the phosphate
backbone passes through the middle of one of the aromatic bipy rings .
the other solution is to displace one bipy ligand completely away
from the tpphz plane .
structures have been calculated for the
and isomers of 2 in the same way and show
similar features ( supporting information figures
s04 and s05 ) .
these calculations imply that the experimental
noe data are compatible with the isomer binding at
the diagonal loop end but not with the isomer binding
at the same site .
this result is thus in agreement with the conclusion
reached above , that both isomers bind at the lateral loop end , but
only the isomer ( and probably the isomer
also ) binds at the diagonal loop end . to investigate this issue further ,
unconstrained molecular dynamics simulations were carried out in a
tip3p water model . to
evaluate the impact
of -1 and -1 complexes on the quadruplex structure when binding under the diagonal
loop , molecular dynamics simulations were performed on free hts and
its association with -1 and -1 . for free hts ,
three independent simulations were undertaken
using the structures presented in figures 57 ( henceforth denoted a , b , and c ) as starting conformations .
these results were then compared with simulations of the associations
formed between the quadruplex and both diastereomers -1 and -1 , labeled -1-hts and -1-hts , respectively . for the -1-hts simulation , the nmr - based structure
shown in figure 6 was used as starting point ,
while for simulation of -1-hts , the starting structure was generated from -1-hts by replacing
-1 with -1 ,
superimposing the two ruthenium atoms and the tpphz bridging ligand .
thus , only the spatial arrangement of the two ru(bipy)2 moieties was changed , in agreement with the respective diastereomers
in the octahedral metal coordination sphere .
further molecular dynamics
simulation details , together with an extended discussion , are provided
in supporting information .
simulations a , b , and c of the free hts show
that the g - tetrads yield low root mean - square deviations ( rmsd ) , calculated
relative to the starting structures , consistent with a minor conformational
rearrangement experienced by these subunits throughout the 50 ns of
simulation time , which is to be expected because they are held in
place by hydrogen bonds .
in contrast , the diagonal loops are more
mobile ( see supporting information figure s06 ) showing higher rmsd values .
overall , the three independent simulations
sampled significant hts conformational space as suggested by the representative
conformations of simulations a , b , and c , which have slightly different structures with cross rmsd
values collected in supporting information table
s03 between 2.71 and 3.88 .
we then went on to look at
the interaction of hts with the metal complex using the same method .
figure 8 shows the rmsd values over the
simulation time ( using the unrelaxed starting structures as reference )
for both the -1-hts and -1-hts associations .
in both cases ,
after an initial jump due to the geometry relaxation
using the ideal force field parameters , the values tend to stabilize .
focusing on the rmsd values for -1-hts , the g - tetrad and the hts structure typically
stabilize after the first five ns while the values for the diagonal
loop oscillate .
this loop mobility is assigned to the presence of
-1 , as it was not observed in simulations a , b , and c of free hts .
apart from
this increased loop mobility , the antiparallel basket is as stable
as free hts was in simulations a , b , and c , so unsurprisingly the rmsds between the representative
conformations of -1-hts and simulations a , b , and c are within the variability found for the calculated cross
rmsds obtained in these three simulations ( see supporting information table s03 ) .
variation of the rmsd
values throughout the course of the md simulations
for -1-hts ( left )
and -1-hts ( right ) .
the vertical black line marks the separation between the equilibration
and collection simulation stages .
by contrast , for -1-hts , all the rmsd values converge very quickly , including
those associated with the diagonal loop .
this indicates that complex
-1 is able to fit under the loop without
causing major g - dna conformational changes .
indeed , the representative
conformation is comparable to the representative conformation of the -1-hts simulation
( with a rmsd value of only 1.55 ) and the representative frames
of the free hts simulationsm a , b , and c , with cross rmsd values ranging from 1.54 to 2.81 .
this indicates that the observed experimental recognition of only
-1 under the diagonal loop is not caused
by the intrinsic loop cavity shape or size because both isomers are
able to fit into the cavity . analyzing the representative conformations
of -1-hts and -1-hts represented
in figure 9 , both ruthenium complexes bind
under the diagonal loop with
the tpphz ligand stacking over the top g - tetrad .
complex -1 adopts a diagonal
arrangement over the guanine bases and under the loop whereas in -1 , the stacking of the tpphz ligand is more localized over
two guanines of only one - half of the g - tetrad .
representative snapshots
of simulations -1-hts ( top , magenta ) and -1-hts ( bottom , aquamarine ) . side and top
views are presented on the left and center , respectively .
to clarify this point , a surface representation
was constructed
for the position occupied by the tpphz ligand ( excluding the hydrogen
atoms ) over a 50 ns collection period for the hts association with
each of the diastereomers ( figure 10 ) .
these
surfaces clearly show a striking difference : in -1-hts , the tpphz ligand is able to float
over the g - tetrad interacting with the four guanines .
in contrast ,
in -1-hts , the
tpphz ligand remains locked over two guanines of the
g - tetrad throughout the entire simulation time .
because tpphz is present
in both dinuclear complexes , the difference in dynamic behavior must
be caused by the stereochemistry of the bipy ligands in the octahedral
ru(ii ) coordination spheres .
this is consistent with the observation
that in -1-hts the diagonal loop appears to be more flexible , oscillating over
the middle of both ru(bipy)2 moieties . on the other hand ,
in -1-hts ,
the
loop is more rigid and locks the -1 complex
movement over the g - tetrad .
surface ( isovalue = 1 ) representing the histogram
of positions
occupied by the tpphz atoms ( excluding hydrogen ) over the 50 ns collection
period in -1-hts ( left ) and -1-hts ( right ) .
the above results suggest
that , although both -1 and -1 complexes can fit under
the loop , sufficient hts loop conformational freedom to permit the
complex entrance into the prefolded g - dna structure is only present
for -1 .
in contrast , the stereochemistry
of -1 appears to induce increased rigidity
on the loop , preventing complex entrance into the loop arch . in other
words ,
-1 does not bind under the diagonal
loop because the loop arch does not fulfill the complex s stereochemical requirements . as mentioned
above , the simulated annealing structure proposed
for the binding of -1 to the diagonal loop
end of hts corresponds to an impossible solution ( figure 7 ) , which could also be rationalized by our unconstrained
md simulations in water .
if one calculates the expected noes ( not
shown ) from the representative conformations of simulations -1-hts and -1-hts ( or from the relaxed structures
obtained by molecular mechanics minimization ) , the protons that contact
the ligand are quite different , meaning that the interaction of -1 and -1 under the loop results
in clearly distinct noes .
-1-hts interaction ) are not suitable as restraints to generate
a hypothetical -1-hts association with this binding mode .
we have shown that -2 binds mainly at
the diagonal loop end of hts , stabilized by a good steric fit under
the loop . by contrast ,
both isomers also
bind to b - dna , but the affinity of -2 is
greater for hts than for b - dna and , importantly , when bound to hts
the luminescence is more intense and is blue - shifted from 675
to 630 nm . studies with other ligands that bind to quadruplex
dna have shown that compounds that bind strongly to one conformation
also stabilize that conformation , as expected from thermodynamic arguments .
we have previously
shown that 2 is actively taken up
by cells , and confocal images show that it generates punctate images
centered mainly in the heterochromatin , as might be expected for a
probe that highlights g - quadruplexes .
it also has a wavelength and
intensity of emission that is different for different quadruplex structures .
-2 is therefore a
useful tool for specifically stabilizing and imaging
antiparallel basket structures with a diagonal loop .
this study also
confirms that the antiparallel structure of hts can be selectively
targeted . in comparison with the use of antibodies to detect quadruplexes , small molecules like complex 2 and its analogues
are
much simpler to rationally design and potentially have wider applicability
as they can be used directly on living cells . furthermore , and as
this study indicates , because such systems can be made to target specific
features of a quadruplex , they can be made specific to individual
quadruplex structures .
consequently , with the structural information
obtained by this study , we are exploring this potential for enhanced
specificity through informed design of derivatives of 2 .
although this work is intended to image antiparallel basket quadruplexes
in living cells , it could subsequently be extended into molecular
tools for selectively stabilizing quadruplexes .
the racemic mixtures
of the tpphz complexes were prepared by methods we have previously
described .
the hts oligonucleotide d[ag3(ttag3)3 ] was purchased from eurogentec
biotechnology ( southampton ,
uk ) , purified by hplc , and used without further annealing .
samples
for uv vis and luminescence titrations were in 10 mm kh2po4/k2hpo4 and 1 mm k2edta in 50200 mm kcl ( ph 7.0 , 298 k ) , in which dna
was added to 10 m ligand , while samples for nmr were prepared
in 50 mm nacl , ph 7 , using 300 mm dna at 298 k. titrations were conducted
with dna and ligand of the same order of concentration as 1/kb , shown to be the optimum values for obtaining
accurate binding constants .
the optimum
temperature for observing noes to 1 was 283 k. cd spectra
were recorded on a jasco j-810 spectrophotometer using a peltier variable
temperature controller : 100 nm / min from 200 to 320 nm .
luminescence
measurements were carried out on a hitachi f-4500 fluorescence spectrophotometer
using a 1 cm path length .
binding affinities were obtained by fitting using
origin 7.0 software to a standard one - set - of - binding - sites model .
nmr experiments were carried out on bruker avance 800 , 600 , and
500 spectrometers .
assignments were made using cosy , tocsy , and noesy
spectra ( mixing times 60 or 90 ms for tocsy , 100 ms for noesy ) , supported
by h
spectra were analyzed using felix ( felix
nmr , inc . , san diego , ca ) .
calculations used simulated annealing over 8000 steps
from 2000 to 100 k , using standard square - well potentials for noes .
all calculations imposed planarity and hydrogen bonding in the tetrads
plus planarity in tpphz and bipy polypyridyl ligands and octahedral
geometry around the ruthenium .
threading of the ligand into the complex
was accomplished by starting with almost zero van der waals radii
and increasing the radius in a geometric progression during the simulated
annealing . for each complex ,
only the intermolecular noes relevant
to that end were included , all specified as ambiguous noes to any
ligand proton , with an upper limit of 5 .
convergence was improved
by including restraints to position the tpphz ring close to the relevant
tetrad plane .
noes for the -1-hts and -1-hts complexes were calculated by numerical integration of
the solomon equations .
unconstrained
md simulations were carried out using the amber ff99bsc0
set of parameters and charges for dna combined with general amber force field ( gaff ) parameters with extra terms and resp charges for both -1 and -1 complexes .
these simulations were undertaken with the pmemd.cuda
amber executable , able to accelerate explicit solvent particle mesh
ewald ( pme ) calculations through the use
of gpus with the new single precision fixed point ( spfp ) model .
Output:
| we report dna binding studies of
the dinuclear ruthenium ligand
[ { ru(phen)2}2tpphz]4 + in enantiomerically
pure forms . as expected from previous studies of related complexes ,
both isomers bind with similar affinity to b - dna and have enhanced
luminescence .
however , when tested against the g - quadruplex from human
telomeres ( which we show to form an antiparallel basket structure
with a diagonal loop across one end ) , the isomer binds
approximately 40 times more tightly than the , with
a stronger luminescence .
nmr studies show that the complex binds at
both ends of the quadruplex . modeling studies , based on experimentally
derived restraints obtained for the closely related [ { ru(bipy)2}2tpphz]4 + ,
show that the
isomer fits neatly under the diagonal loop , whereas the
isomer is unable to bind here and binds at the lateral loop end .
molecular
dynamics simulations show that the isomer is prevented
from binding under the diagonal loop by the rigidity of the loop .
we thus present a novel enantioselective binding substrate for antiparallel
basket g - quadruplexes , with features that make it a useful tool for
quadruplex studies . |
PubmedSumm119668 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: microglia are a type of neuroglia that support , nurture , and
protect neurons which maintain homeostasis of the fluid that bathes neurons .
it is an innate immune component of the central
nervous system ( cns ) parenchyma . under physiological conditions , residential
microglia are quiescent and scattered throughout the cns .
occasionally ,
microglia are moderately activated to play the classic role as scavengers for
maintaining and restoring the cns .
activated microglia release proinflammatory cytokines such as interleukin-1 ( il-1 ) and tumor necrosis factor- ( tnf- ) to induce inflammatory
responses .
furthermore , they also release neurotoxins like reactive
oxygen species ( ros ) and nitric oxide ( no ) , which amplify the
inflammatory responses and cause neuronal damage in the cns .
sustained overactivation of
microglia is found in many neurodegenerative diseases such as multiple
sclerosis , alzheimer 's disease , parkinson 's disease , hiv - associated dementia ,
and ischemia / reperfusion brain injury [ 5 , 6 ] .
endotoxins are high - molecular - weight
complexes of lipopolysaccharide ( lps ) that are major components of the outer
membranes of the cell walls of gram - negative bacteria .
the most severe
septic microvascular inflammatory responses , however , are caused by
gram - negative bacteriemia , and these responses can be produced by an injection
of lps .
endothelial injury , activation of the coagulation cascade , platelet
aggregation , and thrombocytopenia have all been shown to contribute to vascular
fibrin deposition in lps - induced septic shock
[ 79 ] .
lps is known to induce no and tnf- production in
microglia through various extracellular signal - regulated kinase ( erk ) , p38
mitogen - activated protein kinase ( p38 mapk ) , and c - jun n - terminal kinase ( jnk )
pathways [ 10 , 11 ] .
ketamine , an anesthetic induction
agent , is generally reserved for use in patients with severe hypotension or
respiratory depression . as we described previously , ketamine ( 200 and 350 m )
significantly inhibited platelet activation stimulated by collagen . on the
other hand ,
ketamine has been reported to exert anti - inflammatory effects on
macrophages and leucocytes in in vitro
and in vivo studies
[ 1416 ] .
also reported that ketamine
( 300 ~ 1000 m )
significantly inhibited some of the inflammatory responses in microglial cells
stimulated by lps .
however ,
the detailed mechanisms underlying the anti - inflammatory effects of ketamine in
microglia stimulated by lps still
have not been completely resolved yet .
we therefore further examined the effect of ketamine in lps - induced
microglial activation in primary cultures from rats and utilized the
findings to further characterize the anti - inflammatory effects of ketamine .
ketamine , lps ( escherichia
coli , serotype 0127 : b8 ) , and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl - tetrazolium
bromide ( mtt ) were purchased from sigma ( st . louis , mo , usa ) ; rpmi-1640 medium ,
fetal bovine serum ( fbs ) , trypsin ( 0.25% ) , l - glutamine , and penicillin / streptomycin
were from gibcobrl ( gaithersburg , md , usa ) ; deoxyribonuclease
type i ( dnase i ) was from roche ( indianapolis , ind , usa ) ; anti - erk1/2 , anti - phospho - erk1/2
( thr / tyr ) , anti - jnk1/2 , anti - p38 mapk , and anti - phospho - jnk1/2 ( thr / tyr )
monoclonal antibodies ( mabs ) were from cell signaling ( beverly , mass ,
usa ) ; the anti - phospho - p38 mapk ( ser )
mab was from santa cruz ( santa cruz , calif , usa ) ; the horseradish
peroxidase - conjugated secondary antibody was from amersham ( buckinghamshire , uk ) ; and the il-1 and tnf- enzyme immunoassay ( eia ) kits were from
r&d systems ( minneapolis , minn , usa ) .
wistar rats ( 7
days old ; from the experimental animal center , college of medic ine , national taiwan
university ) were used in this study .
all animal experiments and care were
performed according to the guide for the
care and use of laboratory animals ( national academy press , washington , dc ,
1996 ) .
wistar rats were
deeply anesthetized with ether and transcardially perfused with normal saline
until the lungs and liver were clear of blood .
after perfusion , the brain was
removed and kept in rpmi-1640 medium . after dissecting the meninges ,
the brain
tissue was minced in ice - cold rpmi-1640 and treated with trypsin ( 0.25% ) and
deoxyribonuclease ( 10 mg ml ) in rpmi-1640 for 2 hours at 37c .
treated
tissues were further minced in 10% fbs and centrifuged at 1000 rpm for 10 minutes .
the tissue pellet was resuspended in rpmi-1640 and then seeded in 75 cm flasks
at 37c ( 95% o2 and 5% co2 ) .
microglia were harvested from flasks of
mixed glial cultures after shaking for 2 hours .
cells were collected by
centrifugation and then seeded at 5 10 cells ml .
after incubation for 1 hour at 37c , nonadherent or weakly adherent cells were
removed by gentle shaking and washed out .
approximately 2 10 cells were obtained per brain used . to determine the purity of the
microglia ,
these primary cultured cells were > 95% ox-42-positive indicating that they were
composed of microglia .
microglial viability after 24 hours
of continuous exposure to different concentrations of lps ( 1 ~ 200 ng ml ) and ketamine ( 100 ~ 500 m ) was measured with a colorimetric assay
based on the ability of mitochondria in viable cells to reduce the mtt as previously
described .
the percentage of cell viability was calculated as the
absorbance of treated cells / control cells 100% . to determine no production from
microglia , nitrite ( a stable oxidative end product of no ) accumulation in the
media of microglia
briefly , 100 l of supernatant was incubated with an equal
volume of griess reagent ( 1% sulfanilamide and 0.1% naphthyl - ethylenediamine
dihydrocholoride in 2.5% phosphoric acid ) . after a 30-minute incubation at room
temperature ,
nitrite concentrations were calculated by regression with standard
solutions of sodium nitrite prepared in the same culture medium
. for determination of il-1 and tnf- production from microglia
, microglia
( 5 10 cells ml ) were plated onto 24-well culture plates for 24 hours .
cells were
pretreated with various
concentrations of ketamine ( 100 ~ 500 m ) or an isovolumetric pbs buffer for 30 minutes and then
treated with lps ( 100 ng ml ) for the indicated times ( 1 ~ 24 hours ) .
after incubation with lps ,
supernatants were collected and immediately frozen at 70c .
the il-1 and tnf- levels of the supernatants were measured using elisa kits according to the
manufacturer 's protocol . for determination of the
expression of mapks in microglia ,
microglia ( 5 10 cells ml ) were cultured on 24-well plates and treated
with ketamine
( 100 and 250 m ) or an isovolumetric
pbs buffer for 30 minutes followed by the addition of lps ( 100 ng ml ) . at indicated times , cells were washed with
ice - cold pbs buffer ( ph 7.3 ) .
in addition , phosphatase inhibitors ( 10 mm sodium fluoride , 1 mm sodium orthovanadate , and 10 mm sodium pyrophosphate ) were added to the lysis
buffer for the phosphorylated mapk analysis .
lysates were centrifuged , and the
supernatant ( 50 g protein ) was subjected to sds - page and electrophoretically
transferred onto pvdf membranes ( 0.45 mm ;
hybond - p ; amersham ) .
after incubation in blocking buffer
( 50 mm tris - hcl , 100 mm nacl , 0.1% tween 20 , and 5% dry skim milk ; ph 7.5 ) overnight
at 48 hours and being washed three times with
pbs buffer , blots were treated with either anti - phospho - erk1/2 ( p42/44 ) ,
anti - erk1/2 , anti - phospho - jnk1/2 ( p46/54 ) , anti - jnk1/2 , anti - p38 mapk , or anti - phospho - p38 mapk mabs ( 1:2000 ) in a pbs
buffer for 3 hours .
they were subsequently washed three times with pbs buffer
and incubated with a peroxidase - conjugated goat anti - mouse or anti - rabbit antibody
( 1:3000 ) for 2 hours .
blots were then washed three times , and the band with
peroxidase activity was detected using film exposure with enhanced
chemiluminescence detection reagents ( ecl system ; amersham ) .
densitometric analysis
of specific bands was performed using a photo - print digital imaging system
( ip-008-sd ) with analytic software ( bio-1dlight , vers .
the experimental results are expressed as the means s.e.m . and are accompanied by the number of observations .
if a significant difference among the
group means was noted , the difference between two groups would be assessed using
the newman - keuls method . a p value of < .05 was considered statistically significant .
according to a preliminary
test , activation of microglia by lps ( 100 ng ml ) induced a significant
and marked increase in nitrite formation . therefore ,
an lps concentration of 100 ng ml was employed in the following experiments . in
this study ,
the concentration of nitrite produced in the cell supernatant
time - dependently increased from 0.5 0.0 ( resting ) to 6.7 0.3 m at 24 hours after lps treatment ( figure 1 ) .
ketamine ( 100 and 250 m ) concentration - dependently inhibited lps-(100 ng ml ) stimulated nitrite production by
approximately 40% and 60% , respectively , ( figure 1 ) .
ketamine neither interfered
with the griess reaction nor reacted with native no ( data not shown ) .
these
results demonstrate that ketamine markedly suppressed no production stimulated
by lps in microglia .
furthermore , neither ketamine ( 100 ~ 500 m ) ( figure 2 ) nor lps ( 100 ng ml ) ( data not shown ) significantly affected
the cell viability of microglia for 24 hours according to the mtt assay .
lps ( 100 ng ml ) induced a
time - dependent increase in il-1 formation in microglia ,
and it reached a maximal level at 12 hours rising from 135.9 6.5 ( resting ) to 575.9 10.6 pg ml ( figure 3 ) . on
the other hand , after pretreatment of cells with various
concentrations of ketamine for
30 minutes followed by the addition of lps ( 100 ng ml ) for 12 hours , we found
that ketamine ( 100 and 250 m ) concentration - dependently inhibited il-1 production by approximately
13% and 36% , respectively , ( figure 3 ) . on the other hand , activation
of microglia by lps ( 100 ng ml ) induced a significant increase in tnf- formation .
the peak activation of tnf- formation occurred 3 hours after lps ( 100 ng ml ) stimulation ( resting , 1042.2 8.8 pg ml ; 3
hours , 1992.8 38.2 pg ml , n = 3 ) ( figure 4 ) .
after pretreating cells with
various concentrations of ketamine for 30 minutes followed by the addition of
lps ( 100 ng ml )
for 3 hours , only ketamine at the higher concentration ( 500 m ) significantly
inhibited tnf- production by approximately
11% ( figure 4 ) . to further investigate the inhibitory
mechanisms of ketamine in lps - induced microglial activation , three major mapk
signaling molecules were detected : erk1/2 , jnk1/2 , and p38 mapk .
the
immunoblot analysis revealed that treatment with lps ( 100 ng ml ) induced
rapid and marked time - dependent phosphorylation of erk1/2 ( p42/p44 ) , jnk1/2 ( p46/p54 ) ,
and p38 mapk , which reached maximal levels at approximately 45 minutes and then
returned to the basal level ( data not shown ) . after being pretreated with ketamine
( 100 and 250
m ) for 30 minutes ,
phosphorylated erk1/2 stimulated by lps ( 100 ng ml ) was
markedly inhibited by ketamine in a concentration - dependent
manner ( figure 5 ) . however , neither jnk1/2 ( figure 6 ) nor p38 mapk ( figure 7 )
phosphorylation stimulated by lps was significantly inhibited by ketamine
( 100 and 250 m ) .
in this study , we demonstrate an anti - inflammatory effect of ketamine
in primary cultured microglia . ketamine exhibited more potent activity at
inhibiting both no and il-1 formation
than tnf- in
lps - stimulated microglia .
this
discrepancy , however , needs to be further investigated . the high concentration
( 500 m ) of ketamine caused no
significant changes in the number of viable cells estimated by the mtt
reduction assay ( figure 2 ) .
this finding excluded the possibility that the
release of the inflammatory mediators was inhibited by the cytotoxic actions of
ketamine .
it is known
that microglia play a key role in mediating inflammatory processes in the cns ,
which are associated with various neurodegenerative diseases .
lps , a glycolipid
derived from the membrane surface of gram - negative bacteria ( i.e. , an endotoxin ) ,
can trigger a series of inflammatory reactions in phagocytes such as microglia .
with lps stimulation , microglia are activated to drastically change their
cellular functions , producing various types of inflammatory mediators such as no ,
tnf- , and il-1. no and tnf- are two major inflammatory
mediators .
no is beneficial as a messenger or modulator , but in conditions such
as oxidative stress , it is potentially toxic .
no generation by
activated microglia has been shown to cause excitotoxicity through inducing
glutamate release and inhibiting neuronal respiration .
tnf- and il-1 released from activated
microglia also stimulate no production in glial cells and may have a direct
effect on neurons through activating receptors that contain the death domains involved
in apoptosis . in general , total plasma levels of ketamine
are reported to be
in the range of 33 ~ 94 m
immediately after 2.0 ~ 2.2 mg kg i.v .
therefore , we considered 100 m to be
a higher clinically relevant concentration achievable during induction of
ketamine anesthesia , assuming that protein binding is comparable in
serum - supplemented media and plasma .
our studies suggest that ketamine may
modulate some of the inflammatory responses ( i.e. , no and il-1 ) of
microglia stimulated by lps in vitro at
the high range of clinically achievable concentrations .
an adequate
inflammatory reaction results from the equilibrium between proinflammatory and
anti - inflammatory influences .
the survival rate in intensive care unit of patients with septic shock was
improved when they received ketamine as a sedative .
mapks play important roles
in mediating cytokine ( i.e. , tnf- and il-1 ) release with lps - stimulated
microglial activation [ 10 , 11 , 24 ] .
we thus further investigated the roles of mapks involved in ketamine - mediated
suppression of inflammatory responses in lps - stimulated microglia .
mapks are a family of serine - threonine kinases activated by many stimuli
including growth factors and hormones in proliferative cells
.
mapks are able to regulate
a number of transcription factors , cytoplasmic proteins , and downstream
kinases .
p38 mapk and jnk1/2 or stress - activated protein
kinases , which include the 46-kda jnk1 and 54-kda jnk2 isoforms , are involved
in death signaling processes . in the present study
, we found that ketamine
inhibited erk1/2 but not jnk1/2 or p38 mapk phosphorylation in lps - stimulated microglia .
have
reported that ketamine could abolish hyperglycemia - activated erk1/2
phosphorylation through inhibition of the n - methyl d - aspartate - mediated calcium
influx , which subsequently reduces
the hyperglycemia - exaggerated damage . in conclusion , although
ketamine has been shown to exert anti - inflammatory effects on a variety of
immune cells , the exact mechanisms responsible for these actions are not well
understood .
our results suggest that ketamine 's anti - inflammatory activity may
be mediated , at least in part , by inhibition of erk1/2 phosphorylation in
primary cultured microglia
. however , more detailed anti - inflammatory mechanisms
of ketamine in microglia need to be further investigated and classified .
Output:
| microglia activated in response to brain injury release neurotoxic factors including nitric oxide ( no ) and proinflammatory cytokines such as tumor necrosis factor-
( tnf- ) and interleukin-1 ( il-1 ) .
ketamine , an anesthetic induction agent , is generally reserved for use in patients with severe hypotension or respiratory depression . in this study
, we found that ketamine ( 100 and 250 m ) concentration - dependently inhibited lipopolysaccharide ( lps)-induced no and il-1 release in primary cultured microglia .
however , ketamine ( 100 and 250 m ) did not significantly inhibit the lps - induced tnf- production in microglia , except at the higher concentration ( 500 m ) .
further study of the molecular mechanisms revealed that ketamine markedly inhibited extracellular signal - regulated kinase ( erk1/2 ) phosphorylation but not c - jun n - terminal kinase or p38 mitogen - activated protein kinase stimulated by lps in microglia .
these results suggest that microglial inactivation by ketamine is at least partially due to inhibition of erk1/2 phosphorylation . |
PubmedSumm119669 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: cancer is a multifactorial disease and is one of the leading causes of death worldwide .
the contributing factors include specific genetic background , long - term exposure to various environmental stresses , and bias diet habit .
all these risk factors finally reflect on the accumulation of molecular changes in cells , which contributes to the initiation of carcinogenesis .
since some important mutated proteins , such as epithelial growth factor receptor ( egfr ) , p53 , and c - myc , have been recognized as important contributors for carcinogenesis , they have been increasingly taken as major targets for drug development in order to eliminate mutated cancer cells [ 13 ] .
although this common strategy can usually achieve significant effect initially , drug resistance usually comes along with relapsing disease sooner or later .
this implies some missing links between the actual underlying carcinogenic mechanisms and current drug development strategies .
recently , tumor microenvironment has been gradually recognized as a key contributor for cancer progression and drug resistance ( figure 1 ) .
this concept implies that cancer is no longer an isolated cellular population ; instead , it is the consequence of collaboration of different types of malcontrolled cells .
in fact , as early as 1880s , steven paget proposed the seed and soil hypothesis , suggesting that a fertile soil ( the microenvironment ) is essential for the seed ( the tumor cells ) to grow [ 57 ] . in this review ,
as the microenvironment is quite complicated , we would like to focus on the role of dysregulated immune responses and interactions between various components in the microenvironment in tumor progression , invasiveness , and even development of drug resistance .
in addition , this review also discusses the current preclinical testing models and highlights their unsatisfying design , suggesting the need for some new strategies in future anticancer drug development .
a large number of clinical survey have showed that chronic inflammation is an important risk factor for tumor formation [ 8 , 9 ] . these findings that directly support immune mechanisms
indeed , chronic overexpression of inflammatory mediators is a major characteristic of tumor microenvironment and may contribute to carcinogenesis , tumor progression , and metastasis [ 4 , 913 ] .
two types of pathways , intrinsic pathways and extrinsic pathways , lead to the formation of inflammatory microenvironment [ 4 , 10 , 14 ] .
intrinsically , genetic alterations within the neoplastic cells increase their production of inflammatory mediators [ 4 , 10 , 14 ] .
extrinsically , tumor - infiltrating cells , mainly immune cells like t cells , natural killer ( nk ) cells , macrophages , and dendritic cells , produce inflammatory mediators to form a microenvironment promoting cancer development and progression [ 4 , 10 , 11 , 14 ] .
although both anticancer innate and adaptive immune responses are primitively designed for recognizing abnormal cells and further cleaning up , they usually turn into anergy state at the site of chronic inflammation .
the anergy state mainly results from two major causes the gathering of immune regulatory / suppressor cells and accumulation of high concentration of immune inhibitory cytokines or associated ingredients . finding the existence of immune suppressor / regulatory cells is undoubtedly a great breakthrough in autoimmune and cancer research field .
the most well - known immunosuppressor of lymphoid origin is regulatory / suppressor t cells ( tregs ) , which coexpress surface markers such as cd4 and interleukin-2 receptor chain ( il-2r , also known as cd25 ) , as well as a particular intracellular protein called forkhead box p3 ( foxp3 ) .
tregs are usually found around tumor mass in clinical specimens and may suppress the antitumor immune responses . albeit the control mechanism is still unclear ,
the expression of self - peptide recognized t - cell receptor ( tcr ) and cytotoxic t lymphocyte - associated antigen-4 ( ctla-4 , a costimulatory receptor ) may play important roles .
tregs can also secrete immune inhibitory cytokines , such as il-10 and tgf- , which can transform dendritic cells to a suppressive type and downregulate the activity of effector t cells , nk cells , and nkt cells .
although m2 macrophage derives from monocytes and carries cd68 marker as m1 macrophage does , it can be discriminated from the m1 type by its cytokine profile and particular cell surface markers .
m1 macrophage expresses ccr7 , while m2 macrophage expresses cd163 in dominant m2c subtype or cd206 in m2a subtype [ 19 , 20 ] . in general
, m1 macrophage can produce a series of proinflammatory cytokines such as il-6 , il-12 , and tnf- , while m2 macrophage tends to produce immune inhibitory cytokine such as il-10 and tgf- [ 10 , 21 ] .
the other group of myeloid - origin suppressor cells is a diverse population named myeloid - derived suppressor cells ( mdscs ) , which includes granulocytes , monocytes / macrophages , and dendritic cells , depending on the types and stages of the tumor that these immune cells infiltrated [ 9 , 18 ] .
mdscs present as an incompletely mature phenotype and thus may carry cd11b or cd33 markers as precursors of myeloid lineage cells do ; they lack cd14 or hla markers which are mainly expressed in mature myeloid lineage cells
. these cells can interfere with both innate and adaptive anticancer immunity , mainly through secreting il-10 and downregulating il-12 to promote th2 dominant immune environment [ 9 , 22 , 23 ] .
in addition , mdscs can enhance m2 macrophage formation by cell - cell contact interaction [ 23 , 24 ] . moreover , mdscs suppress the function of t lymphocytes , not only through expressing arginase-1 to degrade l - arginine , which decreases the expression of cd3zeta chain and cell cycle regulator in t lymphocytes , but also through producing no , which inhibits expression of jak3 , stat5 , and mhc class ii and induces t - cell apoptosis [ 2530 ] . based on the knowledge that the recruitment and differentiation of immune suppressor cells should be tightly regulated by cytokine or corresponsive mediators , the source of these regulatory signals ought to be questioned .
the immunosuppressive nature of tumor microenvironment may be primarily attributed to the ineffective priming of the immune system against tumor - associated antigen by immunogenic signal from the tumor itself , whereas all kinds of immune cells infiltrating the tumor may participate in the process .
in addition to the cancer cells and immune cells , the surrounding stromal cells can also produce regulatory cytokines and mediators to participate in immune regulation [ 18 , 3133 ] . in recent years , many evidences show that the crosstalk between tumor cells and the tumor - infiltrating cells also contributes to these processes .
for example , monocyte chemoattractant proteins , such as chemokine ( c - c motif ) ligand 2 ( ccl2 ) , secreted by many tumors mediate immunoinhibitory effects and facilitate tumor metastasis ; blocking ccl2-ccr2 signalling by monoclonal antibodies has been shown to augment cd8 + t - cell - mediated responses elicited by immunotherapy and to inhibit metastatic seeding [ 34 , 35 ] .
ccl28 derived from tumor cells has also been shown to promote the recruitment of tregs and thereby promote tolerance of tumor and angiogenesis .
ccl18 from tumor - associated macrophages has also been shown to promote cancer invasion and metastasis . in the case of non - small cell lung cancer ( nsclc ) , it has been evidenced that the neoplasm and vicinal cells can release tgf- or cyclooxygenase-2 ( cox-2 ) for recruiting tregs to tumor region .
some inflammatory cytokines are consequent on long - term interplay of immune and cancer cells , such as prostaglandins , il-1 , il-6 , and il-13 , which can trigger the expansion and activation of mdscs [ 9 , 38 , 39 ] . in some cases
, cancer cells can express or secrete human leukocyte antigen g ( hla - g ) , through which they inhibit the immune surveillance function of nk or nkt cells [ 40 , 41 ] .
furthermore , our previous studies have demonstrated that lung cancer may secrete some mediators causing anergy of tumor - associated dendritic cells ( tadcs ) and promoting their secretion of some factors which in turn enhance cancer progression [ 42 , 43 ] . by transplanting llc adenocarcinoma cells via tail vein injection to the mice with same genetic background ( c57bl/6 mice ) to mimic the original lung tumor environment
, we found that lung cancer cells could secrete galectin-1 to affect the differentiation of monocyte into tolerogenic dendritic cells with increased production of il-10 .
the carcinogenic mutation of cells and dysregulated immune responses are just preludes for cancer progression and invasion . as suggested by the seed and soil
concept , since mutated cells are the foundation for the malignant disease , the tumor microenvironment may be quite important in fostering the tumor cells and may substantially assist them to acquire advanced invasion ability [ 47 ] .
therefore , when abundant evidence showed that the epithelial - mesenchymal transition ( emt ) phenomenon usually intimately correlate with chronic inflammatory situation , it is believed that certain favorable mediators which can facilitate cancer cells to evolve to much invasive type must exist in the inflammatory microenvironment around tumor mass [ 4 , 7 , 9 ] . indeed , increasing evidences
demonstrate that a variety of inflammatory mediators from cancer and tumor - infiltrating cells , such as il-1 , il-6 , and il-8 , facilitate the development of tumor microenvironment in favor of tumor cell proliferation , motility , invasion , and emt and therefore increase their metastatic ability [ 9 , 13 ] .
emt is a specific process by which cells with highly polarized epithelial characteristics acquire the mesenchymal trait , which is widely believed to make the cells much movable and therefore play an important role in cancer invasion and metastasis [ 7 , 4449 ] . in the cellular and molecular level ,
some important changes take place during emt , including increased transcriptional repressors of e - cadherin ( including snail , slug , twist , and zeb-1 ) , e - cadherin degradation , and replacement of epithelial proteins ( such as cytokeratins , apical actin - binding transmembrane protein-1 , and zonula occludens-1 ) with mesenchymal proteins ( such as vimentin and type 1 collagen ) [ 4 , 4449 ] .
coincidentally , these molecular mechanisms are highly permissive in the chronic inflammation environment [ 50 , 51 ] .
the infiltrated immune cells can produce series of emt - favorable cytokines , such as tgf- , tnf- , and il-1 [ 4 , 7 , 51 , 52 ] . the key regulatory role of tgf- for emt has been recognized in various models .
it has been noticed that tgf- induces emt in alveolar epithelial cells , making them transformed to fibroblasts / myofibroblasts [ 52 , 53 ] . besides , tgf- signaling elicits expression of high mobility group a2 ( hmga2 ) via smad transducers , which then upregulates the production of snail , slug , and twist and contributes to emt .
tnf- alone may also mediate emt through promoting e - cadherin degradation , mainly via strengthening snail stability in an nf-b - dependent manner [ 4 , 54 ] .
il-1 and tgf- can induce cox-2 expression , which increased prostaglandin e2 ( pge2 ) level , and subsequently induce emt through the downregulation of e - cadherin via the enhanced expression of transcriptional repressors , snail and zeb1 [ 4 , 55 ] .
our recent studies found that lung cancer cells secret galectin-1 , which promotes its migration , invasion , and emt . on the other hand , our previous studies found that galectin-1 secreted by lung cancer cells may promote differentiation of monocyte to specific tadcs , which can secrete amphiregulin to enhance cancer cell proliferation , emt , and therefore invasiveness .
in addition to the interactions between cancer cells and immune cells , we have also investigated the interactions between lung cancer cells and bone . we have demonstrated that lung cancer cells can not only secrete il-8 to promote osteoclastogenesis but also trigger osteoblast to secrete bone morphogenetic protein-2 ( bmp-2 ) , which in turn promotes lung cancer migration , invasion , and emt [ 48 , 56 ] .
in addition to emt , a well - established tumor can also cooperate with adjacent stromal cells to build up highly specialized surrounding , such as vessel - rich or migration - favorable environment , facilitating further spreading out . after being influenced by abnormal paracrine signals from the tumor , the carcinoma - associated fibroblasts ( cafs )
are gradually formed from the normal stromal cells through the process called stromatogenesis [ 31 , 57 ] .
cafs are the main source of host - derived vegf and may therefore contribute to angiogenesis [ 31 , 58 ] .
cafs also secrete hepatocyte growth factor ( hgf ) , which not only activate emt - related c - met pathway but also give lung cancer cells resistance to conventional epidermal growth factor tyrosine kinase inhibitors [ 7 , 59 ] .
the increased oxygen demand from uncontrolled - growing cancer and infiltrating immune cells brings about a hypoxic environment , which upregulates signal pathway dominated by hypoxia - inducible factor 1 ( hif-1 ) [ 59 , 60 ] .
the hif-1 subunit , which is normally controlled by ubiquitin - mediated degradation in normoxic condition , is stabilized in hypoxic condition and further binds to hif-1 chain to construct a functional heterodimer .
binding of this heterodimer to hypoxia - response elements ( hres ) turns on the transcription of downstream genes involved in the regulation of cell survival , proliferation , extracellular matrix remodeling , angiogenesis , and invasiveness and may therefore contribute to cancer progression [ 4 , 60 , 61 ] .
for example , hif-1-mediated lipoxygenase pathway regulates the migration and invasion of epithelial ovarian cancer cells in hypoxic condition and promotes cancer metastasis .
activation of slug by hif-1 increased the expression of membrane - type 4 matrix metalloproteinase ( mt4-mmp , also known as mmp-17 ) in human cancer cells , which promotes in vitro invasiveness of the cells and in vivo colonization and growth of the cells in the lungs , via an emt - independent mechanism .
hypoxia or overexpression of hif-1 reduces e - cadherin expression and increases cell migration , invasion , and metastasis in a twist - dependent manner , as shown in a study using non - small cell lung cancer , human hypopharyngeal carcinoma , tongue cancer , breast cancer cell lines , and clinical specimens from head and neck squamous cell carcinoma patients .
the pleiotropic nature of cytokines in the microenvironment contributes to promoting cancer cell proliferation , bypassing apoptosis , inducing emt of cancer cells , enhancing chemokines to recruit immune suppressor cells aggregating around the tumor , and even driving the development of drug resistance .
consequently , multiple beneficial elements for tumor invasion and metastasis accumulate over time in the tumor microenvironment , which make cancer therapy much more challenging .
many anticancer drugs have been developed for targeting the crucial signal molecules which are usually overactivated in cancerous tissue .
after immune suppressive mechanism has been gradually revealed , the attempt of using drug for manipulating immune response , in terms of immunotherapy , is already on the way .
however , the attempt for developing cancer - curing medications is usually frustrating because the occurrence of drug resistance seems inevitable .
the concept of tumor microenvironment can provide a sort of understandable reasons for explaining how cancer finally turns the effective drug into a failure .
the underpinning mechanisms are so - called de novo mechanisms , which point out that the dynamic changes of the tumor surrounding can either give the cancer cell new immortal signal or fundamentally alter some default signal pathways and thus cancer cells finally can bypass the influence caused by the original drug .
a new signal input which strengthens cancer cells can be given via soluble factors or physical cell - cell contact in specific tumor microenvironment .
il-6 can be exemplified as a soluble factor which deeply influence the treatment outcome in multiple myeloma models .
the high concentration of il-6 usually exists in the bone marrow microenvironment to where the malignant b cells home .
il-6 transmits major survival signals through various pathways , including pi3k / akt , ras / raf / mek - erk1/2 , jak / stat3 , shp2/raftk , and src - family tyrosine kinase pathways , and each of these pathways may give the cancer cell alternative surviving reliance other than original intrinsic mutation . as for the survival signal given by the direct cell contact ,
the malignant immune cells also acquire survival - related signal when their surface integrin binds to certain extracellular matrix in bone marrow sanctuary , such as fibronectin , vitronectin , laminin , and collagens , and further activates downstream associated factors .
this signal cascade finally modulates cytoskeleton remodeling , which then regulates cell proliferation , differentiation , and the motile ability . as shown by these examples ,
de novo mechanisms provide the rational explanation that initially functional drug may lose their targeting function after cancer cells gain more versatile survival ability after being fostered by proper microenvironment .
in addition to the myeloma model , the drug resistance driven by de novo mechanisms has been demonstrated in solid tumor models as well .
some studies have even shown that cancer cells contacting specific extracellular matrix are able to turn chemotherapy into a proliferation - promoting signal , which contributes to drug resistance .
for example , exposure to cisplatin induces proliferation of oral carcinoma cells while these cells adhere to carcinoma matrix through the function of integrin-1 , which transmits nf-b - dependent signal into the cells . the angiogenesis - triggered resistance to chemotherapy
a study using human non - small cell lung cancer cell lines and clinical specimens showed that higher expression of vegf receptor-2 , a vital angiogenesis - related receptor , in cancer cells was associated with the increased level of hif-1 expression and resistance to platinum - based chemotherapy .
however , even though angiogenesis is the common leading cause of cancer progression , abruptly targeting the crucial contributing factor , vegf , is still risky .
the tumor microenvironment can serve as a clonal selection niche or compensatory substance providing source and thus make the resistance happen .
based on the assumption that tumor mass consists of multigenotypic population , the vegf - targeting therapy may just play a selection pressure for selecting adapting tumor cells .
according to certain observations from human cancer studies , anti - vegf therapy usually eventually results in regrowth of clonal populations with the characteristics of expressing higher compensatory factors such as vegf , fibroblast growth factor ( fgf ) , placental growth factor ( pgf ) , and platelet - derived growth factor ( pdgf ) [ 67 , 68 ] . alternatively
, the other tumor population with greater invasive ability would be favored after antiangiogenic therapy application , while the mechanisms remain under exploration [ 67 , 69 ] .
in addition , while the abnormal tumor vasculature is usually stagnant and functions poorly , anti - vegf therapy reduced vessel size and tortuosity with more pericyte coverage of the remaining normalized vessels .
the growth factors pericytes secrete may facilitate vascular structure stabilization and normalization , which makes the tumors more adapting [ 67 , 71 ] .
overall , the microenvironment may make the therapeutic outcome deviate from the original treatment purpose .
since carcinogenesis is based on a complex individual genetic background , the outer environmental stimulation , and the delicate interplay between cancer cells , surrounding stromal cells , and infiltrating immune cells , the drug applying model should be chosen with caution to ensure adequate simulation of the clinical situation . because in vitro cell culture system lacks the relevance of physiological clues for drug implementation , the investigation of curing efficacy through in vivo model is inevitable prior to the clinical application .
murine model has the advantages of easy manipulation , high fecundity , and close genetic background to human .
thus , the usage of murine model as preclinical in vivo trial is widely accepted .
mouse is a good animal model for assessing maximum tolerated dose of potential drugs ( or drug toxicology ) .
however , the mismatch between murine model and clinical cases in evaluating cancer progression activity or anticancer efficacy of drugs is usually acknowledged .
this mismatch mainly comes from , as mentioned in several review literatures , the impossibility in simulating all detailed carcinogenic mechanisms in human , especially failure to create the same tumor microenvironment [ 7275 ] .
even though many advanced murine models have been developed for addressing this issue , there are still much challenges waiting for breakthrough . xenografting human tumor
to immune deficient mice ( nude or severe combined immunodeficiency mice ) has once been a keystone model for preclinical assessment of anticancer drug efficacy .
the major concern comes from the implanting site of tumor , which is usually located in subcutaneous region for easy observation of the drug 's growing inhibition and tumor mass shrinking effect .
nonetheless , since subcutaneous region usually differs from tumor orthotropic architecture , it casts the doubt for further clinical treatment efficacy , because the drug penetrating ability or tumor evolving course may be quite different from the actual clinical situation .
the previous survey about comparing the drug activity in phase i clinical trial with the corresponsive xenograft model showed that only 3.8% of drug with efficacy in xenograft murine model has positive effect in human .
the poor correlation in the drug effect between murine xenograft models and human beings also proposed other flaws of the murine model .
although the major purpose of clinical drug application is not only delimitating / eliminating the original tumor but also prohibiting cancer relapse / metastasis , the xenograft model almost never does well because it can not simulate the participating process of immune system and the phenomena of tumor metastasis .
orthotropically implanting human tumor to corresponsive tumor site on immune deficient mice takes the advantages to mimic the architecture of tumor primitive growth environment .
the similar histological features as the tumor original site also provide a more faithful microenvironment for assessing the targeting ability of the drug . by comparing the growth inhibiting effect of doxorubicin in mice implanting with human colon cancer cells ectopically or orthotopically ,
it is understandable that the effect can be quite different , from 80% inhibition in subcutaneous region to about 40% inhibition in orthotopic region . nonetheless , the necessity of using immune deficient mice is the major limitation for orthotopic model , as the contribution of immune cells to tumor progression is neglected . to retain the immune function , the murine cancer syngeneic model , using immune component mice inoculated with mice - originated cancer , seems to be more preferable .
the highly coherent correlations between drug fighting against intraperitoneally injected p388 or l1210 cell line ( both are mice leukemia cell lines ) and clinical application are persuasive .
subsequently , the murine subcutaneously injected b16 melanoma model and intravenously injected lewis lung carcinoma model are developed in an attempt to screen the potential drug for treating the same type of cancer in human .
however , the different cell characteristics between human tumors versus mice tumors finally drive the divergence of potential drug screening result .
actually , certain drug compounds which work in human - mouse xenograft model have shown negative response in the murine cancer syngeneic model .
taxol is one of such drugs that might be neglected if only relies on l1210 murine syngeneic test [ 78 , 79 ] .
humanized mice and gene - modified mice are much advanced model for resolving the limitations that existed in the aforementioned models .
humanized mice allow the orthotropic implanting human tumor to be fostered in human - like immune condition through transplanting human stem cells or t cells from the donor of cancerous tissue to the immune deficient mice .
gene - modified mice can be used in much wide application . through performing transgenic ,
knock - out , and knock - in technology to the mice , the mice can be modified to be more humanized via inserting human genome sequence in , or contributing to certain gene defect and representing autochthonous tumor models .
all the above make the animal model more suitable for carrying out human cancer research .
nonetheless , certain technique limitations of these models are still waiting to conquer . except much more capital and time investment to create these models ,
it is still uncertain whether the pharmaceutical efficacy in translation from mice to human can be highly improved [ 74 , 75 ] .
since the tumor microenvironment contributes to many aspects of carcinogenesis and cancer progression and therefore offers promising treatment targets , any new inputs of tumor microenvironment may become the incentive of future anticancer drug development .
after further understanding the tumor microenvironment , it is undoubtedly that the concept for drug development required great revolution .
although the suppressive immunity is predominant in tumor microenvironment , immunomodulation should be used carefully as an anticancer treatment modality .
since the interaction between stromal and cancer cells is so essential for further tumor progression , the new signal molecules which play key roles for the crosstalk should be taken into account while seeking future treatment target .
the environmental - mediated drug resistance points out that the drugs might turn into failure in a long timescale . to avoid the future resistance , the multitargeting drug or
the cocktail drug application strategy may give a more favorable long - term outcome .
indeed , treatments targeting cancer cells as well as key components of the tumor microenvironment , as compared to chemotherapy alone , significantly improve the clinical outcomes . to narrow down the gap between the experimental and clinical application of anticancer drugs , developing a preferable animal model seems inevitable . in conclusion , because all the new directions for drug development are based on the wide knowledge of tumor microenvironment , understanding the mechanisms modulating tumor microenvironment
may facilitate the design of a novel anticancer therapy and may obtain greater success in cancer eradication .
Output:
| recent advances in cancer therapy encounter a bottleneck . relapsing / recurrent disease
almost always developed eventually with resistance to the initially effective drugs .
tumor microenvironment has been gradually recognized as a key contributor for cancer progression , epithelial - mesenchymal transition of the cancer cells , angiogenesis , cancer metastasis , and development of drug resistance , while dysregulated immune responses and interactions between various components in the microenvironment all play important roles .
future development of anticancer treatment should take tumor microenvironment into consideration .
besides , we also discuss the limitations of current pre - clinical testing models that mainly come from the impossibility in simulating all detailed carcinogenic mechanisms in human , especially failure to create the same tumor microenvironment . with the cumulating knowledge about tumor microenvironment
, the design of a novel anticancer therapy may be facilitated and may have better chance for success in cancer eradication . |
PubmedSumm119670 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the rate of infant hiv infection in the usa has plummeted with the advent of routine hiv testing during pregnancy and the availability of potent antiretroviral therapy .
these public health advances shift focus to prevention of other comorbid conditions in hiv - infected women and their infants .
herpes simplex virus type 2 infections are prevalent among women and among persons with hiv infection . in resource - limited settings with high hiv prevalence such as the central african republic , hsv-2 antibody prevalence among hiv - infected women is 91% .
studies have reported an increased risk of hiv infection in infants born to hsv-2- and hiv - coinfected women or women who have clinical genital herpes during pregnancy [ 2 , 3 ] .
the risk is likely mediated by an increase in plasma and/or mucosal hiv rna during hsv reactivation and may be abrogated by antiretroviral therapy .
less attention has been given to the potential for increased risk of neonatal herpes in infants of coinfected women .
persons with hiv and hsv-2 have increased rates of genital hsv reactivation , and , if they have advanced immunosuppression , have a higher rate of mucosal hsv shedding [ 1 , 57 ] . because hsv genital shedding during labor is the strongest risk factor for neonatal herpes ( relative risk > 300 ) , such hiv- and hsv-2-infected women could be at increased risk for transmitting hsv to their newborns .
neonatal herpes is a devastating disease for infants with a 30% mortality rate in the case of adequately treated disseminated disease . to assess the potential for hsv transmission to the neonate among hiv - infected women , we compared rates of hsv-2 infection and genital hsv shedding among hiv - infected and hiv - negative women
women with known hiv infection who delivered at the university of washington medical center ( uwmc ) , a tertiary care referral center , between 1989 and 1996 were included in the study .
additionally , women without known hiv infection delivering at uwmc between 1995 - 96 were included .
all women were receiving comprehensive prenatal care at uwmc or affiliated clinics . during the study period
, type - specific hsv serologies were included in routine prenatal care at our institution as part of a large , continuing study of hsv in pregnancy approved by the university of washington institutional review board .
genital swabs were obtained in a subset of women expected to deliver vaginally as part of an ongoing study of infant exposure to hsv during birth [ 8 , 10 , 11 ] .
genital secretions were obtained from the labia majora and minora as well as perianal and periclitoral areas with a dacron - tipped swab .
a second swab was collected from the ectocervix , endocervix , and posterior vaginal fornices during a speculum exam .
hiv serologic testing was performed using a commercial enzyme - linked immunosorbent assay ( genetic systems hiv-1/hiv-2 plus o eia , bio - rad , redmond , wa ) with western blot confirmation for samples testing positive .
genital swabs were evaluated by real - time quantitative hsv dna polymerase chain reaction ( pcr ) assay .
the prevalence of hsv-1 and hsv-2 antibodies and the median and range of log copies of hsv shed were compared among women with and without hiv infection .
categorical variables were compared using chi - square or fisher 's exact test , and continuous variables were compared using the mann - whitney test .
risk ratios with 95% confidence intervals ( cis ) were also calculated for the difference between these groups .
during the study interval , 75 known hiv seropositive women had a total of 85 deliveries included in this analysis . during 1995 - 1996 , there were 3099 consecutive women admitted to labor and delivery who were not known to be hiv infected , and 3051 ( 98% ) of these women had hsv serology testing available ; these were included as the comparator group .
the median age was 27 ( range 17 , 37 ) for hiv - seropositive women and 29 ( range 15 , 49 ) for hiv - negative women ( p = .6 ) . among hiv - seropositive women ,
seronegative women , 46% were white , 34% black , and 20% were other races .
nulliparous women comprised 31% of hiv - seropositive and 34% of hiv - seronegative women . among 75 hiv - seropositive women , 71.2% had antibody to hsv-2 ( 28.7% to hsv-2 only and 42.5% to hsv-2 and hsv-1 ) , 21.9% to hsv-1 only , and 6.8% were hsv seronegative .
in contrast , among 3051 hiv - seronegative women , the hsv-2 seroprevalence rate was 30.3% ( 11.1% seropositive for hsv-2 only and 19.2% seropositive for both hsv-1 and hsv-2 ) , while 50.6% were hsv-1 seropositive only and 19.1% were hsv seronegative ( p < .001 for the difference in frequency of hsv-2 antibody between hiv seropositive and hiv seronegative women ) . in a subset of hsv-2 seropositive women in the study ,
the swab of genital secretions obtained at the time of delivery was evaluated with hsv dna pcr swabs . among 26 hiv - positive , hsv-2-seropositive women who were evaluated ,
none had genital lesions , and all had swabs obtained for hsv from genital secretions . among 635 hiv - negative , hsv-2-seropositive women who were evaluated , 13 had lesions at delivery , and a swab for hsv was obtained from the remaining 622 for hsv detection .
vaginal deliveries were common in both groups of hsv-2-infected women without lesions as 79% of hiv - positive women and 96% of hiv - negative women delivered vaginally .
genital hsv was detected in 8 ( 30.8% ) of 26 hiv- , hsv-2-infected women at the time of delivery .
seven of these women were hsv-2 pcr positive only , and one was hsv-2 and hsv-1 positive by pcr swab .
specifically , hsv dna was detected in all 8 vulvar swabs , and in 4 of the 8 hsv was also detected in the cervical swabs . among the 622 hiv
seronegative women who had swabs taken for pcr , 59 ( 9.5% ) women had hsv detected .
of 59 women who had hsv detected , 27 were positive both at vulva and cervix , 24 only at the vulva , and 6 only at the cervix ; an additional 2 women were positive at the cervix but vulvar swabs were not available .
the risk of hsv detection among hiv - seropositive women was 3.2-fold higher ( 95% ci 1.6 to 6.5 , p = .001 ) than among hiv - seronegative women ( table 1 ) .
quantitative amount of hsv in the swabs did not differ significantly between hiv - seropositive and hiv - seronegative women with the median number of virion copies per ml of log 3.54 ( range 2.85 , 5.69 ) for hiv - positive women versus log 3.90 ( range 2.17 , 6.92 ) for hiv - negative women ( p = .99 , figure 1 ) .
our study showed that hsv-2- and hiv - coinfected pregnant women were more likely to shed hsv at delivery than their hiv negative counterparts .
the quantitative amounts of shedding did not differ between hiv - positive and hiv - negative women , perhaps reflecting the fact that all had established hsv-2 infection .
viral shedding is the strongest risk factor for transmission of hsv from the mother to the neonate at birth . while most transmissions to newborns occur from pregnant women who have recently acquired genital hsv and have not developed a detectable antibody response by the time of delivery , women with established hsv-2 infection are also at risk for transmitting hsv to their neonate , but at a much lower rate .
prior studies have addressed the role of hsv-2 in increasing the risk of perinatal hiv transmission , especially in africa where hsv-2 infection affects most hiv-1-seropositive pregnant women and highly active antiretroviral therapy is not universally used during pregnancy .
drake et al . showed that genital ulcers were associated with increased plasma hiv-1 rna and increased risk of intrapartum transmission of hiv and calculated that 14% of hiv-1 transmissions were attributable to maternal hsv-2 ulcers .
study in zimbabwe suggested that 28% of intrapartum hiv transmissions are potentially attributed to prevalent maternal hsv-2 . also concerning
this cohort is the additional 17% ( 29 of 193 ) of initially hsv-2-seronegative women who subsequently seroconverted to hsv-2 in the immediate peripartum period .
this suggests that a substantial number of women acquire new hsv-2 infection peripartum , an event associated with a 3050% risk of hsv transmission to the neonate .
we are aware of a single - case report of hsv transmission to the neonate from an hiv - infected woman . in this case
, the hsv infection was acquired at the end of pregnancy . of note , this case was observed in a resource - rich setting , underscoring that a diagnostic workup for neonatal hsv is less likely to be routinely performed in the developing world . to our knowledge ,
no systematic study evaluating the incidence of neonatal hsv in resource - poor areas with high hiv prevalence has been done .
our study was limited by a relatively small number of hiv - positive pregnant women .
in addition , we focused on women who are hsv-2 seropositive , who are at lesser risk for transmitting neonatal herpes than women who acquire genital hsv in late pregnancy .
further studies of the risk of neonatal hsv among hiv - infected women should include women who are at risk for hsv acquisition in the peripartum period . additionally ,
while routine heel sticks on infants born to the presumed hiv - negative women during did not reveal any unrecognized hiv infections , many of these women did not have a confirmed negative hiv test , as the study was done prior to routine hiv testing in pregnancy .
while suppressive therapy for hsv is recommended , and utilized , for prevention of genital lesions at labor and cesarean deliveries for women with a clinical history of genital herpes , the impact of this approach on neonatal hsv is unknown .
the effect of this strategy on the high rate of hsv shedding in labor among hiv - infected , hsv-2-seropositive women has not been studied .
in addition , antiviral therapy for hsv is used infrequently in resource - poor countries .
suppressive therapy with acyclovir and valacyclovir has been shown to reduce plasma and genital hiv rna levels by 0.250.50 log but not to impact the risk of sexual transmission of hiv [ 2123 ] .
ongoing studies will evaluate whether valacyclovir can reduce the risk of mother to child hiv transmission during late pregnancy , the intrapartum period , and breastfeeding .
Output:
| objective . to compare genital hsv shedding among hiv - positive and hiv - negative women . methods . women with and without known hiv infection who delivered at the university of washington medical center between 19891996 had hsv serologies done as part of clinical care .
genital swabs from hsv-2-seropositive women were evaluated by real - time quantitative hsv dna pcr .
results .
hsv-2 seroprevalence was 71% and 30% among 75 hiv - positive and 3051 hiv - negative women , respectively , ( p < .001 ) .
hsv was detected at delivery in the genital tract of 30.8% of hiv - seropositive versus 9.5% of hiv - negative women ( rr = 3.2 , 95% ci 1.6 to 6.5 , p = .001 ) .
the number of virion copies shed per ml was similar ( log 3.54 for hiv positive versus 3.90 for hiv negative , p = .99 ) .
conclusions .
our study demonstrated that hiv- , hsv-2-coinfected women are more likely to shed hsv at delivery . |
PubmedSumm119671 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a four - month - old female infant presented to the emergency department of the children s hospital in winnipeg , manitoba , with full - thickness burns of the anterior lower limbs . according to the infant s mother , the burns had been sustained two weeks previously while visiting family in karachi , pakistan , when an electronic steamer used to relieve the infant s nasal congestion slipped and spilled hot water over her legs .
she was taken to an emergency department in karachi , where she was treated with oral amoxicillin - clavulanate and daily dressing changes .
within one week , her wounds became infected . at this time the family left pakistan without further intervention in the hope of continuing her treatment in winnipeg . on the way to winnipeg
, the infant was taken to the montreal children s hospital ( montreal , quebec ) . during her < 24 h
stay , her wounds were evaluated and her antimicrobial therapy was stopped due to diarrhea . on presentation in winnipeg ,
the infant s temperature was 39.1c , her heart rate was 204 beats / min , her respiratory rate was 36 breaths / min , her blood pressure was 114/64 mmhg and her oxygen saturation was 99% on room air .
examination of her lower limbs revealed 15% body surface area of full - thickness burns , encompassing areas of both legs and feet .
she was born in canada at 40 weeks gestation via emergency caesarean section due to fetal bradycardia .
initial investigations revealed a white blood cell count of 2910 cells / l ( 28% neutrophils and 54% lymphocytes ) , a hemoglobin level of 102
blood , urine , ear swabs and surveillance swabs for methicillin - resistant staphylococcus aureus ( mrsa ) and vancomycin - resistant enterococci were collected for culture .
the patient was taken to the operating room , where her wounds were debrided , the aforementioned gangrenous toes were amputated , and swabs from the left leg and right foot were submitted to the laboratory for microbiological investigations .
antimicrobial susceptibility testing was performed using the vitek2 system ( biomrieux , canada ) , with minimum inhibitory concentrations ( mics ) interpreted using 2013 clinical and laboratory standards institute ( clsi ) breakpoints ( 1 ) .
two different strains of mrsa ( isolates a and b ) were isolated from the nares , as well as the ears , the left leg and the right foot .
one isolate was a canadian mrsa strain type 7 ( usa400 ) according to pulsed - field gel electrophoresis , while the other mrsa had a unique pulsed - field gel electrophoresis pattern that did not match any of the existing canadian mrsa strain types ( 2 ) .
multidrug - resistant ( mdr ) strains of klebsiella pneumoniae ( isolate c ) and pseudomonas aeruginosa ( isolate d ) were recovered from wounds on the left leg and right foot ( table 1 ) . the k pneumoniae
isolate had a relatively elevated meropenem mic of 1 mg / l , which is at the clsi defined breakpoint for susceptibility .
ciprofloxacin was added to the treatment regimen based on the susceptibility pattern of the p aeruginosa isolate ( table 1 , isolate d ) .
given the broad - spectrum antibiotics and severe burns , the patient was also given fluconazole prophylaxis . on day 7 postadmission , the patient s skin grafts were noted to be necrotic in an area of previously exposed tarsal bone .
purulent material adjacent to the first metatarsal bone of the right foot was submitted to the laboratory , and ultimately yielded p aeruginosa and providencia stuartii on culture ( isolates e and f ; table 1 ) .
this new p aeruginosa isolate exhibited a different susceptibility pattern compared with the previously isolated p aeruginosa , and was susceptible to amikacin and tobramycin but resistant to meropenem ( table 1 ) .
given the presumptively infected bone , the patient completed six weeks of combined antimicrobial therapy ( vancomycin , continuous infusion meropenem , ciprofloxacin and amikacin ) for osteomyelitis .
she improved rapidly following the addition of amikacin and was discharged home with no further complications .
the mdr k pneumoniae ( isolate c ) and p aeruginosa ( isolate d ) isolates were forwarded to the national microbiology laboratory in winnipeg , manitoba , for further evaluation .
two multiplex polymerase chain reactions ( pcrs ) , one for the detection of beta - lactamase genes ( shv , tem , ctx - m , oxa-1 and cmy-2 ) and one for the detection of carbapenemase genes ( kpc , ndm , imp , vim , ges and oxa-48 ) were used as previously described ( 3,4 ) .
the k pneumoniae isolate ( isolate c ) was positive for shv , tem , ctx - m , oxa-1 and oxa-48 , and was considered to be an extended - spectrum beta - lactamase ( esbl ) producer and molecular class d oxa-48 car - bapenemase producer .
the p aeruginosa isolate ( isolate d ) was positive for ges by pcr and sequencing confirmed that it possessed ges-13 , a molecular class a carbapenemase .
the carbapenemase pcr was also performed on the p stuartii isolate ( isolate f ) and the second isolate of p aeruginosa ( isolate e ) ; these were both negative .
carbapenemases are beta - lactamase enzymes capable of hydrolyzing carbapenem antimicrobials ( 5 ) . while some bacteria intrinsically produce a carbapenemase , p aeruginosa and many members of the family enterobacteriaceae acquire carbapenemases through mobile genetic elements such as plasmids ( 3 ) .
the global dissemination of carbapenemase - producing bacteria is of great concern because these organisms are often mdr , leaving clinicians with few therapeutic options from which to choose ( 5 ) .
ges beta - lactamases ( ges-1 to ges-23 ; www.lahey.org ) are a group of molecular class a enzymes with extended - spectrum properties ( 6 ) .
the presence of lys-104 has been associated with increased activity against oxyimino - beta - lactams , mainly ceftazidime and aztreonam , whereas asn-170 lends the enzyme weak car - bapenemase activity ( 6 ) .
ges-13 was first isolated in a mdr strain of p aeruginosa from a patient with a respiratory infection in athens , greece ( 7 ) .
laboratory detection of ges enzymes in p aeruginosa relies on molecular methods because a specific phenotypic test does not exist . in the case
described here , the decision to investigate for possible carbapenemase production was made based on the patient s travel history . to our knowledge ,
oxa - type carbapenemases are molecular class d enzymes that have been primarily associated with acinetobacter baumannii ( 8) . in 2001 , the first case of an oxa-48-producing k pneumoniae was reported from istanbul , turkey ( 9,10 ) . for several years
, oxa-48 was identified only in patients hospitalized in turkey or with some link to this country ( 9,10 ) .
however , more recently , the plasmid - mediated oxa-48 and related variants have been detected in enterobacteriaceae from the middle east , north africa , india , europe and north america ( 4,9,11,12 ) .
although oxa-48 displays weak activity against carbapenems and extended - spectrum cephalosporins , isolates harbouring this enzyme often produce other esbls ( 4,9,12 ) .
identification of oxa-48-producing enterobacteriaceae in the clinical laboratory setting is challenging due to the lack of a specific phenotypic test ( 10,13 ) .
furthermore , these isolates may test susceptible to carbapenems , albeit with relatively elevated mics . in a recent study by potron et al ( 9 ) ,
68.6% and 69.5% of 105 oxa-48-producing enterobacteriaceae were susceptible to imipenem and meropenem , respectively , according to current clsi breakpoints .
poirel et al ( 10 ) have proposed that carbapenemase production among enterobacteriaceae be suspected for isolates with an ertapenem mic 0.5 mg / l , or an imipenem or meropenem mic
molecular - based techniques ( pcr ) remain the gold standard for detection of oxa-48 among enterobacteriaceae ( 10,14 ) . in our case ,
the oxa-48-producing k pneumoniae isolate was resistant to ertapenem ( mic 4 mg / l ) and had a relatively elevated meropenem mic of 1 mg / l ( table 1 ) . on molecular testing , this isolate was positive for shv , tem , ctx - m , oxa-1 and oxa-48 by pcr .
the ctx - m enzyme was likely responsible for the extended - spectrum cephalosporin resistance demonstrated by the isolate , as has been previously reported ( 4,9,12 ) .
the present case highlights several of the challenges associated with mdr organisms . as the frequency of worldwide travel continues to increase
, clinicians will need to be aware of not only local epidemiology but also global trends in antimicrobial resistance .
treatment of infections caused by mdr organisms may require complicated and potentially toxic antimicrobial combinations .
the regimen used in the present case resulted in excellent clinical response but required a prolonged hospital stay for the medications to be effectively delivered .
the extended use of an aminoglycoside was well tolerated in our pediatric patient ; however , nephrotoxicity from aminoglycosides may be a greater concern in older age groups and/or patients with underlying renal impairment .
evidence for the use of continuous beta - lactam infusions is limited , particularly in the pediatric population ( 1517 ) . given
the k pneumoniae carbapenem mic of 1 mg / l found in our patient , combined with abnormal blood flow in a burn setting with infected bone , it was the option pursued due to concern over achieving sufficient drug levels in the targeted tissues . while the need for multiple antibiotics made drawing specific conclusions about the role of the continuous infusion difficult , the clinical success of the approach was notable .
we report the first case of a ges-13 carbapenemase - producing p aeruginosa in canada , recovered from the wounds of an infant who sustained burns while travelling in pakistan .
also recovered from the patient s wounds were two isolates of mrsa , an mdr isolate of p stuartii , and an oxa-48 carbapenemase and ctx - m esbl - producing k pneumoniae .
this case highlights the importance of international travel as a risk factor for infection with carbapenemase - producing bacteria .
the travel history here prompted testing for carbapenemase production in the p aeruginosa isolate ( isolate d ) . without this history , it is likely that molecular testing would not have been performed and the ges-13 enzyme would have gone undetected .
this case also illustrates the difficulty faced by clinical microbiology laboratories in detecting oxa-48-producing enterobacteriaceae because many of these isolates remain susceptible to imipenem and meropenem based on current clsi breakpoints .
Output:
| a case of osteomyelitis in an infant following a burn injury sustained in pakistan caused by a ges-13-producing pseudomonas aeruginosa ( the first reported in canada ) and an oxa-48 producing klebsiella pneumoniae is described .
the present case serves to highlight the importance of international travel as a risk factor for infection with carbapenemase - producing bacteria and the challenges in the laboratory detection of these organisms . |
PubmedSumm119672 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: essential properties
of transition - metal complexes that are intimately linked to the electronic
and steric aspects of ligands in the primary coordination sphere include
redox properties , light absorption , and emission .
additionally , in
supermolecule complexes where spatially distinct chromophores are
introduced , the latter may intervene in determining photophysical
properties , for example , through electron or energy transfer .
concerning emission , the quantum yield and luminescence
lifetime are important characteristics , which ultimately define applicability
in light - emitting and sensing architectures .
we and others have previously
applied an approach of harnessing reversible electronic
energy transfer between energetically - matched chromophore pairs exhibiting complementary kinetic behavior ( see
below and the supporting information , si )
in order to enhance the performance of several underperforming luminescent
metal complexes based on ruthenium , osmium , copper , and rhenium as
luminophores and photosensitizing agents .
modification of the photophysical properties of cyclometalated iridium
complexes is of particular interest because of their central role
in multiple applications requiring highly efficient emission such
as electroluminescence , sensing , and bioimaging .
equally , this would add to the rather limited number of
matched chromophore pairs .
in this context , here we report a
straightforward structural modification of a cyclometalated iridium
complex ( see model complex 1 ) , involving the judicious
integration of an auxiliary matched organic chromophore , in order
to obtain a much longer - lived luminescent complex ( 2 ) ,
while retaining a similar emission quantum yield . this modification
could , in principle , broaden the scope of functions in multicomponent
artificial photoactive arrays by changing excited - state properties ,
including the luminescence lifetime and oxygen sensitivity .
a key
to success was the introduction of a non - conjugated aliphatic spacer
between the pyrene group and the adjacent 2,2-bipyridine because
direct attachment of the pyrene to the ancillary ligand results in
quenching of the excited iridium center .
the auxiliary organic chromophore was anticipated to play
the desired role if the newly introduced triplet level was essentially
isoenergetic with the emissive triplet metal - to - ligand charge - transfer
( mlct ) state and exhibits slow inherent deexcitation .
this would enable reversible intercomponent excited - state energy transfer ,
with the organic subunit acting as an energy reservoir , leading to
a net luminescence lifetime increase . on
the basis of luminescence data of 1 , vide infra ,
pyrene
was selected as an appropriate candidate to play the desired role
( triplet energy at 2.09 ev ; phos = 11000 s ) ; see prototype 2 in chart 1 .
all of the starting materials and solvents were commercially available
and were used as received .
solvents and acids were received from fisher
except for diethyl ether ( sigma - aldrich ) and 2-ethoxyethanol ( acros
organics ) .
silica gel ( 60 , 0.0400.063 mm , 230400 mesh )
was received from alfa aesar , 2-bromopyridine ( 99% ) from aldrich ,
and tetrabutylammonium hydroxide ( tbaoh30h2o ) from
sigma - aldrich ; 1-naphthaleneboronic acid and tetrakis(triphenylphosphine)palladium(0 )
were received from acros organics and 2,2,6,6-tetramethyl-3,5-heptanedione ,
boron trifluoride diethyl etherate , and potassium hexafluorophosphate
from alfa aesar ; ircl3xh2o was received from heraeus .
h nmr spectra were
recorded using a bruker aviii 300 spectrometer , and c
nmr spectra were recorded using a bruker aviii 400 spectrometer .
chemical
shifts ( ) were expressed in ppm and referenced to the residual
chcl3 peak ( 7.26 ppm for h and 77.16 ppm for c ) .
mass spectrometry experiments were performed by means
of electrospray ionization on a synapt g2-s hdms mass spectrometer
( waters ltd . ,
manchester , u.k . ) or a qstar elite mass spectrometer
( applied biosystems ) . elemental analysis ( c , h , and n ) was performed
on a thermo finnigan ea flash 2000 analyzer at the cesamo analytical
center , university of bordeaux , talence , france .
compound 3 ( 100 mg , 0.079 mmol ) was dissolved in a ch2cl2/meoh ( 9:1 , v / v ) mixture ( 20 ml ) and degassed
by bubbling argon .
4,4-di - tert - butyl-2,2-bipyridine
( 85 mg , 0.316 mmol , 4 equiv ) was added and the solution heated to
reflux overnight under an argon atmosphere .
the solvent was evaporated ,
and the remaining orange solid was dissolved in meoh and precipitated
with a saturated aqueous solution of kpf6 .
the precipitate
was filtered , washed with water and cold meoh , and dried on the filter .
the solvent
was reduced and added dropwise to et2o to precipitate 1 and remove the excess bipyridine .
after filtration , 1 was obtained as an orange solid ( 114 mg , 0.112 mmol , 71% ) .
h nmr ( 300 mhz , cdcl3 ) : 8.55 ( d , j = 8.5 hz , 4h ) , 8.42 ( s , 2h ) , 7.86 ( t , j = 7.7 hz , 2h ) , 7.74 ( dd , j = 8.1 and 1.0 hz , 4h ) ,
7.68 ( d , j = 5.8 hz , 2h ) , 7.55 ( ddd , j = 8.5 , 6.9 , and 1.3 hz , 2h ) , 7.38 ( t , j = 7.2 hz ,
2h ) , 7.317.23 ( m , 4h ) , 7.177.08 ( m , 2h ) , 6.26 ( d , j = 8.3 hz , 2h ) , 1.41 ( s , 18h ) .
h nmr ( 300 mhz ,
cd3cn ) : 8.64 ( t , j = 8.7 hz , 4h ) ,
8.51 ( d , j = 1.7 hz , 2h ) , 7.95 ( ddd , j = 8.6 , 7.5 , and 1.6 hz , 2h ) , 7.78 ( dd , j = 8.1
and 1.2 hz , 2h ) , 7.757.69 ( m , 4h ) , 7.58 ( ddd , j = 8.5 , 6.9 , and 1.5 hz , 2h ) , 7.457.36 ( m , 4h ) , 7.33 ( d , j = 8.3 hz , 2h ) , 7.07 ( ddd , j = 7.3 , 5.8 ,
and 1.3 hz , 2h ) , 6.34 ( d , j = 8.3 hz , 2h ) , 1.39 ( s ,
18h ) .
compound 5 ( 142 mg , 0.172 mmol ) was dissolved in 20
ml of degassed ch2cl2/meoh ( 9:1 , v / v ) .
after
further degassing , 4-methyl-4-[2-(pyren-1-yl)ethyl]-2,2-bipyridine
( bpy - pyr ; 103 mg , 0.258 mmol , 1.5 equiv ) was added .
the mixture was
heated to reflux ( 40 c ) overnight under an argon atmosphere .
the solvent was evaporated to dryness , and the crude powder was dissolved
in 20 ml of acetonitrile .
a saturated aqueous solution of kpf6 ( 100 ml ) was added , and the mixture was stirred at room temperature
for 1 h. the solvent was gently evaporated until a precipitate formed .
the mixture was left in the a refrigerator for 2 h , and the precipitate
was filtered , washed with water , and dried under vacuum .
the powder
was then dissolved in a minimum amount of ch2cl2 , precipitated in pure diethyl ether ( to remove the remaining unreacted
ligand ) , left in the freezer for 30 min , filtered , and washed with
diethyl ether .
the column was prepared with
pure ch2cl2 , and the complex was adsorbed on
the silica using pure ch2cl2 as the eluent .
the column was eluted first with ch2cl2 to eliminate
the fast - migrating impurities , and then the eluent was changed to
ch2cl2/acetonitrile ( 80:20 , v / v ) to collect
an orange fraction .
anion exchange was performed again using acetonitrile
and saturated kpf6 in water , and 2 was obtained
as an orange powder ( 0.160 g , 0.139 mmol , 81% ) .
h nmr
( 300 mhz , cdcl3 ) : 8.53 ( dd , j =
10.3 and 6.7 hz , 4h ) , 8.43 ( d , j = 5.5 hz , 2h ) , 8.20
( d , j = 9.3 hz , 1h ) , 8.13 ( t , j =
8.0 hz , 2h ) , 8.057.90 ( m , 5h ) , 7.887.77 ( m , 3h ) , 7.72
( dd , j = 13.5 and 7.8 hz , 2h ) , 7.657.43 ( m ,
6h ) , 7.37 ( dt , j = 10.5 and 7.2 hz , 2h ) , 7.24 ( dd , j = 13.0 and 8.2 hz , 2h ) , 7.106.99 ( m , 2h ) , 6.996.91
( m , 1h ) , 6.86 ( dd , j = 5.6 and 1.1 hz , 1h ) , 6.25
( dd , j = 15.1 and 8.3 hz , 2h ) , 3.863.65 ( m ,
2h ) , 3.37 ( t , j = 7.5 hz , 2h ) , 2.51 ( s , 3h ) . hrms .
calcd for c59h44f6irn4op ( 2h2o ) : c , 60.97 ; h , 3.82 ; n , 4.82 . found : c , 60.91 ; h , 3.72 ;
n , 4.94 .
solutions for spectroscopic studies were
degassed by multiple freeze pump thaw cycles , and the
cell was blowtorch - sealed .
electronic absorption spectra were recorded
on dilute solutions in 1 cm quartz cells using a varian cary-50 spectrophotometer .
the
frequency - tripled nd : yag amplified laser system ( 30 ps , 30 mj at 1064
nm , 20 hz , ekspla model pl 2143 ) output was used to pump an optical
parametric generator ( ekspla model pg 401 ) , producing tunable excitation
pulses in the range 4102300 nm .
the residual fundamental laser
radiation was focused into a high - pressure xenon - filled breakdown
cell , where a white - light pulse for sample probing was produced for
nanosecond timescale measurements . for longer timescales ( micro- and
milliseconds ) ,
the white - light probe was obtained using an ensemble
of light - emitting diodes ( roithner lasertechnik , from 365 to 710 nm )
working in flash mode , coupled with a multifurcated fiber - optic cable
( eight cores , avantes ) .
all light signals were analyzed by a spectrograph
( princeton instruments acton model sp2300 ) coupled with a high - dynamic - range
streak camera ( hamamatsu c7700 ) . accumulated sequences ( sample emission ,
probe without and with excitation ) of pulses were recorded and treated
by hpdta ( hamamatsu ) software to produce two - dimensional
maps ( wavelength vs delay ) of transient absorption intensity in the
range 300800 nm .
emission spectra were recorded on
the steak camera setup ( uncorrected ) and a horiba jobin yvon fluorolog
3 equipped with a hamamatsu r928p pmt ( corrected , figure 2 ) .
emission quantum yields ( ) of the complexes
were determined upon comparison with an optically dilute [ ru(bpy)3]cl2 standard ( r ) in air - equilibrated
water ( = 0.028 ) according to the
equation = r(i / ir)(ar / a)(/r ) , where r refers to the reference sample , i is the integrated emission
intensity , a is the absorbance at the excitation
wavelength , and is the refractive index of the solvent .
samples were equally studied on the subpicosecond time scale : this
experiment was based on a femtosecond 1 khz ti : sapphire system producing
30 fs , 0.8 mj laser pulses centered at 800 nm ( femtopower compact
pro ) coupled with an optical parametric generator ( light conversion
topas c ) , and frequency mixer was used to excite samples at the maximum
of the steady - state absorption band . white - light continuum ( 3601000
nm ) pulses generated in a 2 mm d2o cell were used as the
probe .
the variable delay time between excitation and probe pulses
was obtained using a delay line with 0.66 fs resolution .
white - light signal and reference
spectra were recorded using a two - channel fiber spectrometer ( avantes
avaspec-2048 - 2 ) .
a home - written acquisition and experiment control
program in labview made it possible to record transient
spectra with an average error of less than 10 o.d .
a temporal chirp of the probe pulse was corrected by a
computer program with respect to a lorentzian fit of a kerr signal
generated in a 0.2 mm glass plate used in place of the sample . to obtain the sensing films ,
different mixtures were
prepared ( dye concentration of 1.5 mgml )
and shaken on a vortex - genie 2 ( scientific industries , bohemia , ny )
equipped with a homemade holder .
a nanostructure prepared by ilford
imaging switzerland following the procedure previously published was also used as the support matrix .
this nanostructure is called
ap200/19 , and it is based on a poly(ethylene terephthalate ) thin plate
coated by courting coating with aluminum oxide hydroxide , which provides
a positively charged nanostructured film with a pore diameter of 19
nm and a total pore volume of 20 mlm .
once all of the components were dissolved in chloroform , a laurell
model ws-400b-6npp / lite spin coater ( north wales , pa ) was used to
spin - coat the respective mixture on the supports .
both polystyrene
( ps ) and ap200/19 membranes were transparent and showed a thickness
between 2 and 7 m .
the luminescence measurements were
obtained by means of a varian cary - eclipse luminescence spectrometer
equipped with a xenon flash lamp , czerny turner monochromators ,
and a r-928 photomultiplier tube with manual or automatic voltage .
for gas mixing , two mass - flow controllers ( mfcs ) of type el - flow model
f-201cv bronkhorst high - tech ( ruurlo , the netherlands )
these tubes connect the mfcs
and a flow - through cell specially designed for the spectrometer .
the
o2-gas station was controlled by a home - written labview 8.2 program connected to a flow bus interface ( bronkhosrt )
that pilots the bronkhosrt mfcs via rs-232 .
a time trace curve was
used to record i0 and the intensity i at different oxygen partial pressures , which were calculated
from the measured oxygen / nitrogen flows , assuming a constant environmental
pressure of 1000 mbar .
naphthlypyridine ( npy)-based cyclometalated iridium complexes display mlct - based emission centered around 600 nm , which can be fine - tuned
depending on the coligands present in the primary coordination sphere .
the corresponding energy of the emissive state closely approaches
that of the triplet state of pyrene ( vide supra ) , making this combination
of chromophores potentially suitable to introduce reversible interchromophore
electronic energy transfer within the complex and dramatically modify
observed luminescence properties , as demonstrated for complexes based
on other metals . to test this possibility ,
two molecular cyclometalated iridium complexes were prepared , namely
the model complex ( 1 ) and the related bichromophoric
complex ( 2 ) having an appended pyrene group ( chart 1 ) . the synthetic strategy employed to obtain 1 and 2
the reaction of 2-(naphthalen-1-yl)pyridine with iridium(iii ) chloride hydrate gave the
corresponding chloro - bridged dinuclear iridium complex , 3 , which precipitated from the reaction solvent mixture 2-ethoxyethanol / water .
owing to the low solubility of this chloro - bridged dimer in common
deuterated solvents ( chloroform , dichloromethane , acetonitrile , and
dimethyl sulfoxide ) , satisfactory h nmr characterization
was not possible and 3 was initially used without further
purification .
reaction with an excess of
tbubpy in a ch2cl2/meoh solvent mixture followed
by anion exchange with pf6 gave 1 as an orange solid , which was reasonably soluble in cdcl3 and cd3cn .
the same standard protocol was
employed for the synthesis of complex 2 , using bpy - pyr as the ancillary ligand .
however , the resulting
material was contaminated with an unidentified impurity , as seen in h nmr spectra ( figure s7 in the si ) .
purification attempts by column chromatography , on 20 20
cm thin - layer chromatography plates , by reprecipitation , and by recrystallization
were all unsuccessful . to obtain pure 2 ,
reacting the dimer with 2,2,6,6-tetramethylheptane-3,5-dione in the
presence of tbaoh gave a mononuclear intermediate complex , 4 , which is highly soluble in common
organic solvents .
when previous synthetic methods were adapted , the ancillary ligand was removed upon reaction with bf3 in acetonitrile to give the bis(solvato ) complex 5 .
this bis(acetonitrile ) complex was subsequently reacted with bpy - pyr
in a dichloromethane / meoh solvent mixture , yielding pure 2 after anion metathesis and purification by column chromatography
on silica gel .
the complex was characterized by h nmr
and high - resolution mass spectrometry ( hrms ) , and the purity was assessed
by elemental analysis .
this synthetic strategy provides both an approach
to purification of chloro - bridged iridium dimers , if a chloride source
is present during acid degradation of the acetylacetonate - based complex , and a method to obtain bis(solvato ) complexes
without the use of silver salts to remove chlorides from the dimer .
electronic absorption spectra of 1 and 2 in acetonitrile at room temperature ( figure 1 ) are dominated by ligand - based absorption bands
in the uv spectral region , and similar mlct absorption bands are observed
in the visible spectral region for both molecules .
additional pyrene
absorption bands are observed for 2 , which retain their
vibronic fine structure , implying only weak ground - state coupling
between the two chromophores due to the integrated aliphatic spacer
unit . as such , each chromophore
luminescence quantum yield in an air - equilibrated ch3cn solution compared to [ ru(bpy)3 ] ( bpy = 2,2-bipyridine ) in h2o .
electronic absorption spectra of 1 ( dot - dashed line ) and 2 ( solid line ) in acetonitrile .
photoluminescence spectra show mlct - based red emission for acetonitrile
solutions of both 1 and 2 ( em max = 625 nm ; figure 2 ) with similar emission quantum yields in degassed acetonitrile ( degas = 0.1 ) .
while the latter molecule
shows a degas/air ratio of 26 ,
a much higher value of 190 is obtained with 2 , which
is consistent with a much longer excited - state lifetime ; which would
enhance diffusion - limited quenching by dissolved oxygen .
photoluminescence
spectra of 1 ( dot - dashed line ) and 2 ( solid
line ) in degassed acetonitrile at room temperature ( exc = 413 nm ) .
time - resolved spectroscopies in the subpicosecond to millisecond
regimes give further information on the nature of the excited molecule
and a clear insight into excited - state processes in the supermolecule .
an emission lifetime of 8.3 s was obtained for 1 in a degassed acetonitrile solution ( figure 3 ) , while a luminescence lifetime that is over 25 times longer ( 215
15 s ) was measured for a micromolar solution of 2 . extrapolating to
infinite dilution gave an apparent deexcitation
rate of 4400 s , or = 225 s , much
longer than that of the parent chromophore .
luminescence decay in
the 580620 nm range of dilute 1 ( a ) and 2 ( b ) in degassed acetonitrile at room temperature ( ex = 465 nm ) .
complementary transient absorption spectroscopy elucidates
the management of energy by the excited molecule prior to emission ,
and transient absorption signatures for both pyrene and iridium complexes
have been described .
excitation into the mlct absorption band
of 2 at 465 nm rapidly led to population of the pyrene
triplet , denoted by a characteristic tn t1 absorption at 410 nm ( see figure 4 ) .
the kinetics of deexcitation of this absorption band exactly parallels
those of the emission , clearly showing that while energy is principally
located on this triplet ( see the si ) , it
is quantitatively transferred to the metal center , where it is subsequently
emitted .
this observation implies the presence of quasi - isoenergetic
excited states on the adjacent chromophores permitting rapid and reversible
electronic energy transfer between them , leading to a dynamic excited - state
equilibrium .
transient absorption map of 2 showing deexcitation
of the equilibrated bichromophoric molecule in acetonitrile at room
temperature ( ex = 465 nm ) .
low - temperature phosphorescence measurements were undertaken
to elucidate the energies of the pertinent states and relative energy
levels of 1 and 2 . at 77 k , mlct emission
( em max = 572 nm ) could be observed from 1 , while emission of bichromophoric 2 was located
further to the red ( em max = 595 nm ) and is
ascribed to pyrene emission from this lower - lying state . assuming similar mlct levels in both complexes ( at rt ,
they show similar emission spectra ) , only a small energy gap is expected
between the pyrene triplet and the mlct state in 2 , which could enable reversible interchromophore electronic
energy transfer at room temperature .
because such a small energy gap
can not be measured with sufficiently high precision in this fashion ,
the energy gap was determined using analysis of data from time - resolved
spectroscopies ( vide infra ) , which also gave unambiguous evidence
for this unusual phenomenon .
the establishment of a dynamic
excited - state equilibrium from an initial non - equilibrated excited
state can be observed in real time by transient absorption spectroscopy ,
and a 5 ns rise time of the pyrene triplet absorption signature ( see
the si ) was measured .
this value gives
the rate of establishment of equilibrium ( k = 2
10 s ) and is equal to the sum of the
rate constants for forward ( kf ) and backward
( kb ) electronic energy - transfer processes .
the relative kf and kb values can not be determined by direct observation
based on transient absorption signatures because the iridium center
ground - state bleaching signal overlaps with the transient mlct absorption
signal .
rather , along with the excited - state equilibrium constant
( keq , which describes the distribution
of energy between the constituent chromophores ) , kf and kb can be estimated
using the inherent deexcitation properties of the constituent chromophores
and the observed lifetime decay of 2 ( 2 = 225 10 s ) , upon application of eqs 1 and 2 , where mlct and pyr correspond to the time constants for the
decays of the excited iridium moiety and pyrene , respectively .
corresponds to the fraction of excited pyrene - like triplets , and ( 1
) corresponds to the fraction of excited mlct - like
triplets in the equilibrated population.12keq was
thus estimated to be 27.8 2 , which means that the equilibrated
population is predominantly ( 96.5% ) in favor of the organic chromophore .
consequently , kf and kb were determined at 1.9 10 and 6.9
10 s , respectively .
determination
of keq allowed the energy gap between
the triplet levels on the adjacent chromophores to be estimated at
680 cm ( assuming e
rt ln keq ) .
the ultrafast mlct - to - mlct intersystem crossing
( isc ) rate was estimated using femtosecond transient absorption spectroscopy
upon excitation of the mlct absorption band .
on the basis of rapid
changes in the spectrum at around 520 nm , the isc rate was ca .
10
10 s. this high value corresponds
to that previously determined ( 14 10 s ) for related cyclometalated iridium complexes and implies that , following excitation , ultrafast isc precedes
a slower intercomponent energy transfer , which then leads to an excited - state
equilibrium .
the ensemble of rate constants for pertinent processes
is shown in the jablonski diagram in figure 5 .
jablonski diagram showing pertinent energy levels and kinetics of
interchromophore energy transfer and luminescence of 2 .
vr = vibrational relaxation , isc = intersystem crossing , and reet
= reversible electronic energy transfer .
kf and kb correspond to the rates of forward
and backward energy transfer , respectively .
because a long excited - state lifetime is
important for efficient oxygen detection using luminescent probes ,
the oxygen - sensing properties of dye 2 were evaluated
in solid hosts .
we followed our previously reported methodology measuring
emission intensities , in both a polymeric ps membrane and a nanostructured
metal oxide matrix ( ap200/19 ) . a significantly
better performance with ap200/19 compared to ps
was observed because
of improved oxygen permeability ; between 0 and 10% o2 ,
the stern
volmer constants are 1103 and 294 bar for ap200/19 and ps , respectively ( see the si ) .
these results make 2 one of the most sensitive iridium - based
dyes and is highly promising for lifetime - based sensing methods , which
are currently being investigated .
in
summary , time - resolved spectroscopies conclusively show for the first
time that excited - state equilibration is reached in a bichromophoric
iridium complex after a few nanoseconds via reversible intercomponent
electronic energy transfer and subsequent emission of 2 is delayed ( = 225 s ) , without compromising the emission
quantum yield . as well as offering an extremely long excited - state
lifetime , excellent initial results were obtained for low - concentration
oxygen detection and
are under further investigation . additionally ,
a specific synthetic strategy was necessary to obtain 2 as a pure material
. this strategy should prove useful in preparing
pure chloro - bridged iridium dimers and bis(solvato ) complexes without
utilizing silver salts to remove chlorides .
Output:
| a cyclometalated iridium complex
is reported where the core complex comprises naphthylpyridine as the
main ligand and the ancillary 2,2-bipyridine ligand is attached
to a pyrene unit by a short alkyl bridge . to obtain the complex with
satisfactory purity
, it was necessary to modify the standard synthesis
( direct reaction of the ancillary ligand with the chloro - bridged iridium
dimer ) to a method harnessing an intermediate tetramethylheptanolate - based
complex , which was subjected to acid - promoted removal of the ancillary
ligand and subsequent complexation .
the photophysical behavior of
the bichromophoric complex and a model complex without the pendant
pyrene were studied using steady - state and time - resolved spectroscopies .
reversible electronic energy transfer ( reet ) is demonstrated , uniquely
with an emissive cyclometalated iridium center and an adjacent organic
chromophore .
after excited - state equilibration is established ( 5 ns )
as a result of reet , extremely long luminescence lifetimes of up to
225 s result , compared to 8.3 s for the model complex ,
without diminishing the emission quantum yield . as a result , remarkably
high oxygen sensitivity is observed in both solution and polymeric
matrices . |
PubmedSumm119673 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: hairtail ( trichiurus lepturus ) , ecologically warm water fish species , belonging to family trichiuridae , widely distributed on the coast of the yellow sea , south sea and jeju island in the korean peninsula and the several sea areas in china under the natural ecosystem .
the food consumption of this species has increased considerably in various types of restaurants ( including restaurants specializing in serving hairtails roasted and soy - sauce glazed cutlass fish with radish or other vegetables ) for a long time . however , in spite of their economic and scientific significances , a little information currently exist regarding the physiological ( huh , 1999 ; cha & lee , 2004 ) and ecological levels ( zhang & sohn , 1997 ; park et al . ,
only the biological fisheries feature , distribution and migration of hairtail ( t. lepturus ) in korean waters were investigated ( kim et al . , 1998 ;
particularly , clustering analysis of the genetic distance among various fishes and/or mollusks species or populations apart from geographic sites using pcr is of little quantity ( klinbunga et al . , 2000 ;
mccormack et al . , 2000 ; park et al . , 2005 ; yoon & kim , 2010 ; song & yoon , 2013 ) , although genetic variation and species - specific and region - specific markers was assessed by molecular biological methods ( partis & wells , 1996 ; cagigas et al . , 1999 ) . in the present study , to elucidate the genetic distances and differences between geographical hairtail populations , the author performed a clustering analysis of two hairtail populations collected from korea and china .
muscle tissues were collected separately from hairtail ( trichiurus lepturus ) individuals from korea in the yellow sea and china in the east sea , respectively .
pcr analysis was performed on dna samples extracted from a total of 22 individuals using different eight oligonucleotides primers .
hairtail muscle was collected in sterile tubes , immediately placed on devrepy ice , and stored at 40c until the genomic dna extraction .
the extraction / purification of genomic dna was performed under the experimental conditions previously described ( yoon & kim , 2004 ) .
eight primers , opa-07 ( 5-gaaacgggtg-3 ) , opa-20 ( 5-gttgcgatcc-3 ) , opb-14 ( 5-tccgctctgg-3 ) , opb-15 ( 5-ggagggtgtt -3 ) , opb-17 ( 5-agggaacgag-3 ) , opb-18 ( 5-cca cagcagt-3 ) , opd-16 ( 5-acccggtcac-3 ) and urp-07 ( 20-mer ) were used to generate the bandsharing values and genetic distances which could be clearly scored .
pcr was performed using two programmable dna thermal cyclers ( perkin elmer cetus , norwalk , ct , usa ; mj research inc . ,
the concentration of the extracted genomic dna was measured by optical density at 260 nm by a spectrophotometer ( beckman coulter , buckinghamshire , uk ) .
the electrophoresed agarose gels were illuminated by ultraviolet rays , and photographed using a photoman direct copy system ( peca products , beloit , wi , usa ) .
the degree of variability was calculated by use of the dice coefficient ( f ) , which is given by the formula : f = 2 nab/(na+nb ) , where nab is the number of bands shared between the samples a and b , na is the total number of bands for sample a and nb is the total number of bands for sample b ( jeffreys & morton , 1987 ; yoke - kqueen & radu , 2006 ) .
euclidean genetic distances within- and between - populations were also calculated using the hierarchical dendevrepogram program systat ver.10 ( spss inc . , chicago , il , usa ) .
muscle tissues were collected separately from hairtail ( trichiurus lepturus ) individuals from korea in the yellow sea and china in the east sea , respectively .
pcr analysis was performed on dna samples extracted from a total of 22 individuals using different eight oligonucleotides primers .
hairtail muscle was collected in sterile tubes , immediately placed on devrepy ice , and stored at 40c until the genomic dna extraction .
the extraction / purification of genomic dna was performed under the experimental conditions previously described ( yoon & kim , 2004 ) .
eight primers , opa-07 ( 5-gaaacgggtg-3 ) , opa-20 ( 5-gttgcgatcc-3 ) , opb-14 ( 5-tccgctctgg-3 ) , opb-15 ( 5-ggagggtgtt -3 ) , opb-17 ( 5-agggaacgag-3 ) , opb-18 ( 5-cca cagcagt-3 ) , opd-16 ( 5-acccggtcac-3 ) and urp-07 ( 20-mer ) were used to generate the bandsharing values and genetic distances which could be clearly scored .
pcr was performed using two programmable dna thermal cyclers ( perkin elmer cetus , norwalk , ct , usa ; mj research inc . ,
the concentration of the extracted genomic dna was measured by optical density at 260 nm by a spectrophotometer ( beckman coulter , buckinghamshire , uk ) .
the electrophoresed agarose gels were illuminated by ultraviolet rays , and photographed using a photoman direct copy system ( peca products , beloit , wi , usa ) .
the degree of variability was calculated by use of the dice coefficient ( f ) , which is given by the formula : f = 2 nab/(na+nb ) , where nab is the number of bands shared between the samples a and b , na is the total number of bands for sample a and nb is the total number of bands for sample b ( jeffreys & morton , 1987 ; yoke - kqueen & radu , 2006 ) .
euclidean genetic distances within- and between - populations were also calculated using the hierarchical dendevrepogram program systat ver.10 ( spss inc . , chicago , il , usa ) .
oligonucleotides primers were used generating a total of 777 scorable fragments in hairtail population from korea and 783 in population from china , respectively , ranging in size of dna fragments from larger than approximately 150 to larger than 2,400 bp ( fig .
1 ) . the complexity of the banding patterns varied devrepamatically between primers and/or geographically separated locales .
various researchers have studied the sizes of dna fragments in the pcr profiles of barramundi ( lates calcarifer ) ( partis & wells , 1996 ) , brown trout ( salmo trutta ) ( cagigas et al . , 1999 ) , crucian carp ( carassius carassius ) ( yoon & park , 2002 ) , and yellowfin tuna ( thunnus albacares ) ( diaz - jaimes & uribe - alcocer , 2003 ) .
particularly , the oligonucleotides decamer primer , opf-10 produced 11 amplified fragments , with sizes from 200 bp to 600 bp ( diaz - jaimes & uribe - alcocer , 2003 ) .
six primers were also commonly used , generating a total of 602 scorable bands in catfish , and 195 in the bullhead population , respectively , ranging in dna fragment size from approximately 100 bp to more than 2,000 bp ( yoon & kim , 2004 ) .
the similarity matrix based on the average bandsharing values of all of the samples within hairtail population from korea ranged from 0.784 to 0.922 , whereas 0.658~0.843 within population from china ( table 1 ) .
the average bandsharing value ( meansd ) within hairtail population from korea showed 0.8590.031 , whereas 0.7520.039 within population from china . also , bandsharing values between two hairtail populations ranged from 0.473 to 0.611 , with an average of 0.5420.059 .
04 showed the highest level ( 0.922 ) within hairtail population from korea , whereas the value between individual no . 01 and no .
08 showed the lowest level ( 0.784 ) . also , the bandsharing value between no .
19 showed the highest level ( 0.843 ) within hairtail population from china , whereas the value between no .
as compared separately , the bandsharing values of individuals within hairtail population from korea were comparatively higher than those of individuals within population from china . additionally , the bandsharing value between individual no . 02 and no .
12 showed the highest level ( 0.611 ) between two geographic hairtail populations , whereas the value between individual no . 04 and no .
the bandsharing values between two hairtail populations , with an average of 0.5420.059 , as calculated by bandsharing analysis , were different from the results of yoon & park ( 2002 ) stated that the average level of bandsharing obtained by the five decamer primers used was 0.4000.050 in the wild crucian carp population , contrast with 0.6900.080 observed in the cultured crucian carp population .
pcr - generated electrophoretic profiles in korean ( lane 1 - 11 ) and chinese hairtail ( lane 12 - 22 ) amplified by oligonucleotides primers opa-7 ( a ) , opa-20 ( b ) , opb-14 ( c ) , opb-15(d ) and opb-17(e ) .
amplified products were electrophoresed on a 1.4% agarose gel and detected by staining with ethidium bromide .
100 bp ladder marker was utilized as a dna molecular size marker ( m ) .
similarity matrix including bandsharing values ( bs ) calculated using nei and li 's index of the similarity of korean and chinese hairtail populations , respectively the hierarchical dendevrepogram resulted from reliable oligonucleotides primers , indicating two genetic clusters composed of cluster 1 ( koreanhair1~koreanhair11 ) and cluster 2 ( chinesehai12~chinesehai22 ) .
the longest genetic distance ( 0.476 ) displaying significant molecular difference was also between individual no .
01 within hairtail population from korea and no . 22 from chinese . in the present study
, pcr analysis has revealed significant genetic distances between two hairtail population pairs ( p<0.05 ) .
( 1999 ) and yoon & kim ( 2004 ) . via the cluster analysis of genetic similarity values obtained from genetic data ,
the genetic distance ranged from 0.091 to 0.316 within and among four natural spanish populations of brown trout ( salmo trutta ) ( cagigas et al .
the principal aspect of the dendevrepogram was also a remarkable separation of sample 1 from the others , which were closely grouped .
accordingly , pcr analysis generated on the pcr data showed that the geographic hairtail population from korea in the yellow sea was more or less separated from geographic hairtail population from china in the east china sea .
high levels of genetic polymorphisms and the existence of population differentiation between two hairtail populations showed pcr approach is one of the suitable tools for individuals and/or population biological dna studies . as stated above , using several oligonucleotides primers , this pcr analysis has been applied to identify specific / polymorphic markers particular to breed , species and geographical population , as well as genetic polymorphism / diversity in numerous organisms ( partis & wells , 1996 ; mccormack et al . , 2000 ; klinbunga et al .
, 2000 ; diaz - jaimes & uribe - alcocer , 2003 ) . hierarchical dendevrepogram of genetic distances showing the relatedness among different individuals of hairtail population from korea ( koreanhair01~koreanhair11 ) and population from china ( chinesehai12~chinesehai22 ) generated according to the bandsharing values and similarity matrix .
Output:
| pcr analysis generated on the genetic data showed that the geographic hairtail ( trichiurus lepturus ) population from korea in the yellow sea was more or less separated from geographic hairtail population from china in the south sea .
the average bandsharing value ( meansd ) within hairtail population from korea showed 0.8590.031 , whereas 0.7520.039 within population from china . also , bandsharing values between two hairtail populations ranged from 0.470 to 0.611 , with an average of 0.5420.059 .
as compared separately , the bandsharing values of individuals within hairtail population from korea were comparatively higher than those of individuals within population from china .
the hierarchical dendevrepogram resulted from reliable oligonucleotides primers , indicating two genetic clusters composed of cluster 1 ( koreanhair1~koreanhair11 ) and cluster 2 ( chinesehai12~chinesehai22 ) .
the genetic distances between two geographic populations ranged from 0.038 to 0.476 .
individual no .
11 within hairtail population from korea was genetically closely related with no .
10 ( genetic distance=0.038 ) .
the longest genetic distance ( 0.476 ) displaying significant molecular difference was also between individual no .
01 within hairtail population from korea and no . 22 from chinese . in the present study
, pcr analysis has revealed significant genetic distances between two hairtail population pairs ( p<0.05 ) . |
PubmedSumm119674 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| key clinical messagethis case demonstrates the rare coexistence of a prolactinoma with craniopharyngioma and documents its radiological growth .
this case suggests that patients with pituitary neoplasms should be followed closely and although prolactinomas can often be managed medically , a coexistent other lesion may require surgery for histological assessment and to reduce mass effect . |
PubmedSumm119675 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: though pregnancy and labor are considered a physiological process the potential for catastrophic complications is constant and may develop in a matter of minutes .
. global prevalence of samm ( defined as severe life threatening obstetric complication necessitating urgent medical intervention in order to prevent likely death of the mother ) varies from 0.015 to 8.23% .
samm which require high dependency unit ( hdu ) interference . the uk department of health defined hdu care as a level of care which lies in between a general ward and an intensive care unit ( icu ) .
it typically involves the patients with single organ failure and patients who are at a high risk of developing life threatening complications . in western india the incidence of mothers requiring intensive care unit is around 5.48 per 1000 deliveries . in eastern india
we retrospectively analyzed the demographic parameters , reason for admission , course of the stay , prognostic factors and final outcome in hdu requiring cases .
the aim was to review the obstetric admissions to our institutional hdu in terms of hdu utilisation rate , indications for admission , interventions needed and ultimate fetomaternaloutcome .
this retrospective cohort study was conducted from may 2007 to may 2011 in the department of obstetrics and gynaecology , ipgme and r , kolkata after ethical permission was granted from institutional ethical committee .
a dedicated 14 bedded hdu complying with standard recommendation of size , equipment , medical and paramedical staffs is present . of the total 5052 deliveries conducted over a period of four years
a total these obstetric patients 57 parturients required hdu during their course of treatment and were included in this study .
obstetric morbidity was defined as morbidity originating from any cause related directly to pregnancy or its management during antepartum , intrapartum or postpartum period ( up to 42 days after delivery ) .
maternal demographic characteristics included age , past obstetric history and history of any underlying medical disorder .
relevant data regarding obstetric events , indications for hdu transfer / admission , interventions required , length of stay , eventual outcomes were collected , reviewed , tabulated and analyzed .
antenatal mothers were monitored clinically along with cardio tocography , biophysical profile and doppler study .
all patients were individualized and managed with invasive or non - invasive measures as and when required .
statistical data was analyzed by graph pad prism version 4.03 ( graph pad software . in corporation , 2005 ) .
fisher 's exact test was employed to compare categorical variables between study and control subjects .
demography of our study population revealed [ table 1 ] mean age of patients with only obstetric morbidity and cases with prior medical disease at 24.6 4.23 and 24.9 4.33 years respectively .
thirty one primipara ( 54.38% ) and 26 multipara ( 45.61% ) were observed to have required hdu admission .
mode of delivery was either vaginal or abdominal as per obstetric indication and a majority ( 73% ) had delivered at home .
forty eight mothers ( 84.21% ) received no prior antenatal care . on examination anemia was present in all patients [ table 2 ] with haemoglobin level ranging between 6 to 9 gm / dl .
hypotension , tachycardia and fever were observed in 29 ( 50.87% ) , 56 ( 98.29% ) and 22 ( 38.59% ) women respectively .
hypertension was present in 12 women with blood pressure ranged between 140/90 and 200/ 120mmhg .
other disease specific features were splenomegaly , gum bleeding and icterus . interventions [ table 3 ] required during hdu stay were inotropes ( 14 ) , antibiotics ( 57 ) , mechanical ventilation ( 11 ) and central venous monitoring ( 23 ) .
nine out of 10 patients with acute kidney injury ( aki ) required hemodialysis while the tenth patient improved spontaneously on third day of delivery with antibiotics , inotropes and blood transfusion .
indications for hdu utilization as described in table 4 showed that thirty nine ( 68.12% ) women presented with various obstetric complications like ; septicemia ( 20/57 = 35.08% ) , hypertension in 12 cases ( 21.05% ) which included pre - eclampsia ( 7 ) , eclampsia ( 3 ) and two women with hellp ( hemolysis , elevated liver enzymes and low platelet count ) , postpartum hemorrhage ( pph ) ( 17/57 = 29.82% ) , antepartum hemorrhage including one placenta previa and one abruption placenta case ( 2/57 = 3.5% ) , post surgical aki ( 10/57 = 17.54% ) , uterine perforation during abortion ( 2/57 = 3.5% ) , uterine rupture due to placenta percetra ( 1/57 = 1.57% ) and one ruptured ectopic pregnancy .
sepsis was mainly peureperal , postoperative , following criminal abortion or due to pyelonephritis , chrioamnionitis and following acute blood loss .
one of these patients with attempted criminal abortion at 24 weeks of gestation had sigmoid colon injury , for which colostomy was initially carried out and then dead baby delivered vaginally .
post surgical aki patients included 7 women with history of lscs and 3 cases that required hysterectomy for pph .
eighteen ( 31.57% ) obstetric patients with medical disorders required hdu [ table 5 ] .
the disorders included ( ppcm ) peripartum cardiomyopathy ( 4 ) , systemic lupus erythematus ( 2 ) , grade iv ms with twins(1 ) , infective endocarditis with dengue ( 1 ) , atrial tachycardia ( 1 ) , idiopathic dcm ( 1 ) , chronic demylinatingpolyneuro radiculopathy ( cidp ) ( 1 ) , acute pancreatitis ( 1 ) , takayasu arteritis ( 1 ) , deep vein thrombosis ( dvt ) with pregnancy ( 1 ) , thalassemia intermedia ( 1 ) , hepatitis e ( 2 ) and one of the each patient with non specificaortoarteritis and acute gall bladder syndrome . table 6 compared the patients with only obstetric complications with those having pre - existing medical disorders .
obstetric group ( group a ) had mean gestational age of 35.8 6 weeks at delivery where as patients with medical disorders ( group b ) had 32.5 9 weeks .
morbid sequelae like respiratory failure , cardiac failure , prolonged hospital stay and prolonged time for recovery were observed more with group b. five maternal deaths ( 8.77% ) occurred in the group with medical disorders ( group b ) compared to two ( 3.5% ) in group - a .
causes of maternal mortality in obstetric group were cardiac failure in eclampsia and post hemorrhage sepsis leading to multi - organ failure and dic ( disseminated intravascular coagulation ) . in group - b mortality occurred in a patient with acute pancreatitis , one sle case with grade iv nephropathy , one patient with ppcm who presented postpartum with ejection fraction ( ef ) at 23% , one patient with hepatitis e who developed hepatic encephalopathy and one patient with dvt succumbed after pulmonary embolism .
demography particulars of the study population clinical profile at admission in hdu investigations and interventions required in hdu observed obstetrical indications for admission in hdu observed medical indications for admission in hdu comparison of obstetric and non obstetric group in terms of maternal outcome fifty seven pregnancies resulted in 48 live births [ table 7 ] .
one patient with eclampsia delivered still born at 32 weeks . in non obstetric group fetal demise
was observed in sle , ppcm , severe ms with twin pregnancy and the case with acute pancreatitis .
during the 4 year study period 5052 mothers delivered and 57 patients required hdu admission . thus obstetric admission in hdu was 11.2 per 1000 deliveries .
this data from eastern india differed from that of western india , where incidence of icu utilization by obstetric patients was 5.4 per 1000 deliveries , during 5 years .
the incidence varies widely among developed nations also:1.3 in 10 years in hong kong , 2.4 over two years in netherlands , 10.2 in 4 years in dublin ( ireland ) and 26.7 in 23 years in uk .
unfortunately , data regarding hdu requirement for obstetric causes from other developing nations is lacking .
it is interesting to note that despite gross socio economic differences hdu / icu utilization rate here , was almost comparable to some of the developed countries like ireland and uk .
limited accessibility and inadequate availability of hdu , icu services and higher mortality prior receiving medical attention may help explain this contradiction .
we feel that this above incidence of hdu utilization reveals just the tip of the iceberg .
the indications leading to hdu admission were analyzed among the obstetric patients with only pregnancy induced complications .
sepsis accounted for the majority ( 35.08% ) of admissions , followed by pph ( 29.82% ) and severe hypertensive disorders ( bp160/100mmhg)of pregnancy ( 21.05% ) .
common causes of sepsis were massive obstetric hemorrhage , chorioamnionitis , uti , puerperal infections and sequelae of operative interventions including criminal abortions .
the common offending pathogens were escherichia coli , klebsiella , staphylococcus aureus , pseudomonas aeruginosa , bacteroids and anaerobes .
the underlying factors responsible for sepsis were unsupervised home delivery in unhygienic environment , failure to administer necessary antibiotics , rising trend of operative intervention and increased incidence of pph occurring in the background of maternal malnutrition and anemia .
it has been postulated that anemia predisposes to susceptibility to sepsis . of the whole study population forty eight ( 84.21% )
cases were unbooked and referred with unsupervised no previous history of antenatal care . on analyzing the association of sepsis with surgical procedures , we observed that almost 21.05% ( 12/57 ) of cases developed sepsis after various operative procedures ( two criminal abortions , seven lscs and three hysterectomies indicated for pph ) . in other studies the important obstetric causes for hdu admission revolve around pph and hypertensive disorders.[469 ] sepsis ranked least in all the above series .
although in our study more commonly sepsis was associated patients requiring hdu for obstetric reasons only , while hongkong study observed sepsis mostly among non obstetric cases . in this study pph and hypertensive disorders were the next two common causes .
in rural india majority of the deliveries are conducted at home or at health centre 's with inadequate infrastructure .
naturally unsupervised deliveries , dogmatic traditional approaches during birth , failure to use of uterotonics and underlying anemia continue to make pph responsible for almost 28% of maternal mortality in india .
it has been observed that anemia and poor nutrition contribute to the risk of hemodynamic compromise arising from blood loss during delivery and this increases the maternal morbidity . regarding hypertensive patients requiring hdu care , the probable reasons appeared to be lack of timely diagnosis and inappropriate management coupled with ignorance of life threatening complications like hellp and eclampsia . among non obstetric complications we observed various medical disorders necessitating hdu admission .
majority were patients with cardiac disease ppcm ( 4 ) , grade iv ms with twins ( 1 ) , infective endocarditis with dengue ( 1 ) , atrial tachycardia ( 1 ) and idiopathic dcm ( 1 ) .
anticipatory admissions included a patient with atrial tachycardia requiring emergency lscs and another with cidp . keeping in mind the imminent risk of respiratory failure in cidp she was kept admitted in hdu and later delivered by lscs at 35 weeks due to progressive fetal growth restriction ( fgr ) ( baby weight 2.1 kg ) .
the patient with atrial tachycardia had a heart rate of 150 - 170/min in her last trimester , which remained refractory to treatment and ultimately subsided after delivering the baby .
emergency admissions included life threatening obstetrical complications along with medical disorders like sle , ms with twins , non specificaortoarteritis and hypertensive retinopathy with superimposed pre eclampsia etc .
immediate maternal disease related morbidities were significantly increased in the obstetric cases with prior medical disease , these included cardiac failure , respiratory failure , and prolonged hospital stay and increased recovery time .
majority of women from this group also delivered prior to term . in subsequent follow - up patients
were found to have developed crf ( 1 ) , chronic hypertension ( 2 ) and persistent left ventricular dysfunction ( 1 ) . in the present series patients with medical disorders had more mortality in comparison to obstetric group ( 5/18 vs. 2/39 ; p 0.05 ) .
fetal outcome was also worse in the non obstetric category with more incidence of premature babies , fgr , still birth and early neonatal death .
maternal mortality was 12.28% and fetal mortality was 17.54% ( stillborn-4 , early neonatal death-3 , abortions-2 , ectopic-1 ) .
the other indian study from western india reported fetal and maternal mortality of 52% and 21.6% respectively .
in contrast in developed countries maternal mortality of hdu admissions was nil while prenatal mortality was 1.05% to 8% .
one salient point noted was that unbooked patients and those referred from remote rural areas had worse prognosis . in this study maternal mortality and or transfer to iccu ( intensive coronary care unit)/itu ( intensive therapeutic unit ) were taken as worst outcome end points .
the main reasons were poor nutrition coupled with unsupervised births , illegal abortions , absence of modern diagnostic / therapeutic amenities , anesthetic hazards and finally delay in referral and necessary intervention .
also attributed high maternal age , absence of prenatal care , transfer to icu > 24 hours after onset of acute problem and severity of illness at the time of admission as assessed by apache ii score to be the factors responsible for maternal mortality .
we failed to find any significant relation between maternal mortality or morbidity with age , parity and gestational age .
improved treatment strategies for obstetric hemorrhage and sepsis along with timely management of critically ill patients in the high - dependency unit may help decrease maternal mortality and morbidity as a high - dependency care unit fulfils the needs of at least half of the obstetric population who require higher acuity care and simultaneously save considerable expenditure .
emphasis on early detection of maternal problems and prompt referral to tertiary centers could minimize the prevalence of multiple organ failure and mortality in these women .
our findings highlight the need for establishing a high dependency unit in all such centre 's in order to avoid unnecessary admission to the intensive care unit and to ensure proper management . again , since puerperal morbidity has now become a focal parameter for quality of maternal care , a continued psychosocial follow - up of these patients should ideally be implemented to ensure better quality of life .
this review is a reminder that constant vigilance , judicious judgment along with provision of adequate resources are still the major stepping stones on the road to maternal safety .
Output:
| aim : to analyze the hdu requirement in an obstetric population in terms of utilization rate , indications for admission , interventions required and gestational outcome.setting and design : a retrospective observational study was carried out from may 2007 to may 2011 in the dept . of obstetrics and gynecology and hdu of ipgme and r , kolkata.materials and methods : data related to obstetric history , pre - existing medical problems , indications for hdu admission , interventions required , length of stay and outcome were collected and results were analyzed.results:our obstetric hdu utilization rate was 11.2 per 1000 deliveries . out of total 57 subjects 48 had no prior antenatal care . majority ( 68.42% ) admitted in hdu with only obstetric reasons , while 31.57% required hdu for pre - existing medical diseases .
the major obstetric indications were septicemia ( 35.08% ) , pph ( 29.08% ) and hypertension was observed in 21.05% of women .
other less common causes included post surgical acute kidney injury , aph , chrioamnionitis and pyelonephritis .
half of the women with pre - existing medical disease had cardiovascular problems .
patients with medical diseases had more pre - term labor ( 10 vs 5 ; p 0.05 ) , respiratory failure ( 9 vs 2 ; p 0.05 ) , cardiac failure ( 7 vs 1 ; p 0.05 ) , duration of stay more than 10 days ( 15 vs 6 ; p 0.05 ) , fetal growth restriction ( 6vs 3 ; p 0.05 ) and prolonged recovery time .
maternal mortality was 12.28% and fetal mortality was 17.54%.conclusion : early screening of high risk mothers , vigilant antenatal care and proper maintenance of asepsis during delivery and postpartum period can reduce hdu utilization rate and can result in healthier outcome . |
PubmedSumm119676 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: worldwide , more than 14 million new cases of cancer were diagnosed in 2012 ( ferlay et al . , 2013 ) , and
the annual number of incident cancers is expected to reach 24 million in the next two decades , reflecting population ageing , trends towards earlier detection and increasing exposure to risk factors .
it is estimated that between a third and a half of all cases are preventable through reduction of modifiable exposures , including smoking , unhealthy diet , physical inactivity , alcohol consumption , infections or occupational hazards ( vineis and wild , 2014 ) . however , the translation of available evidence on the causes of cancer into preventive action will also depend on the population s health - related beliefs , including the perception of susceptibility to the disease , as well as specific knowledge of its determinants and preventive measures ( sarafino and smith , 2011 ) .
this study aims to describe different aspects of health - related knowledge of cancer in the portuguese population , including the perception of risk and knowledge of the leading causes of cancer and the main preventive behaviours .
the present analysis was based on a national survey conducted in 2012 , aiming to assess knowledge and health behaviours of the portuguese population aged between 16 and 79 years .
a stratified probabilistic sampling procedure was used to identify 150 geographical units , among which a total of 585 starting points were designated for the selection of households through standard random route procedures .
all of the potentially eligible dwellers were identified in each selected household and only the one whose previous birthday was closest to the date of this contact was invited ; a total of 1624 valid interviews were obtained ( response rate : 70.8% ) .
participants were evaluated through face - to - face interviews conducted using a structured questionnaire .
statistical analyses were carried out using stata , version 11.1 ( stata corp lp , college station , texas , usa ) . the associations between explanatory variables and cancer - related knowledge were estimated through adjusted ( sex , age , education ) regression coefficients or prevalence ratios ( pr ) , with 95% confidence intervals ( 95% ci ) , using linear and poisson regression , respectively . all estimates were weighted to be representative of the portuguese population .
the survey was approved by the ethics committee of the university of porto , and all participants provided written informed consent .
the proportion of nonrespondents ranged from 13.4% , when participants were asked to select the most frequent cancer in portugal ( fig .
1a ) , to 63.5% , when the leading cause of cancer was to be named ( fig .
for all questions , the frequency of nonresponse decreased with education , and older participants were less likely to estimate the lifetime risk of cancer ( p for trend=0.001 ) .
knowledge of cancer frequency ( a ) , leading cause of cancer ( b ) and behaviours for cancer prevention ( c ) .
percentage of participants selecting each option from a list of possible answers . includes skin ( melanoma ) , skin ( with no other specification ) , liver , oesophagus , pancreas , leukaemia and other cancers .
percentage of participants naming each cause of cancer ( open question ) , on the basis of a qualitative data analysis ( thematic coding ) , defined to include the most frequent answers . includes smoking , unhealthy diet , consumption of alcoholic beverages , sun exposure , overweight / obesity , lack of physical activity and other unhealthy lifestyles .
includes poor medical care , air pollution , exposure to chemicals or toxic products , consumption of medicines and other diseases .
includes doing regular physical activity , taking multivitamins , being weighed regularly , taking regular measurements of blood pressure and other behaviours . the mean estimate for
the lifetime risk of cancer was 37.0% , being lower in men ( =6.93 , 95% ci : 10.74 to 3.12 ) ( fig .
breast cancer was identified as the most frequent in portugal ( 47.5% among respondents ) ( fig .
men were less likely to mention breast cancer ( pr=0.68 , 95% ci : 0.560.81 ) and more likely to refer to lung cancer as the most frequent ( pr=2.05 , 95% ci : 1.492.82 ) .
the most educated participants referred to prostate cancer less often ( > 12 vs. 04 years : pr=0.36 , 95% ci : 0.140.93 ) . in terms of the leading cause of cancer , lifestyles ( mostly smoking ) were the most frequently referred to ( 72.0% among respondents ) ( fig .
those with higher educational levels were less likely to report lifestyles ( > 12 vs. 04 years : pr=0.71 , 95% ci : 0.580.88 ) and more likely to mention genetics ( > 12 vs. 04 years : pr=3.37 , 95% ci : 1.796.37 ) .
reference to genetic causes increased with age , up to the 6069 year age group .
not smoking was identified as the most important preventive behaviour by 40.2% of the respondents ( fig .
men were more likely to select not smoking ( pr=1.32 , 95% ci : 1.081.60 ) and less likely to indicate having regular blood analysis ( pr=0.51 , 95% ci : 0.290.88 ) .
more educated participants ( > 12 vs. 04 years ) were less likely to select not smoking ( pr=0.65 , 95% ci : 0.460.90 ) and having regular blood analysis ( pr=0.37 , 95% ci : 0.140.99 ) , and more likely to choose a healthy diet ( pr=1.58 , 95% ci : 1.002.51 ) and having regular health check - ups ( pr=2.11 , 95% ci : 1.333.34 ) .
a more frequent reference to a healthy diet was observed with increasing age ( p for trend=0.008 ) .
our results show gaps in specific knowledge related to cancer and , therefore , a large potential for improvement , as observed previously ( adlard and hume , 2003 ) . however , the interpretation of these results is subjective and needs to consider that the different dimensions of cancer - related knowledge may have distinct implications for prevention efforts .
for instance , compared with limited perception of the population s risk , the high proportions of nonresponse or inaccurate answers in terms of preventive behaviours are likely to reflect more relevant gaps in knowledge .
cancer is estimated to affect approximately one - quarter of the portuguese population before age 75 ( ferlay et al . , 2013 ) , which is less than the estimated by the participants in our study ,
although the lifetime risk may be higher as the overall incidence of cancer further increases after 75 years of age .
the use of an open - ended numeric scale may have inflated the estimates and contributed towards higher proportions of nonresponse ( woloshin et al . , 1999 ) .
our findings may also reflect the increasing number of survivors ( pacheco - figueiredo et al . , 2013 ) , who may share their experience with others , and the negative perception of cancer by the general population .
the sex differences observed may result from the fact that men are less likely to search for cancer - specific information ( rutten et al .
, 2006 ) , despite having a higher risk of cancer ( ferlay et al . , 2013 ) .
among the most frequent malignancies , breast cancer was identified as the most common in portugal , which may reflect the existence of screening programmes and the large coverage of breast cancer by the mass media ( lewison et al . , 2008 ) .
the high proportion of participants identifying lifestyles as the leading cause of cancer or not smoking as the most important preventive behaviour , especially among men , is in accordance with the global efforts at tobacco control observed in europe in the last few years , as well as with the higher prevalence of smoking in men ( carreira et al . , 2012 ) .
the increasing use of sophisticated technologies for the detection of asymptomatic diseases at early stages ( webster , 2002 ) , as well as misconceptions on the effectiveness of some screening procedures , may have contributed towards blood analysis and regular check - ups being often identified as preventive behaviours , and may reflect a blurring of the boundaries between primary and secondary prevention .
previous investigations have shown that more educated individuals were more likely to seek cancer - related information ( rutten et al . , 2006 ) , including about hereditary cancers , which is in accordance with the patterns observed in our study on the variation in cancer - related knowledge according to education .
the present study provides baseline data on health - related knowledge of cancer prevention , which may be used for the planning and evaluation of awareness - raising and primary prevention interventions in portugal .
the present study provides baseline data on health - related knowledge of cancer prevention , which may be used for the planning and evaluation of awareness - raising and primary prevention interventions in portugal .
Output:
| the increasing number of new cases of cancer highlights the relevance of primary prevention for cancer control , which is influenced , among other factors , by the population s health - related knowledge .
therefore , we aimed to describe cancer - related knowledge in portugal , including perception of risk , awareness of cancer causes and preventive behaviours .
we evaluated 1624 portuguese - speaking dwellers , aged between 16 and 79 years , through face - to - face interviews conducted using a structured questionnaire .
we computed adjusted ( sex , age , education ) regression coefficients and prevalence ratios , using linear and poisson regression , respectively , to quantify associations with cancer - specific knowledge .
the proportions of nonresponse ranged from 13.4 to 63.5% for the most frequent cancer in portugal and the leading cause of cancer , respectively .
the mean of the estimated lifetime risk of cancer in the portuguese population was 37.0% .
a total of 47.5% of the respondents identified breast cancer as the most frequent in portugal , 72.0% named lifestyles as the leading cause of cancer and 40.2% selected not smoking as the most important preventive behaviour .
lower levels of education were associated with higher proportions of nonresponse , but not consistently with inaccurate knowledge .
men provided lower estimates of the lifetime risk of cancer , indicated breast cancer less frequently and more often lung cancer as the most frequent , and were more likely to select not smoking as the most important preventive behaviour .
the present study provides relevant data on knowledge of cancer prevention , which may be used for the planning and evaluation of awareness - raising and primary prevention interventions in portugal . |
PubmedSumm119677 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: one
of the major infectious diseases that causes significant mortality
around the world is malaria .
currently , primaquine ( pq , figure 1 ) has been used as the drug to treat the liver stage
of this disease . however , a major concern
for primaquine is that its metabolites are able to cause hemolytic
anemia , particularly in glucose-6-phosphate dehydrogenase ( g6pd ) deficient
patients .
the hemotoxicity is related to the conversion of hemoglobin
to methemoglobin , which can not carry molecular oxygen , and the simultaneous
generation of reactive oxygen species , such as superoxide radical
and hydrogen peroxide . from various experimental studies
, it is known that
the degree of hemotoxicity varies in different primaquine metabolites .
for example , 5-hydroxyprimaquine , 5,6-dihydroxyprimaquine , and 6-methoxy-8-(n - hydroxy)aminoquinoline generate more methemoglobin than the parent molecule .
although the attempt to discover
less toxic antimalarial drugs has attracted significant attention , the chemical mechanism of how methemoglobinemia is caused remained
unknown over the past several decades , which , unfortunately , significantly
hampered the discovery of new and safer antimalarial drugs .
since the methemoglobinemia involves a redox reaction , we
believe
that electron transfer processes are the key to understanding its
mechanism . based on our extensive density functional theory ( dft ) ,
molecular dynamics , and quantum mechanics / molecular mechanics ( qm / mm )
studies , we tested the possibilities that ( i ) pq and its derivatives
are not involved in the electron transfer process or that ( ii ) they act as the electron acceptor , and showed proof against both proposed mechanisms .
the third possibility is that pq and its derivatives act as the electron
donor in the redox process , which is in fact supported by our computational
studies .
specifically , we found that upon binding
to hemoglobin , 5-hydroxyprimaquine is able to donate an electron to
the hemoglobin - bound o2 . in the meantime
these
two electrons help the conversion of o2 to h2o2 and simultaneously generate methemoglobin .
furthermore ,
we also showed that an electron - donating
group ( edg ) at the 5-position makes it easier for the corresponding
primaquine derivative to lose an electron .
in contrast , an electron - withdrawing
group ( ewg ) at the 5-position makes this process more difficult .
hence ,
a 5-position ewg - substituted primaquine derivative may generate less
methemoglobin , which is worth considering in the future development
of this class of drugs .
in addition to these studies , we also investigated
the methemoglobinemia potential and the feasibility of formation of
the hydroxylated derivatives of npc1161 , a developmental antimalarial
compound with better efficacy and lower toxicity . in this study
, we further considered the effect of
a substituent
at all other positions of primaquine on its ionization potential .
the results obtained from this work may be used to predict the potential
of these primaquine derivatives to generate methemoglobin and guide
the future design of this class of drugs .
geometries were optimized in the gas phase using
the b3lyp method with the 6 - 31g(d , p ) basis set .
frequency calculations
were also performed at this level to confirm that all the optimized
structures correspond to minima on the potential energy surface and
to obtain zero - point vibrational energies ( zpve ) .
relative energies
in the gas phase were obtained by performing single point calculations
at the b3lyp/6 - 311+g(2df , p ) level based on the above optimized geometries ,
and these were corrected with the zpve from the smaller basis set ,
that is , b3lyp/6 - 311+g(2df , p)//b3lyp/6 - 31g(d , p ) + zpve[b3lyp/6 - 31g(d , p ) ] .
all the gas phase energies reported in this work were obtained at
this level .
to investigate the effects of the polarity of the environment ,
the optimized gas - phase structures were used for single point calculations
employing the integral equation formalism polarizable continuum model
( ief - pcm ) at the b3lyp/6 - 311+g(2df , p )
level .
a dielectric constant ( ) of 78.36 was used to model
aqueous solution .
the ionization potentials ( ips ) were calculated
according to the following definition : the atomic orbital contributions to the highest
occupied molecular orbital ( homo ) were obtained by performing population
analysis using gaussian 09 .
the b3lyp method has been used previously
for calculation of ips that agree well with experiment .
previously , we studied the interaction
between 5-hydroxyprimaquine and hemoglobin , which led to our proposed
methemoglobinemia mechanism . in this
study , we first considered the effect of an -oh group at all other
exocyclic positions on the ionization potential ( ip ) of primaquine .
an extended side chain conformation was used for all the pq derivatives
considered in this work , as was done in our previous study .
the ips of all the derivatives are listed in
table 1 . when any of the exocyclic positions
is substituted with an -oh group ,
the ip of the resulting derivatives
is smaller than that of pq itself . in the gas phase , 5-oh - pq has the
smallest ip of 585.3 kj mol , while 3-oh - pq has
the largest ip of 620.1 kj mol , which is 34.8
kj mol higher in energy than that of 5-oh - pq and
is still 3.2 kj mol less than that of pq . in solution ,
the ips of all the derivatives
significantly decrease
by 128.0135.1 kj mol , most likely due
to the stabilization effect of the solution .
however , compared with
the gas phase , the same trend was observed in solution .
for example ,
5-oh - pq has the smallest ip , while 3-oh - pq has the largest ip , 1.4
kj mol less than that of pq .
according to
our previously proposed mechanism that
the methemoglobinemia caused by the pq derivatives
may be determined by their ionization potentials , hydroxylation at
any of the exocyclic positions should make the corresponding derivative
able to generate more methemoglobin .
in addition , the 5-oh substituted
derivative should be able to generate the most significant methemoglobinemia ,
because it has the smallest ip .
in addition to the hydroxylated
derivatives , we also considered
all the possible methylated derivatives .
similar to the effect of the hydroxyl
group , the -ch3 substituent at the 5-position results in
the smallest ip in both the gas phase and solution , compared with
the same substituent at all other positions .
however , the difference
between the ip of 5-ch3-pq and of those pq derivatives
with the same substituent at other positions is much smaller than
the differences found for the hydroxylated derivatives . specifically ,
the ip of 5-oh - pq is smaller than those of the other -oh substituted
derivatives by 26.234.5 kj mol in solution .
in contrast , the ip of 5-ch3-pq is smaller than those of
the other -ch3 substituted derivatives by only 6.012.4
kj mol in solution .
this is likely due to the
weaker electron - donating ability of the -ch3 group compared
with the -oh group . for comparison ,
the ips of pq
in the gas phase and in solution are also listed .
the calculated ips of all possible
nitro and trifluoromethyl derivatives are listed in tables 3 and 4 , respectively .
it
can be seen that all of them have larger ip than the parent pq molecule
both in the gas phase and in solution , which is the opposite of the
effect of having an edg substituent at the exocyclic position . for
both the nitro and trifluoromethyl compounds , the 4-position substituted
derivatives
have the lowest ip in the gas phase , while the 3-position
substituted derivatives have the lowest ip in solution .
this is different
from the edg - substituted derivatives , in which substitution at the
5-position results in the smallest ip .
however , it should also be
noted that the ips of the 2- , 3- , and 4-position substituted derivatives
are quite close , with the largest difference being only 7.7 kj mol .
the largest ip was found with substitution at the
5-position in the gas phase and at the 7-position in solution . however ,
the difference between the ips of the 5-position and 7-position substituted
derivatives is very small and is within 2 kj mol .
hence , the 5-position seems to be particularly sensitive to the
substituent with respect to change in the ip . specifically , an edg
at this position results in the lowest ip both in the gas phase and
in solution .
in contrast , an ewg at this position results in the largest
ip in the gas phase and the second largest ip in solution , which is
only marginally smaller than the largest ip . for comparison , the ips of pq
in the gas phase and in solution are also listed . for comparison ,
the ips of pq
in the gas phase and in solution are also listed .
it has been previously shown that the ip of a molecule is determined in part by its
highest occupied molecular orbital ( homo ) . in order to understand
the significant effect of a substituent at the 5-position , we plotted
the homo of primaquine , which is shown in figure 2 .
it can be seen that the homo is primarily localized on the
aminoquinoline ring as well as the exocyclic nh moiety at
the 8-position .
the contribution of the individual atomic orbitals
to the homo was also analyzed and is provided in table 5 .
it can be seen
that the 2p orbital of c5 contributed the most ( 0.28 ) to the homo .
hence , any substituent at this position should have the largest effect
on the ip .
this thus explains the above findings that either an edg
or an ewg at this position results in the largest effect on the ip .
in contrast , the contributions of the atomic orbitals of c2 , c3 , and
c4 to the homo are all much smaller than that of c5 .
the atomic orbital that makes the second
largest contribution to
the homo is n8 ( table 5 ) . as a result , any
substituent at this position should also result in a considerable
change to the ip compared with the parent compound .
therefore , the
ips of the molecules having an -oh , -ch3 , or -cf3 substituent on the 8-amino group were calculated and are listed
in table 6 .
it was again found that an edg
( -oh , -ch3 ) at the n8-position decreases the ip while an
ewg ( -cf3 ) at this position increases the ip .
for both
the -oh and -cf3 substituents , the change of ip is more
significant for substitution at n8 than for the same substituent at
the 5-position .
it should be noted that in the optimized structure
of the radical cation of the 8-n - oh derivative , the proton of the
n - oh moiety is transferred to n1 , probably due to the better delocalization
of the positive charge on the aminoquinoline ring . for comparison ,
the ips of pq
in the gas phase and in solution are also listed .
the results in this work provide insights
into the future design of less hemotoxic antimalarial drugs .
we recently
proposed that the methemoglobinemia caused by the primaquine derivatives
may be determined by their electron - donating ability .
if one wants to lower the hemotoxicity of primaquine by
adding an exocyclic substituent , the findings in this work suggest
that an ewg should be considered .
in addition , among all the possible
positions , the 5- and 7-positions deserve particular attention , because
a substituent at these positions should have a larger effect than
those at other positions .
we note that tafenoquine ( figure 3 ) , a promising antimalarial drug candidate that
has entered clinical trials , has a -cf3 exocyclic substituent ,
although it is not directly connected to the c5 position of the aminoquinoline
ring .
however ,
the efficacy of the resulting derivative against the malaria parasite
will also need to be taken into account .
it has been known that when this position is substituted
by a hydroxyl group in 6-methoxy-8-aminoquinoline ( figure 1 ) , the resulting 6-methoxy-8-(n - hydroxy)aminoquinoline derivative generates much more significant
amounts of methemoglobin than 6-methoxy-8-aminoquinoline does .
this is in agreement with our finding that an edg substituent at
n8 decreases the ip .
further experimental studies should also be performed
to determine the advantages of placing an ewg at this position .
in this work , the ionization
potentials of the exocyclic edg- and
ewg - substituted primaquine derivatives were considered .
it was found
that for all the positions , an edg causes the ip to decrease .
however , among all the possible exocyclic
positions , the 5- and 7-positions each play a special role . in solution ,
an edg at the 5-position results in the smallest ip , while an ewg
at the 7-position results in the largest ip .
this can be explained
by the contribution of each atomic orbital to the homo of primaquine .
it was found that p - orbitals from c5 and c7 are among the first three
atomic orbitals with the largest contribution to the homo of primaquine .
the atomic orbital with the second largest contribution to the homo
is that of n8 .
hence , any substituent at the n8 position should also
have a considerable effect on the ip .
when the 8-amino group is substituted by a -cf3 group , the resulting derivative has a larger ip compared
with placing the same substituent at any other position .
the
mechanism of the methemoglobinemia caused by primaquine - based
antimalarial drug has been unknown for decades . as a result , a rational
approach to the development of pq - based antimalarial drugs with less
methemoglobin generation was lacking .
our previous studies suggested that the potential for methemoglobin generation by primaquine
derivatives is determined in part by their ability to lose an electron .
the results reported in this study further suggest that the future
design of less hemotoxic primaquine - based antimalarial drugs should
consider use of an ewg as an exocyclic substituent , in particular
at the c5 , c7 , or n8 positions , because substituents at these positions
have the most significant effect on their ionization potentials .
Output:
| the effect of an
exocyclic substituent on the ionization potential
of primaquine , an important antimalarial drug , was investigated using
density functional theory methods .
it was found that an electron - donating
group ( edg ) makes the ionization potential decrease .
in contrast ,
an electron - withdrawing group ( ewg ) makes the ionization potential
increase . among all the exocyclic positions , a substituent at the
5- or 7-position has the largest effect .
this can be explained by
the contribution of the atomic orbitals at those positions to the
highest occupied molecular orbital ( homo ) .
in addition , a substituent
at the n8-position has a considerably large effect on the ionization
potential because this atom makes the second largest contribution
to the homo .
these findings have potential implications for the design
of less hemotoxic antimalarial drugs .
we suggest that it is worth
considering placement of an ewg at the 5- , 7- , or n8-positions of
primaquine in future drug discovery attempts . |
PubmedSumm119678 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: flightless i ( flii ) is a multifunctional protein of the gelsolin family of actin - remodelling proteins .
there are eight members of this family in mouse and humans , each containing one or two gelsolin domains consisting of three repeated gelsolin motifs of between 125 and 150 amino acids in length .
flii contains 6 repeat gelsolin motifs and an additional 11 leucine rich repeat ( lrr ) domains not present in other family members .
it has been found to play roles in many processes including actin regulation , transcription and inflammation .
flii is distributed across many cellular compartments , as would be expected for such a multifunctional protein , including the nucleus , cytosol and lysosomes . in vivo
flii overexpressing mice ( flii ) have impaired healing with larger , less contracted wounds , reduced cell proliferation and delayed epithelial migration . in contrast , mice with reduced levels of flii ( flii ) have improved wound healing with increased epithelial migration and enhanced wound contraction .
wounds in flii overexpressing mice also show significantly elevated levels of collagen i and overexpression of collagen is a major contributing factor to hypertrophic , or excessive scar formation . given flii s
known role in processes that are all involved in regulating tissue repair it is not surprising that it could alter the course of wound healing and scar formation .
unlike many gelsolin family members , which enhance actin polymerisation and cap actin filaments , flii binds actin filaments and actin monomers and inhibits actin polymerisation .
flii associates with focal adhesions , which are specialized structures that link the actin cytoskeleton to the surface integrin receptors and anchor cells to the extracellular matrix , and can alter their formation .
cells with reduced levels of gelsolin migrate slower , while a reduction in flii levels leads to an increase in migration .
both fibroblasts and keratinocytes , cells typically found in wounds , that have less flii migrate faster in vitro and in vivo and vice versa . the impaired wound healing seen in mice overexpressing flii
could in part be due to the ability of flii to inhibit cell adhesion and migration . however , flii has several other functions , which could also contribute to its negative role in tissue repair .
flii binds to hormone - activated nuclear receptors , including the estrogen and thyroid hormone receptor , as well as the coactivators grip1and carm1 .
flii positively regulates hormone - stimulated gene expression by the estrogen receptor through its gelsolin region and is involved in the recruitment of the chromatin remodelling complex sw1/snf to estrogen - responsive promoters .
thus , flii has the ability to alter transcription in part through its gelsolin domains .
our new data has shown that in fibroblasts flii is found in the nucleus of some but not all cells ( fig .
one and 2 ) and it is probably this pool of flii which may well be responsible for regulating transcription in these cells .
our new data further suggests that flii may have distinct roles in different cell types or under specific conditions .
we show that unlike fibroblasts , macrophages have little to no flii in the nucleus whether they were activated or not suggesting that its roles could differ depending on cell type or stimulus .
in recent years it has becoming increasingly obvious that flii has an important role in dampening inflammation .
unlike other gelsolin family members flii has 11 lrr domains in the n - terminus .
these lrr domains share nearly 50% similarity to the lrr domains of the immune related receptor toll - like receptor ( tlr ) 4 .
they can bind to pathogen - associated molecular pattern ( pamps ) molecules , such as the gram - negative bacteria cell wall component lipopolysaccharide or to damage - associated molecular pattern ( damps ) molecules such as hmgb1 that are released from damaged and dying cells , as well as extracellular matrix cleavage products .
their binding in turn activates intracellular tlr signaling pathways that ultimately lead to the secretion of cytokines .
typically both damps and pamps are present in wounds . the importance of these domains in flii was first hinted at by mouse knockout studies of flii and other gelsolin family members .
apart from flii , mice lacking members of the gelsolin family are viable , but with actin defects .
in contrast , homozygous disruption of the flii gene in mice leads to very early failure of embryonic development with impaired cellularization and gastrulation of the embryo indicating that flii is essential developmental regulator and has additional important functions , which could be related to the role of the lrr domains .
we have recently shown a pool of flii is located in the cytosol and this pool may in part be responsible for its role in dampening inflammation .
although inflammation appears to be a necessary part of the normal adult wound healing process , excessive activation of tlr receptors and the subsequent increased or prolonged inflammatory response can induce considerable tissue damage which can lead to impaired healing .
flii is upregulated in mouse wounds peaking around day 7 when the inflammatory stage of tissue repair is being switched off .
whether flii is playing a role in dampening inflammation during tissue repair has yet to be tested in vivo .
in macrophages flii is located in a complex with the tlr adaptor protein myd88 through its interaction with nucleoredoxin .
binding of flii to this complex inhibits myd88 binding to tlr4 , which results in the inhibition tlr signaling pathways and reduces cytokine secretion .
we recently found a pool of flii localized to late endosomes / lysosomes in fibroblasts and macrophages where it may also have a role in dampening inflammation .
flii binds to caspase-1 and in doing so inhibits the maturation of the cytokine pro - interleukin-1 to pro - interleukin-1 in macrophages , thus reducing its secretion .
exactly where in the cell pro - interleukin-1 is cleaved to form the mature secreted form is controversial ; however , there is data to suggest it may take place in the lysosome and that the mature form can be secreted from this compartment .
flii was thought to be solely an intracellular protein , however , our recent study has shown that in vitro flii is constitutively secreted by at least two cell types typically found in wounds ; macrophages and fibroblasts .
this secretion from fibroblasts can be upregulated in response to wounding and by macrophages in response to lps stimulation .
the upregulation in secretion after wounding suggest this pool of flii may play a role during the repair process . in macrophages
flii localizes to late endosomes / lysosomes but not to compartments typically associated with the classical secretory pathway , for example the golgi complex in macrophages .
similar results are shown here for primary fibroblasts ( figs . 1 and 2 ) .
flii does not colocate with the trans - golgi network and recycling endosome - associated snare protein vti1b in primary fibroblasts ( fig .
however , a pool of flii colocalizes with the lysosomal enzyme cathepsin d in these cells ( fig .
our recent data shows that flii is secreted from macrophages via late endosomes / lysosomes in a manner regulated by rab7 and stx11 .
this data suggests that flii may therefore not only affect cellular activities via its intracellular / nuclear functions but it may also have important extracellular activities .
primary fibroblasts were fixed with methanol , immunostained for flii ( mouse anti - flii antibody ) in combination with the recycling endosome snare protein vamp3 ( a ) or the trans - golgi complex and recycling endosome snare vti1b ( b ) .
( a ) primary fibroblasts were fixed with methanol , immunostained for flii ( mouse anti - flii antibody ) and the late endosomal / lysosomal enzyme cathepsin d ( catd ) .
flii co - localizes with cathepsin d in late endosomes / lysosomes in fibroblasts . in vivo
given flii s important role in wound healing we have now looked to see whether flii is secreted into wound fluid from a number of sources .
we find that secreted flii is also present in acute wound fluid from patients undergoing abdominoplasty and in blister fluid as well as in chronic wound fluid taken from patients with venous leg ulcers ( fig .
exactly what role flii is playing in the wound fluid is currently unclear ; however our results suggest that flii can form a complex with the bacterial cell wall protein lipopolysaccharide ( lps ) .
an antibody to the first llr domain is able to inhibit formation of this complex suggesting that the lrr region might be involved in this process .
altering the level of secreted flii in the media showed that flii can negatively influence the lps induced production and secretion of cytokine , such that cells stimulated with lps in the presence of media with higher levels of flii have reduced production and secretion of tnf .
the clinical investigations were conducted under approval from the women s and children s health network human research ethics committee , adelaide , australia , in accordance to the declaration of helsinski principles and with written informed consent .
( a ) wound fluid collected from patients undergoing abdominoplasty , from blister fluid and from patients with venous leg ulcers was immunoblotted for flii and albumin .
flii is secreted into both acute and chronic wounds . prolonged or augmented inflammation can induce significant tissue damage unfavorable to the repair process thus the body has developed mechanisms that finely tune and regulate tlr activation . for example
, surface tlr expression is downregulated after activation and at the same time soluble tlrs are secreted that compete with their membrane - associated forms for binding to ligands , thus limiting the stimulation of tlr signaling and inflammation .
it is possible given the timing of flii s upregulation after injury that flii could be potentially playing a role in limiting the inflammatory response both from within the cells and in the extracellular matrix
. it will be interesting in the future to see whether this is the case .
Output:
| intracellular flightless i ( flii ) , a gelsolin family member , has been found to have roles modulating actin regulation , transcriptional regulation and inflammation . in vivo flii
can regulate wound healing responses .
we have recently shown that a pool of flii is secreted by fibroblasts and macrophages , cells typically found in wounds , and its secretion can be upregulated upon wounding .
we show that secreted flii can bind to the bacterial cell wall component lipopolysaccharide and has the potential to regulate inflammation .
we now show that secreted flii is present in both acute and chronic wound fluid . |
PubmedSumm119679 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: to evaluate the association of elevated serum lipids with retinal hard exudates formation , the occurrence clinically significant macular edema ( csme ) , occurrence and severity of diabetic retinopathy ( dr ) and loss of vision in type 2 diabetics .
type 2 diabetic patients seeking ocular evaluation for diabetic retinopathy were included in this cross - sectional study .
they were assessed for presence and severity of diabetic retinopathy ( dr ) , presence of hard exudates , clinically significant macular oedema ( csme ) and best corrected visual acuity ( bcva ) .
totally 330 patients were included , of which 141/330 had diabetic retinopathy of any grade .
retinal hard exudate formation , was found to have statistically significant correlation with the presence of dyslipidemia ( p=0.02 ) , increased total cholesterol ( p=0.002 ) and ldl levels ( p=0.001 ) . on multivariate analysis , after correcting for duration , glycemic control and albuminuria , increased cholesterol remained significantly associated with increased hard exudate formation ( p=0.02 ) . elevated cholesterol also showed independent association with visual loss ( p=0.04 ) .
the occurrence csme showed a statistically significant correlation with dyslipidemia ( p=0.04 ) and increased ldl levels ( 0.04 ) , which did not persist on multivariate analysis .
elevated serum lipids showed a significant association with retinal hard exudate formation , csme and loss of vision in type 2 diabetics .
lipid lowering agents may help in reducing the occurrence of these retinal findings and loss of vision in diabetic patients .
while correlation between the various components of serum lipids and increased hard exudate formation and clinically significant macular edema ( csme ) has been demonstrated by some studies , others have failed to do so .
in addition the role of dyslipidemia in the in the severity of retinopathy is still unclear .
the aim of this study was to evaluate the relationship between the various components of serum lipids with retinal hard exudate formation , csme and the occurrence and increasing severity of diabetic retinopathy .
all patients referred to the department of ophthalmology of our tertiary care hospital ( over a period of 18 months ) , for evaluation and management of diabetic retinopathy ( dr ) , after informed consent were included into this cross sectional study .
inclusion criteria were as follows :
type 2 diabetesfitness to undergo a dilated fundus examination and fundus photograph .
exclusion criteria were as follows :
pregnancy , accelerated hypertension , active infection , co - existing ocular disorders like uveitis , opaque or hazy mediaretinal disorders like retinal vein / artery occlusions , retinitis pigmentosa , vitreoretinal degenerations and dystrophies , high myopia andrecent ocular surgeries ( < 6months ) .
accelerated hypertension , co - existing ocular disorders like uveitis , opaque or hazy media retinal disorders like retinal vein / artery occlusions , retinitis pigmentosa , vitreoretinal degenerations and dystrophies , recent ocular surgeries ( < 6months ) .
best - corrected visual acuity ( bcva ) was assessed using illuminated snellen 's chart .
the bcva of the worst eye was utilized for analysis converting it to decimal equivalent for the purposes of statistical analysis .
detailed fundoscopy was done both with indirect ophthalmoscope with 20d lens and slit lamp biomicroscopy with 78d lens .
a stereoscopic 30-degree color photograph centered on the macula was obtained using topcon fundus camera .
patients were divided into two groups ; group 0 : without retinopathy , group 1 : with retinopathy of any stage , for the purpose of deriving the occurrence of retinopathy . for grading the severity of retinopathy , group i patients
were further grouped using the modified early treatment of diabetic retinopathy study ( etdrs ) protocol as follows : group 1 patient with mild - moderate non - proliferative diabetic retinopathy ( npdr ) , group 2 patients with severe npdr and group 3 patients with proliferative diabetic retinopathy ( pdr ) .
grading of hard exudates was done based on wisconsin grading , by comparing patients retinal findings with the standard photographic plates 3 , 4 and 5 .
then they were grouped as group 0 no retinopathy , group 1 patients with retinopathy but no hard exudate , group 2 patients with retinopathy but hard exudates less than or equal to standard plate3 , group 3 less than or equivalent to standard plate 5 and group 4 less than or equivalent to plate 4 .
patients were assessed for the presence of clinically significant macular edema using slit - lamp biomicroscopy assessment with a 78d lens .
the definition utilized in diagnosing csme was the presence of one or more of the following
retinal thickening at or within 500 micron of center of maculahard exudates at or within 500 micron of center of the macula if associated with adjacent retinal thickening.zone or zones of retinal thickening 1 disc area in size , at least part of which is within one disc diameter of center of macula .
retinal thickening at or within 500 micron of center of macula hard exudates at or within 500 micron of center of the macula if associated with adjacent retinal thickening . zone or zones of retinal thickening 1 disc area in size , at least part of which is within one disc diameter of center of macula .
patients were then grouped as either group 0 no retinopathy , group 1 retinopathy present but no features of csme and group 2 csme present .
serum lipid measurements were done using fasting samples , to analyze total cholesterol , cholesterol components and triglycerides utilizing the dade dimension series using photometric enzymatic method . for the purpose of analysis dyslipidemia
was defined as serum total cholesterol > 160mg / dl , triglyceride levels > 150mg / dl , ldl levels > 100mg / dl and hdl<40 for men and < 50 for women mg / dl according to ncep expert panel .
there were 210 males and 120 females , with an age range of 32 - 85 yrs and mean ( sd ) of 56.41(+9.91 ) years .
diabetic retinopathy of any severity was found in 141/330(42.7% ) patients , with mild to moderate npdr in 86/330(26.1% ) , severe npdr in 28/330 ( 8.5% ) and pdr in 27/330(8.2% ) . of the 141 with diabetic retinopathy ,
57/141 had mild hard exudate formation and 38/141 had grade 2 or harder exudate formation .
csme was present in 58/141 ( 41.1% ) retinal hard exudate formation was found to have statistically significant correlation with the presence of dyslipidemia ( p=0.02 ) , increased total cholesterol ( p=0.002 ) and ldl levels ( p=0.001 ) and the correlation with triglyceride levels showed a trend towards significance ( p=0.07 ) on multivariate analysis , increased total cholesterol showed a statistically significant association with increased retinal hard exudate formation ( p=0.02 ) , whilst the other variables did not .
the occurrence csme showed a statistically significant correlation with dyslipidemia ( p=0.04 ) and increased ldl levels ( 0.04 ) , which did not persist on multivariate analysis .
neither the occurrence of dyslipidemia nor the increased levels of the various components of serum lipids showed a statistically significant correlation with the occurrence and increasing severity of diabetic retinopathy .
elevated total cholesterol also showed a statistically significant correlation with decreased bcva ( p=0.01 ) and this association remained , even on multivariate analysis ( p=0.02 ) .
the correlation of elevated ldl with decreased bcva showed a trend towards significance ( p=0.06 ) .
in our study we have found that elevated cholesterol were significantly associated with retinal hard exudate and reduced visual acuity . elevated ldl cholesterol and presence of dyslipidemia showed association with csme and retinal hard exudates .
these find concurrence with studies like the etdrs and wesdr , while they contrast with findings of ausdiab study . like the results of our study ,
the wesdr study did not find a correlation between serum lipids and the incidence and increasing severity of diabetic retinopathy .
the diabetes control and complications trial ( dcct ) however showed a relationship with the occurrence of retinopathy and elevated very low and low density lipoproteins . in some of our patients even with grossly abnormal lipids there was retinopathy indicating that abnormal lipids may not be the only risk factor .
some recent studies have shown lipid lowering drugs to significantly cause regression of hard exudate deposits and improvement in vision .
although the existing data including ours is observational , they suggest serum lipid lowering may help in preventing visual loss . in conclusion
our study findings has added to the growing evidence that dyslipidemia and specifically increased total cholesterol and ldl are significant risk factors for the development of retinal hard exudates , csme and decreased vision .
Output:
| aim : to evaluate the association of elevated serum lipids with retinal hard exudates formation , the occurrence clinically significant macular edema ( csme ) , occurrence and severity of diabetic retinopathy ( dr ) and loss of vision in type 2 diabetics.materials and methods : type 2 diabetic patients seeking ocular evaluation for diabetic retinopathy were included in this cross - sectional study .
they were assessed for presence and severity of diabetic retinopathy ( dr ) , presence of hard exudates , clinically significant macular oedema ( csme ) and best corrected visual acuity ( bcva ) .
retinal findings were correlated to serum lipids levels using univariate and multivariate analysis.results:totally 330 patients were included , of which 141/330 had diabetic retinopathy of any grade .
retinal hard exudate formation , was found to have statistically significant correlation with the presence of dyslipidemia ( p=0.02 ) , increased total cholesterol ( p=0.002 ) and ldl levels ( p=0.001 ) . on multivariate analysis , after correcting for duration , glycemic control and albuminuria , increased cholesterol remained significantly associated with increased hard exudate formation ( p=0.02 ) .
elevated cholesterol also showed independent association with visual loss ( p=0.04 ) .
the occurrence csme showed a statistically significant correlation with dyslipidemia ( p=0.04 ) and increased ldl levels ( 0.04 ) , which did not persist on multivariate analysis .
however the there was no correlation with the occurrence and severity of diabetic retinopathyconclusion : elevated serum lipids showed a significant association with retinal hard exudate formation , csme and loss of vision in type 2 diabetics .
lipid lowering agents may help in reducing the occurrence of these retinal findings and loss of vision in diabetic patients . |
PubmedSumm119680 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: vaginismus is defined according to dsm iv - tr as recurrent or persistent involuntary spasm of the musculature of the outer third of the vagina , which interferes with coitus and causes distress and interpersonal difficulty .
the inclusion of spasm in the definition has been questioned as it has not been consistently documented .
it has been classified as primary when the woman has never experienced non - painful penetrative sexual intercourse and as secondary when she has experienced non - painful penetrative vaginal intercourse in the past .
vaginismus is comorbid with dyspareunia ; sensitivity and specificity of the distinction between the two , however , has been doubtful .
pain due to inflammation , infections , trauma , radiotherapy , muscular and neurological causes may contribute to psychological causes .
classical psychoanalytic theory conceptualized vaginismus as a conversion disorder caused by unresolved psychosexual conflicts in early childhood .
vaginismic women have been characterized as fixated or regressed to the pre - oedipal or oedipal stages .
vaginismus is believed to be a psycho - physiologic disorder due to fear from actual or imagined negative experiences with penetration and/or organic pathology .
women with vaginismus have also been noted to have a lack of sex education . in this case report
, we discuss the successful treatment of vaginismus with sex therapy based on a model proposed by keith hawton .
a 25-year - old lady sought consultation with the psychiatry outpatient services for sexual dysfunction .
she reported of tightness of vagina and introital pain while attempting sex with her husband .
patient 's husband disclosed that few months back when they got engaged , she had expressed apprehensions about having painful sexual intercourse . after the wedding , patient had postponed attempts at penetrative intercourse for 10 days . whenever penetration was attempted , she would not part her legs and begin to cry .
she had initially consulted gynecologists who diagnosed the condition as primary vaginismus . on their advice ,
after about 6 weeks , the couple consulted psychiatry services on advice by the gynecologist .
the patient reported of sadness , ideas of worthlessness and depressive symptoms over the past 56 weeks .
the family of origin was religious ; sex was not openly discussed in keeping with local cultural norms .
her mental status examination revealed depressed affect , ideas of hopelessness and worries about non - consummation of marriage .
the patient underwent five sessions ( weekly ) of sex therapy with the first author being the primary therapist .
the sessions included the husband and the couple initially participated jointly in educative sessions with the primary therapist .
the exercises were carried out at home by the patient and her husband . in the first session , normal reproductive anatomy and physiology of the sexual act were explained .
the patient was made comfortable with her genitals by asking her to look at the area in the mirror .
kegel 's exercises help control the pubococcygeus muscle which surrounds the entrance to the vagina . in the next couple of sessions
, she was advised to insert her fingers into her vagina and move them around , initially one finger , later two fingers .
only after the patient became comfortable with these over three sessions , vaginal containment with lubrication and local anesthesia provided by 5% lignocaine jelly was advised .
vaginal containment involved the patient in female superior position , guiding penile penetration with her hands and the couple remaining still , concentrating on the pleasant sensations they experience . after a month of initiating therapy ,
the patient was able to indulge in normal sexual intercourse without the need for local anesthesia .
james marion sims first coined the term vaginismus in 1862 at an address to the obstetrical society of london .
vaginismus is thought to be one of the most common female psychosexual dysfunctions but the exact prevalence rate among the general population is not known .
however , in sexual dysfunction clinics , the rates vary from 5 to 17% . this condition can result in significant interpersonal problems and marital discord .
botulinum toxin injection and hypnosis are the other approaches that have been tried . there are no randomized controlled trials available to garner evidence for treatment of vaginismus .
discussed here , an eclectic approach was used involving education , graded insertion of fingers , kegel 's exercises and usage of anesthesia with vaginal containment .
the use of ssri escitalopram may also have aided the therapy by providing anxiolysis and relief from depression .
the report demonstrates a successful approach toward managing vaginismus in a clinical setting . there is a need for randomized controlled trials to establish efficacy and bolster these approaches .
Output:
| vaginismus is defined as recurrent or persistent involuntary spasm of the musculature of the outer third of the vagina , which interferes with coitus and causes distress and interpersonal difficulty . in this report
, we describe the successful treatment of vaginismus in a 25-year - old lady based on a model proposed by keith hawton .
the eclectic approach involved education , graded insertion of fingers , kegel 's exercises and usage of local anesthesia with vaginal containment along with the prescription of escitalopram . |
PubmedSumm119681 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the determination of an accurate working length is a critical step in endodontic therapy . establishing the working length at the apical constriction
the apical constriction ( minor apical diameter ) is the narrowest apical portion of the root canal with a variety of morphological variations that make its identification unpredictable .
electronic devices for assessing the root canal length have gained popularity and eliminate many of the problems associated with radiographic measurements . based on suzuki 's discovery that electrical resistances between the periodontal ligament and oral mucosa registered constant values of 6.5 k , sunada in 1962 developed the first electronic apex locator ( eal ) . since then , different generations of eals have been developed .
whilst the simplest devices measure resistance , other devices measure impedance using either high frequency , two frequencies , or multiple frequencies .
in addition , some systems use low frequency oscillation and/or a voltage gradient method to detect the canal terminus .
kyoto , japan ) , a dual frequency device , based on the ratio method
, has been investigated extensively as regards its accuracy and its efficacy in the presence of various irrigants .
sybronendo mini apex locator ( sybronendo , sybron dental , glendora , ca , usa ) is multifrequency based and is also claimed to be accurate in the presence of various intracanal conditions , but has not been investigated much .
thus , the purpose of this in vitro study was to compare the time tested root zx with the newly introduced sybronendo mini apex locator in the presence of various intracanal irrigants .
sixty extracted , straight , single - rooted permanent human teeth with mature apices were selected for this study .
residual soft tissue on the root surface was removed by soaking the teeth in 5% sodium hypochlorite ( nice chemicals , india ) for 3 h. the type i canal configuration was confirmed by using digital radiograph ( gendex , dentsply ) in mesiodistal and labiolingual planes .
teeth with resorption , curvatures , open apices , or radiographically invisible canals were excluded .
the teeth were decoronated at the level of cementoenamel junction with a diamond disc to allow access to the root canal and to provide a stable reference for all measurements .
the coronal portion of each canal was preflared using sequential gates glidden drills # 4 , # 3 , and # 2 ( mani inc . , japan ) , irrigated with saline and pulp extirpated with a barbed broach ( spirocolorinox , dentsply ) .
teeth were numbered 160 and the actual length ( al ) was determined by introducing a size 10 or 15 k - file ( mani inc . ,
japan ) into the canal until its tip emerged through the major apical foramen at 10 magnification under a stereomicroscope ( wild m2z , heerbrugg , switzerland ) .
the long axis of the tooth was placed perpendicular to the line of sight and the tip of the file was positioned tangential to the major apical foramen . after carefully adjusting the silicone stopper to the reference point , the file was withdrawn from the root canal , and the distance between the file tip and silicone stopper was measured with a digital caliper ( mitutoyo co. , japan ) to the nearest 0.5 mm ; 0.5 mm was subtracted from this length and recorded as al . to simulate the periodontium , this study used the in vitro model as designed by donnelly .
a polystyrene specimen bottle ( 40 ml ) was filled with warmed gelatin solution and refrigerated for 2 h to allow gelatin to set .
the apical two - third of the root was embedded in gelatin , and the tooth was stabilized to the lid of a container with auto - polymerizing resin as described by higa et al .
the lip electrode was also placed in gelatin through another opening in the lid [ figure 1 ] .
experimental set - up used in the study the irrigants tested were : 0.9% saline ( denis chem . ,
india ) , 1% sodium hypochlorite ( naocl ) ( nice chemicals pvt . ltd . ,
india ) , 2% chlorhexidine digluconate ( chx ) ( dentochlor , ammdent , india ) , and 17% disodium edetate solution ( edta ) ( canalarge , ammdent , india ) .
two eals tested in this experiment were : root zx ( j. morita mfg corp . , kyoto , japan ) and sybronendo mini apex locator ( sybron endo , sybron dental , glendora , ca , usa ) .
depending on the size of the canal , # 15 or # 20 k - file ( mani inc . , japan ) , was attached to the file holder and introduced into the canal . for root zx
, the meter 's 0.5 mm reading was set between the apex and 1 ( factory setting ) as indicated by a flashing bar and was used for electronic measurements . for each one of the devices ,
the file was gently inserted into the root canal until the apex signal was displayed .
the file was then gently retracted until the display showed a flashing image of the root canal and a flashing bar between apex and 1 ( 0.5 reading ) for root zx and 0.5 blue led was on for sybron mini .
the silicone stopper on the file was carefully adjusted to a reference point , and the file was withdrawn to measure the distance between the silicone stopper and the file tip to the nearest 0.5 mm .
the canal length was assessed twice by two operators individually for each of the eal and individual irrigants , amounting to four readings per tooth . to prevent cross - contamination : (
a ) fresh gelatin was used for the individual irrigant , and ( b ) the root canals were irrigated with ethanol and dried with paper points . the results obtained ( in millimeters ) were recorded . the difference between the median of electronically measured length ( el ) and
the al were calculated for each tooth for all irrigants , and al0.5 mm was used to evaluate the accuracy of the two eals . the relative conductivity and the ph of irrigants
were also determined using a calibrated conductivity meter ( conductivity meter 304 , systronics ltd , india ) and a digital ph meter ( digital ph meter 335 , systronics ltd , india ) . a paired t - test was employed to statistically analyze the significance of mean difference between el and al .
one - way anova was employed to assess the difference among various irrigants in their estimations of the canal length .
inter operator agreement was calculated through the kappa co - efficient range from 0.7 to 0.88 which are highly significant for all the four irrigants for both the apex locators .
the analysis was performed with statistical and presentational system software ( spss 16.0 , spss inc , chicago , il ) .
the mean and standard deviation of actual length ( al ) and electronic length ( el ) measurements obtained by root zx and sybron mini in the presence of various irrigants are shown in table 1 .
the mean differences between the electronic and the al were 0.002 mm and 0.21 mm for root zx and sybron mini , respectively .
the effect of irrigant on the canal length determinations measured with root zx and sybron mini is as shown in table 2 .
mean ( sd ) of al and el measurements with root zx and sybron mini in the presence of various irrigants mean difference between the actual length and the electronically determined length by root zx and sybron mini in the presence of various irrigants in the root canal ( mm ) the measurements of root zx in the presence of saline ( p=0.209 ) and 1% naocl ( p=0.443 ) were closer to the al and with no significant difference between them , while significant differences were observed with 2% chx ( p=0.001 ) and 17% edta ( p=0.005 ) .
sybron mini , in the presence of saline , 1% naocl and 17% edta , gave measurements which were shorter than the al and the results were significant ( p=0.000 ) , whereas , 2% chx was more accurate ( p=0.542 ) and without significance .
although statistically significant differences existed between the irrigants , the majority of the readings were within the acceptable range of 0.5 mm for both eals .
the overall accuracy of measurements within 0.5 mm of al by root zx and sybron mini was 88.3% and 87.5% , respectively .
the distribution of measurements of root zx and sybron mini with various irrigants is presented in table 3 .
distance between al and el ( al - el ) with various irrigants for root zx and sybron mini the results of conductivity testing of the irrigants ranked from most to least conductive were : 1% naocl>17% edta>0.9% saline>2% chx , and ph from high to low : 1% naocl>17% edta>0.9% saline>2% chx .
the first - generation eals were resistance - based and the second - generation eals were impedance - based apex locators .
the main shortcomings of these eals included poor accuracy in the presence of fluids and pulp tissue , and the need for calibration .
the frequency - based third - generation eals have more powerful microprocessors and are able to process mathematical quotient and algorithm calculations required to give accurate readings .
kyoto , japan ) is a third - generation eal that uses dual frequency and comparative impedance principle is based on the ratio method for measuring canal length .
this method simultaneously measures the impedance values at two frequencies ( 8 and 0.4 khz ) and calculates a quotient of impedances .
root zx requires no calibration , and can be used when the canal is filled with a strong electrolyte .
the sybronendo 's mini apex locator uses a sophisticated , multifrequency measurement system to calculate the distance from the tip of the file to the foramen by measuring changes in impedance between two electrodes . according to the manufacturer , an all - digital signal and an 80% shorter cable than other eals
the fourth - generation apex locators do not process the impedance information as a mathematical algorithm , but instead they take the resistance and capacitance measurements separately and compare them with a database to determine the distance to the apex of the root canal .
however , there is still a concern as to whether high electroconductive irrigants such as saline , anesthetic solution , and sodium hypochlorite can affect the of these new - generation eals performance .
the gelatin model was used in this in vitro study to simulate the periodontium , has the advantage of simplicity , ease of the use and the ability to have a strict control over the experimental conditions tested .
it is generally accepted that apical constriction is on average located 0.51.00 mm short of the apex .
this study employed the 0.5 reading ( apical constriction ) on the display of root zx .
in addition , the 0.5 reading on the display of sybron mini was suggested as apical constriction and used as an apical endpoint for all the length measurements .
the manufacturer of sybron mini does not correlate any histologic landmark with the readings . to evaluate the accuracy of eals ,
the 0.5 mm range from al was chosen , which is considered clinically acceptable and highly accurate . in vivo studies
have shown the accuracy of root zx to be varying from 82.3% to 96.2% within 0.5 mm .
the result of our study for root zx is in general agreement with a previously reported in vitro study .
the overall accuracy of sybron mini in this study with various irrigants was 87.5% ; however , with naocl the accuracy was 93.3% comparable to a previous study of 97.5% accuracy with naocl as irrigant .
the difference in electroconductivity of various irrigants could be the reason for lowered overall accuracy of sybron mini .
the literature review revealed that there are no studies evaluating the accuracy of sybron mini in the presence of various irrigants .
the irrigants investigated were : 1% naocl , with tissue solvent and antibacterial activity ; 2% chx with antibacterial activity even against enterococcus faecalis ; 17% edta , a chelator which facilitates canal preparation and removes the smear layer ; and normal saline with only flushing action served as a control .
1% naocl was used in this study because in vitro studies found that , 1% naocl dissolved pulp tissue entirely in the course of an endodontic treatment session and studies indicate that the accuracy of eals is not significantly influenced by different concentrations of naocl . in the presence of saline
, the accuracy of root zx and sybron mini within 0.5 mm was 95% , which was in agreement with a previous study , and 88.3% , respectively .
1% naocl found the accuracy of root zx within 0.5 mm to be 75% , while weiger et al .
de camargo et al . found the accuracy of sybron mini with 1% naocl to be 97.5% ( 1 0.5 mm from total length , meter reading 1 ) , while dassuno et al .
the results of our study with 1% naocl with root zx and sybron mini within 0.5 mm were 90% and 93.3% , respectively . with 2% chx in the canals
the accuracy of root zx and sybron mini was 86.7% and 93.3% , respectively , and with 17% edta solution this was 81.6% and 75% , respectively .
jenkins et al . found the accuracy of root zx was not influenced by 0.12% chx or 17% edta .
found measurements with 17% edta with root zx were similar to dry canals or filled with 3% naocl or normal saline .
there were no studies to compare the accuracy of sybron mini with 0.9% saline , 2% chx , and 17% edta .
the 1% naocl was most electroconductive ( 66 ms ) and had a highly alkaline ph ( 11.72 ) , followed by 17% edta ( 40 ms , ph 7.01 ) and accordingly the measurements with these solutions were short of al , with both eals .
the 2% chx had poor electroconductivity ( 1 ms , ph 6.5 ) and measurements were longer with both root zx ( p=0.001 ) and sybron mini ( p=0.542 ) .
. the better performance of sybron mini with 1% naocl and 2% chx could possibly be due to its multifrequency mechanism and shorter transmission line .
the major limitation of this in vitro study is the length measurements recorded to the nearest 0.5 mm , which is from a statistical point of view gross ; since an error tolerance of 0.5 mm was used to assess the accuracy of the eals .
better statistical results could have been achieved if the measurements were made to the nearest 0.01 mm .
the authors have used 0.5 mm accuracy for the length measurements since this was easy to transfer and reproduce clinically .
the results obtained in this in vitro study can not be applied to the clinical situation , but can provide an objective assessment of a number of variables that are not practical to test clinically .
at best the eals should be used as an adjunct , and not as the only method to determine the canal length in endodontic therapy .
under the conditions of this in vitro study ,
root zx was more accurate compared to sybronendo mini apex locator.with 1% naocl as irrigant , there was a tendency toward shorter measurement , whereas longer measurements were recorded with 2% chx for both the devices.sybronendo mini was more accurate with 1% naocl and 2% chx than root zx .
root zx was more accurate compared to sybronendo mini apex locator . with 1% naocl as irrigant
, there was a tendency toward shorter measurement , whereas longer measurements were recorded with 2% chx for both the devices .
further , in vivo studies with different irrigants are needed to better evaluate the accuracy of sybronendo mini apex locator .
Output:
| aim : this study was designed to compare the accuracy of root zx and sybronendo mini , electronic apex locators ( eals ) , in the presence of various irrigants.materials and methods : sixty extracted , single - rooted human teeth were decoronated and the root canals coronally flared .
the actual length ( al ) was assessed visually and teeth mounted in the gelatin model .
the electronic length ( el ) measurements were recorded with both eals in the presence of 0.9% saline ; 1% sodium hypochlorite ( naocl ) ; 2% chlorhexidine digluconate ( chx ) , and 17% edta solution , at 0.5 reading on display .
the differences between the el and al were compared.results:the accuracy of el measurement of root zx and sybron mini within0.5 mm of al was consistently high in the presence of naocl and found to be least with edta.conclusion:el measurements were shorter with 1% naocl , whereas longer with 2% chx for both the devices .
sybron mini was more accurate with 1% naocl and 2% chx than root zx . |
PubmedSumm119682 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: during 20092013 , a total of 31 adult foxes with signs of a neurologic disorder were brought to the rspca norfolk wildlife hospital in east winch , united kingdom .
the foxes exhibited abnormal behavior , lack of fear , reduced alertness , aimless wandering , circling , facial muscle twitching , hind limb paresis , and visual abnormalities .
cases were only detected when free - living foxes became debilitated and were taken to the wildlife rescue center .
once in captivity , diseased foxes had good appetite and generally survived with no substantial disease progression or death , but they showed no evidence of natural recovery .
after a few weeks , the foxes were usually euthanized because they did not respond to ( nonspecific ) medical treatment .
samples were stored in 10% neutral buffered formalin and embedded in paraffin , and 4 m
thick sections were stained with hematoxylin and eosin and evaluated for the presence of histologic lesions .
all foxes had similar histologic findings consisting of chronic multifocal or diffuse lymphoplasmacytic meningoencephalitis oriented on the forebrain with a predilection for cortical gray matter ( figure 1 ; table 1 ; technical appendix figure 1 ) .
characteristic histopathologic features were nonspecific perivascular cuffing , rod cell proliferation , spongiosis , neuronal necrosis , moderate to severe gliosis , neuronal satellitosis , and neurophagia .
histopathologic changes suggested viral , protozoal , microsporidial , immune - mediated , or idiopathic disease .
immunohistochemistry of brain samples was negative for canine distemper virus , canine adenovirus , borna disease virus , toxoplasma gondii , and neospora canium ( data not shown ) .
serologic test results for canine distemper virus , rabies virus , n. canium , and tickborne encephalitis virus were negative , and ziehl - neelsen and giemsa staining results for microsporidia were negative .
minor white matter involvement , the duration of animal survival , and the current absence of documented rabies cases in the united kingdom eliminated rabies virus as the cause of the neurologic disorder .
a ) multifocal , randomly distributed areas of severe encephalitis and meningitis in the cerebrum ( original magnification 40 ) .
gray and , to a lesser extent , white matter of the cerebrum showed randomly dispersed areas of astrocytosis , gliosis , and infiltration with lymphocytes and plasma cells .
blood vessels in affected areas show perivascular cuffing with distention of virchow - robin spaces with up to 10 layers of lymphocytes and plasma cells ( arrow ) .
axons in affected white matter showed degeneration , characterized by formation of spheroids , shrinkage , and fragmentation ; axon sheaths containing microglia or macrophages ; and presence of gitter cells in surrounding neuropil .
cerebellum was mildly affected , and meninges , especially of the cerebrum , were frequently distended with lymphocytes and plasma cells .
individual neuronal cell bodies were frequently surrounded by up to 5 glial cells ( i.e. , sattelitosis ) and showed margination of nissl substance , hyperchromasia , degeneration , and necrosis .
* bed , bedfordshire ; cam , cambridgeshire ; ct , cycle threshold values of real - time pcr ; ess , essex ; ffpe , formalin - fixed paraffin - embedded tissue ; lei , leicester ; lin , lincolnshire ; nd , not determined ; neg , negative ; nor , norfolk ; pos , positive ; suf , suffolk .
neurologic signs were abnormal behavior , lack of fear , reduced alertness , aimless wandering , circling , facial muscle twitching , progressive weakness of hind legs , and visual abnormalities .
samples were analyzed by using a viral metagenomics approach with the 454 sequence platform ( gs junior ; roche , basel , switzerland ) . taqman real - time pcr .
serum samples from 6 of the foxes ( vs71000016 ) were available for virus discovery studies . to perform the studies
, we used a viral metagenomics approach with the 454 sequence platform ( gs junior ; roche , basel , switzerland ) as described previously ( 710 ) ( table 1 ) .
more than 22,000 reads were analyzed as described previously ( 1012 ) ( technical appendix figure 2 ) .
the complete genome sequences of circoviruses from 3 foxes were obtained ; the sequences were 99% identical at the nucleotide level ( genbank accession nos .
the fox circovirus genomes had an ambisense organization characteristic of circovirus ( technical appendix figure 3 ) .
phylogenetic analysis revealed that the genomes were closely related to those of the recently described canine circoviruses ( 3,13 ) , displaying 92% amino acid identity in the rep protein and 89% nt sequence identity across the entire genome ( technical appendix figure 4 ) . on the basis of the suggested criteria demarcating species ( 1 ) , the fox and canine circoviruses belong to the same species .
a diagnostic real - time fox circovirus pcr was performed targeting the rep - coding sequence on 32 serum samples from foxes with and without neurologic signs ( table 1 ) .
viral nucleic acid was extracted by using the magna pure lc total nucleic acid isolation kit ( roche , indianapolis , in , usa ) and amplified by real - time pcr by using primers vs756 ( 5-tccgagatagcc ggcgtggta-3 ) , vs757 ( 5-cccggccacagatcaagtactta-3 ) , and vs758 ( 5-fam - atccaactccggaggaggagga - tamra-3 ) and the taqman universal master mix ( applied biosystems , foster city , ca , usa ) .
in addition to samples vs71000016 , another 14 fox serum samples were positive for fox circovirus , indicating that the virus had infected foxes in multiple counties in the united kingdom during past years ( table 1 ; technical appendix figure 5 ) .
clinical data indicated that 77% of circovirus - positive foxes had signs of neurologic disease , compared with only 47% of circovirus - negative foxes ( table 2 ) .
fox circovirus was present in male and female foxes and in adults and juveniles ( table 2 ) .
in addition , fox circovirus was detected by real - time pcr in brain samples of 2 of 4 foxes with neurologic disease ( vs7100017 and 19 ; cycle threshold value > 35 ) but not in the brain tissues of 2 foxes without disease .
the detection of fox circovirus nucleic acid in the cerebrum of foxes with neurologic disease was confirmed by using the rnascope 2.0 in situ hybridization kit ( advanced cell diagnostics , hayward , ca , usa ) and a rep gene specific probe according to the manufacturer s instructions .
multifocal fox circovirus rna signal was detected and associated with the aforementioned histologic lesions in the cerebrum ( figure 2 ) .
specifically , rna signal was detected in mononuclear cells in perivascular cuffs , inflammatory infiltrates in the neuropil , and neuronal somata in cerebral gray matter of circovirus - positive foxes with neurologic disease .
no circovirus signal was found in control foxes with lymphocytic cuffs due to other ( known ) viral infections or in control foxes without neurologic disease ( figure 2 ) . * or ,
neurologic signs were abnormal behavior , lack of fear , reduced alertness , aimless wandering , circling , facial muscle twitching , progressive weakness of hind legs , and visual abnormalities .
specific transcripts in brain tissue of foxes with neurologic disease showing in situ hybridization of cerebrum with fox circovirus replication initiator protein gene specific probe ( original magnification 200 ) .
the serum sample from this fox was negative for circovirus , and the animal did not exhibit signs of neurologic disease .
both animals had neurologic disease , and their serum samples were positive for fox circovirus ( see table 1 for more information regarding these foxes ) .
black arrows indicate mononuclear cells in perivascular cuffs , blue arrows show inflammatory infiltrates in the neuropil , and red arrows point to staining in neuronal somata in cerebral gray matter of circovirus positive animals with neurologic disease .
our findings indicate that circoviruses commonly cause systemic infections in wild foxes in the united kingdom and can be detected in the brains of foxes with neurologic disease .
it has been suggested that circoviruses are involved in a plethora of diseases in pigs , dogs , and birds ( 1,35 ) .
the canine circovirus may be associated with development of vasculitis in dogs ( 3 ) , and an overall virus prevalence in serum samples of 3% has been reported ( 3,13 ) .
however , we found that the prevalence of fox circovirus in serum samples from foxes with and without neurologic disease was much higher and more comparable to the prevalence of porcine circoviruses among pigs ( 14 ) .
instead , fox circoviruses may be associated with development of neurologic disease directly or as a contributory complicating cofactor .
cycloviruses , which belong to a proposed new genus in the family circoviridae , were recently found in serum and cerebrospinal fluid of humans with paraplegia and acute infections of the central nervous system ( 11,15 ) , suggesting that viruses from the family circoviridae may have neurologic tropism more commonly than previously anticipated .
however , a causal link between circovirus infection and disease in humans and animals remains to be proven . because the prevalence of circoviruses in foxes was relatively high and closely related circovirus species
seem pathogenic for both dogs and foxes , additional surveillance is warranted to clarify the epidemiology and pathogenicity of circoviruses in foxes .
histopathologic features of brain tissues from foxes with possible circovirus - induced neurologic disease and relative abundance of broad taxonomic categories in metagenomic sequences obtained from fox serum samples .
Output:
| a fox circovirus was identified in serum samples from foxes with unexplained neurologic signs by using viral metagenomics .
fox circovirus nucleic acid was localized in histological lesions of the cerebrum by in situ hybridization .
viruses from the family circoviridae may have neurologic tropism more commonly than previously anticipated . |
PubmedSumm119683 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: she was diagnosed with subfoveal cnv secondary to age - related macular degeneration ( amd ) and the best - corrected visual acuity of the right eye was 20/50 .
pdt with verteporfin was performed according to the standard protocol of the treatment of age - related macular degeneration with photodynamic therapy investigation and repeated after 5 months.13 the visual acuity of the involved eye did not change .
fifteen months after the second pdt , fluorescein angiography of the affected eye revealed persistent subfoveal cnv and the best corrected visual acuity remained 20/50 ( fig .
1a , 2a ) . combined pdt according to the same standard protocol and 1.25 mg intravitreal bevacizumab injection was performed on the same day .
one day after the treatment , the patient 's vision had decreased to counting fingers .
fundus examination and optical coherence tomography ( oct ) showed serous retinal detachment involving the macula ( fig .
, the patient was initiated on an oral steroid ( triamcinolone 24 mg # 1 ) to complete a two week course .
one week into steroid therapy , the visual acuity remained the same , but oct findings of the right eye showed decreased serous retinal detachment ( fig . 2c ) .
the vision slightly improved to 20/200 upon completion of the two week steroid course and fluorescein angiography showed decreased leakage of fluorescein dye ( fig .
there have been several reports about serous retinal detachment after pdt treatment.7,9,14 mennel et al.7 quantified transient serous retinal detachment in cnv after pdt using oct .
kim et al.9 also suggested that serous retinal detachment might develop following pdt but might also resolve spontaneously several days following treatment .
however , there is neither a published report of serous retinal detachment after the combined use of pdt and intravitreal bevacizumab injection nor following intravitreal bevacizumab injection alone .
several mechanisms may be responsible for subretinal fluid accumulation after combined treatment with pdt and intravitreal bevacizumab injection .
the pdt may induce fluid leakage from the cnv itself or damage of retinal pigment epithelium causing an alteration of the blood - retinal barrier.7,9 bevacizumab may cause instability of the intraretinal and subretinal fluid and subsequent serous retinal detachment by rapidly modulating the permeability and activity of the cnv.10,12 in our patient , there was no evidence of increased subretinal fluid after the first two treatments of pdt alone and the pdt protocol was the same for all three treatments .
occurrence of the serous retinal detachment just after combined pdt and intravitreal bevacizumab injection suggests the interaction of these two modalities as a possible causal role .
however , the definitive causation of serous retinal detachment in pdt alone , intravitreal bevacizumab injection alone or combined treatment can not be determined .
a two week course of oral steroids was used to manage the serous retinal detachment after the combined treatment of pdt and intravitreal bevacizumab injection .
kim et al.9 injected triamcinolone into the vitreous in a patient with serous retinal detachment following pdt , whereas , we elected to use a more conservative management with an oral steroid . in conclusion ,
combined pdt and intravitreal bevacizumab injection can be associated with serous retinal detachment which may cause sudden visual loss .
additional studies are needed to establish the standard protocol , safety and complications regarding the combined treatment of pdt and intravitreal bevacizumab injection .
Output:
| we report a case of serous retinal detachment following combined photodynamic therapy ( pdt ) and intravitreal bevacizumab injection in subfoveal choroidal neovascularization ( cnv).a 53-year - old woman was diagnosed with subfoveal cnv secondary to age - related macular degeneration ( amd ) and treated with combined pdt and intravitreal bevacizumab injection .
one day after treatment , the patient experienced a sudden decline of vision and optical coherence tomography ( oct ) showed serous retinal detachment involving the macula .
she was managed conservatively with an oral steroid beginning on the second day of the combined treatment and the subretinal fluid started to decrease one week following the initiation of steroids.this case suggests that combined pdt and intravitreal injection of bevacizumab can be associated with serous retinal detachment .
additional studies are needed to establish the safety and complications following this treatment regimen . |
PubmedSumm119684 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: to assess attitudes and practices of documentation and coding education for emergency medicine residents ( emrs ) .
questions regarding documentation teaching methods were formulated into online surveys for program directors ( pds ) and emrs .
fifty - three of 104 pds and 446 of 576 emrs who received the survey completed it .
although 93% of emrs and 63% of pds believe proper chart documentation is an important skill , only 18% of emrs and 25% of pds believe their program s teaching was adequate .
emrs who received formal lectures and feedback reported higher comfort levels with their knowledge of documentation ( 3.3 1.1 vs. 4.5 1.4 , p < 0.05 ) than those who did not receive formal lectures and feedback .
although most physicians who were surveyed agreed that documentation and coding is a vital skill , many emrs and pds report inadequate instruction .
resident education may benefit from broader implementation of formal lectures and formal feedback on documentation and coding skills .
Output:
| purposes : to assess attitudes and practices of documentation and coding education for emergency medicine residents ( emrs).methods : questions regarding documentation teaching methods were formulated into online surveys for program directors ( pds ) and emrs.results:fifty-three of 104 pds and 446 of 576 emrs who received the survey completed it .
although 93% of emrs and 63% of pds believe proper chart documentation is an important skill , only 18% of emrs and 25% of pds believe their program s teaching was adequate .
eleven percent of emrs reported that they were comfortable with their knowledge of documentation .
emrs who received formal lectures and feedback reported higher comfort levels with their knowledge of documentation ( 3.3 1.1 vs. 4.5 1.4 , p < 0.05 ) than those who did not receive formal lectures and feedback.conclusions:although most physicians who were surveyed agreed that documentation and coding is a vital skill , many emrs and pds report inadequate instruction .
resident education may benefit from broader implementation of formal lectures and formal feedback on documentation and coding skills . |
PubmedSumm119685 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in 2008 a 57-year old man was referred for treatment of polycythemia vera ( pv ) .
one year earlier he had been admitted with symptoms resembling an episode of transitory cerebral ischemia ( tci ) .
the patient also had a history of multiple sclerosis ( ms ) , vitamin b12 deficiency and tobacco smoking .
the ms was not being treated at this point and the b12 deficiency was treated with cyanocobalamin 1 mg / day . at that time
the hemoglobin concentration ( hgb ) was elevated at 18.5 g / dl , the hematocrit ( hct ) was 54% , and the white blood cell count ( wbc ) was 11.010/l .
a cerebral ct - scan showed a hypodense area compatible with an infarction of indeterminable age .
the patient was treated with acetylsalicylic acid 75 mg / day , dipyridamole 200 mg 2 times / day along with simvastatin 40 mg / day .
the patient was phlebotomized once before discharge . unfortunately , although the elevated blood cells should have raised the suspicion of pv , the patient was not referred to a department of hematology , and no jak2-v617f mutation analysis was done at this time .
the patient was referred to the department of hematology in 2008 by his general practitioner because of sustained elevated hgb - concentrations and platelet counts along with fatigue . at the time of the pv diagnosis
the wbc was 12.010/l , and the platelet count 48510/l , the mcv 91 fl and b12 vitamin was elevated at 882 pmol / l .
the red cell mass and plasma volume were both expanded , and serum - epo was lowered at 1
a bone marrow biopsy was compatible with pv with a slightly hypercellular bone marrow with panmyelosis and depleted iron stores , displaying no reticulin fibrosis and a peripheral blood - smear was without leucoerythroblastosis .
1 illustrates the treatment and responses in hematological parameters along with the jak2-v617f allele burden .
approximately 13 months after the pv - diagnosis , treatment with hydroxyurea ( hu ) 500 mg / day was initiated in order to reduce the need of phlebotomies and to normalize elevated leukocyte and platelet counts .
eighteen days later the patient was admitted to a department of neurology with convulsions and fever , being suspected of an attack of ms .
clinically a pneumonia was suspected , and a chest x - ray revealed multiple pulmonary infiltrates .
it was concluded that the alveolitis likely was induced by hu , since the patient steadily improved after hu was discontinued . at follow - up in the hematological out - patient clinic the patient had a normal hct and the platelet count
consequently , treatment with alendronate 70 mg / week was initiated and continued for 18 months , until the patient changed treatment to teriparatide a pth analog for two years .
afterwards alendronate was reintroduced . during these 56 months , after initiation of alendronate , the patient was largely in complete hematological remission ( the platelet count was temporarily above 40010/l on some occasions ) without need for further phlebotomies , and the jak2-v617f mutation status 44 months after pv - diagnosis revealed a marked decrease in the allele burden from 64.0% to 21.4% ( fig .
1 ) . the patient had no need of phlebotomies or cytoreductive treatment to reduce elevated cell counts , and no thrombohemorrhagic events occurred .
subsequent serial measurements of the jak2-v617f allele burden have shown sustained values below 20% and even below 10% on some occasions .
two follow - up bone marrow biopsies at 33 and 53 months after institution of statin and bisphosphonate combination therapy ( 64 and 84 months after pv - diagnosis ) displayed stable disease with remaining features of pv . despite this , the vascular dilatation found in the initial bone marrow biopsy had disappeared in the two following biopsies ( fig .
this case report demonstrates for the first time a remarkable hematological and molecular response with a marked sustained decrease in the jak2-v617f allele burden during statin and bisphosphonate combination therapy of a patient with pv .
both agents potently inhibit the mevalonate pathway , which has been suggested as a therapeutic target in multiple cancer types and also in the treatment of mpns .
an association between chronic inflammation and the development and progression of mpns has been proposed , and both statins and bisphosphonates possess potent anti - inflammatory , anti - neoplastic , anti - thrombotic and anti - angiogenic properties unrelated to the cholesterol lowering effects of statins , , .
these effects are probably mediated by inhibiting the synthesis of the important isoprenoid intermediates such as farnesylpyrophosphate ( fpp ) and geranylgeranylpyrophosphate ( ggp ) .
when activated these pathways induce increased cellular growth , proliferation , migration and oxidative stress .
importantly , simvastatin ( and other statins ) induce apoptosis and inhibit jak2-v617f - dependent cell growth in mpn cell lines . furthermore , the mpn - associated jak2-v617f kinase localization to lipid rafts and its signaling is inhibited by statins .
also , the pro - inflammatory cytokines tnf - alpha and il-6 are decreased during statin treatment in a wide variety of inflammatory conditions , tnf - alpha being able to facilitate clonal expansion of jak2-v617f - positive cells in mpns .
vegf mediated neo - angiogenesis may in part be responsible for the bone marrow fibrosis observed in myelofibrosis , .
this effect may be observed in the bone marrow of this patient , where the cd34 staining revealed vascular dilatation in 2008 but not in the following two biopsies .
release of vegf from the tumor cells may be responsible for the vascular dilatation observed .
regarding the reduction in jak2-v617f allele burden , the patient only received treatment with hu for 18 days during the initial disease course .
thus , it is reasonable to conclude , that the ensuing marked decrease in the jak2-v617f allele burden over the first 44 months after the pv diagnosis was not related to hu - treatment . although hu has been shown to reduce the jak2-v617f allele burden in some studies , other studies have failed to reproduce this effect .
importantly , the effect of hu on peripheral blood cell counts and the jak2-v617f allele burden is but temporary with rising cell counts within a few days after hu being discontinued .
we believe that the response is a result of the treatment with simvastatin and from month 31 the addition of alendronate .
however , since 44 months elapsed between the first two jak2-v617f analyses , we are unable to relate the decrease in the jak2-v617f allele burden directly to the initiation of alendronate treatment .
interestingly , during the two years of teriparatide treatment , when alendronate was paused , the jak2-v617f allele burden was relatively stable .
the following stabilization of the disease parameters might suggest that a long - term bisphosphonate treatment is redundant , and instead a short - term treatment plan with bisphosphonate followed by continuous statin treatment might be a better strategy . during this period the patient was treated with the platelet inhibitors asa and dipyramidole .
dipyramidole is a phosphodiesterase inhibitor similar to anagrelide which is used in the treatment of essential thrombocytosis to reduce platelet count , but not in the standard treatment of pv .
dipyramidole has been shown to inhibit the proliferation of peripheral blood mononuclear cells from patients with cml and aml in - vitro , and could have influenced the hematological response in this patient . on the other hand dipyramidole
likewise , there is no evidence to suggest that asa could have caused the response .
prior case reports have described hematological remission in patients with myelofibrosis during treatment with bisphosphonates , but a phase ii study investigating the effects of zoledronic acid on patients with myelofibrosis showed responses in only 1 of 16 patients . in conclusion , we report complete hematological response in concert with a partial molecular response in a patient with pv treated with alendronate and simvastatin . although bisphosphonate monotherapy as illustrated by delforge et al .
may rarely be beneficial in the late myelofibrosis stage , the highly remarkable response in our patient on combination therapy with statin and bisphosphonate , possibly exhibiting different but synergistic blocking effects in the mevalonate pathway , is certainly an encouraging stimulus for further experimental and clinical research on the potential role of these old drugs in the treatment of mpns alone or adjuvant to hu , interferon-2a or jak1/2 inhibitors .
furthermore , a greater response may be expected in the earlier stages of the mpn disease ( et or pv ) , before the bone marrow becomes fibrotic .
besides , a relatively small number of responders may still be beneficial , when taking into account the relatively low toxicity of these treatments .
Output:
| we report a 57-year old man with polycythemia vera , who had a remarkable hematological and molecular response during treatment with simvastatin and alendronate .
the patient was treated with this combination for 56 months , and during this period the patient has been in complete hematological remission . the jak2-v617f allele burden has dropped from 64% to sustained values below 20% , and follow - up bone marrow biopsies have revealed no change in pv features , without any regular cytoreductive treatment . |
PubmedSumm119686 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: case 1 was a 6-year - old , previously healthy girl from the family of 7 siblings of consanguineous parents living in a rural area of kuwait . for the last 10 days , she complained for pain in muscles of lower limbs , clumsiness , and difficult walking .
, she had limping gait and symmetrically painful muscles on palpation , without signs of trauma .
however , she had preserved deep tendon reflexes and sphincter control , and sensory appeared intact .
whole blood count , liver , renal , electrolyte profiles , creatine kinase enzyme , erythrocyte sedimentation rate , c - reactive protein , and cerebrospinal fluid investigations ( cell and protein counts ) were normal .
due to presumed guillain - barre syndrome , she received immunoglobulins intravenously with mild improvement afterward .
case 2 was her elder 10-year - old brother who came 4 days later to the same hospital with nearly same symptoms and signs , however pain in the muscles was less severe .
cases 3 and 4 were 2 other brothers ( 8 years and 12 years old ) who after another 2 days were admitted for the same problems , then all 4 were transferred from the local hospital to our neuropediatric unit .
on admission , 18 days after the first symptoms , the girl was still complaining of severe pain in the lower limb muscles , also generated by light touch of the extremities , and she was clumsy .
the 3 affected brothers complained of only mild , movement - related muscular pain and had mild gait disturbance .
the 3 other siblings of the same family ( a 14-year - old girl and two boys of 2 and 3 years ) were unaffected . as an exposure to a common environmental agent ( toxin or drug )
was the most probable explanation , the parents ( who first denied ) were specifically asked for any possible poisons in the house .
the father then remembered that he was using a pesticide inside the house to get rid of cockroaches and brought one empty can to us .
it proved to be diacidol 60% ( iupac ) containing 60% of diazinon , a colorless thiophosphoric acid ester a nonsystemic organophosphate used to control cockroaches , ants , and flees in residential buildings .
however , the father insisted that the insecticide was used just before they left the house for a week , for a trip to saudi arabia , and that upon return they cleaned the house completely . with enigma why not all family members were affected , we additionally asked about the circumstances
. finally , the father remembered that the 4 affected children were playing football with the can of diacidol in the garden for an hour before their trip .
he also told us that all affected children had had mild abdominal cramps and diarrheal symptoms during the trip .
unfortunately , hand - on toxicology service was not available at that time and tests to determine cholinesterase activity in red blood cells and/or serum pseudo cholinesterase were not possible
.
being aware of this stumbling point in the diagnostic process , and complaints of leg pain provoked by touch , suggestive of a sensory neuropathy , we performed electromyography / nerve conduction study ( emg / ncv ) studies in 2 most affected siblings ( cases 1 and 2 ) .
however , we started gabapentin reaching the therapeutical dose of 30 mg / kg / d , and the symptoms improved . on discharge , only the girl was still complaining of mild pain in the muscles . on follow - up after 6 months ,
abbreviations : adm , abductor digigit minimi ; ul / ll , upper / lower limb ; cv , conduction velocity ( m / s ) , tl , terminal latency ( ms ) ; a , amplitude ( m wave ) ; mv , motor nerve , amplitude of action potential ; v , sensory nerve ; n , normal
.
decrement study were done in the right adm / right nasalis / left nasalis .
the clustering of cases in a temporal proximity in a family evoked a challenging pathway in search for a common cause .
the diagnosis of guillain - barre syndrome , as first suspected in the girl , became less probable when the brother ( case 2 ) was admitted for the same problems .
viral , autoimmune , or metabolic myopathies seemed unlikely as complete blood counts , creatine kinase , liver enzymes , renal and electrolyte profiles were normal , and serology tests were negative .
organophosphate - induced delayed polyneuropathy is a rare neurotoxicity effect , occurring 1 to 5 weeks following acute cholinergic crisis or after a period of mild or no clinical features , resulting in muscle weakness , pain , and paresthesiae .
although the mechanism is not well understood , organophosphate - induced delayed polyneuropathy is considered not to be due to the effects on acetylcholinesterase itself but to the inhibition of an enzyme in the nervous system , called neuropathy target esterase . in regard to this possibility
, initial diarrheal symptoms and abdominal cramps could be interpreted as mild muscarinic effect of organophosphate .
indeed , one study confirmed that only pinpoint pupils and diarrhea are enough for early triage in pediatric exposure to insecticides .
however , further course of otherwise not straightforward symptoms were actually dominated by nicotinic effects ( muscle weakness and cramps ) and subtle neuropathic signs ( sensitivity to touch ) .
the neuropathy in organophosphate - induced delayed polyneuropathy is commonly described as motor predominant , and if sensory symptoms are present , they are always milder than the motor component . in our cases ,
however , the small sensory nerves involved in organophosphate neuropathy can also give rise to normal results , thus by no means excluding its presence .
clinical signs of organophosphate - induced delayed polyneuropathy in children are otherwise rarely reported , and are much milder than in adults , as it appeared also in our cases .
given that the volume of exposure was not perfectly clear , we postulate that the condition in our cases was due to short - lasting contact , low exposure level , and not on the body parts where almost complete absorption occurs , that is , scrotum and axilla . in view of possible additional inhalation route , as the house has been sprayed , the reported history was not supportive . regarding potential therapies for neuropathic pain as described in this setting ,
we have chosen gabapentin with subsequent improvement in symptoms . in an earlier similar study in adult cases ,
carbamazepine was successfully used . however , owing to its ability to inhibit neuronal hyperactivity along the pain pathways and less side effects , currently gabapentin , along with pregabaline , has become mainstay of treatment for various neuropathic pain syndromes and in these cases a reasonable choice .
so far , only 1 study has been reported specifically related to diazinon - related family poisoning by combined inhaled and cutaneous route , however , with severe symptoms and course .
one might reasonably argue whether there was another , unknown environmental toxic agent ( heavy metal , drug ) to induce described temporal pattern of events . under the circumstances described
, the authors stand for the answer grounded on disclosed contact and subsequent transcutaneous organophosphate absorption , carefully excluding other differentials . in conclusion , we believe that our illustrative cases can further contribute to the better awareness and understanding of variable spectrum of transcutaneous route of organophosphate poisoning .
Output:
| contamination or transcutaneous absorption of organophosphates ( op ) is rare and there exist only few reports of such manner of poisoning . we report four children from the same family in whom temporal proximity of the disease onset , a detailed interrogation of parents and exclusion of other clinical differentials , led to the diagnosis of transcutaneous intoxication with organophosphates ( diazinon ) .
the contamination occurred during the game with a freshly used poison can .
uncommon clinical picture was marked by delayed signs predominantly reflecting certain nicotinic effects ( muscle weakness , cramps ) along with subtle neuropathic features occurring throughout a few weeks after initial event .
our illustrative cases can further contribute to the better awareness and understanding of variable spectrum of transcutaneous route of op poisoning . |
PubmedSumm119687 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a drug intended for use in humans should have an ideal balance of pharmacokinetics and safety , as well as potency and selectivity .
human oral bioavailability is an important pharmacokinetic property which describes the fraction of an administered drug that reaches the systematic circulation and its site of action , to exert its pharmacological and therapeutic effects .
bioavailability is 100% when a medication is administered parenterally as it goes straight into the bloodstream and is usually completely used by the body .
however , when a medication is administered via other routes ( such as orally ) , its bioavailability decreases .
prediction of oral bioavailability is not an easy task , as bioavailability depends on superposition of two processes : absorption and liver first - pass metabolism .
absorption in turn depends on solubility and permeability of compounds , as well as interactions with transporters and metabolizing enzymes in gut wall .
permeability further depends on the size of the molecule , as well as its capacity to make hydrogen bonds , its overall lipophilicity and possibly its shape and flexibility . molecular flexibility , for example ,
as evaluated by counting the number of rotatable bonds , has been identified as a factor influencing bioavailability.-[24 ] the bioavailability of drugs from oral formulations is also influenced by many physiological factors including gastrointestinal fluid composition , ph and dynamics , transit and motility and transport .
these factors may vary with age , gender , race , food , and disease .
oral bioavailability is denoted by the letter f. to lower the attrition rate of drug development there is a need to develop strong and accurate computational methods that can predict and prioritize compounds before they are synthesized or moved towards to preclinical and clinical development .
various prediction models are reported in the literature on known oral bioavailable drugs such as statistical models,[715 ] mechanistic models,[1621 ] qsar / qspr models,[2228 ] genetic programming,[2933 ] artificial neural networks , machine learning classification,[3436 ] etc .
we have selected oral bioavailability data from various literature studies.[4153741 ] the whole dataset comprises of 1664 drugs .
redundancy was completely removed by manually screening and selected dataset for this study comprises of chemically diverse 511 drugs .
drugs having oral bioavailability less than 30% were regarded as low orally bioavailable drugs and drugs with oral bioavailability 30% or more were regarded as high orally bioavailable .
class labels were defined as 1 for high oral bioavailability and 0 for low oral bioavailability .
further the whole dataset of 511 drug molecules was randomly split into training set of 384 drugs and test set of 127 drugs .
training set was used for training various classifiers , while testing set was not exposed to the system during descriptor selection , learning , kernel selection , and hyper - parameter selection phases . in classification problem usually
the data that is to be classified is associated with a large number of features or descriptors . as a result
feature or descriptor selection is a process of identifying and removing as much of the irrelevant and redundant information as possible .
the removal of irrelevant and redundant information often improves the performance of machine learning algorithms .
twelve optimal descriptors were selected using the sequential forward feature selection ( sffs ) algorithm .
iteratively algorithm adds to the basis each feature which was not previously selected and retains the feature subset that results in the highest estimated performance .
the search terminates after the accuracy of the current subset can not be improved by adding any other feature .
sffs is stated as : given a feature set x-{xi | i=1 n } , find a subset ym = { xi , ,
the set of optimal descriptors include molecular mass ( ma ) , molecular surface area ( msa ) , molecular volume ( mv ) , molecular refractivity ( mr ) , total hydrogen count ( hc ) , partition coefficient ( logp ) , rotatable bonds ( rtb ) , total polar surface area ( tpsa ) , solubility index ( logs ) , shape flexibility index ( sfi ) sum of e - states indices ( sesi ) and count of hydroxyl groups ( hyg ) .
different feature values for dataset falls in different ranges hence to avoid the discrepancy we have further scaled down these numeric values between 1 to 1 .
such scaling facilitates better representation of feature values in kernel function and also avoid numerical difficulties during the calculation . in this process
, input vector for training as well as the test set has been quantified as x = ( x1 , x2 , , x13 ) , each labeled by corresponding y = 0 or y = 1 depending on whether it represents high orally bioavailable drug or low orally bioavailable drug , respectively .
training set was then subjected to the support vector machine ( svm ) classifier , which involved fixing several hyper - parameters which further determines the function optimized by svm .
it is extremely crucial and has a profound impact on the performance of trained classifier .
we used several kernels : linear , polynomials , and radial bias function ( rbf ) initially to determine which of them is applicable to our data and is able to classify it efficiently .
we found rbf as the suitable classifier function ( as the number of features was not very large in comparison to the dataset ) for which training errors on low oral bioavailability data ( false negatives ) outweigh errors on high oral bioavailability data ( false positives ) .
k(xi , xj ) = exp ( | | xi xj | | )
.(1 ) this kernel ( 1 ) is best for the data in which the class - conditional probability distribution function approaches the gaussian distribution .
it maps the non - linear data into a higher dimension space where data is linearly separable .
its exponential nature can be expanded into an infinite series , giving rise to an infinite - dimension polynomial kernel .
however , this kernel is bit difficult to design , in the sense that it is difficult to arrive at an optimum and choose the corresponding c that works best for a given problem .
this has been taken care by running grid parameter search exploring all combinations of c and with each cross - validation routine , where ranged from 2 to 2 and c ranged from 2 to 2 . to identify an optimal hyper - parameter set
we have performed a two - step grid - search on c and with the use of 10 folds cross - validation , by dividing training set into 10 subsets of equal size ( ~38 drugs each having 12 descriptors ) .
pairs of ( c ; ) have been tried and the one with the best cross - validation accuracy has been picked . using rbf kernel ,
the best cross - validation accuracy was obtained at = 0.0078125 and c = 512 .
the result obtained showed a good classification accuracy of 88.54% during the cross - validation .
we have selected oral bioavailability data from various literature studies.[4153741 ] the whole dataset comprises of 1664 drugs .
redundancy was completely removed by manually screening and selected dataset for this study comprises of chemically diverse 511 drugs .
drugs having oral bioavailability less than 30% were regarded as low orally bioavailable drugs and drugs with oral bioavailability 30% or more were regarded as high orally bioavailable .
class labels were defined as 1 for high oral bioavailability and 0 for low oral bioavailability .
further the whole dataset of 511 drug molecules was randomly split into training set of 384 drugs and test set of 127 drugs .
training set was used for training various classifiers , while testing set was not exposed to the system during descriptor selection , learning , kernel selection , and hyper - parameter selection phases .
in classification problem usually the data that is to be classified is associated with a large number of features or descriptors . as a result
so first and foremost step is to reduce the dimensions . feature or descriptor selection is a process of identifying and removing as much of the irrelevant and redundant information as possible .
the removal of irrelevant and redundant information often improves the performance of machine learning algorithms .
twelve optimal descriptors were selected using the sequential forward feature selection ( sffs ) algorithm .
sffs algorithm starts with an empty set of features . in first iteration , algorithm considers all feature subsets with only one feature .
iteratively algorithm adds to the basis each feature which was not previously selected and retains the feature subset that results in the highest estimated performance .
the search terminates after the accuracy of the current subset can not be improved by adding any other feature .
sffs is stated as : given a feature set x-{xi | i=1 n } , find a subset ym = { xi ,
, xm } , with m < n , that optimizes an objective function j(y ) .
the set of optimal descriptors include molecular mass ( ma ) , molecular surface area ( msa ) , molecular volume ( mv ) , molecular refractivity ( mr ) , total hydrogen count ( hc ) , partition coefficient ( logp ) , rotatable bonds ( rtb ) , total polar surface area ( tpsa ) , solubility index ( logs ) , shape flexibility index ( sfi ) sum of e - states indices ( sesi ) and count of hydroxyl groups ( hyg ) .
different feature values for dataset falls in different ranges hence to avoid the discrepancy we have further scaled down these numeric values between 1 to 1 .
such scaling facilitates better representation of feature values in kernel function and also avoid numerical difficulties during the calculation .
in this process , input vector for training as well as the test set has been quantified as x = ( x1 , x2 , , x13 ) , each labeled by corresponding y = 0 or y = 1 depending on whether it represents high orally bioavailable drug or low orally bioavailable drug , respectively .
training set was then subjected to the support vector machine ( svm ) classifier , which involved fixing several hyper - parameters which further determines the function optimized by svm .
it is extremely crucial and has a profound impact on the performance of trained classifier .
we used several kernels : linear , polynomials , and radial bias function ( rbf ) initially to determine which of them is applicable to our data and is able to classify it efficiently .
we found rbf as the suitable classifier function ( as the number of features was not very large in comparison to the dataset ) for which training errors on low oral bioavailability data ( false negatives ) outweigh errors on high oral bioavailability data ( false positives ) .
k(xi , xj ) = exp ( | | xi xj | | )
.(1 ) this kernel ( 1 ) is best for the data in which the class - conditional probability distribution function approaches the gaussian distribution .
it maps the non - linear data into a higher dimension space where data is linearly separable .
its exponential nature can be expanded into an infinite series , giving rise to an infinite - dimension polynomial kernel .
however , this kernel is bit difficult to design , in the sense that it is difficult to arrive at an optimum and choose the corresponding c that works best for a given problem .
this has been taken care by running grid parameter search exploring all combinations of c and with each cross - validation routine , where ranged from 2 to 2 and c ranged from 2 to 2 . to identify an optimal hyper - parameter set
we have performed a two - step grid - search on c and with the use of 10 folds cross - validation , by dividing training set into 10 subsets of equal size ( ~38 drugs each having 12 descriptors ) .
pairs of ( c ; ) have been tried and the one with the best cross - validation accuracy has been picked . using rbf kernel ,
the best cross - validation accuracy was obtained at = 0.0078125 and c = 512 .
the result obtained showed a good classification accuracy of 88.54% during the cross - validation .
to optimize the svm parameters and c , 10-fold cross - validation was applied on each of the training datasets bin , exploring various combinations of c ( 2 to 2 ) and ( 2 to 2 ) . in 10-fold cross - validation ,
the training dataset ( 384 drugs , each having 12 descriptors ) was spilt into 10 subsets , each of equal size , where one of such subsets was used as the test dataset while the other subsets were used for training the classifier .
the process is repeated 10 times using a different subset of a corresponding test and training datasets , hence ensuring that all subsets are used for both training and testing .
a twofold grid optimization has been considered and the result shown [ figure 2 ] suggests that the optimized c and were found to be 512 and 0.0078125 , respectively .
contour plot of grid search result showing optimum values of hyper - parameter the best combination of and c that was obtained from grid based optimization is used for training a rbf - based svm classifier using entire training data ( 384 drugs each having 12 descriptors ) .
the result obtained showed a good classification accuracy of 88.54% during the cross - validation .
the reported accuracy on the training datasets depicts the effectiveness and reliability of this prediction method ; but still it may or may not give the equivalent or better accuracy when applied on the novel drugs , i.e. drugs with an unknown oral bioavailability profile .
therefore , it is extremely important to test the svm classifier on the non - cross validated test set which is out - of - sample and independent of the training set data .
we applied the svm classifier on the whole test set ( 127 ligands each having 12 descriptors ) , the classifier incurred an accuracy of 96.85% by using the rbf kernel with = 0.0078125 and c = 512 .
this prediction accuracy suggests that svm - based prediction of oral bioavailability can be considered as a helpful tool in drug discovery and development .
the efficiency of a classifier was further evaluated with the help of various quantitative variable : ( a ) true positive ( tp ) , represents total number of correctly classified high orally bioavailable drugs , ( b ) true negative or ( tn ) , represents total number of correctly classified low orally bioavailable drugs ( c ) false positive ( fp ) , represents total number of incorrectly classified low orally bioavailable drugs , ( d ) false negatives ( fn ) , represents total number of incorrectly classified high orally bioavailable drugs . using these quantitative variables , several statistical metrics were calculated to measure the effectiveness of the oral bioavailability - svm classifier .
sensitivity ( sn ) and specificity ( sp ) metrics , which indicate the ability of a prediction system to classify the high and low orally bioavailable drugs , were calculated by equations ( 2 ) and ( 3 ) and receiver operating characteristic curve ( roc ) for the same was plotted [ figure 3 ] .
receiver operating characteristic ( roc ) plot for a classifier with optimized values of c and sn ( % ) = [ tp/ ( tp+fn)]*100
.(3 ) to indicate an overall performance of the classifier system ; accuracy ( ac ) , for the percentage of correctly classified drugs and the matthews correlation coefficient ( mcc ) were computed as follows : ac = [ ( tp + tn)/ ( tp+fp+tn+fn)]*100
.(4 ) mcc= [ ( tp*tn)-(fp*fn)]/ ( tn+fp ) ( tn+fn ) ( tp+fp ) ( tp+fn )
.(5 ) sensitivity ( sn ) came out to be 95.60% with a false positive proportion ( fp ) of 0.79% whereas specificity ( sp ) came out to be 97.30% with a false negative ( fn ) proportion of 3.15% .
similarly youden 's index ( youden 's index = sensitivity + specificity 1 ) was 0.929 and matthews correlation coefficient ( mcc ) was found to be 0.909 .
the overall accuracy ( ac ) calculated using equation ( 4 ) was 96.1% which is significantly higher than existing methods .
the area under roc curve was found to be 0.943 with a standard error of 0.0253 .
the prediction model derived from svm can serve as primary tool for generating some idea about oral bioavailability of ligands .
user just needs to calculate the 12 physicochemical descriptors , as these values are prerequisite for prediction of oral bioavailability through the generated svm model [ figure 1 ] .
the ligand with unknown oral bioavailability can be tested against the prediction model . for given 12 physicochemical properties
this svm model can predict the oral bioavailability of the ligand under consideration . at preliminary level , this model can predict that whether the oral bioavailability of the ligand under study is low or high .
numerous attempt have been made to predict oral bioavailability of drugs and ligands by computational and experimental method in past .
some of those prediction models are listed in table 1 along with the current study and the model generated by svm seems to be more satisfactory in terms of prediction accuracy .
comparative study of some of the oral bioavailability prediction models with current study absorption of drug taken orally is a complex process and , although related to drug physicochemical properties , it is related in fairly complex ways .
physiological and environmental conditions influence the bioavailability of drugs such as the presence or the absence of food , residence time of the drug in contact with the small intestinal epithelium , etc and make the absorption prediction further complex . failure to appreciate this complexity in attempting to build models may lead to the generation of model with low confidence .
an alternative approach to modeling oral bioavailability is to develop structure - based models for the properties contributing to the absorption process , such as solubility and permeability ( included in presented model as logs and logp ) .
for example , if a potential drug is expected to have poor oral bioavailability due to low - intrinsic aqueous solubility , then this is a property amenable to manipulation by the formulation scientist . on the other hand ,
if the compound is both poorly soluble and permeable , along with a significant metabolic liability , optimization may be very difficult if not impossible .
such candidates present high risks to successful development and should be identified as such early in the drug identification and development process .
the svm classifier with radial basis function kernel with = 0.0078125 and c = 512 applied on the test datasets .
it suggests that while considering chemoinformatics approaches into account , svm - based prediction of oral bioavailability can be a significantly important tool for drug development and discovery at a preliminary level .
Output:
| objective : a computational model for predicting oral bioavailability is very important both in the early stage of drug discovery to select the promising compounds for further optimizations and in later stage to identify candidates for clinical trials . in present study , we propose a support vector machine ( svm)-based kernel learning approach carried out at a set of 511 chemically diverse compounds with known oral bioavailability values.material and methods : for each drug , 12 descriptors were calculated .
the selection of optimal hyper - plane parameters was performed with 384 training set data and the prediction efficiency of proposed classifier was tested on 127 test set data.results:the overall prediction efficiency for the test set came out to be 96.85% .
youden 's index and matthew correlation index were found to be 0.929 and 0.909 , respectively .
the area under receiver operating curve ( roc ) was found to be 0.943 with standard error 0.0253.conclusion:the prediction model suggests that while considering chemoinformatics approaches into account , svm - based prediction of oral bioavailability can be a significantly important tool for drug development and discovery at a preliminary level . |
PubmedSumm119688 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: patients diagnosed with diffuse dme at samsung medical center between september 2003 and august 2004 were enrolled .
diffuse dme was defined as macular thickening corresponding to csme on biomicroscopy with findings of diffuse fluorescein leakage without a responsible microaneurysm on angiography and increased cmt ( > 250 m ) on optical coherence tomography .
eyes in the combination group underwent modified macular grid / focal laser photocoagulation three weeks after ivta .
four milligrams of triamcinolone were injected intravitreally after sterilization with betadine using a sterile lid speculum .
modified grid laser photocoagulation , which consisted of grid patterned laser burns on the capillary non - perfusion area , retinal thickening of the parafoveal region , and direct photocoagulation on the leaking microaneurysms were performed as described previously .
all patients underwent a complete ocular examination , including assessment of best corrected visual acuity on a snellen chart , applanation tonometry , slit lamp examination , dilated fundus examination utilizing biomicroscopy , fundus fluorescein angiography , and optical coherence tomography ( oct ; stratus oct ver .
responses after treatment were evaluated with respect to best corrected visual acuity and central macular thickness on oct .
best corrected visual acuity was converted to a logarithmic scale ( logmar ) for statistical analysis .
slit lamp biomicroscopy , fundus examination , and measurement of intraocular pressure were conducted at each follow - up visit .
this study was initially performed as a prospective study for six months ; the results are described in a previous report . after the initial six - month follow - up , visits were made every 3 to 4 months at the physician 's discretion ( swk ) .
oct examination was performed when 1 ) funduscopy revealed any macular change or 2 ) visual acuity changed .
additional treatment was applied at least six months after the initial treatment . if the funduscopy and oct showed apparent macular edema , additional treatment ( such as macular photocoagulation , ivta , a combination of the two , or pars plana vitrectomy with ivta followed by macular photocoagulation )
the choice of additional treatment was based primarily on the tomographic and angiographic appearance of the recurrent dme . for diffuse
dme with cystoid intraretinal fluid or subretinal fluid accumulation , ivta and laser photocoagulation were considered if the eye had previously been included in the group receiving only ivta . in the most intractable cases , sequential triple therapy of vitrectomy and ivta followed by macular laser photocoagulation
was performed . the demographics and clinical characteristics of the patients ( age , duration of diabetes , number of prior focal / grid laser photocoagulation treatments , central macular thickness , and logmar visual acuity ) were analyzed by a two - tailed t - test .
sex , extent of diabetic retinopathy , and presence of systemic hypertension were evaluated with fisher 's exact test .
initial response was determined at the six - month follow - up visit in eyes that completed the three - year follow - up .
initial response was defined as resolution of macular edema ( cmt measured via oct < 250 m ) .
kaplan - meier survival analysis with log ranks for dme recurrence was employed to evaluate the duration of dme resolution .
recurrence of dme was defined as 1 ) cmt greater than 250 m or 2 ) the need for additional treatment of macular edema in eyes that had initially responded to treatment .
patients diagnosed with diffuse dme at samsung medical center between september 2003 and august 2004 were enrolled .
diffuse dme was defined as macular thickening corresponding to csme on biomicroscopy with findings of diffuse fluorescein leakage without a responsible microaneurysm on angiography and increased cmt ( > 250 m ) on optical coherence tomography .
eyes in the combination group underwent modified macular grid / focal laser photocoagulation three weeks after ivta .
four milligrams of triamcinolone were injected intravitreally after sterilization with betadine using a sterile lid speculum .
modified grid laser photocoagulation , which consisted of grid patterned laser burns on the capillary non - perfusion area , retinal thickening of the parafoveal region , and direct photocoagulation on the leaking microaneurysms were performed as described previously .
all patients underwent a complete ocular examination , including assessment of best corrected visual acuity on a snellen chart , applanation tonometry , slit lamp examination , dilated fundus examination utilizing biomicroscopy , fundus fluorescein angiography , and optical coherence tomography ( oct ; stratus oct ver .
responses after treatment were evaluated with respect to best corrected visual acuity and central macular thickness on oct .
best corrected visual acuity was converted to a logarithmic scale ( logmar ) for statistical analysis .
slit lamp biomicroscopy , fundus examination , and measurement of intraocular pressure were conducted at each follow - up visit .
this study was initially performed as a prospective study for six months ; the results are described in a previous report . after the initial six - month follow - up , visits were made every 3 to 4 months at the physician 's discretion ( swk ) .
oct examination was performed when 1 ) funduscopy revealed any macular change or 2 ) visual acuity changed .
additional treatment was applied at least six months after the initial treatment . if the funduscopy and oct showed apparent macular edema , additional treatment ( such as macular photocoagulation , ivta , a combination of the two , or pars plana vitrectomy with ivta followed by macular photocoagulation )
the choice of additional treatment was based primarily on the tomographic and angiographic appearance of the recurrent dme . for diffuse
dme with cystoid intraretinal fluid or subretinal fluid accumulation , ivta and laser photocoagulation were considered if the eye had previously been included in the group receiving only ivta . in the most intractable cases , sequential triple therapy of vitrectomy and ivta followed by macular laser photocoagulation
the demographics and clinical characteristics of the patients ( age , duration of diabetes , number of prior focal / grid laser photocoagulation treatments , central macular thickness , and logmar visual acuity ) were analyzed by a two - tailed t - test .
sex , extent of diabetic retinopathy , and presence of systemic hypertension were evaluated with fisher 's exact test .
initial response was determined at the six - month follow - up visit in eyes that completed the three - year follow - up .
initial response was defined as resolution of macular edema ( cmt measured via oct < 250 m ) .
kaplan - meier survival analysis with log ranks for dme recurrence was employed to evaluate the duration of dme resolution .
recurrence of dme was defined as 1 ) cmt greater than 250 m or 2 ) the need for additional treatment of macular edema in eyes that had initially responded to treatment .
the mean follow - up period was 30.7 11.2 months ( range , 6 to 41 months ) for the combination group and 32.5 10.1 months ( range , 6 to 40 months ) for the ivta group . among 86 eyes from 74 patients , 67 eyes from 56 patients completed the three - year follow - up .
of those 67 eyes , two in the combination group and two in the ivta group were excluded from analysis because pars plana vitrectomy was performed for reasons other than macular edema .
three eyes ( two eyes in the combination group and one eye in the ivta group ) underwent pars plana vitrectomy for proliferative diabetic retinopathy complicated by vitreous hemorrhage .
one eye in the ivta group was subjected to pars plana vitrectomy for an epiretinal membrane .
clinical and demographic characteristics at baseline and at six months for patients who did and did not complete the three - year follow - up are summarized in table 1 .
no significant differences between those who did and did not complete follow - up were observed at baseline or at six months .
thirty - seven eyes in the combination group and 26 eyes in the ivta group were evaluated for three years .
baseline features , including visual acuity , cmt , stage of retinopathy , mean duration of diabetes , lens status , and number of prior macular photocoagulation procedures , did not differ between the two groups ( table 2 ) . throughout the three - year follow - up period
, macular edema was not observed in nine of 37 eyes ( 24.32% ) in the combination group that did not receive additional treatment and in only one of 26 eyes ( 3.85% ) in the ivta group ( p = 0.028 ) ( table 3 ) . in eyes with initial response ,
recurrence of dme was absent in nine of 17 eyes ( 52.94% ) in the combination group and in one of nine eyes ( 11.11% ) in the ivta group .
in these eyes , macular edema was absent for an average of 19.88 months ( up to 30 months ) in the combination group and 10.33 months in the ivta group ( p = 0.027 ) ( fig .
the mean number of additional treatments during the three - year follow - up was 0.92 0.92 in the combination group and 1.88 1.18 in the ivta group ( p = 0.001 ) ( table 4 ) .
although bcva and cmt improved six months after treatment in both groups , the improvement was greater in the combination group than in the ivta group ( table 2 ) .
bcva and cmt were evaluated at one- , two- , and three - year follow - ups .
for the nine eyes in the combination group that completed the three - year follow - up without additional treatment , logmar visual acuity measurements at baseline , six months , and three years were 0.80 0.34 , 0.66 0.37 , and 0.53 0.48 , respectively .
the respective cmt values were 481.9 177.5 , 157.5 12.9 , and 172.0 37.4 m . because only three eyes in the ivta group were exempt from additional treatment after the one - year follow - up , statistical analysis and comparison of bcva and cmt were not feasible .
nine ( 34.6% ) eyes in the ivta group and eight ( 21.6% ) eyes in the combination group experienced iop elevation in excess of 21 mmhg after initial treatment .
these eyes were treated with topical glaucoma medication , and iop normalized after treatment in most cases .
trabeculectomy was performed in one eye due to intractable intraocular pressure elevation that normalized after surgery .
cataract extraction was performed in 13 ( 38.2% ) of 34 phakic eyes in the combination group compared to seven ( 26.9% ) of 26 phakic eyes in the ivta group .
the mean time to cataract extraction was 15.54 months in the combination group and 19.14 months in the ivta group .
other injection - related complications , including infectious endophthalmitis , vitreous hemorrhage , and retinal detachment , were not observed .
the mean follow - up period was 30.7 11.2 months ( range , 6 to 41 months ) for the combination group and 32.5 10.1 months ( range , 6 to 40 months ) for the ivta group . among 86 eyes from 74 patients , 67 eyes from 56 patients completed the three - year follow - up .
of those 67 eyes , two in the combination group and two in the ivta group were excluded from analysis because pars plana vitrectomy was performed for reasons other than macular edema .
three eyes ( two eyes in the combination group and one eye in the ivta group ) underwent pars plana vitrectomy for proliferative diabetic retinopathy complicated by vitreous hemorrhage .
one eye in the ivta group was subjected to pars plana vitrectomy for an epiretinal membrane .
clinical and demographic characteristics at baseline and at six months for patients who did and did not complete the three - year follow - up are summarized in table 1 .
no significant differences between those who did and did not complete follow - up were observed at baseline or at six months .
thirty - seven eyes in the combination group and 26 eyes in the ivta group were evaluated for three years .
baseline features , including visual acuity , cmt , stage of retinopathy , mean duration of diabetes , lens status , and number of prior macular photocoagulation procedures , did not differ between the two groups ( table 2 ) .
throughout the three - year follow - up period , macular edema was not observed in nine of 37 eyes ( 24.32% ) in the combination group that did not receive additional treatment and in only one of 26 eyes ( 3.85% ) in the ivta group ( p = 0.028 ) ( table 3 ) . in eyes with initial response , recurrence of dme was absent in nine of 17 eyes ( 52.94% ) in the combination group and in one of nine eyes ( 11.11% ) in the ivta group . in these eyes ,
macular edema was absent for an average of 19.88 months ( up to 30 months ) in the combination group and 10.33 months in the ivta group ( p = 0.027 ) ( fig .
the mean number of additional treatments during the three - year follow - up was 0.92 0.92 in the combination group and 1.88 1.18 in the ivta group ( p = 0.001 ) ( table 4 ) .
although bcva and cmt improved six months after treatment in both groups , the improvement was greater in the combination group than in the ivta group ( table 2 ) .
bcva and cmt were evaluated at one- , two- , and three - year follow - ups . for the nine eyes in the combination group that completed the three - year follow - up without additional treatment , logmar visual acuity measurements at baseline , six months , and three years
were 0.80 0.34 , 0.66 0.37 , and 0.53 0.48 , respectively .
the respective cmt values were 481.9 177.5 , 157.5 12.9 , and 172.0 37.4 m . because only three eyes in the ivta group were exempt from additional treatment after the one - year follow - up , statistical analysis and comparison of bcva and cmt were not feasible .
nine ( 34.6% ) eyes in the ivta group and eight ( 21.6% ) eyes in the combination group experienced iop elevation in excess of 21 mmhg after initial treatment .
these eyes were treated with topical glaucoma medication , and iop normalized after treatment in most cases .
trabeculectomy was performed in one eye due to intractable intraocular pressure elevation that normalized after surgery .
cataract extraction was performed in 13 ( 38.2% ) of 34 phakic eyes in the combination group compared to seven ( 26.9% ) of 26 phakic eyes in the ivta group .
the mean time to cataract extraction was 15.54 months in the combination group and 19.14 months in the ivta group .
other injection - related complications , including infectious endophthalmitis , vitreous hemorrhage , and retinal detachment , were not observed .
we previously reported on a six - month comparison between ivta monotherapy and combined ivta and laser photocoagulation .
this comparison revealed that combined therapy resulted in greater improvement in bcva and cmt . among the 86 eyes from 74 patients who were recruited in a previous study ,
clinical and demographic characteristics of the patients who did and did not complete follow - up were compared for the evaluation of unexpected biases due to follow - up loss .
a comparison of clinical and demographic data at baseline between the combination group and ivta group among patients who completed follow - up revealed no significant differences ( table 2 ) .
therefore , we assumed that unexpected bias from loss to follow - up was not significant .
compared with only one of 26 ( 3.85% ) eyes in the ivta group , nine of 37 ( 24.32% ) eyes in the combination group sustained their normalized macular thickness up to the final follow - up visit .
the proportion with persistent resolution of dme was significantly higher in the combination group than in the ivta group ( p = 0.028 ) .
the duration of dme resolution was also significantly longer in the combination group than in the group receiving ivta only ( p = 0.027 ) .
seventeen eyes that initially responded to combination therapy had a significantly longer dme - free period than nine eyes in the ivta group .
it is also noteworthy that nine of the 17 eyes ( 52.9% ) showing an initial response to combination therapy did not require additional treatment for diffuse dme for three years .
these results suggest that a combination of ivta and laser photocoagulation may have long - lasting effects with a lower recurrence rate .
the mean number of additional treatments in the combination group was 0.92 , which was significantly smaller than the number in the ivta group ( 1.88 ) . in a large clinical trial conducted by the drcr network ,
the mean number of treatments in eyes that underwent macular grid / focal photocoagulation was reported to be 3.1 , and the mean frequency of treatments in eyes receiving a 4-mg intravitreal triamcinolone injection was 4 .
this discrepancy is believed to arise from the difference in the mode of additional treatments .
because our study targeted only diffuse dme , which is thought to be more intractable , we employed not only monotherapy ( such as ivta or laser photocoagulation ) , but also combination therapies ( including pars plana vitrectomy , ivta , and laser photocoagulation ) that may have a longer duration of action . because most eyes ( 23 of 26 eyes ) in the ivta group required additional treatment after the one - year follow - up , a comparison of visual acuity and central macular thickness between the combination group and ivta group was not feasible .
bcva and cmt improved gradually throughout the follow - up period in eyes in the combination group that did not undergo additional treatment .
these changes in bcva and cmt correspond with results from an earlier study that reported sustained improvement with gradual augmentation of visual acuity and cmt after macular grid / focal photocoagulation at the three - year follow - up .
we previously reported on the improvement in bcva and cmt after macular focal / grid laser photocoagulation combined with ivta at six months . in another study , although cmt improvement at six months was better in the combination group , the difference in bcva among the combination , laser , and ivta groups was not statistically significant .
the mean cmt of eyes in the former study was 525.4 m , compared to 401.4 m in the latter study .
although improvement in bcva did not immediately follow resolution of dme , improvement in cmt would be expected to contribute to the stabilization or improvement of bcva in the long - run , as described in a previous study .
we hypothesized that macular grid / focal laser photocoagulation after ivta would have its own role in 1 ) reduction of diabetic macular edema as a conventional concept of macular grid / focal photocoagulation and 2 ) maintenance of reduced macular thickness from ivta .
reported that eyes with severe macular edema ( > 400 m ) responded poorly to macular grid / focal photocoagulation , while eyes with moderate macular edema ( retinal thickness < 400 m ) responded well .
we assume that macular grid / focal laser photocoagulation reduces retinal thickness by driving the equilibrium toward the absorption of intraretinal / subretinal fluid .
a recent report from the drcr network suggested that intravitreal ranibizumab with prompt or deferred laser therapy is more effective through at least two years than is prompt laser treatment alone or combination therapy with ivta and macular grid / focal treatment .
however , in a subgroup analysis limited to pseudophakic eyes , eyes treated with intravitreal triamcinolone combined with laser therapy showed comparable outcomes to those treated with intravitreal ranibizumab with prompt or deferred laser treatment . in their analysis of all eyes ( including phakic eyes ) , intravitreal triamcinolone combined with laser therapy failed to show effectiveness , unlike our main outcomes . in their study ,
however , we prefer laser photocoagulation three weeks after the transitory reduction of cmt with ivta to simultaneous application of laser photocoagulation and ivta .
we assume that the decreased foveal thickness and restoration of retinal transparency achieved by ivta may selectively facilitate the delivery of laser energy to the photoreceptors and retinal pigment epithelia .
therefore , it is possible that the interval between ivta and macular grid / focal photocoagulation can lead to dissimilar results .
in addition , intravitreal triamcinolone combined with laser treatment increased subsequent cataract surgery , which can induce pseudophakic macular edema of varying severity . as a result
all cataract surgeries were performed by an experienced cataract surgeon without complications after we confirmed complete resolution of macular edema and lack of neovascular activity .
these may be unknown confounding factors that account for the difference in outcomes between this study and the recent study from the drcr network .
intravitreal administration of an anti - vascular endothelial growth factor ( vegf ) agent is one of the most promising treatment modalities for dme and has several advantages compared to ivta .
recent studies have demonstrated favorable results without significant complications , such as elevated intraocular pressure or cataract progression [ 15 - 17 ] .
however , because dme recurrence after administration of an anti - vegf agent is common , repeat administration is often required , which can be hazardous .
the long - term effectiveness of combination therapy for dme shown in this study may be helpful in attempts to maintain the effect with fewer injections , using modalities such as anti - vegf and laser photocoagulation .
recently , a large clinical trial showed that a combination of intravitreal ranibizumab injection and prompt or deferred laser treatment resulted in greater visual improvement than did a combination of ivta and prompt laser photocoagulation , although both treatments resulted in significant anatomical improvement . although anti - vegf injection and laser photocoagulation demonstrated more favorable outcomes , considering the different mode of action , a combination of ivta and laser photocoagulation may also be an alternative treatment option , particularly in pseudophakic eyes .
the primary weakness of this study is that it was originally designed as a prospective study with a six - month follow - up .
thus , after the initial six months , the follow - up intervals were irregular .
treatment for persistent or recurrent dme after the initial six months depended on the physician 's discretion based on angiographic and tomographic findings , not on a given protocol .
however , despite these weaknesses , because this study includes long - term results from a combination regimen , this report provides a long - term perspective on the clinical course of treatment after combination therapy for dme . in summary , this study presented the superiority of combination therapy at six month and three year follow - ups .
although combination therapy showed more favorable results than ivta monotherapy , dme recurrence was common .
therefore , we suggest that macular laser photocoagulation following resolution of edema through ivta can be an alternative therapeutic option for the treatment of recurrent or intractable dme .
Output:
| purposeto report the three - year outcomes of macular laser photocoagulation following intravitreal injection of triamcinolone acetonide ( ivta ) for diffuse diabetic macular edema ( dme).methodsa prospective , randomized controlled study was completed .
eighty - six eyes of 74 patients with diffuse dme were randomized into two groups .
eyes assigned to the combination group ( n = 48 ) were subjected to macular laser photocoagulation three weeks after ivta .
eyes in the ivta group ( n = 38 ) underwent ivta alone .
central macular thickness was measured by optical coherence tomography , and the number of additional treatments and mean time to recurrence were assessed.resultsthirty-seven eyes in the combination group and 26 eyes in the ivta group completed the three - year follow - up .
recurrence of dme after initial treatment was not observed for nine of the 37 ( 24.3% ) eyes in the combination group or for one of the 26 ( 3.9 $ ) eyes in the ivta group ( p = 0.028 ) .
dme was absent for 19.9 months after treatment in the combination group compared to 10.3 months in the ivta group ( p = 0.027 ) .
the mean number of additional treatments was 0.92 in the combination group and 1.88 in the ivta group ( p = 0.001).conclusionsresults in the subset of subjects who completed the three - year follow - up demonstrated that laser photocoagulation following ivta is more effective than ivta monotherapy for diffuse dme .
combination therapy required fewer additional treatments and resulted in a lower recurrence rate than ivta monotherapy . |
PubmedSumm119689 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: dexmedetomidine , an 2 agonist , has been studied widely as an adjuvant to local anaesthetics in regional anaesthesia techniques to enhance the quality and duration of analgesia .
dexmedetomidine is highly selective ( 8 times more selective than clonidine ) and a specific 2 adrenergic agonist , having analgesic , sedative , antihypertensive and anaesthetic - sparing effects when given by the systemic route .
dexmedetomidine produces manageable hypotension and bradycardia , but the striking feature of this drug is the lack of opioid - related side effects such as respiratory depression , pruritus , nausea and vomiting .
addition of dexmedetomidine to local anaesthetic drugs during peripheral nerve blocks may also prove beneficial for surgical patients .
the role of dexmedetomidine as an adjuvant to local anaesthetic agents in upper limb peripheral nerve blocks has been extensively studied .
a dose of 150 g of dexmedetomidine has been associated with minimal side effects . however , other studies have shown that dexmedetomidine even at 30 g can cause significant compromise , which challenges its use in peripheral nerve blocks in day - care surgeries .
besides , there is no study suggestive of any appropriate dose of dexmedetomidine as an adjuvant in supraclavicular brachial plexus block .
hence , the present study was conducted with the primary aim of assessing the duration of analgesia of two different doses of dexmedetomidine , 50 and 100 g added to 0.5% levobupivacaine , in patients posted for upper limb surgeries under supraclavicular brachial plexus block .
the secondary outcomes measured were the onset and duration of sensorimotor blockade , haemodynamic variables and adverse effects in both the groups .
after approval of the hospital ethical committee , patients were explained about the total procedure and only those who gave written consent were included in the study .
one hundred american society of anesthesiologists ( asa ) physical status i and ii patients , aged 1860 years , undergoing upper limb surgeries under supraclavicular brachial plexus block , were enrolled in this prospective , randomised trial .
patients on adrenoreceptor agonist or antagonist therapy , those with known sensitivity to local anaesthetics , second or third degree heart block , renal and hepatic insufficiency , uncontrolled diabetes and hypertension , pregnant and lactating females , drug abusers and psychiatric patients were excluded from the study .
the 10 cm visual analogue scale ( vas ) ( 0 , no pain and 10 , worst pain imaginable ) was explained during the pre - operative visit .
one hundred patients were randomised using a computer - generated randomisation list [ figure 1 ] .
the sealed envelope was opened by an anaesthesiologist not involved in the study who then prepared the drug solution according to randomisation .
the anaesthesiologist performing the block and observing the patient was blinded to the treatment group .
patients in group ld50 received 29 ml of 0.5% levobupivacaine plus 50 g of dexmedetomidine diluted in 1 ml of normal saline ( total 30 ml ) .
patients in group ld100 received 29 ml of 0.5% levobupivacaine plus 100 g of dexmedetomidine diluted in 1 ml of normal saline ( total 30 ml ) .
consort diagram showing the number of patients included and analysed after shifting the patients to the operation theatre , non - invasive monitors such as blood pressure , oxygen saturation ( spo2 ) and electrocardiogram were applied , and their baseline values were recorded .
supplemental oxygen was provided through nasal cannula at 4 l / min to all patients .
sedation was provided by iv administration of midazolam 1 mg and fentanyl 30 g before the block .
neural localisation was achieved using a nerve locator connected to a 21-gauge , 50-mm - long stimuplex needle .
the stimulation frequency was set at 1 hz , and the intensity of the stimulating current was initially set to deliver 1.5 ma and was then gradually decreased .
the position of the needle was considered to be acceptable when an output current < 0.5 ma still elicited a slight distal motor response in the forearm and hand . on negative aspiration for blood ,
sensory and motor blockade were assessed for every 2 min after completion of injection till 30 min and then for every 30 min after the end of surgery till the first 12 h , thereafter hourly until the block had completely worn off . for sensory loss assessment
, we used pinprick test with a 3-point scale : 0-no block , 1-analgesia ( loss of sensation to pinprick ) and 2 loss of touch .
motor blockade was evaluated by the ability to flex the elbow and hand as : 0 full flexion / extension movement in hand and arm against resistance , 1 movement against gravity but not against resistance , 2 flicker of movement in hand but not in arm and 3 no movement ( complete motor block ) .
onset of sensory blockade was defined as the interval between the end of injection and sensory blockade evidenced by loss of sensation to pinprick or by a score of 1 on pinprick response .
onset of motor blockade was the interval between the end of injection and complete motor paralysis of wrist and hand .
the duration of sensory blockade was defined as the time interval between sensory blockade and reappearance of the pinprick response .
the duration of motor blockade was defined as the time interval between maximum motor blockade and complete movement of wrist and fingers .
duration of analgesia was taken as the time interval between the onset of sensory blockade and the first dose of rescue analgesic given to the patient .
a complete block was defined as one associated with grade 2 sensory anaesthesia and grade 3 motor block and only these patients were included for further study .
patients with sensory block of grade 0 , 1 and motor block of grade 0 , 1 and 2 were considered to have incomplete block and hence were excluded from further analysis and converted to general anaesthesia .
post - operative pain was assessed using vas ( 0 no pain to 10 worst pain ) for every hour till the block lasted .
post - operative heart rate ( hr ) , systolic blood pressure , diastolic blood pressure , mean arterial pressure ( map ) and spo2 were recorded for every 2 h for the first 6 h and thereafter for every 4 h till the need for rescue analgesia .
rescue analgesia was provided with injection diclofenac sodium 75 mg intramuscularly when vas 3 cm .
the number of diclofenac injections given to each patient during the first 24 h of the post - operative period was recorded .
the time between the complete sensory block and the first analgesic request was recorded as the duration of analgesia .
the incidence of side effects ( bradycardia , hypotension and sedation ) was also recorded .
sedation score was assessed according to the modified ramsay sedation scale from 1 to 6 as follows : 1 = anxious , agitated , restless ; 2 = cooperative , oriented , tranquil ; 3 = responds to commands only ; 4 = brisk response to light glabellar tap or loud noise ; 5 = sluggish response to light glabellar tap or loud noise and 6 = no response .
bradycardia was defined as a decrease in hr by 20% from the baseline value or an absolute hr < 50 beats per min ; which was managed by 0.5 mg iv bolus of atropine .
hypotension was defined as fall in blood pressure by 20% from the baseline or an absolute map < 60 mmhg ; which was managed by iv crystalloids ( 200 ml of ringer lactate / normal saline ) or increments of mephentermine 3 mg iv .
sample size calculation was done based on a pilot study of ten patients ( 5 in each group ) .
the duration of analgesia in pilot study in two groups was 870.9 168.2 min and 750.2 221.4 min , respectively . to detect an observed difference of 2 h in the duration of analgesia between the groups , with a type 1 error of 5% and
a power of 80% , the minimum sample size required was 37 in each group .
data were checked , entered and analysed using spss version 19 for windows ( ibm corp . , armonk
quantitative data were represented as mean standard deviation , and for qualitative data , number and percentages were used .
students ' t - test was used as test of significance to find an association for quantitative data .
chi - square test was used as test of significance to find the association for qualitative data .
one patient from group ld50 and one from group ld100 were excluded from the study due to incomplete / failed block .
a total of 98 patients ( 49 in each group ) were included in the study .
both the groups were comparable with respect to age , height , weight , bmi , sex ratio , asa physical status and the duration of surgery [ table 1 ] .
there was no statistical significance in baseline haemodynamic parameters and type of fractures between the two groups ( p > 0.05 ) .
type of fractures in the study patients the sensory and motor block onset was significantly faster in group ld100 than in group ld50 .
the mean sensory block onset time was 12.82 3.8 min in group ld50 as compared to 8.15 1.7 min in group ld100 ( p = 0.026 ) .
the mean motor block onset time was 17.8 6.3 min in group ld50 as compared to 14.3 4.2 min in group ld100 ( p = 0.032 ) [ table 3 ] .
the duration of sensory block was prolonged in group ld100 ( 997.7 102.3 min ) when compared to group ld50 ( 756.2 138.5 min ) ( p = 0.001 ) .
the duration of motor block was also prolonged in group ld100 ( 902.4 122.8 min ) when compared to group ld50 ( 635.6 187.6 min ) ( p = 0.001 ) [ table 3 ] .
the duration of analgesia was significantly prolonged in group ld100 ( 1033.6 141.6 min ) when compared with group ld50 ( 776.4 138.6 min ) ( p = 0.001 ) [ table 3 ] .
about 16/49 patients ( 32.65% ) in group ld50 required diclofenac sodium injection as rescue analgesia , whereas 7 out of 49 patients ( 14.28% ) in group ld100 required rescue analgesia in the first 24 h of post - operative period [ p = 0.037 ; figure 2 ] .
characteristics of block in each group rescue analgesic requirement in post - operative period ( p = 0.037 ) the incidence of adverse effects namely sedation and bradycardia was significantly higher in group ld100 compared with group ld50 [ table 4 ] . however , the incidence of hypotension was statistically not significant between the groups ( p = 0.056 ) .
hypotension was treated with 200 ml bolus of crystalloids ( ringer lactate / normal saline ) and mephentermine 3 mg iv with no further decrement .
significantly more number of patients in group ld100 had higher sedation score ( > 3 ) than those in group ld50 .
results of this prospective , randomised , double - blinded study demonstrate that addition of 100 g dexmedetomidine to 0.5% levobupivacaine produces longer duration of analgesia compared to 50 g dexmedetomidine in supraclavicular brachial plexus block
. the higher dose of dexmedetomidine also hastens the onset and prolongs the duration of sensory and motor block . fewer patients ( 14.28% ) in group ld100
required diclofenac sodium injection as rescue analgesic than patients ( 32.65% ) in group ld50 .
the incidence of bradycardia was observed in more patients ( 44.9% ) in ld100 group , compared to ld50 group .
dexmedetomidine is a potent and a highly selective 2 adrenergic agonist having sedative , sympatholytic and analgesic effects and has been described as a safe and effective additive in many anaesthetic applications and analgesic techniques .
it is available as a preservative - free solution and contains no stabilisers or additives .
the main interest of our study was to evaluate the efficacy and safety of two doses of perineurally administered dexmedetomidine in providing adequate intraoperative anaesthesia and prolongation of the duration of analgesia in supraclavicular brachial plexus block .
found that dexmedetomidine enhanced the duration of bupivacaine anaesthesia and analgesia of sciatic nerve block in rats without any evidence of histopathological damage to the nerve .
the action of dexmedetomidine in peripheral nerve blockade seems to be due to increase in hyperpolarisation - activated cation current that prevents the nerve from returning to its resting membrane potential .
found that high concentrations of dexmedetomidine inhibit compound action potential ( cap ) in frog sciatic nerves without 2 adrenoceptor activation .
their result showed that dexmedetomidine reduced the peak amplitude of caps reversibly in a concentration - dependent manner .
these findings provide the essential justification and rationale of our human studies . in our study , the onset of sensory and motor block was earlier with the higher dose of dexmedetomidine ( 100 g ) . in a recent study by marhofer et al .
they compared three drug regimens with ropivacaine 0.75% , interaction of ropivacaine 0.75% with systemic dexmedetomidine or perineural dexmedetomidine on ulnar nerve block .
onset of motor block was faster , and the duration of motor block was significantly prolonged by the perineural administration of dexmedetomidine .
zhang et al . reported prolonged duration of analgesia in patients who received a higher dose of dexmedetomidine ( 100 g ) in 40 ml of 0.33% ropivacaine when compared to 50 g of dexmedetomidine in axillary brachial plexus block .
they also found that addition of 100 g of dexmedetomidine to ropivacaine produced prolonged duration of sensory and motor block compared to the ropivacaine alone group but concurrently increased the incidence of hypotension and bradycardia .
concluded that dexmedetomidine ( 100 g ) when used as an additive to 40 ml of 0.5% levobupivacaine prolonged axillary brachial plexus block duration .
they showed that dexmedetomidine shortened the sensory block onset time , motor block onset time , and prolonged the duration of the sensory block , duration of the motor block and post - operative analgesia .
swami et al . concluded that dexmedetomidine ( 1 g / kg ) when added to local anaesthetic ( 35 cc , bupivacaine 0.25% ) in supraclavicular brachial plexus block enhanced the duration of sensory and motor block and also the duration of analgesia .
keplinger et al . assessed the dose dependency of dexmedetomidine when added to ropivacaine for peripheral nerve blockade . in their study , all volunteers received an ulnar nerve block with 22.5 mg ropivacaine alone ( r ) , or mixed with 50 ( rd50 ) , 100 ( rd100 ) or 150g ( rd150 ) dexmedetomidine .
there was a significant dose - dependent increase in the mean duration ( sd ) of analgesia with dexmedetomidine : r : 8.7 h , rd50 : 16.4 h , rd100 : 20.4 h and group rd150 : 21.2 h. sedation was also enhanced in a dose - dependent manner .
the analgesic effect of levobupivacaine in supraclavicular brachial plexus block was potentiated in a dose - dependent manner by adjuvant dexmedetomidine . in our study , fewer patients in ld100 group required diclofenac sodium injection as rescue analgesia ( p < 0.05 ) .
similarly , ammar and mahmoud also found that significantly lower iv morphine ( 4.9 mg vs. 13.6 mg ) was given as rescue analgesic in the bupivacaine plus dexmedetomidine group while comparing with plain bupivacaine group in infraclavicular brachial plexus block . in the present study ,
the incidence of adverse effects namely sedation and bradycardia was significantly higher in group ld100 compared with group ld50 .
sedative properties of dexmedetomidine are attributable to its lipophilic nature resulting in systemic absorption when administered perineurally .
reported significant sedation with the higher doses of dexmedetomidine ( 1.5 g / kg ) in caudal ropivacaine compared with plain ropivacaine for post - operative analgesia in paediatric day - care patients .
one hundred microgram dexmedetomidine added to levobupivacaine in brachial plexus block produces a longer duration of analgesia than 50 g .
Output:
| background and aims : the ideal dose of dexmedetomidine for brachial plexus block is a matter of debate .
this study was carried out to evaluate 50 g or 100 g of dexmedetomidine added to 0.5% levobupivacaine , with regard to the duration of analgesia .
our study also sought to assess the onset and duration of sensorimotor blockade , haemodynamic effects , sedation and adverse effects.methods:one hundred adult patients undergoing upper limb surgeries under supraclavicular brachial plexus block were randomly allocated into two groups .
group ld50 received 29 ml of 0.5% levobupivacaine plus 50 g of dexmedetomidine diluted in 1 ml of normal saline .
group ld100 received 29 ml of 0.5% levobupivacaine plus 100 g of dexmedetomidine diluted in 1 ml of normal saline .
duration of analgesia was the primary outcome .
onset and duration of sensorimotor blockade , haemodynamic variables , sedation score , and adverse effects were secondary outcomes .
the data were analysed with students ' t - test and chi - square test.results:the onset of sensory block and motor block was 14.82 3.8 min and 19.75 6.3 min , respectively , in group ld50 , while it was 11.15 1.7 min and 14.3 4.2 min , respectively , in group ld100 .
the duration of analgesia was significantly prolonged in group ld100 ( 1033.6 141.6 vs. 776.4 138.6 min ; p = 0.001 ) .
the incidence of bradycardia and sedation was observed in significantly more patients in group ld100 .
significantly fewer patients in group ld100 required rescue analgesia.conclusion:the 100 g dose of dexmedetomidine in brachial plexus block hastens the onset and prolongs the duration of sensorimotor blockade and analgesia , but with higher incidence of bradycardia and sedation . |
PubmedSumm119690 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: aseptic technique should be used for all survival surgical procedures . disinfect the surgical work surface with commercial disinfectant and prepare sterile surgical packs of instruments , drapes , gauze , swabs , sutures , and scalpel blades by autoclaving . a surgical mask , hair bonnet and sterile gloves should be worn .
a germinator dry bead sterilizer is also used to resterilize surgical instruments between procedures if multiple rat surgeries will be done during one session . prewarm a water - jacketed homeothermic blanket and place under an absorbent pad in order to prevent hypothermia of the rat during surgery .
place spontaneously hypertensive rat ( or other rat strain of choice ) into an induction chamber and induce anesthesia with 5% isoflurane ( anesthesia machine should be set to 1.0 l / min o2 and 1.0 l / min n2o ) .
shave the throat and left neck region beyond the prospective incision site using clippers ( oster a5 with # 10 blade ) .
apply betadine to a gauze pad and disinfect the skin starting from the center of the surgical region , spiraling outward .
rinse with sterile gauze pad containing 70% ethanol , moving pad in a similar pattern .
place rat in sterile stockinette or cover with a sterile surgical drape . under an operating microscope ,
a ventral midline incision is performed and the superficial fascia is dissected . beneath the superficial fascia , there is glandular tissue to the left and three muscles which form a triangle : the sternohyoid , which lies midline over the trachea ; the digastric ( easily identified with its shiny white tendinous portion ) ; and lastly , the sternomastoid muscle . careful sharp and blunt dissection is performed within the triangle to identify the carotid artery ( exclusive blunt dissection may be preferred by some to minimize accidental tissue damage ) . the external , internal , and common carotid arteries ( eca , ica , cca ) are exposed .
the vagus nerve is seen coursing along the lateral aspect of both common and internal carotid arteries and is sharply dissected off the common and internal carotid arteries .
two eca branches are then dissected sharply , the first branch heading medially and the second branch heading laterally . both branches are cauterized and cut , which allows for greater ease in mobilizing the larger vessels .
the hyoid bone may be encountered and this will limit the extent of rostral dissection . the external carotid artery is tied off as distally as possible with a 6 - 0 silk suture .
another 6 - 0 silk suture is placed loosely around the eca near the bifurcation with the ica .
make sure not to occlude the vessel as the intraluminal suture to be used for the occlusion will be going through here at a later step .
an initial partial arteriotomy is created between the two silk suture ties on the external carotid artery .
introduce a 2.2 -3.0 cm length of 4 - 0 monofilament nylon suture , with a kink 2.0 cm from its rounded , silicon - coated tip , into the eca lumen down toward the cca where the microsurgical clip is located .
cut the remaining portion of the eca ( at the site of the partial arteriotomy ) to free the stump and position the stump below the bifurcation of the eca and ica ; this will more easily allow the intraluminal suture to slide into the ica .
tighten the silk suture around the eca stump to secure the intraluminal nylon suture and prevent bleeding , and then remove the microvascular clip from the ica . open the clip slowly before removing it to check for bleeding .
continue advancing the nylon suture from the eca to ica lumen to the middle cerebral artery ( mca ) .
this length is typically 18 - 20 mm and is the reason for placing a kink in the suture prior to insertion .
if this occurs with much of the nylon suture still present outside of the vessel , it indicates that the suture is likely entering the pterygopalatine artery ( see note below ) .
pull back and curve the suture slightly to continue along the ica , which will run more medially .
additionally , dissection of the origin of the ppa may be done to better visualize the path of the intraluminal filament . continue to insert the nylon suture until resistance is felt at and after the 2 cm kinked position . at this point
mca occlusion can be confirmed by monitoring the reduction in regional cerebral blood flow using a laser doppler flowmeter ( see materials table for one equipment source ) .
also note that the origin of the pterygopalatine artery off of the ica can be directly tied off , if preferred , in order to avoid accidental intubation of this vessel with the intraluminal suture .
start the timer and record occlusion start time . remove the microclip from the cca .
close the incision ( dermis , panniculus carnosus , subcutaneous tissue layers ) quickly with 3 - 0 silk suture ( a simple continuous pattern will facilitate reopening for reperfusion ) and carefully place the rat in a recovery cage . check that the cage floor around the nose and mouth are free of bedding material and monitor recovery from anesthesia .
shortly before the occlusion period should end , re - anesthetize the rat , disinfect the incision site with betadine and 70% ethanol ( 3 cycles , as before ) and reopen the incision by removing the closing sutures .
withdraw the occluding suture partway from the ica until the suture end is visible through the ica .
do not fully remove the suture from the ica / eca ! place a microclip on the ica above the end of the intraluminal suture . completely remove the occluding suture and tightly tie off the eca stump .
moisten the region with several drops of sterile saline and close the incision layers ( dermis , panniculus carnosus , subcutaneous tissue ) with 3 - 0 silk suture using a simple interrupted pattern .
administer 0.05 mg / kg buprenorphine ( or other appropriate post - operative analgesic following your institutional guidelines ) into the peritoneal space .
after the rat has recovered , test for behavioral indication of infarction by holding the rat by the tail and observing whether the rat can turn to both sides .
simple scoring scales can be used to record initial post - infarct behavorial functioning ( see discussion ) .
additional injections of buprenorphine ( same dosage as above ) should be given every 6 to 8 hours for 24 hr of pain relief .
. a simplified diagram of the cranial circulatory system of the rat is shown with a silicon - coated intraluminal suture occluding the origin of the mca .
the oa and st branches off of the left eca have been ligated and a suture tie around the eca stump holds the intraluminal suture in place .
aca , anterior cerebral artery ; ba , basilar artery ; cca , common carotid artery ; eca , external carotid artery ; ica , internal carotid artery ; mca , middle cerebral artery ; oa , occipital artery ; pca , posterior cerebral artery ; pcoma , posterior communicating artery ; ppa , pterygopalatine artery ; st , superior thyroid artery .
representative magnetic resonance imaging of coronal sections of rat brain 24 hours after 1 hour transient mcao .
similar infarct patterns can be seen with more advanced mri techniques such as diffusion - weighted imaging and apparent diffusion coefficient mapping .
representative coronal sections of rat brain stained with ttc 24 hours after 1 hour transient mcao .
ttc staining reveals white ( unstained ) infarcted regions of cerebral cortex and striatum in the same rat as that shown in figure 2 .
note that the general pattern of focal ischemic lesions is similar to that seen in the mri t2-weighted images , although the final infarct area determined histologically may be slightly smaller than the t2 lesion .
aseptic technique should be used for all survival surgical procedures . disinfect the surgical work surface with commercial disinfectant and prepare sterile surgical packs of instruments , drapes , gauze , swabs , sutures , and scalpel blades by autoclaving . a surgical mask , hair bonnet and sterile gloves should be worn .
a germinator dry bead sterilizer is also used to resterilize surgical instruments between procedures if multiple rat surgeries will be done during one session . prewarm a water - jacketed homeothermic blanket and place under an absorbent pad in order to prevent hypothermia of the rat during surgery .
place spontaneously hypertensive rat ( or other rat strain of choice ) into an induction chamber and induce anesthesia with 5% isoflurane ( anesthesia machine should be set to 1.0 l / min o2 and 1.0 l / min n2o ) .
shave the throat and left neck region beyond the prospective incision site using clippers ( oster a5 with # 10 blade ) .
apply betadine to a gauze pad and disinfect the skin starting from the center of the surgical region , spiraling outward .
rinse with sterile gauze pad containing 70% ethanol , moving pad in a similar pattern .
under an operating microscope , a ventral midline incision is performed and the superficial fascia is dissected . beneath the superficial fascia , there is glandular tissue to the left and three muscles which form a triangle : the sternohyoid , which lies midline over the trachea ; the digastric ( easily identified with its shiny white tendinous portion ) ; and lastly , the sternomastoid muscle . careful sharp and blunt dissection is performed within the triangle to identify the carotid artery ( exclusive blunt dissection may be preferred by some to minimize accidental tissue damage ) . the external , internal , and common carotid arteries ( eca , ica , cca ) are exposed .
the vagus nerve is seen coursing along the lateral aspect of both common and internal carotid arteries and is sharply dissected off the common and internal carotid arteries .
two eca branches are then dissected sharply , the first branch heading medially and the second branch heading laterally . both branches are cauterized and cut , which allows for greater ease in mobilizing the larger vessels .
the hyoid bone may be encountered and this will limit the extent of rostral dissection . the external carotid artery is tied off as distally as possible with a 6 - 0 silk suture .
another 6 - 0 silk suture is placed loosely around the eca near the bifurcation with the ica .
make sure not to occlude the vessel as the intraluminal suture to be used for the occlusion will be going through here at a later step .
an initial partial arteriotomy is created between the two silk suture ties on the external carotid artery .
introduce a 2.2 -3.0 cm length of 4 - 0 monofilament nylon suture , with a kink 2.0 cm from its rounded , silicon - coated tip , into the eca lumen down toward the cca where the microsurgical clip is located .
. , redlands , ca , usa ) . cut the remaining portion of the eca ( at the site of the partial arteriotomy ) to free the stump and position the stump below the bifurcation of the eca and ica ; this will more easily allow the intraluminal suture to slide into the ica .
tighten the silk suture around the eca stump to secure the intraluminal nylon suture and prevent bleeding , and then remove the microvascular clip from the ica . open the clip slowly before removing it to check for bleeding .
continue advancing the nylon suture from the eca to ica lumen to the middle cerebral artery ( mca ) .
this length is typically 18 - 20 mm and is the reason for placing a kink in the suture prior to insertion . after a variable length of nylon suture
if this occurs with much of the nylon suture still present outside of the vessel , it indicates that the suture is likely entering the pterygopalatine artery ( see note below ) .
pull back and curve the suture slightly to continue along the ica , which will run more medially .
additionally , dissection of the origin of the ppa may be done to better visualize the path of the intraluminal filament .
continue to insert the nylon suture until resistance is felt at and after the 2 cm kinked position . at this point
mca occlusion can be confirmed by monitoring the reduction in regional cerebral blood flow using a laser doppler flowmeter ( see materials table for one equipment source ) .
also note that the origin of the pterygopalatine artery off of the ica can be directly tied off , if preferred , in order to avoid accidental intubation of this vessel with the intraluminal suture .
close the incision ( dermis , panniculus carnosus , subcutaneous tissue layers ) quickly with 3 - 0 silk suture ( a simple continuous pattern will facilitate reopening for reperfusion ) and carefully place the rat in a recovery cage . check that the cage floor around the nose and mouth are free of bedding material and monitor recovery from anesthesia .
shortly before the occlusion period should end , re - anesthetize the rat , disinfect the incision site with betadine and 70% ethanol ( 3 cycles , as before ) and reopen the incision by removing the closing sutures .
withdraw the occluding suture partway from the ica until the suture end is visible through the ica .
do not fully remove the suture from the ica / eca ! place a microclip on the ica above the end of the intraluminal suture .
moisten the region with several drops of sterile saline and close the incision layers ( dermis , panniculus carnosus , subcutaneous tissue ) with 3 - 0 silk suture using a simple interrupted pattern .
administer 0.05 mg / kg buprenorphine ( or other appropriate post - operative analgesic following your institutional guidelines ) into the peritoneal space .
after the rat has recovered , test for behavioral indication of infarction by holding the rat by the tail and observing whether the rat can turn to both sides .
simple scoring scales can be used to record initial post - infarct behavorial functioning ( see discussion ) .
additional injections of buprenorphine ( same dosage as above ) should be given every 6 to 8 hours for 24 hr of pain relief .
occlusion of the middle cerebral artery by endovascular suture . a simplified diagram of the cranial circulatory system of the rat is shown with a silicon - coated intraluminal suture occluding the origin of the mca .
the oa and st branches off of the left eca have been ligated and a suture tie around the eca stump holds the intraluminal suture in place .
aca , anterior cerebral artery ; ba , basilar artery ; cca , common carotid artery ; eca , external carotid artery ; ica , internal carotid artery ; mca , middle cerebral artery ; oa , occipital artery ; pca , posterior cerebral artery ; pcoma , posterior communicating artery ; ppa , pterygopalatine artery ; st , superior thyroid artery .
representative magnetic resonance imaging of coronal sections of rat brain 24 hours after 1 hour transient mcao .
similar infarct patterns can be seen with more advanced mri techniques such as diffusion - weighted imaging and apparent diffusion coefficient mapping .
representative coronal sections of rat brain stained with ttc 24 hours after 1 hour transient mcao .
ttc staining reveals white ( unstained ) infarcted regions of cerebral cortex and striatum in the same rat as that shown in figure 2 .
note that the general pattern of focal ischemic lesions is similar to that seen in the mri t2-weighted images , although the final infarct area determined histologically may be slightly smaller than the t2 lesion .
rodent models of cerebral ischemia can be classified as global or focal and as reversible or irreversible .
we use a reversible focal ischemia model in order to mimic the reperfusion injury that can occur following recanalization in human stroke patients . while the rat shares the advantage of similar cranial circulation to the human , the extensive intracranial collateral circulation due to the circle of willis and leptomeningeal anastomoses results in inconsistent infarct volumes .
we use the spontaneously hypertensive rat ( shr ) strain because infarct size is greater in shrs exposed to focal cerebral ischemia compared to normotensive rats .
stroke induction in shrs is also more consistent and may generate less mortality than in other commonly used strains .
in addition , physiological parameters should be monitored throughout the surgery , because fluctuations can add to the variability in infarct volumes ; these parameters include blood pressure , arterial o2 and co2 levels , hypothermia , and hyperglycemia , which can exacerbate ischemic injury .
hypothermia is of particular concern because it can lessen the degree of neuronal ischemic injury , and therefore , placing the rat on a thermoregulatory heating pad during surgery is essential .
we employ commercially prepared silicon - coated sutures in this procedure in an attempt to increase consistency in the infarct size .
traditionally , intraluminal sutures used to occlude the mca have been prepared by flame - rounding a 3 - 0 nylon suture tip or using a hot glue gun to coat the suture tip with a small glue bead .
these procedures produce sutures with varying tip diameters and thus , may require several attempts at occlusion before finding a suture that matches the vessel diameter of a given rat .
additional variations on the mcao method described in this video include more distal occlusion , sparing the lenticulostriate branches in order to have a pure cortical infarct , and simultaneous occlusion of the mca and ipsilateral common carotid artery to reduce collateral blood flow .
the functional effects of stroke can be assessed using a variety of behavioral tests , in which deficits in specific tasks are reflected in a simple scoring scale .
for example , bederson et al . developed a neurological score grading rats on the extent of forelimb flexion in an elevated body position , asymmetric resistance to a lateral push , and open field circling behavior .
rats extending both forelimbs to the floor when elevated and exhibiting no other deficits were graded " normal ( 0 ) " , whereas rats with contralateral forelimb flexion only were classified with " moderate deficits ( 1 ) " . " severe grade 2 " rats displayed decreased resistance on the contralateral side to a lateral force and " severe grade 3 " rats additionally engaged in circling behaviors .
lower grade behavioral deficits were always observed in the next higher grade ( e.g. , grade 2 and 3 animals also displayed forelimb flexion ) and these scores were predictive of differences in infarct size .
thus , such a simple scoring system allows for a rapid , consistent semi - quantitative assessment of the functional deficits from stroke .
measurement of the extent of cerebral infarction is commonly accomplished by histological staining for tissue damage using ttc , cresyl violet ( nissl stain ) or hematoxylin and eosin .
magnetic resonance imaging techniques , including diffusion - weighted mri to visualize the infarct at early time points after occlusion , allow for the determination of an infarct volume in each individual rat without the need for harvesting tissue .
this is especially valuable in studies aimed at determining the efficacy of a neuroprotective treatment following stroke ; imaging the rat after mcao but prior to treatment administration gives the investigator confidence that all experimental and control animals experienced similar strokes to start , reducing the confounding effects of variability in stroke induction .
the authors have no conflicting interests to disclose.this protocol was approved by the institutional animal care and use committee at university of wisconsin - madison school of medicine and public health and abides by the national institutes of health guidelines for the use of experimental animals .
Output:
| stroke is the leading cause of disability and the third leading cause of death in adults worldwide1 . in human stroke
, there exists a highly variable clinical state ; in the development of animal models of focal ischemia , however , achieving reproducibility of experimentally induced infarct volume is essential .
the rat is a widely used animal model for stroke due to its relatively low animal husbandry costs and to the similarity of its cranial circulation to that of humans2,3 . in humans , the middle cerebral artery ( mca )
is most commonly affected in stroke syndromes and multiple methods of mca occlusion ( mcao ) have been described to mimic this clinical syndrome in animal models .
because recanalization commonly occurs following an acute stroke in the human , reperfusion after a period of occlusion has been included in many of these models . in this video
, we demonstrate the transient endovascular suture mcao model in the spontaneously hypertensive rat ( shr ) . a filament with a silicon tip coating
is placed intraluminally at the mca origin for 60 minutes , followed by reperfusion . note that the optimal occlusion period may vary in other rat strains , such as wistar or sprague - dawley .
several behavioral indicators of stroke in the rat are shown .
focal ischemia is confirmed using t2-weighted magnetic resonance images and by staining brain sections with 2,3,5-triphenyltetrazolium chloride ( ttc ) 24 hours after mcao . |
PubmedSumm119691 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the contura multi - lumen balloon ( mlb ) by senorx is a five - channel breast brachytherapy balloon developed for accelerated partial breast irradiation ( apbi ) using high dose rate iridium-192 .
the device is designed to improve upon the utility of single channel breast brachytherapy by offering multiple channels for the sake of dose optimization . because of its close proximity , the single channel device is not always suitable , as it can lead to unacceptably high skin dose , resulting in poor cosmesis [ 1 , 2 ] .
the contura mlb design includes four stable treatment channels that surround a fifth central channel .
this geometry offers greater ability to optimize the treatment dose distribution , especially with regard to skin , rib and lung .
target tissue conformance to the balloon surface is another important consideration in this type of apbi .
however , up to 10% of the planning target volume ( ptv ) may be displaced by air or fluid and still be considered acceptable .
the contura has a vacuum port that can remove air and fluid from the surrounding lumpectomy cavity ( other devices do not have this feature ) and thereby improve tissue conformance to the balloon surface . the contura device is inflated with a solution of saline and iodine contrast ( isovue - m 300 , bracco diagnostics ) to a volume ranging from 28 - 64.5 cm ( 4 - 5 cm diameter contura ) , depending on lumpectomy cavity size . the vendor recommends a 3% contrast solution by volume with the saline to assure optimal imaging using either ct or simulator .
most commercial treatment planning systems are not capable of computing the perturbation effects that may result from air pockets or contrast material .
earlier studies have investigated dose perturbation effects associated with certain partial breast brachytherapy devices [ 612 ] .
this study evaluates the dosimetric effects of high atomic number contrast and air pockets for the contura device .
the experimental setup for the dose perturbation measurements used a water phantom with a waterproof markus parallel plate ionization chamber ( ptw ) and k602 electrometer ( cnmc best ) .
the chamber was supported on a motorized vertical drive assembly with the incident surface overlying the upper contura surface .
the contura was inflated to 37 cm ( 42 mm diameter ) and supported horizontally in a ring stand with a clamp .
two flexible needle source transfer tubes connected the nucletron microselectron indexer to the central contura [ senorx ] channel ( # 5 ) and to the channel oriented closest to the ionization chamber ( channel # 1 ) .
the channel attachments were made above the water surface by bending the contura stem vertically .
the incident surface of the parallel plate chamber was positioned adjacent to the upper surface of the contura ( senorx ) and a motorized support raised the chamber for data collection ( right ) .
the outer contura channels are 5 mm from the central channel at mid cross - section ( left ) the determination of the sweetspot
( ir-192 source position that resulted in the maximum ionization current ) was performed for each channel and repeated for each experimental condition .
baseline ionization measurements were made at distances from 1 - 51 mm from the contura surface without any air bubble or contrast .
the following seven test conditions were achieved using a 60 cc syringe and then tested for comparison to determine dose perturbation effects : 1 cm , 2 cm , 3 cm and 4 cm air bubble , and 3% , 6% and 9% contrast solutions .
corrections were applied to account for temperature and pressure variations and for the source decay during several days of the measurements .
the experimental setup was performed twice and the results reported are the average of the two data sets .
dpf was defined as the ratio of dose with and without air or contrast medium .
figures 2 and 3 demonstrate that higher doses by 2 - 4% result from the introduction of 1 - 3 cm of air .
the dimensions of the air volumes were not evaluated but these results indicate that the path length of air toward the point of measurement is not proportional to the volume of air introduced . with two sets of data taken , the uncertainty in the measurements was in the range of 0.9 2.4% .
the 9% solution results in 4% lower dose close to the contura balloon and moderates with distance to 2 - 3% . the air pocket and
the central and off - center channel results for each measurement condition are similar but more pronounced by about 1% for the central channel .
for the two measurement sessions the reproducibility of air volume perturbation results did not vary by more than 0.9% with standard deviation of 0.3% .
the reproducibility of the contrast perturbation experiments was within 2.4% for the central channel and 1.5% for the off - center channel with standard deviations within 0.3%
dose perturbations due to air pockets with the hdr iridium source in the central contura ( senorx ) channel ( # 5 ) ( data collected 1 mm to 51 mm from contura surface ) 1 - 4 cc air bubble , no contrast , channel 1 .
dose perturbations due to air pockets with the hdr iridium source in the contura ( senorx ) channel # 1 ( data collected 1 mm to 51 mm from contura surface ) 3 - 9% contrast , no air bubble , channel 5 .
dose perturbations due to different iodinated contrast solutions ( by volume ) with the hdr iridium source in the central contura ( senorx ) channel ( # 5 ) ( data collected 1 mm to 51 mm from contura surface ) 3 - 9% contrast , no air bubble , channel 1 .
dose perturbations due to different iodinated contrast solutions ( by volume ) with the hdr iridium source in the contura ( senorx ) channel # 1 ( data collected 1 mm to 51 mm from contura surface )
dose perturbations resulting from air pockets and high atomic number contrast have been studied in accelerated partial brachytherapy devices . based on earlier dose perturbation studies [ 79 , 11 , 12 ] of the single channel mammosite
, similar results would be expected for the contura , at least from the central channel 5 .
those studies demonstrated that high z contrast causes dose reduction while the presence of air leads to increased dose .
this study also demonstrates that channel location does not impact significantly on the perturbation effects .
although air bubble dimensions were not evaluated , the experimental conditions would be comparable in the clinical situation .
brachytherapy dose measurement precision is always limited in non rigid phantoms . in this study deflection and compression of the contura balloon
this represents a limitation on the conclusions that can be drawn as well as differences from results previously reported for the mammosite . in this
study the effect of air appears to be more significant while the effect of contrast is less .
however , the trends are clear and consistent and demonstrate the importance of following vendor instructions and sound procedures to ensure accurate dose delivery .
vendor instructions recommend 3% contrast solution by volume and that is shown here to cause clinically insignificant dose perturbation effect .
dose perturbation effects due to air and high z contrast in a multichannel breast brachytherapy device have been measured .
the results reported here are similar to earlier reported results for a single central channel device . in the absence of inhomogeneity correction
incorporation of ct data for planning should be developed to offer improved dose computation accuracy .
for that reason , it is important to follow the appropriate guidelines for the use of contrast and to minimize the presence of air in order to limit dose perturbation effects in patient treatment .
Output:
| purposea study was conducted to determine the dosimetric effects resulting from air pockets and high atomic number ( z ) contrast medium within a multichannel breast brachytherapy device.material and methodsa 5 - 6 cm diameter contura ( senorx ) brachytherapy device was inflated using 37 cm3 of saline .
baseline dose falloff from an hdr iridium-192 source was measured with the iridium source centered in the central channel and an anterior off - center channel .
data were collected at distances from 1 to 50 mm .
comparison studies were conducted with identically inflated volume containing varied air pocket volumes ( 1 - 4 cm3 ) and concentrations of contrast solution ( 3% , 6% , and 9% by volume ) .
dose perturbation factors ( dpf ) were computed and evaluated.resultsdose perturbations due to air pockets and contrast solutions were observed . as the volume of air increased ,
the dpf increased by approximately 2.25%/cm3 .
the effect was consistent for both channels .
the contrast effects were more complex .
the 3% contrast media had minimal dose perturbation .
the 6% contrast solution caused dose reduction of 1.0% from the central channel but 1.5% dose increase from the anterior channel .
the 9% contrast solution caused dose reductions by 4.0% ( from central channel ) and 3.0% ( from anterior channel ) .
the dpf from all contrast solutions moderated with increasing distance.conclusionsdose perturbations due to air pockets and high - z contrast solution can be significant .
it is important to control these effects to avoid dose errors . |
PubmedSumm119692 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: five of the articles deal directly or indirectly with children 's mental health matters in the context of medicaid .
this overview compares and discusses the findings of these articles in some detail before briefly outlining the remaining articles on more specialized topics .
the president 's new freedom commission on mental health issued its final report in july 2003 , setting forth a number of key goals and findings . among those particularly relevant to matters discussed in this issue
mental health is essential to overall health , and goal 3 , that disparities in mental health services [ specifically , the underserving of minority populations ] should be eliminated . in 2004
a key part of that agenda will be the conduct of research to understand disparities in mental health treatment and provide a basis for their elimination .
the first three articles in this issue contain findings that underscore the continued existence of the disparities noted by the commission , and , to some extent , particularize those disparities
the article by larson , miller , sharma , and manderscheid examines data on service use and payments for children in racial / ethnic subgroups in medicaid programs of four states , and compares the service use of children treated for mental health / substance abuse conditions with those without such conditions .
the authors note previous findings that mental health problems among children and adolescents affect about 10 to 20 percent of children age 9 - 13 , and that treatment rates appear to be increasing .
most importantly , they note that previous evidence suggests that the overall rate of diagnosable mental health / substance abuse disorders is comparable across racial and ethnic groups . in this article
, the authors present updated analyses of medicaid data that predate many state health care reform initiatives in order to provide baseline data for the analysis of reforms .
study resulted in a number of complex findings concerning demographic differences in treatment rates and types of conditions treated for various groups . particularly striking are the findings that : nearly all diagnoses are more common among medicaid recipients who are white ; mental health / substance abuse diagnoses among white claimants are over two times the rate of diagnoses of children in other racial or ethnic groups combined ; and major depression , bipolar disorders , and other psychoses are nearly three times more common among white child / adolescent claimants than youth in other race / ethnicity groups .
not surprisingly , similar findings of concern related to disparities in the actual use of mental health / substance abuse services , such as physician services and inpatient hospital care .
their article closes with some helpful suggestions as to approaches to address disparities in diagnosis and treatment of mental health / substance abuse disorders , noting that , ultimately , public insurance programs such as medicaid must use multiple points of leverage to increase access , address stigma and misperceptions of care , and influence the quality of care delivered .
the article by saunders and heflinger examines the effects of introducing medicaid managed care into a previously fee - for - service ( ffs ) environment on children and adolescents ' access to behavioral health care services , and on the mix of such services that will be available .
it does this by comparing access and service mix in mississippi ( ffs ) and tennessee ( managed care ) .
it also examines access and service mix in these states based on race , sex , age , and medicaid enrollment category . the study found , among other things , that although each state experienced positive annual growth in behavioral health service access ( with the exception of tennessee 's overnight services ) , female and minority youth were less likely to access behavioral health services , both overall and by type of service .
offer evidence that managed care not only reduces access to behavioral services overall and both access to and mix of inpatient services , but it also may lead to reductions in specialty outpatient services as well . in the medicaid categories , the authors report a consistent pattern of lower access to behavioral health services among poverty - related youth and greater access of foster care youth relative to youth on supplemental security income . on the other hand , the authors state :
nevertheless , the news [ coming from this study ] is not all bad for managed care explaining that tennessee experienced significant positive increases in case management services .
this suggests that the problem of reduced access to mental health service providers is offset by increased use of the services of case managers .
the article by cook et al . examines the association between caregivers ' ( parents and families ) satisfaction with services and the likelihood that children with severe emotional disturbance will receive mental health services .
focuses on caregivers ' satisfaction with services provided under managed care ( as opposed to ffs ) arrangements that are increasingly used to control costs in programs for low - income children and their families .
the study confirmed a robust association between caregivers ' prior level of satisfaction with features of medicaid - funded behavioral health care plans and children 's later mental health service utilization .
moreover , it identified particular areas in which caregivers were least satisfied , and thus , areas for possible improvement in service delivery by focusing on improving caregiver satisfaction .
the area most in need of improvement was the adequacy of plans ' information about the availability of services and providers .
also sources of dissatisfaction were the number of forms to be filled out , the willingness of plans to pay for inpatient hospital or residential care , the inability to find providers willing to accept the plans , and the truthfulness of information provided about plan benefits and services .
consistent with the findings of saunders and heflinger , cook et al . found that children in managed care plans were significantly less likely to use a number of services .
they also note a trend toward lesser likelihood of psychiatric inpatient care ( as well as other services ) among those enrolled in managed care , and counsels : efforts to control the rising costs of health care must not occur at the expense of this vulnerable group of america 's children . in closing , they suggest a number of policy protections to avoid this result , including increasing the involvement of caregivers in the design and implementation of managed care arrangements .
the three articles in this issue devoted directly to children 's mental health in the medicaid context , when viewed together , suggest that the baseline from which we must work to eliminate disparities in access and quality of mental health / substance abuse services to minority or other underserved populations presents a great challenge .
in addition , these articles suggest that the increasing use of managed care , with its inherent pressure toward controlling health care costs , tends to exacerbate that challenge .
the article by baugh , pine , blackwell , and cibrowski concerning medicaid spending for central nervous system and antipsychotic drugs further illustrates the challenge of meeting the goals of the president 's new freedom commission on mental health .
it shows that , in 1998 , central nervous system drugs were the most expensive therapeutic category of drugs for state medicaid programs .
mental health is essential to overall health , it is critical that these important drugs be provided to consumers as needed . at the same time , mounting cost - control pressures in connection with meeting this need can be expected to increase the trend toward managed care arrangements , which to date have a relatively poor track record in terms of removal of disparities in access to quality mental health / substance abuse treatments by minorities and other underserved populations .
the article by holmes and deb examines whether , in one state ( indiana ) , community mental health centers differ in their ability to serve at - risk populations .
it succeeded in identifying certain exemplary centers whose practices may be worth emulating , as well as centers operating on a sub - par level .
the empirical model used in this study in indiana may be useful for evaluating community mental health centers ' performance in other states as a basis for improving medicaid service delivery nationwide .
the article by cotterill and thomas reports the findings of an empirical analysis of per case and per diem models of prospective payment for medicare inpatient psychiatric care .
their study supports the viability of the per diem model and identifies directions for future research .
the article by cromwell , maier , gage , drozd , osber , richter , greenwald , and goldman addresses limitations in previous studies of the costs of medicare psychiatric inpatients caused by the use of claims and provider cost reports that failed to identify differences in patient characteristics and routine costs .
this article is based on new primary data from 66 units in 40 facilities nationwide to measure the times spent by staff in caring for medicare patients .
the study identifies key patient characteristics associated with high staffing days , including severe psychiatric diagnosis , deficits in activities of daily living , and assaultive or agitated behaviors .
the article by larson , miller , sharma , and manderscheid examines data on service use and payments for children in racial / ethnic subgroups in medicaid programs of four states , and compares the service use of children treated for mental health / substance abuse conditions with those without such conditions .
the authors note previous findings that mental health problems among children and adolescents affect about 10 to 20 percent of children age 9 - 13 , and that treatment rates appear to be increasing .
most importantly , they note that previous evidence suggests that the overall rate of diagnosable mental health / substance abuse disorders is comparable across racial and ethnic groups . in this article , the authors present updated analyses of medicaid data that predate many state health care reform initiatives in order to provide baseline data for the analysis of reforms .
study resulted in a number of complex findings concerning demographic differences in treatment rates and types of conditions treated for various groups . particularly striking are the findings that : nearly all diagnoses are more common among medicaid recipients who are white ; mental health / substance abuse diagnoses among white claimants are over two times the rate of diagnoses of children in other racial or ethnic groups combined ; and major depression , bipolar disorders , and other psychoses are nearly three times more common among white child / adolescent claimants than youth in other race / ethnicity groups .
not surprisingly , similar findings of concern related to disparities in the actual use of mental health / substance abuse services , such as physician services and inpatient hospital care .
their article closes with some helpful suggestions as to approaches to address disparities in diagnosis and treatment of mental health / substance abuse disorders , noting that , ultimately , public insurance programs such as medicaid must use multiple points of leverage to increase access , address stigma and misperceptions of care , and influence the quality of care delivered .
the article by saunders and heflinger examines the effects of introducing medicaid managed care into a previously fee - for - service ( ffs ) environment on children and adolescents ' access to behavioral health care services , and on the mix of such services that will be available .
it does this by comparing access and service mix in mississippi ( ffs ) and tennessee ( managed care ) .
it also examines access and service mix in these states based on race , sex , age , and medicaid enrollment category . the study found , among other things , that although each state experienced positive annual growth in behavioral health service access ( with the exception of tennessee 's overnight services ) , female and minority youth were less likely to access behavioral health services , both overall and by type of service .
offer evidence that managed care not only reduces access to behavioral services overall and both access to and mix of inpatient services , but it also may lead to reductions in specialty outpatient services as well . in the medicaid categories , the authors report a consistent pattern of lower access to behavioral health services among poverty - related youth and greater access of foster care youth relative to youth on supplemental security income .
nevertheless , the news [ coming from this study ] is not all bad for managed care explaining that tennessee experienced significant positive increases in case management services .
this suggests that the problem of reduced access to mental health service providers is offset by increased use of the services of case managers .
the article by cook et al . examines the association between caregivers ' ( parents and families ) satisfaction with services and the likelihood that children with severe emotional disturbance will receive mental health services .
focuses on caregivers ' satisfaction with services provided under managed care ( as opposed to ffs ) arrangements that are increasingly used to control costs in programs for low - income children and their families .
the study confirmed a robust association between caregivers ' prior level of satisfaction with features of medicaid - funded behavioral health care plans and children 's later mental health service utilization .
moreover , it identified particular areas in which caregivers were least satisfied , and thus , areas for possible improvement in service delivery by focusing on improving caregiver satisfaction .
the area most in need of improvement was the adequacy of plans ' information about the availability of services and providers .
also sources of dissatisfaction were the number of forms to be filled out , the willingness of plans to pay for inpatient hospital or residential care , the inability to find providers willing to accept the plans , and the truthfulness of information provided about plan benefits and services .
consistent with the findings of saunders and heflinger , cook et al . found that children in managed care plans were significantly less likely to use a number of services .
they also note a trend toward lesser likelihood of psychiatric inpatient care ( as well as other services ) among those enrolled in managed care , and counsels : efforts to control the rising costs of health care must not occur at the expense of this vulnerable group of america 's children . in closing , they suggest a number of policy protections to avoid this result , including increasing the involvement of caregivers in the design and implementation of managed care arrangements .
the three articles in this issue devoted directly to children 's mental health in the medicaid context , when viewed together , suggest that the baseline from which we must work to eliminate disparities in access and quality of mental health / substance abuse services to minority or other underserved populations presents a great challenge .
in addition , these articles suggest that the increasing use of managed care , with its inherent pressure toward controlling health care costs , tends to exacerbate that challenge .
the article by baugh , pine , blackwell , and cibrowski concerning medicaid spending for central nervous system and antipsychotic drugs further illustrates the challenge of meeting the goals of the president 's new freedom commission on mental health .
it shows that , in 1998 , central nervous system drugs were the most expensive therapeutic category of drugs for state medicaid programs .
mental health is essential to overall health , it is critical that these important drugs be provided to consumers as needed . at the same time , mounting cost - control pressures in connection with meeting this need can be expected to increase the trend toward managed care arrangements , which to date have a relatively poor track record in terms of removal of disparities in access to quality mental health / substance abuse treatments by minorities and other underserved populations .
the article by holmes and deb examines whether , in one state ( indiana ) , community mental health centers differ in their ability to serve at - risk populations .
it succeeded in identifying certain exemplary centers whose practices may be worth emulating , as well as centers operating on a sub - par level .
the empirical model used in this study in indiana may be useful for evaluating community mental health centers ' performance in other states as a basis for improving medicaid service delivery nationwide .
the article by cotterill and thomas reports the findings of an empirical analysis of per case and per diem models of prospective payment for medicare inpatient psychiatric care .
their study supports the viability of the per diem model and identifies directions for future research . the article by cromwell , maier , gage , drozd , osber , richter , greenwald , and goldman addresses limitations in previous studies of the costs of medicare psychiatric inpatients caused by the use of claims and provider cost reports that failed to identify differences in patient characteristics and routine costs .
this article is based on new primary data from 66 units in 40 facilities nationwide to measure the times spent by staff in caring for medicare patients .
the study identifies key patient characteristics associated with high staffing days , including severe psychiatric diagnosis , deficits in activities of daily living , and assaultive or agitated behaviors .
Output:
| the following overview discusses and compares the findings and implications of the articles in this issue of the health care financing review that deal with mental health topics particularly children 's mental health in the medicaid context .
it also briefly describes articles concerning prospective payments for psychiatric patients under medicare . |
PubmedSumm119693 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: medulloblastoma ( mb ) is the most common malignant brain tumor in children , but in adults the disease is rare and accounts for less than 1 % of all intracranial malignancies . due to the infrequent occurrence of this disease in adults ,
not much was known until recently about the biology and genetics of adult mb and there are no prospective mb trials for this particular age group .
most centers therefore treat adults either by radiotherapy alone , by glioblastoma protocols , or by using pediatric mb protocols , although it is well known that toxicity profiles vary greatly between children and adults , leading to dose - limiting toxicity in a majority of adults that are treated on pediatric protocols [ 24 ] .
medulloblastoma is not a single disease but in fact comprises a collection of clinically and molecularly diverse tumor subgroups both in children and in adults .
the current consensus is that there are four major subgroups named wnt , shh , group 3 , and group 4 [ 5 , 6 ] .
wnt mbs are characterized by activated wnt signaling , mostly caused by mutations in b - catenin , and they have an excellent outcome with survival rates of > 90 % .
genomically they are very stable , except that almost all cases have lost an entire copy of chromosome 6 .
interestingly , it is the adult cases that tend to lose only parts of chromosome 6 .
shh mbs are characterized by shh signaling , caused by mutations in ptch1 , smo , or sufu , and/or amplifications of gli1 or gli2 , which all lead to constitutive activation of the shh signaling pathway .
genomically they are characterized by frequent loss of chromosome arm 9q , which harbors the ptch1 gene .
a subset of shh tumors have amplified the mycn oncogene , which in this subgroup is associated with a poor outcome [ 6 , 8 , 9 ] . in general these patients
have an intermediate outcome , although there are strong differences in prognosis depending on histology .
desmoplastic histology is associated with a much better outcome than cases with a classic histological pattern , while large cell / anaplastic ( lca ) histology predicts a very poor outcome .
group 3 and 4 tumors are less well characterized , but they contain most of the chromosome 17 aberrations that are frequently found in medulloblastoma .
small subsets of these subgroups have amplifications of either the myc ( group 3 ) or the mycn oncogene ( group 4 ) .
the worst outcome is seen for group 3 tumors , while group 4 tumors have more of an intermediate outcome similar to the shh subgroup .
recent meta - analyses performed on all published datasets of medulloblastomas analyzed and categorized into subgroups either by gene expression profiling or immunohistochemistry , and which included infants ( < 4 years ) ( 167 ; 18 % ) , children ( 416 years ) ( 599 ; 63 % ) , and adults ( > 16 years ) ( 177 ; 19 % ) , showed that the same four molecular subgroups ( wnt , shh , group 3 , and group 4 ) are found across all age groups , but they occur at strikingly different frequencies within each age group ( table 1 ) ( and references therein ) . in adults , the shh subgroup forms by far the largest subgroup , accounting for 57 % of all tumors .
other tumors in this age group are mainly characterized as wnt ( 13 % ) or group 4 ( 28 % ) , while group 3 tumors are very rare in adults ( 2 % ) [ 5 , 6 , 10].comparing survival rates for the four subgroups in adult patients versus those in pediatric patients showed some remarkable differences .
in particular , group 4 adult patients fare much worse than the group 4 pediatric patients , and have a similar poor outcome as the group 3 patients ( table 1 and fig .
adult patients with wnt tumors also tend to do worse than their pediatric counterparts , who almost all survive .
patients with shh tumors in the pediatric or adult age group have similar outcomes , and desmoplastic histology in adults remains associated with a better outcome than tumors with classic or lca histology ( table 1 and fig .
all desmoplastic cases ( 31/175 ) in adults were classified as shh tumors , but the opposite is not true : not all shh tumors in adults are of desmoplastic histology ( 31/100 ) .
the majority are of classic histology ( 67/100 ) , unlike the shh tumors in infants where the majority display desmoplastic histology ( 63/90 ) .
metastatic disease at diagnosis , present in 32 % of all pediatric mb patients , is much less frequent in adult mb patients ( 7 % ) . unlike in pediatric patients , where it is more frequently associated with group 3 and 4 tumors , metastasis is present in all subgroups in adults , but it is not a significant marker for outcome in this age group .
myc and mycn amplifications occur only rarely in adult mbs , but when present they still predict a poor outcome ( fig .
1overall survival ( os ) analyses of molecular and histological subgroups within adult medulloblastomas using kaplan meier plots and log - rank tests .
tumor data are combined from gene expression studies and tissue microarray ( tma ) analyses as described in plus 17 new adult cases that were recently added to our mb tmas .
a os analysis of molecular subgroups among all adult medulloblastoma patients ( n = 158 ) .
b os analysis of classic , desmoplastic , and lca histological subgroups among all adult medulloblastoma patients . c os analysis of myc or mycn amplified adult medulloblastomas versus nonamplified adult medulloblastomas .
d , g , j os analyses of patients harboring 10q loss versus patients with a balanced 10q , either in all adult medulloblastoma patients ( d ) , in shh medulloblastomas only ( g ) , or in group 4 medulloblastomas only ( j ) .
e , h , k os analyses of patients harboring 17p loss versus patients with a balanced 17p , either in all adult medulloblastoma patients ( e ) , in shh medulloblastomas only ( h ) , or in group 4 medulloblastomas only ( k ) .
f , i , l os analyses of patients harboring 17q gain versus patients with a balanced 17q , either in all adult medulloblastoma patients ( f ) , in shh medulloblastomas only ( i ) , or in group 4 medulloblastomas only ( l ) .
numbers next to the kaplan meier plots indicate the total number of patients per subgroup and the number of events in that subgroup .
ns not significanttable 1overview of medulloblastoma molecular subgroup distribution , histological subgroup distribution , and metastatic groups in infants ( age < 16 years ) , children ( age 416 ) , and adults ( age > 16)infantschildrenadultspercentageospercentageospercentageosmolecular subgroupswnt1na12961382shh577718815781group 334292655225group
485744782839histological subgroupspercentageospercentageospercentageosclassic434980797968desmoplastic43888861888large cell / anaplastic15261248320metastatic stagepercentageospercentageospercentageosm0686668819371 m + 32503265752data are from meta - analyses performed on published datasets of medulloblastomas analyzed and categorized into subgroups either by gene expression profiling or immunohistochemistry os overall survivalnumbers indicate the frequency each subgroup occurs within that age categoryfor each subgroup the percentage of patients is shown that is still alive 5 years after medulloblastoma diagnosis as determined by kaplan meier analysis overall survival ( os ) analyses of molecular and histological subgroups within adult medulloblastomas using kaplan
tumor data are combined from gene expression studies and tissue microarray ( tma ) analyses as described in plus 17 new adult cases that were recently added to our mb tmas .
a os analysis of molecular subgroups among all adult medulloblastoma patients ( n = 158 ) .
b os analysis of classic , desmoplastic , and lca histological subgroups among all adult medulloblastoma patients .
d , g , j os analyses of patients harboring 10q loss versus patients with a balanced 10q , either in all adult medulloblastoma patients ( d ) , in shh medulloblastomas only ( g ) , or in group 4 medulloblastomas only ( j ) .
e , h , k os analyses of patients harboring 17p loss versus patients with a balanced 17p , either in all adult medulloblastoma patients ( e ) , in shh medulloblastomas only ( h ) , or in group 4 medulloblastomas only ( k ) .
f , i , l os analyses of patients harboring 17q gain versus patients with a balanced 17q , either in all adult medulloblastoma patients ( f ) , in shh medulloblastomas only ( i ) , or in group 4 medulloblastomas only ( l ) .
numbers next to the kaplan meier plots indicate the total number of patients per subgroup and the number of events in that subgroup .
ns not significant overview of medulloblastoma molecular subgroup distribution , histological subgroup distribution , and metastatic groups in infants ( age < 16 years ) , children ( age 416 ) , and adults ( age > 16 ) data are from meta - analyses performed on published datasets of medulloblastomas analyzed and categorized into subgroups either by gene expression profiling or immunohistochemistry numbers indicate the frequency each subgroup occurs within that age category for each subgroup the percentage of patients is shown that is still alive 5 years after medulloblastoma diagnosis as determined by kaplan meier analysis
interestingly , shh mbs are the only subgroup that occur in a bimodal age distribution .
they are frequent in infants and adults ( both 57 % ) , whereas they are quite rare in children ( 18 % ) [ 6 , 11 , 12 ] .
this unusual age distribution of shh tumors suggested that these tumors in infants and adults may not be the same and may even have a different cellular origin .
interestingly , recent data showed that shh medulloblastomas may indeed arise from different precursor cells in either the cerebellum or brain stem . however
, whether these different origins are in addition linked to the difference between shh medulloblastomas in infants and adults remains to be seen , but it is known that medulloblastomas in adults mostly occur in the cerebellar hemispheres while medulloblastomas in children more often arise in the vermis and the 4th ventricle .
showed by expression profiling and cytogenetic analyses that pediatric and adult shh mbs are indeed transcriptionally and genetically distinct .
most notably , mycn amplifications and chromosome 10q deletions were less frequent in adult shh tumors than in pediatric shh tumors . however , adult shh mbs harboring 10q deletions and/or gli2 amplifications appeared to have a much worse prognosis as compared to pediatric shh medulloblastomas with the same genetic aberrations .
current treatment decisions for medulloblastoma are still largely based on the clinical variables of metastatic disease at diagnosis and extent of surgical resection both for pediatric and adult patients . for pediatric patients , age is also taken into account , as patients younger than 4 years of age are usually not treated with radiotherapy , especially those with standard risk .
however , stratifying patients in only two major risk categories , standard and high - risk , inappropriately simplifies the true clinical and molecular heterogeneity of medulloblastoma .
we therefore recently proposed a molecular risk stratification system for pediatric medulloblastomas based on cytogenetic aberrations ( myc / mycn amplifications , chromosome 6 and 17 aberrations ) . however , as has been shown , pediatric and adult medulloblastomas are distinct in terms of genomic aberrations and their impact on clinical outcome .
myc / mycn amplifications are very rare in adult medulloblastoma and chromosome 6 aberrations do not have the prognostic value in adult medulloblastoma patients as they have in pediatric medulloblastoma patients .
we therefore proposed a different algorithm for the molecular stratification of adult medulloblastomas based on aberrations of chromosome 10 and 17 .
this system may now need a further adjustment to acknowledge the fact that distinct molecular subgroups exist in medulloblastoma , including in the adult age group . as shown previously , loss of 10q , loss of 17p , and gain of 17q ,
all demonstrate prognostic significance in adult mb and all of them predict a poor outcome ( fig .
this is largely driven by the shh subgroup , in which these three markers clearly show prognostic significance ( fig .
all adult patients tend to have a poor prognosis , and the three copy - number markers therefore do not show as significant a prognostic effect as they do for shh tumors ( fig .
1j l).consequently , the dna copy number status of chromosome 10 and 17 will be most useful as molecular markers for risk stratification when combined with subgroup assessment . for subgroup assessment
, the nanostring assay can be used , which predicts the tumor - specific subgroup with high accuracy , based on the expression level of 22 subgroup - specific signature genes .
alternatively , a panel of immunohistochemistry - based markers ( b - catenin , sfrp1 , npr3 , kcna1 ) can be assessed , as has been shown in previous publications [ 11 , 17 , 18 ] . of note
, it is clear that these emerging biological risk criteria in mb will need prospective validation using multivariate analysis and taking into account classical prognostic factors ( extent of surgery , metastatic disease ) .
the recent progress that has been made in the genetic analysis of adult medulloblastomas has led to a much better understanding of these tumors and how they differ from pediatric medulloblastomas .
the same four molecular subgroups exist in adult medulloblastoma as they do in pediatric medulloblastoma , but they occur at different frequencies and they also carry a different prognostic significance when compared with their pediatric counterparts . molecular stratification algorithms using subgroup assessment and subgroup - specific biomarkers
will therefore also be useful for treatment stratification of adult medulloblastomas in the setting of clinical trials .
as shh medulloblastomas form the majority among adult medulloblastomas , they are of particular interest for molecularly targeted therapies , using for instance smo inhibitors
. initial reports treating shh medulloblastomas in humans or mice were hopeful , but the effects were only temporary [ 19 , 20 ] .
tumors quickly became resistant to these drugs either due to mutations in smo or to amplification of downstream signaling members such as mycn , gli1 , or gli2
. as these amplifications are already present in some primary ( untreated)shh tumors , further research of larger adult medulloblastoma cohorts is needed , for instance by full genome sequencing technologies , to assess to what extent adult medulloblastomas might or might not be responsive to these shh pathway inhibitors .
these sequencing efforts may also reveal other potential targets for rational ( combination ) therapies in a subgroup - specific manner .
Output:
| medulloblastoma encompasses a group of aggressively growing cancers that arise either in the cerebellum or brain stem .
they present primarily in children , with 8085 % of medulloblastomas being diagnosed in patients of 16 years and younger . in adults ,
medulloblastomas are rare and account for less than 1 % of intracranial malignancies .
due to the low incidence of medulloblastoma in adults , the biology and genetics of adult medulloblastomas have long been poorly understood .
many centers therefore still treat adults either by radiotherapy only or by using glioblastoma protocols ( both often noncurative ) , or with standard pediatric medulloblastoma regimes ( often associated with dose - limiting toxicity).current clinical staging systems discriminate between standard - risk or high - risk patients based on clinical and histological parameters .
however , clinico - pathological features often fail to accurately predict treatment response . in children ,
molecularly defined risk assessment has become important to improve survival of high - risk patients and to decrease treatment - related toxicity and long - term sequelae in standard - risk patients .
however , several recent studies have shown that adult and pediatric medulloblastomas are genetically distinct and may require different algorithms for molecular risk stratification . moreover , four subtypes of medulloblastoma have been identified that appear at different frequencies in children and adults and that have a different prognostic impact depending on age .
molecular markers such as chromosome 10q and chromosome 17 statuses can be used for molecular risk stratification of adult medulloblastoma , but only in a subgroup - specific context . here
we present an overview of the current knowledge of the genomics of adult medulloblastoma and how these tumors differ from their pediatric counterparts . |
PubmedSumm119694 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: anxiety disorders , such as post - traumatic stress disorder , social phobia , specific phobias , panic and obsessive - compulsive disorders , are among the most common mental disorders in humans ( olesen et al . , 2012 ) .
these disorders are associated with problems to extinguish learned fear responses and also to consolidate extinction memories ( myers and davis , 2007 ; milad et al . , 2009 ) .
to date , the most effective strategies in the treatment of anxiety disorders include use of pharmacological and cognitive strategies ( nutt , 2005 ) .
however , significant drawbacks to current therapy exist including lack of treatment response and also a lack of long - term beneficial effect of combining available drugs with exposure - based therapy ( barlow et al . , 2000 ; davidson et al . , 2004 ; foa et al . , 2005 ; yehuda and ledoux , 2007 ; norberg et al . , 2008 ) . clinical interventions which rescue deficits in fear extinction acquisition and consolidation would constitute important treatment options in these disorders .
along these lines , pharmacological and genetic silencing studies , predominantly in normally behaving rodents and using massed extinction training paradigms , have identified a number of neurobiological mechanisms that govern acquisition of fear extinction learning and extinction consolidation .
acquisition of extinction learning requires n - methyl - d - aspartate ( nmda ) receptor 2b ( sotres - bayon et al . , 2007 ) ,
-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid ( ampa ) ( zushida et al . , 2007 ; yamada et al .
, 2009 ) and metabotropic glutamate 7 ( mglu7 ) ( fendt et al . , 2008 ) receptor activities in addition to gabaergic signalling [ for example , see ( harris and westbrook , 1998 ; chhatwal et al .
, 2006 ; lin et al . , 2009 ; dalton et al . , 2012 ) ] , amongst others . following acquisition of extinction , there is a consolidation phase which lasts up to several hours which serves to stabilize plastic events into long - term memory ( mcgaugh , 2000 ) .
activation of nmda receptors ( davis , 2011 ) , brain - derived neurotrophic factor ( bdnf ) signalling ( chhatwal et al .
, 2006 ; soliman et al . , 2010 ) and inhibition of histone deacetylases ( hdac ) ( guan et al . , 2009 ;
2011 ) , amongst others , are important for consolidation of extinction [ for detailed reviews , see ( myers and davis , 2007 ; quirk and mueller , 2008 ; herry et al . , 2010 ; pape and pare , 2010 ; steckler and risbrough , 2011 ; orsini and maren , 2012 ; tronson et al . , 2012 ) ] .
the present study used isogenic 129s1/svimj ( s1 ) mice which display deficient extinction acquisition , poor recovery of fear - induced suppression of heart - rate variability , enlarged dendritic arbours in basolateral amygdala neurons and functional abnormalities in cortico - amygdala circuitry mediating fear extinction ( hefner et al .
in the current study we reduced the intensity of fear conditioning and observed that weak fear conditioning allowed for extinction acquisition in s1 mice but revealed deficient extinction retrieval .
recent findings show that impaired extinction acquisition and dysfunctional cortico - amygdala circuitry can be rescued by a novel zinc restricted diet ( whittle et al . , 2010 ) , which interestingly did not affect either fear learning or fear expression .
also , recent findings reveal that the s1 fear extinction phenotype can be rescued by fluoxetine ( a serotonin - selective reuptake inhibitor ) ( camp et al . , 2012 ) which is of clinical relevance as serotonin - selective reuptake inhibitors are first - line treatment for anxiety disorders ( nutt , 2005 ) . considering the well - known disadvantages of long - term ssri treatments , we screened for novel treatments which rescue both deficient extinction acquisition and extinction consolidation / retrieval in s1 mice .
evidence suggests that deep brain stimulation ( dbs ) of the nucleus accumbens ( acbc ) can enhance extinction - like behaviour in intractable obsessive - compulsive disorder patients , which is characterised by avoidance behaviours that fail to extinguish ( lipsman et al .
, 2010 ; greenberg et al . , 2010 ; grant et al . ,
furthermore , a small clinical study involving patients suffering from treatment - resistant depression has shown that dbs of the acbc can enhance various measures of cognition independent of mood status ( bewernick et al . , 2012 )
. however , there are also reports of no effect of acbc - dbs in mood disorder patients ( grubert et al . , 2011 ) .
very recently , dbs of the acbc during extinction training reduced fear expression and strengthened extinction memory in normally behaving rats ( rodriguez - romaguera et al . , 2012 ) potentially showing the utility of dbs of the acbc as a novel fear reducing adjunct during exposure - based therapy
here , we went beyond using normally behaving rodents and assessed whether dbs of the acbc during extinction training can rescue deficient extinction acquisition and extinction consolidation / retrieval in s1 mice .
pharmacological compounds which enhance glutamatergic signalling , including dcs ( nmda receptor partial agonist ) , pepa ( ampa receptor potentiator ) or amn082 ( mglu7 receptor agonist ) , can facilitate fear extinction in normally extinguishing animal models and in clinical studies ( myers et al . , 2011 ) .
we have previously shown that prior extinction training administration of dcs is ineffective in rescuing deficient extinction learning in s1 mice ( hefner et al . , 2008 ) .
however , it remains unknown whether dcs can rescue deficient extinction consolidation / retrieval once at least some extinction learning is induced , which we revealed in weak fear conditioned s1 mice .
furthermore , it is not known whether pepa or amn082 can reduce fear in an animal model of impaired extinction .
drugs inhibiting hdac proteins to prevent the removal of acetyl groups on histone tails is a promising approach in central nervous system disorders associated with disturbed learning and memory ( kazantsev and thompson , 2008 ) . interestingly , inhibiting hdacs has been shown to enhance fear learning ( guan et al . ,
2009 ) and rescue deficits in fear learning in mouse models of anxiety or neurodegeneration ( li et al . , 2006 ; dash et al . , 2009 ; kilgore et al . , 2010 ) .
facilitation of fear extinction by hdac inhibition has been reported in normally extinguishing mice ( bredy et al .
, 2007 ; lattal et al . , 2007 ; bredy and barad , 2008 ; guan et al . ,
however , it is not known whether inhibiting hdacs can improve extinction learning in animal models of impaired extinction .
thus , we tested whether valproic acid ( vpa ) , a dual hdac inhibitor and enhancer of gabaergic signalling or ms-275 , a more specific hdac inhibitor ( khan et al . , 2008 ; bantscheff et al . , 2011 ) , can rescue deficient extinction in s1 mice .
subjects were male 35 month old 129s1/svimj ( s1 ) mice . for experiments performed at the university of innsbruck , mice ( obtained from charles river , germany )
were housed ( 45 per cage ) in a temperature- ( 22 2 c ) and humidity- ( 5060% ) controlled vivarium under a 12 h light / dark cycle ( lights on at 7:00 a.m. ) . for experiments conducted at the national institutes of health , mice ( obtained from the jackson laboratory , usa ) were housed ( 2 per cage ) in a temperature ( 22 1 c)- and humidity ( 45 15%)-controlled vivarium under a 12 h light / dark cycle ( lights on , 6:00 a.m. ) .
all experimental procedures were approved by the austrian animal experimentation ethics board and by the national institute on alcohol abuse and alcoholism animal care and use and austrian ethical committees on animal care and use ( bundesministerium fr wissenschaft und verkehr , kommission fr tierversuchsangelegenheiten ) and followed the national institutes of health guidelines outlined in using animals in intramural research and the local animal care and use committees . for experiments performed at the university of innsbruck ,
mice were conditioned in a 25 25 35 cm chamber with transparent walls and a metal rod floor , cleaned with water and illuminated to 300 lux ( context a ) .
after a 120 s acclimation period , there were 3 pairings of a 120 s , 80 db white noise conditioned stimulus ( cs ) and a 2 s scrambled foot shock unconditioned stimulus ( us ) ( 0.6 ma unless stated otherwise ) , with a 120 s inter - pairing interval .
there was a 120 s no - stimulus consolidation period after the final pairing before mice were returned to the home cage .
extinction training was performed the next day in a 25 25 35 cm cage with a solid grey floor and black walls , cleaned with a 100% ethanol and illuminated to 10 lux ( context b ) .
after a 120 s acclimation period , there were cs - alone trials ( 16 unless stated otherwise ) , with a 5-sec inter - cs interval .
stimulus presentation was controlled by a tse operant system ( tse , bad homburg , germany ) .
extinction retrieval was conducted the following day by repeating the extinction training procedure but with 2 cs trials .
freezing was measured as an index of fear ( blanchard and blanchard , 1969 ) , manually scored based on dvd recordings of the duration of the cs , defined as no visible movement except that required for respiration , and converted to a percentage [ ( duration of freezing within the cs / total time of the cs ) 100 ] by a trained observer blind to the animals ' group . for experiments performed at niaaa ,
mice were conditioned in a 27 27 11 cm chamber with a metal - rod floor , cleaned with a 79.5% water/19.5% ethanol/1% vanilla - extract solution ( context a ) .
after a 180 s acclimation period , there were 3 pairings ( 60120 s inter - pairing interval ) of the conditioned stimulus ( cs ; 30 s 80 db , 3 khz tone ) and the unconditioned stimulus ( us ; 2 s , 0.6 ma scrambled foot shock ) , in which the us was presented during the last 2 s of the cs .
stimulus presentation was controlled by the med associates videofreeze system ( med associates , burlington , vt , usa ) .
24 h after conditioning , extinction training was conducted in a novel context ( context b ) ( cylinders with black / white - chequered walls and a solid plexiglas opaque floor cleaned with a 1% acetic acid/99% water solution ) housed in a different room from conditioning .
after a 180 s acclimation period , there were 16 cs presentations ( 5-sec inter - cs interval ) .
after a 180 s acclimation period , there were 3 cs presentations ( 5-sec inter - cs interval ) . freezing ( no visible movement except respiration )
was scored every 5 s by an observer blind to condition / treatment and converted to a percentage [ ( freezing observations / total observations ) 100 ] .
procedures and apparatuses for normal fear conditioning were as described above and involved 3 pairings of the cs with a 0.6 ma us .
the weak fear conditioning procedure was the same with the exception that the us was 0.3 ma .
mice were randomly assigned to either weak or normal fear conditioning and tested for extinction training and retrieval as above ( fig .
mice were anaesthetized with a mixture of ketamine / xylazine ( 80/5 mg / kg ) injected intraperitoneally ( i.p . ) . using a stereotaxic frame , electrodes ( ms303 - 3-b - spc , bipolar , twisted , 8 mm , plastics one , usa )
the coordinates were + 1.10 mm anterior to bregma , + 1.45 mm lateral from midline , 4.65 mm ventral according to the atlas of ( franklin and paxinos , 2008 ) .
electrodes were fixed to the skull with 2 stainless steel screws and dental cement ( havard cement , richter & hoffmann harvard dental gmbh , germany ) .
after surgery animals were individually caged and received buprenorphin ( 0.1 mg / kg injected intraperitoneally ) every 8 h for 3 days to minimise pain .
after 45 days of recovery , mice were conditioned via 5 pairings of the cs with a 0.7 ma us .
extinction training began with 2 cs - alone trials without dbs to measure fear expression in the absence of any influence of dbs before presenting 16 cs - alone extinction trials .
dbs ( 130 hz , 100 a , 60 s pulse width ) was applied via an a310 accupulser and a365 stimulus isolator ( world precision instruments , sarasota , usa ) throughout the cs period during each 16 cs extinction trials ( fig .
sham controls were connected to the stimulator but received no current . at the completion of testing ,
the localization of electrodes was confirmed from inspection of cresyl violet stained coronal sections ( fig .
mice were conditioned via 3 pairings of the cs with a 0.6 ma us .
louis , usa ) or saline vehicle was injected i.p . in a volume of 10 ml / kg body weight 2 h prior to extinction training ( fig .
the dose , route and timing of administration was based on previous studies showing extinction facilitating effects of vpa in mice ( bredy et al .
, 2007 ; bredy and barad , 2008 ) and that 2 h is required before maximal histone acetylation is observed ( tremolizzo et al . , 2005 ) .
mice were conditioned via 3 pairings of the cs with a 0.6 ma us . 6 mg / kg amn082 ( tocris bioscience , bristol , united kingdom ) or saline + 0.5% methylcellulose vehicle was administered per oral ( p.o . ) via gavage in a volume of 10 ml / kg body weight 2 h prior to extinction training ( fig .
the dose , route and timing of administration was based on previous studies showing extinction facilitating effects of amn082 in mice ( fendt et al . , 2008 ) .
mice were conditioned via 3 pairings of the cs with a 0.6 ma us . 10 or 30 mg / kg pepa ( sigma , st .
louis , usa ) or saline + 0.45% nacl + 33% ( 2-hydroxypropyl)--cyclodextrin vehicle was injected i.p . in a volume of 10 ml / kg body weight 15 min prior to extinction training ( fig .
the doses , route and timing of administration was based on previous studies showing extinction facilitating effects of pepa in mice ( zushida et al .
mice were conditioned via 3 pairings of the cs with a 0.6 ma us . 5 or 10 mg / kg ms-275 ( sigma , st .
louis , usa ) or saline + 25% dmso vehicle was injected i.p . in a volume of 10 ml / kg body weight 2 h prior to extinction training ( fig .
the doses , route and timing of administration was based on a previous study showing that maximal increases in histone acetylation occurs 2 h following s.c .
mice were conditioned via 3 pairings of the cs with a 0.3 ma us . 10 mg / kg ms-275 ( eubio , vienna , austria ) , 15 mg / kg dcs ( sigma , st .
louis , usa ) or saline + 25% dmso vehicle was injected i.p . in a volume of 10
ml / kg body weight immediately ( < 2 min ) after extinction training ( fig .
the doses , route and timing of administration of ms-275 was based on our earlier experiment and the doses , route and timing of administration of dcs was based on previous studies showing extinction facilitating effects in rats and humans ( walker and davis , 2002 ; ressler et al . , 2004 ;
all data were examined for equal variances using levene 's test before performing parametric tests .
data were analyzed using analysis of variance ( anova ) , with repeated measures for trial / trial - block , or by student 's t - test .
we have previously found that the level of fear expression in s1 mice can be modulated by the intensity ( shock amplitude , shock - tone trial number ) of fear conditioning ( camp et al . , 2009 ) .
therefore , we asked whether extinction in s1 was graded by the intensity of conditioning .
there was a significant and similar increase in freezing across 3 conditioning trials in mice given 0.3 ma and 0.6 ma shocks [ anova effect of trial : f(2 , 20 ) = 80 .
15 , p < 0.001 ; effect of group : p > 0.05 , interaction : p > 0.05 , n = 6/group ] ( fig .
block interaction for freezing ( f(7 , 70 ) = 8.71 , p < 0.001 ) .
post hoc tests revealed that the weak shock group displayed lower freezing than the 0.6 ma group on blocks 38 , but not blocks 1 or 2 ( fig .
however , during extinction retrieval , freezing was not different between groups ( t - test : p > 0.05 ) ( fig .
these results show that while this weak conditioning procedure did not reduce fear learning or expression compared to normal conditioning , it did allow for significant fear reduction during the extinction learning trial in s1 mice
. however , extinction memory was not successfully consolidated / retrieved on the next day .
we first examined the effects of dbs of the acbc , applied during extinction training , on impaired extinction in s1 mice . during conditioning , freezing increased across trials and did not differ between groups [ anova effect of trial : f(4 , 64 ) = 109.80 , p < 0.001 , effect of group : p > 0.05 , interaction : p > 0.05 , n = 9/group ] ( fig .
dbs during extinction training did not affect freezing , as compared to sham - stimulated controls , as both groups showed no change in freezing across trial - blocks [ anova effect of group : p > 0.05 , effect of trial - block : p > 0.05 , group trial - block interaction : p > 0.05 ] ( fig .
freezing was significantly lower in dbs than sham controls during extinction retrieval ( t16 = 2.96 , p < 0.01 ) ( fig .
these results show that dbs of the nucleus accumbens rescued extinction retrieval , but not extinction acquisition , in s1 mice .
we next examined the effects of 3 diverse pharmacological compounds , applied acutely prior to extinction training , on impaired s1 extinction .
our first experiment tested the effects of vpa . during conditioning , freezing increased across trials and did not differ between groups [ anova effect of trial : f(2 , 32 ) = 347.05 , p < 0.001 , effect of group : p > 0.05 , interaction : p > 0.05 , n = 89/group ] ( fig .
there was a significant group trial block interaction for freezing during training ( f(7 , 98 ) = 3.24 , p < 0.01 ) .
post hoc tests showed freezing was significantly lower in the vpa group relative to vehicle , on trial - blocks 28 ( fig .
freezing was again significantly lower in the vpa than the vehicle group ( t15 = 4.75 , p < 0.001 ) ( fig .
our next experiment examined the effects of pre - extinction - administered amn082 . during conditioning , freezing increased across trials and did not differ between groups [ anova effect of trial : f(2 , 28 ) = 90.25 , p < 0.001 , effect of group : p > 0.05 , interaction : p > 0.05 , n = 8/group ] ( fig .
there was a significant treatment trial - block interaction for freezing during extinction training ( f(7 , 98 ) = 4.82 , p < 0.001 ) .
post hoc tests showed significantly lower freezing in the amn082 treated group as compared to vehicle on trial - blocks 38 ( fig .
freezing was also significantly lower in the amn082 group than the vehicle group during extinction retrieval ( t14 = 4.24 , p < 0.001 ) ( fig .
the results of this experiment indicate rescue of impaired s1 extinction learning and retrieval by amn082 .
we next studied the effects pepa applied before extinction . during conditioning , freezing increased across trials and did not differ between groups [ anova effect of trial : f(2 , 42 ) = 140.25 , p < 0.001 , effect of group : p > 0.05 , interaction : p > 0.05 ,
5b ) . there was no effect of treatment on freezing during extinction training and neither group showed a reduction in freezing across trial - blocks ( fig .
these data show that , unlike vpa and amn082 , pepa failed to rescue impaired s1 extinction . in our next experiment
, we examined the ability of ms-275 , administered prior to extinction training , to rescue impaired s1 extinction retrieval .
freezing increased across conditioning trials , and treatment groups did not differ from one another [ anova effect of trial : f(2 , 42 ) = 90.82 , p < 0.001 , effect of group : p > 0.05 , interaction : p > 0.05 , n = 710/group ] ( fig .
there was no effect of treatment on freezing during extinction training and neither group showed a reduction in freezing across trial - blocks ( fig .
this experiment shows that , like pepa , application of ms-275 prior to extinction training failed to rescue impaired s1 extinction .
our observation that s1 mice can exhibit extinction learning after weak conditioning , but still have a deficit in extinction retrieval , led us to test whether two drug treatments shown here ( mcs-275 ) and previously ( dcs ) ( hefner et al . , 2008 ) to be ineffective in rescuing extinction after normal conditioning would be effective after weaker conditioning .
freezing increased across conditioning trials , and treatment groups did not differ from one another [ anova effect of trial : f(2 , 50 ) = 163.80 , p < 0.001 , effect of group : p > 0.05 , interaction : p
, there was a significant reduction in freezing across trials that was similar between groups [ anova effect of trial : f(7 , 175 ) = 88.18 , p < 0.001 , effect of group : p >
there was a significant effect of treatment on freezing during extinction retrieval ( f(2 , 25 ) = 7.21 , p < 0.01 ) .
post hoc tests showed that freezing was significantly lower in the dcs ( p < 0.05 ) and ms-275 ( p
the results of this experiment show that ms-275 and dcs can rescue impaired extinction retrieval in s1 mice given weak conditioning .
behaviourally , we show that using a weak fear conditioning paradigm s1 mice were able to reduce fear during extinction training , but were unable to consolidate / retrieve this memory during an extinction retrieval test .
this result , in addition to the well described profound extinction acquisition deficit observed following normal conditioning ( hefner et al . , 2008 ; camp et al . , 2009 ; whittle et al . , 2010 ) , reveal that s1 mice , by using graded conditioning paradigms , can serve as an ideal model to dissociate whether extinction - promoting interventions act via inducing extinction acquisition and/or by enhancing extinction consolidation / retrieval .
we next assessed a variety of treatments in their ability to rescue the profound extinction acquisition deficit seen after normal fear conditioning in s1 mice . here
we show that dbs of the acbc during extinction training lowers fear in extinction retrieval and that pharmacological compounds which enhance gabaergic signalling in tandem with hdac inhibition , or drugs that activate mglu7 receptors , rescue extinction acquisition deficits and lower fear during extinction retrieval in s1 mice .
lastly , we revealed that compounds which enhance nmda receptor activity or inhibit hdacs rescue the impaired extinction consolidation / retrieval deficit in s1 mice .
present data reveal a novel behavioural finding that weak fear conditioned s1 mice display impaired extinction consolidation / retrieval despite successful reduction of fear during extinction training .
no significant alterations in either fear learning or fear expression were observed between weak and normal fear conditioned s1 mice demonstrating the selectivity of the extinction consolidation / retrieval deficit .
importantly , it is unlikely that sensitisation to the cs contributed to the observed extinction retrieval deficit as we have previously shown that s1 mice do not sensitise to the cs ( camp et al . , 2009 ) .
collectively , our current data and that of previously published behavioural findings showing s1 mice display deficient extinction acquisition following normal fear conditioning ( hefner et al . , 2008 ; camp et al . , 2009 ; whittle et al . , 2010 ) , reveal that s1 mice represent a unique model to determine whether extinction promoting treatments act via inducing extinction acquisition and/or enhancing extinction consolidation by using
dbs of the acbc during extinction training reduced freezing in the extinction retrieval test indicating a novel treatment to overcome impaired extinction and thus to reduce learned fear .
the acbc was chosen based on evidence that stimulation of the acbc enhances extinction - like cognitive performance in intractable obsessive - compulsive disorder patients ( lipsman et al .
2011 ) and is associated with long - term enhancement in cognitive performance on tests including attention , learning and memory in remitted depressed patients ( bewernick et al . , 2012 ) .
interestingly , the extinction promoting effect of acbc stimulation was independent of any observable reduction of fear during extinction training .
reasons for this may be inferred from clinical studies showing that dbs of the acbc can induce / enhance symptoms of fear and panic ( palpitations and increased heart rate , flushing , fearful and panicky feelings ) in patients ( shapira et al . , 2006 ;
thus , assessment of potential reductions in freezing behaviour during the extinction session may be overlaid by enhancing fearful responses by dbs of the acbc per se .
the exact mechanisms via which dbs of the acbc promotes extinction are not fully understood and different hypotheses exist .
dbs has been proposed to cause a functional lesion by suppressing neural activity at the stimulated brain area , or that dbs elicits stimulation - induced activation of axons resulting in a wide range of effects on local cells and at a circuit level ( mcintyre et al . , 2004 ) . however ,
existing data indicate that suppression of acbc activity may not mediate fear reductions directly since lesions of the acbc ( riedel et al . , 1997 ; levita et al . , 2002 ; josselyn et al . ,
2005 ) , or temporary inactivation ( haralambous and westbrook , 1999 ; rodriguez - romaguera et al . , 2012 )
do not disrupt fear responses regardless of how fear is measured ( fear - potentiated startle or conditioned freezing ) . in addition , dbs of the acbc does not evoke any change in local neurotransmitter release within this brain region ( van dijk et al . , 2011 ) further negating a direct role of the acbc mediating fear reduction .
it is possible that dbs of the acbc exerts its fear reducing effect at a circuit level to modulate pathological network activity , as our experiment used 130 hz , 100 a and 60 s pulse width , conditions which can influence fibres of passage ( nowak and bullier , 1998a , b ) and induce changes in excitability and plasticity in brain regions critically involved in fear extinction .
specifically , dbs of the acbc selectively increases slow oscillatory activity ( mccracken and grace , 2009 ) and supresses pyramidal cell firing ( mccracken and grace , 2007 ) in the orbitofrontal cortex , and increases spontaneous and stimulus - induced coherent activity between regions in the thalamocortical system , which are implicated in extinction circuitry [ e.g. medial prefrontal cortex and mediodorsal thalamus ( pape and pare , 2010 ; lee et al . , 2011 ) ] .
furthermore , increased expression of phosphorylated extra cellular - regulated kinase ( perk ) , a marker of cell plasticity ( sweatt , 2004 ) , is observed in brain regions critical for extinction learning including the medial prefrontal cortex , orbitofrontal cortex , and a small subregion of the lateral part of the central amygdala following dbs in the acbc ( rodriguez - romaguera et al . , 2012 ) , indicating that many of exactly those areas are targeted by acbc dbs that have been shown to be aberrantly activated in extinction - impaired s1 mice ( whittle et al . , 2010 ) .
collectively , our results reveal for the first time that dbs of the acbc rescued deficient extinction retrieval in an animal model of impaired extinction , most likely by positively interfering with the documented cortico - limbic extinction circuitry failure accompanying the impaired extinction .
we have previously revealed that enhancing the activity of ionotropic nmda receptors , via administration of dcs , is ineffective in inducing extinction acquisition in s1 mice ( hefner et al . , 2008 ) . here , we investigated whether enhancing the activity of ionotropic ampa receptors by administration of pepa , or metabotropic mglu7 receptors , by administration of amn082 , could rescue the extinction acquisition deficit in s1 .
administration of amn082 , but not pepa , prior to an extinction training session induced fear extinction and also reduced fear during a retrieval test in s1 mice .
the lack of extinction promoting effect of pepa is in contrast with published studies in normally behaving mice ( zushida et al . , 2007 ) .
it is likely that pepa , like dcs , facilitates the consolidation of extinction learning rather than inducing extinction learning per se ( davis et al . , 2006 ) .
evidence supporting this hypothesis is that long - term potentiation elicited by the ampa receptor glutamate receptor 1 is necessary for the formation of emotional memories ( humeau et al . , 2007 ) .
the present finding that amn082 rescued deficient extinction acquisition in s1 mice extends recent studies showing that amn082 , a specific allosteric modulator of mglu7 receptors ( mitsukawa et al . , 2005 ) , impairs the acquisition of conditioned fear as well as facilitates between - session extinction in normally behaving rodents ( fendt et al . , 2008 ; siegl et al . ,
thus , amn082 , in addition to dietary zinc - restriction ( see introduction ) , constitute rare examples of treatments which enhance extinction learning , but not fear learning .
moreover , these results show that amn082 can rescue extinction deficits in a psychopathological animal model , suggesting that amn082 be used during extinction - based therapy to induce extinction learning in individuals with pathological fear . at present , it is difficult to understand the extinction promoting effect of amn082 ( o'connor et al . , 2010 ) .
mglu7 receptors , located entirely pre - synaptically , are widely distributed throughout the central nervous system ( ohishi et al . , 1995 ) .
activation of this receptor generally inhibits glutamatergic and gabaergic synaptic transmission ( schoepp , 2001 ) , although facilitation of glutamatergic transmission has also been reported in specific brain regions ( millan et al .
, 2002 ; li et al . , 2008 ; martin et al . ,
2010 ) . given the wide - spread distribution of mglu7 receptors and their location on both glutamatergic and gabaergic axon terminals , the cumulative excitatory and inhibitory effects of systemic application of amn082 is difficult to predict at present as precise knowledge of the location of the receptor in the microcircuits underlying fear extinction acquisition is lacking .
furthermore , recent findings reveal that a major metabolite of amn082 inhibits serotonin- , dopamine- and noradrenaline - transporters ( sukoff rizzo et al . , 2011 ) . as chronic treatment with the selective serotonin re - uptake inhibitor fluoxetine
reduces fear in s1 mice ( camp et al . , 2012 ) and protects against the return of fear in normally extinguishing mice ( karpova et al . ,
2011 ) , we can not exclude the contribution of enhanced monoaminergic neurotransmission in amn082-induced reduction of fear .
a meta - analysis of published data shows that dcs is effective in reducing fear when combined with fear extinction or exposure therapy ( norberg et al . , 2008 ) .
results from normally extinguishing rodents show that dcs , administered immediately post extinction training , can lower fear by enhancing extinction memory consolidation ( ledgerwood et al . , 2003 ) .
clinically , dcs , combined with exposure - based therapy , is effective in reducing fear in patients with so - called simple fears including acrophobia , social anxiety , obsessive compulsive and panic disorders ( graham et al . , 2010 ) .
however , in most cases beneficial effects of dcs were only apparent after a few exposure sessions further suggesting that the primary mechanism of dcs is to consolidate fear extinction memories .
along these lines , we have previously published that prior extinction training administration of dcs is ineffective in rescuing deficient extinction learning in s1 mice ( hefner et al .
using a novel behavioural finding that s1 mice display impaired extinction consolidation / retrieval we tested whether dcs is effective in lowering fear when administered following successful fear reduction in extinction learning .
( 2008 ) conclusively demonstrate that dcs can rescue deficient extinction learning only when administered during the extinction consolidation phase and that the efficacy of dcs is gated by the ability of s1 mice to acquire ( at least to some extent ) extinction acquisition .
these results using a psychopathological animal model have clinical implications as they strengthen the suggestion that dcs be used as an add - on drug to facilitate reductions in fear by exposure therapy in specific anxiety disorders ( norberg et al .
recent studies have demonstrated that histone acetylation is dynamically regulated following successful extinction learning ( levenson et al .
, 2004 ; fontan - lozano et al . , 2008 ; bousiges et al . , 2010 ;
peleg et al . , 2010 ; monsey et al . , 2011 ; stafford et al . ,
2012 ) , and furthermore , that pharmacological or genetic silencing of hdac enzyme isoforms can enhance fear extinction ( bredy et al . , 2007 ; lattal et al . , 2007 ; bredy and barad , 2008 ;
, 2009 ; monsey et al . , 2011 ) . here , we first assessed whether ms-275 , which is , using a chemoproteomic approach a hdac1- 2- and 3-isoform inhibitor ( bantscheff et al . , 2011 ) , or using purified rhhdacs
primarily a hdac1- and 9-isoform inhibitor ( khan et al . , 2008 ) , could rescue deficient extinction consolidation / retrieval in weak fear conditioned s1 mice .
we revealed that post extinction training administration of ms-275 , at a dose with demonstrated hdac inhibitory properties ( simonini et al . , 2006 ) ,
it is likely that combined inhibition of hdac1- , hadac2- and hdac3-isoforms contributes to the observed rescue of deficient extinction consolidation / retrieval in s1 mice .
pharmacological and/or genetic silencing of hdac1- or hdac2-isoforms have been shown to enhance the consolidation of fear and/or extinction memories ( guan et al . , 2009 ; bahari - javan et al . ,
2012 ) and that genetic silencing of the hdac3-isoform enhances long term memory in the object recognition test ( mcquown et al . , 2011 ) .
notwithstanding , our data show for the first time that preferentially selective hdac inhibitors such as ms-275 can rescue profound extinction consolidation / retrieval deficits in a psychopathological animal model and thus suggest that such compounds be used as an add - on drugs to facilitate reductions in fear in exposure - based therapy .
the extinction consolidation / retrieval - promoting effect of ms-275 was specific as results revealed that following
fear conditioning , in which s1 mice display deficient extinction acquisition , prior extinction training administration of ms-275 did not induce extinction acquisition or reduce fear during a retrieval test .
this indicates that rescue of deficient extinction acquisition requires mechanisms beyond hdac inhibition . as enhancing gabaergic activity
has been shown to significantly contribute to the molecular mechanisms underlying fear extinction [ for example , see ( harris and westbrook , 1998 ; chhatwal et al . , 2005 ;
, 2009 ; dalton et al . , 2012 ) ] , we tested whether vpa , a pharmacological compound which enhances gabaergic signalling ( mimaki et al . , 1984 ; miller et al . , 1988 ;
2006 ) in addition to exhibiting robust hdac inhibition ( kramer et al . , 2003 ; khan et al . , 2008 ) , can rescue impaired extinction acquisition and deficient extinction consolidation / retrieval . indeed , our results revealed that prior extinction training administration of vpa rescued both deficient extinction acquisition and deficient extinction consolidation / retrieval in s1 mice .
this result in a psychopathological animal model further extends findings showing prior extinction training administration of vpa potentiates reductions in fear extinction in normally extinguishing b6 mice ( bredy et al .
, 2007 ; bredy and barad , 2008 ) and , when administered prior to cognitive behavioural therapy , facilitates extinction in healthy humans ( kuriyama et al . , 2011 ) .
our current result using a psychopathological animal model reveals that prior exposure - based extinction training administration of vpa , acutely applied , can rescue impaired extinction acquisition and deficient extinction consolidation / retrieval .
specifically , to date , in preclinical animal models of impaired fear learning and neurodegeneration , cognitive enhancing effects of vpa have been shown only with chronic prior fear conditioning administration ( li et al . , 2006 ; dash et al . , 2009 ; kilgore et al . , 2010 ) .
our present result in a psychopathological animal model demonstrates the utility of a single vpa treatment in combination with exposure - based therapy to rescue impaired extinction acquisition and deficient extinction consolidation / retrieval .
furthermore , a number of small clinical studies demonstrate that chronic vpa monotherapy , for a minimum of eight weeks , reduces fear in social anxiety- ( kinrys et al . , 2003 ) , panic- ( primeau et al . , 1990 ; keck et al . , 1993 ;
woodman and noyes , 1994 ; baetz and bowen , 1998 ) and obsessive - compulsive- ( cora - locatelli et al . ,
beneficial effects of chronic vpa monotherapy have also been reported in combat veterans with ptsd ( fesler , 1991 ; otte et al . , 2004 ) , however , lacking effects are also reported ( davis et al . , 2008 ; hamner et al . ,
is that up to 25% of patients within the afore - mentioned studies are reported to stop medication due to adverse effects ( including nausea , dizziness , fatigue , sedation and gastrointestinal complaints ) .
our current data suggests that acute vpa treatment , combined with exposure - based therapy may be an effective and novel clinical strategy to reduce fear in anxiety patients with minimal adverse effects .
in summary , we show that s1 mice are a unique psychopathological animal model as they display deficient extinction acquisition and deficient extinction retrieval , which can be experimentally dissociated by choosing different experimental conditioning setups . using this mouse model
the present data identify novel therapeutic targets that induce fear reductions when combined with extinction , resembling exposure - based therapy .
different pharmacological and non - pharmacological treatments that target cellular and molecular mechanisms with a documented or putative role in extinction memory formation within relevant brain areas and circuitries were chosen .
this study reveals that dbs of the acbc during exposure - based therapy may be a novel non - pharmacological treatment strategy to overcome impairments in reducing learned fear .
furthermore , that pharmacological enhancement of nmda receptor activity or inhibition of hdac1- , hdac2- and hdac3-isoforms , may rescue deficient extinction retrieval only following successful reductions in fear during extinction training , which can have important implications for the use of such agents in human exposure therapy . on the other hand ,
enhancing mglu7 activity or enhancement in gabaergic activity in tandem with broad inhibition of hdac isoforms could be a novel pharmacological treatment strategy to rescue both , impairments in extinction acquisition and extinction retrieval .
Output:
| anxiety disorders are characterized by persistent , excessive fear . therapeutic interventions that reverse deficits in fear extinction represent a tractable approach to treating these disorders .
we previously reported that 129s1/svimj ( s1 ) mice show no extinction learning following normal fear conditioning .
we now demonstrate that weak fear conditioning does permit fear reduction during massed extinction training in s1 mice , but reveals specific deficiency in extinction memory consolidation / retrieval .
rescue of this impaired extinction consolidation / retrieval was achieved with d - cycloserine ( n - methly - d - aspartate partial agonist ) or ms-275 ( histone deacetylase ( hdac ) inhibitor ) , applied after extinction training .
we next examined the ability of different drugs and non - pharmacological manipulations to rescue the extreme fear extinction deficit in s1 following normal fear conditioning with the ultimate aim to produce low fear levels in extinction retrieval tests .
results showed that deep brain stimulation ( dbs ) by applying high frequency stimulation to the nucleus accumbens ( ventral striatum ) during extinction training , indeed significantly reduced fear during extinction retrieval compared to sham stimulation controls .
rescue of both impaired extinction acquisition and deficient extinction consolidation / retrieval was achieved with prior extinction training administration of valproic acid ( a gabaergic enhancer and hdac inhibitor ) or amn082 [ metabotropic glutamate receptor 7 ( mglu7 ) agonist ] , while ms-275 or pepa ( ampa receptor potentiator ) failed to affect extinction acquisition in s1 mice .
collectively , these data identify potential beneficial effects of dbs and various drug treatments , including those with hdac inhibiting or mglu7 agonism properties , as adjuncts to overcome treatment resistance in exposure - based therapies.this article is part of a special issue entitled cognitive enhancers. |
PubmedSumm119695 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: globally , alcohol causes 4% of all deaths and contributes 5% to the global burden of disease .
alcohol consumption has increased globally over years and india being one of the most populous countries contributes significantly to the alcohol - attributable burden . among 1549-year - old men in india ,
the prevalence of daily and weekly use of alcohol is 9.4% and 26.7% , respectively .
studies indicate that about 80% of patients relapse within a year of detoxification . among patients under treatment , it is important to examine the factors that contribute to relapse .
sociodemographic factors such as living alone , low socioeconomic status , family history of alcoholism , and psychosocial stressors have been associated with increased risk for relapse .
aspects such as religion , taking part in self - help groups , and proper follow - up visits tend to reduce relapse risk .
identifying specific factors contributing to relapse could pave way for optimizing treatments at the individual level .
personality traits have found to predict treatment outcome in diseases such as obesity , hyperopia , and various surgical treatments . in psychiatry ,
personality traits have been linked to depression , schizophrenia , and withdrawal severity in substance dependence . with regard to alcoholism , the novelty seeking trait has been found to predict relapse in alcohol - dependent males and harm avoidance
alcohol dependence has been associated with higher neuroticism scores and lesser conscientiousness scores . in a longitudinal study ,
extraversion at 14 years of age predicted alcohol dependence at 30 years of age . in the indian context ,
chaudhury et al . studied psychological aspects in alcohol - dependent individuals and showed that they had significantly high neuroticism , extroversion , anxiety , depression , and psychopathic deviation and significantly low self - esteem as compared to normal control subjects .
however , there are no indian studies to our knowledge correlating personality traits and alcohol dependence with particular reference to treatment outcome .
adult participants with alcohol dependence diagnosed by diagnostic and statistical manual of mental disorders - fourth edition ( dsm - iv ) were recruited from the inpatient and outpatient wards of a tertiary care de - addiction facility in india . from the participants who met the inclusion / exclusion criteria ,
data included age , gender , education and employment status , marital status , satisfaction with life ( swl ) , age at first drink , and smoking history .
the study was designed to prospectively re - assess the participants at the end of 3 months .
pharmacological treatment was standard detoxification regimen , followed by anticraving measures and multivitamin supplements as prescribed by trained psychiatrists . at the completion of 3 months follow - up , patients were assessed for relapse / abstinence from alcohol .
we defined relapse as any drink in the past 3 months and abstinence as continuous abstinence from any alcoholic beverage after the recruitment .
questionnaires administered at baseline were revised neo personality inventory ( neo - pi - r ) , swl , mini - international neuropsychiatric interview ( mini ) , and alcohol use disorders identification test ( audit ) . at 3 months , patients were followed up by direct / phone interview and assessed for relapse / abstinence .
neo - pi - r is the most often used tool to measure personality according to the five - factor model .
alphas for the domains range from 0.86 to 0.92 for self - report [ table 1 ] .
revised neo personality inventory domains and facets the mini is a short - structured clinical interview which enables researchers to make diagnoses of psychiatric disorders according to the dsm - iv .
it is a 28-item questionnaire assessing the warning signs of relapse , and the scores give out the probability of drinking in next 2 months based on whether they were drinking / abstinent in the last two months .
questionnaires administered at baseline were revised neo personality inventory ( neo - pi - r ) , swl , mini - international neuropsychiatric interview ( mini ) , and alcohol use disorders identification test ( audit ) . at 3 months , patients were followed up by direct / phone interview and assessed for relapse / abstinence .
neo - pi - r is the most often used tool to measure personality according to the five - factor model .
alphas for the domains range from 0.86 to 0.92 for self - report [ table 1 ] . revised neo personality inventory domains and facets
the mini is a short - structured clinical interview which enables researchers to make diagnoses of psychiatric disorders according to the dsm - iv .
it is a 28-item questionnaire assessing the warning signs of relapse , and the scores give out the probability of drinking in next 2 months based on whether they were drinking / abstinent in the last two months .
fifty - four patients came for follow - up up to 3 months , and the aware scores were obtained from them .
thus , 3-month follow - up information was available for a total of 82 ( 82.8% ) patients , of whom three died due to alcohol - related complications and 34 maintained abstinence .
we considered the 17 patients who lost follow - up and could not be interviewed through phone as relapsers .
we excluded the three patients who died of alcohol - related complications from the study .
alcohol use duration , body mass index , smoking scores measured as fagerstrom test for nicotine dependence , and swl did not predict abstinence / relapse at 3-month follow - up [ table 2 ] .
family history of alcoholism was available for 85 patients , and among them , 63.53% had a positive family history . among the 8 females included in the baseline , one died , 4 relapsed , and 3 remained abstinent .
females who relapsed had lesser age at first drink and later age of presentation when compared with females who maintained abstinence in follow - up .
comparison of abstainers versus relapsers among our study group , there was a significant difference between the relapsers and abstainers ( p = 0.005 ) with regard to the socioeconomic status .
all three patients who had current diagnosis of social anxiety disorder relapsed ( p = 0.025 ) , and 60% of patients with moderately high suicidal thoughts relapsed ( p = 0.006 ) . the mean age at first drink among relapsers was 20.13 ( 4.62 ) and was significantly lower compared to the mean age at first drink of abstainers ( p = 0.021 ) . in our study group , there was no significant difference in neo - pi - r domain and facet scores between relapsers and abstainers [ tables 3 and 4 ] .
e4 ( activity ) facet of the extraversion domain in the neo - pi - r significantly correlated with the baseline drinking scores ( r = 0.204 , p = 0.042 , n = 99 ) and aware scores ( r = 0.276 , p = 0.043 , n = 54 ) [ figures 1 and 2 ] .
there was a significant negative correlation between the e2 ( gregariousness ) facet and swl scores ( r = 0.211 , p = 0.036 , n = 99 ) .
revised neo personality inventory t - scores -relapsers versus abstainers revised neo personality inventory domain and facet scores
relapsers versus abstainers correlation between e4 ( activity ) domain and alcohol use disorders identification test scores correlation between e4 ( activity ) domain and advanced warning of alcohol relapse scores
although personality factors have been well correlated with substance use , studies linking personality and treatment outcomes are scarce , especially with regard to auds . in this context
, we examined the relation between personality domains based on the big five model , with the treatment outcomes in treatment - seeking alcohol - dependent patients .
earlier studies established a correlation between problem drinking and the personality domains , especially with the extraversion . in our study , after controlling for age , gender , age at first drink , swl , smoking , marital status , and socioeconomic status , e4 facet ( activity ) of the extraversion domain correlated significantly with the baseline audit scores ( r = 0.204 , p = 0.042 , n = 99 ) and aware scores ( r = 0.276 , p = 0.043 , n = 54 ) .
this suggests that people who score high on extraversion tend to be more involved in drinking .
higher risk for relapse as measured by aware scores might be associated with the severity of initial drinking . however , in our study group , the correlation between the baseline audit scores and follow - up aware scores was not significant ( r = 0.138 , p = 0.320 , n = 54 ) .
thus , the risk for relapse appears to be associated with higher activity facet of the extraversion domain rather than the heavy drinking at the baseline
. the increased risk for relapse among people who have impulsive suicidal attempts in the past has been documented . among our study group ,
social anxiety disorder is an important comorbid illness often found among alcohol - dependent patients .
over one - third of the patients diagnosed with social phobia have auds in their lifetime . in our population ,
therefore , attention should be given to those people with the past suicidal ideations and comorbid social phobia when treating for alcohol dependence .
there was a significant negative correlation between the swl scores and the e2 ( gregariousness ) facet ( r = 0.211 , p = 0.036 , n = 99 ) .
thus , among people with alcohol dependence , it can be construed that people who tend to be more sociable and less satisfied with their lives tend to cope up with substances . there was a significant difference in the age at first drink among relapsers and abstainers with relapsers having lesser age at first drink .
our study suggests that factors related to extraversion , specifically , high activity might be associated with higher involvement in drinking as well as higher risk for early relapse .
our study also suggests that substance use could be one of the ways of coping up among people who are more sociable people and yet less satisfied with their lives .
people with comorbid social anxiety disorders and suicidal ideations should be given more focus as they tend to relapse to alcohol .
our study also suggests that earlier the age of first drink , higher is the relapse risk .
this has important implications for alcohol control policies and tailoring treatment needs for the patients .
Output:
| background : studying personality profiles allows researchers to generate important hypotheses in risk factors and correlates of alcohol use / misuse .
studies examining the association between personality traits and treatment outcome are limited in india .
we studied the correlation between personality and treatment outcome in patients with alcohol dependence.methods:adult participants with alcohol dependence were recruited from the inpatient and outpatient wards of de - addiction unit of a tertiary care facility in india using a prospective design and followed up after 3 months .
questionnaires administered were revised neo personality inventory ( neo - pi - r ) , alcohol use disorders identification test , and advanced warning of alcohol relapse ( aware).results : out of 99 recruited participants ( 92% males ) with mean age of 37 ( 8.36 ) years , 82 ( 82.8% ) patients were followed up to 3 months .
e4 ( activity ) facet of the extraversion domain in the neo - pi - r significantly correlated with the baseline drinking scores ( r = 0.204 , p = 0.042 ,
n = 99 ) and aware scores ( r = 0.276 , p = 0.043 , n = 54 ) .
there was a significant negative correlation between the e2 ( gregariousness ) facet and satisfaction with life scores ( r = 0.211 , p = 0.036 , n = 99 ) .
age at first drink was significantly lower among relapsers ( p = 0.021).conclusion : our study suggests that factors related to extraversion , specifically , high activity might be associated with higher drinking as well as higher risk of alcohol relapse . predicting alcohol relapse by studying the personality traits would help clinicians in improving treatment outcomes . |
PubmedSumm119696 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: acute liver failure ( alf ) is a critical condition that can occasionally lead to death .
ho et al . have reported that infectious diseases , alcohol abuse , and malignancy are several risk factors associated with poor prognosis in alf patients .
on - line hemodiafiltration ( olhdf ) uses a large amount of sterile dialysate as a substitution fluid and helps patients with alf to achieve restoration of consciousness .
one of the advantages of olhdf is that it removes ammonia , which could cause disturbances of consciousness in alf patients .
olhdf is one of the most effective artificial liver support devices in the treatment of alf , and managing olhdf without infections is preferable . in japan as well as the usa ,
even patients with alf should wait for a proper liver donor for deceased donor liver transplantation or living donor liver transplantation .
we report a patient with alf associated with benzbromarone use who received olhdf via an arteriovenous fistula to avoid infectious complications , and he was successfully rescued by liver transplantation .
a 59-year - old japanese man who had liver dysfunction for over 1 year was referred to the former hospital with fatigue and jaundice . prior to developing liver dysfunction ,
benzbromarone 50 mg daily , benidipine 4 mg daily , and pravastatin 5 mg daily were all prescribed .
after he had been diagnosed with liver dysfunction , ursodeoxycholic acid 400 mg daily was prescribed .
the laboratory examinations on admission to the former hospital showed the following values : total bilirubin , 8.1 mg / dl ; aspartate transaminase ( ast ) , 1,457 iu / l ; alanine transaminase ( alt ) , 1,696 iu / l ; prothrombin time ( pt ) , 69% , and pt international normalized ratio ( pt - inr ) , 1.33 .
eight days after admission to the former hospital , the laboratory examinations showed the following values : total bilirubin level , 21.6 mg / dl ; ast , 340 iu / l ; alt , 529 iu / l ; pt , 38% , and pt - inr , 1.82 .
although he had received conservative treatment , disorientation , drowsiness , and incontinence appeared 14 days after his prior hospitalization , and he was diagnosed as having alf with grade 2 hepatic encephalopathy .
the patient was transferred to the chiba university hospital for treatment of the alf . on admission ,
his body height and weight were 1.63 m and 60.2 kg , respectively . on physical examination , deep jaundice , abdominal distension , and leg edema were observed .
based on his medical history , we suspected that the benzbromarone was responsible for his hepatic injury [ 5 , 6 ] .
ct imaging demonstrated heterogeneous hypoattentuation and atrophy of the liver with massive ascites ( fig .
the model for end - stage liver disease ( meld ) score of the patient was 24 .
he was registered as a potential liver recipient , and we continued medical treatment . until liver transplantation , intermittent olhdf was performed to improve the disturbances in his level of consciousness .
surgical construction of an arteriovenous fistula was performed in the right forearm 12 days after admission to our unit . after evaluating the condition of his blood vessels , the fistula was constructed in the right forearm .
the deceased donor liver transplantation was successfully performed without any infectious complications 53 days after admission to our unit .
the volume of his liver was 730 g , and histology of the liver revealed submassive necrosis in the right lobe and massive necrosis in the left lobe ( fig .
2 ) . there was no evidence of liver cirrhosis , supporting the diagnosis of alf rather than acute - on - chronic liver failure . during his hospitalization , no symptoms of infectious complications were observed ( fig .
the clinical course of alf is associated with rapidly progressive multiorgan failure and devastating complications such as encephalopathy and coagulopathy .
reported that bacterial bloodstream infection was found in 35% of cases with infectious complications in autoimmune alf .
infection is also an important prognostic factor for morbidity and mortality in hemodialysis and olhdf patients with alf .
vascular access - related infection occurs frequently , and patients with arteriovenous fistulas for hemodialysis are at lower risk of death and infections when compared to patients with catheters .
in addition , moura et al . reported that patients who have arteriovenous fistulas for vascular access have higher health - related quality of life scores when compared to patients using central venous catheters .
the patient in this report was initially admitted to the intensive care unit in our hospital .
after he received an arteriovenous fistula , he was able to walk and perform rehabilitation training in a general patient room .
our patient successfully avoided the risk of infectious diseases by having an arteriovenous fistula created in the right forearm for dialysis .
his level of consciousness was maintained by intermittent rather than continuous olhdf , and this might also have been beneficial to avoid other infections .
there have been several reports that benzbromarone is occasionally associated with alf [ 14 , 15 ] .
when prescribing benzbromarone , clinicians should pay attention to the possibility of liver dysfunction . there may be no evidence to support this assumption , and not all patients transplanted for alf who require temporary renal support via a dialysis catheter develop infections . in conclusion , forming an arteriovenous fistula for dialysis may be a beneficial option in the management of alf , although the excellent outcome in our patient was most likely related to the excellent care and surgical technique of the transplant team .
Output:
| on - line hemodiafiltration ( olhdf ) is one of the treatment options in the management of acute liver failure ( alf ) in japan .
it is essential to avoid infection in the management of alf .
in fact , infection is one of the prognostic factors in alf . in this report
, we present a middle - aged japanese man with alf associated with benzbromarone use .
he was successfully managed without infection until liver transplantation by creating an arteriovenous fistula for olhdf .
utilizing an arteriovenous fistula for olhdf , rather than inserting a vascular access catheter , is a beneficial option to avoid infectious diseases in the management of alf . |
PubmedSumm119697 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: nevoid hyperkeratosis of the nipple and the areola ( nhna ) of the breast is a rare condition which is characterized by verrucose thickening and caf au lait pigmentation of the nipple and areola .
first described in the medical literature by tauber in 1923 as a benign dermatologic change in the nipple and areola , it may involve the nipple , the areola or both .
athough , in most cases , nhna is a benign condition , and the location and the potential recurrence may have serious consequences on the breast , of both functional and aesthetic nature .
nevoid hyperkeratosis can be managed surgically or by conservative modalities ; however , it can either threaten the breast function or it can lead to a bad aesthetic result due to mismanagement .
a 19-year - old greek girl presented to our plastic surgery unit with a bilateral nevoid hyperkeratosis [ figure 1 ] .
she complained that the lesions appeared 7 years ago in both breasts , without any other symptoms apart from the local changes .
there was not any remarkable past medical history ; her family medical history was also unremarkable . therefore , she visited our department asking for a surgical treatment .
the nevoid hyperkeratosis of the areola before the surgery on examination , there was no sign or history for any endocrine disease ; menarche occurred at 13 year .
serology for hepatitis viruses ( a , b , c ) , human immunodeficiency virus and venereal disease research laboratory test ( vdrl ) was negative .
imaging studies revealed no hepato - splenomegaly , enlarged lymph nodes or abdominal or mediastinal masses .
a punch biopsy revealed hyperkeratosis , acanthosis and papillomatosis thus confirming a vha type 3 according to the classification of levy frankel .
we performed a surgical shaving of the right nipple and areola ; we also performed surgical resection of the left areola without shaving of the left nipple [ figure 2 ] .
the areolae were repaired with skin graft from the internal surface of the thigh under general anaesthesia .
surgical shaving of the left nipple and areola two years after operation , the patient is well ; there is no evidence for a recurrence of the disease [ figure 3 ] .
less than 90 cases , mainly sporadic , have been reported in the literature . .
it mostly affects women in the second or third decade of life , mainly during pregnancy .
it is believed that today it is more common than in the past ; no evident explanation is provided for that , but it may be due to more accurate diagnosis .
the diagnosis is histologically confirmed ; deferential diagnosis includes paget 's disease , superficial basal cell carcinoma , dermatophytosis and bowen 's disease .
although it is considered as benign condition , it may accompany other more serious systemic disorders .
according to levy and frankel , it can be classified into the following three types :
type 1 : hyperkeratosis of the nipple and areola representing an extension of a verrucosus ( epidermal ) nevus , usually unilateral in both sexes.type 2 : hyperkeratosis of the nipple and areola associated with other dermatoses such as ichthyosis , ichthyosiform , acanthosis nigricans , darier 's disease , cutaneous t - cell lymphoma , chronic eczema and erythroderma .
it may also be a manifestation of graft versus host reaction ( gvhr ) following allogeneic bone marrow transplantation .
this type may be bilateral.type 3 : this type is also known as idiopathic or nevoid hyperkeratosis of the nipple and areola .
it is usually bilateral and it affects both the nipple and areola in more than 70% of the cases . according to some authors , it may appear at puberty or during pregnancy in women , and in men treated with diethylstilbestrol for prostatic carcinoma .
type 1 : hyperkeratosis of the nipple and areola representing an extension of a verrucosus ( epidermal ) nevus , usually unilateral in both sexes .
type 2 : hyperkeratosis of the nipple and areola associated with other dermatoses such as ichthyosis , ichthyosiform , acanthosis nigricans , darier 's disease , cutaneous t - cell lymphoma , chronic eczema and erythroderma .
it may also be a manifestation of graft versus host reaction ( gvhr ) following allogeneic bone marrow transplantation .
type 3 : this type is also known as idiopathic or nevoid hyperkeratosis of the nipple and areola . this unusual variant , according to obayachi et al .
it is usually bilateral and it affects both the nipple and areola in more than 70% of the cases . according to some authors , it may appear at puberty or during pregnancy in women , and in men treated with diethylstilbestrol for prostatic carcinoma .
the therapeutic options to nhna can be summarized as follows :
conservative approach includes keratolysis as salicylic acid 6% , lactic acid lotion , topical steroids , topical trietinoin , oral vitamin a and calcipotriol 2.non-conservative methods are cryotherapy , laser and surgery .
conservative approach includes keratolysis as salicylic acid 6% , lactic acid lotion , topical steroids , topical trietinoin , oral vitamin a and calcipotriol 2 .
the surgical management of nhna was first applied by mehregan et al . in 1977 . in managing nhna
, one has to consider the need for restoring function and aesthetic appearance of the breast especially in the young .
surgery seems to be preferable due to a longer lasting and more aesthetically acceptable result .
our own case is now free of any discomfort or evidence for a local relapse . to the best of our knowledge
Output:
| nevoid hyperkeratosis of the breast is a rare condition affecting the nipple , the areola or both .
it appears in both sexes and it can by lateral or unilateral .
it can also accompany other skin diseases or systemic conditions including malignancies .
treatment may not be easy due to aesthetic consequences but surgery seems to be the most preferable therapeutic option .
we report such a case successfully managed by surgical intervention . |
PubmedSumm119698 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: caesarean section in the second stage of labour is a technically difficult procedure , especially when performed after an operative vaginal delivery has been attempted and when the fetal head is deeply impacted within the pelvis .
therefore , a second stage caesarean section may be associated with increased maternal and fetal morbidity [ 14 ] .
although operative vaginal births are also associated with fetal trauma [ 5 , 6 ] , significant maternal and fetal trauma can also occur during a caesarean section that is performed during late second stage of labour .
the rising rates of caesarean section at full dilatation not only are a concern for the delivery in question but also may have a negative impact on woman 's future pregnancies and deliveries .
a recent 10-year study of operative delivery in a large london teaching hospital has shown a trend to choose a ventouse ( vacuum extractor ) over forceps and opting for delivery in the operating theatre as well as a small increase in the rate of caesarean section at full dilatation .
this study also showed an increase in failed instrumental delivery ( correlation coefficient 0.93 , p < 0.05 ) which was thought to be due to both instrument failure and a reluctance to attempt instrumentation during second stage of labour .
other studies have also noted the rise in numbers of caesarean sections at full dilatation [ 9 , 10 ] and both the royal college of obstetricians and gynaecologists and the american college of obstetricians and gynaecologists have advocated the need for further training on instrumental vaginal deliveries .
the aim of this study is to review the determinants for a failed operative vaginal delivery and thereby emergency caesarean sections at full dilatation as well as to determine associated fetal and maternal morbidity .
all women who delivered by caesarean section after a failed instrumental delivery at st . georges hospital , london , between july 2007 and june 2012 , were identified .
this london teaching hospital has over 5000 deliveries a year , with three tiers of obstetricians ( registrar st3 - 5 , senior registrar st6 - 7 , and consultant ) working on labour ward .
there was always at least the registrar plus senior registrar or consultant on site 24 hours a day , seven days a week .
all of the women whose case notes were obtained were over 37 weeks of gestation and had a cephalic presentation .
a proforma was created and completed from the case notes of each woman , detailing background characteristics as well as details surrounding the labour and delivery .
maternal complications that were considered were haemorrhage , intraoperative complications , and genital tract trauma .
neonatal morbidity included apgar scores , cord arterial ph , and evidence of scalp or fetal lacerations and cephalhematoma .
information regarding the use of instruments , the total number of instruments ( with different types of forceps being classed as two separate instruments ) , the number of pulls with each instrument during the delivery , and the number of times the cup detached from the fetal head was also recorded .
georges hospital are performed using the kiwi omnicup and metal and silastic cups are not used .
this study was deemed exempt from the need for ethical approval as it is a retrospective observational analysis performed by review of case notes with no clinical interventions and with results showing no identifiable patient data .
a total of 119 women from a cohort of 26,856 deliveries required a caesarean section ( 0.44% ) after failed operative delivery .
our overall failed instrumental delivery rate ( total number of failed instrumental deliveries / total number of instrumental deliveries ) was 5.1% .
case notes were obtained for a total of 119 women . of these 119 women ,
22 were delivered for ctg ( cardiotocograph ) abnormalities and the other 97 because of failure to progress in the second stage of labour .
the other 13 women had only one previous delivery ; therefore in total there had been 15 previous deliveries .
with respect to their previous deliveries , 5 women had had a previous caesarean section at 8 cm , 2 had an elective caesarean section for breech , 4 had a spontaneous vaginal delivery , and 4 had required an operative vaginal delivery during their previous labour .
characteristics of women who had a failed instrumental vaginal delivery ( fid ) are given in table 1 .
25% of women in our study had a postpartum haemorrhage ( table 2 ) and almost half of all women sustained maternal trauma at the time of the attempted operative vaginal delivery or caesarean section ( table 3 ) .
40 out of 106 neonates had a low apgar score or an umbilical cord arterial ph of < 7.1 ( table 5 ) . in 13 cases ( 10.9% ) ,
to the best of our knowledge , our study is the largest study that analyzed the determinants as well as maternal and fetal outcomes for emergency caesarean sections performed for fid over a 5-year period .
a number of studies have previously looked at predictors of failed operative vaginal delivery [ 1 , 3 , 13 ] and have concluded that risk factors for fid includedpersistent op presentation;birthweight > 4 kg;maternal body mass index > 30;mid - cavity delivery or when 1/5th of the fetal head is palpable per abdomen .
persistent op presentation ; maternal body mass index > 30 ; mid - cavity delivery or when 1/5th of the fetal head is palpable per abdomen .
murphy et al . also concluded that instrumental delivery , whether successful or not , was associated with increased risk of maternal trauma and increased neonatal trauma ( if there were > 3 pulls ) .
multiple instrument usage was associated with increased neonatal trauma as well as initial attempt at vaginal delivery by an inexperienced operator . considering previous deliveries in multiparous women , hoskins and gomez in 1997 found that having a previous caesarean section at full dilatation reduced the chance of a successful subsequent vaginal delivery to 13% .
this is compared to a success rate of 73% and 67% , respectively , if their previous caesarean section was at 69 cm or 5 cm or less .
malposition was a key factor in our cohort of women who had a failed instrumental delivery . in only 29% of women was the fetal head in a direct , right , or left occipitoanterior position .
there are no randomized control trials looking at the optimal method of delivery when there is malposition .
options include manual rotation and direct traction forceps , rotational vacuum extractor , or keilland forceps and each of these options has its own relative merits and demerits . however , keilland forceps require additional expertise because of the additional risks they confer . therefore , in our unit ,
only those who can demonstrate competency and regularly perform keilland forceps delivery are permitted to do so .
tempest et al . suggest that women are more likely to need a caesarean section if rotational ventouse rather than keilland forceps is used to assist the birth ( or 8.2 ; 95%ci 4.5414.79 ) and the adverse maternal and neonatal outcomes are comparable when delivery is by keilland forceps compared to failed rotational ventouse and subsequent caesarean section . in our unit , the kiwi omnicup is the recommended instrument for rotational deliveries .
it was chosen as the first instrument in 91 of the 119 cases ( 76% ) with 36 ( 40% ) of them having a second instrument ( nonrotational or rotational forceps ) applied . in 2001
vacca reported a 98% success rate for the kiwi omnicup in his cohort which included 18 nonrotational and 32 rotational deliveries .
however , more recent randomized control trials in the united kingdom concluded that the kiwi omnicup was less successful at achieving a successful vaginal delivery when compared to a standard cup ( 34% versus 21% ) and thereby increases the rates of sequential instrument use .
however , operator experience and skill need to be considered whilst interpreting the data . whether the use of the kiwi cup rather than other rotational instruments is a factor for the failed instrumental rate
can not be determined from our data as this comparison could not be made . from our data
, it can also be seen that failed instrumental deliveries are more common out - of - hours with 60% occurring between 2001 and 0759 . whilst it is not possible to conclude that lack of competency and experience contributed to failed instrumental births , instrumental deliveries are predominantly undertaken by trainees during out - of - hours .
lack of consultant presence on labour ward during out - of - hours has been an issue which the royal college of obstetrics and gynaecology has been attempting to address over recent years . in our study ,
a large proportion of trials of instrumental delivery were by trainees , although most of these were by obstetricians with over 5-year experience .
the impact of the shortening of obstetric training within the uk as a result of the european working time directive may have resulted in trainees being less skilled and consequently having a higher failure rate of instrumental deliveries compared to their consultant colleagues . of the women that required syntocinon ,
35% commenced syntocinon in the later stages of labour ( at or more than 8 cm ) .
this illustrates the importance of carefully assessing the causes of secondary arrest of labour and having senior input if instrumental vaginal delivery is subsequently required in these cases . more than 80% of women also had a second stage lasting for more than four hours .
the national institute for clinical excellence intrapartum guidelines stated that after 2 hours of active pushing , primiparous women should have a diagnosis of delay made ( i.e. , failure to progress ) and plans should be put in place for an operative delivery to occur enabling primiparous women to be delivered within 3 hours of the active second stage starting .
this illustrates the importance of having definite endpoints in the second stage of labour and to strike the right balance between promoting normality and reducing the risks of a prolonged second stage of labour .
the station of the fetal head may also be a determinant of failed instrumental delivery . according to the royal college of obstetrics and gynaecology , mid - cavity delivery
is defined as when the leading point of the fetal skull is above station plus 2 cm but not above the ischial spine .
just over 95% of our cases are therefore defined as mid - cavity and therefore , should be performed by an experienced operator because of the need for a high level of clinical and technical skill .
body mass index of over 30 is generally thought to be a risk factor for failed instrumental delivery although this was not borne out in our analysis .
fetal factors that contribute to a failed instrumental delivery are difficult to be predicted , both antenatally and during the intrapartum period .
for example , a fetal weight of more than 4 kg is associated with increased likelihood of failed instrumental delivery but there is no good evidence to support the use of ultrasound for estimation of fetal weight due to its inaccuracy .
clinical skills therefore remain important in the diagnosis and management of failure to progress in second stage .
it has been reported that clinical examination was found to be significantly more likely within 10% of the actual weight than an ultrasound derived estimation of fetal weight ( 58% versus 32% ; rr 1.65 ; 95% ci 1.421.69 ) .
it is therefore unlikely that fetal factors such as weight could be used to predict the likelihood of either successful or failed instrumental delivery .
when considering maternal outcomes associated with fid , approximately 25% of women in our study lost more than 1000 ml at the time of their caesarean section . in the study by murphy et al .
, only 10% of women lost more than 1000 ml at the time of their caesarean section but this was significantly more than those women who achieved a vaginal delivery ( adjusted or 2.8 , 95% ci 1.17.6 ) .
their group also showed that increased blood loss was less likely with an experienced obstetrician but in our cohort that did not appear to be the case .
this increase in blood loss with a fully dilated caesarean section as compared to vaginal delivery was also noted by ebulue et al . in 2008
we run regular fire drills on estimation of blood loss in our unit for all staff and therefore it is very likely that the higher ebl noted in our study reflects a more accurate estimation of blood loss at delivery .
in addition , obstetric trainees were involved in delivery of 80% of cases who sustained a postpartum haemorrhage of > 1000 ml ( table 2 ) .
maternal trauma sustained at the time of delivery can occur either at the time of attempted vaginal delivery or during the emergency caesarean section following fid . in our study , a total of 66 episodes of maternal trauma were documented .
eight women sustained trauma via two separate mechanisms whereas 61 women did not sustain any trauma at the time of delivery . therefore
, 48% of women sustained trauma at the time of their failed instrumental vaginal delivery or caesarean section . over 25% of the women who sustained trauma had vaginal / perineal injuries .
there is no evidence to support the routine use of episiotomy at the time of operative vaginal delivery .
macleod and murphy surveyed practicing obstetricians with regard to operative delivery and the use of episiotomy .
they found that a restrictive approach was preferred for deliveries using a ventouse ( 72% ) but a routine approach for forceps ( 73% ) .
even with such an approach , episiotomies should not be performed until the stage where delivery is deemed to be imminent .
therefore , it is essential to avoid an episiotomy when the fetal head is at station 0 or plus 1 cm when there is minimal or no descent with traction , to avoid an inappropriate episiotomy .
our study highlights the fact that both the incidence and severity of maternal trauma are greater when an emergency caesarean was performed for fid , where the primary indication was failure to progress in labour .
therefore , optimization of management of second stage of labour and providing experienced obstetric input is paramount to avoid these complications .
neonatal outcomes at the time of failed operative delivery and subsequent caesarean have been considered by a number of studies in the past .
unfortunately , it is difficult to compare our data with these studies due to a wide variation in neonatal complications ( neonatal unit admissions , jaundice , sepsis , and seizures ) that have been considered by individual studies .
much of the available evidence suggests that sequential instrumentation should be avoided if possible because of the increased neonatal morbidity .
murphy et al . found that the use of sequential instruments was associated with increased neonatal trauma ( adjusted or 3.1 , 95% ci 1.56.8 and adjusted or 4.4 , 95% ci 1.314.4 , for completed and failed deliveries , resp . ) . in our study , 34 women ( 29% ) had sequential instruments with either ventouse and forceps or nonrotational and rotational forceps .
loss of scalp tissue and laceration of the eye ( table 4 ) highlight operator factors and the need to determine the fetal position accurately , if necessary , using an ultrasound scan to identify fetal orbits , to avoid these complications .
emergency caesarean section during second stage of labour is associated with maternal and fetal complications and also has the potential to negatively influence a woman 's birth experience .
our study has shown that failed instrumental delivery is more likely with fetal malposition , prolonged second stage of labour , use of oxytocin for secondary arrest , and lack of operator experience .
although current guidelines on operative vaginal delivery do identify risk factors that may increase the incidence of failed instrumental delivery , there are no scoring systems to aid obstetricians in determining the likelihood of failure . based on the findings of our study that analyzed emergency caesarean sections for fid in 119 women ,
we have formulated a failed instrumental delivery score to aid clinicians on the shop floor in determining the likelihood of failure ( table 6 ) .
we have suggested that if the failed instrumental delivery score is 8 , there is an increased likelihood of a failed instrumental vaginal birth and hence a trial of instrumental vaginal delivery in the theatre should be considered and the consultant on call should be alerted in view of associated increased maternal and fetal morbidity due to fid .
we sincerely hope that use of such clinical scoring system based on key parameters that could be easily determined prior to attempting an instrumental vaginal delivery would help clinicians to ensure availability of an experienced clinician and also to conduct delivery in an appropriate environment with a ready recourse to caesarean section .
Output:
| objectives . to review the determinants for a failed operative vaginal delivery and to examine associated fetal and maternal morbidity . design .
retrospective observational study . setting .
large london teaching hospital . method .
a retrospective review of case notes during a 5-year period was carried out .
results .
overall 119 women ( 0.44% ) out of 26,856 births had a caesarean section following a failed instrumental delivery , which comprised 5.1% of all operative vaginal births .
73% had a spontaneous onset of labour and 63% required syntocinon at some time prior to delivery .
71.5% of deliveries were complicated by malposition .
only 20% of deliveries were attended by a consultant obstetrician .
almost 50% of women and 8.4% of neonates sustained trauma at the time of either their failed instrumental delivery or the caesarean section .
conclusions .
emergency caesarean section during the second stage of labour is associated with maternal and fetal complications .
a failed instrumental delivery score ' ( fids ) may aid practitioners in predicting an increased likelihood of a failed operative vaginal birth and therefore to consider a trial of operative vaginal delivery in the theatre .
senior input should also be sought because a failed operative vaginal birth is associated with increased maternal and fetal morbidity . |
PubmedSumm119699 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: congenital hypothyroidism ( cht ) is the most common congenital endocrine disorder with a world - wide incidence around 1 in 3500 to 4000 live births .
reduced thyroid hormone production in babies with cht has a major detrimental effect on central nervous system development and growth .
most babies with cht have thyroid gland agenesis or dysgenesis with a poorly formed or absent gland .
a minority ( ~20% ) have a normally sited gland but an underlying single gene defect preventing the normal process of thyroid hormone production within the gland ( dyshormonogenesis ) .
although germline mutations in thyroid transcription factors 1 and 2 ( ttf-1 and ttf-2 ) and pax-8 ( paired box transcription-8 ) have been identified as aetiological risk factors for dysgenesis or agenesis , they only explain a small percentage of cases ( around 2% ) .
it is important to highlight the fact that iodine deficiency is a well recognised and important cause of neonatal thyroid dysfunction in some parts of the world .
an increasing incidence of cht has been suggested from an analysis of data including that from new york state and mexico , although no similar increase was shown in a similar study of data from quebec .
previous studies in the united kingdom have suggested that cht is more prevalent in asian sectors of the population and that prevalence has increased .
studies also suggest that the prevalence of hypothyroidism in scotland has increased , with a study from the same area of scotland demonstrating an increased population prevalence of hypothyroidism in young people compared to previously published rates .
the incidence of cht has also been suggested to vary seasonally in a number of studies in different geographical areas including the west midlands of england , finland , japan [ 911 ] , and australia .
however , seasonality also has been not observed in a number of other studies , including those in the north west of england , the netherlands , saudi arabia , canada , norway , france and switzerland .
should seasonal variation in cht risk exist , this would suggest that an unknown environmental factor may be involved in the disease 's aetiology .
temporal trends in risk are usually unlikely to include genetic factors , unless either population shifts result in germline mutations being more prominent in a particular geographical area or environmental influences on germline mutations or epigenetic changes have increased in prevalence over the study period .
circulating thyroid stimulating hormone ( tsh ) levels are measured as part of screening programmes for cht across many parts of europe , japan , and increasingly in north america . in the uk , neonatal screening for cht began in 1979 in scotland and in 1981 in the remainder of the uk after a recommendation from the uk department of health .
this paper describes the incidence of elevated tsh levels in newborns in the north of england over an eleven - year period ( 19942005 ) and examines whether seasonal variation in incidence exists in this geographical area .
around 35 000 infants in the northern region of england , comprising north east england ( the area from teesside extending north into northumberland ) and north cumbria , are screened every year in a single centre by measuring blood spot tsh levels .
data on all cases , including dates of birth , were available from 1994 to 2005 inclusive .
we opted to refer to tsh rather than cht in this study for the following reasons .
the extent to which cases of suspected cht are investigated will vary from one unit to another [ 16 , 17 ] .
we felt that this was likely to be the case in our region of the uk as well .
there is no definitive test or tests that can identify the underlying thyroid gland abnormality in this condition .
even the combination of isotope scanning and ultrasonography does not reveal an underlying diagnosis in all infants [ 16 , 18 ] .
the sensitivity and specificity of tests such as isotope scanning is suboptimal with potentially misleading information generated by factors such as early thyroxine therapy .
some studies have used thyroxine intervention as confirmation of underlying cht but the threshold for intervention will vary with time and from clinician to clinician and centre to centre . hence some babies with raised tsh values and thyroid hormone values within the laboratory normal range will be treated whilst others will not [ 5 , 16 ] .
ultimately , biochemistry is the most important parameter ; a baby with a raised tsh but normal imaging will require thyroxine treatment whilst a baby with normal biochemistry but abnormal imaging will not . during the period of the study the screening centre moved between the royal victoria infirmary ( rvi ) , newcastle and the university hospital of north durham ( uhnd ) , durham .
the screening blood spot tsh method and cut - off value for screening failure also changed during the study from a manual radioimmunassay method ( 1994march 1998 ) to an acs-(beyer ) chemiluminometric assay ( april 1998february 2003 ) and then a delfia ( perkin elmer ) fluoroimmunometric assay ( march 2003present ) ( table 1 ) .
interassay coefficients of variation ( cv ) for blood spot tsh assays were 16.5% , 9.4% , and 8.8% for the manual radioimmun assay method at tsh values of 22.0 , 38.6 , and 74.1
interassay cv for blood spot tsh assays were 7% and 6% for the acs chemiluminometric assay at tsh values of 14
mu / l , respectively , and 11% and 12% for the delfia fluoroimmunometric assay at tsh values of 16
nine replicates over 9 analytical runs were used to calculate inter assay precision for the acs assay and 42 replicates over 10 analytical runs for the delfia assay . to ensure that cut - off values were comparable across the different screening methods used , prior to a change in method blood spot samples received as part of the screening program
were analysed by both methods ( radioimmunoassay v acs-180 , n = 2634 ; acs-180 v delfia , n = 682 ) .
revised cut - off values were established by comparing the results using scatter charts and using least squares linear regression .
there was a highly significant correlation between the 2 methods when the assay was changed from ria to acs-180 in 1998 ( p < .001 ; r = 0.94 ) and when it was changed from acs-180 to delfia in 2003 ( p < .001 ; r = 0.99 ) .
100% agreement for screening passes and failures was obtained using the revised cut - off values .
values identified as being greater than 20 mu / l by the radioimmunassay method , 10 mu / l by the acs method , and greater than 6 mu /
l by the delfia method were followed by analysis of a repeat blood spot from the screening card .
they were deemed to be screening failures if the final blood spot value was again greater than 10 mu / l ( acs ) or 6 mu / l ( delfia ) .
all infants where the paediatrician was subsequently notified of an increased value and hence were classed as neonatal screening test failures were included in the analysis .
the yearly incidence of elevated tsh values in newborns was calculated as the number of cases in each year per 100,000 live births born in the northern region .
seasonal variation in incidence was assessed using the edwards test for seasonality with an adjustment for variable month length .
all statistical analyses were performed using the statistical software package stata , version 9.0 ( statacorp , texas ) .
approvals for this study were obtained from the newcastle and north tyneside local research ethics committee and the patient information advisory group for england and wales .
between 1994 and 2005 inclusive , there were 213 cases of elevated tsh values in newborns in the northern region of england .
the ratio of female to male cases was 1.3 : 1 . over the study period , the average annual incidence was 59.94 per 100,000 live births .
the annual number of cases of tsh elevation in newborns in the northern region and annual incidence per 100,000 live births are shown in table 2 .
incidence increased significantly over the study period ( p < .0001 ) from 37 per 100,000 in 1994 to a peak of 92.8 in 2003 .
the number of cases by month of birth is reported in table 3 . despite peak number of cases in may and in the august october period
, there was no significant evidence of seasonal variation in the number of cases ( p = .16 ) . nor was there evidence of seasonal variation with sex - specific seasonality analyses ( p = .17 for females and 0.59 for males ) .
despite advances made in identifying genetic risk markers for cht , there remains a great deal to be explained in terms of the aetiology of the disease .
this study showed an increasing incidence of elevated tsh values in newborns in the northern region of england between 1994 and 2005 , but did not find evidence of seasonal variation in the number of cases .
many other studies have depended primarily on biochemistry including tsh rather than other investigations when making a diagnosis of cht . given the high risk of subclinical hypothyroidism and morphological abnormalities in false - positive patients [ 23 , 24 ] we suspect that our figures for raised tsh will be closely linked to the number of actual cases of cht .
unfortunately we do not have detailed information on outcome in these children because they were managed in more than 10 different hospitals by an even greater number of clinicians .
more detailed data were therefore not available to allow us to assess changes in permanent cht or to analyse the data with respect to different aetiologies . an increasing temporal trend in incidence of cht
has recently been reported in new york state , with a 138% increase between 1978 and 2005 . excluding new york state , nationwide united states data suggest a 73% increase between 1987 and 2002 .
however , this is in contrast to research conducted in quebec , canada , where no changes in incidence were seen over a 16-year period .
a real temporal trend , aside from changes in diagnostic procedures which can lead to increases in incidence , suggests either an increasing exposure to an environmental risk factor , or a changing distribution of risk factors among the population .
the incidence rates in this study dropped slightly after 2003 and it remains to be seen whether this is a true decline or simply random variation .
the division between a screen positive and screen negative in a screening programme such as this is not linked to robust outcome measures and the screening threshold and management of cases with mild thyroid dysfunction varies between regions .
we were keen to establish that the change in incidence was not simply a reflection of change in assay methodology or laboratory practice ( as opposed to seasonality where we would not expect assay change to have the same impact ) .
all births in the study region were screened in a single centre at any one time .
the physical location of this centre changed originally in april 1998 from newcastle to durham and again in april 2005 from durham to newcastle .
the move in 1998 also corresponded to a change in the laboratory assay with a further change in assay in 2003 .
the different assay methods were rigorously compared to ensure that there would be no difference in the number of cases identified as a result of the change . to this
end a large number of samples were analysed and there was no difference in screening passes or failures with 100% concordance .
it is of note that the increasing incidence in raised tsh values was most striking during the period when tsh was measured only by the acs method although we suspect that this represents a true increase because the rise had commenced prior to the change in methodology and continued after this changed to the delfia assay .
many other studies of cht or elevated tsh levels have encountered similar issues regarding data interpretation as assay methodology has changed . in terms of changes in the population structure ,
two previous studies from england have reported an increased incidence of cht among asians [ 5 , 12 ] .
however , the northern region of england has a population of 3.1 million , of which less than 2% are from ethnic minorities , with low levels of migration .
therefore , while the data are not available to assess directly , it is unlikely that the increased incidence is related to changes in population structure and with it changes in genetic risk factor profiles .
exposure to environmental factors such as chemicals or increasing levels of other risk factors such as maternal iodine deficiency or high prenatal iodine exposures or low birth weight infants may be suggested by an increasing temporal trend whereas infections or seasonally varying dietary factors or chemical exposures , such as dioxin and polychlorinated biphenyl , may be suggested by evidence of seasonal variation in the number of cases .
the potential role of a suboptimal maternal iodine status in some parts of the north of england should be highlighted and clearly warrants further study .
we found little evidence of seasonal variation of elevated tsh levels in newborns , in line with a number of previous reports of no seasonality [ 4 , 9 , 1214 ] .
in contrast , a number of previous studies have reported seasonal variation in a number of different geographical areas [ 5 , 811 ] , including a different part of england .
gu et al . also found sex - specific seasonal patterns of incidence in japan .
however , sex - specific analyses also showed little evidence of seasonal variation in this study .
the issue of statistical power should be considered when interpreting our results and it is possible that with a larger sample a seasonal effect may have been found .
it is also possible that differences in findings may reflect differences in the underlying populations . our sex ratio ( f : m ) of 1.3 : 1 was significantly less than the sex ratio of 2.8 : 1 previously shown in a study from scotland that used thyroxine prescription data as a surrogate for hypothyroidism in children and young people and less than the ratio of 2.1 : 1 reported for cases of true cht from the same country .
this underlines the importance of taking factors such as iodine status into consideration in future work . in conclusion , we have observed a significant increasing trend in the incidence of elevated tsh levels in newborns , a surrogate for increasing levels of cht , since 1994 .
whilst the reasons for the increase are unclear , it would appear from this analysis that seasonally varying factors are not involved .
it is also unlikely to be due to a change in the population distribution of genetic risk factors , although environmental determinants of genetic mutations and epigenetic factors can not be ruled out .
Output:
| previous studies of congenital hypothyroidism have suggested an increasing incidence and seasonal variation in incidence , which may suggest nongenetic factors involved in aetiology .
this study describes the incidence of elevated thyroid stimulating hormone ( tsh ) values in newborns , a surrogate for congenital hypothyroidism , measured as part of the screening programme for congenital hypothyroidism , over an eleven - year period ( 19942005 ) , and assesses whether seasonal variation exists .
all infants born in the northern region of england are screened by measuring levels of circulating tsh using a blood spot assay .
data on all 213 cases born from 1994 to 2005 inclusive were available .
annual incidence increased significantly from 37 per 100,000 in 1994 to a peak of 92.8 per 100,000 in 2003 .
there was no evidence of seasonal variation in incidence .
the reasons for the increasing incidence are unclear , but do not appear to involve increasing exposure to seasonally varying factors or changes in measurements methods . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.