id
stringlengths 11
16
| query
stringlengths 279
826k
| answer
stringlengths 174
4.34k
|
|---|---|---|
PubmedSumm118400 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: hirschsprung 's disease ( hscr ) , or aganglionic megacolon , occurs due to the congenital absence of parasympathetic neuronal ganglia in a segment of the hindgut , resulting in malfunction of the affected segment .
the condition presents as a common cause of intestinal obstruction in neonates , with an incidence of 1 in 5,000 ( 0.02% ) live births and an overall risk to siblings of 4% ( 1)(3 ) .
a study of hscr indicates several clear - cut associations that are known or are suspected to be related to an increased risk of hscr .
these include its recurrence in families and the association with the major susceptibility genes points convincingly to genetic factors in its multifactorial pathogenesis .
the main susceptibility gene for hirschsprung 's disease is the ret ( rearranged during transfection ) proto - oncogene tyrosine kinase which is situated at chromosome 10q11.2 .
there are early reports of associations between hscr and a number of associated anomalies related to neural cell development .
these include neuroblastoma ( 1 ) , phaeochromocytoma ( 1),(4),(5 ) and multiple endocrine neoplasia ( men ) type 2 a and b syndromes ( 5)(7 ) , among others ( 1 ) .
reports on this relatively uncommon cosegregation of hscr and men2 in the same patient ( 6),(8)(20 ) exist because of the common factor of the ret gene being associated with both conditions ( hscr , men type 2 and medullary thyroid carcinoma ( mtc ) .
this is an extremely interesting observation , as it involves both gain and loss of function of the same gene in the same patient .
the men hscr association has been shown to cosegregate in hscr patients with both short- and long - segment aganglionosis ( 21 ) .
it seems to be particularly associated with long - segment aganglionic segments , and decker et al .
( 21 ) reported a long aganglionic segment ( l - hscr ) in seven out of 13 patients ( 54% ) .
our experience is of total colonic aganglionosis ( tca ) in the index patient in all three families identified in our series ( 22 ) .
it therefore appears that patients with long - segment hscr carry the highest risk of developing mtc and should have a detailed family history taken : the presence of a long - segment hscr should be an important selection criterion for gene testing in hscr .
it is important to explore this concept further in families where hscr and mtc coexist , as it will yield possible ret gene associations and insights into possible molecular reasons for the phenotypic expression .
it is generally accepted that aberrant ret protein synthesis , due to inactivating genetic variations , lead to the congenital malformation of the enteric nervous system ( ens ) which we call hirschsprung 's disease .
mtc relationship also appears to be bi - directional , and ret gene activation or suppression appeared to vary over succeeding generations within the same family ( 22 ) .
butter et al . ( 23 ) reported a 50% incidence of hscr in 20 patients undergoing a prophylactic thyroidectomy for ret - associated mtc risk ( a ret c620 mutation ) . in one further reported case of familial mtc ( 24 ) with a c620s point mutation ,
the mtc developed 12 years after surgical correction of hscr in the child plus a maternal mtc 7 years after the child 's birth . in our reported series ( 22 )
, mtc was detected in the parent 5 years after the birth of the affected child .
the ret proto - oncogene [ 10q11.22 ] is the major gene involved in the pathogenesis of hscr with causative loss - of - function mutations being identified in more than 70% of cases ( 25 ) .
in essence , the extracellular domain ret mutations alter the protein and possibly its processing in the endoplasmic reticulum ( 26 ) . as a result , ret transport to and its expression at the cell surface is decreased .
multiple endocrine neoplasia also results from autosomally dominant , inherited , highly penetrant germline ret mutations that predispose patients to the development of tumors in cells derived from neural crest origin . of the more than 25 ret proto - oncogene gene mutations which have been described in association with men type 2 syndromes , the most important
are associated with the six cysteine alleles of the extracellular portion of the ret proto - oncogene in men2a .
ret is a vital gene which directs the migration , proliferation and survival of the enteric neural crest - derived cells of the enteric nervous system ( ens ) during embryogenesis .
it is also responsible for the development of the autonomic nervous system as well as for controlling kidney development and spermatogenesis , among other functions .
genetic mutation and/or variation may result in ret malfunction , which has been associated with at least four clinical conditions ( hscr , men type 2 syndromes ( a and b ) and familial medullary thyroid carcinoma ( fmtc ) . in hscr , hypomorphic ret alleles may cause delayed neuroblast migration and non - apoptotic cell death .
this causes ens maldevelopment , resulting in aganglionosis ( hscr ) and other related conditions of the ens .
men2 association raises the question of which hscr patients are at greatest risk and should therefore be further investigated by ret gene analysis .
hereditary mtc can , with rare exceptions , be traced back in family trees ( 27 ) and the hscr men2 familial association
may be missed because the mtc may appear later in life without the connection being made . as a result ,
the risk of hscr patients later developing features of an men2 syndrome ( with mtc ) is thought to be under - evaluated .
the risk of a future thyroid carcinoma remains a matter of general concern in long - term hscr management .
it is becoming clear that there is a need for screening in order to determine which patients require ret gene analysis as a means of determining risk .
the most frequently identified mutation responsible for men2a involves the substitution of the cysteine amino acid at position 634 ( cys634arg or c634r ) by the amino acid arginine .
however , point mutations in the cysteine - rich ret area at the 620 position , along with some other ret gene areas ( e.g. c609 , c611 and c618 ) have been reported as being mostly associated with the hscr men2 phenotype . by way of contrast , in > 90% of men2b patients , the amino acid methionine is replaced by threonine at position 918 ( m918 t ) in the intracellular portion of the gene .
there are also a number of other ret variations that are associated with thyroid cancers and familial medullary thyroid carcinoma which may give rise to an overactive abnormal ret protein .
the cosegregation of hscr and men2 is particularly interesting as it involves both a switch off and a switch on of the gene in the same patient .
some remarkable family lineages have been reported which demonstrate the occurrence of the two conditions in family lineages ( 17),(22 ) .
like other receptor tyrosine kinases ( rtks ) , ret is made up of at least three functional areas ( extracellular , transmembrane and intracellular regions ) which appear to have specific roles in cellular function ( 28 ) .
it is interesting that , in contrast to other susceptibility areas , the ret mutations which have been identified as carrying both a risk for hscr as well as men2 approximate the transmembrane domain of the gene ( mostly c620r and occasionally c620s and rarely c620w ) ( 21 ) .
although the majority of reports connect these two conditions with point mutations in the cysteine - rich ret - area at the 620 position , other ret gene areas ( e.g. c609 , c611 and c618 ) have been reported as alternative sites . the high frequency with which the c620 ret mutation occurs in hscr
mutation in this position , which , like the roman god of doorways , can face in both directions ( i.e. activation ( men / mtc ) and inactivation ( hscr ) . our own studies ( 22 ) have shown the ret-620 cysteine variations to be present in 2.5% of hscr families ( three out of 118 families investigated ) , which is in keeping with other reports ( 21 ) .
there was , however , an uncertain prevalence of hscr men in related family members as not all could be tested .
studies have also shown that the closer mutations are to the transmembrane domain , the higher their importance in terms of the development of cellular proliferation and tumor activation ( 29 ) .
a strong self - association has been shown in the transmembrane portion of the gene ( ret - tm ) , which has been suggested as a possible explanation of the oncogenic activation due to ret cysteine mutations in oncogenesis ( 29 ) .
this suggests an area that plays an important role in mtc risk evaluation and may identify a target area for novel therapeutic strategies .
because men2a relates mostly to the ret alleles at the six cysteine positions in the extracellular domain of the gene , it appears to induce a different set of downstream signaling genes from that carrying the men 2b mutation .
the multidocking intracellular portion of the ret gene where men2b ret variations are situated appears to be vital to both tyrosine kinase function and downstream signaling due to the number of signaling molecules that interact there ( e.g. shc , src , frs2 , irs1 , gab1/2 , and enigma ) ( 30)(32 ) .
it is therefore easier to understand how mutations within this tyrosine - kinase rich region ( e.g. in 95% of men2b patients ) alters the substrate specificity of ret tyrosine kinase and results in gene activation .
genetic variations impair the ret tyrosine kinase response to tyrosine kinase activation , thus appearing to dictate downstream signaling cascade response ( 33 ) .
the induction of a disulfide - linked homodimerization resulting from the cysteine - related mutations within the extracellular portion of the ret proto - oncogene promote dimer formation within the gene as covalent receptor dimers are linked by disulfide bonds between unpaired cysteines ( 34),(35 ) .
it is known that the ret protein targets a number of intracellular signaling cascades , including the ras - raf - erk1/2 , pik3-akt , and stat transcription pathways ( 36 ) .
the activation of the mapk and ras / erk molecular signaling cascades involves grb2/msos recruitment ( 37 ) .
in addition , recent studies have suggested that the mammalian target of the rapamycin ( mtor ) intracellular signaling pathway is functionally activated in mtc ( especially in those with germline ret mutations ) ( 38 ) , and that the role of the other downstream ret tyrosine kinase signaling cascades ( e.g. braf , ras isoforms and pi3 kinase ) is less certain .
oncogenic ret mutations mostly occur de novo in sporadic mtc , and it is now well accepted that ret gene variations produce aberrant proteins which may bypass the normal linking to growth factors outside the cell , most probably triggering cells to grow and divide abnormally and , in turn , promoting tumor formation .
ret activation then promotes ret - dimer formation and activation of the tyrosine kinase outside of the normal ligand binding system .
however , little is known of the actual mechanisms whereby extracellular domain mutations ( e.g. c620s ) may result in c - cell proliferation ( 39 ) . current understanding of ret gene activation in mtc is that the gene is activated by alterations in autophosphorylation , or alternatively by the modification of the subcellular distribution of the active kinase or the induction of unusual interactions with other proteins ( e.g. ret / ptc ) ( 40 ) .
it is possible that the men2a hscr connection represents a second alternative intracellular mechanism in the pathogenesis of mtc ( 41 ) .
the less common codons c620 , c618 and c611 within exon 10 confer a weaker transforming activity in vitro than exon 11 ( c634 ) ret mutations ( 42 ) . it has been suggested that the men2a hscr connection represents a second alternative intracellular mechanism in the pathogenesis of mtc involving the endoplasmic reticulum which has been shown to decrease cell surface ret expression in hscr ( 26 ) .
changes in polarity in men2a hscr may result in the unfolding of the ret protein initially failing to achieve homeostasis via the unfolded protein response ( upr ) of the endoplasmic reticulum , leading to apoptosis and hscr .
subsequent upregulation of the upr may then induce changes which allow gene activation , thus providing a growth advantage to tumor cells .
oncogenic ret mutations affect protein synthesis and function , which then influence a number of downstream molecular signaling pathways ( 43 ) .
studies have demonstrated that ret influences the downstream phosphorylation of the insulin receptor substrate-2 ( irs 2 ) with subsequent activation of phosphatidylinositol 3 kinase ( pi 3-kinase ) and protein kinase b ( pkb / akt ) signaling pathways ( 44 ) .
in addition , the induction of phosphorylation of shc results in growth factor receptor binding protein 2 ( grb-2 ) binding and activation of the mitogen - activating protein ( map ) kinase pathway ( 45 ) .
the resulting mapk irs-2 , pi 3-kinase and pkb / akt activation could transduce the oncogenic ret signal to promote gene transcription , possibly through activation of the jun / ap-1 transcription cascades ( 44 ) .
this paper draws attention to the apparent genotype phenotype correlation which exists between ret and the men2 syndromes ( 46),(47 ) .
clinical awareness of possible mtc has led to timely intervention and early treatment of this poor prognosis chemo- and radioresistant tumor .
establishment of risk by genetic testing has become a classic model of molecular medicine being integrated into patient care .
it is therefore fairly clear that ret gene screening is of considerable value in familial screening , and offering ret testing is considered best practice for the clinical management of patients at risk of men2a and men2b .
gene mutation in the ret 620 position carries significant risk of developing hscr and/or mtc . in the interests of cost - effectiveness
, it may be part of a targeted investigation of high - risk areas of the gene in hscr patients at risk , thus facilitating follow - up and future management .
genetic screening is an extremely sensitive method of identifying risk in men2 syndromes ( 98% ) and prophylactic surgical intervention may prevent the onset of the radio- and chemoresistant mtc ( 48 ) .
better understanding of the ret-620 relationship would also allow for a more cost - effective method of identifying those at risk by focusing ret gene testing to this specific area as a hot spot .
in addition , a number of attractive targets are being identified which may be suitable for novel therapeutic signaling pathway - specific drug design ( 49 ) .
novel approaches to treatment based on this genetic knowledge have already resulted in randomized clinical trials into the effectiveness of multi - kinase inhibitors such as axitinib , sorafenib , motesanib , and xl-184 .
these have shown early promise in selected cases which may soon change the management of thyroid cancer ( 50 ) .
the men hscr association has been shown to cosegregate in hscr patients with both short- and long - segment aganglionosis ( 21 ) .
it seems to be particularly associated with long - segment aganglionic segments , and decker et al .
( 21 ) reported a long aganglionic segment ( l - hscr ) in seven out of 13 patients ( 54% ) .
our experience is of total colonic aganglionosis ( tca ) in the index patient in all three families identified in our series ( 22 ) .
it therefore appears that patients with long - segment hscr carry the highest risk of developing mtc and should have a detailed family history taken : the presence of a long - segment hscr should be an important selection criterion for gene testing in hscr .
it is important to explore this concept further in families where hscr and mtc coexist , as it will yield possible ret gene associations and insights into possible molecular reasons for the phenotypic expression .
it is generally accepted that aberrant ret protein synthesis , due to inactivating genetic variations , lead to the congenital malformation of the enteric nervous system ( ens ) which we call hirschsprung 's disease .
mtc relationship also appears to be bi - directional , and ret gene activation or suppression appeared to vary over succeeding generations within the same family ( 22 ) .
butter et al . ( 23 ) reported a 50% incidence of hscr in 20 patients undergoing a prophylactic thyroidectomy for ret - associated mtc risk ( a ret c620 mutation ) . in one further reported case of familial mtc ( 24 ) with a c620s point mutation ,
the mtc developed 12 years after surgical correction of hscr in the child plus a maternal mtc 7 years after the child 's birth . in our reported series ( 22 ) ,
mtc was detected in the parent 5 years after the birth of the affected child .
the ret proto - oncogene [ 10q11.22 ] is the major gene involved in the pathogenesis of hscr with causative loss - of - function mutations being identified in more than 70% of cases ( 25 ) . in essence , the extracellular domain ret mutations alter the protein and possibly its processing in the endoplasmic reticulum ( 26 ) . as a result , ret transport to and its expression at the cell surface is decreased .
multiple endocrine neoplasia also results from autosomally dominant , inherited , highly penetrant germline ret mutations that predispose patients to the development of tumors in cells derived from neural crest origin . of the more than 25 ret proto - oncogene gene mutations which have been described in association with men type 2 syndromes , the most important
are associated with the six cysteine alleles of the extracellular portion of the ret proto - oncogene in men2a .
ret is a vital gene which directs the migration , proliferation and survival of the enteric neural crest - derived cells of the enteric nervous system ( ens ) during embryogenesis .
it is also responsible for the development of the autonomic nervous system as well as for controlling kidney development and spermatogenesis , among other functions .
genetic mutation and/or variation may result in ret malfunction , which has been associated with at least four clinical conditions ( hscr , men type 2 syndromes ( a and b ) and familial medullary thyroid carcinoma ( fmtc ) . in hscr , hypomorphic ret alleles may cause delayed neuroblast migration and non - apoptotic cell death .
this causes ens maldevelopment , resulting in aganglionosis ( hscr ) and other related conditions of the ens .
men2 association raises the question of which hscr patients are at greatest risk and should therefore be further investigated by ret gene analysis .
hereditary mtc can , with rare exceptions , be traced back in family trees ( 27 ) and the hscr men2 familial association may be missed because the mtc may appear later in life without the connection being made . as a result
, the risk of hscr patients later developing features of an men2 syndrome ( with mtc ) is thought to be under - evaluated .
the risk of a future thyroid carcinoma remains a matter of general concern in long - term hscr management .
it is becoming clear that there is a need for screening in order to determine which patients require ret gene analysis as a means of determining risk .
the most frequently identified mutation responsible for men2a involves the substitution of the cysteine amino acid at position 634 ( cys634arg or c634r ) by the amino acid arginine .
however , point mutations in the cysteine - rich ret area at the 620 position , along with some other ret gene areas ( e.g. c609 , c611 and c618 ) have been reported as being mostly associated with the hscr men2 phenotype . by way of contrast , in > 90% of men2b patients , the amino acid methionine is replaced by threonine at position 918 ( m918 t ) in the intracellular portion of the gene .
there are also a number of other ret variations that are associated with thyroid cancers and familial medullary thyroid carcinoma which may give rise to an overactive abnormal ret protein .
the cosegregation of hscr and men2 is particularly interesting as it involves both a switch off and a switch on of the gene in the same patient .
some remarkable family lineages have been reported which demonstrate the occurrence of the two conditions in family lineages ( 17),(22 ) .
like other receptor tyrosine kinases ( rtks ) , ret is made up of at least three functional areas ( extracellular , transmembrane and intracellular regions ) which appear to have specific roles in cellular function ( 28 ) .
it is interesting that , in contrast to other susceptibility areas , the ret mutations which have been identified as carrying both a risk for hscr as well as men2 approximate the transmembrane domain of the gene ( mostly c620r and occasionally c620s and rarely c620w ) ( 21 ) .
although the majority of reports connect these two conditions with point mutations in the cysteine - rich ret - area at the 620 position , other ret gene areas ( e.g. c609 , c611 and c618 ) have been reported as alternative sites .
the high frequency with which the c620 ret mutation occurs in hscr men patients suggests the concept of the so - called janus gene
mutation in this position , which , like the roman god of doorways , can face in both directions ( i.e. activation ( men / mtc ) and inactivation ( hscr ) . our own studies ( 22 ) have shown the ret-620 cysteine variations to be present in 2.5% of hscr families ( three out of 118 families investigated ) , which is in keeping with other reports ( 21 ) .
there was , however , an uncertain prevalence of hscr men in related family members as not all could be tested .
studies have also shown that the closer mutations are to the transmembrane domain , the higher their importance in terms of the development of cellular proliferation and tumor activation ( 29 ) .
a strong self - association has been shown in the transmembrane portion of the gene ( ret - tm ) , which has been suggested as a possible explanation of the oncogenic activation due to ret cysteine mutations in oncogenesis ( 29 ) .
this suggests an area that plays an important role in mtc risk evaluation and may identify a target area for novel therapeutic strategies .
because men2a relates mostly to the ret alleles at the six cysteine positions in the extracellular domain of the gene , it appears to induce a different set of downstream signaling genes from that carrying the men 2b mutation .
the multidocking intracellular portion of the ret gene where men2b ret variations are situated appears to be vital to both tyrosine kinase function and downstream signaling due to the number of signaling molecules that interact there ( e.g. shc , src , frs2 , irs1 , gab1/2 , and enigma ) ( 30)(32 ) .
it is therefore easier to understand how mutations within this tyrosine - kinase rich region ( e.g. in 95% of men2b patients ) alters the substrate specificity of ret tyrosine kinase and results in gene activation .
genetic variations impair the ret tyrosine kinase response to tyrosine kinase activation , thus appearing to dictate downstream signaling cascade response ( 33 ) .
the induction of a disulfide - linked homodimerization resulting from the cysteine - related mutations within the extracellular portion of the ret proto - oncogene promote dimer formation within the gene as covalent receptor dimers are linked by disulfide bonds between unpaired cysteines ( 34),(35 ) .
it is known that the ret protein targets a number of intracellular signaling cascades , including the ras - raf - erk1/2 , pik3-akt , and stat transcription pathways ( 36 ) .
the activation of the mapk and ras / erk molecular signaling cascades involves grb2/msos recruitment ( 37 ) .
in addition , recent studies have suggested that the mammalian target of the rapamycin ( mtor ) intracellular signaling pathway is functionally activated in mtc ( especially in those with germline ret mutations ) ( 38 ) , and that the role of the other downstream ret tyrosine kinase signaling cascades ( e.g. braf , ras isoforms and pi3 kinase ) is less certain .
oncogenic ret mutations mostly occur de novo in sporadic mtc , and it is now well accepted that ret gene variations produce aberrant proteins which may bypass the normal linking to growth factors outside the cell , most probably triggering cells to grow and divide abnormally and , in turn , promoting tumor formation .
ret activation then promotes ret - dimer formation and activation of the tyrosine kinase outside of the normal ligand binding system .
current understanding of ret gene activation in mtc is that the gene is activated by alterations in autophosphorylation , or alternatively by the modification of the subcellular distribution of the active kinase or the induction of unusual interactions with other proteins ( e.g. ret / ptc ) ( 40 ) .
it is possible that the men2a hscr connection represents a second alternative intracellular mechanism in the pathogenesis of mtc ( 41 ) .
the less common codons c620 , c618 and c611 within exon 10 confer a weaker transforming activity in vitro than exon 11 ( c634 ) ret mutations ( 42 ) . it has been suggested that the men2a hscr connection represents a second alternative intracellular mechanism in the pathogenesis of mtc involving the endoplasmic reticulum which has been shown to decrease cell surface ret expression in hscr ( 26 ) .
changes in polarity in men2a hscr may result in the unfolding of the ret protein initially failing to achieve homeostasis via the unfolded protein response ( upr ) of the endoplasmic reticulum , leading to apoptosis and hscr .
subsequent upregulation of the upr may then induce changes which allow gene activation , thus providing a growth advantage to tumor cells .
oncogenic ret mutations affect protein synthesis and function , which then influence a number of downstream molecular signaling pathways ( 43 ) .
studies have demonstrated that ret influences the downstream phosphorylation of the insulin receptor substrate-2 ( irs 2 ) with subsequent activation of phosphatidylinositol 3 kinase ( pi 3-kinase ) and protein kinase b ( pkb / akt ) signaling pathways ( 44 ) .
in addition , the induction of phosphorylation of shc results in growth factor receptor binding protein 2 ( grb-2 ) binding and activation of the mitogen - activating protein ( map ) kinase pathway ( 45 ) .
the resulting mapk irs-2 , pi 3-kinase and pkb / akt activation could transduce the oncogenic ret signal to promote gene transcription , possibly through activation of the jun / ap-1 transcription cascades ( 44 ) .
this paper draws attention to the apparent genotype phenotype correlation which exists between ret and the men2 syndromes ( 46),(47 ) . clinical awareness of possible mtc has led to timely intervention and early treatment of this poor prognosis chemo- and radioresistant tumor .
establishment of risk by genetic testing has become a classic model of molecular medicine being integrated into patient care .
it is therefore fairly clear that ret gene screening is of considerable value in familial screening , and offering ret testing is considered best practice for the clinical management of patients at risk of men2a and men2b .
gene mutation in the ret 620 position carries significant risk of developing hscr and/or mtc . in the interests of cost - effectiveness
, it may be part of a targeted investigation of high - risk areas of the gene in hscr patients at risk , thus facilitating follow - up and future management .
genetic screening is an extremely sensitive method of identifying risk in men2 syndromes ( 98% ) and prophylactic surgical intervention may prevent the onset of the radio- and chemoresistant mtc ( 48 ) .
better understanding of the ret-620 relationship would also allow for a more cost - effective method of identifying those at risk by focusing ret gene testing to this specific area as a hot spot .
in addition , a number of attractive targets are being identified which may be suitable for novel therapeutic signaling pathway - specific drug design ( 49 ) .
novel approaches to treatment based on this genetic knowledge have already resulted in randomized clinical trials into the effectiveness of multi - kinase inhibitors such as axitinib , sorafenib , motesanib , and xl-184 .
these have shown early promise in selected cases which may soon change the management of thyroid cancer ( 50 ) .
Output:
| the risk of patients with hirschsprung 's disease later developing multiple endocrine neoplasia remains a matter of concern .
the multiple endocrine neoplasia 2hirschsprung 's disease association has been shown to cosegregate in hirschsprung 's disease patients with both short- and long - segment aganglionosis , although patients with long - segment aganglionosis a to carry the greatest risk .
the hirschsprung 's disease
medullary thyroid carcinoma relationship also appears to be bi - directional , and activation or suppression of the rearranged during transfection gene appeared to vary over succeeding generations within the same family . rearranged during transfection gene variations are associated with both conditions .
the cosegregation of hirschsprung 's disease and multiple endocrine neoplasia 2 is particularly interesting as it involves both
switch off and switch on of the rearranged during transfection proto - oncogene in the same patient .
this cosegregation mostly relates to the cysteine - rich area on ret-620 ( the janus gene ) .
the mechanism whereby rearranged during transfection influences gene activation in multiple endocrine neoplasia 2 is complex , but genetic variations impair the rearranged during transfection tyrosine kinase response to tyrosine kinase activation , thus appearing to dictate downstream signaling cascade responses .
better understanding of the ret-620 relationship allows for a more cost - effective method of identifying those at risk by focusing rearranged during transfection gene testing to this specific area as a hot spot .
the clinical awareness of possible medullary thyroid carcinoma has led to timely intervention and early treatment of this chemo- and radioresistant tumor with poor prognosis .
establishment of risk by genetic testing has become a classic model of molecular medicine being integrated into patient care and offering rearranged during transfection - directed prophylactic surgical management .
in addition , novel approaches to treatment based on this genetic knowledge have already shown early promise in randomized clinical trials . |
PubmedSumm118401 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: multidrug - resistant strains of gram - positive pathogens have evolved which are especially difficult to eradicate . in particular
, the emergence and spread of multidrug - resistant staphylococcus aureus is a serious health concern .
subsequently , there is a continuing need for alternative antibacterial agents , especially with novel mechanisms of action .
the increasing use of methicillin resistant s. aureus screening with rapid diagnostics(3 ) prior to elective hospital admissions means that a selective antistaphylococcal agent would be a useful addition to the clinician s armory .
cell division has been of considerable interest to the pharmaceutical industry as a target because it involves a group of well - conserved proteins that are all essential for the viability of a wide range of bacteria , and their activities are distinct from those of the proteins involved in mammalian cell division .
ftsz is an essential guanosine triphosphatase that undergoes gtp - dependentaaabbreviations : adme , absorption , distribution , metabolism and excretion ; apci , atmospheric pressure chemical ionization ; auc , area under the curve ; bsa , bovine serum albumin ; cfu , colony forming units ; diad , diisopropyl azodicarboxylate ; dmf , dimethylformamide ; dmso , dimethyl sulfoxide ; esi , electrospray ionization ; gtp , guanosine triphosphate ; hplc , high pressure liquid chromatography ; ip , intraperitoneal ; iv , intravenous ; lc , liquid chromatography ; mic , minimal inhibitory concentration ; ms , mass spectrometry ; nmr , nuclear magnetic resonance ; po , per oral ; pk , pharmacokinetics ; rt , retention time ; sar , structureactivity relationship ; sc , subcutaneous ; thf , tetrahydrofuran ; tlc , thin layer chromatography ; uv , ultraviolet .
polymerization at midcell and assembles to form the z - ring . when bacteria divide , ftsz recruits other cell division proteins to synthesize the septum that enables the daughter cells to separate .
ftsz is structurally and functionally homologous to mammalian -tubulin , which has been successfully exploited for cancer therapy .
abbreviations : adme , absorption , distribution , metabolism and excretion ; apci , atmospheric pressure chemical ionization ; auc , area under the curve ; bsa , bovine serum albumin ; cfu , colony forming units ; diad , diisopropyl azodicarboxylate ; dmf , dimethylformamide ; dmso , dimethyl sulfoxide ; esi , electrospray ionization ; gtp , guanosine triphosphate ; hplc , high pressure liquid chromatography ; ip , intraperitoneal ; iv , intravenous ; lc , liquid chromatography ; mic , minimal inhibitory concentration ; ms , mass spectrometry ; nmr , nuclear magnetic resonance ; po , per oral ; pk , pharmacokinetics ; rt , retention time ; sar , structureactivity relationship ; sc , subcutaneous ; thf , tetrahydrofuran ; tlc , thin layer chromatography ; uv , ultraviolet .
many of these reported inhibitors were explored , and 3-methoxybenzamide ( compound 1 ) was found to be the most attractive for development into an antibacterial agent .
recently , we reported the identification of a potent derivative of 1 , pc190723 ( figure 1 , compound 2 ) , that inhibits ftsz , resulting in enlargement of the bacterial cells ( figure 2 ) and killing of staphylococci in vivo.(11 ) design of analogues leading toward 2 .
cells of s. aureus atcc 29213 were cultured ( 3 h ) in the absence ( a ) or presence ( b ) of 2 g / ml of compound 2 and analyzed by electron microscopy .
scale bars = 0.5 m . the early structureactivity relationships ( sar ) leading to the synthesis of potent 2,6-difluoro-3-alkyloxybenzamide ftsz inhibitors from 1 has been published.(12 ) these 2,6-difluoro-3-alkyloxybenzamides are 8000 more potent than 1(12 ) and are excellent reagents to explore bacterial cell biology . to be clinically efficacious , a compound must have appropriate physicochemical properties(13 ) so that it is absorbed , distributed , and not extensively metabolized or rapidly excreted .
the 2,6-difluoro-3-alkyloxybenzamides have suboptimal drug - like absorption , distribution , metabolism , or excretion ( adme ) properties , so the objective was to improve the pharmaceutical profile of these ftsz inhibitors while retaining the on - target antistaphylococcal activity to create molecules suitable for preclinical development .
the sar and the process used to create 2 , a compound with attractive in vivo pharmacology , from the 2,6-difluoro-3-alkyloxybenzamide ftsz inhibitors that have antibacterial activity , but suboptimal drug - like properties , are described here .
the routes to the target 3-substituted 2,6-difluoro - benzamide analogues are concise , straightforward , and are described below .
the commercially available 2,6-difluoro-3-methoxybenzamide ( 3 ) was demethylated to the phenol ( 4 ) via treatment with boron tribromide in dichloromethane .
the synthesis of most final compounds was achieved via alkylation of 4 with an alkyl halide in the presence of potassium carbonate with dimethylformamide as solvent ( schemes 1 and 2 ) . in the case of compounds 6j and 6k , the alkylation of 4 with the corresponding alcohols was performed under mitsunobu reaction conditions , using triphenyl phosphine and diisopropyl azodicarboxylate ( diad ) in tetrahydrofuran ( thf ) ( scheme 2 ) .
reagents and conditions : ( i ) demethylation : bbr3 , ch2cl2 ; ( ii ) alkylation of phenol using alkyl halides ; ( iii ) alkylation of phenol via mitsunobu reaction . reagents : ( ii ) k2co3 , dmf ; ( iii ) triphenylphosphine , diisopropyl azodicarboxylate , triethylamine , thf .
a subseries based on the 5-substituted benzothiazol-2-yl methoxy group was accessed by alkylation with a wide range of 5-substituted-2-halomethyl - benzothiazoles ( scheme 3 ) .
reagents : ( i ) bbr3 , ch2cl2 ; ( ii ) k2co3 , dmf ; ( iv ) sncl22h2o , etoh , reflux ; ( v ) allyltributyltin , tetrakis(triphenylphosphine)palladium(0 ) , dmf ; ( vi ) pdc , meoh ; ( vii ) bispinacolatodiboron , koac , pd2(dba)3 , tricyclohexylphosphine , 1,4-dioxane ; ( viii ) 2-iodoimidazole , dichlorobis(triphenylphosphine)palladium(ii ) , k3po4 , dmf - h2o , 120 c .
( ix ) lioh , thf - h2o , reflux ; ( x ) socl2 , toluene , reflux ; ( xi ) acetamide oxime , k2co3 , toluene , reflux ; ( xii ) nh3 ( gas ) , thf .
similarly , a small series of substituted thiazolopyridines was accessed by alkylation with substituted halomethyl - thiazolopyridines and subsequent standard modification ( scheme 6 ) .
for the isomeric 4- and 6-substituted subseries of benzothiazoles , a different approach was used if the suitably substituted 2-halomethyl - benzothiazole was not available .
3-(cyanomethoxy)-2,6-difluorobenzamide ( 19 ) was prepared via alkylation of 4 with chloroacetonitrile and served as a common intermediate for the synthesis of compounds 22ae ( scheme 4 ) . the 2-amino-1,3-benzothiazoles ( 20ae )
were converted to the required amino thiols ( 21ae ) by refluxing with koh in aqueous 2-methoxyethanol .
these in turn were condensed with 19 in etoh at 120150 c to afford the desired 4- , 6- and 7-substituted benzothiazoles 22ae .
reagents : ( ii ) chloroacetonitrile , k2co3 , dmf ; ( xiii ) 10 n koh in 2-methoxyethanol or 10 n naoh , reflux ; ( xiv ) etoh at 120150 c .
the biological activities of the compounds were determined by measuring the minimal inhibitory concentrations ( mics ) against s. aureus atcc 29213 and by morphometric analysis using light microscopy to determine on - target activity , expressed by ballooning of the cocci . in line with clsi approved standards ,
the reproducibility of the mic test is within one 2-fold dilution of the actual end point.(16 ) on - target activity was substantiated for selected compounds by generating compound - resistant strains ; in all cases , a mutation was identified in the ftsz gene ( data not shown ) . selected compounds with a suitable level of on - target activity were screened through a panel of assays to determine their in vitro adme properties .
compounds with drug - like in vitro adme profiles were then characterized in vivo . to improve the pharmaceutical properties of the 2,6-difluoro-3-alkyloxybenzamide ftsz inhibitors , a series of molecules where the alkyl substituent was replaced with a heterocycle , were synthesized ( scheme 2 ) .
approximately 60 of this type of molecule were synthesized from commercial building blocks where the molecular weight of r was in the 100200 da range . replacing the alkyl substituent with such heterocycles
was designed to reduce the log p , the number of rotatable bonds , and the plasma protein binding of the molecule as well as to introduce the potential for additional hydrogen bonding to the ftsz protein .
the antibacterial activity against s. aureus and inhibition of cell division for a selection of this series of 3-substituted 2,6-difluorobenzamides ( compounds 6ak ) is presented in table 1 .
several methoxy - linked heterocyclic derivatives demonstrated potent antistaphylococcal activity mediated through inhibition of cell division .
the most potent of these , a benzothiazole compound 6 g , was selected for additional exploration of the sar .
analogues with substitutions in each of the available positions of the benzothiazole were prepared ( schemes 3 , 4 , 5 ) .
lowest concentration at which ballooning of s. aureus is observed indicating on - target activity .
enlarged cells , but not balloons as seen with more potent compounds , were observed at 20484096 g / ml .
reagents : ( ii ) k2co3 , dmf ; ( xv ) 24c , pdc , nh3 ( aq ) , meoh .
this series of substituted benzothiazoles were tested for inhibition of cell division and antibacterial activity against s. aureus ( table 2 ) .
the presence of a chloro substitution in the 4- , 6- , or 7-position of the benzothiazole ( compounds 22a , 22b , and 24e ) resulted in active compounds but with reduced antibacterial activity and potency in the cell division assay . similarly , 4- and
5-methyl as well as 4-methoxy substitutions of the benzothiazole ( compounds 22c , 8f , and 25 ) resulted in less potent but active analogues .
one compound , with a 5-methoxy substitution ( 8h ) , retained similar activity to the unsubstituted benzothiazole . from this set of substituted benzothiazoles ,
two analogues , with 5-chloro or 5-phenyl substitutions , were found to have improved on target antibacterial activity ( 8j and 8a ) with mics of 0.25 g / ml . lowest concentration at which ballooning of s. aureus is observed indicating on - target activity .
because improved activity was observed for the 5-chloro and 5-phenyl derivatives , further substitutions in the 5-position of the benzothiazole were explored next .
in contrast to polar substitutions , hydrophobic substitutions at the 5-position resulted in improved on - target activity compared to the unsubstituted benzothiazole . derivatives with 5-propyl 11 , 5-ethoxy 8b , 5-bromo 8d , and 5-trifluoromethyl
similarly , methyl ester ( 8i ) and 1,2,4-oxadiazol-5-yl ( 17 ) substitutions resulted in improved on - target activity .
lowest concentration at which ballooning of s. aureus is observed indicating on - target activity .
the design of molecules was largely driven by traditional sar - directed medicinal chemistry processes ; however , the availability of ftsz crystal structures enabled the use of structure - informed optimization of the ligands .
a cleft between helix 7 and the c - terminal domain of ftsz(15 ) was identified as a potential binding site for this series of inhibitors ( figure 3).(11 ) the experimental findings described herein are consistent with the proposed binding model with a preference for hydrophobic substitutions and all of the active compounds docked convincingly into the hydrophobic channel present in the s. aureus ftsz protein .
the model was not used to design molecules per se , however it was used as a tool to prioritise the synthesis of compounds that docked well into the binding site .
close up view showing the nucleotide substrate bound into the nucleotide - binding site ( right ) and 2 docked into a cleft ( left ) analogous to the taxol - binding site of tubulin adjacent to helix 7 ( red ) . in this model , hydrogen bonds are formed between the phenoxy ether of 2 and r191 and q192 ( dashed yellow lines ) . because of the hydrophobic nature of the molecules , the protein binding was of concern and the effect of protein on the antibacterial activity was tracked by adding protein ( 50% v / v serum or 2% w / v bovine serum albumin ( bsa ) ) to the mic assays .
the alkyloxy compounds , such as 6a , were particularly sensitive to the presence of added protein with serum or bsa inducing large fold increases in the mics .
the majority of compounds described herein were less sensitive to added protein , with serum or bsa inducing more modest shifts in the mics ( tables 1 and 4 ) . nonetheless , the most active benzothiazole derivatives were still highly bound to protein with plasma protein binding values of > 95% being observed using an equilibrium dialysis assay ( table 4 ) .
because hydrophobic substituents appear to be preferred from an activity perspective ( table 3 ) , attempts were made to reduce protein binding by lowering the logp without introducing polar groups .
as such , a set of thiazolopyridine analogues were synthesized ( scheme 6 ) . the antibacterial activity and plasma protein binding were determined for these analogues ( table 4 ) .
reagents : ( ii ) k2co3 , dmf ; ( xvi ) 28a , phenylboronic acid , dichlorobis(triphenylphosphine)palladium(ii ) , k3po4 , dmf - h2o , 110 c ; ( xvii ) 28b , 2,4,6-trifluoro-3-methoxyphenyl boronic acid , k3po4 , dichlorobis(triphenylphosphine)palladium(ii ) , dmf - h2o .
the thiazolopyridine ( 28c ) where z = n was 32-fold less active than the benzothiazole ( 8j ) , however where z = n ( 2 , 30 , and 29 ) , the antibacterial activity was equivalent or only 24-fold less potent than the corresponding benzothiazole .
furthermore , the plasma protein binding of the thiazolopyridines was lower for the chloro ( 2 ) and ethoxy ( 29 ) derivatives .
the in vitro adme properties were determined for molecules where the potency and protein binding were suitable for progression .
the upper portion of table 5 summarizes the results of a set of in vitro screens used to evaluate the drug - like properties of compound 2 with compound 8j shown for comparison .
compound 2 did not inhibit any of the cytochrome p450 isozymes tested , nor did it inhibit the herg ion channel at the concentrations tested .
the chemical and plasma stabilities of compound 2 were good , and the clearances in microsomes and hepatocytes were low , suggesting that it should not be rapidly metabolized in vivo .
the permeability of compound 2 in caco-2 cells was good with a low efflux ratio , indicating that compound 2 should not be a substrate of drug transporters such as p - glycoprotein and should be orally bioavailable .
compound 8j had a similar adme profile to compound 2 , with increased plasma protein binding and increased clearance in hepatocytes being the notable exceptions .
table 5 and figure 4 illustrate the pharmacokinetic properties of compound 2 , with 8j shown for comparison .
the clearance ( cl ) of compound 2 following intravenous administration in the mouse was low , with a long terminal half - life ( t1/2 ) resulting in a good area under the curve ( auc ) .
in contrast , the corresponding benzothiazole ( compound 8j ) was rapidly cleared both in hepatocytes and in the mouse .
pharmacokinetic profile of compounds 2 ( solid lines ) and 8j ( dotted line ) . compound 2 was dosed intravenously ( black line ) and orally ( gray line ) at 3 mg / kg individually and compound 8j at 2 mg / kg in a cassette .
plasma concentrations were measured over an 8 h period with samples taken after 5 , 15 , 30 , 60 , 120 , 240 , and 480 min . both compounds 2 and 8j
compound 2 was efficacious following a single administration : intraperitoneal ( ip ) ed50 < 3 mg / kg , subcutaneous ( sc ) ed50 = 7 mg / kg , and intravenous ( iv ) ed50 = 10 mg / kg.(11 ) while compound 8j was efficacious when administered ip ( ed50 = 41 mg / kg ) , it was not when administered sc ( ed50 > 30 mg / kg ) .
although the bioavailability of compound 2 was good , no efficacy was observed following a single oral administration of 30 mg / kg ( data not shown ) .
( a , c ) compound 8j , ( b , d ) compound 2 . ( a , b ) subcutaneous ( sc ) administration , ( c , d ) intraperitoneal ( ip ) administration .
solid lines = 30 mg / kg , dashed lines = 10 mg / kg , dotted lines = 3 mg / kg .
all mice treated with vehicle alone died on day 2 . all mice treated sc with 3 , 10 , or 30 mg / kg of compound 8j died on day 2 ( a ) .
all mice treated ip with 3 , 10 , or 30 mg / kg of compound 2 survived ( d ) . therefore the modest reduction in potency of the thiazolopyridine compared to the benzothiazole is more than offset by reducing protein binding and metabolism , resulting in a drug - like pharmacokinetic profile and efficacy in the murine model of staphylococcal infection .
a series of 3-substituted benzamides as inhibitors of ftsz , which demonstrate potent antistaphylococcal activity by inhibiting cell division , has been synthesized and the sar has been determined .
replacement of a 3-alkyloxy substituent with a variety of heteroarylmethoxy substituents resulted in drug - like compounds with on - target antibacterial activity .
the most potent of these substitutions was 1,3-benzothiazol-2-ylmethoxy , so the focus was to optimize the benzothiazole by further substitution around the phenyl ring .
substitutions such as chloro , phenyl , or ethyloxy in the 5-position of the benzothiazole resulted in an 8- to 16-fold improvement in the on - target activity , with mics as low as 0.125 g / ml against s. aureus .
although these 5-substituted-1,3-benzothiazol-2-ylmethoxy compounds were more drug - like than the 3-alkyloxy derivatives described above , their protein binding , at > 95% bound to plasma , was considered too high to progress . replacing the benzothiazole substituent with
furthermore , the metabolic stability of the thiazolopyridine was improved compared to the benzothiazole , resulting in an approximately 15-fold reduction in clearance following intravenous administration in the mouse .
the balance of antibacterial activity , plasma protein binding , and metabolic stability of compound 2 resulted in the compound being tested in the mouse model of staphylococcal infection .
compound 2 was efficacious in an in vivo model of infection , protecting mice infected with a lethal dose of s. aureus .
the data validate ftsz as a target for antibacterial intervention and demonstrate that the series is suitable for optimization into a new antistaphylococcal therapy .
s. aureus atcc 29213 was obtained from lgc promochem ( teddington , uk ) and was propagated according to standard microbiological practice .
mics were determined by the broth microdilution method according to the recommendations of the clinical and laboratory standards institute.(16 ) cell division phenotype assays were performed as described previously.(17 ) the cytochrome p450 assay measured the metabolism of fluorogenic substrates by human recombinant enzymes supplied by invitrogen .
plasma protein binding was assessed by equilibrium dialysis of a 10 m solution using the pierce red devices .
plasma stability of a 10 m solution was determined by lc / ms after 24 h at 37 c .
microsomal stability of a 10 m solution was determined over a time course by measuring the remaining parent compound using lc / ms .
permeability assays , performed at cyprotex ltd . , used lc / ms / ms to determine bidirectional transport across caco-2 monolayers . chemical stability of a 10 m solution in phosphate buffered saline was determined by lc / ms after 24 h at 37 c
, was determined over a time course by measuring the remaining parent compound using lc / ms / ms .
parameters were calculated using winnonlin from the plasma concentrations determined by lc / ms / ms over an 8 h time course following intravenous or oral administration of the compounds in mice .
mice were inoculated ip with an ld90100 of s. aureus ( smith ) ( 5 10 cfu / mouse for sc study and 4 10 cfu / mouse for ip study ) in 0.5 ml of brain heart infusion broth containing 5% mucin .
docking of ligands to the putative binding site on bacillus subtilis ftsz described previously(11 ) was completed using benchware 3d explorer software ( tripos l.p . ) .
compounds were visualized by uv light and/or stained with either i2 or potassium permanganate solution followed by heating .
h nmr spectra were recorded on either a jeol gsx-400 mhz or on a bruker avance 400 mhz spectrometer with a broad band observe ( bbo ) and broad band fluorine observe ( bbfo ) probe .
chemical shifts ( ) are expressed in parts per million ( ppm ) downfield by reference to tetramethylsilane as the internal standard .
splitting patterns are designated as s ( singlet ) , d ( doublet ) , t ( triplet ) , q ( quartet ) , m ( multiplet ) , br s ( broad singlet ) , app ( apparent ) .
lc - ms analyses were performed on either an acquity c-18 column ( 2.10 mm 100 mm , 1.70 m ) using the electrospray ionization ( esi ) technique or on a gemini c-18 column ( 4.6 mm 50 mm , 5 m ) using the atmospheric pressure chemical ionization ( apci ) technique .
the purity of all tested compounds was determined by analytical hplc and hplc - ms analyses and was greater than 95% , unless otherwise stated .
method 1 consisted of the following : discovery hsc-18 column 4.60 mm 250 mm , 5 m .
mobile phase ; a , acetonitrile with 0.10% formic acid ; b , h2o with 0.10% formic acid ; gradient , 10% a to 90% a in 15 min with 30 min run time and a flow rate of 1 ml / min .
method 2 consisted of the following : purospher star c-18 column 4.60 mm 250 mm , 5 m .
mobile phase ; a , acetonitrile with 0.10% formic acid ; b , h2o with 0.10% formic acid ; gradient , 10% a to 90% a in 15 min with 30 min run time and a flow rate of 1 ml / min .
method 3 consisted of the following : xbridge c-18 column 4.60 mm 250 mm , 5 m .
mobile phase ; a , acetonitrile with 0.10% formic acid ; b , h2o with 0.10% formic acid ; gradient , 10% a to 90% a in 15 min with 30 min run time and a flow rate of 1 ml / min .
method 4 consisted of the following : acquity beh c-18 column 2.10 mm 100 mm , 1.70 m . mobile phase ; a , acetonitrile with 0.10% formic acid ; b , h2o with 0.10% formic acid ; gradient , 10% a to 90% a in 6 min with 10 min run time and a flow rate of 1 ml / min .
method 5 consisted of the following : gemini c-18 column 4.6 mm 50 mm , 5 m . mobile phase : 2090% ch3cn:10 mm aqueous ammonium acetate , over 4 min , isocratic for 1 min , 20% ch3cn:10 mm aqueous ammonium acetate for 2 min , flow rate = 1 ml / min at 40 c .
melting points were measured using a stuart scientific smp10 or a buchi b545 apparatus and are uncorrected .
experimental and spectroscopic details of compounds not described herein and synthetic schemes and experimental details of the intermediates used to make all compounds are presented in the supporting information .
boron tribromide solution ( 1 m in ch2cl2 , 8.55 ml , 8.55 mmol , 2 equiv ) was added dropwise to a stirred suspension of 2,6-difluoro-3-methoxybenzamide ( 3 ) ( 800 mg , 4.3 mmol ) in ch2cl2 ( 20 ml ) , at room temperature , under n2 atmosphere .
the reaction mixture was stirred at room temperature for 48 h. the solvent was removed under reduced pressure , and the residue was taken up in water ( 50 ml ) and extracted with etoac ( 3 40 ml ) .
the combined organic extracts were washed with water ( 2 40 ml ) , dried ( na2so4 ) , and filtered through a pad of silica . the filtrate was evaporated to dryness under reduced pressure , to give 4 as a light - brown solid ( 580 mg , 78% ) .
h nmr ( dmso - d6 ) : 6.906.95 ( m , 2h ) , 7.73 ( br s , 1h ) , 8.03 ( br s , 1h ) , 9.89 ( br s , 1h ) . to an ice - cold solution of 2,5-dichloropyridin-3-amine ( 31 ) ( 2.50 g , 15.33 mmol ) in ch2cl2 ( 50 ml )
was added triethylamine ( 3.17 ml , 23 mmol , 1.5 equiv ) followed by the addition of a solution of 2-(benzyloxy)acetyl chloride ( 4.20 g , 23 mmol , 1.5 equiv ) in ch2cl2 ( 50 ml ) .
the resulting mixture was stirred at room temperature for 2 h. the solvent was removed under reduced pressure , and the residue was taken up in water ( 100 ml ) and extracted with etoac ( 3 100 ml ) .
the combined organic extracts were washed with brine , dried ( na2so4 ) , filtered , and concentrated under reduced pressure .
the residue was purified over silica eluting with 5% etoachexane to obtain the title compound 32 ( 2.20 g , 46% ) .
to a solution of 32 ( 2.20 g , 7.07 mmol ) in toluene ( 50 ml ) was added lawesson s reagent ( 2.84 g , 7.07 mmol , 1 equiv ) , and the resulting reaction mixture was refluxed for 45 h. the solvent was evaporated and the residue was purified over silica eluting with 3% etoachexane to obtain the title compound 33 ( 1.75 g , 85% ) .
a solution of 33 ( 2 g , 6.87 mmol ) in ch2cl2 ( 100 ml ) was cooled to 78 c followed by dropwise addition of bbr3 ( 3.30 ml , 34.39 mmol , 5 equiv ) .
the mixture was stirred at room temperature for 3 h then was cooled again to 78 c and quenched by dropwise addition of water followed by extraction with etoac ( 3 100 ml ) .
the combined organic extracts were washed with saturated nahco3 solution , dried ( na2so4 ) , filtered , and concentrated under reduced pressure .
the residue was purified over silica eluting with 2% etoachexane to obtain the title compound 26 ( 1.50 g , 88% ) .
h nmr ( dmso - d6 ) : 5.16 ( s , 2h ) , 8.67 ( d , j = 2.4 hz , 1h ) , 8.73 ( d , j = 2.4 hz , 1h ) . ms ( esi ) m / z : 262.90 [ m + h ] . reagents and conditions : ( i ) bbr3 , ch2cl2 ; ( xviii ) 2-(benzyloxy)acetyl chloride , et3n , ch2cl2 ; ( xix ) lawesson s reagent , toluene , reflux . k2co3 ( 1.53.5 equiv ) and nai ( 0.2 equiv ) were added to a solution of 4 in dmf ( 38 ml per mmol ) .
the resulting suspension was stirred for 5 min at room temperature before the corresponding halide ( 1.01.1 equiv ) was added .
the reaction mixture was stirred at 2060 c for 318 h , under n2 atmosphere .
after cooling to room temperature , one of two workup procedures was followed . in some cases , the reaction mixture was poured into water ( 15 ml per mmol ) , and the precipitant solid was filtered , washed with water , and dried to give the crude product . in other cases , the reaction mixture was partitioned between etoac ( 30 ml per mmol ) and water ( 20 ml per mmol ) , the organic phase was separated , washed with water ( 2 15 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo to give the crude solid .
compound 2 was prepared from 4 ( 590 mg , 3.41 mmol ) and 26 ( 900 mg , 3.41 mmol , 1 equiv ) using 3.5 equiv of k2co3 , according to the general procedure ( 20 c , 3 h , etoac / h2o workup ) .
the residue was purified over silica eluting with 60% etoachexane to obtain the title compound 2 ( 940 mg , 78% ) , mp 218 c .
h nmr ( dmso - d6 ) : 5.72 ( s , 2h ) , 7.12 ( m , 1h ) , 7.40 ( m , 1h ) , 7.89 ( br s , 1h ) , 8.17 ( br s , 1h ) , 8.68 ( d , j = 2.4 hz , 1h ) , 8.73 ( d , j = 2.4 hz , 1h ) .
ms ( esi ) m / z 356.27 [ m + h ] . hplc ( method 3 ) rt = 15.40 min .
compound 19 was prepared from 4 ( 1 g , 5.8 mmol ) and chloroacetonitrile ( 0.40 ml , 6.4 mmol , 1.1 equiv ) using 1.5 equiv k2co3 , according to the general procedure ( 60 c , overnight , etoac / h2o workup ) .
the crude product was triturated with diethyl ether ( 30 ml ) , filtered , and dried in vacuo to give 19 as a gray solid ( 1.06 g , 86% ) ; mp 122123 c .
h nmr ( dmso - d6 ) : 5.26 ( s , 2h ) , 7.18 ( app dt , j = 9.0 , 1.8 hz , 1h ) , 7.40 ( m , 1h ) , 7.86 ( br s , 1h ) , 8.14 ( br s , 1h ) .
hplc - ms ( apci ) m / z 213 [ m + h ] , ( method 5 ) rt = 1.97 min .
general procedure for the synthesis of substituted benzothiazole derivatives from 3-cyanomethoxy-2,6-difluoro - benzamide ( 19 ) and substituted 1,3-benzothiazol-2-amines .
a solution of koh ( 20 equiv ) in water ( 25 ml ) was added to a solution of the substituted 1,3-benzothiazol-2-amine in 2-methoxy - ethanol ( 25 ml ) , and the reaction mixture was heated to reflux overnight . after cooling at room temperature ,
the mixture was diluted with water ( 200 ml ) , acidified with 5n hcl solution to ph 4 , and extracted with ch2cl2 ( 3 150 ml ) .
the combined organic extracts were washed with brine ( 100 ml ) , dried ( na2so4 ) , and concentrated under reduced pressure to dryness , to give crude substituted 2-aminobenzenethiol .
a portion of this material ( 1.5 equiv ) were mixed with 19 ( 150 mg , 0.7 mmol ) , and the mixture was stirred at 120 c , in a preheated oil bath , under n2 , for 2 h. etoh ( 2 ml ) was added and the reaction mixture was heated at 120 c for a further 2 h. the products either precipitated from the reaction mixture on cooling or the reaction mixtures were evaporated and the crude products purified by trituration of the residue .
Output:
| 3-methoxybenzamide ( 1 ) is a weak inhibitor of the essential bacterial cell division protein ftsz .
alkyl derivatives of 1 are potent antistaphylococcal compounds with suboptimal drug - like properties .
exploration of the structureactivity relationships of analogues of these inhibitors led to the identification of potent antistaphylococcal compounds with improved pharmaceutical properties . |
PubmedSumm118402 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the masticatory function is acquired by eating experiences and is especially influenced by the consistencies of food . the maximum bite force ( mbf ) , based on masticatory function and related to individual anthropometric characteristics such as sex and age , has been discussed in the literature.1
2 the mbf varies according to gender , general physical structure ( height and weight ) , condition of teeth , facial morphology , and also age.2
3 there are some contradictions in the literature on the real relationship between these variables.4
5
6
7
the masticatory process consists of cutting , grinding , and spraying steps .
this process reduces the particle size at different levels and angles of the dental arch , which promotes its correct function . during the process of human development , nutrition and food consistencies are modified as height grows and teeth erupt .
thus , a liquid diet gradually becomes firmer , which is necessary for proper swallowing and provides increased facial muscle tone and helps with speech.8
9
it is known that the peaks of mbf occur after the third molar that is around 6 years of age.10 upon completion of the permanent dentition and hormonal stability , mbf decreases and stabilizes .
it is also expected that in the phase defined as senility ( above 60 years),10 the mbf is affected by the aging process because of bone and muscle degeneration.8
9
few studies relate the mbf and age , and there is a lack of consensus in the literature on this topic and its relevance to orofacial motor function in relation to diagnosis , prognosis , and therapy of changes in mastication .
therefore , the aim of this study was to analyze the mbf , according to different age groups , gender , and body mass index ( bmi ) .
the study was approved by the ethics committee of universidade federal de so paulo , n.1508/11 and was funded by the foundation for research support of the state of so paulo
the experimental sample consisted of 100 individuals from the city of so paulo , equally divided between gender and age groups ( table 1 ) . all participants and , in some cases , those responsible for minors , signed a term and statement of consent form .
the inclusion criteria of the sample were as follows : be at least 11 years old for female participants and at least 12 years for male participants , with a maximum age restriction was 60 years , and have complete permanent dentition and absence of dental mutilation , regardless of the type of dental occlusion .
individuals of age groups described on the above classification.10
the exclusion criteria of the sample were as follows : the age groups described in the literature as infancy , because it involves individuals with incomplete deciduous or mixed dentition , and senility age , involving individuals without teeth , in most cases not fitting one of certain basic criteria for sample .
also considered ineligible were individuals with any kind of syndrome , degenerative diseases , mental deficiencies , malformation , changes of the temporomandibular articulation , open and cross - bite , myofunctional changes of masticatory muscles , and dental implants .
each participant underwent a speech evaluation that consisted of anamnesis , anthropometric measurements , assessment of dental conditions , and measurement of the mbf .
the anamnesis consisted of personal information such as name , date of birth , age , gender , address , and personal e - mail .
anthropometric measurements were performed with a tape measure , measuring the height ( in centimeters ) and a digital weighing scale , in kilograms ( magna , g - life , so paulo ) . from these measurements ,
bmi was determined by the formula bmi = weight ( kg)/height ( m ) .
subsequently , dental conditions were assessed and also the dental composition was examined through clinical observation to ensure the presence or absence of dental mutilation and orthodontic treatment .
this stage of evaluation was performed by a specialist in orthodontics , to ensure data reliability .
bite force was assessed by measuring the maximum force of bites , using a digital dynamometer model ddk / m ( kratos , so paulo , brazil ) .
this device was developed to determine the amount of force applied by an individual at the time of a bite .
the scale used is kilogram force ( kgf ) , newtons ( n ) or pound force ( lbf ) , with an adjustment knob to zero , and peak results are recorded on a digital screen , which allows measurement of the maximum force applied ( maximum capacity of 100 kgf , adapted to oral conditions ) .
each participant performed three bites on each side ( right and left ) , alternately , and the arithmetic means of all measurements were calculated .
the measurement process was performed in the orofacial miotherapy clinic of universidade federal de so paulo , located in so paulo . during the assessments ,
the participant was asked to stand up and was instructed to keep the legs slightly open to ensure the body balance .
the instructions were detailed during the proceedings , and before the actual measurements were started , the participants were instructed to bite ( equipment testing performed twice ) to ensure measurement reliability . to measure the mbf , the device was alternately placed on the first molars and on both sides of the dental arch .
participants were instructed to bite as hard as they could . then , three measurements on each side were made with an interval of 2 minutes .
the mbf was recorded in newtons and measured as the peak force shown on the device screen .
the dynamometer was cleaned with 70% alcohol and protected with disposable latex finger cots , positioned on the bite device between each process .
spss software , version 12 ( spss inc . , quarry bay , hk ) was used and the test was set up to analyze the mbf as the dependent variable and with age and gender as random factors and bmi as a control variable .
data analysis revealed that f - values were to low to reject the null hypothesis ( fimc = 1.252 , p > 0.10 ; fgroup = 1.305 , p > 0.10 ; fsex = 0.450 , p > 0.10 ; fgroupsex = 1,721 , p > 0.10 ) .
this means that the measures of mbf in between mbi , age and sex groups varied equally in large scale . causing a non - rejection of the null hypothesis : the average values of mbf according to the measures listed above varied largely , but in the same proportion , in all groups of analysis ( table 2 ) .
the differences were not statistically significant between the values of mbf and age groups , even without the age gender interaction .
after calculating the bmi , no significant relationship was found in the variables of height and weight with the mbf .
abbreviations : df , degrees of freedom ; imc , bmi , body mass index ; group * sex , interaction between the two variables .
the mean values showed a nonlinear variation , especially in female participants , for whom the values became smaller between 11 and 17 years , and then rose again with another valley in early adulthood , 25 years of age ( fig .
maximum bite force curve , in newtons , according to age groups.10 abbreviations : pre , prepubescent ; pub , pubescent ; post , postpubscent ; young , young adult ; adult , adult age group .
male participants had higher values for mbf compared with girls in the pubescent period . bite force also declined between 12 and 19 years of age .
however , it appeared to be lower than that of women aged 20 years old .
this difference decreases from the age of 25 , since the force for the male participants increases less abruptly , as shown in table 3 , approaching the average for female participants .
after independent analysis of the age variable , the average bite force of male participants was greater than that of female participants , with a difference of 31.01 n ( male : 285.01
although men had a bite force 12.21% higher than women , the difference was not statistically significant ( p > 0.05 ) .
mbf is an objective and quantitative measure for evaluating masticatory performance , which verifies the effectiveness of incising , crushing , and pulverizing food by the number of functional teeth.11
fig .
1 shows the mbf curve in newtons according to age groups.10 it is possible that younger children ( prepubescent age group ) faithfully followed the instructions for measuring strength .
however , it is possible to infer that children from the puberty group had toothaches or concern with muscle pain , tooth damage , or seizure and that is why this group had higher results than expected for their age .
research indicates that the measurement of mbf depends on the motivation and cooperation of individuals , emphasizing that these concerns can occur with some participants , as well as other concerns not noted in this study , such as temporomandibular joint structures and support pain and limitation of strength for pain reflex mechanisms.1
table 3 shows that there was an increase in mbf according to age . in the literature ,
the increase in mbf occurs in individuals between 15 and 18 years of age.4 also in table 3 , the average bite force for men was 12.21% higher than that of women , with a difference of 31.01 n between them .
although the results showed no statistically significant difference between the variables , there may be a greater tendency with a larger sample . in the literature , there are significant differences in mbf between men and women.1
2
6 a survey revealed that the bite force of men is usually 30% higher when compared with women.12
one study looked at the average curve between genders and stated that there is a variation of mbf according to age .
however , other studies have analyzed that mbf is not determined by age , but gender has been a highly correlated variable.5
6 one possible explanation for the fact that women had higher measures than men in adulthood is that the variation of responses are higher than age .
table 3 shows that the standard deviations for these groups is higher , which means that the values varied widely . in some studies , authors did not use a validated age classification.10 many studies do not use the same equipment for measuring bite force as used in this study.2
3
4
6
7
13
14
15 some studies reported that age , gender and height2
16 are not sufficient to determine mbf , as observed in this study .
table 3 shows that mbf increased until age 20 , stabilized up to 40 or 50 years of age , and then a reduction occurred.1 as observed in this study , female participants aged over 25 years showed decreased mbf .
some studies reported that mbf decrease with increasing age may occur mainly due to tooth decay7 and reduced androgenic hormones,2 which decreases in both sexes around 35 years of age .
in women , this decrease is more notable because they begin with a much lower rate of hormone than men , and so their strength reduces more quickly .
the hormonal factor was not controlled in this study , suggesting further investigation on the variable in question .
there was no consensus among the national and international literature on the importance of age as a determinant of mbf , as showed above .
there are reports that mbf decreases in women after 25 years of age and in men over 45 years of age.1
6 it was not possible to precisely compare the age classification used in this study ( 25 to 60 years old ) with other studies .
significant relationships were observed with bmi and mbf as a trend , as found in the literature ( table 2 ) , but one difference might be in the size of the sample .
some studies showed a nonexistent relationship between mbf and body measurements.13
14
15 researchers studied normal subjects with permanent dentition and concluded that there is relationship between mbf and age as well as height and weight,6 and the present study found a trend ( table 2 ) .
a study of children and adolescents reported that masticatory performance increases with age17 ; another study reported that in adolescents and adults , age does not influence masticatory performance.11 additionally , dentition is indirectly related to the mbf,11
17 which indicates that the force is determined by the development .
so even with weak or no correlations between mbf and age , this study , along with the literature described , indicate that growth and development can cause changes in mbf .
this study has limitations , such as sample size , which affected the determination of the correlation between mbf and age groups as well as the influence of bmi and gender .
future research is proposed to determine other variables that can directly interfere with the results , such as ethnic factor indirectly related to facial morphology , hormone levels associated with pregnancy , testosterone levels , tooth decay , and masticatory preference side .
in this study , it was concluded that the mbf varies qualitatively along the human development process ; there is an important increase in bite force in women until adulthood , which then decreases in adulthood ( 25 years ) . for men ,
Output:
| introduction maximum bite force ( mbf ) is the maximum force performed by the subject on the fragmentation of food , directly related with the mastication and determined by many factors .
objective analyze the mbf of subjects according to age groups .
methods one hundred individuals from the city of so paulo were equally divided according to age groups and gender .
each individual submitted to a myotherapy evaluation composed of anthropometric measurements of height and weight to obtain body mass index ( bmi ) , using a tape and a digital scale ( magna , g - life , so paulo ) , and a dental condition and maximum bite force evaluation , using a digital dynamometer model ddk / m ( kratos , so paulo , brazil ) , on newton scale .
the dental and bite force evaluations were monitored by a professional from the area .
analysis of variance was used with mbf as a dependent variable , age group and gender as random factors , and bmi as a control variable .
results till the end of adolescence , it was possible to observe a decrease in mbf in both sexes , with the male force greater than the female force . in young adults ,
the female force became greater the males , then decreased in adulthood .
there was no correlation between mbf and bmi .
conclusion there are mbf variations that characterizes the human development stages , according to age groups . |
PubmedSumm118403 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the alkene ring - closing metathesis ( rcm ) reaction has enabled many complex and important molecules to be constructed in new ways .
the popularity of the rcm reaction has been driven by the commercial availability of highly active and stable ruthenium precatalysts such as 13 .
industry has seized upon the potential of the technology , and reactions have now progressed from the realm of the discovery chemist into chemical development and scale - up .
the boehringer - ingelheim group have prepared biln 2061 4 on a multikilogram scale using rcm of diene 5 to form 15-membered macrocycle 6 as a key step ( scheme 1 ) . during the course of the campaign ,
extensive optimization studies involving changes of solvent , precatalyst and substrate structure were carried out , and cyclization efficiency was quantified using the method described by ercolani et al . ;
plotting the concentration of cyclic product squared versus the concentration of cyclic dimer yields a linear plot with slope ( emproduct)/(emdimer ) ( eq 1 ) , which can be used to compare different reaction conditions quantitatively.1 the study showed that the quantification of reaction outcomes required some care , as the process of product isolation can change the reaction yield unless all the metathesis - active species are quenched before samples are concentrated . the increasing concentration during solvent removal can result in secondary metathesis events that may be complex in nature and demonstrates the difficulty involved in using reaction yields from the synthetic chemistry literature to draw firm conclusions about the interplay between structure and reactivity . we have used h nmr , a less invasive method , to quantify the outcomes of small - scale metathesis reactions of simple ,-dienes and to follow the course of their rcm reactions in kinetic studies .
we have also modeled the potential energy surfaces for these reactions in some detail using the m06-l functional .
it should be possible to interpret the concentration / time data obtained from kinetic experiments using a combination of computational insights and quantitative data obtained from fundamental studies of precatalyst systems .
an appropriate kinetic model that takes account of precatalyst initiation and active catalyst decomposition would allow the interpretation of this concentration / time data ( which very rarely correspond to a simple kinetic order ) and comparisons between different reaction solvents and precatalyst systems .
the 2008 study published by adjiman , taylor and co - workers was therefore of great interest .
the study applied a very simple kinetic model to the cyclization of diethyl diallylmalonate 7 to form product 8 ( using grubbs second generation precatalyst 1 ) and promoted acetic acid as an unexpectedly effective solvent for rcm reactions on the basis of the findings ; the model took account of precatalyst initiation and active catalyst decomposition explicitly ( scheme 2 , l = h2imes ) .
the model comprises reversible initiation of 1 to form 14e benzylidene 9 , reversible rcm of 7 to form 8 and irreversible decomposition of two molecules of 9 to form 10 .
numerical integration software was used to analyze and simulate concentration / time data from reactions that were carried out under reaction conditions similar to those used for the majority of target synthesis projects .
the meticulous exclusion of oxygen and water from reactions using glovebox techniques is required for maximum rigor , but such procedures bear almost no resemblance to the way rcm reactions are carried out in the synthetic laboratory .
indeed , the relative robustness of ruthenium - based precatalysts represents one of the reasons for their wide appeal and ubiquity compared to the more active but far more fragile molybdenum - based systems . while synthetic chemists would use dried ( and typically degassed ) solvents
, they would not usually do more , so the level of rigor employed by adjiman , taylor and co - workers is entirely appropriate and relevant .
if their model could be applied to other systems , it could be used by synthetic chemists to predict conditions under which maximum reaction yield could be obtained at optimal substrate concentration , with the most appropriate precatalyst at the lowest practical loading and reaction time , with obvious and considerable advantages to those involved in scale - up campaigns .
we therefore set out to apply the published model to our own systems of interest and investigate its scope and limitations ; we report our findings in this manuscript .
reaction concentration / time data were collected for the rcm reactions of diethyl diallylmalonate 7 to form product 8 , heptadiene 11 to form cyclopentene 12 and octadiene 13 to form cyclohexene 14 ( scheme 3 ) catalyzed by 1 and 2 , by h nmr ( at 400 or 600 mhz ) following the procedures described previously .
dichloromethane - d2 ( dcm - d2 ) was used initially as it is the default solvent for synthetic rcm ; however , we also used chloroform - d for many experiments because it is a fraction of the cost of dcm - d2 and precatalyst initiation occurs at similar rates in the two solvents ( vide infra ) .
stock solutions of substrates and precatalysts were prepared in dried solvents ( solvents were allowed to stand over activated 4 molecular sieves overnight , then degassed before use by sparging with dry oxygen - free nitrogen ) using dried volumetric glassware so that weighing and dilution errors would be minimized . for more dilute reactions , concentrated stock solutions were prepared and diluted down immediately before use .
solid 1 and 2 and their solutions were handled with care under a flow of nitrogen .
reactions were carried out in nmr tubes fitted with pierced caps , allowing free egress of ethene . the published model ( scheme 2 , eqs 26 )
was constructed in both berkeley madonna and micromath scientist software packages ( using the default runge kutta fourth - order integration method for each ) and reaction concentration / time data ( for dienes 7 , 11 and 13 and products 8 , 12 and 14 ) were imported as text files or spreadsheets , respectively .
each experiment was checked for mass balance : the reactions treated in this manuscript all convert diene to cycloalkene ( plus ethene ) without the formation of oligomers or side - products .
initially , attempts were made to reproduce the experiment in dcm - d2 reported by adjiman and taylor ( 120 mm 7 , 6.7 mm 1 ) and obtain the published rate constants through fitting.23456 unfortunately , the concentration / time profile recorded indicated a faster reaction than the one published ( figure 1 ) .
a slower reaction took place in dcm - d2 from a freshly opened ampule , although this did not match the literature concentration / time profile either .
karl fischer titration showed that the drying procedure had been effective , with a water content of ca .
30 ppm before drying ( untreated chloroform - d and dcm - d2 ) but less than 10 ppm afterward .
it is clear that commercial nmr solvents from ampules must be treated with some caution if relatively significant amounts of water are not to be introduced .
straightforward drying of solvents using molecular sieves reduced the water content of the deuterated solvents to a level similar to that found in dcm obtained from widely used solvent purification systems ; for example , dcm from the innovative technologies puresolv system used in - house contains water at no more than 5 ppm . although the kinetic data were not consistent with the published literature profile , we fitted the data set ; diene and cycloalkene concentration were both fitted , but only cycloalkene concentration is shown for clarity .
an excellent fit was obtained for both species . however , quite different values for all rate constants were required ( table 1 ) , prompting further investigation with this data set .
experimental concentration / time data and simulations thereof obtained using the adjiman and taylor model and rate constants for the rcm of 7 in dry dcm - d2 ( red , red line ) and wet dcm - d2 ( , black line ) at 298 k. diene and cycloalkene concentration were both fitted , but only cycloalkene concentration is shown for clarity .
diethyl diallylmalonate 7 is used as a benchmark substrate to assess the performance of new precatalyst systems because it is assumed to cyclize irreversibly and via rate - limiting precatalyst initiation .
the absolute values of k1 and k1 should be very influential on the predicted concentration / time profiles , so the value of k1 was stepped in factors of 10 between fixed values from 10 to 10 s in the fitting , allowing k2 and k2 to optimize .
the k2 and k2 constants represent many events comprising the ring - closing metathesis process ; this is an inherent weakness in a fitting approach but it represents one way to achieve significant simplification without recourse to unrealistic reaction conditions .
was fixed to zero and once where k3 was allowed to vary in the fitting .
good fits were obtained for all values of k1 from 10 to 10 s when k3 was fixed , and from 10 to 10 s when k3 was allowed to change , which is very surprising given the importance of precatalyst activation .
the values of other rate constants changed smoothly with changes in k1 ( figure 2 ) .
testing the flexibility of k1 in the model with ( a ) k3 fixed to zero and with ( b ) k3 allowed to change in the fitting routine .
it is clear these rate constants are correlated ; the model will tolerate quite large changes in k1 by readjusting the value of other rate constants in direct proportion to the change in k1 , because the rate constants in the model are all dependent on k1 .
the irrelevance of the absolute value of k1 is a source of considerable concern ; unconstrained fitting of even moderately complex reactions is unwise because of the number of variables and the dependencies between them .
the absolute values of strongly correlated rate constants can not be obtained from fitting . with these results in hand ,
concentration / time data were recorded for the rcm reactions of diethyl diallylmalonate 7 over a range of reaction conditions ( 10 to 500 mm 7 , 1 to 10 mol % 1 , table 2 ) .
kinetic data collected using h nmr at 600 mhz with 2 scans per data point .
multiple data sets were imported into berkeley madonna and fitted simultaneously ( batch fitted ) to the adjiman model , on the basis that fitting a number of the data sets in table 2 would yield a set of rate constants that could describe a wider range of conditions .
unfortunately , a fit that described all data sets at once could not be achieved through this batch fitting approach .
the rate constants corresponding to the best fit are in table 3 . while the best fit described the shapes of the concentration / time profiles well for some data sets ( where 250 mm ) , fitting of the experimental data was moderate or poor for others .
figure 3 shows excellent ( = 500 mm ) , moderate ( = 120 mm ) and poor ( = 50 mm ) fits from the batch fitting results .
we refer to the maximum difference between experimental and simulated concentrations during the reaction . at this point
, it is clear that the flexibility of the model with respect to diene concentration is a major limitation ; at a give diene concentration , precatalyst concentration can be varied with good fits obtaining ( vide infra ) .
different best fits can be found for each data set ; either these are not global but local minima , or the model simply fails to describe a range of conditions .
testing the quality of fitting as a function of diene concentration for ( a ) = 500 mm ( 1 mol % 1 ) ( = data points , solid line = simulation ) and ( b ) = 120 mm ( 5.5 mol % 1 ) ( , red solid line ) and = 50 mm ( 2.5 mol % 1 ) ( blue , blue solid line ) .
attention then turned to constraining the value of k1 in the fitting , reflecting the importance of the precatalyst initiation event .
the kinetics of the initiation of precatalysts 1 , 2 and 3 have been studied in some depth and the initiation rate of 2 in dcm at 298 k is already known ( 0.0263 l mol s ) .
values of 1.40 10 and 4.5 10 s were obtained for 1 in dcm and chloroform , respectively , and 0.0234 l mol s for 2 in chloroform ( see the supporting information for details ) by following the reaction of the precatalyst with ethyl vinyl ether at 298 k by either h nmr ( for 1 ) or uv / vis spectroscopy ( for 2 ) .
these modest differences in initiation rate render chloroform - d a cost - effective solvent for the study of rcm . though the 14e complex 9 is an accepted intermediate on the energy surfaces for metathesis pathways , the barriers to alkene coordination or phosphane recoordination are very small .
the value of k1/k2 ( where k2 refers to the rate of alkene coordination ) is close to 1 from the experimental work of sanford et al . ,
however , complex 9 undergoes barrierless forward and backward reactions , so it follows that k1/k1 should reflect this in a very low numerical value .
p bond separation ; k1/k1 = k 10 at 298 k follows from this .
the ratios of k1/k1 derived by adjiman and taylor ( k1/k1 = 0.18 in dichloromethane , table 1 ) are therefore inconsistent with detailed experimental and theoretical studies on the phosphane dissociation event .
the values of k3 , which represent the rate of a bimolecular decomposition of active catalyst , also varied considerably with solvent . according to the work of hong et al .
, phosphane - bound methylidene 15 decomposes via 14e methylidene 16 to yield diruthenium complex 10 ( scheme 4 ) ; two molecules of 16 and one of tricyclohexylphosphane are consumed to produce one molecule of 10 , with tricyclohexylphosphane being converted to tricyclohexylphosphonium chloride in the process . in the adjiman model ,
this pathway is represented by the term k3 , but inspection of the high - field region of the h nmr spectrum of a 500 mm rcm of 7 ( 2.5 mol % 1 ) did not reveal 10 , whereas 1 and 15 are clearly visible .
formation of the diruthenium hydride complex 10 has been observed in concentrated solutions ( > 20 mm ) of phosphane - bound methylidene 15 at higher temperatures ( 322 k ) , or in the presence of a large excess of ethene , so the formation of 10 ( which requires two bimolecular steps ) would be expected to be slow under the mild and more dilute conditions used here and in most synthetic rcm experiments .
the decomposition pathway characterized by hong et al . has not yet been shown to account for significant quantities of ruthenium - carbene loss in synthetic rcm experiments .
the value of k1 was then fixed to the experimentally determined value ( for the relevant precatalyst / solvent combination ) for subsequent fitting .
simultaneous fitting of the 13 rcm reaction concentration / time profiles ( with k3 fixed to zero ) in table 2 yielded a new set of rate constants ( table 4 ) .
once again , these rate constants failed to describe a range of concentrations and only described reactions well when 250 mm . at this point ,
the limitations appear to follow from the way in which the model is constructed ( that is , the differential equations used to set it up ) .
the literature model was also constructed in micromath scientist , which provides a number of useful statistics with which to evaluate and compare reaction models , in order to evaluate how flexible the model was with a fixed value for k1 .
three data sets covering a wide concentration range ( entries 3 , 7 , and 12 in table 2 ) were fitted to the model in turn , providing good fits in each case but requiring vastly different rate constants ( entries 1 , 2 , and 3 in table 5 ) .
analysis of the fitting statistics showed that all rate constants were highly correlated , in agreement with the previous result ( figure 2 ) , and that 95% confidence limits for each rate constant were very wide indeed .
the confidence limits for k3 are so wide ( and encompass zero ) as to suggest that its value has very little bearing on the reaction , as would be expected for a bimolecular process occurring under very dilute conditions .
attempts at fitting multiple data sets using scientist were unsuccessful ; fitting the three data sets which had been examined separately yielded a good fit for the 500 mm reaction but underestimated the rates of the 120 and 50 mm reactions by ca .
it is now useful to examine the model in more detail , understand more fully the importance of k1 and identify the scope and utility of the model in its current form .
one of the important predictions of adjiman , taylor and co - workers concerns the extent to which precatalyst 1 dissociates , and the concentration / time profile of active catalyst 9 .
the published paper does not report any measurements of the concentration of 1 , even though the solution concentration would have allowed the benzylidene proton to be observed ( h = ca .
19.2 ppm in chloroform - d and dcm - d2 ) and integrated with confidence .
when spectra were recorded over a 20 ppm chemical shift range , the change in concentration of 1 was seen to be modest during the course of the reaction .
most of the initial charge of 1 remains well after complete conversion of 7 to 8 , in agreement with previous literature reports , indicating clearly that the reaction conditions are not causing extensive catalyst decomposition on the time scale of the rcm ( figure 4 ) .
concentration / time profiles of 8 ( ) , precatalyst 1 ( ) and inactive phosphane - bound methylidene 13 ( red ) during the rcm of 7 ( 120 mm , 5.5 mol % 1 ; entry 9 in table 2 ) .
complete dissociation of phosphane clearly does not occur ; the simulated catalyst concentration / time profile presented by adjiman and taylor is an artifact arising from the use of an excessively large value of k1 ( 6.17 10 s ) .
a second alkylidene species was observed to form slowly during rcm reactions , with a chemical shift consistent with metathesis inactive methylidene complex 15 ( h = 17.8 ppm ) , formed by irreversible recapture of 16 by phosphane ; despite recent and detailed low - temperature nmr studies by van der eide,16 has not yet been detected by nmr .
capture of 16 by phosphane is slow because the concentrations of 16 and phosphane are very low ; substrates , ethene and products , all competitive and reversibly binding ligands , are all present at much higher concentrations . in the reaction profile in figure 4 , complete turnover of 7 has been achieved at the expense of ca .
the continued decrease in the concentration of precatalyst 1 even after the reaction has finished is due to reaction with ethene , which is known to yield a low energy metallocyclobutane after reaction with two molecules of ethene .
this initiation behavior was confirmed by following the decay of the precatalyst 1 in ethene - sparged solvent , which occurred at the same rate as precatalyst initiation with ethyl vinyl ether .
adjiman and taylor present a simulation of active catalyst concentration which shows rapid and complete precatalyst dissociation followed by active catalyst decomposition at various rates in each solvent , which is not consistent with experimental observations . for each of the reactions in table 2 ,
the precatalyst concentration after approximately 2000 s was measured by h nmr integration and compared to the values obtained at the same time point using simulations with rate constants from adjiman and taylor , or using our best fit set of rate constants from table 4 ( figure 5 ) .
2000 s in experiments in table 2 ( except data set 13 ) using ( a ) rate constants in table 1 , entry 2 ( ) or ( b ) rate constants in table 4 ( red ) ; the black line represents identity between simulated and measured values ( i.e. , slope = 1 ) .
it can be concluded that the rate constants in table 4 represent the behavior of the precatalyst more effectively , but still do not completely account for its behavior in rcm reactions .
various values of k1 , k2 and k2 can still be obtained , depending on which data set is fitted , presumably due to the large number of local minima for the fitting method .
further changes to the model are required before a wide range of concentrations can be described .
attempts were therefore made to fit multiple data sets within a narrower range of concentrations and explore the concentration range over which the approximations and simplifications of the model hold .
rate constants were obtained ( through data fitting ) that describe all experiments with 250500 mm 7 ( table 6 , entry 1 ; data sets 1 to 6 in table 2 ) and a second set that describe all experiments with 50120 mm 7 ( table 6 , entry 2 ; data sets 7 to 12 in table 2 ) ; k1 and k3 were fixed in the fitting .
rate constants in table 6 describe experiments at ( a ) 500 mm , using entry 1 , and ( b ) 50 mm , using entry 2 , relatively well , even when the precatalyst concentration varies .
there are clear differences between the rate constants required to fit the different concentration regimes , with higher k1 and k2 values required to successfully model the lower concentration reactions .
the different value of k1 is required due to the incorrect modeling of the 14e species ( methylidene 16 does not capture phosphane reversibly ) and the absence of ethene from the reaction model means that [ ethene ] is effectively embedded in k2 .
however , the rate constants successfully fit different precatalyst loadings and substrate concentrations within these ranges and are therefore useful for predicting the effect of changing these parameters , for example , to predict the lowest loading of 1 that will effect complete reaction within a given time frame .
the extraction of rate constants for different substrates was the original aim of this project , so attention turned to assessing different substrates in rcm reactions quantitatively from reactions conducted at the same initial diene concentration .
concentration / time data for the rcm of 7 ( table 2 , data set 13 ) , heptadiene 11 to form cyclopentene ( in duplicate ) and octadiene 12 ( in duplicate ) in dcm - d2 , all with 10 mm substrate and 0.1 mm 1 , were imported into berkeley madonna and fitted to the simple model in scheme 2 .
the values of k1 ( 1.4 10 s ) and k3 ( zero ) were fixed and the data was fitted with a common k1 , k1 and k3 ( substrate independent rate constants ) but a different k2 and k2 for each substrate .
fitting concentration / time data for the rcm reactions of heptadiene ( = data points , solid black line = simulation ; , dashed black line ) , octadiene ( red , solid red line and red , dashed red line ) and diethyl diallylmalonate ( blue , solid blue line ) ; the initial substrate concentration was 10 mm ( 1 mol % 1 ) .
the model is therefore useful for deriving quantitative conclusions about the relative rate of rcm of different substrates .
interestingly , the rcm of diethyl diallylmalonate appears to occur at half the rate of the
parent heptadiene substrate , despite the gem - disubstitution ; this order of reactivity was confirmed by a competition rcm experiment ( 5 mm heptadiene , 5 mm diethyl diallylmalonate , 0.1 mm 1 ) in which the heptadiene cyclized more rapidly ( see the supporting information ) .
small scale rcm experiments at up to = 4 m showed that despite the fact that 7 undergoes rcm slower than heptadiene 11 , it is a far more efficient reaction ( higher emt ) and does not produce oligomeric material even when run almost neat .
this is in stark contrast to heptadiene which produces oligomeric material even at concentrations as low as 10 m , further highlighting the need for a quantitative understanding of the effects of substrate structure on rcm rate and efficiency ; trends in rcm rate are not always the same as those in rcm efficiency .
fitting of a batch of data in chloroform - d ( 11/13 mixtures , each with 0.1 mm 1 : 10/0 , 9/1 , 7.5/2.5 , 5/5 , 2.5/7.5 , 1/9 , 0/10 ) with k1 fixed ( 4.5 10 s ) yielded a set of rate constants for heptadiene and octadiene rcm in chloroform - d ( table 8 , entry 1 ) .
measured by following the reaction of 2 with ethyl vinyl ether in chloroform at 298 k by uv / vis spectrometry following the experimental procedure in ref ( 18 ) and fixed in the fitting .
many studies have been conducted to understand the effects of precatalyst on reaction rate and outcome , so the ability of the model to predict the effect of changing the precatalyst was investigated .
precatalyst 2 generates the same active species as 1 after the first turnover , so two competition reactions ( in duplicate in chloroform - d with either 0.1 mm 1 or 0.1 mm 2 , plus 5 mm heptadiene and 5 mm octadiene ) were conducted and the data were imported into berkeley madonna .
the four experiments were fitted with common k2 , k2 , k2 and k2 ( forward and backward rates for heptadiene and octadiene respectively , the superscript refers to the product ring size ) with k1 and k1 to model the behavior of 1 and k1 to model the initiation of 2 ; although the initiation of 2 has been shown to proceed via an interchange mechanism , a dissociative mechanism ( the simplest model ) was trialled first to see if a correctly shaped concentration / time plot could be generated .
fitting the data ( k3 fixed to zero ) yielded a set of rate constants similar to those obtained for the various chloroform/1 data ( table 8 , entry 1 ) that approximately described the data from reactions with 1 but more accurately described the octadiene / cyclohexene profiles from reactions with 2 ( table 8 , entry 2 ) .
recently , the timing of events involved in the initiation of grubbs - hoveyda second generation precatalyst 2 has been re - evaluated .
vorfalt et al . have recently shown that precatalyst initiation is irreversible , in disagreement with the more established boomerang
the way in which the initiation behavior is modeled for 2 may therefore be appropriate ; an interchange mechanism , ( eqs 712 ) was therefore explored.789101112 the model was set up to allow simulation of rcm of binary mixtures of dienes 11 and 13 with 2 , and to see how the model behaved for data obtained with 1 .
values of k2 , k2 , k2 , k2 and k1 were allowed to vary ( table 8 , entry 3 ) .
the fitting was quite successful for 2 , though less successful for 1 ; the exact shape of concentration / time profile can not be simulated ( figure 8) .
experimental data points and simulated concentration / time profiles for the rcm reactions of a 5 mm/5 mm solution of 11 and 13 with either 1 ( red = data points for 14 ; solid red line = simulation of 14 , red = data points for 12 , dashed red line = simulation of 12 ) or 2 ( , solid black line and , dashed black line ) ; diamonds / dashed lines represent 12 and triangles / solid lines represent 14 .
it does not appear that the same model can be used for both precatalysts , which may suggest strongly that there are significant mechanistic differences between the processes involving 1 and 2 .
nevertheless , these initial successes for the simulation for the interchange mechanism are extremely promising .
we have found that the kinetic model published by adjiman and taylor significantly simplifies the canonical mechanism for rcm at some cost . specifically , the treatment of the ruthenium species is not detailed enough , the precatalyst initiation rates obtained in the original paper through data fitting are inconsistent with literature knowledge , the prediction of active catalyst concentration is incorrect , and ethene is not considered at all . consequently the model does not describe even a modest range of substrate concentrations well . however , when constrained with measured initiation rate constants , concentration / time profiles can be simulated accurately , albeit over relatively narrow ( ca .
100 to 300 mm ) concentration ranges , and changes in precatalyst loading can be described .
pleasingly , from kinetic experiments on different substrates ( at a common concentration , and with a constant k1/k1 in the fitting ) , relative rates can be extracted , and thus useful quantitative performance comparisons can be made between rcm substrates .
unfortunately , it is not possible to use a common model for accurate simulation with precatalysts 1 and 2 , consistent with recent findings on the mechanism of initiation of 2 .
these studies show the need for the development of a more robust modeling approach for rcm if kinetic data are to be interpreted successfully and fully .
we are currently working on further development and elaboration of these models for applications over wider concentration ranges and with different precatalysts .
kinetics experiments were followed by h nmr , either by observation at 400 mhz with a bbfo - z - atma probe or at 600 mhz with a tbi - z probe ( inverse probe ) .
glove box conditions were not employed , but the precatalysts and solutions thereof were handled with care under nitrogen .
all solutions were prepared in dry volumetric glassware and carefully transferred using dry gastight syringes .
dcm - d2 was purchased from goss scientific and chloroform - d from sigma - aldrich ; solvents were dried on activated 4 molecular sieves for at least 24 h before use . the internal standard ( 1,3,5-trimethoxybenzene ) and
precatalysts 1 and 2 were purchased from sigma - aldrich and used as supplied . for low concentration reactions , the substrate /
internal standard solution was used to tune , match , lock and shim the instrument . a small ( ca .
5 to 20 l ) volume of a concentrated precatalyst solution was added and the tube was shaken . for higher concentration reactions
the substrate / internal standard solution and precatalyst solution were prepared , a t0
sample was prepared from x l solvent plus ( 500 x ) l substrate / standard solution and this was used to prepare the instrument and acquire the first spectrum . following this , in a separate tube , x
l precatalyst solution was added to ( 500 x ) l substrate / standard solution and the tube was shaken .
nmr spectra were then acquired periodically until after the rcm reaction had finished ; a d1 setting of 35 s was used ( 5 times the largest t1 measured : 7 s , see supporting information ) .
Output:
| a published model for revealing solvent effects on the ring - closing metathesis ( rcm ) reaction of diethyl diallylmalonate 7 has been evaluated over a wider range of conditions , to assess its suitability for new applications .
unfortunately , the model is too flexible and the published rate constants do not agree with experimental studies in the literature .
however , by fixing the values of important rate constants and restricting the concentration ranges studied , useful conclusions can be drawn about the relative rates of rcm of different substrates , precatalyst concentration can be simulated accurately and the effect of precatalyst loading can be anticipated .
progress has also been made toward applying the model to precatalyst evaluation , but further modifications to the model are necessary to achieve much broader aims . |
PubmedSumm118404 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: metronidazole ( 2-methyl-5-nitroimidazole-1-ethanol ) belongs to a group of nitroimidazole drugs used in therapeutics mainly in the treatment of infections caused by susceptible organisms , particularly anaerobic bacteria ( bacteroides , fusobacterium , campylobacterium , and clostridium ) and protozoa ( trichomonas , treponema , and histomonas ) [ 1 , 2 ] .
it can kill or inhibit the majority of anaerobic bacteria when the metronidazole concentration in serum is in the range of 2 to 8 mg / ml .
due to its antimicrobial activity , rapid bacterial killing , good tissue penetration , low cost , and limited adverse ejects , metronidazole ( mtz ) is the drug of choice for prophylaxis and treatment of patients with crohn 's disease and ulcerative colitis to prevent infectious complications [ 4 , 5 ] .
the pharmacokinetic and pharmacodynamic properties of the drug are favorable , and it is available as oral , intravenous , vaginal , and topical formulations . after oral administration , metronidazole is well absorbed , and its peak plasma concentrations occur 1 - 2 h after administration [ 1 , 4 ] . in accordance with the international guidelines , metronidazole is also a component of multidrug regimens ( e.g. , in combination with omeprazole , rabeprazole , and amoxicillin ) for therapy of helicobacter pylori infections , which is a major cause of gastritis and a risk factor for stomach cancer [ 4 , 6 ] . however , high doses and long - term systemic treatment with metronidazole are associated with the development of leucopenia , neutropenia , increased risk of peripheral neuropathy , and toxicity of the central nervous system . in clinical studies , where high doses of metronidazole were used during radiation treatment for cancer , an overdose was believed to increase the risk of seizures or nerve problems in the hands and feet .
the side effects may vary from patient to patient depending on the overall health of the patient .
the medication is most likely to cause problems in the case of overdose when it is taken by mouth or by iv , rather than applied to the skin or used vaginally .
high performance liquid chromatography [ 911 ] , titrimetric method , and spectrophotometry are the conventional methods reported for the determination of metronidazole in pharmaceutical sample .
however , most of these methods are time - consuming , tedious , environmental nonfriendly , and expensive and require trained technicians . on the contrary ,
electrochemical methods are promising alternatives for the determination of electroactive species , because of their inherent advantages of simplicity , ease of miniaturization , high sensitivity , and relatively low cost [ 15 , 16 ] .
limited works have been reported on the electrochemical determination of metronidazole in pharmaceutical and clinical matrices using mercury electrode [ 17 , 18 ] , dna - modified glassy carbon electrode , composite polymer membrane electrode , ultratrace graphite electrode ( ute ) , activated glassy carbon electrode , and mwnt / glassy carbon electrode .
although the reported methods are sensitive with detection to a nanomolar level , most of them have used mercury electrode which is environmental unfriendly , while the others have used expensive electrodes .
thus , the development of a simple , cost effective , and sensitive method is needed for the determination of metronidazole in pharmaceutical formulations .
thus , square wave voltammetric determination of metronidazole in tablet samples using carbon paste electrode ( cpe ) is presented in this study .
standard metronidazole and graphite powder ( british drug houses ltd . , uk ) , metronidazole tablets of three brands , two ethiopian brands ( addis pharmaceuticals factory ( apf ) and ethiopian pharmaceuticals factory ( epharm ) ) and the third is an indian brand , rabeprazole and tinidazole tablets ( apf ) , omeprazole tablet ( epharm ) , paraffin oil ( abron chemicals ltd . ) , phosphoric acid ( epharmecor ) , and boric acid , glacial acetic acid , and sodium hydroxide ( blulux laboratories ltd . ) were used .
a bas 100b , electrochemical analyzer ( bioanalytical systems ( bas ) , usa ) with three - electrode system , carbon paste electrode as working electrode , platinum wire as auxiliary electrode , and ag / agcl as reference electrode , was used .
jenway model 3310 ph meter and an electronic balance ( denver instrument ) were used to measure the ph of the buffer solutions and the mass of different chemicals , respectively .
britton robinson buffer solution ( brb solution ) in the ph range 2.012.0 was prepared from a mixture ( 0.1 m ) of acetic acid , boric acid , and phosphoric acid .
the ph of the solutions was adjusted using 1 m sodium hydroxide solution . a stock solution of 5 mm standard metronidazole solution
was prepared by dissolving 0.0856 g of metronidazole in 100 ml of distilled water .
the required metronidazole working solutions were prepared by diluting the stock solution with the brb solution of the appropriate ph .
metronidazole tablets ( all labelled as 250 mg per tablet ) of three brands , two of which are ethiopian ( addis pharmaceuticals factory ( apf ) and ethiopian pharmaceuticals factory ( epharm ) ) and the third is an indian factory ( aurobindo pharmaceutical industries ) , were collected from a pharmacy .
five tablet formulations of each brand were accurately weighed and ground using mortar and pestle .
an adequate amount of this powder , corresponding to a stock solution of concentration 1 10 m , was weighed and transferred into a 100 ml flask and filled to the mark with distilled water .
an intermediate tablet solution of 5 mm concentration was prepared from the tablet stock solution using distilled water as a solvent .
after filtration , 35 , 70 , and 88 m sample solutions were prepared from the tablet stock solution using brb solutions for each brand of metronidazole tablet .
carbon paste electrode was prepared by thoroughly mixing 1 g of graphite powder with paraffin oil in a ratio of 72% ( w / w ) graphite powder and 28% ( w / w ) paraffin oil .
the mixture was homogenized with mortar and pestle for 30 minutes and allowed to stand for 24 hrs .
the homogenized paste was packed into the tip of a plastic tube of diameter 3.5 mm ( chewing gum stick bought from ordinary shop ) .
after copper wire was inserted from the backside of the plastic tube to provide electrical contact , the electrode was made ready for use after the surface of the electrode was smoothed manually against a smooth white paper until a shiny surface is emerged .
cyclic voltammetry in the potential window + 500 to 1200 mv was used for the investigation of the electrochemical behavior of standard metronidazole at carbon paste electrode .
the effects of scan rate in the range of 10 to 250 mv / s and ph in the range 20 to 120 on the peak potential and peak current of metronidazole were also studied using cyclic voltammetry . for the quantitative determination of metronidazole using carbon paste as a working electrode , a square wave voltammetry in the range 100 to 1100
linear calibration curve for the dependence of square wave peak current on the concentration of standard metronidazole was obtained . moreover ,
recovery results of spiked standard metronidazole in tablet solutions , interference study results , method detection limit , linear range , and precession of the results obtained were used to validate the applicability of the developed method for the determination of metronidazole in pharmaceutical formulations .
figure 1 presents the cyclic voltammograms of cpe in brb solution ( ph 2.0 ) in the presence and absence of 1 mm metronidazole . in the absence of metronidazole ,
a weak and broad reductive peak that appeared between 500 and 1050 mv was ascribed to the oxygen reduction ( curve ( a ) of figure 1 ) . on the contrary , a well - defined , intensive , and sharp reductive peak centered at 450 mv ( curve ( b ) of figure 1 )
was observed in the presence of 1 mm metronidazole indicating an irreversible reduction of metronidazole at cpe .
the effects of scan rate on the reduction peak current and peak potential of metronidazole were studied .
figure 2 describes the cyclic voltammograms of 1 mm metronidazole at scan rate range of 10250 mv / s .
cathodic peak potential shifted to a larger negative potential value confirming the irreversibility of the reduction reaction of mtz at cpe . in order to investigate whether the reduction process of metronidazole at cpe is predominantly diffusion controlled or adsorption controlled process ,
the correlation coefficients for the linear plots of the reductive peak current versus the scan rate and reductive peak current versus the square root of scan rate were compared ( figure not shown ) .
in contrast , a better correlation coefficient for the dependence of reductive peak current on the scan rate ( r = 0.999 ) than on the square root of scan rate ( r = 0.993 ) indicated that the reduction of metronidazole at cpe is governed by both surface - adsorption and diffusion kinetics though it is predominantly surface - confined kinetics .
furthermore , the number of electrons transferred ( n ) for the surface - confined irreversible process was estimated employing the following equations [ 25 , 27]:(1)ipc=nn2f22.718rt,(2)epep/2=1.85rtnf v=0.048n vat 25c,(3)=qnfa , where ip is peak current , is scan rate , is surface concentration of the electroactive species in mol cm , a is electrochemical active electrode surface area in cm , is electron transfer coefficient , r is the universal gas constant ( 8.314 j k mol ) , t is the kelvin temperature , f is faraday constant ( 9,6485 c mol ) , ep is peak potential , ep/2 is half peak potential , and q is the charge consumed in coulomb obtained by integrating the peak area . taking the voltammogram at a scan rate of 100 mv in figure 2 , n value estimated using ( 2 ) was calculated to be about 0.913 .
substituting term of ( 3 ) into ( 1 ) , a new relation was obtained ( 4 ) from which the number of electrons transferred ( n ) in the rate determining step was calculated to be 3.77 ( 4 ) which is in agreement with earlier reported work ( 4)n=2.718iprtnfq.the value of was then calculated to be 0.228 , still confirming the irreversibility of the reduction of mtz at cpe .
plot of reductive peak potential ( epc ) against the logarithm of scan rates ( ln ) showed linear dependence with a linear regression equation and correlation coefficient of epc / v = 0.37356 0.026157 ln/vs and r = 0.999 , respectively ( figure not shown ) , from which the standard rate constant value for an irreversible reductive reaction was calculated using the following equation : ( 5)ep = eo+rtnflnrtk0nfrtnfln,where ep is the peak potential , e is the formal potential , is the electron transfer coefficient , k0 ( s ) is the electrochemical rate constant , and the other parameters have their usual meanings . after calculating e from the linear regression equation of the graph of ep versus ( figure not shown ) ,
the value of k0 was calculated from the intercept of the plot of ep versus ln ( figure not shown ) to be 280.38 s(6)eo+rtnflnrtk0nf=0.3736 v. the effect of ph on the reductive peak current and peak potential of metronidazole at cpe was further studied .
brb solutions with ph values varying from 2.0 to 12.0 were used to investigate its effect on the reduction of metronidazole at carbon paste electrode .
the results revealed that voltammetric responses were strongly ph dependent in the acidic and neutral region in contrast to the alkaline medium which was in agreement with most of the electrochemical methods reported .
a peak potential independent of ph in the alkaline medium could be attributed to the unavailability of protons that promote the reduction of mtz at phs larger than its pka value .
figure 3 represents cyclic voltammograms of 1 mm mtz in the region where its reduction is ph dependent ( phs 2.08.0 ) .
a well - defined irreversible cathodic peak was observed in the entire buffer system at the cpe .
the effect of ph on the peak current in the studied ph range was investigated ( figure 4(a ) ) .
the cathodic peak current increased sharply from ph 2.0 to 7.0 beyond which it started to decrease .
thus , ph 7.0 was selected as the optimum ph for the subsequent experiments which is in agreement with previous works . with increasing solution
ph up to 8.0 , a peak potential shift in the negative potential direction was observed indicating the involvement of protons during the reduction reaction of metronidazole in acidic and neutral media ( figure 3 ) .
a linear dependence of peak potential on solution ph in the ph range 2.08.0 ( figure 4(b ) ) with a linear regression equation and correlation coefficient of epc ( mv ) = 291.26 64.36ph and r = 0.999 , respectively , was observed .
a slope of 64.36 mv / ph typically suggested that the number of protons taking part in the reaction is similar to the number of electrons that participated in the rate determining step .
hence , a reaction mechanism involving four electrons and four protons was proposed ( scheme 1 ) .
square wave voltammetry ( swv ) , which is one of the most sensitive voltammetric techniques , was used for the quantitative determination of metronidazole in tablet samples .
figure 5 presents the square wave voltammograms of cpe in ph 7.0 brb solution containing no ( a ) and 1 mm metronidazole ( b ) .
as can be seen from the figure , no peak is observed at cpe in the buffer solution containing no mtz ( curve ( a ) of figure 5 ) .
in contrast , the same working electrode in ph 7.0 brb solution containing 1 mm mtz resulted in an enhanced reductive peak ( curve ( b ) of figure 5 ) . under the optimum experimental conditions ( ph , accumulation potential ( eacc ) , accumulation time ( tacc ) , swv frequency , amplitude , and step potential of 7.0 , 500 mv , 25 s , 30 hz , 50 mv , and 10 mv , resp . ) , the dependence of square wave voltammetric peak current on the concentration of mtz and the inherited sensitivity of the method were investigated in the range 1 105 10 m. figure 6 shows square wave voltammograms of various concentrations of mtz corrected for background .
inset of figure 6 presents the plot of the reductive peak current as a function of the concentration of mtz .
the limit of detection ( lod ) and limit of quantification ( loq ) calculated using ( 7 ) and ( 8) were found to be 2.97 10 and 9.91 10 , respectively:(7)lod=3sm,(8)loq=10sm , where s is the standard deviation for the blank
( n = 8) and m is the slope of the calibration curve . compared to the previously reported works which have used expensive electrode materials , cpe which is the cheapest carbon based material revealed a comparable lod . the selectivity and
the accuracy and hence the validity of the carbon paste electrode for the determination of mtz in real samples were demonstrated by evaluating its application for the determination of mtz content in some pharmaceutical tablets .
briefly , five tablets from each brand ( apf , epharm , and indian ) were weighed and powdered . for each brand of tablet , an amount corresponding to a stock solution of 0.01 m concentration was weighed and transferred into 100 ml flask and then completed to the volume with ph 7.0 brb solution .
finally , 35 , 70 , and 88 m tablet sample solutions were prepared from the corresponding stock solution .
square wave voltammograms were recorded ( figure not shown ) following the outlined voltammetric procedure and optimized conditions as described earlier .
the results for different concentrations of the three brands of tablets are summarized in table 1 .
the tablet formulations for the collected brands being all 250 mg of mtz per tablet , the amount of mtz detected relative to the expected value according to the label in the apf , epharm , and indian brand tablets were about 90.139% , 96.235% , and 93.544% , respectively .
detected values lower than the prescribed value may be due to the possible mass loss of mtz during preparation or sort of degradation during storage , otherwise originally lower levels of mtz in the tablets .
the square wave voltammograms for 35 m tablet samples of each brand tablet , each spiked with the same amount of standard mtz ( 100 m ) , were recorded ( figures not shown ) . as can be observed from table 2 , recovery results in the range of 95.374% to 97.331% confirmed the potential applicability of the developed method for mtz analyses in real samples .
relative standard deviation ( rsd ) of 2.439 which is comparable to elsewhere reported work using utge showed the reliability of our result .
to further elaborate the potential applicability of the method , the selectivity of the method for mtz in the presence of potential interferents was studied . for the interference studies , drugs which could be present in the mtz tablet ( rabeprazole and omeprazole ) or have structural similarities with mtz ( tinidazole )
the effect of each selected potential interferent was investigated at various concentrations of the interferents ( figure not shown ) added to 35 m mtz .
as can be seen from table 3 , the presence of different concentrations of rabeprazole and omeprazole with a fixed concentration of metronidazole did not significantly affect the peak current response for the mtz and the change in peak current was less than 5%
. however , the presence of tinidazole in whatever amount showed positive interference as in the reported works .
cyclic voltammetric investigation of metronidazole at cpe revealed an irreversible reduction peak over the studied potential window . while the peak potential shift with scan rate confirmed the irreversibility of the reaction , peak potential shift with ph also indicated the involvement of protons in the reduction process .
the calculated kinetic parameters of the reduction of metronidazole at carbon paste electrode are found to be in agreement with the proposed reaction mechanism in literature . under the optimized solution ph , swv , and accumulation parameters ,
carbon paste electrode showed relatively wide linear range with comparable lod , loq , recovery , and selectivity relative to the previously reported works which have used expensive electrodes .
hence , the developed electrochemical method using the cheapest carbon based electrode can be used as an alternative method for the determination of metronidazole even in a complex matrix system like pharmaceutical formulations .
Output:
| cyclic voltammetric investigation of metronidazole at carbon paste electrode revealed an irreversible reduction peak centered at about 0.4 v. observed peak potential shift with ph in the range 2.0 to 8.5 indicated the involvement of protons during the reduction of metronidazole , whereas the peak potential shift with scan rate in the range 10250 mv / s confirmed the irreversibility of the reduction reaction .
a better correlation coefficient for the dependence of peak current on the scan rate than on the square root of scan rate indicated an adsorption controlled kinetics . under the optimized method and solution parameters , an excellent linearity between the reductive peak current and the concentration of metronidazole
was observed in the concentration range 1.0 106 to 5.0 104 m with a correlation coefficient , method detection limit ( based on s = 3 ) , and limit of quantification of 0.999 , 2.97 107 m and 9.91 107 m , respectively .
good recovery results for spiked metronidazole in tablet samples and selective determination of metronidazole in tablet formulations in the presence of selected potential interferents such as rabeprazole , omeprazole , and tinidazole confirmed the potential applicability of the developed method for the determination of metronidazole in real samples like pharmaceutical tablets . |
PubmedSumm118405 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: jellyfish ( aurelia aurita ) were obtained from the new england aquarium and maintained in 20-l aquaria at 20 c . for recording
, individual animals were placed into a glass filming vessel ( 30 10 25 cm ) filled with filtered seawater .
recordings of free - swimming animals were acquired by a high - speed digital video camera ( fastcam 1024 pci ; photron ) at 1,000 frames per second .
detailed swimming kinematics ( 2d ) were obtained using imagej v1.46 software ( national institutes of health ) to track the x and y coordinates of the apex of the jellyfish bell margin over time .
bell margin speed was calculated from the change in the position of the margin tip over time as :
u=((x2x1)2+((y2y1)2))1/2t2t1
jellyfish were illuminated with a laser sheet ( 680 nm , 2w continuous wave ; lavision ) oriented perpendicular to the camera s optical axis to provide a distinctive body outline for image analysis and to ensure the animal remained in - plane , which ensures the accuracy of 2d estimates of position and velocity .
fluid motion created by the jellyfish while swimming was quantified using 2d digital particle image velocimetry ( dpiv ) . using the setup described in gemmell et al .
the velocities of particles illuminated in the laser sheet were determined from sequential images analyzed using a cross correlation algorithm ( lavision software ) .
image pairs were analyzed with shifting , overlapping interrogation windows of a decreasing size of 64 64 pixels to 32 32 pixels .
Output:
| the ability of animals to propel themselves efficiently through a fluid medium is ecologically advantageous .
flexible components that influence vortex interactions are widespread among animal propulsors . however the mechanisms by which vortices are enhanced and appropriately positioned for thrust generation are still poorly understood . here , we describe how kinematic propulsor movements of a jellyfish can enhance and reposition a vortex ring that allows the recapture of wake energy for secondary thrust generation and efficient locomotion .
we use high - speed video and digital particle image velocimetry ( dpiv ) to resolve kinematics simultaneously with fluid structures .
these results provide new insight into how animals can manipulate fluid structures to reduce metabolic energy demands of swimming muscles and may have implications in bio - inspired design . |
PubmedSumm118406 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: collapsing glomerulopathy ( cg ) is a morphologically and clinically distinct podocytopathy characterized by segmental or global collapse of glomerular capillaries , formation of pseudocrescents and variable tubulointerstitial injury , presenting with an accelerated clinical course , not responding to standard therapeutic regimens .
originally described in 1978 as an idiopathic disorder termed malignant focal segmental glomerulosclerosis ( fsgs ) , it became a relatively frequent diagnosis of the 80s with the identification of human immunodeficiency virus - associated nephropathy ( hivan ) , exhibiting a striking racial predilection for african americans . in recent years
, there has been a growing list of disorders associated with cg in non - hiv infected patients , which includes infections , autoimmune diseases , intake of medicinal and illegal drugs , and thrombotic microangiopathy ( tma ) .
conversely , the detection of cg in the setting of hiv has declined with the advent of antiretroviral therapy .
we report a case of cg associated with iga nephropathy ( igan ) , in a 16-year - old , non - hiv infected boy with a history of anabolic steroid use for enhancing his appearance .
a 16-year - old boy presented with history of vomiting and headache of 15 days duration . on evaluation , he was found to have blood pressure of 160/80 mmhg .
he had a history of consumption of anabolic steroids ( dexona + dianabol [ methandrostenolone ] combination ) for general body development for a duration of 3 months .
laboratory studies revealed a serum creatinine of 2.27 mg / dl , urine protein to creatinine ratio of 6 , proteinuria of 4.7 g in 24 h. urine microscopy showed 10 - 12 white blood cells and 5 - 40 red blood cells per high power field .
the renal biopsy showed global glomerulosclerosis in four of the 15 glomeruli , with the remaining showing mesangial and endocapillary cell proliferation with paramesangial capillary wall thickening .
the extra glomerular compartment showed interstitial fibrosis amounting to 20% , aggregates of mononuclear inflammatory cells , tubular atrophy , microcystic dilatation of tubules with hyaline casts and necrotic cells in nonatrophic tubular lumina [ figure 1 ] .
implosive collapse of a glomerular tuft with poorly cohesive proliferating podocytes appearing to fall off into the increased urinary space .
periodic acid - schiff ( pas ) stain demonstrates protein resorption droplets in hypertrophic podocytes .
adjacent tubule shows microcystic dilatation ( pas , 400 ) the immunofluorescence ( if ) done on two glomeruli revealed arborizing mesangial deposits of iga ( 3 + ) , igg ( 2 + to 3 + ) and c3 ( 2 + to 3 + ) with extension into the paramesangial capillary walls .
electron microscopic examination of seven glomeruli showed abundant paramesangial electron - dense deposits , focally extending subendothelially into peripheral capillary loops .
segmental thinning and splitting of glomerular basement membranes ( gbms ) were present , suggestive of primary igan .
one glomerulus showed segmental [ figures 2 and 3 ] and another showed global collapse with corrugated gbms and pseudocrescent formation [ figures 46 ] , features consistent with cg .
endothelial tubuloreticular inclusions were absent , in keeping with the patient 's negative serology for hiv and other viral infections .
segmental collapse with overlying podocyte hyperplasia ( transmission electron microscopy , 390 ) toluidine blue stain highlights protein resorption droplets in hypertrophied podocytes in a glomerulus with segmental collapse and early pseudocrescent ( semi - thin sections , toluidine blue , 400 ) pseudocrescent in bowman 's space composed of proliferating podocytes , some with protein resorption droplets .
abundant electron - dense deposits are present along with segmental wrinkling of glomerular basement membranes ( transmission electron microscopy , 610 ) podocyte bridging and hyperplasia with underlying corrugated glomerular basement membranes in a glomerulus with collapsing glomerulopathy ( transmission electron microscopy , 1700 ) enlarged podocyte containing protein resorption droplets ( transmission electron microscopy , 6000 ) the final diagnosis was cg associated with igan .
the patient was treated with oral prednisolone and mycophenolate mofetil with therapeutic drug level monitoring and strongly recommended to abstain from further use of body - building drugs . on follow - up after 6 months
, the patient has achieved partial remission with proteinuria decreasing to 1.6 g/24 h. but serum creatinine remained high at 2.96 mg / dl .
collapsing glomerulopathy is being increasingly reported in literature with growing awareness in the medical community of disorders other than hiv related to its occurrence .
although cg was considered to be a variant of fsgs in the columbia classification , recent taxonomical categorization proposes cg as a podocytopathy distinct from fsgs .
cg is defined by presence of pseudocrescents in the bowman 's space , resulting from exuberant podocyte proliferation and associated collapse or wrinkling of gbms whereas fsgs is characterized by podocytopenia .
ultrastructurally , podocytes in cg are more cuboidal with loss of primary foot processes indicating a dysregulated phenotype as seen in this case irrespective of etiology and clinical correlates , cg has a poor prognosis , with rapidly deteriorating renal function and marked proteinuria refractory to standard therapy .
igan is the leading cause of glomerulonephritis globally with high incidence in indian population unlike cg , which is extremely rare in this population , with only occasional case reports in the setting of hivan and systemic lupus erythematosus .
this could be attributed to probable variations in genetic susceptibility , reflected in high prevalence of hiv and non - hiv associated cg among patients of african origin .
although a recent study from france has reported occurrence of cg associated with igan ( eight cases of cg among 128 igan cases ) , portending a poor prognosis , a definite etiological link has not been established .
another study from portugal found concurrent mesangial iga deposits in three cases of cg , one of which was in a hepatitis b - infected patient using illegal oral drugs .
long - term abuse of anabolic steroids has been related to cg among body builders by herlitz et al .
a direct nephrotoxic effect of anabolic steroids , in addition to post - adaptive stress driven by increased body mass was implicated in the pathogenesis of cg and fsgs in this study .
interestingly , seven patients who discontinued anabolic steroids achieved remission in contrast to one patient who did not abstain .
the present case describes short - term anabolic steroid abuse and development of cg in a young patient from a low risk population with underlying primary igan .
the diagnosis of primary igan was based on lm , if and electron microscopy ( em ) studies .
em demonstrated presence of paramesangial electron - dense deposits with gbm thinning and splitting , which are additional ultrastructural findings supportive of a primary rather than secondary igan .
the onset of cg followed intake of anabolic steroids and despite high prevalence of igan in this population , there is no previous documentation of concurrent cg and igan from india . there was no biochemical or histological evidence of tma or severe ischemic changes or other viral infections to suggest possible etiologies of cg .
although all patients with igan exposed to anabolic steroids do not develop cg , the temporal sequence of events in our case , as described above , helps identify anabolic steroids as a co - factor precipitating cg in this patient . since mature podocytes
do not normally enter the cell cycle unless subjected to strong mitogenic stimuli , accumulated stress due to repeated insults against a background of genetic susceptibility has been implicated in the pathogenesis of cg .
nevertheless , this case supports the current school of thought that more than one hit to the podocyte may be involved in etiology of cg .
because of its attendant poor prognosis , a high degree of clinical suspicion should entail careful search for cg on renal biopsies of all relevant cases , even in low incidence areas with high prevalence of other primary glomerulonephritis .
this should be followed by an effort to ascertain the etiology , whenever possible , to rule out potentially modifiable causes like drug or toxin exposure . finally , the alarming increase in anabolic steroid use for appearance enhancement , particularly among adolescents and youth , warrants physicians to target their efforts in counseling about potential nephrotoxic effects especially in the context of pre - existing renal disease .
Output:
| collapsing glomerulopathy ( cg ) is a proliferative podocytopathy , increasingly recognized in a variety of disease conditions .
we report a case of cg in a 16-year - old boy with iga nephropathy ( igan ) who presented with acute kidney injury , marked proteinuria and hypertension following a short period of anabolic steroid use .
although cg has been associated with long - term anabolic steroid use among body builders , there is no data on the effect of anabolic steroid use in persons with underlying renal disease like igan .
we postulate that development of cg in our patient could be temporally linked to intake of body - building steroids along with a predisposing background renal disease of igan . |
PubmedSumm118407 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: because older people constitute the fastest - growing proportion of the population in the industrialized world , the prevalence of arrhythmias is expected to increase.1 consequently , arrhythmias represent a growing challenge for health care services.2,3 the onset of arrhythmia is often associated with other chronic diseases and may cause complications such as stroke .
abnormal electrocardiographic ( ecg ) findings are also seen in patients with syncope,4 a condition associated with twofold increased mortality in the population.5 atrial fibrillation ( af ) is a common arrhythmia that is reported to have a prevalence of 1.5%3% in the general population in the developed world6,7 and 20% in the oldest population.8,9 however , these statistics may underestimate the prevalence of af , as this condition can be asymptomatic10 and screening is not routine.11 furthermore , much of the knowledge concerning these findings is based on information obtained from inpatient populations and does not include persons 80 years old.1214 these studies also represent preselected populations , which can be a source of bias.15 to prevent af - related complications , it is important to address af medically . despite this ,
many patients with chronic af and increased risk of stroke are not treated with anticoagulants , and undertreatment is especially common in females and patients 80 years old.5 the national board of sweden recommends cardiac screening in high - risk groups of patients and compares the cost - effectiveness of cardiac screening for cervical cancer .
it also recommends that various methods for different populations to be screened should be evaluated.5 the most common way to screen for arrhythmias in the outpatient population is the use of traditional 24-hour ambulatory ecg devices , such as holter monitors .
however , there are also new long - term recording ( ltr ) ecg technologies in health care , such as thumb ecgs,16 which are aimed at the outpatient population.17 these newer devices have been shown to detect more arrhythmias than the traditional 24-hour ambulatory ecgs,18 which have relatively low detection rates19,20 and sensitivity , as revealed in a trial that included patients with implantable devices.21 the new wireless ltr ecgs allow for long - term monitoring from , for example , the patient s home,18 and some devices can relay data over mobile networks in real time.22 this technology may be associated with improvements in treatment , time management , and diagnosis by enabling superior management in a timely manner.17 like inpatient telemetry , they can allow for real - time analysis.23 however , these new devices often require active participation from the wearers , and therefore it can be difficult to detect asymptomatic af .
it has recently been stated that disease - management programs with ecg equipment for home use and integrated telemedicine solutions will become increasingly important in ensuring safety and cost - effectiveness in health care.16 therefore , in the present population - based study , we explored the prevalence of arrhythmias in 200 outpatients aged 66 years .
we also examined the feasibility of using the new wireless ltr ecg - bodykom device to screen for arrhythmias .
the study sample was drawn from the swedish national study on aging and care ( snac ) .
snac is a large , national , long - term , longitudinal , multipurpose study that involves four research centers and collects data in four different areas of sweden24 to provide a general picture of the aging population . the present study acquired data from one of the four centers , snac - blekinge ( snac - b ) .
the snac - b population consists of individuals 60 years old living in the karlskrona municipality .
every month , a randomized sample of patients 60 years old were recruited from eleven age cohorts for medical and psychological examination at snac - b ( 2030 patients per month ) . during the period from april 2010 to december 2013
after power calculation and exclusion , 200 persons of the total 612 were recruited to test the ltr ecg - bodycom .
exclusion was based on persons who could not wear the equipment nonstop until the day after , participants who did not want to test the equipment , or if the equipment had technical problems . to compare the younger old and older old populations ,
the sample was divided into two age cohorts : 6680 years and > 80 years . for participation , after providing the written informed consent , participants had to wear the equipment nonstop from the day they were examined until the day after .
the examiner also helped to choose participants after cognitive assessment , which included an mini mental state examination test ( score of > 26 required for inclusion in the study ) .
participants were examined either at the snac - b research center or in their home ( figure 1 ) .
this project was conducted in compliance with the established ethical guidelines of the declaration of helsinki.25 the study received ethical clearance from the regional ethical review board in lund to protect the interests of participants in the study ( drn lu 605 - 00 and lu 744 - 00 ) . to ensure compliance with the swedish data protection act,26 data
were stored securely and anonymized . to estimate the prevalence of arrhythmias , the wireless ltr ecg - bodykom device
the equipment was applied to the patient at the end of the clinical examination , usually between 11 am and 4 pm , and removed the following day .
the ltr ecg - bodykom was compared previously with traditional 24-hour ambulatory ecg ( holter ) to evaluate how well the two methods matched up with regard to the number of registered qrs complexes and to record transfer problems so that they could be rectified on a continuous basis.22 the equipment consists of a two - channel lead recording system with five electrodes attached to the participant s chest and a sensor .
data were then transmitted across the mobile network and transferred to a database for storage before analysis with cardio explorer analysis software27 ( figure 2 ) and then manually overread by a specialist .
the cost of each survey is 110 euros , including equipment and interpretation of the ecg .
the participants did not need to worry about the equipment while they had it on and were told to live their life as usual .
information about and history of cardiovascular risk factors , such as heart failure , hypertension , diabetes , stroke , ischemic cardiac disease , hypo / hyperthyroidism , medical treatment for af , and smoking habits , were collected during the medical examination and questionnaires including a medical history .
the medical examination included taking blood samples , resting ecg , examine blood pressure , and so on .
medical history , known af , and anticoagulant use were not taken into consideration , and the examiner performing mini mental state examination was not blinded to medical history . to examine how the ltr ecg - bodykom was tolerated during the recording time
the questionnaire included multiple - choice answers to indicate level of agreement with the following statements : the equipment was easy to use ,
i have been living normally during the past day , and sleeping with the equipment worked well . to describe heart rhythm , rate , and arrhythmias , the researchers categorized the data based on the minnesota code manual of electrocardiographic findings.28 heart rate : minimum , maximum , and mean rate ; basic heart rhythm : sinus , pacemaker , chronic af , ectopic atrial , and idioventricular rhythm ; and episodes of paroxysmal af / atrial flutter , tachycardia ( > 100 beats / min ) , bradycardia ( < 50 beats / min ) , and paroxysmal supraventricular tachycardia were recorded .
causes were described as follows : interference in impulse formation as aberrant qrs , atrioventricular block , bundle branch block , and asystole .
differences between sex and age cohorts were calculated by the chi - square test for nominal data .
statistical analysis was performed with spss version 22.0 ( ibm corporation , armonk , ny , usa ) .
the study sample was drawn from the swedish national study on aging and care ( snac ) .
snac is a large , national , long - term , longitudinal , multipurpose study that involves four research centers and collects data in four different areas of sweden24 to provide a general picture of the aging population . the present study acquired data from one of the four centers , snac - blekinge ( snac - b ) .
the snac - b population consists of individuals 60 years old living in the karlskrona municipality .
every month , a randomized sample of patients 60 years old were recruited from eleven age cohorts for medical and psychological examination at snac - b ( 2030 patients per month ) . during the period from april 2010 to december 2013
after power calculation and exclusion , 200 persons of the total 612 were recruited to test the ltr ecg - bodycom .
exclusion was based on persons who could not wear the equipment nonstop until the day after , participants who did not want to test the equipment , or if the equipment had technical problems . to compare the younger old and older old populations ,
the sample was divided into two age cohorts : 6680 years and > 80 years . for participation , after providing the written informed consent , participants had to wear the equipment nonstop from the day they were examined until the day after .
the examiner also helped to choose participants after cognitive assessment , which included an mini mental state examination test ( score of > 26 required for inclusion in the study ) .
participants were examined either at the snac - b research center or in their home ( figure 1 ) .
this project was conducted in compliance with the established ethical guidelines of the declaration of helsinki.25 the study received ethical clearance from the regional ethical review board in lund to protect the interests of participants in the study ( drn lu 605 - 00 and lu 744 - 00 ) . to ensure compliance with the swedish data protection act,26 data
to estimate the prevalence of arrhythmias , the wireless ltr ecg - bodykom device ( kiwok nordic ab , stockholm , sweden ) was used .
the equipment was applied to the patient at the end of the clinical examination , usually between 11 am and 4 pm , and removed the following day .
the ltr ecg - bodykom was compared previously with traditional 24-hour ambulatory ecg ( holter ) to evaluate how well the two methods matched up with regard to the number of registered qrs complexes and to record transfer problems so that they could be rectified on a continuous basis.22 the equipment consists of a two - channel lead recording system with five electrodes attached to the participant s chest and a sensor .
data were then transmitted across the mobile network and transferred to a database for storage before analysis with cardio explorer analysis software27 ( figure 2 ) and then manually overread by a specialist .
the cost of each survey is 110 euros , including equipment and interpretation of the ecg .
the participants did not need to worry about the equipment while they had it on and were told to live their life as usual .
information about and history of cardiovascular risk factors , such as heart failure , hypertension , diabetes , stroke , ischemic cardiac disease , hypo / hyperthyroidism , medical treatment for af , and smoking habits , were collected during the medical examination and questionnaires including a medical history .
the medical examination included taking blood samples , resting ecg , examine blood pressure , and so on .
medical history , known af , and anticoagulant use were not taken into consideration , and the examiner performing mini mental state examination was not blinded to medical history . to examine how the ltr ecg - bodykom was tolerated during the recording time
the questionnaire included multiple - choice answers to indicate level of agreement with the following statements : the equipment was easy to use ,
i have been living normally during the past day , and sleeping with the equipment worked well .
to describe heart rhythm , rate , and arrhythmias , the researchers categorized the data based on the minnesota code manual of electrocardiographic findings.28 heart rate : minimum , maximum , and mean rate ; basic heart rhythm : sinus , pacemaker , chronic af , ectopic atrial , and idioventricular rhythm ; and episodes of paroxysmal af / atrial flutter , tachycardia ( > 100 beats / min ) , bradycardia ( < 50 beats / min ) , and paroxysmal supraventricular tachycardia were recorded .
causes were described as follows : interference in impulse formation as aberrant qrs , atrioventricular block , bundle branch block , and asystole .
differences between sex and age cohorts were calculated by the chi - square test for nominal data .
statistical analysis was performed with spss version 22.0 ( ibm corporation , armonk , ny , usa ) .
table 1 presents characteristics of the study sample , including sex , age , history of diagnosed heart failure , hypertension , diabetes , stroke , ischemic cardiac disease , hypo / hyperthyroidism , and smoking habits .
of the 200 patients included in the study , 112 ( 56.0% ) were females .
the mean age of the females was 75.2 years ( sd 7.4 , range 6690 years ) , whereas the mean age of the males was 77.0 years ( sd 8.1 , range 6696 years ) .
there were 125 patients in the younger age cohort and 75 in the older age cohort . in the excluded population ( n=412 ) ,
there were 32% in the younger age cohort and 68% in the older age cohort .
the mean age of females was 83.8 years ( sd 8.9 , range 65102 years ) , while the mean age of males was 81.1 years ( sd 9.7 , range 6599 years ; nonsignificant ) . in the included and examined population ( n=200 ) ,
heart failure was identified in eleven ( 5.5% ) patients : eight females and three males .
there was no statistical difference between the two age cohorts ( six patients with heart failure in the 6680 years group and five in the > 80 years group , p=0.575 ) .
ten patients ( 5% ) had hypertension ( three males and seven females ) . there were three patients in the 6680 years group and seven in the > 80 years group ( p=0.559 ) .
nine patients ( 4.5% ) had diabetes , with no difference between age cohorts ( six patients with diabetes in the 6680 years group and three in the > 80 years group , p=0.792 ) .
there was a history of stroke / transient ischemic attack in 6.5% of the sample ( six males and seven females ) , with no difference between the age cohorts ( p=0.951 ) .
ischemic heart disease was found in 20 patients ( 10% ; eleven males and nine females ) , with no difference between age cohorts ( eleven patients in the 6680 years group and nine in the > 80 years group , p=0.465 ) .
twenty patients had hyper / hypothyroidism ( 10% , 17 females and three males ) , with no difference between the age cohorts : ten in the 6680 years group and ten in the > 80 years group ( p=0.224 ) .
ten participants were smokers ( five males and five females ) , with no difference between the age cohorts ( p=0.575 ) .
the mean cha2ds2vasc score for all included participants was 2.32 ( range 17 ) , while the mean cha2ds2vasc score for all excluded participants was 2.77 ( range 19 ) , 3.15 for females and 2.25 for males .
heart failure was found in 7.5% of the population , 3.5% had diabetes , and there was a history of stroke / transient ischemic attack in 7.5% of the sample .
the mean heart rate was slightly higher for males ( 73.8 beats / min ) than for females ( 72.7 beats / min ) .
heart rate fell below 50 beats / min in 62 cases ; in most of these , bradycardia occurred only during the night . in 166 cases ( 83% ) ,
heart rate increased to > 100 beats / min exclusively during the day in connection with physical activity .
the results revealed persistent af in 20 patients ( 10% ) ; there was no significant difference between the two age cohorts .
nine ( 45% ) of the participants with persistent af received medical treatment ( anticoagulants ) for their condition , due to earlier diagnoses .
two patients ( 20% ) with persistent af had a history of heart failure , one ( 10% ) had ischemic heart disease , none had a stroke , three ( 15% ) had hyper / hypothyroidism , none were diabetics , and one ( 5% ) had high blood pressure .
there was no significant difference between males and females regarding sinus rhythm as basic rhythm ( p=0.430 ) .
sinus rhythm was detected in most of the population ; the prevalence of paroxysmal af / atrial flutter was 5.5% , and there was no difference between males and females ( p=0.469 ) .
furthermore , paroxysmal af did not increase in the older cohort ; the prevalence was 3% in the younger cohort and 2.5% in the older cohort ( p=0.065 ) .
of those with paroxysmal af , 18% had a history of ischemic heart disease , 9% had heart failure , 9% were diabetic , 18% had hyper / hypothyroidism , and 9% had received medical treatment with acetylsalicylic acid . among those with paroxysmal af none were on medical treatment ( anticoagulants ) when detected , but all persons with paroxysmal af had a cha2ds2vasc score of 2 and were therefore candidates for follow - up and medical examination . these persons had not been previously diagnosed with paroxysmal af .
ninety - two patients ( 46% ) in the study populations had episodes of paroxysmal supraventricular tachycardia .
ventricular premature contractions occurred in 160 patients ( 81% ) , and supraventricular ectopic contractions occurred in 178 patients ( 89% ) , while another common arrhythmia , extra beats unspecified , occurred in 113 patients ( 56.5% ) .
first- and second - degree av block occurred in one man ( 0.5% ) and second - degree av block occurred in one man ( 0.5% ) who was 78 years old ( table 2 ) .
an average recording time with the wireless sensor was calculated from > 1.5 days of use .
however , wireless recordings for those with shorter times were the result of terminations due to technical reasons ( eg , the recorder aborted the recordings ) and personal reasons ( the electrode fell off or the person moved out of range of the telephone ) .
none of the participants terminated the recordings of their own free will prior to the scheduled time , and compliance with the bodykom was at a satisfying level . according to information obtained from interviews after the recording , 162 participants ( 81% ) agreed that the equipment was easy to wear ; only two persons ( 1% ) disagreed .
one hundred and sixty - four patients ( 82% ) agreed that they lived their normal daily life while wearing the equipment .
furthermore , 155 participants ( 77.5% ) thought that sleeping with the equipment worked well , only 1% disagreed .
there were only an average of three equipment of bodykom per day during the study period , but there were slots for four examinations per day in snac - b .
the ecg recording quality of the wireless recorder was satisfactory , with almost negligible disturbances from artifacts , as long as the electrodes were properly attached to the person s skin and the sensor was communicating with the telephone .
analysis times ranged from 0.31 hours to 37.49 hours , and the mean time was 17.29 hours .
there were no significant differences between males and females ( p=0.464 ) or between the two age cohorts ( p=0.564 ) regarding the recording time ( table 3 ) .
the results revealed persistent af in 20 patients ( 10% ) ; there was no significant difference between the two age cohorts .
nine ( 45% ) of the participants with persistent af received medical treatment ( anticoagulants ) for their condition , due to earlier diagnoses .
two patients ( 20% ) with persistent af had a history of heart failure , one ( 10% ) had ischemic heart disease , none had a stroke , three ( 15% ) had hyper / hypothyroidism , none were diabetics , and one ( 5% ) had high blood pressure .
there was no significant difference between males and females regarding sinus rhythm as basic rhythm ( p=0.430 ) .
sinus rhythm was detected in most of the population ; the prevalence of paroxysmal af / atrial flutter was 5.5% , and there was no difference between males and females ( p=0.469 ) .
furthermore , paroxysmal af did not increase in the older cohort ; the prevalence was 3% in the younger cohort and 2.5% in the older cohort ( p=0.065 ) .
of those with paroxysmal af , 18% had a history of ischemic heart disease , 9% had heart failure , 9% were diabetic , 18% had hyper / hypothyroidism , and 9% had received medical treatment with acetylsalicylic acid . among those with paroxysmal af none were on medical treatment ( anticoagulants ) when detected , but all persons with paroxysmal af had a cha2ds2vasc score of 2 and were therefore candidates for follow - up and medical examination .
ninety - two patients ( 46% ) in the study populations had episodes of paroxysmal supraventricular tachycardia .
ventricular premature contractions occurred in 160 patients ( 81% ) , and supraventricular ectopic contractions occurred in 178 patients ( 89% ) , while another common arrhythmia , extra beats unspecified , occurred in 113 patients ( 56.5% ) .
first- and second - degree av block occurred in one man ( 0.5% ) and second - degree av block occurred in one man ( 0.5% ) who was 78 years old ( table 2 ) .
an average recording time with the wireless sensor was calculated from > 1.5 days of use .
however , wireless recordings for those with shorter times were the result of terminations due to technical reasons ( eg , the recorder aborted the recordings ) and personal reasons ( the electrode fell off or the person moved out of range of the telephone ) .
none of the participants terminated the recordings of their own free will prior to the scheduled time , and compliance with the bodykom was at a satisfying level . according to information obtained from interviews after the recording , 162 participants ( 81% ) agreed that the equipment was easy to wear ; only two persons ( 1% ) disagreed .
one hundred and sixty - four patients ( 82% ) agreed that they lived their normal daily life while wearing the equipment .
furthermore , 155 participants ( 77.5% ) thought that sleeping with the equipment worked well , only 1% disagreed .
there were only an average of three equipment of bodykom per day during the study period , but there were slots for four examinations per day in snac - b .
the ecg recording quality of the wireless recorder was satisfactory , with almost negligible disturbances from artifacts , as long as the electrodes were properly attached to the person s skin and the sensor was communicating with the telephone .
analysis times ranged from 0.31 hours to 37.49 hours , and the mean time was 17.29 hours .
there were no significant differences between males and females ( p=0.464 ) or between the two age cohorts ( p=0.564 ) regarding the recording time ( table 3 ) .
the main findings of this study concerned the prevalence of persistent and paroxysmal af in this older outpatient population .
other studies1315,29,30 reflect the fact that the incidence of different arrhythmias increases with age but this expected age - related increased incidence is not seen in this study , probably due to small sample size or the already high age of our cohort .
sinus rhythm was the most common basic rhythm , but persistent af occurred in 20 persons ( 10% ) , including six males and 14 females .
of these , ten persons were 6680 years and ten were > 80 years of age .
characteristics of the study sample , including sex , age , history of diagnosed heart failure , hypertension , diabetes , stroke , and ischemic cardiac disease , did differ between the included and excluded population . among the study population testing the ltr bodykom , 5% had hypertension compared to 11% of those excluded , and heart failure was identified in 5.5% compared to 7.5% , which may indicate that it was comparatively healthy individuals participating in the study and that the incidence of af may be underestimated .
other studies have reported the prevalence of chronic af in the general population to be 1.5%3% in the developed world6,7 and have stated that chronic af increases with age to 20% in the oldest population.8,9 a recently published study that used intermittent ecg recording reported the occurrence of previously unknown af in 3% of participants aged 7576 years old.16 in addition , rich31 reported that the incidence and prevalence of chronic af increase progressively with age , and 50% of patients with chronic af are 75 years .
the occurrence of chronic af and a cha2ds2vasc score of 2 should be addressed by medical treatment with oral anticoagulants.32 in the present study , only nine ( 45% ) of those with persistent af were receiving medical treatment with anticoagulants for their af .
thus , their af was previously diagnosed while the other eleven were undiagnosed , and they were therefore remitted to their family doctor for further examinations .
the ecg recording quality of the wireless recorder was satisfactory , with relatively negligible disturbances from artifacts .
its identification of arrhythmias was consistent with that of other long - term ecgs.2,33 this simple method requires little of the user and thus may be useful in screening the older population for arrhythmias .
although our data were gathered from a small population , they are indicative of the prevalence of arrhythmias in the elderly population . questionnaire interviews with the participants revealed high rates of satisfaction with the equipment and a good overall experience wearing it . participants did not need to worry about the equipment during the time they had it on .
problems reported by the participants included electrodes falling off during the night ( 2.5% ) , itching underneath electrodes ( 1% ) , and concerns about the technical equipment ( 3.5% ) .
there are several types of ecg monitoring , including resting ecg , event recorders , and holter ecgs .
all of these have been tested extensively and are used in clinical environments.34 holter monitors are often used as the standard method,18,19,35 although they have been shown to be more insensitive than implantable devices21 and do not offer , like the bodycom , the possibility of real - time analysis.19 methods such as wireless ltr ecg have been shown to diagnose arrhythmias , including af , with high sensitivity .
their ease of use not only facilitates screening for arrhythmias but may also help to improve quality of care for the older population .
screening may also be useful for identifying high - risk patients with clinically significant arrhythmias that require immediate admission to the cardiology ward .
first , the number of analyzed persons was not very large and , therefore , the presented results must be considered with caution .
a larger population allowing a more rigorous statistical analysis should be required in order to provide confidence in the robustness of this arrhythmia screening strategy .
second , we used registrations of only one day due to limited number of equipment ; we do not know at present the most optimal registration time .
the present study shows that many older outpatients have undiagnosed and thus untreated persistent and paroxysmal af .
this is a challenge for health care providers , and it is essential to develop more effective strategies for the detection , treatment , and prevention of arrhythmias .
this study confirms that the long - term wireless ecg recorder bodykom has good feasibility for arrhythmia screening in older outpatient populations .
arrhythmia screening devices need to be simple to apply , and they must require little from those wearing them .
Output:
| purposewith longer life expectancies , the prevalence of arrhythmias is increasing ; thus , there is a need for new methods to screen the older outpatient population .
this population - based study describes the prevalence of arrhythmias in 200 outpatients aged 66 years .
we also investigated the feasibility of wireless long - term recording ( ltr ) using the ecg-bodykom.methodstwo hundred elderly persons aged 6693 years were recruited from the swedish national study on aging and care in 20102013 , and data were collected via wireless ltr ecg-bodykom.resultsscreening with the ltr ecg revealed that persistent atrial fibrillation ( af ) occurred in 10% of the outpatient population aged 66 years .
paroxysmal af occurred in 5.5% of the population , with no difference between younger ( 6080 years ) and older ( > 80 years ) elderly participants .
furthermore , all patients with paroxysmal af had a cha2ds2vasc score of 2 and were therefore potential candidates for follow - up and medical examination .
ltr ecg - bodykom can be considered a feasible method to screen for arrhythmias in older outpatient populations .
this simple method requires little of the user , and there was high satisfaction with the equipment and a good overall experience wearing it.conclusionthe increasing occurrence of arrhythmias in the older population , as well as the high number of untreated cases of arrhythmias such as persistent af and paroxysmal af , poses a challenge for health care .
therefore , it is essential to develop effective strategies for their prevention and treatment . |
PubmedSumm118408 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a variety of surgical approaches have been used in the treatment of symptomatic patients with cervical discogenic disease refractory to medical management , but anterior interbody fusion of the cervical spine have become the gold standard for treating this kind of diseases ( 13).the most important benefit of anterior approach is that it allows direct visualization of the entire disc space and wide decompression of the anterior aspect to spinal cord and nerve roots . for this procedure various kind of implants such as ceramic , carbon and peek cage have been used ( 48 ) and developed .
the peek cages are widely used because of the immediate good stabilization with minimum donor site - related complications . instead of one possibility , nowadays
another possible treatment is considering ; cervical anterior discectomy without implantation of any structure ( cad ) .
a debate started as which method is the best . while this discussion is still not closed , and it is not clear which one could reduce symptoms and could result in better response in patients .
therefore , the aim of this study was to compare long term follow up results in patients with cervical disk disease treated with anterior peek cage implantation and without it .
during this historical cohort study in rasoul akram hospital ( tehran , iran ) retrospectively 160 patients who underwent cervical disk procedure with anterior approaches more than eight years and came to department of neurosurgery of for follow up , 98 patients were excluded .
this left a study population of 63 patients with known cervical discogenic disorders who went under surgery with and without cage implantation .
all patients were treated by medication and physical therapy for more than three months , but symptoms and signs did not improve .
the neurological examination and neurologic function were assessed by the japanese orthopedic association ( joa ) scoring system before and 8 years after surgery in each patient .
antero posterior and lateral radiographs were performed at before and 8years after follow - up . at the end
also the neurologic state of the patients was evaluated according to the neurological cervical spine scale ( ncss ) ( 9 ) which evaluated motor function of the lower and upper extremities and sensory deficits .
all adult patients aged between 18 and 55 years with cervical disk diseases had signs and symptoms .
exclusion criteria were symptoms and/or signs of myelopathy , previous cervical surgery and psychiatric or mental disease .
anesthetic exposure was via a left - sided skin incision according to the robinson and smith technique ( 10 ) .
the operating levels confirmed with fluoroscope and then peek cage were placed . before closing the wound , a lateral fluoroscopic image was obtained and the correct position of the implant checked .
the study protocol was approved by the ethic committee of the tehran university of medical sciences , tehran , iran . paired and independent
sample t - test and wilcoxin and mc - nemar chi2 were used for data analysis , with the meansd .
all analyses were performed with spss 16.0 ( statistical package for social sciences ) for microsoft windows .
all adult patients aged between 18 and 55 years with cervical disk diseases had signs and symptoms .
exclusion criteria were symptoms and/or signs of myelopathy , previous cervical surgery and psychiatric or mental disease .
anesthetic exposure was via a left - sided skin incision according to the robinson and smith technique ( 10 ) .
the operating levels confirmed with fluoroscope and then peek cage were placed . before closing the wound ,
the study protocol was approved by the ethic committee of the tehran university of medical sciences , tehran , iran .
paired and independent sample t - test and wilcoxin and mc - nemar chi2 were used for data analysis , with the meansd .
all analyses were performed with spss 16.0 ( statistical package for social sciences ) for microsoft windows .
patients were divided into two groups . in the first group , there were 44 levels of anterior cervical surgery with no cage among 35 patients affected by discogenic diseases .
the second group contained 48 levels of anterior cervical fusion from among 27 patients who were fused with peek cage and autograft .
the characteristics of patients are showed in table 2 but in overall view there were not any significant difference between two groups on the bases of aged ( p = 0.342 ) and gender ( p = 0.512 ) .
assessment scale proposed by the joa .
case= anterior approach with cage insertion ; control= anterior the mean preoperative ncss score was 10.71.4 and the mean post operative score after follow up was 12.80.9 .
our samples showed significant difference between pre and post operative function based on ncss score ( p < 0.001 ) .
the ncss score shows significantly different between two groups after surgery ( p = 0.035 ) but this difference before surgery was not significant ( p = 0.163 ) . according to the joa score
, the group with peek cage improved from 11.2 pre - operatively to 14.9after surgery , with no complication . in the second group ,
the post - operative score had achieved 13.22.6 from 10.31.8 , with no non - union and without complication .
no statistical significance difference was observed in joa score and complications before and after procedure , but joa post surgery score between two groups was significantly different ( p = 0.047 ) , and in none of the cases reoperation , graft complications , collapse or dislodgement , operative site infection , esophageal injury or related nerve injury were seen .
present study showed that postoperative function based on ncss score was significantly different between two groups after surgery . since 1950s anterior cervical discectomy and fusion has gained immense popularity by smith robinson and cloward ( 11 , 12 ) .
however donor site morbidity were common so other study evaluated better material for interbody fusion ( 7 , 16 , 17 ) . in the present study
satisfactory results were seen in patients who treated with peek cages in comparison with other who were not .
jung cc ( 18 ) reported cervical fusion using the cage containing a bovine xenograft , with 84% good to excellent results and a subsidence rate of 8% . in another study topuz k ( 19 ) showed that cervical fusion with peek cage packed with demineralized bone matrix had 87% good to excellent results and a non - union rate of 8.3% .
it seems one of the most important things which changed interbody cages implantation to the popular procedure is providing immediate stability , restoring alignment and minimizing operative time and complications which seen in the present study .
our study was performed to evaluate the results of treatment of cervical disk diseases with anterior cervical disectomy and fusion , which provided stability by the peek cage , and in compared anterior disectomy without cage .
we found anterior cervical discectomy and fusion with peek cage is more effective than anterior disectomy without peek cage in terms of subsidence and nonunion .
there has not been any study to compare the anterior disectomy in patients with use of peek cage and patients without cage .
however , present study based on joa score showed that peek cage implantation had little problem with donor pain .
to reduce donor site complications and operative times , peek cage in disectomy is better than disectomy without peek cage .
in conclusion , present study showed that peek cage implantation is a highly useful alternative to the conventional treatment methods .
Output:
| backgroundanterior interbody fusion of the cervical spine have become the gold standard for treating spinal diseases , hence the aim of this study was to compare long term follow up results in patients with cervical disk disease treated with anterior peek cage implantation and without it in anterior approach.methodsretrospectively 63 patients with known cervical discogenic disorders who went under surgery with and without cage implantation were enrolled .
the neurological examination and neurologic function were assessed by using the japanese orthopedic association ( joa ) scoring system and neurological cervical spine scale ( ncss ) before and 8 years after surgery in each patient and at the end all complications were recorded.resultsin the first group , there were 15 males and 14 females ( mean age : 4910 years ) and in the second group there were 27 male and 7 female ( mean age : 479 years ) .
the ncss score was significantly different between two groups after surgery ( p = 0.035 ) but there was no significant difference before surgery ( p = 0.163 ) .
no statistical significance difference was also observed in joa score and complications before and after procedure , but joa post surgery score between two groups had significant difference ( p = 0.047).conclusionin conclusion , present study showed that peek cage implantation is a highly useful alternative to the conventional treatment methods . |
PubmedSumm118409 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: scrub typhus , also known as tsutsugamushi disease , is caused by orientia tsutsugamushi , which is considered to be an acute infectious disease and to be successfully cured with antibiotics .
studies using the polymerase chain reaction ( pcr ) reveal that o. tsutsugamushi dna in blood disappears gradually over 1 month after antibiotic treatment ( 1 - 4 ) .
it has not been clarified whether the dna detected by pcr after the disappearance of symptoms of scrub typhus represents dead or viable bacteria , and its relevance and clinical significance have not been investigated .
although isolation of o. tsutsugamushi beyond 1 month after scrub typhus in humans has been reported sometimes ( 5 - 7 ) , these cases are thought to be exceptional .
contrast to the short duration of scrub typhus in humans , persistence of o. tsutsugamushi is a common finding in mice ( 8 - 14 ) .
ability of o. tsutsugamushi to persist in cell culture assay is also documented ( 15 ) .
chloramphenicol and tetracyclines show bacteriostatic effects against o. tsutsugamushi in mice ( 10 , 16 ) ; therefore , theoretically antibiotics can not eradicate the bacterium from the human body .
although the immune system is known to be involved in the recovery of an individual from scrub typhus and in protection from rechallenge of o. tsutsugamushi ( 17 ) , it is never been proven that this system can completely eradicate o. tsutsugamushi from the human body . in the present study , we investigated the persistence of viable o. tsutsugamushi and its association with any clinical or laboratory abnormalities in patients who had recovered from scrub typhus
blood specimens beyond 30 days after the onset of fever ( defined as ' chronic phase ' ) were available from 6 patients .
five patients ( patient no . 1 to 5 ) were followed from the onset of scrub typhus diagnosed at our hospital between 2008 and 2009 , and 1 patient ( patient no .
scrub typhus was diagnosed by the presence of fever and positive serology or blood nested pcr that was performed as described previously ( 3 ) .
details of cell culture and immunofluorescent ( if ) staining were described previously ( 15 ) .
briefly , 0.3 ml of edta - treated whole blood was inoculated into a monolayer of ecv304 cells ( 18 ) grown in a tissue culture flask ( 25 cm ) .
twenty - four hours later , the inoculated blood was washed out with phosphate buffered saline , and culture was maintained in m199 medium ( gibco brl , gaithersburg , md , usa ) supplemented with 10% heat - inactivated fetal bovine serum ( gibco brl ) at 37 in a humidified atmosphere containing 6% co2 .
media were changed every 3 to 4 days , and cultures were maintained for 7 months without subculture . during the maintenance of the cell culture ,
cell cultures were inspected daily with optical microscopy ( olympus , tokyo , japan ) .
after cytopathic changes were identified , a small amount of the ecv304 monolayer was aspirated with a pipette , and if staining of the aspirate was performed with mouse polyclonal hyperimmune serum against the boryong strain of o. tsutsugamushi . for negative control , blood from 5 healthy persons and 5 patients with unrelated illnesses ( cerebrovascular accident [
n = 2 ] ; acute myocardial infarction [ n = 2 ] ; and diabetes mellitus [ n = 1 ] ) were processed as the same manner . to identify the genotype of cultured isolates and to compare nucleotide sequences of the isolates ,
the 56-kda type - specific antigen ( tsa56 ) gene of o. tsutsugamushi was amplified using pcr and then sequenced .
genomic dna from the infected ecv304 cells was prepared with qiaamp dna mini kit ( qiagen , hilden , germany ) according to the manufacturer 's instruction .
the primer set used for the amplification of the first half tsa56 gene of o. tsutsugamushi were primer 1 ( forward ) ( 5'-tttcgaacgtgtctttaagc-3 ' ; corresponding to nucleotide position -266 to -285 from the start codon of the 56-kda gene based on the gilliam strain ) and primer 2 ( reverse ) ( 5'-acagatgcactattaggcaa-3 ' ; 847 - 865 ) .
primer 3 ( forward ) ( 5'-atgctaataaacctagcgct-3 ' ; 731 - 749 ) and primer 4 ( reverse ) ( 5'-ctagaagttatagcgtacacctgcacttgc-3 ' ; 1546 - 1575 ) were used for amplification of the second half one .
primer 9 ( 5'-gtttagaatggttaccac-3 ' ; -36 to -53 ) and primer 7 ( 5'-agcgctaggtttattagcat-3 ' ; 731 - 749 ) were used for sequencing of the amplified first half of the tsa56 gene , and primer 8 ( 5'-tccacatacacaccttcagc-3 ' ; 1459 - 1478 ) and primer 10 ( 5'-cctagcgttactcctgtcaaag-3 ' ; 742 - 763 ) were used for the amplified second half of the tsa56 gene .
the first half of the tsa56 gene was amplified in a 50-l reaction mixture consisting of 5 l of template dna , 250 m ( each ) deoxynucleotide triphosphate , 200 m each of primers 1 and 2 , 1.25 u of taq polymerase and 5 l of 10 pcr buffer ( takara shuzo co. , kyoto , japan ) in a perkin - elmer model 9600 thermocycler ( perkin - elmer cetus instruments , norwalk , ct , usa ) .
the mixture was incubated in the thermal cycler at 94 for 5 min , then cycled 30 times at 94 for 1 min , at 55 for 1.5 min , at 72 for 2 min , and finally once at 72 for 7 min .
amplification of the second half of the tsa56 gene was performed as described above except that primers 3 and 4 were used and the annealing period was shortened to 1 min instead of 1.5 min .
the amplified products were electrophoresed in 1.5% agarose gels , purified with the qiaquick kit ( qiagen ) , and sequenced by the single - pass sequencing method using the bigdye terminator cycle sequencing reaction kit and abi prism 3700 & 3730xl automatic sequencer ( applied biosystems , foster city , ca , usa ) .
genotypes of the isolates were determined by identifying a representative strain revealing a maximum pairwise identity score with the tsa56 gene from the genbank ( national institutes of health , bethesda ,
md , usa ) , and sequence homology of the isolates were examined by pairwise comparisons using blast ( national institutes of health ) .
the study protocol was approved by the institutional review board of inha university hospital ( irb no .
blood specimens beyond 30 days after the onset of fever ( defined as ' chronic phase ' ) were available from 6 patients .
five patients ( patient no . 1 to 5 ) were followed from the onset of scrub typhus diagnosed at our hospital between 2008 and 2009 , and 1 patient ( patient no .
scrub typhus was diagnosed by the presence of fever and positive serology or blood nested pcr that was performed as described previously ( 3 ) .
details of cell culture and immunofluorescent ( if ) staining were described previously ( 15 ) .
briefly , 0.3 ml of edta - treated whole blood was inoculated into a monolayer of ecv304 cells ( 18 ) grown in a tissue culture flask ( 25 cm ) .
twenty - four hours later , the inoculated blood was washed out with phosphate buffered saline , and culture was maintained in m199 medium ( gibco brl , gaithersburg , md , usa ) supplemented with 10% heat - inactivated fetal bovine serum ( gibco brl ) at 37 in a humidified atmosphere containing 6% co2 .
media were changed every 3 to 4 days , and cultures were maintained for 7 months without subculture . during the maintenance of the cell culture ,
cell cultures were inspected daily with optical microscopy ( olympus , tokyo , japan ) .
after cytopathic changes were identified , a small amount of the ecv304 monolayer was aspirated with a pipette , and if staining of the aspirate was performed with mouse polyclonal hyperimmune serum against the boryong strain of o. tsutsugamushi . for negative control , blood from 5 healthy persons and 5 patients with unrelated illnesses ( cerebrovascular accident [
n = 2 ] ; acute myocardial infarction [ n = 2 ] ; and diabetes mellitus [ n = 1 ] ) were processed as the same manner .
to identify the genotype of cultured isolates and to compare nucleotide sequences of the isolates , the 56-kda type - specific antigen ( tsa56 ) gene of o. tsutsugamushi was amplified using pcr and then sequenced .
genomic dna from the infected ecv304 cells was prepared with qiaamp dna mini kit ( qiagen , hilden , germany ) according to the manufacturer 's instruction .
the primer set used for the amplification of the first half tsa56 gene of o. tsutsugamushi were primer 1 ( forward ) ( 5'-tttcgaacgtgtctttaagc-3 ' ; corresponding to nucleotide position -266 to -285 from the start codon of the 56-kda gene based on the gilliam strain ) and primer 2 ( reverse ) ( 5'-acagatgcactattaggcaa-3 ' ; 847 - 865 ) .
primer 3 ( forward ) ( 5'-atgctaataaacctagcgct-3 ' ; 731 - 749 ) and primer 4 ( reverse ) ( 5'-ctagaagttatagcgtacacctgcacttgc-3 ' ; 1546 - 1575 ) were used for amplification of the second half one .
primer 9 ( 5'-gtttagaatggttaccac-3 ' ; -36 to -53 ) and primer 7 ( 5'-agcgctaggtttattagcat-3 ' ; 731 - 749 ) were used for sequencing of the amplified first half of the tsa56 gene , and primer 8 ( 5'-tccacatacacaccttcagc-3 ' ; 1459 - 1478 ) and primer 10 ( 5'-cctagcgttactcctgtcaaag-3 ' ; 742 - 763 ) were used for the amplified second half of the tsa56 gene .
the first half of the tsa56 gene was amplified in a 50-l reaction mixture consisting of 5 l of template dna , 250 m ( each ) deoxynucleotide triphosphate , 200 m each of primers 1 and 2 , 1.25 u of taq polymerase and 5 l of 10 pcr buffer ( takara shuzo co. , kyoto , japan ) in a perkin - elmer model 9600 thermocycler ( perkin - elmer cetus instruments , norwalk , ct , usa ) .
the mixture was incubated in the thermal cycler at 94 for 5 min , then cycled 30 times at 94 for 1 min , at 55 for 1.5 min , at 72 for 2 min , and finally once at 72 for 7 min .
amplification of the second half of the tsa56 gene was performed as described above except that primers 3 and 4 were used and the annealing period was shortened to 1 min instead of 1.5 min .
the amplified products were electrophoresed in 1.5% agarose gels , purified with the qiaquick kit ( qiagen ) , and sequenced by the single - pass sequencing method using the bigdye terminator cycle sequencing reaction kit and abi prism 3700 & 3730xl automatic sequencer ( applied biosystems , foster city , ca , usa ) .
genotypes of the isolates were determined by identifying a representative strain revealing a maximum pairwise identity score with the tsa56 gene from the genbank ( national institutes of health , bethesda , md , usa ) , and sequence homology of the isolates were examined by pairwise comparisons using blast ( national institutes of health ) .
the study protocol was approved by the institutional review board of inha university hospital ( irb no .
all six patients revealed o. tsutsugamushi in blood culture in the afebrile state at 1 to 18 months after scrub typhus ( table 1 ) .
the genotypes of isolates were the boryong in five patients ( patients 2 , 3 , 4 , and 6 ) and non - boryong genotypes in two patients ( yonchon from patient 1 and karp from patient 5 ) .
nucleotide sequences of isolates serially collected from each patient were identical in all five patients in whom nucleotide sequences were compared .
nucleotide sequences of 9 isolates typed as the boryong were 99% to 100% homologous , thus it is less helpful to differentiate each other ; however , 2 isolates of the yonchon and 2 isolates of the karp types were distinctively different from other isolates . from 5 healthy persons and 5 patients with unrelated illnesses , no organism was isolated .
patient 1 , who presented with shock and was managed with steroid in addition to azithromycin , experienced a relapse 2 days after completion of 7-days ' azithromycin therapy ; treatment with doxycycline abated fever .
patients 1 and 2 complained of weakness in the absence of fever for 1 to 2.5 months after the illness and revealed positive blood nested pcrs ; patient 1 showed abnormal aminotransferase level on day 31 ; and patient 2 revealed leukopenia on day 73 , and retreatment with doxycycline resulted in improvement of weakness over 5 days .
patient 4 showed elevated erythrocyte sedimentation rate and positive pcrs 2 times over 4 months and experienced a transient ischemic attack ( tia ) 8 months after scrub typhus .
patient 6 , who had been managed with angina pectoris , experienced dizziness of cardiac origin and underwent percutaneous coronary angioplasty 6 months after scrub typhus .
asymptomatic harboring of o. tsutsugamushi or its dna is frequently observed in animals , and these data are regarded as to represent an indirect evidence of persistent o. tsutsugamushi infection .
for example , jackson et al . ( 8) isolated o. tsutsugamushi from 12 ( 13.2% ) among 91 wild rodents in korea . using pcr ,
o. tsutsugamushi dna was detected in 12 ( 9.5% ) among 127 wild rodents ( 9 ) . in studies with experimentally infected mice , persistence of o. tsutsugamushi
using mouse inoculation , persistence of viable o. tsutsugamushi is documented for up to 100 ( 10 ) , 270 ( 11 ) , and 610 days ( 12 ) , irrespective of antibiotic therapy . nested pcr also revealed persistence of o. tsutsugamushi dna until 64 days after infection ( 13 ) . on the contrary
hayashi and watanabe ( 5 ) detected o. tsutsugamushi bacteremia in a patient who was at 34 days after defervescence .
the pescadores strain of o. tsutsugamushi was isolated from a patient at 5 months after scrub typhus ( 6 ) .
( 7 ) recovered o. tsutsugamushi from the lymph nodes of 1 person among 12 who had experienced scrub typhus 1 to 2 yr previously . because these 3 reports were performed before the introduction of modern technology , identification of isolates is not sufficient to affirm the homology of isolates . in volunteers experimentally infected by laboratory - reared chiggers ,
thereafter , attempts to isolate viable o. tsutsugamushi from patients have seldom been tried . instead , in recent years
, pcr has been used to show that o. tsutsugamushi dna disappeared gradually over 5 to 27 days after administration of antibiotics and reaffirmed short duration of o. tsutsugamushi bacteremia in human ( 1 - 4 ) .
these pcr data were contrasted to the result of the present study , and the main reason for the difference is thought to be low sensitivity of pcr .
nested pcr is very sensitive enough to detect 10 attogram ( 10 g ) , i.e. , 1 copy , of o. tsutsugamushi dna , if it is performed by an experienced person and using southern blot hybridization .
however , if agarose gel electrophoresis is used , which was used in the above pcr studies , the sensitivity is lowered by 10 .
additionally , if clinical specimens such as blood or spleen are examined , it can lower the sensitivity of pcr further ( 13 ) . among the above pcr studies , only 1 study described that the detection threshold of the study method was 100 femtogram ( 10 g ) , i.e. , 10 copies , of o. tsutsugamushi dna ( 2 ) .
the quantity of o. tsutsugamushi in blood during scrub typhus , which was evaluated by real - time pcr , varies from undetectable level during days 1 - 4 to up to 10 copies per ml during days 9 - 12 ; and the detection limit of the real - time pcr was 1,062 target gene copies per ml of edta blood ( 21 ) .
we assume that the quantity of o. tsutsugamushi in blood during the chronic phase is below the quantity during days 1 to 4 .
thus , nested pcr employed in clinical practice can not detect o. tsutsugamushi dna during the chronic phase in most scrub typhus patients .
more importantly , the reason that the pcr studies did not detect o. tsutsugamushi dna beyond 1 month of scrub typhus is that there has been little attempt to detect dna beyond 1 month after the onset of scrub typhus ( 1 - 4 , 21 ) .
our study confirmed that the remaining dna beyond the symptomatic period of scrub typhus was due to viable o. tsutsugamushi .
cell culture has several disadvantages , such as requirement of long incubation , infectious hazard , and inability to detect dead organism ; however , theoretically it can detect even 1 viable organism in blood .
regardless of which method is more sensitive , our study revealed a high isolation rate of o. tsutsugamushi during the chronic phase .
one concern is laboratory contamination of cell culture during long incubation ; however , this possibility can be excluded by the following reasons : firstly , our laboratory has about two decades ' experiences in cultivating o. tsutsugamushi and maintains the contamination rate as minimal .
cell culture is not intrinsically prone to contamination as pcr , and if contamination occurs , bacterial contamination is more likely , and in turn culture is grossly spoiled .
secondly , nucleotide sequences of the isolates were identical within each patient , but different between patients infected by different genotypes .
although the persistence of o. tsutsugamushi and its clinical significance in humans are firstly documented in the present study , persistence of rickettsia prowazekii , a bacterium closely related to o. tsutsugamushi , in humans is well known , and brill - zinsser disease is a relapse of latent r. prowazekii infection . likewise ,
it is already known that " early relapse " , i.e. , recurrence of fever within several days after completion of antibiotic therapy , is occasionally observed when antibiotic therapy is discontinued before the development of the protective immunity .
in addition , " prolonged convalescence " , i.e. , persistent vague symptoms such as weakness in the absence of fever , as shown in patients 1 and 2 , was clarified to be associated with the presence of o. tsutsugamushi in blood .
this complication seems to occur as a result of slow development of the immunity . "
late relapse " , i.e. , recurrence of scrub typhus several months or years after the initial o. tsutsugamushi infection , is surely possible .
reactivation of dormant o. tsutsugamushi infection is documented in mice after inoculation of heterologous strain of o. tsutsugamushi or treatment with cyclophosphamide ( 14 ) ; in humans , coinfection of scrub typhus and leptospirosis ( 22 ) , especially in patients not accompanied with eschar , may represent reactivation of scrub typhus triggered by leptospirosis .
although it is not certain whether occurrence of the tia in patient 4 and aggravation of coronary artery disease in patient 6 are related with persistent o. tsutsugamushi infection , these cases raise the necessity of long - term follow - up of scrub typhus patients , especially if they have multiple risk factors for atherosclerosis .
o. tsutsugamushi is a representative bacterium infecting vascular endothelium , and infection may be one of risk factors for progression of atherosclerosis ( 23 ) .
furthermore , antibiotics can not eradicate o. tsutsugamushi , so once o. tsutsugamushi infection occurs , its effect may persists for a long time .
Output:
| we investigated the persistence of viable orientia tsutsugamushi in patients who had recovered from scrub typhus .
blood specimens were available from six patients with scrub typhus who were at 1 to 18 months after the onset of the illness .
the edta - treated blood specimens were inoculated into ecv304 cells , and cultures were maintained for 7 months .
sequencing of the 56-kda type - specific antigen gene of o. tsutsugamushi was performed to ascertain the homology of isolates .
o. tsutsugamushi was isolated from all six patients , and nucleotide sequences of isolates serially collected from each patient were identical in all five patients in whom nucleotide sequences were compared .
one patient relapsed 2 days after completion of antibiotic therapy ; two patients complained of weakness for 1 to 2.5 months after the illness ; one patient underwent coronary angioplasty 6 months later ; and one patient suffered from a transient ischemic attack 8 months later .
this finding suggests that o. tsutsugamushi causes chronic latent infection , which may be associated with certain clinical illnesses , preceded by scrub typhus .
antibiotic therapy abates the symptoms of scrub typhus , but does not eradicate o. tsutsugamushi from the human body . |
PubmedSumm118410 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: anthocyanins are the most important group of water - soluble plant pigments visible to the human eye .
these pigments are responsible
for a great variety of colours of several fruits , vegetables , and
plants .
the colour of red wine is manly due to the presence of
these polyphenolic compounds extracted from grape berries during
the wine - making process .
the general structure of
vitis vinifera
anthocyanidin monoglucosides is represented in
figure 1 .
these compounds differ in their
hydroxylation and methoxylation patterns of ring b yielding a
wide range of colours from orange - red to violet at very acidic ph
.
the glucosyl moiety linked at the 3-o position
of ring c may also be acylated with acetic acid , coumaric acid , or
caffeic acid .
these compounds undergo chemical transformations during wine
ageing yielding new pigments that become responsible for the
changing colour and its longevity .
these new pigments
were first thought to result mainly from condensation reactions
between anthocyanins and flavanols directly or mediated by
acetaldehyde [ 3 , 4 , 5 , 6 , 7 , 8 , 9 ] . nevertheless , over the
last decade , reactions involving anthocyanins with other
compounds such as pyruvic acid [ 10 , 11 , 12 , 13 , 14 , 15 ] ,
vinylphenol [ 16 , 17 ] , vinylcatechol ,
-ketoglutaric acid , acetone [ 19 , 20 , 21 ] ,
and 4-vinylguaiacol have been demonstrated yielding new
families of anthocyanin - derived pigments , namely ,
pyranoanthocyanins , with spectroscopic features that may somehow
contribute to a more orange - red colour .
this family of
pyranoanthocyanins has been extensively investigated over the
last years and several compounds have been recently evidenced in
aged port red wines [ 22 , 23 , 24 ] ( see table 1 and figure 2 ) .
it is interesting to notice that the anthocyanins - catechin
pigments revealed the same max as the pyruvate derivatives ,
which is hypsochromically shifted from that of original
anthocyanins .
strikingly , pigments 9 and 13 which contain a
procyanidin dimer unit in their structure revealed an important
bathochromic shift ( 9 nm ) from that of their counterparts with a
single flavanol monomeric unit ( ( + ) -catechin or ( )-epicatechin ) .
this outcome highlights the importance of the type of flavanol
moiety on the color characteristics of the pigments ( and it
suggests that some kind of intramolecular copigmentation between
the flavanol residue and the flavylium chromophore may somehow
occur ) .
more recently , two new pigments with unique spectroscopic
features exhibiting a bluish colour in acidic solution were found
to occur in aged port red wines ( see figure 3 ,
pigments 22 and 23 ) . indeed , these two pigments with maximum
absorption in the visible region at 583 nm were detected by hplc
in two - year - old port wine samples .
these newly formed pigment
structures in which anthocyanins are linked to flavanols by a
vinyl linkage were named as portisins .
likewise , similar pigments
arising from different anthocyanins and flavanols were
tentatively detected by lc - dad - ms in port wine
samples ( table 2 ) .
furthermore , a portisin with a phenol group replacing the
flavanol moiety ( pigment 26 ) has also recently been found to occur
in
aged port wine ( table 2 ) ( n. mateus et al ,
unpublished data ) .
however , the maximum absorption of this pigment in the visible
region ( 538 nm ) was found to be quite hypsochromically
shifted from that of portisins with a flavanol moiety
( figure 4 ) .
the small hydroxylation pattern of the
phenol ring probably contributes to this hypsochromic shift
more significantly compared to the
phloroglucinol ring of flavanols .
effectively , a similar pigment
with a phloroglucinol moiety replacing the phenol group resulting
from the reaction between malvidin 3-o - glucoside and
phloroglucinol in the presence of acetaldehyde was shown to have
a max of 565 nm ( unpublished data ) .
pyranoanthocyanin structures detected in wine fractions
( table 1 ) ; cat = catechin ; epi = epicatechin .
portisin structures detected in port red wine fractions
( table 2 ) ; cat = catechin ; pc = procyanidin
dimer .
( a ) uv - vis spectra of malvidin 3-o - glucoside ( solid ) , ( b )
vinylpyranomv-3-gluc - phenol ( dashed ) , and ( c )
vinylpyranomv-3-gluc - phloroglucinol ( dotted ) recorded from the hplc
diode array detector ( ph = 1.5 ) .
r1 and r2 are
h , oh , or ome , r3 is an
( -o - glycosyl ) group which is substituted with one , or
more acyl groups , and r4 is an
aryl .
( a ) anthocyanins after 2 days of reaction with pyruvic acid :
cy-3-(samb)-5-gluc ( 1 ) , cy-3-samb + cy-3-gluc ( 2 ) , cy-3-samb - py ( 3 ) ,
cy-3-gluc - py ( 4 ) ; ( b ) portisins : vinylpyranocy-3-samb ( 5 ) ,
vinylpyranocy-3-gluc ( 6 ) .
concerning their formation , this new class of anthocyanin - derived
pigments may be obtained through a reaction between
anthocyanin - pyruvic - acid adducts and other compounds such as
flavanols ( eg , catechins , procyanidins ) or phloroglucinol in the
presence of acetaldehyde ( figure 5 ) , or
directly by reaction with p - vinylphenol . the last step of their
formation is thought to include decarboxylation , dehydration , and
oxidation yielding a structure with extended conjugation of the
electrons , which is likely to confer a higher stability of
the molecule and is probably at the origin of its blue color .
similar vinylpyranoanthocyanins had previously been synthesized
using starting chemicals not found in grapes or in the yeasts
.
the chromatic features of this kind of pigments bring promising
expectations concerning the use of these naturally occurring blue
pigments in the food industry . indeed , despite the extensive
colour palette available in nature , pigments exhibiting blue
colours are very scarce . for instance , the blue colours displayed
by some flowers are mainly due to copigmentation phenomena
[ 28 , 29 , 30 , 31 , 32 ] .
moreover , bluish hues may be obtained
by the presence of quinonoidal forms of anthocyanins in high ph
media [ 33 , 34 ] .
therefore , the food industry has been searching for new
alternative ways to produce products ( foodstuffs and beverages )
with bluish colours .
bearing this in mind , the production of
bluish pigments was attempted in the laboratory using different
precursors .
firstly , the formation of such pigments requires
anthocyanins , which can be obtained using several red fruit
extracts .
sweet cherry , bilberry , red apple , plum , blackberry ,
and elderberry extracts were used as anthocyanin sources for the
synthesis of anthocyanin - derived pigments . following this ,
the
formation of the anthocyanin - pyruvic - acid adduct was achieved
through a reaction with pyruvic acid , as previously developed for
grape malvidin 3-o - glucoside - pyruvic - acid adduct .
the different anthocyanins from the red fruit extracts
yielded pyruvic acid adducts with a max hypsochromically
shifted from that of genuine anthocyanins , some of which are indicated
in table 3 . consequently , the colour of all the extracts
turned to a more orange - like hue .
these anthocyanin - pyruvic - acid
adducts were used as precursors for the formation of portisins ,
which was attempted using ( + ) -catechin in the presence of
acetaldehyde . as an example ,
figure 6 shows the anthocyanin profile of
an elderberry extract ( sambucus nigra ) after two days of reaction
with pyruvic acid .
the anthocyanins of elderberries are two
cyanidin monoglucosides ( 2 ) ( cyanidin 3-o - glucoside and
cyanidin 3-o - sambubioside ) and a cyanidin
3,5-diglucoside ( 1 ) ( 3-o - sambubioside ,
5-o - glucoside ) .
this latter is not likely to react
with pyruvic acid as position 5-o of the anthocyanin must be
free from any substitution . therefore , the only two pigments
formed are the pyruvic acid adducts of the cyanidin
monoglucosides ( ( 3 ) and ( 4 ) ) , as seen from the respective hplc
chromatogram recorded at 520 nm ( figure 6a ) .
moreover , the hplc chromatogram recorded at 570 nm of the
purified pyruvate extract further treated with catechin in the
presence of acetaldehyde is shown in figure 6b .
this
portisin profile of the elderberry extract was obtained when
practically all the pyruvic acid derivatives had reacted .
the two
portisins obtained correspond to the vinylpyranoanthocyanins of
cyanidin 3-o - glucoside ( 5 ) and cyanidin
3-o - sambubioside ( 6 ) , as confirmed by lc - dad - ms
( data not shown ) .
overall , the malvidin monoglucosides and derivatives appeared to
be the anthocyanins with the highest max in the
uv - vis spectrum when compared with cyanidin mono- or diglucosides ,
as seen from table 3 .
the type of sugar moiety and
the presence of a mono- or disaccharide in the anthocyanin
structure did not seem to induce any influence on its
max . this behaviour was also observed with regard to
the anthocyanin - pyruvic - acid adducts and the respective portisins .
additionally , acylation of the sugar moiety of malvidin
monoglucosides with p - coumaric acid yielded in a max
higher than its nonacylated counterpart .
it has already been
reported that , in the case of anthocyanins , acylation of the sugar
moiety with hydroxycinnamic acids induces a bathochromic shift , as
well as an intensification and stabilization of the colour , probably
through intramolecular copigmentation phenomena , as reported
elsewhere .
this bathochromic shift arising from the
acylation of the sugar moiety was also observed for the portisins
reported in aged port red wine ( table 3 ) .
the search for new natural food colourings has attracted the
interest of several manufacturers over the last years . from the
organoleptic point of view and considering the available colours
widespread in nature
therefore , the production of new natural blue colourings for the
food industry appears to be a priority . concerning the food
quality and safety , the natural colourings present significant
benefits compared to the synthetic ones ,
even if it may be
due to psychological concerns of the consumer . in fact
,
nature - derived pigments are easily accepted as being healthy and
are thus a major issue for the food industry .
( mv = malvidin ; dp = delphinidin ; pt = petunidin ; pn = peonidin ;
py = pyruvic
acid derivative ; gluc = glucoside ; cat = ( + ) -catechin or ( )-epicatechin ;
pc = procyanidin dimer . ) portisins detected in port wine fractions .
( mv = malvidin ; pn = peonidin ;
pt = petunidin ; gluc = glucoside ;
cat = catechin ; pc = procyanidin dimer . ) some anthocyanins respective pyruvic acid adducts and
portisins obtained from different red fruit extracts .
( cy =
cyanidin ; mv = malvidin ; py = pyruvic acid derivative ; gluc =
glucoside ; samb = sambubiose ; ara = arabinose ; rut = rutinose ;
cat = catechin . )
Output:
| the use of anthocyanins has been investigated for the preparation
of food and beverage natural colorants as they seem to have
nontoxic effects . in this context , vinylpyranoanthocyanins were
recently found to naturally occur in ageing red wine .
this new
family of anthocyanin - derived pigments may be obtained directly
through the reaction between anthocyanin derivatives and other
compounds .
some of these newly formed pigments have been found to
exhibit a bluish color at acidic ph .
the formation of bluish
pigment was obtained through reaction between
anthocyanin - pyruvic - acid adducts and flavanols in the
presence of acetaldehyde .
the formation of similar bluish
pigments was attempted using other different precursors .
the chromatic features of this kind of pigments bring promising
expectations concerning the use of these naturally occurring blue
pigments in the food industry . |
PubmedSumm118411 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 46-year - old male had been admitted in the intensive care unit ( icu ) for severe chronic obstructive pulmonary disease ( copd ; bronchial asthma ) .
based on the clinical picture of acute bilateral proptosis with retracted lids [ fig . 1 ] and
patient 's history of similar episode in the past , a diagnosis of globe luxation was made and the globe was reduced by pressing on the superior sclera down and back while pinching the upper lid [ figs . 2 and 3 ] . history from the patient and his wife revealed that he had previous such episodes over past 45 years .
the episodes initiated after he started developing wheezing episodes and most of the globe luxation episodes occurred along with exacerbations of copd .
ct scan showed a proptosed eye with a stretched optic nerve because patient developed luxation while ct was being performed .
right eye still luxated both globes have been reduced ct scan showing bilateral prominent globe luxation with stretched optic nerve during his stay in icu , the patient had repeated episodes of globe luxation ( almost every 2 hours ) which was reduced each time .
bilateral temporary tarsorrhaphy was done after five to six episodes of repeated globe luxation to prevent the repeated proptosis .
unfortunately , the patient developed complications such as respiratory paralysis and septicemia and expired on the third day of admission .
kunesh et al . reviewed and found 26 reported cases of spontaneous globe luxation till 2001 .
after that , another four case reports regarding spontaneous globe luxation could be identified in literature review till 2010 .
spontaneous globe luxation occurs in patients with thyroid eye disease , proptosis , floppy eyelid syndrome and shallow orbit .
luxation can be precipitated by lid manipulation , valsalva maneuver , trauma , general anesthesia and even by contact lens insertion .
structural anomalies resulting in laxity of orbital ligaments and extraocular muscles can predispose to globe luxation .
once the luxation starts , the orbicularis muscle goes into spasm to maintain the state of luxation .
the case reported here had a history of globe luxation whose onset correlated with increased severity of copd .
preexistent weaknesses of extraocular muscles and ligaments could have predisposed the patient for globe luxation .
review of literature did not reveal any such case of luxation being precipitated and aggravated by copd .
management consists of simple reducing maneuvers like asking the patient to look down , pinching the upper lid and pressing on the superior sclera down and back .
this simple technique can be taught to the patient also and can help to avoid severe anxiety when the patient develops such an episode where help may not be available .
surgical treatment consists of lateral tarsorrhaphy , pentagonal wedge eyelid resection and advancement of orbital wall . but
lateral tarsorrhaphy has also been reported to increase the risk of luxation by producing a tighter orbit and increased intraorbital pressure , and once luxation occurs , the smaller remaining palpebral aperture can hinder the reduction of the globe .
Output:
| spontaneous globe luxation is a rarely reported condition which can lead to complications like optic neuropathy .
common causes are thyroid eye disease , shallow orbit and floppy eyelid syndrome .
we report a case of spontaneous globe luxation with the onset and severity associated with chronic obstructive pulmonary disease ( copd ) . to our knowledge
, this is the first case of spontaneous globe luxation associated with copd . |
PubmedSumm118412 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: multiple sclerosis ( ms ) is a demyelinating inflammatory disease of the central nervous system that is identified with the triad of inflammation , demyelination , and gliosis .
it has been a long time since identifying much higher prevalence of ms in economically developed countries than in the developing countries .
one of the theories proposed to explain this increase in developed regions is a low prevalence of parasitic infections in these areas .
this theory , named old friends hypothesis as an amendment to the well - known hygiene hypothesis was first proposed by strachan in 1998 and widely received by the world 's medical community .
this theory states that microorganisms such as lactobacilli and parasitic worms play an important role in regulating the immune system in the human body as their host .
hence , their elimination from modern life leads to diseases induced by deregulation of the immune system such as autoimmune , and allergy .
in other words , these biological factors can activate the immune response against them , and prevent or modulate damage to own antigens due to the high antigenic power including the immune system . to confirm the above theory ,
the last decade was full of studies investigating the regulation of host immunity at cellular and molecular scales that suggested numerous mechanisms and paths for this regulation .
most drugs used , including mitoxantrone , avonex , and beta - interferon are immune modulators and prevent the incidence of symptoms and progress of the disease .
given issues discussed , and mechanisms of drugs mentioned , methods that can prevent attacks on self - antigens and the incidence of autoimmune diseases without suppressing the immune system could be effective in control of the disease . in animal models , there is a correlation between parasitic infections and autoimmune diseases such as ms , and these infections can cause modulation of the immune system , and consequently remitting the symptoms of autoimmune diseases . in this study we aimed to compare the frequency of blood tissue parasitic infections in patients with ms as compared to their family members .
this descriptive - analytical study was conducted on 50 relapsing - remitting ms patients resident in isfahan province and 50 family members cohabiting with the patients , attending ms clinic at alzahra hospital .
the study commenced after explaining the objectives of the project , completing the questionnaires and obtaining their written consents . to prepare serums for measuring igm and igg anti - toxoplasma gondii
, blood samples were centrifuged without the anticoagulation agent , and serums were tested for anti - t .
gondii igg and igm antibodies titers by commercially available enzyme immunoassays ( euroimmun , germany ) with an automatic microplate spectrophotometer ( bio - tek instruments inc .
analyses were performed as instructed by the manufacturers , at the school of medicine , isfahan university of medical sciences .
results were obtained by comparison with a cut - off value measured at 450 nm absorbance . according to the manufacturer instruction of the kit , an isr 13.05
was considered as positive . meanwhile , given the prevalence of cutaneous leishmaniasis in isfahan region , the participants were examined for protozoan leishmania microscopically .
the samples were taken of those participants with fresh wounds , and after preparing smear slides , they received final approval using giemsa staining , but the other group with only a scar was analyzed in the group with the history of this disease . to investigate malaria parasite ,
the chi - square and student 's t - test was used to test statistically significant differences .
the distribution of igg antibody titers of serum samples measured by elisa is shown in table 1 .
a total of 18 patients and 24 of their family members had a positive test in igg t. gondii .
chi - square test revealed not significant differences between the two groups . in both groups
, there was no positive igm t. gondii , indicating the absence of active disease in the two groups .
of the total population , 42.4% of tests are positive igg t. gondii ( p = 0.09 ) .
comparison of the results of the igm and igg elisa in the case and control groups the mean duration of ms disease in the participants that tested positive for igg t. gondii was 44.6 10.1 months , and for the participants with negative test results , the mean duration was 44.3 8.9 months .
independent t - test showed that the mean duration of disease had no significant difference with positive igg t. gondii test ( p = 0.98 ) . in investigating leishmania , only 3 participants a total of 18 patients and 24 of their family members positive , and chi - square test showed no significant difference between the two groups ( p = 0.25 ) .
nine persons in patient 's group and 22 in the control group had a history of parasitic diseases .
the chi - square test showed that this difference was not significant ( p = 0.05 ) .
a history of parasitic disease in the case group 18.4% and the control group was 44.9% . a significant relationship between a parasitic disease history and risk of ms between the two groups was observed ( p = 0.001 ) .
in this study , attempts were made to examine the relationship between ms and a few parasitic diseases .
this current information reflects the endemicity of protozoan blood and tissue infections in 50 ms patients and 50 family members of these patients . in both groups
, there was no positive igm t. gondii , indicating the absence of active disease in the two groups .
it was reported that t. gondii seroprevalence ranges from 12% to 91% in iranian population . in the present study
, we have shown that the prevalence of toxoplasmosis in patients and their family members was 36% and 49% respectively .
this rate was similar to previous data of mostafavi et al . who reported a 41.4% positive rate in isfahan ( center of iran ) in the total population . in man , evidence of infection
has been found in all population groups investigated prevalence rates vary from place to place .
the prevalence of toxoplasmosis is related to several factors , including culture , nutritional habits and type of diet , age , and a rural or urban setting .
drinking contaminated water , the role of domestic and cats has been not fully assessed .
the results shed light the relationship between these diseases and a mismatch with hypotheses examined .
however , considering that the prevalence of toxoplasmosis , leishmaniasis , and malaria varies with time , and depends on numerous epidemiological factors , hence , at the time of this study , this rate was low in the control group , as well .
it is recommended that these theories should be verified with a larger sample size , or by infecting animal models with these parasites to examine the clinical changes in ms disease in them .
our results showed a mismatch with hygiene hypotheses examined . however , considering that the prevalence of parasites varies with time , and depends on numerous epidemiological factors ; these results do not discredit the theory investigated .
Output:
| background : multiple sclerosis ( ms ) is a chronic demyelinating disease of the central nervous system which has been identifies more prevalent in economically developed countries than in the developing countries .
low prevalence of parasitic infections ( which can activate immune response and prevent or modulate damage to host antigens ) in these areas is among the possible responsible factors for such a difference . in this study we aimed to compare frequency of blood - tissue parasitic infections in patients with ms , as compared to their healthy family members.methods:this study
was conducted on 50 relapsing remitting ms patients and 50 family members attending ms clinic at alzahra hospital .
igm and igg anti - toxoplasma gondii were measured .
given the high prevalence of cutaneous leishmaniasis in isfahan , all the participants were also examined for protozoan leishmania microscopically .
furthermore malaria parasite was investigated.results:eighteen patients and 24 healthy family members had positive test in igg toxoplasma gondii(p = 0.09 ) . in both groups
, there was no positive igm toxoplasma gondii . in investigating leishmania , only 3 participants in the case group and 2 in the control tested positive ( p = 0.25 ) .
no case of malaria was found among the participants.conclusion:our results showed a mismatch with hygiene hypotheses examined .
however , considering that the prevalence of parasites varies with time , and depends on numerous epidemiological factors ; these results do not discredit the theory investigated . |
PubmedSumm118413 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: pattern recognition receptors directly recognize common antigen determinants of virtually all classes of pathogens ( so - called pathogen - associated molecular patterns , or pamps).14 in addition , they recognize endogenous ligands , usually releasing during cell stress and known as damage - associated molecular patterns.14 as a result of ligand recognition , pattern recognition receptors initiate an immune response via specific intracellular signaling pathways , and so have a key role in initiation and promotion of septic and aseptic inflammation.14 pattern recognition receptors also have a number of other vital functions apart from participation in the immune response , in that they may regulate many aspects of cell proliferation , survival , apoptosis , autophagy , generation perspectives of reactive oxygen species , pyroptosis , angiogenesis , and , consequently , tissue remodeling and repair.14 there are four main groups of pattern recognition receptors , ie , toll - like receptors , nod - like receptors , c - type lectin receptors , and rig - i - like receptors , and genes encoding them are broadly expressed , eg , in epithelial cells , endothelial cells , keratinocytes , lymphocytes , granulocytes , fibroblasts , and neurons.14 a summary of the most modern conceptual data about members of these groups and about their structure and function can be obtained from recent comprehensive reviews by kawai and akira,1 elinav et al,2 osorio et al,3 and loo and gale.4 the completion of the human genome project and widespread distribution of genotyping technologies have led to an enormous number of studies devoted to associating inherited gene polymorphisms with various diseases .
single nucleotide polymorphisms may result in amino acid substitutions altering protein function or splicing , and they can also change the structure of enhancer sequences during splicing5 and affect mrna stability.6 single nucleotide polymorphisms may alter transcription factor binding motifs , change the efficacy of enhancer or repressor elements,7 and alter the structure of translation initiation codons that may lead to downregulation of wild - type transcripts.8 gene polymorphisms located in leucine - rich repeats constituting ectodomains of many pattern recognition receptors may affect the ability of these receptors to bind pathogens they normally recognize,9 single nucleotide polymorphisms in transmembrane domains can lead to defects of intracellular receptor transport that prevent receptors localizing to the cell membrane,10 and , finally , polymorphisms in the cytosolic domains may result in altered interactions with adaptor proteins or in disrupted receptor dimerization .
therefore , there are many avenues by which single nucleotide polymorphisms may alter pattern recognition receptor expression and activity . because pattern recognition receptors recognize a number of oncogenic infectious agents and launch an immune response against them , inherited variation in their structure may modulate cancer risk and , possibly , influence cancer progression .
in addition , pattern recognition receptors bind a lot of endogenous ligands,14 so polymorphisms of genes encoding them can affect risk and/or progression of some autoimmune disorders and , consequently , cancer risk and/or progression , given that there is a fundamental and epidemiological association between many autoimmune diseases and cancer risk .
although there are a lot of studies investigating the association between single nucleotide polymorphisms in genes encoding toll - like receptors and nod - like receptors and the risk and features of cancer progression , there is an almost complete absence of articles analyzing the correlation between polymorphisms of genes encoding c - type lectin receptors and rig - i - like receptors and cancer risk or progression .
this can be explained by the fact that the first wave of studies devoted to the association of polymorphisms of genes encoding toll - like receptors and nod - like receptors with cancer risk appeared only in 2004 , and the number of such papers was relatively small until 2008 .
in addition , known hypotheses about the infectious agents causing human cancer and their recognition by pattern recognition receptors suggested that toll - like receptors and nod - like receptors should play a major role in the immune response against biological carcinogens .
however , more recent findings concerning specific potentially carcinogenic ligands of c - type lectin receptors and rig - i - like receptors were only obtained in the last few years,3,4 so there has not been enough time as yet to conduct comprehensive investigations between single nucleotide polymorphisms of genes encoding c - type lectin receptors and rig - i - like receptors and cancer risk .
however , there is some evidence supporting the hypothesis that inherited features of c - type lectin receptor and rig - i - like receptor structure can be associated with increased cancer risk .
certain c - type lectin receptors and rig - i - like receptors recognize pamps of oncogenic infectious agents.3,4,11,12 c - type lectin receptors : mrc1 ( cd206 , clec13d , mannose receptor ) and pamps of mycobacterium tuberculosis , klebsiella pneumoniae , streptococcus pneumoniae , candida albicans , human immunodeficiency virus type-1 ( hiv-1 ) cd207 ( clec4k , langerin ) and pamps of candida spp , hiv-1 ly75 ( cd205 , clec13b , dec-205 ) and pamps of hiv-1 cd209 ( clec4l , dc - sign ) and pamps of mycobacterium spp , schistosoma mansoni , c. albicans , hcv , hiv-1 , cytomegalovirus clec7a ( dectin-1 ) and pamps of mycobacterium spp clec1b ( clec-2 ) and pamps of hiv-1 clec6a ( clec4n , dectin-2 ) and pamps of m. tuberculosis , c. albicans , paracoccidioides brasiliensis , histoplasma capsulatum clec4e ( mincle ) and pamps of m. tuberculosis and c. albicans clec4a ( dcir ) and pamps of hiv-1 rig - i - like receptors : rig - i and pamps of epstein barr virus and hepatitis c virus on the basis of known associations between inherited structural variations in toll - like receptors and nod - like receptors and cancer risk,1,2 and according to data about cancer types caused by carcinogenic infectious agents,11,12 it is possible to suggest that risk of lung cancer may be modulated by polymorphisms of the mrc1 , cd209 , clec7a , clec6a , and clec4e genes , oral cancer risk by single nucleotide polymorphisms of the mrc1 , cd207 , cd209 , clec6a , and clec4e genes , risk of glioblastoma and colorectal cancer by polymorphisms of the cd209 gene , hepatocellular carcinoma risk by polymorphisms of the cd209 and rig - i genes , and risk of lymphoma , multiple myeloma , nasopharyngeal carcinoma , and esophageal and gastric cancer by single nucleotide polymorphisms of the rig - i gene .
in addition , single nucleotide polymorphisms of mrc1 , cd207 , ly75 , cd209 , clec1b , and clec4a genes may correlate with cancer types associated with hiv-1 infection .
certain polymorphisms of genes indicated above may have functional consequences on the molecular level that can lead to association of such single nucleotide polymorphisms with risk or progression of some diseases that may modulate cancer risk , so these gene polymorphisms may affect cancer risk indirectly .
in addition , polymorphisms of these genes correlating with diseases that are not related to cancer risk may also be useful in oncogenomics because they may have functional consequences at the molecular level as well , although they have not been investigated in relation to association with cancer risk or progression .
for instance , it was suggested that variant alleles of mrc1 rs2477637 , rs2253120 , rs2477664 , rs692527 , rs1926736 , and rs691005 gene polymorphisms are associated with development of asthma13 ( eg , variant a allele of rs1926736 was connected with decreased asthma risk ) .
in addition , alter et al14 found that the variant a allele ( s396 ) of rs1926736 ( g396s ) polymorphism is associated with a lower leprosy risk and , conversely , g allele ( g396 ) correlates with increased risk of this disease .
interestingly , g396 did not influence leprosy risk in combination with t399 and l407 ( amino acids resulting from variant alleles of rs2478577 and rs2437257 , respectively).14 the authors noted that all three of these mrc1 gene single nucleotide polymorphisms map to the second c - type lectin domain ( ctld2 ) of the mrc1 protein , with their in vitro results suggesting that a direct interaction between ctld2 and an accessory receptor molecule is necessary in order for microbial ligand recognition to occur.14 it is logical to propose that such interaction would be sensitive to g396 only in the context of the a399-f407 haplotype , and not in the context of the t399-l407 haplotype .
14 thus , rs1926736 may have substantial functional consequences at the molecular level , but this depends on its relationship with other single nucleotide polymorphisms in the same exon .
finally , hattori et al15 showed that a variant allele of rs691005 polymorphism , located within the 3 untranslated region of the mrc1 gene , is associated with a higher risk of sarcoidosis .
because of its location , it is feasible that this single nucleotide polymorphism may alter the regulatory binding sequence and influence mrna expression.15 the only study investigating the association of polymorphisms of genes encoding c - type lectin receptors and rig - i - like receptors with cancer risk is a study by xu et al.16 they investigated single nucleotide polymorphisms of the cd209 gene and found that the gg genotype of the rs2287886 , aa genotype of the 939 promoter polymorphism , and the g allele of the rs735239 single nucleotide polymorphism were connected with higher nasopharyngeal carcinoma risk.16 polymorphisms in the promoter of the cd209 gene and in the cd209 gene were also associated with hemorrhage in patients with dengue fever ( g allele of rs4804803),17,18 modulated tuberculosis risk ( g allele of rs4804803 , a allele of rs735239),1921 higher celiac disease risk in hla - dq2-negative cases ( g allele of rs4804803),22 increased ulcerative colitis risk in hla - dr3-positive patients ( g allele of rs4804803),23 higher susceptibility to cytomegalovirus infection ( g allele of rs735240 and c allele of rs2287886),24 protection from lung cavitation20 and fever during tuberculosis25 ( gg genotype and g allele of rs4804803 ) , decreased hiv-1 infection risk ( gg genotype of rs4804803),21 accelerated progression to acquired immune deficiency syndrome in hiv-1-infected hemophiliacs ( c allele of rs2287886),26 decreased human t - lymphotropic virus type i infection risk ( g allele of rs4804803 , a allele of rs2287886),27 increased severity of liver disease during hepatitis c virus infection ( g allele of rs4804803),28 and better prognosis following severe acute respiratory syndrome ( g allele of rs4804803).29,30 it was shown that the a allele of the rs4804803 single nucleotide polymorphism may increase gene expression in vitro,17 and , consequently , decreased cd209 gene expression in subjects with the g allele may result in an impaired immune response against hepatitis c virus,28
m. tuberculosis,19,21 and bacteria potentially causing celiac disease22 and ulcerative colitis,23 that elevates the risk of diseases caused by these infectious agents .
such a decreased immune response may protect from hemorrhage during dengue fever,17 from lung cavitation,20 from fever during tuberculosis , 25 and from lung injury during severe acute respiratory syndrome29,30 as a result of less cytokine production and diminished activation of immune cells .
however , from the point of view of vannberg et al,20 conversely , lower cd209 gene expression as a consequence of g allele of rs4804803 polymorphism may protect against tuberculosis because of decreased production of proinflammatory cytokines such as interleukin-4 .
further fundamental , translational , and clinical studies are necessary to clarify these discrepancies . nevertheless , although there are a number of reasons for the discrepancies between studies devoted to the association between cd209 single nucleotide polymorphisms and development of tuberculosis , but confounding host , bacterial , and environmental factors between different study populations should be taken into account .
in addition , mezger et al24 demonstrated that alleles of rs735240 and rs2287886 polymorphisms may also influence cd209 gene expression and thus affect transcription factor binding .
in relation to the clec7a ( dectin-1 ) gene , it was also found that a variant allele of rs16910526 polymorphism is associated with impaired cytokine production by macrophages31,32 and with a defective response to aspergillus and candida invasion.33,34 the variant s form of i223s polymorphism was characterized by a lower capacity of the receptor to bind zymosan.35 among polymorphisms of genes encoding rig - i - like receptors , rig - i single nucleotide polymorphisms are the most investigated .
pothlichet et al36 conducted a comprehensive study investigating the functional consequences of rs36055726 ( p229fs ) and rs11795404 ( s183i ) polymorphisms .
they found that the variant allele of rs36055726 results in a truncated constitutively active rig - i ( that leads to permanent production of proinflammatory mediators , particularly antiviral ) , and , conversely , the variant allele of rs11795404 induces an abortive conformation of rig - i , causing formation of unintended stable complexes between card modules of rig - i and between rig - i and its downstream adapter protein , mavs , rendering rig - i incapable of downstream signaling and further cytokine synthesis.36 moreover , shigemoto et al identified a variant of rs11795404 as a loss - of - function allele.37 ovsyannikova et al38,39 showed that a minor allele of rs10813831 polymorphism is associated with a decrease in the rubella virus - specific granulocyte - macrophage colony - stimulating factor / interleukin-6/igg response , whilst a variant allele of rs3824456 is connected with an increase in the rubella virus - specific tumor necrosis factor alpha response , and a variant allele of rs669260 correlates with an increase in the rubella - specific antibody level .
hu et al40 discovered that a variant allele of rs10813831 polymorphism leads to increased gene expression and , consequently , cytokine production due to an amino acid substitution in the card domain of rig - i that results in functional alteration of this rig - i - like receptor .
there are also a lot of studies investigating the role of ifih1/mda5 ( the gene encoding mda5 protein that is also a rig - i - like receptor ) single nucleotide polymorphisms in the etiology of autoimmune diseases , but almost all of them are devoted to type 1 diabetes and multiple sclerosis , and data about the association of these diseases with cancer risk are conflicting , in that some studies showed an increased risk in patients with type 1 diabetes and multiple sclerosis,41,42 and in other investigations no connection or decreased risk of cancer has been observed.4349 taking into account that there are no carcinogenic infectious agents recognizing mda5 , it does not seem to be prudent to investigate ifih1/mda5 gene polymorphisms from the oncogenomic point of view .
in addition , polymorphisms of genes coding for components of the toll - like receptor signaling pathway may modulate cancer risk as single nucleotide polymorphisms of the tlr gene family.1 the same statement can be true for c - type lectin receptor and rig - i - like receptor signaling pathways .
for instance , a variant allele of rs11905552 , encoding mavs / visa / ips-1 , a key downstream signaling molecule of rig - i and mda5 , was associated with a particular systemic lupus erythematosus phenotype.50 it was found that this single nucleotide polymorphism leads to reduced production of type i interferon and other proinflammatory mediators , and also to the absence of anti - rna - binding protein autoantibodies.50 in addition , variant alleles of rs17857295 and rs2326369 polymorphisms of the mavs / visa / ips-1 gene were associated with nephritis and arthritis in patients suffering from systemic lupus erythematosus.51 a variant allele of another single nucleotide polymorphism of this gene , rs7269320 , showed associations with different clinical characteristics of this autoimmune disease.51 all the population case - control studies mentioned above are summarized in table 1 .
all polymorphisms of genes encoding c - type lectin receptors , rig - i - like receptors , and proteins of their specific signaling pathways that have known functional consequences and may be relevant to oncogenomics are summarized in table 2 .
the fundamental basis for the association of the inherited coding variation in genes encoding c - type lectin receptors and rig - i - like receptors with cancer is represented by the defects in the immune response ( that are caused by various single nucleotide polymorphisms ) against specific carcinogenic infectious agents .
some polymorphisms may be valued as the most promising for further oncogenomic investigations on the basis of their association with cancer risk or because of their substantial functional consequences on the molecular level according to the following concept : gene polymorphism may be included on the short list for further oncogenomic studies if : the single nucleotide polymorphism leads to substantial functional consequences at the molecular level ( for instance , it strongly affects transcription , splicing , translation , stability and transport of pre - mrna , mrna , noncoding rna , or protein encoding by the gene , or it noticeably influences signaling of synthesized protein ) it is associated with risk of cancer in population studies it has functional consequences at the molecular level and it is strongly associated with a condition that significantly increases the risk of cancer ( threshold may vary for each cancer type ) the gene polymorphism can be also included on the extended list if : it is characterized by more subtle functional alterations in a gene that , nonetheless , result in qualitative or quantitative alterations of the encoding protein ( or noncoding rna ) it is associated with a condition that substantially increases the risk of cancer but has not specifically been identified to increase the risk of cancer . according to this concept , the indicated short list of polymorphisms includes rs1926736 , rs2478577 , rs2437257 , rs691005 ( all located in the mrc1 gene ) , rs2287886 , -939 promoter polymorphism , rs735239 , rs735240 , rs4804803 ( all located in the cd209 gene ) , rs16910526 ( clec7a gene ) , and rs36055726 , rs11795404 , rs10813831 ( all located in the rig - i gene ) .
other polymorphisms mentioned in this article may be added to the extended list for further investigations .
polymorphisms with known functional effects ( rs1926736 , rs2437257 , rs691005 , rs2287886 , rs735240 , rs4804803 , rs16910526 ) were associated with relatively significant modulation of risk of diseases ( as shown in table 1 ) which is logical and demonstrates the correctness of the studies in which functional consequences of such single nucleotide polymorphisms were analyzed .
there are still no comprehensive functional investigations for other single nucleotide polymorphisms correlated with risk of disease , so it is difficult to conclude which of them have independent significance , and which of them are just in linkage disequilibrium with truly functional variants .
in addition , pamps of specific infectious agents recognized by each c - type lectin receptor or rig - i - like receptor define cancer types which can be primarily associated with inherited structural variation in the receptors discussed earlier .
furthermore , if a single nucleotide polymorphism of a gene encoding a specific c - type lectin receptor or rig - i - like receptor is associated with risk or progression features of certain malignancies , polymorphisms in genes encoding specific signaling molecules constituting pathways of these receptors should correlate with similar neoplasms , if they have substantial functional consequences at the molecular level .
the issue of an association of single nucleotide polymorphisms of genes encoding c - type lectin receptors , rig - i - like receptors , and proteins of pattern recognition receptor pathways with various features of cancer progression is open , and only further population studies would be likely to give a definite answer .
reasons for discrepancies in different investigations analyzing the association of polymorphisms in genes encoding c - type lectin receptors , rig - i - like receptors , and the proteins of their signaling pathways with various aspects of cancer development may include confounding host , bacterial , or environmental factors in different ethnicities modulating penetrance of variant alleles and affecting the risk of conditions increasing cancer risk ( such as autoimmune diseases , precancerous gastric lesions , tuberculosis , recurrent pneumonia ) , different bacterial impact on the etiology of such conditions in different populations ( that will be reflected in different features of c - type lectin receptor / rig - i - like receptor - mediated immune response because of specific c - type lectin receptor / rig - i - like receptor - ligand interaction ) , differences in sample size , in clinicopathological characteristics between study samples , in prevalence of infectious agents in case and control groups , diagnostics , stratification , genotyping methods , and chance .
another interesting issue is that associations between single nucleotide polymorphisms of genes encoding c - type lectin receptors and rig - i - like receptors and cancer risk can be skewed by differences between cohorts in various immune responses and infections that may not influence cancer development .
the problem is that the design in an epidemiological study having a large sample is very seldom ideal .
stratification by status of chronic infection is rather difficult because of their extreme diversity and because of the very high cost of such testing .
stratification by an immune response is even more complex because of innumerable peculiarities in functioning of the immune system .
therefore , if the study has a perfect funding source , stratification by infection status can be possible , but stratification by immune response status will be far from ideal .
unfortunately , to the best of the authors knowledge , no genome - wide association studies of the connection between polymorphisms of genes encoding the c - type lectin receptor and rig - i - like receptors and cancer risk or progression have been performed , and this can be explained by the relative newness of the problem or perhaps by another unknown reason . summing up , polymorphisms of genes encoding c - type lectin receptors , rig - i - like receptors , and proteins of their signaling pathways
may be promising targets for oncogenomics and possibly could be used in programs of cancer prevention and early cancer diagnostics in the future .
population and further fundamental studies devoted to their association with cancer risk of progression should shed light on this issue .
Output:
| the group of pattern recognition receptors includes families of toll - like receptors , nod - like receptors , c - type lectin receptors , and rig - i - like receptors .
they are key sensors for a number of infectious agents , some of which are oncogenic , and they launch an immune response against them , normally promoting their eradication . inherited variations in genes encoding these receptors and proteins and their signaling pathways may affect their function , possibly modulating cancer risk and features of cancer progression .
there are numerous studies investigating the association of single nucleotide polymorphisms within or near genes encoding toll - like receptors and nod - like receptors , cancer risk , and features of cancer progression .
however , there is an almost total absence of articles analyzing the correlation between polymorphisms of genes encoding c - type lectin receptors and rig - i - like receptors and cancer risk or progression .
nevertheless , there is some evidence supporting the hypothesis that inherited c - type lectin receptor and rig - i - like receptor variants can be associated with increased cancer risk .
certain c - type lectin receptors and rig - i - like receptors recognize pathogen - associated molecular patterns of potentially oncogenic infectious agents , and certain polymorphisms of genes encoding c - type lectin receptors and rig - i - like receptors may have functional consequences at the molecular level that can lead to association of such single nucleotide polymorphisms with risk or progression of some diseases that may modulate cancer risk , so these gene polymorphisms may affect cancer risk indirectly .
polymorphisms of genes encoding c - type lectin receptors and rig - i - like receptors thereby may be correlated with a risk of lung , oral , esophageal , gastric , colorectal , and liver cancer , as well as nasopharyngeal carcinoma , glioblastoma , multiple myeloma , and lymphoma .
the list of the most promising polymorphisms for oncogenomic investigations may include rs1926736 , rs2478577 , rs2437257 , rs691005 , rs2287886 , rs735239 , rs4804803 , rs16910526 , rs36055726 , rs11795404 , and rs10813831 . |
PubmedSumm118414 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the xingu indigenous park was created in 1961 and occupies 2.9 million acres of the amazon region in the state of mato grosso ( 10 ) . in 2011
the sobradinho indian settlement is located in the far northern region of mato grosso ( 111530s , 534453w ) , and the settlement is part of the xingu indigenous park ( figure 1 ) . from the 1950s
onwards , the kayab people started moving to the xingu indigenous park and now currently reside in this indian settlement ( 12 ) .
we analyzed documents and also examined all the notification forms of patients with confirmed cases of hps during december 2009january 2010 who were likely infected in the sobradinho indian settlement , as well as all the documented records of the epidemiologic investigation from the office of the state health secretary of mato grosso .
indigenous areas in brazil were considered to be unaffected by hantavirus until the beginning of february 2010 , when serologic tests were performed on blood samples from 3 patients who lived in the sobradinho indian settlement .
we used elisas to test the samples for igg with the specific antigen for sin nombre virus and for igm with the laguna negra and andes viruses .
the first notification that aroused suspicion of hantavirus infection occurred on january 12 , 2010 , in patients from the sobradinho indian settlement .
the 33 samples collected during an epidemiologic investigation were tested for hantavirus antibodies . of the samples , 17 ( 51.5% ) were from inhabitants of a single home ( house 3 ) while the outbreak was being investigated .
of the 33 samples that underwent serologic testing , 17 ( 51.1% ) were positive for hantavirus antibodies,9 ( 52.9% ) were positive for igm / igg , and 8 ( 47.1% ) were positive only for igg .
of the 17 examined persons who lived in house 3 , 11 ( 64.7% ) had positive serologic test results for hantavirus and survived : 7 ( 41.2% ) had igm / igg antibodies , and 4 ( 23.5% ) had igg antibodies .
in addition , a member of this family ( mother ) died on january 11 , 2010 ( figure 2 ) .
genogram for residents of house 3 and other persons infected during the hantavirus outbreak in the sobradinho indian settlement , january 2010 , mato grosso state , brazil .
the other 6 infected persons who did not live in house 3 would go to this house on a daily basis , and these persons exhibited unspecified signs and symptoms .
four tested persons were positive for igg ; 2 tested positive for igm / igg ( figure 2 ) . in the family with the deceased mother ,
a 19-year - old girl and a 4-year - old boy were infected . a 38-year - old woman , who lived with 7 patients with symptoms , died on january 11 ; she exhibited the same initial symptoms and reported insufficient breathing before her death .
she received no assistance and was buried inside a hut in accordance with her cultural traditions .
patient ages ranged from 1 to 38 years , with an average of 13.7 years ( table 1 ) .
a total of 14 signs and symptoms were reported ; thelargest proportions of patients experienced fever ( 100% ) , dry cough ( 72.2% ) , and abdominal pain ( 66.7% ) ( table 2 ) .
the clinical manifestations were recorded from december 30 , 2009 , through 28 january 28 , 2010 .
thus , the interval between the cases did not exceed the disease incubation period , which may vary from 4 to 55 days ( 7 ) .
source : health state secretary of mato grosso , 2011 . * hps , hantavirus pulmonary syndrome ; cv , coefficient of variance . during this outbreak , pulmonary disease developed in 6 patients , and 5 survived .
the symptoms preceding the death of 1 patient were recorded by her husband , who drew attention to her breathing difficulty and intense sudoresis .
the time between the onset of the symptoms and hospitalization was , on average , 3.17 days ( median3 ) ( table 2 ) .
the duration of hospitalization ranged from 4 to 10 days , with a median of 4 days and an average of 6.40 .
the death rate in this outbreak was 10% lower than the state rate ( 33.3% ) and the national rate ( 44.4% ) for 2010 hps outbreaks the hantaviruses known to circulate in this area are the strains castelo dos sonhos ( in oligoryzomys utiaritensisrats ) and the laguna negra ( in calomys aff.callosus mice ) ( 9,1315 ) .
these are typically responsible for cases of hps in mato grosso , in southern par state ( castelo dos sonhos ) , and in the cities near the xingu indigenous park . in the outbreak described here ,
no pcr or sequencing was done to confirm the strain . in all of these cases ,
the home was the likely environment where infection occurred . however , other situations in which persons are at risk for infection include the following : harvesting and transportation of grains ( 30.0% ) on plantations , house cleaning in a wilderness area ( 100.0% ) , contact with wild rodents and their excreta ( 100.0% ) , and contact with persons with hps ( 90.0% ) .
patients have become infected during housecleaning , when hantavirusesin rodent excreta could have been swept into the air .
this supposition is supported by the fact that the infection was detected in the woman who did the cleaning and in children and adolescents who were also in the house .
other risky situations include agricultural activities , the management and storage of grains , and the direct contact with wild rodents and their excreta .
disease awareness and information campaigns targeted toward the prevention of hantaviruses in the xingu indigenous park should be intensified , given the risk of the potential presence of infected rodents in other indian settlements .
as hps has become recognized in brazilian indigenous areas , new studies should be conducted to evaluate the serum prevalence among indigenous peoples .
such surveillance will allow identification of the possible reservoirs and the prevalence of hantaviruses in the area .
Output:
| an outbreak of hantavirus pulmonary syndrome occurred in the sobradinho indian settlement of the kayab ethnic group in northern mato grosso during december 2009january 2010 .
we conducted a retrospective study to clarify the outbreak s epidemiologic and clinical characteristics .
results suggest a relationship between the outbreak and deforestation and farming expansion in indigenous areas . |
PubmedSumm118415 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: cancer research like all life sciences has developed in the tension between nothing - buttery and morethanism : the reductionistic paradigm rests on the hypothesis that every living organism is nothing but physical and chemical reactions and can be fully explained by interactions of its parts , while the holistic paradigm implies that the whole of a living organism is more than the sum of its constituent parts ( box 1 ) . a comparison of the reductionistic and holistic paradigms both paradigms date back to the ancient greeks but have intensively directed research during the last centuries .
it was tremendously successful in guiding experimental science in generating an enormous mass of information on cellular and molecular structures , characteristics , behavior , and interactions .
this wealth of information , however , also revealed the immense complexity that currently confronts modern biology .
multiparticularism : in human or animal organisms , tens of thousands of relevant functionally diverse biological molecules have been analyzed ; hundreds or thousands of them are involved in the same process such as tumor growth , tumor immunology , or gene function .
multirelationism : these molecules interact with dozens or hundreds of other molecules , selectively and nonlinearly , meaning that the net effect in a biological process can differ substantially from its effect under isolated experimental conditions ( a small change in initial conditions can be vastly amplified to produce chaotic behavior ) .
pleiotropism , pluripotence , or multifunctionality : each cell or molecule , like cytokines , can have multiple functions and effects .
context - dependency of the effects : the effect of a certain molecule or cell on another cell or process is dependent on the context and can be the opposite . in networks , context is everything .
these different dimensions of mind - numbing complexity that crushed basic concepts of cellular and molecular interactions7 preclude the precise and clear - cut understanding of how these molecules are integrated in cell , tissue , organ function , or organism as well as a reliable explanation and a precise prediction of biological processes by its constituent parts : when we get to a certain network complexity , we completely fail to understand how it works or even if you construct a complete list of all the processes known to occur within a cell , that wo n't tell you how it works .
faced with this challenge to calculate coherent behavior out of more than a universe full of informational data
biology needs an approach beyond reductionism , a whole - istic biology
systems biology became one of the emerging fields in an attempt to understand complex networks with methods like computational biology , simulations , and mathematical modeling .
still , living organisms have essential characteristics that reach beyond the complex interrelationship of thousands of molecules in networks : multilevel systems ; an ability to react , adapt , and restore functions ; the regulation and harmonization of all functions on different levels . to understand living organisms , a paradigm shift
( cancer is caused by alterations in oncogenes , tumor - suppressor genes , and microrna genes .
) these mutations can be caused by chemicals , ionizing radiation , or viruses or during normal replication of chromosomes .
this leads to increased and uncontrolled cell proliferation through gain - of - function mutations in oncogenes ( they stimulate proliferation , survival , metastases ) and through loss - of - function mutations in tumor - suppressor genes ( they regulate and inhibit cell proliferation , promote dna repair , induce apoptosis ) .
further mutations accumulate and lead to cancer progression : increased genetic instability generating genetic diversity ; growth advantage through self - sufficiency in growth signals and insensitivity to anti - growth signals ; aggressiveness ; cell survival , evasion of natural cell death ( apoptosis ) ; sustained angiogenesis ; tissue invasion ; metastatic spread , etc .
cancer cells are distinct from normal cells ; they are autonomous , uncontrolled by the microenvironment , tissue , organism , and the malignant process is irreversible , progressive , and cumulative , finally leading to the death of the host .
the adequate therapy according to this paradigm is to completely and aggressively eradicate all cancer cells , accepting mutilation of the patient ; accordingly , wording and metaphors in oncology
research , treatment , patient communication , advertisement are predominantly military . methods of cancer research and the concepts of the cancer cell were inspired and guided by two tremendously successful disciplines : parasitology , whose dramatic successes at the end of the 19th and beginning of the 20th centuries inspired all areas of medical research , particularly with the successful discovery of antibiotics , and by the leading discipline of the 20th century , genetics .
seminal steps in the evolution of the reductionistic cancer paradigm are shown in box 2 .
seminal steps in the evolution of the reductionistic cancer concept johannes mller ( 1838 ) : cancer tissue is built up by cancer cells .
theodor boveri ( 1914 ) : somatic mutation theory of cancer : malignant neoplasms develop from a single cell that acquired a certain abnormality in its chromosome .
dulbecco and sachs ( 1960 - 1961 ) : neoplastic transformation of mouse and hamster cells by dna viruses ; viral dna is permanently integrated into the cellular dna .
howard temin ( 1960 - 1964 ) : provirus hypothesis : the rna of a tumor virus acts as template for synthesis of dna and is integrated into the cell genome as a provirus . it can serve as a template for progeny rna viruses and can lead to malignant transformation in progeny cells .
berwald and sachs ( 1965 ) : neoplastic transformation of mammalian embryo cells in cell culture by carcinogenic chemicals .
huebner and todaro ( 1969 ) : viral oncogene hypothesis : cells of vertebrates have viral genes that they transmit vertically to progeny cells .
these can be activated by carcinogenes , irradiation , or aging and lead to cancer .
martin , vogt , and duesberg ( 1970 - 1973 ) : investigated first viral oncogene src with src - deletion mutants .
bruce ames ( 1973 - 1975 ) : identified mutagens in salmonella assay ; correlation between mutagenic and carcinogenic properties in chemicals : carcinogens cause cancer through their ability to mutate genes .
( weinberg : this will become the credo of our religion . ) michael bishop and harold varmus ( 1976 ) : viral oncogene src is not a true viral gene but a normal cellular gene .
normal cells carry potential cancer genes proto - oncogenes that can be activated to oncogenes .
robert weinberg , geoffrey cooper , and others ( 1981 ) : activated oncogenes from cancer cells transferred into nih 3t3 mouse fibroblasts induce their malignant transformation .
weinberg , barbacid , and wigler ( 1982 ) : human ras oncogene is activated by point mutation .
sporn , roberts , and todaro ( 1980 - 1985 ) : cancer cells produce and respond to their own growth factors ( autocrine secretion ) .
cavenee , white ( 1983 ) : discovered tumor suppressor gene in retinoblastoma . in 1971 , us president richard nixon declared the war on cancer
( national cancer act of 1971 ) and announced the goal to cure cancer in the bicentennial year 1976 . with a national commitment and a similar concentrated effort that split the atom and took man to the moon , this dreaded disease should be conquered .
although , unquestionably , the treatment and survival rates have substantially improved in some types of cancer such as lymphomas , leukemia , childhood malignancies , and testicular cancer , the overall goal is far from reached despite almost unlimited research funding and the transformation of cancer - drug development into a multibillion dollar industry .
up to 1990 , death rates continuously increased , and since then , they slowly decreased , mainly due to cancer prevention through tobacco control and other endeavors .
altogether , death rates have changed little , and cancer has remained a major fatal disease in the industrialized world .
reasons are manifold : inadequate tumor models used in the many cancer - drug screening programs ; significant acute and long - term toxicity of anticancer drugs ; low response rates in patients due to low drug sensitivity ( currently , expectations go to select responders and individually target the treatment to molecular characteristics of cancer cells ) ; and rapid evolution of aggressive drug - resistant cells due to high mutation rates and selective pressure , resulting in transitory treatment responses . , but basically , the empirical observations revealed high complexity that thwarted the presumption of cancer as a simple story .
the somatic mutation theory was challenged by the multiple discoveries that genes were not the clear - cut coded instructions for life , the command center , or
hidden ruler of life as presupposed , where the function and structure clearly and unambiguously follows out of the dna sequence .
instead , it was revealed that genes themselves are de facto regulated on many levels : by histones ; methylation ; splicing ( dna sequences have to be cut out and put together to generate a gene ) and alternative splicing ( dna sequences may produce different rnas and hence different proteins ) ; rna - editing ; rna - transport from nucleus to cytoplasm ; modification of translation ; , stabilization or degradation of mrna ; posttranslational modifications ; acetylation ; methylation , etc .
so , a certain dna sequence can participate in the synthesis of many different proteins and many different functions .
it is a passive source of material upon which a cell has to draw to synthesize proteins and tissues with certain functions35 depending on its regulation . besides , the dna itself also turned out to be less stable than anticipated , but rather fluid , flexible , and able to reorganize rapidly . in the face of the disappointing resultsthe war against cancer
is far from overthe need for a turning point in cancer research and cancer paradigm is called for40 : the time has come , to shift the cancer paradigm .
this is especially so , as mounting evidence points to the importance of the microenvironment , the tissue and organism in regulating genetic function and cellular behavior , in cancer development .
why do we harbor so many potentially malignant tumors without getting cancer ? in autopsies , cancer is found quite frequently , in many more instances than it appears during life .
for instance , in the prostate glands from deceased young male patients , small foci of histological cancer were found in 27% and 34% of the men in their 30s and 40s , respectively .
autopsies of 110 young and middle - aged danish women ( 20 - 54 years ) found malignancy in the breast of 22 women ( 20% , mostly carcinoma in situ ) , with multicentric and bilateral lesions in nearly half of them .
the life - long cumulated frequency of clinical , invasive breast cancer in the danish population , however , is just 6.5% . in 101 consecutive autopsies of thyroids ,
these lesions were even regarded as a normal finding not to be treated when incidentally found .
cancer cells are less autonomous than assumed : there is deluge of data showing that cell proliferation , survival , apoptosis , differentiation , polarity of cells , gene function , invasiveness , ability to metastasize , angiogenesis , and drug resistance are enhanced , inhibited , or otherwise modified by the microenvironment , the surrounding cells or molecules ( figure 1 ) , including cytokines , lymphocytes , granulocytes , macrophages , fibroblasts , and many others .
interestingly , identical cytokines and identical cells quite commonly have different and often opposite effects on tumor cells ' behavior , depending again on the context .
, , , the behavior of cancer cells is influenced by various other cells and molecules .
, extracellular matrix also regulates normal development and function of an organism : embryogenesis , growth and differentiation of cells , gene function , apoptosis , tissue specificity , tissue structure , and normal homeostasis of the adult organism .
the classic feature of cancer tissue is the disturbed communication between cells and extracellular matrix .
, , breaking cell - cell bonds and intercellular communication is known to induce neoplastic behavior .
experimentally , the interaction between tumor cells and extracellular matrix could be improved by correcting the extracellular matrix receptor integrin ( treating with inhibitory -integrin antibodies in a 3-dimensional basement membrane culture ) .
this led to a striking morphological and functional reversion of the breast cancer cells to a normal phenotype .
also , their malignancy in vivo was substantially reduced despite persisting prominent mutations , amplifications , and deletions on the genetic level .
cells can have a multitude of chromosomal mutations , but as long as the cells are in an appropriate cellular microenvironment that allows a cell to adopt a normal structure , the cell will display a normal phenotype . normal breast tissue adjacent to breast cancer tissue , for instance , displayed a normal morphological appearance in situ , although the cells contained chromosomal aberrations ( loss of heterozygosity ) identical to mutations that characterize invasive breast cancer . ,
cancer researcher bissell concluded , the structure of the tissue is dominant over the genome , and that we may need a new paradigm for how epithelia - specific genes are regulated in vivo .
we also argue that unless the structure of the tissue is critically altered , malignancy will not progress , even in the presence of multiple chromosomal mutations .
the normal microenvironment and architecture of the tissue can constrain tumor development but , conversely , can also promote and induce cancer . ,
not only do the microenvironment , surrounding cells , molecules , and extracellular matrix influence the behavior of the tumor , tumor cells themselves also influence each other .
the multiple subclones in a tumor tissue differ in important behavioral properties , such as growth rate , ability to metastasize , and sensitivity to treatment .
when different tumor subpopulations with different characteristics are mixed together to mimic tumor heterogeneity , they influence each other 's growth , metastatic behavior , and response to chemotherapeutics or hormones in a way that can not be predicted from the behavior of the individual subclones .
growth can be induced , enhanced , reduced , or inhibited ; insensitive clones can become sensitive and vice versa : cell clones interact any way they can .
the growth of multiple tumors in the same experimental host often results in a mutual decrease in growth rate .
after removal of a tumor , the growth of the remaining tumors or metastases is accelerated . when a second tumor was implanted , the growth of the others decreased .
cancer should therefore be dealt with and investigated as an integrated organ , a cancer cell society , with its own characteristics , rather than a collection of independently growing cells . ,
not only the phenotype but also the malignancy itself , the malignant transformation and its reversal , can be induced by the environment .
this was shown in athymic nude mice transplanted with human tumor cells a classic experimental model in cancer research .
when cells had grown to tumors , these were harvested and investigated : they consisted of either only human cancer cells ( as expected ) , a mixture of both human cancer cells and mouse ( host ) transformed cells with abnormal karyotypes or chromosomal constitutions , or only transformed mouse cells with specific chromosomal abnormalities and malignant phenotypes . the initial dogma
once a cancer cell , always a cancer cell was disproven by barry pierce and his colleagues , who demonstrated the differentiation of malignant neoplastic cells to benign cell types . back in the 1950s ,
his observations first of all led to a rejection by cancer 's editor , because everybody knows that cancer cells can not differentiate . today , this phenomenon cancer cells can differentiate to normal cells with normal behavior when exposed to certain environments or certain substances is well known .
illmensee and mintz were the first to demonstrate that teratocarcinoma cells , when transplanted into normal early embryos ( embryoblasts ) can reverse to normal cells ( figure 2 ) .
these embryos develop into normal healthy mice , which are in fact chimeras , a mosaic of tissues from normal embryonic cells derived from their natural parents and of cells derived from the teratocarcinoma that reversed to normality .
the ex - carcinoma cells were found in all tissues skin , eye , blood , bowel , heart , kidney , muscle , reproductive glands , and others .
subsequent breeding of a male showed that it produced viable sperm derived from the original teratocarcinoma cells .
similar experiments were conducted in other laboratories with other carcinoma cells such as myeloic leukemic cells , , neuroblastoma cells , , and melanoma cells and showed that the normal embryonic milieu can reprogram meta - static tumor cells toward benign ones with normal behavior that display cell morphologies resembling the host cells .
experiments by mintz and illmensee : metastatic melanoma was produced by placing a 6-day male 129 embryo under a testis capsule .
the malignant core cells were injected into blastocysts from parents of c57bl/6 mice , which were then transferred to the uterus of pseudopregnant mothers .
normal mice , which were chimeras , were born with coal - colored mosaicism or internal tissue contribution of the 129 tumor cells . a mosaic male produced viable sperm of the 129 genotype . despite originating from malignant cells , the progeny did not produce tumors .
figure source : mintz b , illmensee k , 1975 . reprinted with permission from the author .
the importance of cytoplasmatic , epigenetic regulation for gene ( and oncogene ) function and for the malignant or benign phenotype of the cell was shown by transplantation of nuclei from frog renal adenocarcinoma into activated but enucleated normal frog ova : no growth of cancer cells was observed , but a blastulae development up to early stage tadpoles with normal appearance occurred .
transplantation of tissue of these tadpoles into normal hosts generated tissue indistinguishable from normal tissue .
similar results also were observed after transplantation of the nucleus of other cancer types , such as medulloblastomas , melanomas , and some breast cancer and lymphoma cell lines , into enucleated oocytes . , adult tissue can also lead to reconversion of malignant to benign growth .
for instance , the transplantation of basal cell carcinomas into the uterus of rats first led to tumor formation , which then regressed .
after 4 to 6 weeks , the tumors had disappeared , and progressively larger stretches of the uterine lumen were covered with stratified epithelium , which resembled epidermis .
highly aggressive cancer cells derived from liver epithelial cells produced aggressively growing tumors when transplanted subcutaneously ; however , when transplanted into the liver , they lost aggressiveness and neo - plastic behavior , either partly or completely with a fully differentiated morphology and integration into hepatic plates . this regulatory capacity of
although transplanted tumor cells partly responded to epigenetic differentiation signals of the hepatic tissue of older rats or when younger rats grew older , their progeny proliferated again , formed foci , and when removed from the liver , reverted to an aggressively tumorigenic phenotype .
, cancer development as a physiological response to environmental perturbations or altered tissue environment was also confirmed by farber et al , who treated rats with carcinogens , leading to a multitude of small nodules in the liver .
these were resistant to a variety of agents , including carcinogens , and showed a whole array of differences from the normal liver tissue .
they were regarded as a physiological pattern of adaption to survive in a hostile environment .
only 2% to 5% of the nodules persisted and became the origin of slow evolution to cancer ; the majority ( 95%-98% ) of the nodules disappeared again by differentiation , remodeling , reorganization , and rearrangement of their component hepatocytes and blood vessels to form normal liver tissue . ,
cancer cells and tissue closely resemble embryonic and regenerating cells and tissue in their proliferation , migration , invasiveness , neoangiogenesis , undifferentiation , synthesis of fetal proteins , potential immortality , induction of immunological tolerance in the host , etc .
however , there is one key difference : in embryonic and regenerating tissues , these processes are highly organized , whereas in cancer they are displaced and unregulated .
cancer , therefore , is seen as a problem of developmental biology , and as a caricature of the normal process of tissue renewal , where carcinoma cells grossly exaggerate normal characteristics , or as wounds that do not heal .
interestingly , the ability to develop cancer is inversely correlated to the propensity for regeneration : cancer has been found only in animals with a low or absent regenerative capacity of complete limbs or head , while animals with a strong ability to rebuild lost limbs hardly ever develop cancer .
this is especially noticeable in hydra , which can replace all limbs without any difficulties .
it can be split in many small particles which assemble again to a new organism .
turbellaria , a flatworm , has a strong regenerative ability , which differs within the body parts .
when the turbellaria was treated with carcinogens , tumors could only be induced in nonregenerative parts of the worm but not in parts with a high regenerative capacity .
still , these tumors did not lead to the death of the worm and healed spontaneously with interesting features .
after some growth , an open wound appeared at the tumor site , followed by change of the histological appearance : the tissue became increasingly structured , cells moved to the wound , tumor cells successively differentiated and showed the morphology of the normal local tissue until the tumor had completely disappeared .
similar observations were made in other powerful regeneration models , such as the lenses and iris or limbs from newts , showing that the autonomous growth of malignant cells can be brought under control or reintegrated into the biological system by the regenerative process .
correspondingly , an impaired , incomplete , or uncoordinated regenerative process after chronic injury or inflammation can give rise to a malignant tumor .
this resembles acute feverish infectious diseases in humans that are associated with a reduced cancer incidence and even with cancer remission , while chronic inflammation which seems to be the result of an individual 's inability to eliminate infection and restore immune homeostasis
physical isolation from the biological system alone can induce malignant tumor growth , as was discovered accidentally when rats ' kidneys were wrapped in cellophane film to produce experimental hypertension , but instead unexpectedly induced sarcomas that hardly ever develop spontaneously in these rats .
the physical form , the physical separation , was critical . when the plastic had other physical forms , such as perforated film , fibers , textiles , powders , or granules , the sarcoma - inducing ability disappeared and few or no sarcomas were induced any more .
thus , cancer can be induced by disturbed tissue topography by disturbing the normal homeostatic relations and interaction between cells , tissues , and organs , their morphogenetic field .
michael sporn , one of the leading figures in oncogene research ( box 2 ) stated , carcinoma is a disease of the whole organism .
although molecular and cell biology have immense power as analytical tools , the ultimate understanding and control of the process of carcinogenesis will require a new synthesis at the levels of tissue , organ , and organism . but what is an organism ?
the postgenomic era overcomes its crisis by making networks to the centerpiece of the new paradigm , of the systems biology 's endeavor to understand biological processes , to find the coordinating principles . while the notion of system has been known in biology for a century with its eminent thinkers paul weiss , ludwig von bertalanffy , walter m. elsasser , and others its meaning varied over time . today , systems biology is based on the premise that a living organism consists of an interacting and dynamic network of genes , proteins , and other molecules that cause the function and behavior of the whole macroscopic organism .
it uses bioinformatics and embraces a variety of experimental and computational approaches , including data mining to find hidden patterns ( automated discovery ) and simulation - based analysis to test hypotheses .
this is facilitated by the rapid progress in molecular biology generating large quantitative datasets on the one side and the substantial advances in software and computational power on the other side .
they do not address a whole host of considerations , including the fundamental characteristics of the living organism ; the hierarchically structured different levels ; emergence ( the behavior of the overall system typically manifests itself in totally new phenomena , called emergent behavior ) ; cross - level interaction ; vertical causality ; harmonization ; the development of the supracellular form or gestalt of organs or body parts ; the positional information within the whole despite parts being displaced ; regeneration ; robustness ; and the reliable functioning of tissues , organs , and organism over decades or even a century . for a conceptual breakthrough a new paradigm is needed beyond the current parameters of networks and of systems . holistic thinking in biology
can be traced back to ancient greece and had its zeniths during german idealism with one of its outstanding figures , johann wolfgang von goethe .
, , the concept of system was introduced into modern biology by paul weiss .
he pointed out that the essence of a living system is its hierarchical order , with the macrodeterminism as its most decisive element : the macroscopic level has a high determinism , a high grade of order and predictability , and can maintain its order while the constituent parts are highly variable .
, the property of the system as a whole to build , operate , and maintain itself in a state of desirable orderliness , predictable from its repetitive and systematic recurrence and endurance , in spite of the continued flux and infinitely greater range of variation , hence , unpredictability , of the behavior of its constituent units , which carry out the building , operation , and maintenance . in a system ,
the structure of the whole coordinates the play of the parts . the living system , ie , organism , is hierarchically ordered and consists of several interacting subordinate sub - systems .
each sub - system regulates its own subordinate smaller parts , restraining their degree of freedom ( figure 3 ) .
the system is lawful , and its laws can be found without knowing all of the details of the involved elementary processes . in this sense ,
the field is structured and ascribes certain qualities , direction , intensities , and functions to every point of the field .
weiss was also inspired by the gestalt theory of christian von ehrenfels , wertheimer , khler , koffka , lewin , and others , who made seminal discoveries that fundamentally influenced the theories of perception and gestalt psychology .
it is more than the sum of its parts , and it is perceived independent of its parts .
in general , scientific objectivity and scientific reasoning , as well as clinical judgment , often rely on gestalt cognition . , concept of living organism by paul weiss : interactive relations between hierarchically ordered subsystems . adapted from weiss pa , 1967 .
these strong concepts influenced many fields of modern science , of holistic and organismic concepts of biology and medicine .
one of the most outstanding and well - elaborated organismic concepts of cancer was framed by the molecular and developmental biologists sonnenschein and soto .
these distinguished cell researchers from boston start with the question , why do cells proliferate ?
the dominant premise is that quiescence , g0 , is the default state of a cell in metazoa and that cells divide only when they receive a positive signal , ie , are stimulated by growth factors .
this notion has acquired an axiomatic quality although it is seldom discussed and has never been proven .
sonnenschein and soto now propose the contrary : proliferation is the default state of cells , with the consequence that their control is mediated negatively by inhibitory signals .
this is based on an evolutionary perspective and on their long experience working with cell cultures . among microbiologists
, it is generally accepted that proliferation is the default state of prokaryotes and unicellular eukaryotes ; the ability to proliferate is constitutive to these organisms and largely depends on the availability of nutrition . as multicellular organisms evolved from unicellular organisms , a more complex control and restraint of cell proliferation evolved as well .
rate of proliferation depends on cell type , tissue , organ development , and physiological stage . since cell cycle markers have been highly conserved from yeast to humans ,
is it implausible that the default state of proliferation inherent to unicellular organisms would have switched so fundamentally to quiescence .
unicellular and multicellular meaning that cells will exercise their constitutive , built - in capacity to proliferate when adequately nourished and when extracellular or intracellular inhibitors are absent or inactive .
, when proliferation is the default state of a cell , the control of proliferation has to be negative .
the major difference between unicellular and multicellular systems is the coordinated control of cell regulation . and therein lies the new perspective on organisms and cancer , evolved from the concept of the morphogenetic field , which is a basic paradigm of embryology and developmental biology : we posit that in normal , adult , multicellular organisms there are discrete units of tissue maintenance and/or organization ; histologically , they comprise the parenchyma and the stroma of an organ . during embryogenesis ,
we further postulate that these units of tissue maintenance and/or organization are tridimensional and carry positional and historical information .
they maintain the normal architecture of all organs and guide tissue turnover , remodeling and healing through a dynamic process .
, these units of tissue organization field regulate cellular behavior , proliferation , mobility , differentiation , survival , invasiveness , etc .
they are the primary locus of cancer development and the primary target of carcinogenic agents .
cancerogenesis begins with a disruption of normal interaction between cells and the subadjacent stroma of an organ .
individual cells within these lesions recognize misinformation , which may lead to increased proliferation and disorders in organization or appearance such as dysplasia or metaplasia .
if the disturbance persists , cancer develops with increasing proliferation , invasiveness , metastatic ability , autonomy , survival , genetic instability , etc , due to diminished regulation by the disturbed morphogenetic field .
important , however , are investigations in the complete tissue , where the core changes are represented , such as in hyperplasia , dysplasia , metaplasia , and carcinoma in situ . placing cells in a culture dish
already disrupts the tissue field , potentially producing malignant cellular behavior because the exploration of the tissue organization field theory of carcinogenesis requires the use of tissue recombination and transplantation experiments , comparable to the ones that informed embryologists about the inductive and permissive influences in organogenesis .
, the experimental observations described above are compatible with the tissue organization field theory of neoplasia .
this theory is also consistent with the conclusion of many researchers who have characterized cancer as a disease of organization ; a breakdown of the hierarchical organization ; an ongoing systemic failure in growth control ; homoeostase , or communication between epithelium and stroma ; a chronic , maladaptive tissue and organismic response to injury ; a caricature of tissue renewal , ; a dynamic developmental disorder ; a disturbance of the morphogenetic field , specifically the field for tissue organization and/or maintenance ; a change in the growth - restraining forces ; a failure of host 's organs and tissues to exercise growth control ; a multicellular life that has partially escaped from the hierarchical controls of tissue , organ , and organismal life ; an embryonic growth potential released from restraint ; and a disease of the whole organism .
further research within this organismic , holistic paradigm that understands cancer as deranged organs acting in the context of an organism has to concentrate on the tissue , organ , and organism .
key requirements are new and elaborate paradigms and conceptual breakthroughs as well as the investigation of microenvironmental regulation , normal development , tissue architecture , homeostasis , hygiogenesis , repair , and regeneration . rather than
why do n't smokers get cancer ? meaning : how do some organisms manage to restore health despite strong carcinogenic influences ? additionally , the restorative function of high feverous infections and the historic success of fever therapy with bacterial vaccines will be of renewed interest .
Output:
| somatic mutation theory of cancer has directed cancer research during the last century .
a deluge of information on cellular , molecular , and genetic behavior was uncovered , but so was a mind - numbing complexity that still challenges research and concepts , and expectations in the war on cancer have by and large not been fulfilled .
a change of paradigm beyond reductionism has been called for , especially as research ubiquitously points at the importance of tissue , microenvironment , extracellular matrix , embryonic and morphogenetic fields , and fields of tissue maintenance and organization in the processes of carcinogenesis , cancer control , and cancer progression , as well as in the control of cellular and genetic behavior .
holistic , organismic systems concepts open new perspectives for cancer research and treatment , as well as general biological understanding . |
PubmedSumm118416 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| active - site directed probes are powerful in studies of
enzymatic
function .
we report an active - site directed probe based on a warhead
so far considered unreactive . by replacing the c - terminal carboxylate
of ubiquitin ( ub ) with an alkyne functionality ,
a selective reaction
with the active - site cysteine residue of de - ubiquitinating enzymes
was observed .
the resulting product was shown to be a quaternary vinyl
thioether , as determined by x - ray crystallography .
proteomic
analysis of proteins bound to an immobilized ub alkyne probe confirmed
the selectivity toward de - ubiquitinating enzymes .
the observed reactivity
is not just restricted to propargylated ub , as highlighted by
the selective reaction between caspase-1 ( interleukin converting enzyme )
and a propargylated peptide derived from il-1 , a caspase-1
substrate . |
PubmedSumm118417 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the superiorly based pedicled transverse rectus abdominus myocutaneous flap ( tram ) has assumed its vital place as a tool among the various methods for immediate or delayed post mastectomy reconstruction .
skin necrosis after reconstruction using pedicled deep superior epigastric vessels is still a common complication , and many attempts have been made in the past few years to study ways and means of predicting and augmenting the flap dependability .
laboratory clinical surgical delay of tram flaps at least one week before surgery was observed to decrease the risk of partial and complete necrosis .
we have found laparoscopic ligation of the deep and superficial inferior epigastric vessels at the time of mastectomy to be an easy , practical and safe procedure that could replace the usual open surgical delay in the era of laparoscopy .
the ten patients chosen for laparoscopic delay were of four categories :
1 ) smokers -- of more than one pack per day ( four patients).2 ) obese -- more than 20% of the peer group for age and height ( three patients).3 ) both smokers and obese ( two patients).4 ) one patient who had a large volume requirement .
1 ) smokers -- of more than one pack per day ( four patients ) .
2 ) obese -- more than 20% of the peer group for age and height ( three patients ) .
laparoscopic delay was carried at the time of mastectomy one week prior to the tram flap reconstruction in four patients . in the remaining six patients ,
the delay was carried on an outpatient basis one week prior to their delayed reconstruction .
all patients were pre - medicated one hour before the procedure , and elastic anti - thrombotic stockings were applied . under general anesthesia , with the patient in the supine position ,
a 10 cm trocar was inserted , and a 0 degree laparoscope was attached to the camera and introduced through the port .
full laparoscopy for the liver and the ovaries was performed to document absence of metastasis from the breast cancer .
another two 5 mm ports to the left and right of both recti muscles were also established , and the deep inferior epigastric vessels were identified . with the help of a scissors and grasping forceps , the peritoneum over the vessels was opened and the latter were isolated , double clipped and then divided from the internal iliac artery and vein at their take off .
the superficial inferior system was marked with the doppler and , through a stab wound incision , was similarly isolated , divided and double clipped .
delayed reconstruction was performed one week to six months later on all of the ten patients who underwent modified radical mastectomy using the tram flap procedure as described by hartrampf in 1982 .
our patients ' ages ranged between 42 and 63 years , among which five were obese ( i.e. , more than 20% of the peer group for age and height ) .
in all six patients who opted for postponement of their reconstruction , the laparoscopic delay was carried on an outside basis where they were discharged in the evening on tylenol 500 mg p.o .
the average operative time for the laparoscopic delay of the deep system and inguinal skin incisions for ligation of the superficial epigastric system ranged between 21 to 28 minutes , with an average of 26 minutes . the total blood loss in all patients was negligible with no infection in any of our patients .
although this is a small series of ten patients , it is a select group that is very liable for total or partial necrosis of superiorly pedicled tram flap reconstruction of the average non - delayed patient which varies in different series .
all except two of our patients had a successful reconstruction , with complete survival of all the transferred soft tissue .
this resulted in small areas of skin and fat necrosis at the distal end of their flap that necessitated secondary debridement by wedge resection and closure under local anesthesia as an office procedure with complete healing .
it is not known how well the superior epigastric system can maintain blood flow on both cutaneous sides of the tram flap after the inferior epigastric vessels have been ligated .
one of the most common complications after pedicled tram flap operations is partial skin necrosis , which varies from 2 - 28% , depending on the review .
many attempts have been made to find ways and means to predict and augment blood supply of the superiorly pedicled tram flap .
hidalgo et al . found that continuous intra - arterial infusion of prostaglandin el and heparin was helpful in extending and improving the survival of pedicled musculocutaneous flaps . the intraoperative study performed by harris et al .
, which was done to establish the functional and quantitative properties of the blood supply to the tram flap through assessment and manipulation of blood flow through the deep epigastric arterial system , revealed that survival of the lower tram flap tissues requires reversal in the normal direction of arterial flow to the flap .
have shown in their lab and clinical studies that one week following the delay procedure the superior deep epigastric artery diameter increased significantly .
similar to other procedures in general surgery ( i.e. , cholecystectomy , appendectomy , herniorraphy , etc . )
we feel that laparoscopic delay has opened a new horizon for high risk patients like ours because no major incisions were needed and no retraction on the muscles was required thus , minimal postoperative pain was the rule .
in addition to the short operative time that decreased as more experience followed with each procedure , we were able to perform the delay procedure using one medial port of entry to approach both deep inferior epigastric vessels , thereby eliminating one of the abdominal incisions in the open delay procedure .
we find more surgical ease in using the laparoscope in harvesting the deep inferior epigastric vessels as close as possible to the iliac vessels .
this is not possible in the open technique without widening our surgical incisions and using excessive medial retraction on the recti causing the patient more postoperative pain and morbidity .
in our group of high risk patients , laparoscopic delay of the deep inferior epigastric vessels of a superiorly based tram flap for breast reconstruction has offered us a short , minimally invasive procedure that is safe and more practical than the
we recognize that the efficacy of the delay itself is the same whether the laparoscopic or the open techniques are used ; however , we have observed much less pain and morbidity in our patients because of shorter operative time , less muscle retraction , and ease of execution of the procedure -- with no added cost to the patient .
the limited partial skin and fat necrosis of the distal end of the flap did not significantly affect the final outcome of the reconstruction and did not add a major surgical intervention .
Output:
| laparoscopic ligation of the deep and superficial inferior epigastric vessels was done for ten mastectomized patients who elected to have autogenous reconstruction of their breast .
all these patients had at least one indication for the delay which included obesity , smoking , or requirement of a large volume of tissue for their reconstruction .
the procedure did not add any morbidity or mortality to our patients and was found to be comparable to the
open
delay in preventing partial tissue loss in all but two patients .
we describe the use of a minimally invasive procedure to augment the deep superior epigastric pedicled blood supply for the future transverse rectus abdominus flap . we have found in laparoscopic delay a safe , short procedure that is useful in high risk patients who choose the option of autologous breast reconstruction . |
PubmedSumm118418 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: it has been well documented that nursing students across the world experience stress and anxiety throughout their education and training [ 17 ] .
issues that contribute to their stress and anxiety include academic challenges , clinical challenges , technological advances , financial concerns , interpersonal difficulties , family problems , physical and mental health issues , inadequate support , and poor coping skills .
additional stressors for nonnative nursing students include cultural adjustments , language issues , social isolation , and discrimination . furthermore , during the initial clinical training experience , nursing students report increases in their levels of stress and anxiety [ 813 ] . the stress and anxiety levels increase as nursing students learn to apply their theoretical knowledge to the clinical work with their first patients in new environments while being observed by their clinical instructors and their peers . over the past 2 decades
, many forms of interventions have been suggested to help nursing students with their stress and anxiety .
one study developed a 6-week individualized stress - management program to help reduce performance anxiety of nursing students .
another study utilized a worksite 6-session relaxation intervention workshop to help reduce the anxiety level of nursing students . furthering the implementation of relaxation practices
, a study found that mindfulness meditation over 8-week timeframe is helpful in reducing stress and anxiety among nursing students .
most recently , one researcher recommended using humor , peer instructors , mentors , and mindfulness training to help decrease nursing students ' anxiety .
another research found cognitive modification with biofeedback techniques for self - relaxation helpful in reducing anxiety in nursing students over a 5-week period .
however , no recent studies have been conducted with the new generation of portable biofeedback equipments to help address nursing students ' stress and anxiety specifically during the beginning of the clinical training period .
the purpose of this randomized controlled research study is to investigate the impact of an early biofeedback intervention program on the levels of stress and anxiety of second - year baccalaureate nursing students as they begin their first clinical experience .
stress can be described as physical , mental , or emotional strain or tension as well as a condition or feeling experienced when a person perceives that demands exceed the personal and social resources the individual is able to mobilize .
, states of anxiety are characterized by subjective feelings of nervousness , worry , tension , or apprehension , and by arousal of the autonomic nervous system ( i.e. , sweating , heart palpitation , muscle tension ) .
. found that nursing students in japan and england have additional vulnerability to stress as well as higher level of stress when compared with the general college - student population .
tully reported significant distress among nursing students in ireland and found that second - year nursing students were significantly more distressed than first - year students . during the first clinical experience of nursing students , stress and anxiety
reported that anxiety levels among nursing students in clinical setting were high compared to those nonnursing college students in the united states .
jimenez et al . found that nursing students in spain experience clinical training stressors more intensely than academic or external stressors and display more psychological symptoms than physiological symptoms .
specific stressors for nursing students as they encounter the new clinical rotation include fear of the unknown , implementation of technical skills , fear of specific rotation , and the writing of care plans .
biofeedback is a process of becoming aware of the body 's physiological functions . using specialized devices and sensors
, the person can receive feedback on heart rate , skin temperature , brainwave activity , blood pressure , respiration , and muscle activity .
biofeedback training helps the person learn to modify physiological activity to improve health and performance .
biofeedback training has been utilized to help with various conditions including anxiety , asthma , attention deficit hyperactivity disorder , chronic pain , depression , epilepsy , headache , hypertension , insomnia , irritable bowel syndrome , posttraumatic stress disorder , stroke , and urinary incontinence .
some of the widely used modalities include electromyographic ( emg ) , heart rate variability ( hrv ) , electrocardiogram ( ecg ) , electroencephalograph ( eeg ) , electrodermograph ( eda ) , and feedback thermometer .
one study utilized emg feedback training with nursing students in ireland to help reduce anxiety .
since then , there have been only a few studies that used biofeedback training with nursing students .
ohkuma examined the effects of evoking imagery to control skin temperature with biofeedback among nursing students in japan .
utz used auditory biofeedback training to lower muscle tension in nursing students in the united states while prato helped american nursing students reduce test anxiety with a biofeedback - assisted relaxation training program [ 28 , 29 ] .
thus far , no study has focused specifically on using biofeedback training with nursing students to manage stress and anxiety as they begin their clinical training . for the present study with nursing students in clinical settings , portability and ease of use
are the two important factors in selecting the biofeedback training type and device . based on the previous review article of portable biofeedback devices ,
this study selected the emwave psr device that uses the heart rate variability ( hrv ) measurement .
measuring the individual 's hrv is a noninvasive process as doing so only requires placement of the thumb on the pulse sensor of the portable emwave psr device . in 3 steps , hrv biofeedback training helps the individual to ( 1 )
become aware of the involuntary hrv , ( 2 ) learn to control the hrv through slower breathing and positive emotions , and ( 3 ) achieve a heart - rhythm pattern associated with lower stress and anxiety - related symptoms .
this randomized controlled study was conducted with second - year baccalaureate nursing students at a public nursing college in thailand .
the purpose of this research was to investigate the impact of biofeedback intervention on the stress and anxiety levels of nursing students as they begin their clinical training .
the age range for participants was between 18 and 21 years old ( m = 19.27 , sd = 0.61 ) .
the gpa range for participants was between 2.98 and 3.90 ( m = 3.46 , sd = 0.22 ) .
sixty participants were selected based on a priori power analysis by g*power computer program . using parameters of 0.8 power , 0.75 moderate effect size , and 0.05 alpha , the sample size fort - test needed per group was 29 participants .
once the nursing college 's institutional review board approval was obtained , nursing students were recruited to participate in the study .
after the volunteer participants signed the informed consent forms , they were randomly assigned to either the biofeedback intervention group or the control group .
all participants completed the pre - intervention and post - intervention surveys consisting of brief demographic information , perceived stress scale , and state anxiety scale .
the preintervention survey was completed at the beginning of the new school year , before classes and clinical training began .
the post - intervention survey was conducted 5 weeks after the pre - intervention survey .
an incentive of 150 baht ( local currency equivalent to 5 moderate meals ) was given to each participant who volunteered for the study .
after completing the preintervention survey , the 30 participants in the biofeedback group received 2 training sessions led by the researchers on how to use the portable biofeedback device to assist in stress and anxiety management .
specifically , participants were trained to control the hrv through slower breathing and positive emotions .
the portable biofeedback device provided immediate visual and auditory feedback to the participants to help them learn to control the hrv . after completing the training and being able to achieve a sustained heart - rhythm pattern associated with lower stress and anxiety - related symptoms , each nursing student in the biofeedback group
they were instructed to use the portable device for biofeedback training 3 times per day and record their practice time on the log .
the 30 participants in the control group did not receive any training or device to use .
the perceived stress scale ( pss ) was used to assess participants ' level of perceived stress in the past month .
the pss contains 10 items using a 5-point likert scale ( 0 = never , 4 = very often ) . a higher score indicates a higher level of perceived stress .
several previous studies have used the pss with nursing students [ 19 , 33 , 34 ] .
the internal consistency ( cronbach 's alpha ) of the perceived stress scale for the current sample was .77 for the preintervention and .80 for the postintervention .
the state anxiety scale from the state - trait anxiety inventory was used to assess participants ' current level of anxiety .
the state anxiety scale contains 20 items using a 4-point likert scale ( 0 = not at all , 3 = very much so ) .
several previous studies have use the state anxiety scale with nursing students [ 6 , 15 , 35 ] .
the internal consistency ( cronbach 's alpha ) of the state anxiety scale for the current sample was .93 for the preintervention and .91 for the postintervention .
no significant differences in age and gpa were found between the biofeedback group and the control group ( see table 1 ) . there were no significant differences in the preintervention perceived stress scale and the preintervention state anxiety scale between the two groups . in terms of stress , the biofeedback group had a very small and nonsignificant increase in the perceived stress scale score over the 5-week period , while the control group had a significant increase ( see figure 1 ) .
for the biofeedback group , the mean postintervention pss score ( m = 13.77 , sd = 4.64 ) only slightly increased from the mean preintervention pss score ( m = 13.47 , sd = 4.26 ) . for the control group ,
the mean postintervention pss score ( m = 15.97 , sd = 4.37 ) significantly increased from the mean preintervention pss score ( m = 13.27 , sd = 4.32 ) .
a paired - sample t - test for the control group indicated a significant increase in the pss score : t(29 ) = 3.74 , p < .001 .
the cohen 's d = 0.62 , a medium effect . in the area of anxiety
, the biofeedback group had a significant decrease in the state anxiety scale score over the 5-week period while the control group had a moderate increase ( see figure 2 ) .
for the biofeedback group , the mean postintervention state anxiety score ( m = 13.70 , sd = 6.70 ) was significantly lower than the mean preintervention state anxiety score ( m = 18.60 , sd = 10.25 ) .
a paired - sample t - test for the biofeedback group indicated a significant decrease in the state anxiety scale score : t(29 ) = 2.93 , p < .01 , cohen 's d = 0.57 ( a medium effect ) .
for the control group , the moderate increase from the mean preintervention state anxiety score ( m = 16.40 , sd = 8.34 ) to the mean postintervention state anxiety score ( m = 19.00 , sd = 8.69 ) was not statistically significant . when comparing the two groups , the biofeedback group had a significantly lower level of anxiety than the control group after the 5-week intervention , t(58 ) = 2.65 , p < .01 , cohen 's d = 0.68 , a medium effect
based on the findings from previous studies , both stress and anxiety levels are expected to increase for nursing students when they begin their first clinical training if they do not receive any interventions .
the results from this study demonstrate that the 5-week biofeedback training intervention not only kept the nursing students ' stress levels from increasing , but also significantly reduced their levels of anxiety .
nursing students in the biofeedback group were able to maintain the same level of stress over the 5-week period even though they experienced more stressors and demands from their new clinical training .
nursing students in the control group had a significant increase in their stress level over the same period . additionally , nursing students in the biofeedback group had a significant decrease in their anxiety level over this 5-week period while those in the control group had a moderate increase in anxiety level .
it is very important for nurse educators to help nursing students manage their stress and anxiety in order to prevent additional problems .
ross et al . found that nursing students who experience high stress tend to be depressed .
high stress and anxiety in nursing students also negatively affect learning and academic performance by impeding memory , concentration , and problem solving skills .
depression in nursing students often affects their ability to perform their clinical duties , their relationship with the patients , and their attitude toward the nursing profession .
likewise , if nursing students experience problems with concentration and problem solving , not only will they have a hard time getting through school , but also will they not be performing their nursing duties at optimum levels , which will affect the quality of patient care .
the positive results of the biofeedback training program from this study give nurse educators another tool to help augment the clinical training component of nursing education .
with limited investment in time and financial resources , a biofeedback training program could be set up to help improve the psychological well - being of nursing students as they begin their clinical training .
furthermore , nursing students will gain awareness of how the body works and how the body and mind are linked , ultimately providing them with a more comprehensive , participatory understanding of their patients .
in addition to using biofeedback training to help reduce anxiety , suliman and halabi also found that critical thinking and self - esteem were negatively related to state anxiety .
nurse educators can train students in critical thinking skills as well as set up programs to help improve students ' self - esteem to reduce the anxiety levels among nursing students . with an increased sense of self - efficacy via biofeedback training or critical
thinking skills along with the mastery of each subject or clinical area through education and training , nursing students can keep stress and anxiety at bay and perform according to their potential .
additionally , a follow - up study on the impact of the biofeedback training on stress , anxiety , and academic performance of nursing students after one to two years will help nurse educators to better understand the long - term efficacy of the biofeedback intervention program .
with clinical training being one of the most vital components of the nursing education , it is imperative that nurse educators continue the effort to help nursing students manage their stress and anxiety during this important process .
biofeedback training is one tool that has been demonstrated to be effective in helping with this developmental journey .
the better the nursing students can manage their stress and anxiety , the more successful they can be in their clinical training .
ultimately , the more psychologically healthy the nursing students are , the more likely they will flourish and graduate to become productive and contributing members of the nursing profession .
Output:
| purpose . it has been well documented that nursing students across the world experience stress and anxiety throughout their education and training .
the purpose of this randomized controlled study is to investigate the impact of biofeedback intervention program on nursing students ' levels of stress and anxiety during their first clinical training . methods .
participants consisted of 60 second - year baccalaureate nursing students .
the 30 participants in the biofeedback group received training on how to use the biofeedback device to assist in stress and anxiety management for 5 weeks while the 30 in the control group did not receive any training . findings .
results indicated that the biofeedback group was able to maintain the stress level while the control group had a significant increase in the stress level over the 5-week period of clinical training .
additionally , the biofeedback group had a significant reduction in anxiety , while the control group had a moderate increase in anxiety .
conclusions .
the better the nursing students can manage their stress and anxiety , the more successful they can be in their clinical training .
ultimately , the more psychologically healthy the nursing students are , the more likely they will flourish and graduate to become productive and contributing members of the nursing profession . |
PubmedSumm118419 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 24-year - old woman was referred to our center at 28 weeks gestationbecause of suspected fetal cardiac anomalies .
we echocardiographically diagnosed cctga and additional cardiac anomalies in utero at 28 weeks gestation ( gravida : 3 para : 2 ) .
associated cardiac lesions includedventricular septal defect , mild pulmonary valve stenosis , tricuspid valvar displacement and moderate tricuspid regurgitation ( figure 13 ) .
situs solitus with levocardia . a detailed examination of the ventricular morphology helped to confirm that the right - sided right atrium entered , via a morphologic mitral valve ( mv ) , the right - sided left ventricle ( lv ) , which in turn emptied into the posterior , right - sided pulmonary artery ( pa ) instead the left - sided left atrium was connected , through a morphologic tricuspid valve ( tv ) , to the left - sided right ventricle ( rv ) , which emptied into the anterior , left - sided aorta ( ao ) , ventricular septal defect ventricular septal defect ( vsd ) .
note the ventriculoarterial discordance : the aortaarises from the left - sided , morphologically right ventricle instead bifurcating pulmonary artery arising from the morphological left ventricle , ventricular septal defect ventricular septal defect ( vsd ) .
the pulmonary bifurcating ( pulm ) is in the middle between ascending aorta ( ao ) and superior vena cava ( svc ) , almost aligned .
this fetus experienced supraventricular tachycardia ( svt ) in pregnancy ( at 35 weeks gestation ) ( fig 4 ) .
postnatal echocardiography found visceral situs solitus , visceroatrial concordance , and atrioventricular and ventriculoarterial discordance , ventricular septal defect , pulmonary outflow obstruction ( mild ) , tricuspid valvar displacement , mild tricuspid regurgitation .
postnatal svt recurred ( figure 6 ) electrocardiographic and holter monitor evidence was confirmed , in which initial treatment with adenosine was ineffective , but amiadarone was effective .
congenitally corrected transposition is a rare congenital anomaly , with only a few cases diagnosed and reported prenatally even in the largest fetal series.12 prenatal sonographic diagnosis of ctga is very difficult because the ventricular outflow tract may appear to arise correctly from the right and left ventricles .
the long - term prognosis of cctga is dependent on associated other major cardiac anomalies and rhythm disturbances that can influence prognosis.3 svt is reported to account for 47 68 % of cases of fetal tachycardiaand is associated with a low percentage of structural abnormalities ( 2 % of cases).4 fetal tachycardia of any form that is intermittent , not accompanied by cardiac or valve dysfunction , and present < 50% of the time is best not treated , but needs to be monitoredclosely .
schnabel reported cctga at 20weeks gestation with recurrent svt.4 some of these cases may undergo major and unexpected changes , particularly with regard to cardiac rhythm and tricuspid valvar function , with concomitant significant changes in prognosis .
the diagnosis of these specific types of fetal tachycardia is difficult , if not impossible with the most widely used current technology .
the electrophysiologic events are clearly defined in this situation , however , a precise diagnosis is still debatable.4 in this case , postnatal svt recurred , electrocardiographic and holter monitor evidence was confirmed , and the initial treatment with adenosine was ineffective , but amiadarone was effective .
the svt shown in postnatal ekg ( figure 3 ) for instance , may be avrt using a concealed accessory pathway .
anti - arrhythmic therapy are started when arrhythmias were sustained or associated with hemodynamic compromise prior to 34 weeks gestation . after 34 weeks gestation , such cases are delivered.5 furthermore , some controversy exists in relation to first - line and second - line treatment.regimens for fetal supraventricular tachycardia . in general
, digoxin is used as first - line treatment in the us , whereas in europe flecainide is used for this purpose . for second - line treatment of drug - refractory supraventricular tachycardia with hydrops
fetalis , maternal intravenous or oral digoxin , alone or in combination with amiodarone can be used without increasing mortality . for fetuses without ventricular dysfunction ,
flecainide or sotalol have been used as second line agents , and both have efficacies of 6080% . however , for fetuses with ventricular dysfunction or severe atrioventricular valve regurgitation , amiodarone is the most effective drug ( > 93% efficacy alone or in combination ) , and is associated with a low risk of proarrhythmia.56 cesarian deliveries is advocated for fetal distress associated with persistent svt such as in our patient at 35 weeks of gestation . in conclusion , we think thataccurate fetal segmental analysis of the four - chamber and great vessel connections and relations ( l - transposition ) by fetal echocardiography could be highly helpful in improving follow - up of potentially critical neonates ( especially irregular heartbeat ) . the combined presence of svt and cctga are rarely reported in the literature during fetal monitoring.4
Output:
| the prenatal sonographic diagnosis of congenitally corrected transposition of the great arteries ( cctga ) , a rare form of congenital heart disease is very difficult .
a24-year - old woman was referred to our center at 28 weeks gestationbecause of suspected fetal cardiac anomalies .
we report a case of cctga with supraventricular tachycardia , ventricular septal defect , pulmonary valve stenosis , tricuspid valvar displacement and moderate tricuspid regurgitation during her pregnancy .
the combined presence of svt and cctga are occasionally present in the literature . |
PubmedSumm118420 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: other articles have described study methodology in depth . to summarize , this phase iii trial had two treatment phases : an induction phase of four cycles of pemetrexed ( intravenously [ iv ] , 500 mg / m ) and cisplatin ( iv , 75 mg / m ) administered on day 1 of a 21-day cycle and a maintenance phase in which eligible patients were randomized ( 2:1 ) to continuation pemetrexed ( iv , 500 mg / m ) or placebo ( iv , 0.9% sodium chloride ) , both on day 1 of 21-day cycles .
criteria for patients to be eligible for induction included advanced nonsquamous nsclc ( stage iiib / iv ) ( lung cancer staging guidelines , version 5 ) , at least one measureable lesion per response evaluation criteria in solid tumors ( recist 1.0 ) , eastern cooperative oncology group performance status ( ps ) of 0/1 , and no previous systemic chemotherapy for lung cancer .
patient eligibility for maintenance included pr or cr or sd following four cycles of pemetrexed cisplatin induction therapy and ps of 0/1 .
patients were randomized to a maintenance arm and began treatment within 7 days , 21 to 42 days from day 1 of induction cycle 4 .
randomization to treatment was stratified by the following prognostic factors : disease stage before induction ( iiib versus iv ) , tumor response to induction ( cr pr versus sd ) , and ps before randomization ( 0 versus 1 ) . maintenance treatment continued until disease progression , unacceptable toxicity , or patient
patients were followed until death or study closure . during both phases of the study , patients were administered folic acid , vitamin b12 supplementation , and prophylactic dexamethasone as recommended on the pemetrexed label .
toxicity was assessed before each cycle using the common terminology criteria for adverse events , version 3.0 .
principles of good clinical practice and the declaration of helsinki ethical principles were used to guide study conduct .
all patients randomized to maintenance were included in the efficacy analyses ( intent - to - treat ) .
the unadjusted cox proportional hazards regression model was used to estimate pfs and os hrs and 95% ci .
differences in survival estimates between pemetrexed and placebo arms were assessed using a two - sided log - rank test .
using known prognostic variables , post hoc descriptive analyses were undertaken to expand on os analyses in the statistical analysis plan .
statistical analysis software ( version 9.1.3 ; sas institute , cary , nc ) was used for all statistical analyses .
other articles have described study methodology in depth . to summarize , this phase iii trial had two treatment phases : an induction phase of four cycles of pemetrexed ( intravenously [ iv ] , 500 mg / m ) and cisplatin ( iv , 75 mg / m ) administered on day 1 of a 21-day cycle and a maintenance phase in which eligible patients were randomized ( 2:1 ) to continuation pemetrexed ( iv , 500 mg / m ) or placebo ( iv , 0.9% sodium chloride ) , both on day 1 of 21-day cycles .
criteria for patients to be eligible for induction included advanced nonsquamous nsclc ( stage iiib / iv ) ( lung cancer staging guidelines , version 5 ) , at least one measureable lesion per response evaluation criteria in solid tumors ( recist 1.0 ) , eastern cooperative oncology group performance status ( ps ) of 0/1 , and no previous systemic chemotherapy for lung cancer .
patient eligibility for maintenance included pr or cr or sd following four cycles of pemetrexed cisplatin induction therapy and ps of 0/1 .
patients were randomized to a maintenance arm and began treatment within 7 days , 21 to 42 days from day 1 of induction cycle 4 .
randomization to treatment was stratified by the following prognostic factors : disease stage before induction ( iiib versus iv ) , tumor response to induction ( cr pr versus sd ) , and ps before randomization ( 0 versus 1 ) . maintenance treatment continued until disease progression , unacceptable toxicity , or patient
patients were followed until death or study closure . during both phases of the study , patients were administered folic acid , vitamin b12 supplementation , and prophylactic dexamethasone as recommended on the pemetrexed label .
toxicity was assessed before each cycle using the common terminology criteria for adverse events , version 3.0 .
principles of good clinical practice and the declaration of helsinki ethical principles were used to guide study conduct . each patient provided written informed consent before treatment initiation .
all patients randomized to maintenance were included in the efficacy analyses ( intent - to - treat ) . the unadjusted cox proportional hazards regression model was used to estimate pfs and os hrs and 95% ci .
differences in survival estimates between pemetrexed and placebo arms were assessed using a two - sided log - rank test . using known prognostic variables , post hoc descriptive analyses were undertaken to expand on os analyses in the statistical analysis plan .
statistical analysis software ( version 9.1.3 ; sas institute , cary , nc ) was used for all statistical analyses .
as previously reported , 939 patients were enrolled in the induction phase of the study at 83 primarily european sites ; 700 of these patients ( 75% ) achieved disease control ( tumor response or sd ) and 637 patients ( 68% ) completed four cycles of pemetrexed cisplatin .
subsequently , 539 patients who completed four cycles of induction and who exhibited both disease control and ps 0 to 1 were randomized 2:1 to maintenance treatment ( 359 pemetrexed , 180 placebo ) . to explore whether any patient or disease characteristic was indicative of longer or shorter survival among patients receiving pemetrexed maintenance therapy ,
although the small patient numbers in some subgroups preclude definitive conclusions , in general , the indicated baseline patient and disease characteristics of patients surviving longer periods were comparable to those surviving shorter periods .
this includes patient characteristics of age , sex , ethnic origin , prior smoking status , and tumor histology and stage .
these data suggest that there is no baseline characteristic that identifies those patients who receive a long - term survival benefit from pemetrexed maintenance therapy from those patients who stop maintenance treatment early due to disease progression .
comparison of baseline characteristics of pemetrexed arm patients surviving longer vs. shorter periods since adverse events ( aes ) during induction therapy can impact physician decision whether to continue with maintenance therapy , we examined if induction aes were indicative of survival duration among patients receiving pemetrexed maintenance therapy ( table 2 ) .
no grade 3 and 4 induction toxicities were experienced disproportionately by patients with os of shorter duration .
likewise , low grade toxicities ( grade 12 ) were not experienced more frequently by patients with shorter survival times ( data not shown ) .
select aes as indicators of length of overall survival among patients receiving pemetrexed continuation maintenance therapya patient response to induction therapy has also been proposed as an indicator of the utility of maintenance therapy .
a prior report noted that both cr pr and sd subgroups of the pemetrexed maintenance arm showed numerically positive survival results , although the study was not powered for these subgroups and the differences were not statistically significant .
further analysis also showed that the response by treatment interaction term was not significant as assessed using the cox model of response , treatment , and response by treatment interaction ( cr pr versus sd ; p = 0.731 ) .
a compilation of maintenance cycle data for the induction response subgroups revealed that on the pemetrexed arm , patients with an induction response of cr pr received a similar mean number of cycles as those with an induction response of sd ( 8.5 versus 7.5 ; range , 044 and 037 , respectively ) but a greater median number of cycles ( six versus four , respectively ) . on the placebo arm , both induction response groups received similar mean and median number of cycles ( cr pr : median , 4.7 cycles ; mean , four cycles ; range , 038 cycles ; sd : median , 5.1 cycles ; mean four cycles ; range , 036 cycles ) .
in addition , patients on pemetrexed maintenance therapy were found to have a greater mean number of cycles than patients on placebo maintenance therapy . to further analyze induction response as a potential indicator of survival outcome
, patients on both arms were separated into induction response subgroups ( cr pr versus sd ) then segregated further into groups based on length of survival ( table 3 ) .
similar to the data displayed in tables 1 and 2 , among patients who received maintenance pemetrexed , the proportion of patients with an induction response of cr pr versus sd was largely consistent over time .
patients who experienced limited benefit from maintenance treatment ( os < 3 mo ) are few in number , hindering analysis , but this population contains both patients with a tumor response and those with sd . in the two induction response groups ( cr pr and sd ) , similar proportions of patients lived greater than 18 months ( as measured from randomization to maintenance therapy ) .
interestingly , os also did not seem to be impacted by type of induction response among patients who received placebo for maintenance therapy . in general , these results suggest that tumor response to induction as assessed by recist designations of tumor response and sd are not indicative of os outcome for pemetrexed continuation maintenance treatment . induction response and ps as indicators of overall survival among patients receiving continuation maintenance pemetrexed or placebo because recist tumor efficacy designations collapse smaller positive tumor responses ( < 30% decrease in tumor size ) and smaller negative response ( < 20% increase in tumor size ) into one category ( sd ) , and , likewise , group all tumor responses less than complete tumor disappearance into a pr grouping , it is of value to look at tumor size change in individual patient records to further examine its relationship with survival . for each randomized patient , the percent change in the sum of the longest diameter of target lesions diameters ( i.e. , a normalized index of tumor growth or shrinkage ) from baseline to the fourth induction cycle was graphed in a waterfall plot ( left y axis ) , along with an indication of each patient s pfs or os time ( right y axis ) ( fig .
the plot illustrates the expected variation within the sd designation ( green bars ) , with a few patients showing a slight increase ( up to 23% ) in tumor size , with the majority of patients showing either no change in tumor size or modest decrease in tumor size ( < 30% decrease in the sum of target tumor lesion diameters ) .
os for patients with sd is variable , with the associated points ranging from approximately 0 to 37 months , as reported above .
likewise , patients with the designation of pr or cr also show a variability in the percent change of the sum of target lesion measurements ranging from 30% to 100% .
os for this group of patients ranged from 0 to 44 months , a range similar to the patients with sd .
in general , these results suggest that the degree of tumor shrinkage after induction is not an indicator of os outcome .
analysis of the data in figure 1b ( through scattergram , plotting individual patient induction response tumor data versus os time [ months ] ) confirmed this finding ( data not shown ) .
computation of spearman s rank correlation coefficient revealed no correlation between the percentage of tumor reduction and final os ( spearman s rho = 0.019 ; p = 0.674 ) .
the waterfall plots display individual patient induction response data expressed as percent change in the sum of the longest diameter of target lesions as measured at baseline and visit 4 of the induction period .
best induction tumor response for each patient ( sd , pr , or cr ) is indicated by the color of the data bar . a , pfs time ( months )
b , os time ( months ) ( right y axis ) for each patient , also indicated by points .
sd , stable disease ; pr , partial response ; cr , complete response ; pfs , progression - free survival ; os , overall survival ; bsc , best supportive care .
additional analyses focused on the impact of ps on efficacy outcomes among patients with advanced nsclc receiving maintenance therapy . when patients on both arms were divided into subgroups based on ps ( 0 versus 1 ) and os , a greater proportion of pemetrexed arm patients with ps 1 had shorter survival times than those with ps 0 ( table 3 ) .
although the study was not powered for subgroup analyses , data were analyzed by kaplan
0 patients were found to survive longer than ps 1 patients : median os ps 0 patients : 17.2 months ( 95% ci , 14.222.7 ) versus ps 1 patients : 12.9 months ( 95% ci , 11.815.3 ) ( log rank p = 0.023 ) . when median os was compared between ps 0 and ps 1 patients who received placebo for maintenance therapy
, there was no statistical difference ( p = 0.423 ) ( table 4 ) .
nevertheless , both ps 0 and ps 1 patients receiving pemetrexed maintenance therapy survived longer than patients with similar ps receiving placebo ( pemetrexed ps 0 : 17.2 months versus placebo ps 0 : 12.9 , p = 0.059 ; pemetrexed ps 1 : 12.9 months versus placebo ps 1 : 10.7 , p = 0.121 ) .
these results were directional , but not significant , likely influenced by inadequate sample size as the study was not powered for this analysis .
meier plots depict overall survival by performance status 0 ( a ) and overall survival by performance status 1 ( b ) .
os of maintenance therapy subgroups a further parameter that might influence the efficacy of pemetrexed continuation maintenance therapy is the length of the interval between completion of induction therapy and the start of maintenance therapy . by protocol specification ,
maintenance therapy was to start within 21 to 42 days after the start of cycle 4 .
median time from start of induction therapy to the start of maintenance treatment was 3 months on both arms .
time from end of induction to the start of maintenance assuming a 21-day cycle 4 : median 3 days , range 2 to 30 days , with the majority of patients ( 68% ) initiated maintenance therapy immediately ( < 7 days ) after the completion of induction .
the difference in survival in patients who started maintenance therapy less than 7 days from the completion of induction treatment and patients starting greater than or equal to 7 days after the completion of induction treatment was determined .
as shown in table 4 , median os is not significantly different among patients who begin maintenance therapy in less than 7 days versus greater than or equal to 7 days ( but 30 days ) .
phase iii clinical trials have identified switch and continuation maintenance chemotherapy strategies that result in improved pfs and os , while maintaining quality of life in advanced nsclc patients .
meier pfs and os plots in the paramount trial reveals that approximately 25% of patients progressed or died at the first 6-week evaluation of pemetrexed continuation maintenance therapy , whereas 32% of paramount patients had survived 2 years after randomization .
similarly , other maintenance trials have patients who survive substantially greater or lesser periods than others in the treatment arm .
interest has grown in predicting which patients may benefit most from maintenance therapy to balance any increased toxicities with quality - of - life concerns and for economic considerations .
previous studies have identified a number of factors that may have bearing on the success of maintenance therapy outcome .
these have been summarized in the recent review article by gerber and schiller and include tumor histology , response to first - line therapy , ps , likelihood of receiving therapy at progression , and molecular characteristics , in particular for those agents with tumor targets with variable expression ( e.g. , activating egfr and kras mutations ) .
tumor histology ( nonsquamous subgroups ) and other baseline and disease characteristics including patient age , sex , ethnic origin , smoking status , and disease stage were previously examined by forest plot for their effect on the pfs and os efficacy parameters . in each subgroup , the impact of pemetrexed continuation maintenance treatment on os and pfs was consistently positive . likewise , in this analysis summary , neither those patients with limited survival ( os <3 mo ) nor those patients with extensive survival ( os > 24 mo ) were observed to cluster in any particular baseline patient or disease characteristic group .
the median age and the proportion of patients greater than 65 years were nearly constant .
likewise , subgroups within smoking status , disease stage , ethnic origin , and sex categories had a relatively consistent percentage of patients in the various survival time categories .
the survival interval of 0 to 3 months had too few patients to draw conclusions , but one could note that these patients who benefitted minimally from treatment were represented in all of the subgroups .
type and severity of aes experienced by patients during induction were also examined to determine if they impacted length of survival ; no clear association was observed .
another parameter widely considered potentially impactful on maintenance results is the response to induction therapy . the initial pemetrexed switch maintenance trial and
the current paramount trial reported that tumor response during induction did not have bearing on survival parameters .
in contrast , the saturn trial found that erlotinib as a switch maintenance agent only yielded an os benefit for patients with sd after induction ( hr = 0.72 sd versus hr = 0.90 for patients with a tumor response ) , an outcome reflected in the maintenance indication for which erlotinib is approved for treatment in europe . in a separate study by fidias et al .
, docetaxel was found to be effective as a switch maintenance agent only for the cohort of patients with a tumor response after induction ( hr = 0.61 versus 1.02 for patients with sd ) .
. led to the suggestion that induction response may affect survival results when using continuation maintenance . the post hoc analyses reported herein sought to further explore the initial paramount finding .
when patients were divided into induction response groups ( cr pr versus sd ) and the percentage of pemetrexed arm patients was compared with os time falling within specific intervals , the proportion of patients in the induction response groups was relatively consistent .
when this descriptive analysis was expanded to look at individual patient data through a waterfall plot , both the pfs and os outcomes were entirely random relative to the induction tumor response .
this was true for patients who manifested sd as slight tumor growth and those who exhibited modest target tumor shrinkage .
likewise , patients who had been characterized as partial responders with target tumor shrinkage in the range of greater than 30% to 93% exhibited a wide variation in pfs and os .
further analysis with a scattergram confirmed the lack of correlation , thus leading to the conclusion that degree of tumor reduction does not predict outcome of continuation maintenance in the paramount study .
this finding differs from that of saturn and other studies that indicate patients with sd following first - line chemotherapy have a poorer prognosis than patients with a tumor response . comparing the saturn study with paramount , one notes that the induction regimen for saturn consisted of four cycles of a mix of platinum - based doublet chemotherapy , whereas in paramount , all patients received pemetrexed
whether this difference has bearing on the similar responsiveness of the induction response subgroups ( sd and pr cr ) remains to be investigated .
the waterfall plots used to confirm the dissociation of induction tumor response and survival outcomes were also a useful tool to visualize the substantial variability in tumor response within a group of patients . expressing tumor response data in terms of recist categories may be helpful for analytical purposes , but it yields an incomplete picture of the results .
in particular , the sd category represents a highly heterogeneous population as evidenced by the waterfall plots and corresponding survival data .
indeed , these plots underscore the need to review how well a patient responds to treatment through tolerability , symptomatic , and radiological assessment , when determining whether to recommend maintenance treatment .
descriptive analyses identified a significant improved survival outcome for pemetrexed continuation maintenance patients with ps 0 over those with ps 1 .
interestingly , ps impacted results sufficiently that the ps 1 pemetrexed cohort had a median os value comparable to the placebo ps 0 cohort . nonetheless , both ps 0 and ps 1 pemetrexed arm subgroups had greater median os than patient subgroups with the same ps who received placebo maintenance therapy .
these results are comparable to recently published ps and symptom burden analyses of the phase iii switch maintenance pemetrexed trial .
although both phase iii trial analyses were retrospective and derived from studies not suitably powered for subgroup analysis , they both support the prognostic value of ps and underscore its importance as an indicator of suitability for maintenance .
furthermore , they substantiate the notion of not delaying maintenance treatment in favor of second - line treatment as the delay might entail ps decline .
interestingly , a recent retrospective analysis concluded that patients with poorer ps ( 2 ) should be considered candidates for well - tolerated maintenance therapy because as a cohort , they are less likely to receive second - line therapy .
nevertheless , a study by brodowicz et al . observed that patients with poorer ps ( karnofsky ps 80 ) did not exhibit a survival benefit with continuation maintenance gemcitabine , and a second trial that included 60% ps 2 patients also failed to demonstrate improved survival with continuation maintenance gemcitabine . hence , further studies will be necessary to determine if patients with ps 2 receive any benefit from continuation maintenance pemetrexed .
further examination of the concept of delayed treatment led to the analysis whether longer or shorter intervals between the conclusion of induction and the initiation of maintenance treatment might have bearing on survival results .
an analysis of survival among patients receiving pemetrexed who initiated maintenance within a week ( < 7 days ) after the end of induction versus those who initiated maintenance after a longer period , but one still within protocol specifications ( > 7 and 30 days ) , showed that the brief delay in maintenance initiation had no measurable effect on survival results .
nevertheless , prospective studies are needed to fully examine the ongoing consideration of maintenance treatment versus second - line treatment .
such studies should include prespecified , fully powered subgroup analyses to examine the impact of potentially predictive factors and assess factors identified with a lower likelihood of receipt of second - line chemotherapy as possible predictors of patients who will benefit from maintenance therapy .
in addition to the aforementioned limitations inherent in retrospective analyses of study data not powered for subgroup analysis , the paramount study and associated analyses are limited by the lack of data on the molecular characteristics of patient tumors associated with longer or shorter survival outcomes .
arguably , although analysis of such tissue at this time would be an open - ended inquiry , molecular genomic studies are thought of as pivotal future determinants of individualized patient care ; therefore , appropriate tissue samples should be acquired when possible . in summary , the analyses summarized here show that other than the ps prognostic marker , no baseline or clinical parameter identifies a subgroup of patients more or less likely to benefit from pemetrexed maintenance therapy .
degree of tumor shrinkage was not correlated with survival ; both long - term and short - term survivors were variable in tumor response , with some long - term survivors characterized as having sd .
these data underscore the usefulness of pemetrexed continuation maintenance therapy following four cycles of cisplatin - containing induction therapy for nonprogressing patients with ps 0 to 1 .
furthermore , these analyses emphasize the importance of making maintenance treatment decisions based on a full clinical assessment of each patient and with an awareness of each patient s preferences and needs .
Output:
| introduction : the paramount phase iii trial demonstrated that pemetrexed continuation maintenance significantly reduced the risk of disease progression ( hazard ratio = 0.62 ) and death ( hazard ratio = 0.78 ) versus placebo in patients with advanced nonsquamous non small - cell lung cancer . to further understand the survival data , descriptive subgroup analyses were undertaken.methods:nine hundred thirty - nine patients received induction therapy ( four 21-day cycles pemetrexed 500 mg / m2 and cisplatin 75 mg / m2 ) , after which 539 nonprogressing patients with an eastern cooperative oncology group performance status ( ps ) of 0/1 were randomized ( 2:1 ) to maintenance pemetrexed ( 500 mg / m2 ) cycles or placebo until disease progression.results:baseline characteristics of patients surviving for longer periods were comparable to patients surviving shorter periods , suggesting overall survival ( os ) benefit for all subgroups of patients on maintenance therapy .
an examination of type and severity of induction adverse events also found no association with survival duration .
response to induction ( tumor response versus stable disease ) was not determinate of pemetrexed maintenance os outcome as assessed by waterfall plot and scattergrams and by the distribution of patients among various os intervals .
the length of the interval before beginning maintenance therapy ( < 7 days versus 7/30 days ) also did not impact the survival results .
ps , a known prognostic factor , was the only baseline characteristic associated with improved os ; however , both ps 0 and ps 1 patients exhibited a survival benefit from pemetrexed maintenance.conclusions:in paramount , the os benefit was seen across all subgroups .
other than ps , no baseline or clinical parameter clearly identified a subgroup more likely to benefit .
maintenance treatment decisions should be made on an individual basis . |
PubmedSumm118421 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: small cell carcinomas are most commonly seen in the lung , but rare cases of extrapulmonary sites have also been reported and include : the esophagus , larynx , nasal cavity , gastrointestinal tract , uterine cervix , bladder , and breast1 , 2 ) .
small cell carcinoma of the kidney is an uncommon and reportedly a very aggressive neoplasm ; there is no standard treatment protocol available due to the small number of cases described .
the median survival rate is reported as up to 8 months3 ) . as in cases of pulmonary small cell carcinoma
, chemotherapy may lead to an improved outcome in patients with extrapulmonary small cell carcinoma .
we report a patient with primary small cell carcinoma of the kidney ; this patient was treated with nephrectomy followed by adjuvant chemotherapy with etoposide and cisplatin .
a 52-year - old woman had a 2-week history of right flank pain and intermittent hematuria with iron deficiency anemia .
physical examination of the patient was unremarkable , except for an abdominal mass and cva tenderness .
laboratory data were as follows : white blood count 8,280/l , platelet 346,000/l , hemoglobin 9.5 g / dl , mcv 74.3 fl , mch 24.4 pg , mchc 32.8 g / dl ; serum blood urea nitrogen 12.7 mg / dl , serum creatinine 0.89 mg / dl .
a computed tomography ( ct ) scan of the abdomen revealed a relatively well defined , large heterogeneous tumor in the right kidney ( figure 1 ) .
ct scans of the brain and chest , as well as a bone scan were carefully examined to look for signs of metastatic disease .
the preoperative impression was a renal cell carcinoma ; the patient underwent a right radical nephrectomy .
macroscopically , a very large mass measuring 1015 cm , from the right kidney , was identified ( figure 2 ) .
the tumor penetrated the capsule , but there was no infiltration into the renal pelvis , hilus of the kidney or adjacent lymph nodes .
histological examination revealed a pure small cell carcinoma with scant cytoplasm and stippled nuclear chromatin ( figure 3a ) .
immunohistochemical stains revealed that the tumor cells were strongly positive for synaptophysin , weakly positive for chromogranin , and negative for s-100 , leukocyte common antigen ( figure 3b , 3c ) .
postoperatively , the patient received six courses of adjuvant chemotherapy consisting of etoposide and cisplatin . upon completion of the chemotherapy , all oncological investigations , including abdominopelvic ct and chest x - ray , revealed no evidence of recurrence .
the patient is currently well without any evidence of recurrence at 28 months following the primary diagnosis .
small cell carcinomas are most commonly identified in the lungs ; these tumors have also been reported to originate from a number of extrapulmonary sites such as : colorectal , esophagus , pancreas , bladder , uterine cervix , larynx , and salivary glands1 , 2 ) .
small cell carcinomas of the genitourinary tract have most commonly been reported to develop in the urinary bladder .
a review of patients with small cell carcinoma of the kidney revealed a median age at diagnosis of 62 years , and showed that women are more commonly affected than men3 ) .
there are no pathognomic clinical findings or symptoms that suggest the presence of this abnormality .
symptoms , as with other cancers of the kidney , are fundamentally characterized by abdominal pain and hematuria .
the next most common clinical manifestations are hematuria ( 45% ) followed by flank mass ( 15% ) and weight loss ( 10% ) .
the diagnosis of a small cell carcinoma , whether of pulmonary or extrapulmonary origin , can be established by light microscopic and immunohistochemical examination of tumor tissue .
the tumor can be further classified into a pure or combined type . in the literature , masuda et al4 )
reported 18 cases of small cell carcinoma of the kidney ; more than half of these cases were associated with transitional cell carcinoma .
patients with small cell carcinoma of the kidney can be clinically classified using a method similar to that of small cell carcinoma of the lung5 ) .
limited disease is defined as a tumor localized to the organ of origin , and regional lymph nodes easily included within one radiation therapy treatment portal ; any evidence of disease beyond this is classified as extensive disease .
majhail et al3 ) reviewed the literature based on this classification and found that limited stage disease was present in 10 of 18 patients available for evaluation .
although the clinical behavior of these tumors can vary based on their origin , extrapulmonary small cell carcinomas are invariably aggressive , with a median survival time of less than one year ; they have a tendency to develop early nodal and disseminated metastatic disease6 ) .
because of the unfavorable prognosis , multimodal therapy has been used increasingly to prolong life .
multimodal therapy typically includes chemotherapy and radiotherapy as well as possible surgery depending on the severity of the disease and its primary site .
chemotherapeutic regimens used in treating extrapulmonary small cell carcinomas are the same as those employed in small cell carcinomas of the lung .
the use of platinum based adjuvant chemotherapy may be a reasonable approach to these patients in an effort to decrease the chance of systemic recurrence .
however , localized treatments should not be used , as a single modality , for the treatment of limited disease . in conclusion , we report a case of an unusual primary small cell carcinoma of the kidney .
the patient is currently well without any evidence of recurrence at 28 months following the primary diagnosis .
our results suggest that after complete resection of the tumor , chemotherapy should be provided due to the high incidence of occult metastases .
the outcome of our patient suggests that cisplatin based chemotherapy , following surgical treatment of a small cell carcinoma of the kidney , may improve the currently dismal prognosis of similar cases .
Output:
| up to 5% of all small cell carcinomas develop at extrapulmonary sites .
primary small cell carcinomas originating in the kidney are extremely rare neoplasms . here
we report a case of primary small cell carcinoma of the kidney .
a nephrectomy was performed on a 52-year - old female patient to remove a large tumor located in the right kidney .
the histology and immunohistochemistry of the resected tumor revealed a pure small cell carcinoma with invasion into the renal capsule .
the patient received postoperative adjuvant chemotherapy with etoposide and cisplatin .
the patient has been monitored with regular check ups and remains stable with no recurrence at 28 months after the initial diagnosis . |
PubmedSumm118422 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: abortion is defined as the expulsion of the accessories of the embryo or those of fetus weighing less than 500 from the uterus cavity before the twentieth week of the pregnancy .
it has been clearly shown that -hcg and progesterone have a prognostic value in differentiating spontaneous abortions from the normal pregnancy .
ischemia - modified albumin ( i m a ) , a modification of human serum albumin caused by ischemia , measured by the albumin cobalt test has been proposed as a serum biomarker of myocardial ischemia .
it is a nonspecific marker for ischemia because oxidative free radicals can be formed in every kind of ischemia .
serum i m a appears to be elevated in normal pregnancy [ 1 , 2 ] .
previous reports have documented ongoing ischemia and formation of oxygen free radicals during physiological pregnancy [ 35 ] .
several studies were also performed to investigate i m a levels in complicated pregnancies such as preeclampsia , intrauterine growth restriction ( iugr ) , and recurrent pregnancy loss [ 6 , 7 ] and serum i m a levels from women with preeclampsia as a consequence of defective endovascular trophoblast invasion were detected to be higher than those with normal placentation in first trimester and serum i m a levels were significantly higher in women with recurrent pregnancy loss as an abnormally high hypoxic intrauterine environment which may be associated with abnormal placental development .
our previous study including free -hcg , progesterone , and ca-125 showed that ca-125 levels are not an effective marker either alone or by adding -hcg with progesterone in detecting abortions and the single measurement of free -hcg or progesterone levels can be useful in the prediction of first trimester spontaneous abortions . by excluding ca-125 ,
our aim was to investigate serum levels of free -hcg , progesterone , and i m a alone and their combined use in the prediction of first trimester abortion in the present study .
the study protocol was approved by the medical ethics committee of our university and a written informed consent was obtained from each patient who participated in this study .
this work was supported by the research fund of karadeniz technical university , project number : 2009.114.002.6 .
a total of 156 singleton pregnant women who were admitted to our department of obstetrics and gynecology between the 5th and 13th week of gestational age were included in this case - control study .
pregnant women with multiple pregnancy , ectopic pregnancy , missed abortion , blighted ovum , threatened abortion , an abnormal serum albumin level ( normal level , 35.5 mg / dl ) , prior treatment with progesterone , who were smokers or had diabetes mellitus , renal , trophoblastic and thrombophilia diseases were excluded . at admission , serum levels of free -hcg , progesterone , and i m a were noted and all pregnant women were followed until delivery .
gestational ages were determined by last menstrual period and the results of first trimester or early second trimester ultrasonographic examinations followed by a detailed examination at 20 weeks of gestation .
the diagnoses of inevitable , incomplete , complete , and missed abortion were made according to the criteria in the abortion classification .
all cases were divided into two groups , group i ( n = 77 ) resulted with abortion including missed abortion , abortus incompletus / completus , and inevitable whereas group ii ( n = 79 ) included normal pregnancies where their pregnancy did not result in abortion .
venous blood samples were collected at admission from the brachial vein of the patients and centrifuged at 3000 rpm during 10 minutes in the biochemistry laboratory of karadeniz technical university .
the levels of human serum -hcg were determined by using roch hitachi modular e-170 autoanalyzer ( tokyo , japan ) in clinical laboratory of karadeniz technical university faculty of medicine , farabi hospital .
the levels of human serum progesterone were determined by using roch hitachi modular e-170 autoanalyzer ( tokyo , japan ) in clinical laboratory of karadeniz technical university faculty of medicine , farabi hospital . the results were expressed as ng / ml . the detection range of the parameter is 0.0360 ng / ml . reduced cobalt to albumin binding capacity ( i m a level ) was analyzed using the rapid and colorimetric method of bar - or et al . .
two hundred l of patient serum was placed into glass tubes and 50 l of 0.1% cobalt chloride ( sigma , cocl2 6h2o ) in h2o was added .
after gentle shaking , the solution was left for 10 minutes , in order to ensure sufficient cobalt albumin binding .
fifty microliters of dithiothreitol ( dtt ) ( sigma , 1.5 mg / ml h2o ) was added as a colorizing agent and the reaction was quenched 2 min later by adding 1.0 ml of 0.9% nacl .
a colorimetric control was prepared for preoperative and postoperative serum samples . for the colorimetric control samples ,
50 l of distilled water was substituted for 50 l of 1.5 mg / ml dtt .
specimen absorbencies were analyzed at 470 nm by a spectrophotometer ( shimadzu uv1601 , australia ) .
the color of the dtt containing specimens was compared with that of the colorimetric control tubes .
the statistical package program for the social sciences ( spss 11.0 ; spss inc . ,
data are presented as incidence or mean sd . the compatibility of the data obtained by measurement of the normal distribution was studied by the kolmogorov smirnov test .
statistical comparisons between groups were performed using the mann - whitney u test and test and fisher exact test .
a multivariate logistic regression analysis was performed to evaluate the influence of variables on abortion according to two groups .
cut - off values were determined using receiver operating characteristic ( roc ) curve analysis , and they were 19.98 miu / ml for -hcg ( sensitivity 87.01 [ 77.493.6 95% ci ] ; specificity 79.75 [ 69.288 95% ci ] ) , 20.45 ng / ml for progesterone ( sensitivity 96.10 [ 8999.2 95% ci ] ; specificity 74.68 [ 63.683.8 95% ci ] ) , and > 0.886 for i m a ( sensitivity 75.32 [ 64.284.4 95% ci ] ; specificity 91.14 [ 82.696.4 95% ci ] ) .
sensitivity and specificity were calculated according to the formulas [ tp / tp + fn ] 100 , [ tn / tn + fp ] 100 , respectively , and expressed as a percentage . in the formulas we have the following : tp : true positive
; fn : false negative ; tn : true negative ; and fp : false positive cases .
normal pregnancy was defined as delivery after 37 weeks of gestation where the neonatal birthweight was above the 5th centile for gestation .
the general characteristics of cases during the admission and the mean values of -hcg , progesterone , and i m a for each group are represented in table 1 .
no difference was detected between the two groups in terms of age , number of pregnancy , mean pregnancy weeks , and number of previous abortions ( p > 0.05 , p > 0.05 , p > 0.05 , and p > 0.05 , resp . ) .
when the groups were compared , a statistical difference was found in terms of mean -hcg , progesterone , and i m a values ( p < 0.01 , p < 0.01 , and p < 0.01 , resp . ) , ( table 2 ) . the sensitivity , specificity , and positive predictive and negative predictive values are given in table 3 .
when 20 miu / ml was taken as cut - off value for -hcg level , a significant difference was detected between both groups ( p < 0.01 ) .
when 20.45 ng / ml was taken as cut - off value for progesterone level , a statistically significant difference was detected markedly between both groups ( p < 0.01 ) .
when 0.886 was taken as cut - off value for i m a level , a significant difference was detected between the groups ( p < 0.05 ) ( table 3 ) .
the sensitivity , specificity , and positive and negative indicative values in determining abortion when all parameters are used together are given in ( table 3 ) . by taking the age as constant in multivariate logistic regression analysis it was observed that -hcg , progesterone , and i m a are independent determining factor in predicting abortion ( table 4 ) .
in aggrement with the previous studies [ 11 , 12 ] , we found -hcg levels significantly lower in the group where their pregnancy resulted in abortion than that of the group where no abortion was detected . in the previous study , when the healthy pregnancy group as control was compared with the abortus group , we found sensitivity as 91% , specificity as 82% , and positive predictive value as 46% in abortion cases when we took the estimation value as < 20 miu / ml for -hcg .
the sensitivity value of the single measurement of -hcg ( 20 miu / ml ) and the sensitivity of using -hcg and progesterone together that we obtained as 88% and the specificity of both as 80% in detecting abortions are consistent with those of our previously reported study and those found in the study of daily et al . .
in addition , similar to our previously reported study , we detected that -hcg has an independent effect on abortion in the multiple regression analysis in the present study .
daily et al . found the sensitivity of progesterone as 75% and specificity as 78% when they took the estimation value as < 15 ng / ml in the differentiation of the abnormal pregnancy and the normal pregnancy .
similarly , according to the study of daily et al . , we found previously the sensitivity of progesterone as 91% and the specificity as 89% in the differentiation of pregnancies resulting in abortion from normal pregnancies when we took the estimation value as < 15 ng / ml in pregnancies between the 5th and 13th week of gestational age . in the present study
, we found the sensitivity as 96% and the specificity as 75% in the detection of abortion when we took the estimation value as 20.45 ng / ml . our results are consistent with those of daily et al . and hahlin et al .
it is clear that when the cut - off level of progesterone will be found higher , the detection of spontaneous abortion rate will increase .
in addition , similar to our previously reported study , we detected that -hcg has an independent effect on abortion in the multiple regression analysis in the present study .
furthermore , according to our previously reported study , we detected similarly that the use of both -hcg and progesterone together instead of studying -hcg and progesterone once does not provide additional benefit in terms of increasing the sensitivity value i m a ; a protein elevated in cardiac ischemia , is also increased to supraphysiological levels in early normal pregnancy .
this finding supports the hypothesis that normal trophoblast development is stimulated by a hypoxic intrauterine environment and abnormally high intrauterine hypoxia and subsequent reperfusion oxidative damage may be associated with defective trophoblast development .
however , the mechanism of i m a related pregnancy is not totally understood and various studies have demonstrated.that i m a may increase in normal pregnancy [ 1 , 2 ] , remain unchanged or increase [ 35 ] in pregnancy with preeclampsia .
it can be also speculated that serum i m a levels from women with ectopic pregnancy may be detected to be higher than those with normal placentation in first trimester by a hypoxic environment and reperfusion oxidative damage .
differences in methodology or specificity of procedures to determine the i m a and the differences of cut - off value have probably resulted in differences outcome .
in addition , the types of abortus vary among studies ; therefore the heterogeneity in classification may differ the outcome .
the test combinations and the timing of screening during pregnancy may also influence the different outcome
. we found that i m a levels were significantly higher in the abortus groups than in the control group and i m a with a cut - off point of 0.886 identified women with abortus with sensitivity 74% and specificity 91% .
in the study of hjortshj et al . the sensitivity of admission i m a ( at optimal cut - off threshold 91 u / ml ) for a final diagnosis of acute coronary syndrome was 86% , specificity 49% , and npv 88% .
this rise in i m a may be a clinical manifestation of abnormally high intrauterine hypoxia and subsequent reperfusion oxidative damage that underlie defective endovascular trophoblast development .
first trimester serum i m a may thus be a potential biomarker for abnormal placental development . in conclusion , based on the findings that the single measurement of i m a had higher specificity and ppv , the single and the combination measurements of free -hcg and progesterone levels had higher sensitivity in the present study and as independent variables the combined use of free -hcg , progesterone , and i m a levels can be useful in the prediction of first trimester spontaneous abortions .
Output:
| objective . to investigate serum levels of free -hcg , progesterone , and ischemia - modified albumin ( i m a ) and their combined use in the prediction of first trimester abortions
. methods .
a total of 156 pregnant women between 5 and 13 weeks of gestational age were included in this study . at admission , serum levels of free -hcg , progesterone , and i m a
were noted and all cases were divided into two groups ; group i ( n = 77 ) resulted in abortion including missed abortion , incomplete / complete abortion , and inevitable abortion whereas group ii ( n = 79 ) included normal pregnancies .
results . compared to group ii , the significantly decreased value of free -hcg progesterone and significantly increased value of i m a were found in group i ( p < 0.01 , p < 0.01 , p < 0.01 , resp . ) .
when combining all three parameters , sensitivity 75% , specificity 99% , ppv 98% , and npv 76% were obtained .
the multivariate logistic regression analysis revealed the free -hcg , progesterone , and i m a independent factors in the prediction of abortions . conclusions . the combined use of free -hcg , progesterone , and i m a levels can be useful in the prediction of first trimester spontaneous abortions . |
PubmedSumm118423 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: intracytoplasmic sperm injection ( icsi ) has emerged as an ideal tool for the treatment of severe male infertility .
previous studies have confirmed that a viable spermatozoon is the prerequisite for initiating fertilization in cases of icsi .
it was reported that icsi using completely immotile spermatozoa usually resulted in a relatively low fertilization rate and at times , even complete fertilization failure .
therefore , motile sperm are preferentially selected for icsi in practice . thus far , sperm cryopreservation is the most effective method of preserving male fertility , although the freezing - thawing process can cause irreversible damage to the sperm .
considering the cryodamage to the sperm , only motile sperm should be cryopreserved . however , we do not know whether completely immotile spermatozoa are suitable for cryopreservation for icsi .
on the basis of our previous reports , we present a case in which successful pregnancy was achieved by using a noncontact diode laser ( wavelength , 1.48 m ) to identify viable sperm before freezing and after thawing in a patient with completely immotile spermatozoa ; this may help embryologists recognize the value of cryopreserving completely immotile spermatozoa .
in this study , we considered a 40-year - old man with infertility due to nonobstructive azoospermia .
his 38-year - old wife presented to center for reproductive medicine , the maternal and child health hospital of guangxi zhuang autonomous region with a 10-year - long history primary infertility .
his serum follicle - stimulating hormone level was 14.7 miu / ml , and his karyotype was 46,xy without y - chromosome microdeletion . a semen analysis according to the world health organization manual repeatedly showed azoospermia .
three to five completely immotile spermatozoa per view were observed in the retrieval of the extracted testicular sperm under an inverted microscope ( magnification 200 ; olympus , tokyo , japan ) after culture for 4 hours .
sperm viability was then assessed by applying a laser beam directly to the tip of the sperm flagellum .
the viable spermatozoa rate was 55.8% , which suggested that this spermatozoa sample was worth freezing for subsequent icsi .
anesthesia was performed by 2% lidocaine to the spermatic cord block . a 50-ml syringe containing 0.5 ml of quinn 's 1020 ( sage , trumbull , ct , usa ) and
these samples were then independently minced using two sterile needles in a dish containing 2 ml of the fertilization medium , quinn 's 1020 . the sperm sample containing a 200 l suspension
was concentrated to 5 l by centrifugation ( 2,000 rpm ) and then diluted with a sperm cryoprotectant medium in a 1:1 ratio . after being maintained at the liquid nitrogen surface for 4 minutes
, the cryotip was rapidly immersed in liquid nitrogen at 196 for long - term cryopreservation .
the thawing test was performed on the day of oocyte pick - up as follows : the cryotip was taken out of the liquid nitrogen , placed immediately into the 37 water bath , and kept for 15 minutes before adding to the quinn 's 1020 dish .
after incubation for 4 hours , no motile sperm were observed , and viability was assessed by laser .
controlled ovarian stimulation was carried out after downregulation with diphereline ( ipsen , tianjin , china ) .
follicle - stimulating hormone was administered at a dose of 200 iu per day as described previously by feng et al . .
when dominant follicles reached a diameter of 18 mm , ovulation was induced by an intramuscular injection of 10,000 iu of human chorionic gonadotrophin ( hcg ) .
oocytes were recovered by the transvaginal aspiration of follicles under ultrasound guidance 36 hours after the hcg injection .
sperm viability was assessed by a diode laser ( wavelength , 1.48 m ) as described by aktan et al . .
before the freezing process , testicular sperm viability was assessed by laser , and cryopreservation was performed immediately .
thawed spermatozoa were washed , and the pellet was suspended in quinn 's 1020 medium .
laser assessment of sperm viability was performed by a direct laser shot to the tip of the sperm flagellum using laser energy of approximately 200 j at an irradiation time of approximately 2 ms .
if a spermatozoon responded to the laser shot by the curling of its tail , it was regarded as presumably viable and selected for icsi ( figure 1 ) .
fertilization was checked by the detection of two pronuclei and two polar bodies at 16 to 18 hours after icsi . only zygotes displaying two pronuclei were transferred to quinn 's 1026 medium ( sage ) supplemented with 10% serum protein substitute ( sage ) from days 0 to 3 , and then were moved into quinn 's 1029 medium ( sage ) supplemented with 10% serum protein substitute for another 2 days .
a biochemical pregnancy test was carried out 14 days after embryo transfer by measuring the serum -hcg level .
clinical pregnancy was confirmed if a gestational sac was observed in a vaginal ultrasound 6 to 8 weeks after transfer . on the day of oocyte
pick - up , the spermatozoa sample was thawed and no motile spermatozoa were detected , while 39.8% of the spermatozoa were observed to be viable in the laser assessment . after culturing for 4 hours , the viable spermatozoa from the frozen - thawed immotile spermatozoa were selected by laser for icsi .
a total of five mature oocytes were injected , resulting in four cases of normal fertilization ( 80% ) on day 1 , four cases of normal cleavage on day 2 , and two high - quality embryos on day 3 .
fourteen days after the intrauterine transfer , the blood concentration of -hcg was 492.6 iu / l , and one gestational sac with heart activity was observed by transvaginal ultrasonography 3 weeks after the transfer .
in this study , we considered a 40-year - old man with infertility due to nonobstructive azoospermia .
his 38-year - old wife presented to center for reproductive medicine , the maternal and child health hospital of guangxi zhuang autonomous region with a 10-year - long history primary infertility .
his serum follicle - stimulating hormone level was 14.7 miu / ml , and his karyotype was 46,xy without y - chromosome microdeletion . a semen analysis according to the world health organization manual repeatedly showed azoospermia .
three to five completely immotile spermatozoa per view were observed in the retrieval of the extracted testicular sperm under an inverted microscope ( magnification 200 ; olympus , tokyo , japan ) after culture for 4 hours .
sperm viability was then assessed by applying a laser beam directly to the tip of the sperm flagellum .
the viable spermatozoa rate was 55.8% , which suggested that this spermatozoa sample was worth freezing for subsequent icsi .
anesthesia was performed by 2% lidocaine to the spermatic cord block . a 50-ml syringe containing 0.5 ml of quinn 's 1020 ( sage , trumbull , ct , usa ) and
these samples were then independently minced using two sterile needles in a dish containing 2 ml of the fertilization medium , quinn 's 1020 . the sperm sample containing a 200 l suspension
was concentrated to 5 l by centrifugation ( 2,000 rpm ) and then diluted with a sperm cryoprotectant medium in a 1:1 ratio . after being maintained at the liquid nitrogen surface for 4 minutes
, the cryotip was rapidly immersed in liquid nitrogen at 196 for long - term cryopreservation .
the thawing test was performed on the day of oocyte pick - up as follows : the cryotip was taken out of the liquid nitrogen , placed immediately into the 37 water bath , and kept for 15 minutes before adding to the quinn 's 1020 dish .
after incubation for 4 hours , no motile sperm were observed , and viability was assessed by laser .
controlled ovarian stimulation was carried out after downregulation with diphereline ( ipsen , tianjin , china ) .
follicle - stimulating hormone was administered at a dose of 200 iu per day as described previously by feng et al . .
when dominant follicles reached a diameter of 18 mm , ovulation was induced by an intramuscular injection of 10,000 iu of human chorionic gonadotrophin ( hcg ) .
oocytes were recovered by the transvaginal aspiration of follicles under ultrasound guidance 36 hours after the hcg injection .
sperm viability was assessed by a diode laser ( wavelength , 1.48 m ) as described by aktan et al . .
before the freezing process , testicular sperm viability was assessed by laser , and cryopreservation was performed immediately .
thawed spermatozoa were washed , and the pellet was suspended in quinn 's 1020 medium .
laser assessment of sperm viability was performed by a direct laser shot to the tip of the sperm flagellum using laser energy of approximately 200 j at an irradiation time of approximately 2 ms .
if a spermatozoon responded to the laser shot by the curling of its tail , it was regarded as presumably viable and selected for icsi ( figure 1 ) .
fertilization was checked by the detection of two pronuclei and two polar bodies at 16 to 18 hours after icsi . only zygotes displaying two pronuclei were transferred to quinn 's 1026 medium ( sage ) supplemented with 10% serum protein substitute ( sage ) from days 0 to 3 , and then were moved into quinn 's 1029 medium ( sage ) supplemented with 10% serum protein substitute for another 2 days .
a biochemical pregnancy test was carried out 14 days after embryo transfer by measuring the serum -hcg level .
clinical pregnancy was confirmed if a gestational sac was observed in a vaginal ultrasound 6 to 8 weeks after transfer . on the day of oocyte
pick - up , the spermatozoa sample was thawed and no motile spermatozoa were detected , while 39.8% of the spermatozoa were observed to be viable in the laser assessment . after culturing for 4 hours , the viable spermatozoa from the frozen - thawed immotile spermatozoa were selected by laser for icsi .
a total of five mature oocytes were injected , resulting in four cases of normal fertilization ( 80% ) on day 1 , four cases of normal cleavage on day 2 , and two high - quality embryos on day 3 .
fourteen days after the intrauterine transfer , the blood concentration of -hcg was 492.6 iu / l , and one gestational sac with heart activity was observed by transvaginal ultrasonography 3 weeks after the transfer .
to the best of our knowledge , this is the first report of a successful pregnancy achieved using completely immotile frozen - thawed spermatozoa selected by laser .
our report demonstrates for the first time that completely immotile sperm can be successfully frozen and that normal in vitro fertilization ( ivf ) ability can be achieved , which may provide a new insight into male fertility preservation in patients with completely immotile sperm . regarding the cryodamage to the sperm , only motile sperm
are generally cryopreserved in routine clinical operations , while the immotile spermatozoa are often discarded , resulting in the loss of the opportunity of assisted reproductive treatment for some patients . therefore
, effective preservation of the fertility of viable but immotile spermatozoa is a major challenge facing ivf .
as is known , completely immotile spermatozoa are often found in ivf treatment cycles involving ejaculate samples in patients with conditions such as primary cilia dyskinesia , which is a rare autosomal recessive multisystem disorder characterized by ultrastructural and functional defects of the ciliated cells of the body .
completely immotile spermatozoa also occasionally occur in surgically extracted testicular spermatozoa , which can be attributed to very heterogeneous events and are a consequence of oxidative stress , infection , or numerous other factors .
according to the traditional freezing procedure , immotile testicular spermatozoa are likely to be abandoned and a subsequent biopsy is scheduled , which increases both the chances of long - term complications and the economic burden on the patients .
many studies have demonstrated that using fresh immotile sperm for icsi can lead to successful fertilization .
the selection of immotile but viable spermatozoa on the day of icsi is a major challenge for embryologists .
the latest world health organization manual ( 2010 ) for the examination and processing of human semen recommends the eosin test , which may be used in combination with negrosin , and the hypo - osmotic swelling ( hos ) test for the diagnostic evaluation of vitality .
the eosin test is the standard technique for determining sperm viability and is based on the exclusion of the dye .
nonviable spermatozoa exhibit deficient cell membrane structures , permitting eosin to enter the cells and stain them , whereas viable spermatozoa remain unstained .
however , once exposed to toxic dyes , spermatozoa are no longer suitable for icsi , which limits its application in assisted reproductive techniques .
the hos test has been reported to be successful in the fertility treatment of patients with fresh completely immotile spermatozoa .
however , it must be noted that spontaneously developed tail swelling may influence the accuracy of the hos test in the determination of the membrane integrity and viability of human spermatozoa .
therefore , this method is not suitable for spermatozoa that have been processed , specifically for cryopreservation , and then thawed .
a healthy birth was reported after the laser - assisted immobilization of spermatozoa before icsi .
application of a noncontact diode laser to immobilize sperm is considered safe , because its energy is much lower than that used in assisted hatching . in 2004 ,
for the first time presented data showing that presumably viable spermatozoa can be easily selected by using a laser system .
their results showed that the percentage of immotile spermatozoa classified as viable by the laser test ( 22.0% ) was similar to that detected by the hos test ( 21.50% ) .
the fertilization rate increased significantly from 20.4% in the randomly selected testicular sperm extraction spermatozoa to 45.4% in the laser - selected group ; accordingly , the take - home baby rate increased from 5.9% to 19.0% .
laser - assisted selection of viable spermatozoa in a patient with completely immotile sperm , which were subsequently used for icsi , was found to lead to a successful pregnancy .
compared with the hos test , laser - assisted selection of viable sperm is more objective , simple , and rapid , and does not require the use of other chemical agents . here , we described the successful cryopreservation of immotile but viable spermatozoa detected by single laser shots , and the achievement of ideal embryo development and clinical outcomes using the viable frozen - thawed spermatozoa for icsi . in conclusion
, we believe that viable but immotile spermatozoa can be preserved for further icsi , which provides a new insight into male fertility preservation with completely immotile spermatozoa .
Output:
| the aim of this study was to report a successful pregnancy using completely immotile frozen - thawed spermatozoa selected by laser .
a single laser shot was used to detect the presence of viable immotile spermatozoa in fresh and frozen - thawed testicular spermatozoa .
the viability rate was 55.8% after the laser detection , and cryopreservation was carried out immediately .
the thawing test was performed on the day of oocyte pick - up , and no motile sperm were observed after extending the culture for another 4 hours , while a survival rate of 39.8% was detected using the laser . in all , five mature oocytes were injected , resulting in four cases of normal fertilization ( 80% ) on day 1 .
further , two high - quality day 3 embryos were transferred , which resulted in a singleton pregnancy .
our study demonstrates that completely immotile spermatozoa are worth cryopreserving for further intracytoplasmic sperm injection , which provides a new insight into male fertility preservation in cases of completely immotile spermatozoa . |
PubmedSumm118424 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: we present a case of foreign body granuloma on the eyelids secondary to cosmetic filler injection on the forehead , which developed several years after the injection .
filler migration and the clinical significance and microscopic features of granuloma lesions are also discussed .
written informed consent was obtained from the patient and this study was approved by the tri - service general hospital review board ( affiliated to the national defense medical center ) .
a 72-year - old taiwanese woman was referred to our oculoplastic clinic , with swelling on both upper eyelids , with multiple painless nonmovable palpable masses , without blepharoptosis , which she had for 4 years .
the best - corrected visual acuity of both eyes was 6/8.6 , and intraocular pressure was normal .
she did not receive the injection around both eyelids , and there were no other specific problems after the injections .
the masses were found below the eyebrow border , sized ~2.5 and ~2.0 cm in diameter in the right and left eyes , respectively , with well - defined , irregular - shaped borders firm on palpation .
there was no sign of acute inflammation of the overlying skin ( figure 1a ) .
the excised mass was yellowish with an irregular border and had a rubbery consistency ( indicated by arrows in figure 1a and b ) .
the size of the mass detected in the subcutaneous region in the right eye was 2 cm 1 cm ( figure 1b and c ) .
microscopic examination showed that foreign body granuloma was composed of multiple nodules characterized by basophilic amorphous materials surrounded by an irregular fibrous border ( figure 2a ; hematoxylin and eosin [ h&e ] , 100 ) .
the fibrous border was composed of histiocytes , multinucleated giant cells , and fibroblasts ( figure 2b ; h&e , 400 ) .
after 1 year postoperative follow - up , the patient recovered well without obvious disfigurement and had only slight scar from the surgery .
eyelid problems range from benign , self - resolving processes to malignant , possibly metastatic , tumors . in the past few decades ,
more and more people have been resorting to facial enhancement with dermal fillers for cosmetic purposes .
clinically , dermal fillers are composed of autologous fat , bovine collagen , paraffin , fluid silicone , polytetrafluoroethylene ( teflon ; dupont , wilmington , de , usa ) , and polymer and silicone particles .
these fillers have been used to correct soft tissue defects as well as to fill in soft tissue volume around the lips and nasolabial region . for this reason ,
dermal fillers should have properties of biocompatibility , safety , and stability at the implant site and the abilities to maintain their volume , remain pliable , induce minimal foreign body reactions , and not cause foreign body granuloma.1 autologous fat is a nonallergenic , well - tolerated , supple , versatile implant material .
autogenous fat injection ( afi ) into the periorbital or midface region is a common type of cosmetic surgery for rejuvenation in middle - aged and elderly western subjects.2 common complications of facial afi include unrealistic patient expectations , bruising , hematoma , undercorrection , overcorrection , and asymmetry contour of injection site.3 often these adverse reactions result from improper use of products performed by unskilled ( or unlicensed ) practitioners.4 the complication of lipogranuloma formation at the periorbital area away from the afi site is rarely reported.5 it is plausible that the injected fat tissue on the forehead could move down to the periorbital area away from the injection site because of the movement of the frontalis muscle and gravity , as in the case of our patient .
furthermore , the fat tissue harvested for afi is usually stored frozen at 20c , but during such cryopreservation , ice crystals form inside the fat cell and many fat cells lose viability . also , if the fat tissue without viability is injected , it can increase the risk for inflammation by foreign body reaction.5 the patient in our report was confirmed to have used the cryopreserved afi for the second time , and we consider this to be the cause of the lipogranuloma .
in conclusion , there is evidence present to show that potential complications after tissue injection of autologous fat still exist .
as we treat similar cases , we should also be concerned with a possible occurrence of migration . in our study , the patient had palpable and visible masses near the upper eyelid that resulted from afi on the forehead 21 years ago .
therefore , tracking patient s detailed history and performing a thorough physical examination are necessarily important .
if any unknown mass is detected , excisional biopsy should be immediately conducted by experienced clinicians for diagnosis to avoid severe facial disfigurement afterward .
Output:
| a 72-year - old taiwanese woman had the history of cosmetic cryopreserved autologous fat injection on her forehead ~21 years ago and was referred to our oculoplastic clinic and presented with multiple painless mass , which she had for 4 years , on both upper eyelids .
histopathology confirmed the diagnosis of foreign body granuloma on both upper eyelids .
clinicians should be aware of the potential complication of granuloma reaction and migration even many years after the injection .
we advise that autologous fat injection should be performed solely by trained physicians and it should be made known that there is a possible occurrence of migration . |
PubmedSumm118425 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: parasites : blood infected with b. bovis ( shannxian ) , a
kind gift from the lanzhou veterinary research institute , was inoculated into a
splenectomized cattle immunosuppressed by dexamethasone injection .
when parasitemia reached
5% , the animal was bled and the infected blood was cryopreserved in liquid nitrogen .
the
animal experiments in this research were approved by gansu provincial science and technology
department in china and in accordance with the animal house of lanzhou institute of
husbandry and veterinary pharmaceutical science instructions .
rna extraction and cdna synthesis : total rna was extracted from purified
merozoites using the trizol reagent ( invitrogen , carlsbad , ca , u.s.a . ) and treated with
rnase - free dnasei ( takara , otsu , japan ) to remove possible contaminating dna .
measurement of
rna concentration was conducted at od 260 nm on a spectrophotometer ( thermo , hudson , nh ,
u.s.a . ) .
the cdna was prepared from approximately 5 g of the total rna
using the m - mlv first - strand synthesis system for qrt - pcr ( invitrogen ) according to the
manufacturer s instructions .
cloning and bioinformatic analysis of bbdxs gene : primers specific for
b. bovis dxs were designed based the b. bovis t2bo
dxs(genbank accession no .
the open reading frame ( orf )
of dxs was amplified by pcr using primers with bamhi and hindiii
restriction sites ( underlined ) , bbdxs - f ( ggtcggatccatggtgctgatgttaccccttgt ) and bbdxs - r ( gtgcaagctttcatgacgccaggaactgcc ) .
the pcr conditions were as follows : initial denaturation
at 94c for 5 min , followed by 30 amplification cycles ( 94c for 45 sec , 68c for 45 sec and
72c for 2 min ) and a final extension step at 72c for 10 min .
the pcr products were
purified with the dna purification kit ( takara ) and subcloned into pgem - t easy vector
( promega , madison , wi , u.s.a . ) .
( shanghai , china ) . functional domains , enzyme active sites and secondary structures of the deduced proteins
were analyzed using the blast search tools .
the characteristics of the deduced proteins were
compared with those of other dxs homologs by multiple amino acid alignment analysis , and the
dxs amino acid sequences of the other species were obtained from the genbank database .
alignment of all the homologous peptides was carried out using clustal omega
( http://www.ebi.ac.uk/tools/msa/clustalo/ ) software .
expression and purification of rbbdxs protein : the positive clones
plasmids were digested with restriction enzymes bamh i and hind iii and then inserted into a
similarly digested pet-30a expression plasmid with his - tag ( clontech , otsu , japan ) .
the
plasmid was transformed into e. coli bl21 ( de3 ) , and the transformed colony
was cultured in a lysogeny broth ( lb ) medium containing 50 g / ml kanamycin sodium at 37c .
when the optical density at 600 nm
reached 0.8 , expression of the recombinant fusion protein was induced by addition of 1 mm
isopropyl b - d - thiogalactopylanoside ( takara ) , followed by incubation for another 12 hr at
20c .
the bacteria were harvested by centrifugation and lysed by sonication in buffer
containing 50 mm tris - hcl ( ph 8.0 ) , 1 mm edta , 100 mm nacl , 2 mm dl - dithiothreitol , 1
mg / ml lysozyme and 0.5% triton x-100 . the recombinant fusion protein ,
his - rbbdxs , was purified using ni - nta affinity chromatography according to the
manufacturer s instructions ( ge healthcare , fairfield , ct . u.s.a . ) .
the purified protein was
analyzed on a 10% resolving gel using sodium dodecyl sulfate polyacrylamide gel
electrophoresis ( sds - page ) .
the concentration of the purified rbbdxs protein was determined
using the bca protein assay ( sangon ) with bovine serum albumin as the standard .
production of rabbit anti - rbbdxs anti - serum and identification of native bbdxs
enzyme : three- to six - month - old rabbits , from which pre - immune sera were
collected before immunizations , were immunized subcutaneously by injection with 2 mg
purified rbbdxs protein emulsified with an equal volume of freund s complete adjuvant
( sigma , st .
thereafter , three boosters consisting of 1 mg of the same
antigen emulsified with freund s incomplete adjuvant ( sigma ) were administered to the rabbit
via the same route at days 14 , 21 and 28 .
sera were collected 7 days after the last booster
and checked for specific antibodies by western blotting .
the animal experiments in this research were approved by gansu provincial
science and technology department in china and in accordance with the animal house of
lanzhou institute of husbandry and veterinary pharmaceutical science instructions .
b. bovis lysate was prepared as described previously and separated by 10% sds - page .
the native enzyme was
identified by western blotting using rabbit anti - rbbdxs serum , the lysate of health bovine
erythrocytes and leukocytes as a control .
rbbdxs enzyme activity : the rbbdxs enzyme reaction mixtures contained 120
mm tris - hcl ph 7.5 , 10 mm mgcl2 , 5 mm 2-mercaptoethanol , 2 mm thiamin
diphosphate , various concentrations of pyruvate - na and d , l - glyceraldehyde 3-phosphate
( d , l - gap ) or dihydroxyacetone ( dhap ) and rbbdxs in a final volume of 100
l .
after incubation at 37c , reactions were stopped by heating at 80c for
5 min , and 5-l aliquots were
separated on silica gel with n - propanol / ethylacetate / h2o 5:1:3 ( v / v / v ) .
doxp formation was monitored under 365 nm excitation
after reaction with a 10% ethylenediamine sulfate solution for 5 min at 100c . for the determination of kinetic parameters ,
the concentrations of the substrates varied , and
kinetic parameter values were calculated with graphpad prism v 5 software ( san diego , ca ,
u.s.a . ) .
the final enzymatic product doxp was identified and measured by lc - ms / ms . for lc - ms / ms analysis , we used a hypersil ods 3
m 4.6 100 mm column , coupled with an agilent 6410a triple - quadrupole
mass spectrometer ( agilent technologies , santa clara , ca , u.s.a . ) with an electrospray
ionization ( esi ) source interface operated in the negative - ion scan mode .
the ions monitored
were doxp m / z=214.11 , [ m - h ] 213 .
the capillary potential of the
ms was + 4,000 v , the gas temperature was 350c , the gas flow rate was 10 l min ,
the nebulizer pressure was 30 psi , and the dwell time was 200 ms .
all assays for the
calculation of km values were carried out at 37c and in
triplicate .
cloning and bioinformatic analysis of b. bovis dxs enzyme : among these
enzymes involved in mep pathway , we focused on dxs , which catalyzed the first step of the
mep pathway , making this enzyme a putative drug target .
this orf sequence ( genbank i d : kf694747 ) was 2,061 bp and
encoded a protein of 686 amino acids with a calculated molecular mass of 75 kda and an
isoelectric point of 6.93 ( genbank i d : kf694747 ) .
therefore , we performed blastp analysis of
translated bbdxs polypeptide and found that it shares significant homology with the
b. bovis t2bo dxs enzyme ( genbank i d : xm_001611343 ) , having 98% amino
acid sequence identity ( e value=0 ) .
the predicted secondary structure of bbdxs consisted of thiamine pyrophosphate
( tpp)binding module , a pyrimidine ( pyr ) binding domain and a transketolase c - terminal
domain ( fig . 1afig .
it consisted of tpp - binding module , pyr binding
domain and a transketolase c - terminal domain .
( b ) dxs amino acid sequences were
aligned with using the clustal omega program .
arabidopsis thaliana
( genbank : np_566686.2 ) , escherichia coli ( genbank :
wp_001583256.1 ) and theileria annulata ( genbank : xp_954253.1 ) . ) , each of which bears homology to the equivalent domains in transketolase and the e1
subunit of pyruvate dehydrogenase .
these predicted results indicated that the bbdxs belongs
to the tpp - dependent superfamily , as the dxs enzyme is highly conserved in plants and
bacteria ( fig .
residues in the active
catalysis domain are highly conserved among the dxs enzymes , and weak sequence homology has
also been identified with transketolase and the pyruvate dehydrogenase e1 subunit . expression and detection of the native of
bbdxs enzyme
: to complete the dxs enzyme biochemical characterization , the
corresponding gene was overexpressed in e. coli and purified by ni - nta
affinity chromatography .
purified rbbdxs revealed a 78-kda band on 10% sds - page , including an
additional 3 kda of the his - tag sequence ( fig .
lane 1 , purified recombinant bbdxs fused with his - tag after analysis by sds - page ; ( b )
lane m , molecular size marker .
lane 2 and lane 4 , western blot analysis of the
purified rbbdxs ; lane 3 and lane 5 , western blot analysis of the lysates of
b.bovis ; lane 6 and lane 7 , western blot analysis of the
erythrocytes and leukocyte of health bovine , respectively .
the first antibody of lane
2 and lane 3 was preimmune sera of rabbit;the first antibody of lane 4 to lane 7 was
rabbit anti - rbbdxs anti - serum . ) .
furthermore , rabbit anti - rbbdxs enzyme serum reacted with b. bovis
lysate to yield a specific band of approximately 75 kda and with the purified rbbdxs to
yield a 78-kda band , but not the health bovine erythrocytes and leukocytes .
however , serum
of non - immunized rabbit did not react with the babesia lysate ( fig .
it consisted of tpp - binding module , pyr binding
domain and a transketolase c - terminal domain .
( b ) dxs amino acid sequences were
aligned with using the clustal omega program .
arabidopsis thaliana
( genbank : np_566686.2 ) , escherichia coli ( genbank :
wp_001583256.1 ) and theileria annulata ( genbank : xp_954253.1 )
lane 1 , purified recombinant bbdxs fused with his - tag after analysis by sds - page ; ( b )
lane m , molecular size marker . lane 2 and lane 4 , western blot analysis of the
purified rbbdxs ; lane 3 and lane 5 , western blot analysis of the lysates of
b.bovis ; lane 6 and lane 7 , western blot analysis of the
erythrocytes and leukocyte of health bovine , respectively .
the first antibody of lane
2 and lane 3 was preimmune sera of rabbit;the first antibody of lane 4 to lane 7 was
rabbit anti - rbbdxs anti - serum .
rbbdxs enzyme activity : we theorized that the expressed rbbdxs is likely
to be an active enzyme because bbdxs cdna encoded an authentic protein .
therefore , we
examined rbbdxs activity and found that rbbdxs could catalyze the formation of doxp using
d , l - gap or dhap as a substrate .
this demonstrates that the rbbdxs enzyme may have
isomerization activity . when the reaction product was subjected to chromatography with
authentic doxp ( sigma ) under the same assay conditions , no formation of doxp
after induction
of e. coli bl21 ( de3)/pet 30a - dxs with iptg , purified rbbdxs was
incubated with na - pyruvate and d , l - glyceraldehyde 3-phosphate or dihydroxyacetone
( dhap ) . in the product mixture separation by tlc , the product doxp was detected under
365 nm uv either pyruvate and dl - gap ( lane3 ) or pyruvate and dhap ( lane4 ) as
substrates .
after induction
of e. coli bl21 ( de3)/pet 30a - dxs with iptg , purified rbbdxs was
incubated with na - pyruvate and d , l - glyceraldehyde 3-phosphate or dihydroxyacetone
( dhap ) . in the product mixture separation by tlc
, the product doxp was detected under
365 nm uv either pyruvate and dl - gap ( lane3 ) or pyruvate and dhap ( lane4 ) as
substrates .
the steady - state kinetic parameters for rbbdxs enzyme revealed
km values of 380 46 m and 790 52
m for d , l - gap and na - pyruvate , respectively ( fig .
4.effects of substrate concentration on the activities of purified dxs for pyruvate ( a )
and d , l - gap ( b ) .
dxs activities were determined in the presence of a fixed
concentration of the second substrate by using a coupled assay method . ) .
the km values for both pyruvate and d , l - gap were higher
than the values obtained for agrobacterium tumefaciens ( 40.3 and 23.2
m for pyruvate and gap , respectively ) and for streptomyces sp . strain ( 65 and 120
m for pyruvate and d - gap , respectively ) .
effects of substrate concentration on the activities of purified dxs for pyruvate ( a )
and d , l - gap ( b ) .
dxs activities were determined in the presence of a fixed
concentration of the second substrate by using a coupled assay method .
the mevalonate - independent pathway for isoprenoid biosynthesis , which generates isoprenoid
precursors , is a promising chemotherapeutic target , because this pathway is different from
the mevalonate pathway in mammals and very important to such pathogens .
the reaction , which is catalyzed by dxs enzyme in
the mep pathway , is similar to that of transketolases : a c2 unit derived from
pyruvate is transferred to an aldose in a thiamine - dependent reaction .
although the dxs proteins from other microorganisms and plants have
been the subject of characterization and metabolic engineering studies , no characterization has been reported for dxs from
b. bovis , which is one of the most important apicomplexan parasites
worldwide .
therefore , we cloned and expressed the dxs - encoding genes from b.
bovis in this study .
first , we identified the b. bovis dxs gene that encodes the putative
enzyme of the mep pathway , indicating that the pathway is present in this parasite .
multiple
sequence alignments show that the deduced secondary structure of bbdxs is similar to that of
other known enzymes .
we found that the bbdxs polypeptide has tpp - binding module , a
pyr - binding domain , and a transketolase c - terminal domain as do the already characterized
dxs enzymes .
we also found that amino acid
residues in the catalytic domain of babesia dxs and those of other species
are highly conserved .
these observations appear to concur with previous reports that the dxs
enzyme belongs to the tpp - dependent superfamily and shares homology with the transketolases
. in apicomplexa ,
protein import into the lumen of the apicoplast is faciliated by a
bipartite signaling mechanism that requires an n - teriminal signal peptide followed by a
transit peptide .
however , application of either program to predict apicoplast targeted
proteins in related apicomplexans is unreliable due to the low adenine - thymidine content of
the genome of plasmodium falciparum used to train pats and plasmoap [ 4 , 20 ] . predicted
signal and transit peptides for the b.bovis dxs protein showed that there
is no signal peptide and transit peptide using singalp , psort , pats and plasmoap . in this study
, we successfully expressed a corresponding rbbdxs in e. coli
and produced its anti - serum .
antisera against recombinant enzymes have been used to identify
and characterize other enzymes of apicomplexan parasites , including babesia
species .
similarly , our results revealed that
rabbit antisera against rbbdxs could identify rbbdxs and native bbdxs in b.
bovis , demonstrating that the bbdxs cdna encoded an authentic enzyme that exists
in some of the parasite stages .
expression of the recombinant dxs enzyme enabled us to study the biochemical properties of
the enzyme in vitro , and the determined properties of bbdxs were similar to
those reported for dxs of e. coli and r. capsulatus . in conclusion , this study reports for the first time the isolation , cloning and expression
of the b. bovis dxs gene , providing a corresponding purified rbbdxs enzyme
of approximately 78 kda that is catalytically active .
our study also demonstrated the
presence of an approximately 75-kda native bbdxs in the parasite lysate by western blotting .
we showed that b. bovis has a catalytically active dxs enzyme and
characterized the biochemical properties of rbbdxs in vitro .
consequently ,
we propose further research of the active sites of the enzyme and the study of the tertiary
structure of the purified enzyme to facilitate the design of anti - babesia
agents that can optimally target the active sites of the enzyme .
Output:
| abstractthe
1-deoxy - d - xylulose-5-phosphate synthase ( dxs ) enzyme has been characterized in other
species , but not in the genus babesia , which causes major losses in the
livestock industries worldwide .
therefore , we isolated , cloned and expressed the wild - type
b. bovis dxs cdna in escherichia coli and evaluated
its enzymatic activity in vitro .
dna sequence analysis revealed an open
reading frame of 2061 bp capable of encoding a polypeptide of 686 amino acid residues with
a calculated isoelectric point of ph 6.93 and a molecular mass of 75 kda .
the expressed
soluble recombinant fusion dxs protein was approximately 78 kda , which is similar to the
native enzyme identified from the parasite merozoite using anti - rdxs serum .
the
recombinant fusion dxs enzyme exhibited km values of 380 46
m and 790 52 m for d , l - glyceraldehyde 3-phosphate
and pyruvate , respectively . in this work , we present the first cloning , expression and
characterization of dxs enzyme from b. bovis . |
PubmedSumm118426 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: cat scratch colon is a rare colonoscopic finding first described by mcdonnell et al.1 in 2007 and is defined as bright , erythematous linear breaks that arise spontaneously and resemble scratches made by a cat .
sometimes , bright red linear markings with extravasations of fresh blood are seen in the cecum and ascending colon .
cat scratch colon was a rare condition that occurs spontaneously or is partially associated with collagenous colitis.1,2,3 a large volume of air entering the lumen of the colon during colonoscopy was believed to cause cat scratch colon.4 the cecum and ascending colon are the most common regions of occurrence of cat scratch colon .
however , we here report a case of ischemic colitis so that we can broaden our experience of this endoscopic finding in the transverse colon .
a 65-year - old woman was referred for colonoscopy because of abdominal pain and hematochezia . she had a history of end - stage renal disease , hypertension , and diabetes mellitus .
laboratory tests revealed a white blood cell ( wbc ) count of 13,900/mm , a hemoglobin level of 9.4 g / dl , and a platelet count of 228,000/mm .
serum biochemistry showed creatinine level , 6.6 mg / dl ; albumin level , 3.0 g / dl ; alanine aminotransferase level , 36 iu / l ; aspartate aminotransferase level , 38
iu / l ; bilirubin level , 1.2 mg / dl ; and alkaline phosphatase level , 198 iu / l with normal electrolytes .
negative results were obtained for stool wbc , stool culture , and clostridium difficile toxin a / b .
colonoscopy was performed after standard bowel preparation and under sedation with 3 mg of midazolam .
the colonoscopic findings showed diffuse bowel wall edema . upon examination of the distal transverse colon
computed tomography ( ct ) scan showed moderate - to - severe diffuse bowel wall thickening and focally decreased mucosal enhancement in the right colon .
the patient was diagnosed with ischemic colitis based on colonoscopic and ct findings , and clinical manifestations .
intravenous fluids were administered to treat dehydration , and total parenteral nutrition with prophylactic antibiotics was provided .
after 3 weeks , follow - up colonoscopy and ct were performed . on follow - up colonoscopy ,
the previous severe ischemic colonoscopic findings had disappeared , and ischemic mucosal change showed further resolution ( fig .
" cat scratch colon " was described for the first time in 2007 . over the past few years , very few cases have been reported .
these lesions have a prevalence rate of 0.25%.1 cat scratch colon is defined as the presence of linear mucosal breaks in the cecum and ascending colon ; the scratches are of variable length , bright red , resembling a cat scratch .
although the cause is unclear , there are several hypotheses : barotrauma from air insufflation into a less compliant colon during colonoscopy,1 complications resulting from collagenous colitis,2,3 tension in the wall of a cylindrical vessel,5 lesions related to diversion colitis,4 chronic cholestasis and its complications,6 chronic anti - inflammatory drug ingestion,7 and others . until recently ,
recently , colonic perforation due to high air pressure was reported following observation of a cat scratch colon.8 this supports the hypothesis that cat scratch colon is commonly associated with barotrauma etiology . however , barotrauma alone is not the sole cause of cat scratch colon .
recently , significant hemorrhagic linear marks have been reported to occur during colonoscopy in patients with collagenous colitis.1,2 variable amounts of chronic inflammatory infiltration is typically present in the lamina propria , with an increased number of intraepithelial lymphocytes .
in the case documented above , cat scratch colon was seen in a patient with ischemic colitis .
the right colon is predominantly involved in the hemodialysis population.9 hemodialysis tends to cause repeated hypotensive episodes and may thus induce induce vasoconstriction of the vasa recta in the right colon , leading to colonic ischemia.10 ischemic colitis is caused by hypoxemia to the terminal vascular distribution of the intestines .
the ischemic process is transient and limited to the mucosa , with fibrosis and formation of colonic strictures in the late phase .
chronic ischemic change may play a role in cat scratch colon development owing to decreased compliance similar to collagen colitis .
cat scratch colon predominantly occurs in the right colon , where the mucosa is less compliant and more susceptible.8 until recently , cat scratch colon was reported in only the cecum and ascending colon . unlike other cases of cat scratch colon , this patient 's lesion was located in the middle - to - distal transverse colon . in this case , the mucosa of the ascending colon and proximal transverse colon was already edematous , because of which barotrauma may have been an unlikely cause .
moreover , the ischemic parts of the colon wall were too stiff ( decreased compliance ) , and pressure during air insufflation may have affected the more susceptible distal ischemic area . in our case , we did not perform a mucosal biopsy and could not exclude collagenous colitis entirely . in conclusion , the presence of cat scratch colon during colonoscopy may suggest barotrauma or other colonic pathology that affects wall compliance .
ischemic colitis in this patient may have played a role in the development of cat scratch colon .
Output:
| " cat scratch colon " is a gross finding characterized by hemorrhagic mucosal scratches on colonoscopy . it is usually associated with a normal colon and
is rarely associated with collagenous colitis . in a previous report , cat scratch colon was noted in the cecum and ascending colon , but has also been observed in the distal transverse colon .
the patient in this study was also diagnosed with ischemic colitis that may have played a role in the development of cat scratch colon . |
PubmedSumm118427 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: although much discussion has centered around the appropriate technique for performing laparoscopic adjustable gastric banding ( lagb ) and has led to modifications to reduce postoperative complications , less information is available regarding the ideal method for postoperative management of the band .
they range from regularly scheduled adjustments with predetermined volumes of saline , to patient - driven fluoroscopically guided adjustments .
we propose that patient - driven , fluoroscopically guided band adjustment performed during cine - esophagography obtains optimal restriction while reducing the incidence of overtightening . this likely results in less postadjustment dysphagia and esophageal and pouch dilation .
between november 2001 and october 2003 , 248 patients underwent lagb at loyola university medical center .
all procedures were performed using the pars lucida technique . the 10-cm lap - band device ( inamed , santa barbara , ca ) was implanted in all patients .
patients were discharged on a liquid diet , which was slowly advanced over the following 4 weeks to 6 weeks .
patients were seen for band adjustments on an as needed basis with a minimum 6-week interval from the date of surgery .
criteria for adjustment were based on the patient consuming solid food , not sensing satiety , and not experiencing regular weight loss .
fluoroscopic guidance was utilized for both port access and during oral ingestion of contrast to allow for optimal band tightness . a thin stream of barium passing through the band , appropriate hold - up above the band , and no significant reflux of barium from the gastric pouch into the proximal esophagus
the volume of saline instilled was determined by the appearance of the flow of contrast during fluoroscopy .
any esophageal or pouch dilatation seen on contrast study prompted complete removal of all saline from the band and follow - up evaluation in 2 weeks to 4 weeks .
follow - up appointments for band adjustments are made based on the aforementioned criteria of consuming solid food , not sensing satiety , and not experiencing regular weight loss .
patients had their bands adjusted as often as necessary to obtain adequate restriction and to achieve ideal weight loss .
weight loss data were collected prospectively at the time of adjustment and through follow - up telephone interviews .
all patients who had a band in place at the time of this report were included in the analysis .
seven ( 2.8% ) patients had their bands removed laparoscopically , 3 for band slippage , 1 for early band erosion , 1 for gastric strangulation , 1 for conversion to gastric bypass , and 1 per patient request .
these patients were excluded from weight loss data analysis . of the remaining 241 patients ,
141 patients had a minimum of 6-month follow - up and were included in the following analysis of data .
the average age of the patients was 42 years ( range , 18 to 71 ) .
mean preoperative weight and body mass index ( bmi ) for all 141 patients were 144.4 kg ( range , 92.3 to 214.1 ) and 50.9 kg / m ( range , 35.6 to 73.8 ) , respectively .
mean postoperative bmi and percentage excess weight loss ( % ewl ) were 40.9 kg / m and 40.0% , respectively , with a mean follow - up of 11 months .
patients were further divided into 3 groups according to the length of follow - up : 6 to 12 months , 12 to 18 months , and 18 to 23 months .
patients in this group underwent a mean of 3.3 ( range , 1 to 10 ) adjustments .
mean number of adjustments for this group was 4.7 ( range , 1 to 10 ) .
twenty patients had 18 to 23 months of follow - up and underwent a mean of 6.6 ( range , 4 to 10 ) adjustments .
percentages of excess weight loss were 35.3% ( range , -2.1 to 81.0 ) , 44.4% ( range , 13.6 to 98.9 ) , and 52.1% ( range , 13.3 to 80.1 ) for the 6 to 12 month , 12 to 18 month , and 18 to 23 month follow - up periods , respectively .
follow - up bmis were 42.3 kg / m ( range , 27.8 to 65.3 ) , 39.3 kg / m ( range , 25.2 to 54.0 ) and 37.9 kg / m ( range , 29.1 to 48.5 ) for the 6 to 12 month , 12 to 18 month , and 18 to 23 month follow - up groups , respectively .
six of these slipped bands were revised laparoscopically and 3 were removed , 2 for recurrent band slippages and 1 per patient request .
eleven ( 4.4% ) port revisions were necessary , 9 for catheter leakage , 1 for flipped port , and 1 for a malfunctioning port .
at least 2 of the catheter leaks were thought to be iatrogenic in nature secondary to injury to the catheter during port access .
the average band adjustment ( time from one patient to the next ) is estimated as 10 minutes .
methods described include simple filling of the band without any radiologic guidance , the use of fluoroscopy , the possibility of a combination of both , and even the use of dynamic radio isotopic scintigraphy using radiolabeled yogurt .
favretti et al described a method of adjustment in the office without any radiological guidance based solely on patient symptomatology .
this does not afford the opportunity to individualize the volume of fluid added or removed from the band .
the authors claim that this method of adjustment is simple , quick , and effective .
they caution , however , that the office - based adjustment protocol could possibly lead to missed complications , and they go on to further recommend individualized use of radiographically guided adjustments as a method to identify and treat complications , such as esophageal or pouch dilatation , band erosion as well as stomal obstruction .
lagb was approved for use in the united states by the food and drug administration ( fda ) in june 2001 . to date ,
the initial us experience has been criticized for reporting suboptimal weight loss results compared with weight loss results reported in international studies .
however , review of the adjustment methods used in the fda a clinical trial demonstrates that adjustments were made every 3 months to 6 months , according to radiologic band lumen diameter . in some patients
it is felt that this practice led to overaggressive band tightening and possibly resulted in the high rate of complications of pouch and esophageal dilatation and poor weight loss ( 34.5% and 37.8% ewl at 12 and 24 months ) .
subsequent adoption of methods utilized by international surgeons who perform adjustments based on patient appetite and weight loss has resulted in improved results .
rubenstein et al reported their 3-year follow - up experience in 63 patients from the fda
b trial with average % ewl of 27.2% at 6 months , 38.3% at 1 year , 46.6% at 2 years , and 53.6% at 3 years .
band adjustments in this study were performed with the routine use of fluoroscopy to evaluate for the adequacy of the adjustment .
however , the authors did not mention whether adjustments were on a predetermined schedule , based on patient symptomatology or whether the volume of saline used was adjusted based on the fluoroscopic findings .
ren et al also reported excellent weight loss results with % ewl of 35.6% at 9 months and 41.6% at 12 months using similar techniques of band adjustments .
percentage ewls in our study of 35.3% , 44.4% , and 52.1% for the 6 to 12 month , 21 to 18 month and 18 to 23 month follow - up patients are comparable to those reported by international studies .
individualized band adjustment based on fluoroscopic guidance is likely to reduce the number of subsequent patient visits for additional tightening of a loose band or removal of fluid from a band in a patient with dysphagia .
additionally , the routine use of cineesophagography at the time of band adjustments allows early detection of complications , such as esophageal and pouch dilatation or band slippage .
many of these early signs can be addressed by removing fluid from the band and reevaluation in 2 weeks to 4 weeks for follow - up contrast study , thus potentially reducing long - term complications .
the complication rates in our study requiring repeat operative interventions are acceptable and consistent with reoperation rates reported in international studies . additionally , the use of fluoroscopy has prevented injury to the port or catheter during port access .
we experienced 2 such injuries during our first 100 patients who had adjustments done without the benefit of fluoroscopy . with
the ability to direct the needle into the port under radiologic guidance , inadvertent puncture or laceration of the port or catheter is avoided . finally , any leak in the system due to port malfunction is easily detected during fluoroscopic examination . if we are unable to draw back fluid or if no change occurs in the appearance of the flow of oral contrast through the band with inflation , injectable contrast is infused through the port .
extravasation of contrast and point of leakage are easily identified , leading to port revisions performed as outpatient surgery as necessary .
our data suggest that patient - driven band adjustment results in superior weight loss . in addition
, fluoroscopic guidance may optimize the result of each adjustment and minimize the incidence of adjustment - related complications .
Output:
| background : laparoscopic adjustable gastric banding has led to variable weight loss results in the united states .
we believe a patient - driven , fluoroscopically guided method of band adjustments results in the most successful weight loss.methods:between november 2001 and october 2003 , 248 patients underwent laparoscopic adjustable gastric banding . patients underwent band adjustments when consuming solid food , not sensing satiety , and not experiencing regular weight loss .
adjustments were done under fluoroscopic guidance .
data were collected at the time of adjustments and through periodic telephone interviews.results:weight loss data are available for 141 patients with a minimum of 6-month follow - up .
patients were divided into 3 groups by length of follow - up : 6 to 12 months , 12 to 18 months , and 18 to 23 months .
mean preoperative weight and body mass index for all 141 patients were 144.4 kg ( range , 92.3 to 214.1 ) and 50.9 kg / m2 ( range , 35.6 to 73.8 ) , respectively .
following a mean of 4.1 ( range , 0 10 ) adjustments , percentage excess weight loss was 35.3% ( range , -2.1 to 81.0 ) , 44.4% ( range , 13.6 to 98.9 ) , and 52.1% ( range , 13.3 to 80.1 ) for the 6 to 12 , 12 to 18 , and 18 to 23 month follow - up periods , respectively.conclusions:our data suggest that patient - driven band adjustment results in superior weight loss .
additionally , fluoroscopic guidance may optimize the result of each adjustment and minimize the incidence of adjustment - related complications . |
PubmedSumm118428 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the chosen treatment option may depend on socioeconomic and cultural factors and also on sick persons perceived susceptibility and seriousness of the disease ( 1 , 2 ) . self medication as one of the common selected choices ( 3 ) is defined as a self designated practice of using synthetic or hand - made drugs or following an unprofessional advice .
use of previously prescribed drugs for own , friends and family members , using left over drugs at home and failing to adhere to the prescribed treatment plan ( prolonging or shortening treatment period ) or change in the applied dose of the prescribed drugs could also be categorized as self medication ( 47 ) . despite efforts to limit prevalence of self medication , its increase was evident in different countries ( 8) which may pose serious threats to the health of individuals and larger societies .
notwithstanding , self medication can mitigate improvement of mild illnesses and thus relinquish needs to medical consult and alienate pressure on medical services supply especially in less developed and developing countries ( 9 , 10 ) .
use of drugs particularly prescription only medicines ( pom ) without receiving professional advice ; however , may have several consequences of which bacterial resistance , drugs interactions , prolonged treatment period , serious side effects , fail in optimal treatment , intentional and unintentional poisoning , increase of malignant and lethal diseases and drug dependency ( 1113 ) are eminent .
they are sometimes irreversible ( e.g. hepatic and renal disorders ) and may multiply treatment costs ( 14 ) .
the reported prevalence of self - medication is not compatible in different parts of the world and ranges from 12.7% in spain ( 15 ) to 75% in southern chile ( 16 ) , 40 - 60% in the vietnamese ( 17 ) , 32% in the chinese ( 18 ) , 71% in the indians ( 19 ) , 48% in the high school students of kuwait ( 20 ) , 98% in the palestinian students ( 21 ) , 18% in the spanish adults ( 22 ) , 21.5% in the portuguese s villagers(8)and 61% in mexico ( 23 ) .
the estimated per capita drug consumption in iran is higher than the reported figures in many countries of the world ( 24 , 25 ) .
self medication was introduced as one of the important precipitating factors for such a drug consumption pattern .
its prevalence was reported to be 7.83% ( 26 ) among the medical and engineering students , 3.8% ( 27 ) in a sample of teachers in northern city of babol and 57.7% ( 24 , 25 ) among the elderly people of tehran .
demographic and socioeconomic circumstances ( 12 , 16 ) , poor access to health care ( 4 , 19 , 28 , 29 ) , increase of lay people s awareness about treatment protocols ( 3 , 16 , 30 ) , change in the treatment approaches and pattern of diseases ( 11 ) , high costs of health care ( 6 , 23 ) and ease of drugs purchase without having a prescription ( 31 , 32 ) are among the frequently reported provoking factors of self - medication around the world . since we have not a clear and inclusive overview about the leading factors of self medication in iran , we attempted in this systematic review to identify all probable causes of the behavior as our first step to plan a population based study on prominent self medication s predicting factors .
several databases including ovid , medline , amed , scopus , medlib , pub med , science direct and also the scientific information database ( sid ) which is a national database of published articles in the iranian journals were scrutinized without a time limit from inception to february 2013 .
a general search were also conducted in super searcher of google scholar using the keywords of self - medication , self prescription and self treatment and their persian equivalent for unpublished materials within the mentioned time limit . all publications and reports of
non - interventional population based studies that presented prevalence of self - medication and its causing factors in english or persian were included . those studies that reported self medication using traditional or herbal medicines or over the counter ( otc ) drugs and also studies that were conducted on institution based samples
quality of the studies were determined based on the inclusion of sample size , sampling method , sampling frame , study feature and precise report of the outcome variables including prevalence of self medication and its contributing factors .
the authors assessed quality of the retrieved publications independently and any disagreement was resolved with consensus .
titles and abstracts of these papers were checked and 1121 irrelevant or duplicate studies were excluded . in the second stage 395 remaining abstracts from previous stage were scrutinized that led to exclusion of 297 abstracts due to inconsistency with the objectives of this systematic review .
full text of 98 articles assessed for eligibility at the next step and 28 were excluded due to poor reporting quality or irrelevant methodology applied . finally , 70 studies were selected based on the inclusion criteria ( fig .
the prevalence of self medication was reported in the 39 papers and its range was from 8.0% in children and adolescents of germany ( 33 ) to 98.0% in the palestinian university students ( 21 ) ( table 1 ) .
prisma flow diagram of the study search findings reported prevalence of self - medication ( psm ) in the included studies the precipitating factors of self medication were reported in 31 recruited publications that were shown in table 2 . since more than one self medication inducing factor
was introduced in the retrieved studies the total number of indicated papers in the table is more than the number of included research publications
. self medication behavior in developed countries compared to the developing countries occurs due to different precipitating factors as shown in table 3 .
sign of disease or reason(s ) that triggered self medication behavior among the studied target groups in the retrieved publication were presented in table 4 .
reported self medication inducing factors in the recruited research comparison of the reported self medication inducing factors between developed and developing countries in the recruited research reported sign of disease or reason that triggered self medication behavior in the included studies fever and headache were the most common felt signs for which self medication initiated .
family and relatives , friends , information received based on previous prescription of drugs by a physician and pharmacist were the most frequently reported source of information for self medicators .
source of information to attempt self - medication by the respondents in the recruited studies this is concordant with the source of drug supply by those who have reported performing self medication behavior ( table 6 ) .
analgesics and anti infection drugs were most frequently applied medications by the study participants in the recruited studies . reported self medicators source of drug supply in the retrieved publications findings of this study also revealed that women mostly performed self medication ( 9 , 12 , 15 , 16 , 19 , 22 , 44 , 47 , 71 ) compared to men and only in one publication the number of self medicatiors was higher amongst men ( 5 ) .
having health insurance coverage was discussed in 7 included reports among them in 6 studies the study respondents had not any health insurance ( 15 , 40 , 45 , 47 , 57 , 63 ) and one study reported that the studied sample had a kind of health insurance ( 38 ) . due to the observed methodological heterogeneity of the included studies in this systematic review including the studies target group , the applied data collection tools and reported prevalence of self medication no further statistical analysis
the review showed that regardless of the type of studied samples ( driven from general population or selected sub - groups of population ) the reported prevalence of self medication in about 53.8% of the studies was higher than 50% .
therefore , high prevalence of self medication seems to be a health challenge in many countries of the world .
low perceived seriousness of disease , lack of sufficient time to visit a physician , easy purchase of medications , having experience of good results from previous self medication and high costs of visiting a professional health care provider were among the most frequently reported factors to adopt self medication behavior .
the study findings also indicated that self medication was more prevalent in developing countries that the developed world .
receiving un - professional advice from family members , relatives and friends about efficacy of several drugs to treat different diseases in most of the recruited studies were the main sources of information for those who preferred to treat themselves .
pharmacies , friends and stored drugs at home were indicated to be the main source of drug supply for the study respondents in the retrieved publications .
analgesics and anti infection drugs were shown to be the most frequently applied drugs for self medication .
the results are consistent with the findings of several individual studies ( 2 , 4 - 8 , 12 , 15 - 19 , 22 , 28 , 29 , 31 , 36 , 37 , 38 , 40 , 46 , 47 , 51 - 53 , 58 , 60 , 62 , 70 - 72 ) on general populations .
however , the observed differences among findings of this study with the results of individual studies could mostly represent the inherent differences in the applied methodological methods in the conducted research rather than authentic divergences in the influencing factors of self medication among different populations .
this speculation is concurrent with the findings of several studies that indicated heterogeneity in the methodologies used in studies on iranians and also reporting inadequacies especially in research evidence published in iran ( 7375 ) .
as far as we are aware , this systematic review is the first review on the precipitating factors of self mediation both in general and selected samples of populations .
while we tried to follow steps of a standard protocol in conducting this systematic review , the possibility of selection bias should not be rolled out completely .
lack of access to some of the popular databases in the field , lack of time to examine all routes to find relevant publications ( cross referencing ) and to probe further for unpublished research reports were main limitations in our attempt to shed light on precipitating factors of self medication behavior .
to lower the current extent of self medication in different populations , we need more focus on all above discussed aspects of the behavior .
blaming people for their adopted treatment option without eliminating current hassles they encounter in accessing health care will not lead to a major change in practice .
there is a considerable heterogeneity in the methodology and findings of the studies that have focused on self medication behavior .
the wide range of the reported prevalence of self medication among different communities and subgroups of populations represents both methodological challenges we have in practicing evidence based research approach and also practical challenges in controlling the interrelated factors that may lead to self medication behavior .
the identified factors can be categorized into contextual factors ( education level and economic conditions in communities , etc ) , health care systems related factors ( current policies to sell non otc drugs , pursuing of standard protocols in prescribing drugs , etc ) and individual factors ( knowledge of people , their attitudes towards diseases , etc ) . without a comprehensive approach to intervene and amend these triggering determinants of self medication practice , scattered efforts will create scattered results .
the study finding implied that improvement in service quality of health care may be more beneficial than the measures were taken hitherto .
future studies must focus on examining subjective and objective barriers that may exist in front of establishing the required but nonexistent harmony amongst all stakeholders of health systems to diminish the scale of the problem .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .
Output:
| abstractbackgroundself - medication with over the counter ( otc ) and non otc drugs may provoke serious consequences for users and societies .
recognition of its predictors therefore , is pivotal in plans to hinder the aggregating behavior .
this study aimed to identify possibly all predictors of self - medication and the range of its prevalence among different populations.methodsmedline , amed , scopus , medlib , sid , pub med , science direct , and super searcher of google scholar were scrutinized using self - medication , self - prescription and self - treatment key words without a time limit with special focus on iranian studies .
authors independently assessed the title , abstract and full text of identified articles for inclusion and any disagreement was resolved with consensus.resultsthe range of reported self - medication in the 70 included publications was 8.5 - 98.0% . having a minor illness ( 15 studies ) , health care costs ( 9 studies ) , lack of adequate time to visit a physician ( 11 studies ) , prior experience ( 7 studies ) in using a drug and long waiting time to visit a qualified practitioner ( 5 studies )
were most frequently reported reasons of self-medication.conclusionthe observed diversity in the reported prevalence and reasons of self - medication among different sub - groups of populations ( e.g. males vs. females ) and between developed and developing countries highlights the importance of explanatory behavioral chain analysis of self - medication in different population groups and countries . even within a single country ,
predictors of this harmful practice could be inconsistent .
lack of sufficient quality re - search to identify precipitating factors of self - medication in developing countries is paramount . |
PubmedSumm118429 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: basal cell carcinoma ( bcc ) is the most common cutaneous malignancy and accounts for approximately 80 percent of all nonmelanoma skin cancers .
exposure to ultraviolet radiation is the main environmental risk factor associated with the development of bccs , although they have also been found to occur less frequently in photo - protected sites .
albeit rare , bccs of the nipple - areola complex ( nac ) have been suggested as being more aggressive with higher rates of metastasis to regional lymph nodes . to date , three cases of bcc of the nac metastatic to the lymph nodes have been described . in comparison , metastatic bccs from all anatomic sites
have been described in a total of 364 cases from 1894 through 2011 . as a result , there has been controversy over the management of bccs of the nac . to address the surveillance and management of bcc of the nac , an extensive world literature review was conducted to identify cases reported between 1893 and 2016 .
we review the characteristics of individuals who developed bccs of the nac and their management .
using the pubmed database , a literature search was performed searching for articles related to bcc of the nipple or nac published in the world literature .
information pertaining to age , sex , site of bcc , morphology of bcc , histological subtype of bcc , presence of pigment on histology , previous history of bcc , risk factors , treatment , lymph node involvement , and clinical outcome was identified from each case report .
additional informed consent was obtained from one patient for whom identifying information is included in this article .
fifty - five patients with bcc of the nipple and areola have been reported in the world literature , including the patient described in figs . 1 and 2 ( tables 1 , 2 ) [ 2 , 451 ] .
bcc of this site occurred more frequently in males ( 35 , 63.6% ) than in females ( 20 , 36.4% ) .
the median onset age in males was 61 years , whereas the median onset age in females was 66 years .
the onset age was not mentioned for one female .fig . 1
a , b a previously unreported clinical presentation of basal cell carcinoma of the areola .
distant view ( a ) of a flesh - colored to hypopigmented dermal nodule on the upper medial quadrant of the right areola in a 67-year - old caucasian male with fitzpatrick skin type 2 .
he had a prior history of basal cell carcinoma on the left arm diagnosed 3 years earlier and presented with a 6-month history of a slowly enlarging , asymptomatic lesion on the right areola and adjacent breast .
he had no exposure to ionizing radiation and had no family history of basal cell carcinoma or basal cell nevus syndrome .
closer view ( b ) of the right breast shows the 7 7-mm flesh - colored to hypopigmented dermal nodule on the upper medial quadrant of his right areola and extending into the adjacent breast .
the patient in these figures is also cited in table 1 ( case 35)fig . 2
a , b a previously unreported pathologic presentation of the basal cell carcinoma of the areola shown in fig . 1 .
low ( a ) and higher ( b ) magnification views of the pigmented basal cell carcinoma show nodular aggregates of basaloid tumor cells extending from the epidermis into the dermis ( a ) . deposits of melanin were present not only in the tumor cells but also in dermal melanophages ( b ) .
the residual tumor was excised using the mohs micrographic technique , and clear margins were achieved after three stages .
the final wound measured 20 14 mm and a layered side - to - side closure was used to close the surgical defect .
the patient in these figures is also cited in table 1 ( case 35)table 1clinical characteristics of males with basal cell carcinoma of the nipple - areola complexcaseage ( years)racelocmorphologyhist subpother nmscsrisk factorsrxoutcomereferences160nsr n , airregular ulcerated patchns
nsnssimple excision and axillary lyn samplingno recurrencedied 18 months later of unrelated causerobinson 257nsl nnsnsnsnsnsnslyn involvement died of disease in 8 yearswainwright 343wnnsnod+
nsnssimple mastectomyno recurrence after 1 yearcongdon et al .
449nsr nscaly and crusted lesion with ulceration and scar
nsnsnsnswide excisionnsfarrow 571wr n , a8-cm tumor with ulcerationnod
nsnssimple mastectomylyn involvedafter mastectomy , no recurrencewyatt 672nsr nenlarged , firm r nipple
nod nsnswide excisionnslupton et al .
. 1053wl nulcerated lesion
nod nsnssimple excisionclear margins at surgeryknudsen
1151wl n , areddish brown , scaly , indurated plaque with pearly rolled borders nonesun exposuresimple excisionclear margins at surgerybruce et al .
1258nsl nskin breakdown of l nipple
m : nod , i nonenonesimple excision followed by radiotherapy4 years later had recurrence in axillary lyn , treated with mastectomy and lyn clearanceshertz et al .
1386nsr nred , scaly , ulcerated oozing lesion
f bcc and scc on face and scalptrauma to the chestsimple excision
nsnirodi et al .
1463wr n , aeroded plaque with crustnod nsnonesimple excisionno recurrence after 16 monthsc1 , cain et al .
1580wr n , aindurated reddish brown mass with ulceration
f nsnswide excisionno recurrence after 8 monthsc2 , cain et al .
1668wl n2 cm reddish brown to gray and blackish bluish nodulesup+
nsnssimple excisionclear margins at surgerytitzmann et al .
bcc 4 on face and armssun exposure , although noted patient states he always wore a shirtsimple mastectomyno recurrence after 2 yearsbenharroch et al .
2039wn , awell - limited plaque with crustsup nsnonewide excisionno recurrence after 2 yearsc2 , betti et al .
2167wl n , aulcerated , erythematous lesion
nod bcc foreheadnswide excisionclear margins at surgerygupta et al
. 2261wl apink , pearly papulensnsbcc 2 on abdomenburn to chest wall from firemmsclear margins at surgerynouri et al .
2378nsl n , aerythematous nodule with crusting and swellingnod nsnonesimple mastectomy with lyn dissectionclear at surgerykim et al .
2460wl nerythematous ulcer with scale and crust
f nonenonesimple mastectomyclear at surgeryavci et al .
2769wr npoorly defined , pink , telangiectatic plaque with ulcerationm : nod , s nonesun exposuremmsno recurrence after 2 yearssinha et al .
3023nsr nwell - defined pink , semicircular papule with multiple pin - point pigmented macules on the nipplens+
nsnssimple excisionno recurrence after 5 yearsbrown et al .
3178asianl n , apigmented maculenod+
nonenonesimple excisiondisease free at 1 yearkalyani et al .
3278asianr npigmented mass with ulceration
s
+
nsgastric cancer , chemosimple excisionno recurrence at 6 monthstakeno et al .
3375wr nerythematous ulcer on r nipple
s surgical excision of nod bcc 3 years priornsmms showed lactiferous ducts were infiltrated , so simple mastectomy was performedclear margins after simple mastectomymiglino et al .
. 3567wr aflesh colored to hypopigmented nodulenod+
bcc of l armnonemmsno recurrence after 6 monthschun et al .
cr
a areola , bcns basal cell nevus syndrome , cm centimeter , cr current report , f fibroepithelioma of pinkus , hist sub histologic subtype , i infiltrative , l left , loc location , lyn lymph node , m mixed , mms mohs micrographic surgery , mn micronodular , n nipple , nod nodular , ns not stated , p pigmented ; s superficial , w white , y years
tumor is microscopically pigmented .
clinical presentation was not stated
primary morphology not stated
article in danish
for this patient , the nipple was excised
tumor is both clinically and microscopically pigmented
article in german
article in korean
tumor is microscopically pigmented , but not clinically pigmented
presented in figs . 1 and 2
simple excision is defined as excision with narrower margins if visually normal - appearing skin
wide local excision is defined as involving a larger margin of normal - appearing skintable 2clinical characteristics of females with basal cell carcinoma of the nipple - areola complexcaseage ( years)racelocmorphologyhistopother nmscsrisk factorsrxoutcomereferences1nsnsnnsnsnsnsnssimple mastectomyalive and disease free at 2 yearscongdon et al . 266wl
nred , scaly nipple with induration
s nsnswide excisionclear margins at surgerydavis et al .
nonesmokeretretinate followed by simple mastectomyclear margins at surgeryjones et al . 449nsn , ansnsnsnsnsno treatmentnsbetti et al .
plaque on left breast with ulcerationsnsbcc , melanomanswide excisionno recurrence after 6 monthswong et al .
775nsl n , ared , eczematous lesion
m : nod , s nsnswide excision followed by radiotherapyclear margins at surgerysauven et al .
865nsl n , aerythematous , indurated plaque with ulcerationm : nod , i nonemoderate sun exposuremmsno recurrence after 1 yearsanchez- carpintero et al .
1047hl n , aill - defined erythematous plaques nonenonemmsclear margins at surgeryzhu et al .
1147wl n , ared - brown , indurated nodulenod nonenonewide excisionno recurrence after 2 yearsc3 , betti et al .
1246asianr awell - defined , slightly crusted plaques nonenoneinitially had simple excision , but due to positive margins had a simple mastectomy and excision of an axillary sentinel lyndisease free after 1 yearhuang et al .
1349wl n , aindurated red - brown plaquem : s , i nonetopless sunbathingmms with sentinel lyn biopsyclear margins at surgeryrosen et al .
1648nsr n , ahyperpigmented , erythematous plaque with ulcerationnod+
nonenonesimple excisionclear margins at surgerysharma et al .
1772asianr n , aerythematous ulcer with scale and crust
f nsnswide excisionnsxu et al
1966aal alichenified , scaly , excoriated plaques+
nsns5-fu bid x 6 weeksresolved clinically , but recurred after 22 monthsgoddard et al .
a areola , aa african american , f fibroepithelioma of pinkus , hist sub histologic subtype , i infiltrative , l left , loc location , lyn lymph node , m mixed , mms mohs micrographic surgery , n nipple , nod nodular , ns not stated , r right , s superficial , y years
primary morphology not stated
tumor is both clinically and microscopically pigmented
simple excision is defined as excision with narrower margins if visually normal - appearing skin
wide local excision is defined as involving a larger margin of normal - appearing skin
tumor is microscopically pigmented , but not clinically pigmented
a , b a previously unreported clinical presentation of basal cell carcinoma of the areola .
distant view ( a ) of a flesh - colored to hypopigmented dermal nodule on the upper medial quadrant of the right areola in a 67-year - old caucasian male with fitzpatrick skin type 2 .
he had a prior history of basal cell carcinoma on the left arm diagnosed 3 years earlier and presented with a 6-month history of a slowly enlarging , asymptomatic lesion on the right areola and adjacent breast .
he had no exposure to ionizing radiation and had no family history of basal cell carcinoma or basal cell nevus syndrome .
closer view ( b ) of the right breast shows the 7 7-mm flesh - colored to hypopigmented dermal nodule on the upper medial quadrant of his right areola and extending into the adjacent breast .
the patient in these figures is also cited in table 1 ( case 35 )
a , b a previously unreported pathologic presentation of the basal cell carcinoma of the areola shown in fig . 1
. low ( a ) and higher ( b ) magnification views of the pigmented basal cell carcinoma show nodular aggregates of basaloid tumor cells extending from the epidermis into the dermis ( a ) .
deposits of melanin were present not only in the tumor cells but also in dermal melanophages ( b ) .
the residual tumor was excised using the mohs micrographic technique , and clear margins were achieved after three stages .
the final wound measured 20 14 mm and a layered side - to - side closure was used to close the surgical defect .
the patient in these figures is also cited in table 1 ( case 35 ) clinical characteristics of males with basal cell carcinoma of the nipple - areola complex
a areola , bcns basal cell nevus syndrome , cm centimeter , cr current report , f fibroepithelioma of pinkus , hist sub histologic subtype , i infiltrative , l left , loc location , lyn lymph node , m mixed , mms mohs micrographic surgery , mn micronodular , n nipple , nod nodular , ns not stated , p pigmented ; s superficial , w white , y years
tumor is microscopically pigmented .
clinical presentation was not stated
primary morphology not stated
for this patient , the nipple was excised
tumor is both clinically and microscopically pigmented
tumor is microscopically pigmented , but not clinically pigmented
presented in figs . 1 and 2
simple excision is defined as excision with narrower margins if visually normal - appearing skin
wide local excision is defined as involving a larger margin of normal - appearing skin clinical characteristics of females with basal cell carcinoma of the nipple - areola complex
a areola , aa african american , f fibroepithelioma of pinkus , hist sub histologic subtype , i infiltrative , l left , loc location , lyn lymph node , m mixed , mms mohs micrographic surgery , n nipple , nod nodular , ns not stated , r right , s superficial , y years
primary morphology not stated
tumor is both clinically and microscopically pigmented
simple excision is defined as excision with narrower margins if visually normal - appearing skin
wide local excision is defined as involving a larger margin of normal - appearing skin
tumor is microscopically pigmented , but not clinically pigmented bccs of the nipple - areola complex were observed on the left ( 28/51 , 54.9% ) more frequently than the right ( 23/51 , 45.1% ) .
the nipple was affected in 45 patients ( 81.8% ) ; 22 of these individuals also had tumors that affected the areola .
however , bcc of the nac was also described in 7 asians ( 18.9% ) , 1 african american ( 2.7% ) , and 1 hispanic ( 2.7% ) patient .
clinical presentation was variable and presented as a plaque ( 17/34 , 50% ) , nodule ( 8/34 , 23.5% ) , papule ( 6/34 , 17.6% ) , macule ( 2/34 , 5.9% ) , or patch ( 1/34 , 2.9% ) .
secondary changes were additionally noted : ulceration or erosion of the bcc was noted in 19 cases , scale in 10 , and crust in 7 .
other histologic subtypes of bcc observed were superficial ( 13/42 , 30.9% ) , mixed ( 7/42 , 16.7% ) , fibroepithelioma of pinkus ( 4/42 , 9.5% ) , and pigmented ( 11/42 , 26.2% ) .
of mixed subtypes , four were noted to have aggressive features on histology , including infiltrative ( 3/7 , 42.9% ) and micronodular ( 1/7 , 14.3% ) .
removal of the tumor was the most common treatment ( tables 1 , 2 , and 3 ) .
this included either simple excision , being the most frequently performed ( 15/50 , 30% ) , wide excision ( 14/50 , 28% ) , or mohs micrographic surgery ( 11/50 , 22% ) with examination of the margins during the excision to confirm complete tumor removal .
six patients had simple mastectomies as their initial modality of treatment ( 6/50 , 12%).table 3initial treatment of basal cell carcinomas of the nipple - areola
complexinitial treatment
males
femalesn
total
simple excision10
5
15wide excision68
14mms8
311simple mastectomy51
6
5-fluorouracil01
1etretinate01
1no treatment112total302050
mms mohs micrographic surgery
initial treatment not stated in 5 males
number of males for whom treatment was performed
number of females for whom treatment was performed
total number of males and females for whom treatment was performed
this group includes one patient whose nipple was excised , and the excision type was not specified .
two patients had subsequent treatment including either axillary lymph node sampling or radiotherapy
one female had additional treatment : simple mastectomy and lymph node sampling
one female had additional treatment : radiotherapy
following mms , one male had a simple mastectomy
one female was treated with etretinate and subsequently had a simple mastectomy
simple mastectomy was the initial treatment for six patients ; however , nine mastectomies were eventually performed .
one male was initially treated with mms , and one female initially treated by simple excision followed by radiotherapy ; one female was initially treated with etretinate
one female was treated with 5-fluorouracil twice daily for 6 weeks .
the bcc initially resolved , but recurred at 22 months
following etretinate therapy , one female had a simple mastectomy initial treatment of basal cell carcinomas of the nipple - areola complex
mms mohs micrographic surgery
initial treatment not stated in 5 males
number of males for whom treatment was performed
number of females for whom treatment was performed
total number of males and females for whom treatment was performed
this group includes one patient whose nipple was excised , and the excision type was not specified .
two patients had subsequent treatment including either axillary lymph node sampling or radiotherapy
one female had additional treatment : simple mastectomy and lymph node sampling
one female had additional treatment : radiotherapy
following mms , one male had a simple mastectomy
one female was treated with etretinate and subsequently had a simple mastectomy
simple mastectomy was the initial treatment for six patients ; however , nine mastectomies were eventually performed .
one male was initially treated with mms , and one female initially treated by simple excision followed by radiotherapy ; one female was initially treated with etretinate
one female was treated with 5-fluorouracil twice daily for 6 weeks .
the bcc initially resolved , but recurred at 22 months
following etretinate therapy , one female had a simple mastectomy one patient received topical 5-flourouracil ( 5-fu ) twice daily for 6 weeks .
in addition , two patients received no treatment [ 25 , 36 ] . in five males , there was no mention of management .
one male had mohs micrographic surgery , which showed the lactiferous ducts had been infiltrated ; thus , a simple mastectomy was performed ( 2% ) .
one male had a simple excision followed by radiotherapy , but 4 years later was noted to have recurrence in the axillary lymph node and thus had a simple mastectomy ( 2% ) .
one female had a simple excision , but due to positive margins , she subsequently had a partial mastectomy ( 2% ) .
most of the patients ( 43/45 , 95.6% ) had no recurrence after successful treatment of their tumor . in ten patients
there had been three reported cases of metastatic disease to the lymph nodes at the time of this review , and of these patients , one died from the disease .
previous studies have noted a close histogenic relationship between bccs and pilosebaceous units [ 5254 ] , and bccs are therefore thought to arise in proportion to the number of pilosebaceous units present .
the nipple and areola are deficient in these units , which may explain the paucity of bccs of the nipple and areola . after an extensive world literature search
, we identified 55 cases of bcc of the nac from 1893 to 2016 ( 123 years ) . a 2009 review by ferguson et al .
revealed 33 cases of bcc of the nipple and areola . since 2009 , 22 additional cases of bcc of the nac have been reported in the world literature .
this apparent increase in bccs of this site may be due to a publication bias ; however , this trend reflects an overall increased incidence of sporadic bccs .
the increased incidence of bcc of the nac observed in males ( 35 , 63.6% ) versus females ( 20 , 36.4% ) [ 2 , 451 ] has been attributed to greater sun exposure of the chest in males [ 2 , 13 , 15 , 20 , 27 , 41 , 42 ] .
although ultraviolent light exposure is the major risk factor for the development of bcc , other etiologies include arsenic exposure , genetic predisposition , environmental exposures , immunosuppression , ionizing radiation exposure , injury ( burns or trauma ) , light - colored skin , previous bccs at another site , and sunburns .
although the majority of cases did not reveal possible risk factors of bcc of the nac , our review revealed two males ( table 1 , cases 11 and 26 ) [ 13 , 27 ] and two females ( table 2 , cases 8 and 13 ) [ 40 , 44 ] had increased sun exposure to the chest from shirtless sunbathing .
nine patients ( 9/26 , 34.6% ) had a prior history of bcc [ 14 , 17 , 20 , 21 , 25 , 28 , 32 ] .
two males reported prior trauma to the chest ( 2/27 , 7.4% ) [ 14 , 21 ] .
one male had basal cell nevus syndrome ( 1/27 , 3.7% ) , and one male was immunosuppressed on chemotherapy for gastric cancer ( 1/27 , 3.7% ) . to date , there have been eight patients with clinically pigmented bccs of the nac .
therefore , primary melanoma of the nac , pigmented paget disease , and pigmented epidermotropic metastases are important considerations in the clinical differential diagnosis of a pigmented lesion of the nac .
these can be differentiated by histologic examination and immunohistochemistry markers , such as cea , cytokeratins , ema , hmb-45 , mart1 , microphthalmia transcription factor ( mitf ) , and s-100 [ 29 , 57 ] .
interestingly , two patients ( including the patient described in figs . 1 and 2 ) with histologic findings of pigmented bcc had flesh - colored non - pigmented clinical lesions . the clinical presentation of one male with microscopic pigmented bcc was not described .
confirmation of bcc of the nac requires a biopsy , although other approaches are available to evaluate a suspected diagnosis of bcc , including confocal laser scanning microscopy and dermoscopy .
confocal laser scanning microscopy , also known as reflective confocal microscopy , is a noninvasive diagnostic method that enables real - time imaging of the skin layers and cellular structures in the horizontal plane .
classical findings of bcc on confocal laser scanning microscopy include five confocal imaging criteria : presence of elongated monomorphic basaloid nuclei , polarization of these nuclei along the same axis of orientation , heavy inflammatory infiltrate , increased vasculature , and pleomorphism of the overlying epidermis indicating actinic damage .
dermoscopy is another noninvasive method that allows for the in vivo evaluation of structures and colors of the epidermis , dermoepidermal junction , and papillary dermis not visible to the unaided eye .
dermoscopic diagnosis of bcc involves the absence of a pigmented network and presence of at least one of the following classical criteria : multiple blue - gray globules , large blue - gray ovoid nests , maple leaf - like areas , spoke - wheel areas , arborizing telangiectasia , and ulceration .
non - classical dermoscopic criteria are also helpful for the diagnosis of bccs , especially early lesions , and include short fine superficial telangiectasia , concentric structures , multiple small erosions , multiple in - focus blue - gray dots , blue whitish veil , shiny pink - white areas , and milia - like cysts .
due to the infrequent presentation of bcc of the nac , there has been a lack of characteristic findings in the literature to aid in the diagnosis of bcc of the nac .
however , a recent review by kitamura et al . revealed a dermoscopic feature of pigmented bcc of the nac that was termed a large black web. on dermoscopic evaluation , it was noted that the black network structure was thicker than the typical pigment network of the areola , and the surrounding area consisted of arborizing vessels and spoke - wheel areas . when this patient was compared with nine others diagnosed with superficial bcc of the trunk
, the authors found that the large black web was unique to bcc of the nac and appeared to avoid the hair follicles .
earlier investigations have reported an increased metastatic potential of bcc of the nipple and areola .
these studies hypothesized that the increased lymphatics of the nac may provide a direct route for tumor spread .
there have been three cases of bcc of the nac with lymph node involvement ( table 1 , cases 2 , 5 , and 12 ) [ 2 , 5 , 8 ] , which is a minimum metastatic rate of 5.5% .
since the outcome was not stated in ten patients and several patients had a short duration of follow - up after surgery , this rate could potentially be higher .
the histologic subtypes observed were most commonly nodular ( 42.9% ) and superficial ( 30.9% ) ; less often they showed pigment microscopically ( 11/42 , 26.2% ) , mixed histology ( 16.7% ) , or fibroepithioloma of pinkus variant ( 9.5% ) .
of the mixed subtypes , four cases were noted to have features associated with aggressive subtypes , such as infiltrative ( 3/7 , 42.9% ) and micronodular ( 1/7 , 14.3% ) bccs .
given the concern for higher metastatic potential or the presence of positive excision margins for tumors , nine patients underwent a simple mastectomy , although tissue - sparing surgery , such as simple excision , wide local excision , and mohs micrographic surgery , was most commonly utilized .
recurrence of nac bcc is low and was noted in one male who demonstrated lymph node involvement that occurred 4 years after simple excision .
more males were affected than females ; the left side was affected more than the right .
although previous reports raise the concern of metastatic potential , most patients have been successfully treated with excision of the tumor .
additional informed consent was obtained from one patient for whom identifying information is included in this article .
this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license ( http://creativecommons.org/licenses/by-nc/4.0/ ) , which permits any noncommercial use , distribution , and reproduction in any medium , provided you give appropriate credit to the original author(s ) and the source , provide a link to the creative commons license , and indicate if changes were made .
Output:
| backgroundbasal cell carcinomas ( bccs ) usually occur in sun - exposed areas
. however , they may also occur albeit infrequently in unusual locations , such as the nipple - areola complex.methodsusing the pubmed database , an extensive literature search was performed for the following keywords : areola , basal cell carcinoma , and nipple .
papers and references cited in those papers were reviewed to accumulate reports of patients with bcc of the areola and nipple.resultsbcc of the areola and nipple has been described in 55 individuals : 35 males and 20 females .
the onset age ranged from 35 to 86 years .
the median onset age in males was 61 years , whereas the median onset age in females was 66 years .
bcc of the nac predominantly occurred in caucasians ( 75.7% ) .
bcc of the nipple - areola complex ( nac ) was observed on the left ( 54.9% ) more frequently than the right ( 45.1% ) .
clinical presentation was variable and commonly included scaly or ulcerated plaques and nodules .
this tumor was typically associated with the nodular ( 42.9% ) or superficial ( 30.9% ) subtype of bcc .
the most common treatment was excision .
there were three reported patients who had metastatic disease to their lymph nodes ; one of the patients died from his tumor.conclusionthe nipple and areola are uncommon sites of bcc .
bcc of the nipple - areola complex is less frequently observed in females ( 36.4% ) , as this is more commonly a photo - protected site .
bcc of the nac has been considered to behave more aggressively than bccs at other anatomical sites ; however , the bccs are frequently associated with a non - aggressive histologic subtype .
treatment usually involves complete excision of the bcc .
tumor recurrence was uncommon following successful treatment of the primary neoplasm . |
PubmedSumm118430 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the increasing demand for precise and well - looking dental restorations has led to development and employment of new materials and techniques for tooth restoration or replacement .
high - strength ceramic materials for core construction necessitate the use of grinding mechanisms to fabricate desired structures .
today , the application of computer - aided design / computer - aided manufacturing ( cad / cam ) technology in dentistry significantly affected the laboratory and clinical procedures .
the advantages of cad / cam technology for dental applications are the possibility of applying new materials for fabrication of restorations , reduced labor , cost effectiveness and quality control .
the ability to use new materials made it feasible to fabricate all - ceramic restorations with superior esthetics .
different types of ceramic materials are now available as cad - cam blocks for chair - side and laboratory applications .
feldspathic - based ceramics are composed of fine - grained powders that produce a relatively high strength and nearly pore - free structure with fine crystals .
the strength of these ceramics has been approximated to be about 160mpa and provides esthetics in combination with the ability of acid - etching and bonding to resin .
ips e.max cad is a lithium disilicate glass - ceramic with the strength of about 320 mpa which is partially crystallized to facilitate machining . after milling ,
the final microstructure is composed of a glass matrix , containing a fine - grained size of approximately 1.5m .
zirconia - based ceramics are widely used for dental prosthetic restorations because of good physical , chemical and mechanical properties . as a polymorphic material
at room temperature , pure zirconia is monoclinic , which transforms to tetragonal at high temperature .
the tetragonal zirconia can be retained at room temperature if stabilized with yttria , which is called yttria tetragonal stabilized zirconia polycrystalline ( y - tzp ) and it is the proposed mechanism for high fracture toughness for this type of ceramic materials . however , grinding procedure during machining the ceramic blocks may cause inevitable damage accumulation that occurs at the surface of restoration and within the machined material . although the ceramic restorations that are produced by machining ceramic blocks may optimize and improve the structural reliability , but
the effect of the machining process on the long - term stability of the restorations must be taken under consideration . according to the grinding mechanism of ceramic materials , analysis of the chipped fragments and cutting
forces showed that ceramic material removal is dominantly a brittle fracture mechanism . on the other hand , before cementation of ceramic restorations , different surface treatments methods such as airborne particle abrasion ( sand - blasting ) with aluminum oxide , hydrofluoric ( hf ) acid etching , or laser irradiation are employed to improve the resin - ceramic bond strength .
it has been shown that these surface treatments which increase the irregularities on the ceramic surface might be the source of future failure and adversely affect the fracture resistance of the ceramic restorations .
the aim of this study was to evaluate the effect of different ceramic surface treatments after machining grinding on the biaxial flexural strength ( bfs ) of cad / cam machinable dental ceramics with different crystalline phases .
three different commercial cad / cam machinable ceramic core materials ( two silica - based and one zirconia - based ceramics ) were employed in this study ; lithium disilicate - based glass ceramic ( ips e.max cad , ivoclar vivadent , schaan , liechtenstein ) , leuicte - based feldspathic ceramic ( vitablocs mark ii , vita , bad sckingen , germany ) , and zirconia - based ceramic ( cercon , degudent gmbh , hanau , germany ) blocks .
the as - received ceramic blocks were worked on a diamond wheel point using a micromotor handpiece to make 10mm - diameter cylindrical rods . for the zirconia - based ceramic ( cercon ) ,
a cylindrical acrylic resin pattern was used for the milling of the pre - sintered zirconia blocks by an authorized dental laboratory .
the cylinders were cut oversized considering an approximate of 24% shrinkage during post - sintering of zirconia - based ceramics according to the manufacturer s instructions .
description of ceramic materials used the cylindrical ceramic rods were then cut into 1.3-mm thick disk - like specimens using a water - cooled low speed diamond saw ( isomet , buehler , lake bluff , il , usa ) . for the cercon ceramic ,
1.6 mm thick specimens were cut to compensate the 24% shrinkage during the sintering procedure .
the cercon and ips e.max cad ceramic specimens were then sintered to complete the crystallization according to the manufacturer s instructions .
one side of each disk was polished slightly using 800 to 1200 grit wet silicon carbide papers and cleaned ultrasonically in distilled water for 10 minutes .
the other side of each type of the ceramic specimen was then randomly treated with different surface treatment methods as follows ( 15 specimens in each subgroup ) : machined finish as control using a 60 m diamond bur ( d&z , diamant gmbh , lemgo , germany ) at high speed hand piece ( nsk dental , kanuma , japan ) with water spray coolant .
this surface finish was used to simulate the machining process of the cad / cam technology .
( vm-1 and e.cad-1 ) machined finish and sandblasting with 50 m aluminum oxide particles ( bego , easy blast , bremen , germany ) at a pressure of 2.8 bar , distance of 10 mm , and perpendicular to the ceramic surface for 20 s. ( vm-2 and e.cad-2 ) machined finish and acid etching with hf acid ( ultradent porcelain etch 9.5% buffered , ultradent products , south jordan , ut , usa ) for 20 s and one minute for ips e.max cad and vitablocks mark ii ceramics , respectively as recommended by the manufacturer .
( vm-3 and e.cad-3 ) machined finish as control using a 60 m diamond bur and then post - sintered according to the manufacturer s instructions .
( cer-1 ) machined finish , post - sintered , and sandblasted with 50 m aluminum oxide particles at a pressure of 2.8 bar , distance of 10 mm , and perpendicular to the ceramic surface for 20 s. ( cer-2 ) .
machined finish , post - sintered , and nd;yag laser ( fotona , m001 - 10f , ljubljana , slovenia ) irradiation ( cer-3 ) .
the laser optical fiber ( 320 m in diameter ) was kept one mm from the surface and the entire ceramic area was manually scanned perpendicularly for two minutes .
the parameters of the applied nd : yag laser after surface treatment , the specimens were cleansed in distilled water in an ultrasonic device for 15 minutes . the piston - on - three - ball test ( astm standard f394 - 78 )
we selected a specimen with a smaller diameter in order to promote a more realistic sample fabrication and to simulate dental restoration dimensions more closely .
three steel spheres ( 3.18 mm in diameter ) placed on a circle ( 10 mm in diameter ) arranged 120 apart were used to center and support the disk specimens .
the load was applied to the specimen center by a right circular cylinder of hardened steel having a diameter of 1.58 mm with the flat end perpendicular to the axis . in order to achieve a uniform load distribution
, we placed a thin plastic sheet between the flat - ended loading cylinder and specimen surface .
the specimens were loaded in a universal testing machine ( zwick , z100 , ulm , germany ) at a crosshead speed of 0.5 mm / min until fracture .
the maximum tensile stress ( mpa ) , which corresponded to the biaxial flexure strength , was calculated according to the equation suggested by the test standard ( astm f394 - 78 ) as follows : s = 0.2387p(x y)/d2 where s is the maximum tensile stress ( mpa ) , p is the load at fracture ( n ) , and d is the specimen thickness ( mm ) at fracture origin .
x and y were determined as follows :
x=(1+v ) ln ( b / c)2 + [ ( 1)/2](b / c)2,y=(1+)[1 + ln ( a / c)2 ] + ( 1 v)(a / c)2 ,
where is the poisson s ratio , a is the radius of the support circle ( mm ) , b is the radius of the tip of the piston ( mm ) , and c is the radius of the specimen ( mm ) .
the value for poisson s ratio was assumed as 0.25 ( if the value for the ceramic concerned is not known , poisson s ratio of 0.25 is used ) .
data were analyzed by analysis of variance and tukey s multiple comparisons post hoc test at a significance level of p<0.05 , using the statistical package for social sciences ( spss for windows 11.5 , spss , inc . ,
the microstructure of each ceramic material after different surface treatment methods was evaluated using a field emission scanning electron microscope ( sem ) ( hitachi sem s-4160 , tokyo , japan ) .
machined finish as control using a 60 m diamond bur ( d&z , diamant gmbh , lemgo , germany ) at high speed hand piece ( nsk dental , kanuma , japan ) with water spray coolant .
this surface finish was used to simulate the machining process of the cad / cam technology .
( vm-1 and e.cad-1 ) machined finish and sandblasting with 50 m aluminum oxide particles ( bego , easy blast , bremen , germany ) at a pressure of 2.8 bar , distance of 10 mm , and perpendicular to the ceramic surface for 20 s. ( vm-2 and e.cad-2 ) machined finish and acid etching with hf acid ( ultradent porcelain etch 9.5% buffered , ultradent products , south jordan , ut , usa ) for 20 s and one minute for ips e.max cad and vitablocks mark ii ceramics , respectively as recommended by the manufacturer . then the specimens were rinsed and air dried for one minute .
machined finish as control using a 60 m diamond bur and then post - sintered according to the manufacturer s instructions .
( cer-1 ) machined finish , post - sintered , and sandblasted with 50 m aluminum oxide particles at a pressure of 2.8 bar , distance of 10 mm , and perpendicular to the ceramic surface for 20 s. ( cer-2 ) .
machined finish , post - sintered , and nd;yag laser ( fotona , m001 - 10f , ljubljana , slovenia ) irradiation ( cer-3 ) .
the laser optical fiber ( 320 m in diameter ) was kept one mm from the surface and the entire ceramic area was manually scanned perpendicularly for two minutes .
the parameters of the applied nd : yag laser after surface treatment , the specimens were cleansed in distilled water in an ultrasonic device for 15 minutes .
the piston - on - three - ball test ( astm standard f394 - 78 ) was used to determine the bfs of 15 disk specimens per test group .
we selected a specimen with a smaller diameter in order to promote a more realistic sample fabrication and to simulate dental restoration dimensions more closely .
three steel spheres ( 3.18 mm in diameter ) placed on a circle ( 10 mm in diameter ) arranged 120 apart were used to center and support the disk specimens .
the load was applied to the specimen center by a right circular cylinder of hardened steel having a diameter of 1.58 mm with the flat end perpendicular to the axis . in order to achieve a uniform load distribution
, we placed a thin plastic sheet between the flat - ended loading cylinder and specimen surface .
the specimens were loaded in a universal testing machine ( zwick , z100 , ulm , germany ) at a crosshead speed of 0.5 mm / min until fracture .
testing was performed at room conditions . the maximum tensile stress ( mpa ) , which corresponded to the biaxial flexure strength ,
was calculated according to the equation suggested by the test standard ( astm f394 - 78 ) as follows : s = 0.2387p(x y)/d2 where s is the maximum tensile stress ( mpa ) , p is the load at fracture ( n ) , and d is the specimen thickness ( mm ) at fracture origin . x and y were determined as follows :
x=(1+v ) ln ( b / c)2 + [ ( 1)/2](b / c)2,y=(1+)[1 + ln ( a / c)2 ] + ( 1 v)(a / c)2 ,
where is the poisson s ratio , a is the radius of the support circle ( mm ) , b is the radius of the tip of the piston ( mm ) , and c is the radius of the specimen ( mm ) . the value for poisson s ratio was assumed as 0.25 ( if the value for the ceramic concerned is not known , poisson s ratio of 0.25 is used ) .
data were analyzed by analysis of variance and tukey s multiple comparisons post hoc test at a significance level of p<0.05 , using the statistical package for social sciences ( spss for windows 11.5 , spss , inc .
the microstructure of each ceramic material after different surface treatment methods was evaluated using a field emission scanning electron microscope ( sem ) ( hitachi sem s-4160 , tokyo , japan ) .
the mean bfs values ( bfs ) for different ceramic surface treatments in each group are reported in table 3 . for each ceramic type ,
one - way analysis of variance for each ceramic type showed that different surface treatments significantly affected the mean bfs values in each group .
mean biaxial flexural strength data ( mpa ) for different ceramic surface treatments machined finish : groups vm-1 ( vitablock mark ii ) and e.cad-1 ( ips e.max cad ) , and machined finish & post - sintered : group cer-1 ( cercon ) .
machined finish & sandblasted : groups vm-2 ( vitablock mark ii ) and e.cad-2 ( ips e.max cad ) , and machined finish & post - sintered & sandblasted : group cer-2 ( cercon ) . machined finish & acid
etched : groups vm-3 ( vitablock mark ii ) and e.cad-3 ( ips e.max cad ) , and machined finish & post - sintered & laser irradiated : group cer-3 ( cercon ) .
tukey s multiple comparisons for the vitablocks mark ii ceramic revealed that vm-1 specimens ( machined finish ) had significantly higher mean bfs value than that of vm-2 ( machined finish and sandblasted , p=0.001 ) and vm-3 ( machined finish and acid etched , p=0.005 ) groups .
no significant difference in the mean bfs values was observed between vm-2 and vm-3 specimens ( p=0.742 ) . for the ips e.max cad ceramic ,
a significantly lower mean bfs value for the e.cad-2 specimens ( machined finish and sandblasted ) than that of e.cad-1 ( machined finish , p=0.001 ) and e.cad-3 ( machined finish and acid etched , p=0.009 ) was found .
no significant difference in the mean bfs values was observed between e.cad-1 and e.cad-3 groups ( p=0.70 ) . for the cercon ceramic , cer-2 specimens ( machined finish ,
post - sintered , and sandblasted ) showed a significantly higher mean value than that of cer-1 ( machined finish and post - sintered , p=0.02 ) and cer-3 ( machined finish , post - sintered , and nd;yag laser irradiation , p<0.001 ) specimens .
the lowest mean bfs value was found for cer-3 specimens which was significantly different from those of cer-1 ( p=0.007 ) and cer-2 ( p<0.001 ) specimens . in vitablocks
mark ii ceramic specimens , scanning electron micrographs showed clearly that all the surface treatment methods altered the ceramic surfaces . as shown in figs 1.a ,
surface treatment in the vm-2 specimens led to more surface porosity in combination with more crack formation ( fig .
scanning electron micrographs in figs 2.d , e and f showed that for the e.max cad ceramic , machined finish surfaces in combination with sandblasting with 50 m aluminum oxide particles ( e.cad-2 ) altered the ceramic surfaces followed by e.cad-3 specimens receiving machined finishing and etching with hf acid . with regard to the cercon ceramic specimens , sem analysis revealed an alteration in the grain structure of zirconia as shown in figs 3.g , h , and i. sandblasting with alumina ( cer-2 )
3.h , in comparison with the specimens which had only machined finish and post - sintered surfaces ( cer-1 , fig .
3.i ) after nd : yag laser irradiation ( cer-3 ) . scanning electron micrographs of vitablocks mark ii ceramic specimens after surface treatment ; a : machined finish ; b : machined finish and sandblasted ; c : machined finish and hf acid etched ( 600 ) . scanning electron micrographs of ips e.max cad ceramic specimens after surface treatment ;
d : machined finish , e : machined finish and sandblasted , f : machined finish and hf acid etched ( 600 ) .
scanning electron micrographs of cercon ceramic specimens after surface treatment ; g : machined finish and post - sintered , h : machined finish , post - sintered , and sandblasted , i : machined finish , post - sintered , and nd;yag laser irradiated ( 600 ) .
new cad / cam ceramic materials have been developed to satisfy the outspreading demand for strong as well as esthetic dental restorations .
the optimum strength of ceramic materials is dependent on the fabrication procedures and content of flaws .
furthermore , several factors may influence the definitive strength of ceramics , including dimension of specimens , test environment , rate of stressing area of specimen subjected to the stresses , and testing methods .
the bfs test was used in this study since the measurement of the strength of brittle materials under biaxial flexure conditions rather than uniaxial flexure ( 3 or 4-point flexural tests ) is often considered more reliable . this is because specimen fracture is not influenced by edge failures and maximum tensile stresses occurring within central loading .
however , in biaxial flexural testing , the small loading piston induces concentrated stress at the opposite surface of a disk - like specimen .
the experiment setup is so that this test is quite sensitive to surface condition . in the present study ,
the machined surface treatment using a 60 m diamond bur represents the ceramic surface finishing that is created by the cad / cam milling process with no other surface treatment .
the results showed that for the vitablocks mark ii with leucite crystalline phase content , sandblasting or hf acid etching significantly decreased the bfs of the material compared with machined finish only surfaces .
sem analysis also demonstrated the appearance of surface cracks and destruction after sandblasting or acid etching of leucite - based ceramic surfaces ( figs 1.b and c ) .
it is proved that surface roughness negatively affects the mechanical properties in dental ceramics , since a decrease in surface roughness generally improves the mechanical properties of this ceramic .
in addition , our results showed that the bfs for vitablocks mark ii was similarly decreased by either sandblasting or hf acid etching surface treatment .
this is in agreement with another study by chen et al . who reported that similar periods of hf acid etching or sandblasting may lead to similar pattern of surface damage in machinable leucite - based feldspathic ceramics .
surface damage and weakening effect of acid etching or sandblasting on the strength of leucite - based ceramics could be due to the modification of the resident surface flaw population .
for the ips e.max cad ceramic with lithium disilicate crystalline phase , a significantly decreased in the bfs was found by sandblasting compared with acid etched or machined finish only ceramic surfaces .
this may be due to excessive destruction of crystals and glass of machinable lithium disilicate ceramic by sandblasting which was observed on scanning electron micrographs ( fig .
our study showed that after machine grinding of the e.max cad ceramic surfaces , the bfs was not significantly decreased by hf acid etching for 20 s. sem analysis also showed slight changes in the surface topography of the acid etched e.max cad ceramic surfaces ( fig .
this finding was in consistent with another study by pollington et al . who reported that the mean surface roughness ( ra ) of both fluorocanasite and lithium disilicate glass - ceramics after hf acid etching was lower in comparison to the sandblasted surfaces .
on the other hand , our previous study showed that surface hf acid etching for 2 minutes could have a weakening effect on the bfs of two hot - pressed leucite or lithium disilicate - based glass ceramic systems .
this observation might be due to the selected longer etching time compared with that of used in this study . as it has been also shown , hf acid etching for 60 s decreased the flexural strength of e.max cad ceramic in a time - dependent manner in comparison with untreated ceramic surfaces .
hf acid dissolves the glassy or crystalline phases of the ceramic and thus changes the microstructure of ceramic surface .
this creates microporosity on the ceramic surface , increases the surface area and allows the formation of micro - mechanical retention with resin composites .
the results obtained from the present study showed that the machinable leucite - based ceramic surfaces were more susceptible to acid attack than the lithium disilicate ceramic .
this might be due to the change in the microstructure of the leucite - based ceramic surface , resulting in the surface being considerably weakened by the hf acid etching .
sandblasting was destructive on both machinable silica - based ceramic surfaces with leucite and lithium disilicate crystalline phases .
for the cercon ceramics with zirconia crystalline phase , a significantly increased ( 32% ) in the bfs was found by sandblasting compared with laser - irradiated or machined finish only surfaces .
our finding is consistent with other studies that reported sandblasting increased the strength of dental y - tzp ceramics [ 2426 ] .
the explanation for this finding might be that air abrasion of zirconia by alumina particles can introduce residual surface compressive stresses because of surface phase transformation from the metastable tetragonal phase ( t ) to the more stable monoclinic ( m ) phase . with 50-m alumina air abrasion , the compressive fields created by this transformation could increase the strength of the zirconia ceramic .
sandblasting may cause surface flaws ; however , it appears that these flaws have surpassed the compressive surface layer thickness since material strength increased instead of showing reduction .
in addition , weakly attached surface grains could be removed and other imperfections concentrating stresses that could act as crack initiation sites might be eliminated . on the other hand , the mean bfs was significantly dropped by 34% of that of the machined finish surfaces after nd : yag laser irradiation .
sem micrographs also showed that laser beam may melt the zircnoia ceramic surfaces ( fig .
this observation was similar to that of another investigation in which many cracks appeared at the subsurface layer of cercon ceramic after nd : yag laser irradiation .
. it might be due to the volume change during the solidification of melted ceramic as well as phase transformation from cubic to tetragonal .
in addition , akyil et al . have reported that nd : yag laser induces thermal degradation of superficial layer of zirconia ceramic .
finally , it should be noted that the bfss reported in this in vitro study will not reflect the actual fracture strengths in the clinical situation because of different environmental and loading conditions
. some limitations of the present study are defect driven failure and limitations in producing a precise stress - free cutting in the specimens .
further in vitro and in vivo studies evaluating the effect of other variables on the mechanical strength of machinable dental ceramic systems are needed .
within the limitations of this study , it can be concluded that the bfs of the machinable ceramics evaluated in the present study was affected by the type of ceramic material and surface treatment method .
sandblasting with alumina was detrimental to the strength of both machinable silica - based ceramics systems .
in contrast , alumina sand - blasting considerably increased the strength of y - tzp - based ceramic after machining .
nd : yag laser irradiation of machined y - tzp ceramic surfaces may lead to substantial strength degradation and can not be recommended as a reliable surface treatment method .
finally , careful selection of the surface treatment method for resin bonding which does not induce further surface damage , is a prerequisite for the success of machinable ceramics restorations .
Output:
| objectives : this study aimed to evaluate the effect of different ceramic surface treatments after machining grinding on the biaxial flexural strength ( bfs ) of machinable dental ceramics with different crystalline phases.materials and methods : disk - shape specimens ( 10 mm in diameter and 1.3 mm in thickness ) of machinable ceramic cores ( two silica - based and one zirconia - based ceramics ) were prepared .
each type of the ceramic surfaces was then randomly treated ( n=15 ) with different treatments as follows : 1 ) machined finish as control , 2 ) machined finish and sandblasting with alumina , and 3 ) machined finish and hydrofluoric acid etching for the leucite and lithium disilicate - based ceramics , and for the zirconia ; 1 ) machined finish and post - sintered as control , 2 ) machined finish , post - sintered , and sandblasting , and 3 ) machined finish , post - sintered , and nd;yag laser irradiation .
the bfs were measured in a universal testing machine .
data based were analyzed by anova and tukey s multiple comparisons post - hoc test ( =0.05).results : the mean bfs of machined finish only surfaces for leucite ceramic was significantly higher than that of sandblasted ( p=0.001 ) and acid etched surfaces ( p=0.005 ) .
a significantly lower bfs was found after sandblasting for lithium disilicate compared with that of other groups ( p<0.05 ) .
sandblasting significantly increased the bfs for the zirconia ( p<0.05 ) , but the bfs was significantly decreased after laser irradiation ( p<0.05).conclusions : the bfs of the machinable ceramics was affected by the type of ceramic material and surface treatment method .
sandblasting with alumina was detrimental to the strength of only silica - based ceramics .
nd : yag laser irradiation may lead to substantial strength degradation of zirconia . |
PubmedSumm118431 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: belowground herbivores can cause substantial damage to plant roots , which in many cases has a more severe impact on plant fitness than shoot damage ( gerber et al .
. nevertheless , interactions between belowground herbivores and their hosts have been much less - studied than those of their aboveground counterparts .
one of the reasons is the obscurity of root - herbivore interactions in the soil , which also means that root damage can not be assessed as easily as shoot damage . plants generally need to be sampled destructively to assess how much and where root feeding has occurred . to overcome this drawback and to non - invasively visualize the activities of root herbivores , techniques such as x - ray tomography and magnetic resonance imaging ( mri )
in addition , the development of new methods , for example , root area determination by using electrical potential measurements , may lead to novel approaches that help to monitor the feeding activities of root herbivores in vivo ( cao et al . , 2010 ) . here , we present a novel approach to tracing the feeding activities of root herbivores that involves the detection of herbivore - induced volatile organic compounds ( vocs ) as a method for damage assessment ( van tol et al .
, 2005 ; kaplan et al . , 2008 ) . despite the paucity of data
, it has become evident that responses induced below ground in many respects resemble those found in aboveground plant - herbivore interactions . just as in shoots
, responses induced by herbivores may be both local and systemic , either within the root system or the whole plant , and comprise a wide range of defense compounds , such as alkaloids , phenolics , cardiac glycosides , and glucosinolates ( kaplan et al .
, 2008 ; rasmann et al . , 2009 ; van dam , 2009 ; hiltpold et al .
in addition , root herbivory leads to the induction of volatile organic compounds ( vocs ) that can be involved in indirect defenses below ground , by attracting the enemies of the attackers ( van tol et al . , 2001 ;
the role of vocs might be even more important for belowground communities in the rhizosphere , as they serve herbivores and parasoitoids as cues for host localization in an environment where visual cues are lacking ( rasmann et al .
indeed , recent studies have revealed various root - produced vocs that play a role in plant - environment interactions .
maize roots attacked by larvae of the western cornworm ( diabrotica virgifera virgifera ) emit ( e)--caryophyllene , a sesquiterpenoid that attracts entomopathogenic nematodes ( rasmann et al . , 2005 ) , while brassica plants infested with the larvae of the cabbage root fly ( delia radicum ) emit sulfides that attract ground - dwelling predatory beetles ( ferry et al . , 2007 ) and also various other vocs that may be important cues for parasitoids of these root herbivores ( neveu et al . , 2002 ; pierre et al
many compound classes that have been identified to play a role in belowground plant - environment interactions also are known from aboveground organs . despite the overlap in defense strategies and compounds , there are striking differences in the vocs produced by roots and shoots . for example , green leaf volatiles ( glvs ) are commonly emitted by aboveground tissues of almost all higher plants after damage ( hansson et al . , 1999 ; barth and schmid , 2001 ) .
however , they are not emitted when plant roots are artificially damaged or infested by herbivores ( steeghs et al . , 2004 ) , although they can be detected in minute amounts when plant roots are ground up ( matthias erb , pers .
furthermore , the emission of sulfides , which often decreases when brassica plants are damaged by aboveground herbivores ( blaakmeer et al . , 1994 ; geervliet et al . , 1997 ) , is strongly enhanced in roots of belowground - infested brassica plants ( blaakmeer et al . , 1994 ; geervliet et al . , 1997 ; ferry et al . , 2007
these differences may be related to differences in the performance of these compounds in soil environments .
properties such as polarity , boiling point , and solubility determine the degradation , adsorption to soil particles , and the distance over which a compound can disperse through soils , which in turn are important factors for the perception by soil biota . at present
, the diversity of herbivore - induced vocs released by aboveground plant organs appears to be greater than that in roots .
it must be noted , however , that there still is a paucity of data on root specific vocs , which leads to a bias , underestimating vocs from roots .
in addition to local voc responses , root herbivores also may induce systemic responses in shoots .
the activities of root herbivores not only affect aboveground herbivores that are ovipositing and feeding on the leaves of the same plant ( bezemer et al .
, 2004 ; anderson et al . , 2011 ) , but also alter the behavior of organisms at higher trophic levels such as parasitoids and predators foraging above ground ( rasmann and turlings , 2007 ; soler et al . , 2007 , this issue ) .
the effect on aboveground higher trophic levels can either be mediated through changes in the host plant quality elicited in root - induced plants , such as proteinase inhibitors and the accumulation of secondary metabolites , or via changes in the volatile bouquets of root - induced plants that render these plants less attractive ( rasmann and turlings , 2007 ; soler et al . , 2007 ) .
changes in voc emissions due to root herbivory can be detected in both belowground and aboveground tissues .
such root - induced changes in voc emissions possibly can be exploited as indicators of root damage by herbivores without harvesting the plant . in order to do so ,
we need sensitive and non - invasive techniques that are capable of detecting minute changes in voc emissions . proton - transfer - reaction mass spectrometry ( ptr - ms ) is an on - line technique that allows the sensitive assessment of plant vocs in real - time . in this review
, we discuss the potential , possibilities , and pitfalls of using ptr - ms for the non - invasive and on - line analysis of vocs induced by root herbivores in comparison to more traditional techniques applied in voc research .
plants emit substantial amounts of their assimilated carbon as vocs : up to 10 % of their carbon assimilation can be released in this way ( peuelas and llusi , 2004 ) .
the highly diverse class of higher isoprenoids ( > 30,000 different structures are described to date ; connolly and hill , 1991 ) contributes smaller proportions , and their emission rates are often correlated with biotic and abiotic stressors . in the early days of chemical ecology , around three decades ago , the ability to investigate gaseous emissions from plants focused on the major peaks in the chromatogram . with the progress of analytical technologies , we are more and more approaching whole metabolome analyses , which is important , since minor compounds in the background of a complex volatile blend can contribute significantly to the biological activity of that blend ( mumm and hilker , 2005 ; van dam and poppy , 2006 ) .
the emission rates of plant vocs usually are very low , ranging from a few nanograms to micrograms per gram plant dry weight , released per hour . at present ,
reported emission rates are particularly difficult to compare . in the chemical ecology literature , emission values
are either presented in relation to plant weight ( dry or fresh ) , or as relative emissions ( e.g. , geervliet et al . , 1997 ; pierre et al . , 2011b
this is , most likely , due to the fact that it would require many authentic standards to properly quantify each voc in gc - ms analyses , and these are often difficult to obtain .
frequently , it also is a problem of units that prevents direct comparisons between published studies , especially between gc - ms and ptr - ms analyses .
a conversion of the unit commonly used for voc emissions , in ngg[plant weight]h , into mixing ratios ( in parts per billion volume , a common non si - unit to report ptr - ms results ) will give us this opportunity .
we can approximately convert emissions by the following formula1:1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{emissio}}{{\text{n}}_{{ppbv } } } = \frac{{{\text{emissio}}{{\text{n}}_{{g \cdot { g^ { { - 1}}}\left [ { dw } \right ] \cdot { h^ { { - 1 } } } } } } * 24.5\frac{\text{l}}{\text{mol } } * { { \text{m}}_{{plant}}}}}{{{{\text{m}}_r } * { { \text{v}}_{{air } } } } } $ $ \end{document } here , we give an example of this conversion for green leaf volatiles ( glvs ) , which are one of the most widespread voc classes in the plant kingdom , at least above ground ( table 1 ) . because of the molecular weight , which has to be taken into account for the conversion , each compound contributes different ratios to the total emission , depending on the unit the value is described with .
the glv ( z)-3-hexenol , for example , was emitted at a rate of 153.6 ngg [ dw]h , which is 43 % of all glvs in the herbivore treatment , but when expressed as a mixing ratio ( ppbv ) , the same compound constitutes 53 % of all glvs ( table 1 ) . depending on the context ,
for example for insect physiology , the values might be biologically more informative when presented on a number - of - molecule basis , whereas in atmospheric chemistry the gram - based units might be preferred.table 1conversion of units commonly found in the literature for plant voc emissions with an example of gypsy moth - induced green leaf volatiles ( glvs ) of poplar ( populus trichocarpa ) , adapted from danner et al .
dry weightppbv parts per billion volume conversion of units commonly found in the literature for plant voc emissions with an example of gypsy moth - induced green leaf volatiles ( glvs ) of poplar ( populus trichocarpa ) , adapted from danner et al .
parts per billion volume due to low emission rates , the vocs sampled from the plant headspace usually need to be pre - concentrated on adsorbents before they can be analyzed on gas chromatography ( gc ) platforms .
most commonly , plant vocs are sampled on tubes filled with polymer materials , such as tenax , porapaq , carbopack , and charcoal , or on solid phase micro - extraction fibers ( spme ; dalessandro and turlings , 2006 ; tholl et al . , 2006 ; birkett , 2010 ) . in view of this necessity to preconcentrate the sample before analysis ,
the procedure involves collection periods in the range of minutes to hours , which prevents highly time - resolved measurements of voc emissions .
additionally , the sampling procedure may cause contaminations to be introduced when solvents are used to elute vocs from the tubes before injection on the gc . with other sampling techniques this can be avoided . using direct thermodesorption ( td ) tubes , the vocs are thermally desorbed from the packing material and transferred directly to the gc injector port in the gaseous phase ( e.g. , pierre et al . , 2011b ) in both cases ,
however , the relatively high temperatures , essential for rapid desorption or evaporation of the solvent in the injector port , may cause the vocs to break - down or to be converted into other components ( de kraker et al .
certain vocs , such as sabinene and -pinene , also degrade to some extent as a result of reactions with the adsorbent surface ( rothweiler et al .
moreover , depending on the packing materials of the sampling tubes , selective breakthrough of certain compounds , such as isoprene and other short - chain hydrocarbons , may occur , which makes the analysis less quantitative for these compounds ( dettmer et al .
by contrast , ptr - ms has the potential to sample vocs on - line and with high sensitivity ( pptv ) , without the need for pre - concentration , thereby avoiding many of the above - mentioned drawbacks .
additionally , the instrument operates at much lower temperatures ( around 50c ) which reduces the formation of chemical artifacts ( hansel et al . ,
about 15 years ago , ptr - ms emerged as a powerful tool for monitoring vocs . whereas conventional ms technology is often based on electron ionization ( ei ) , which results in extensive fragmentation providing rich ion fragments , ptr - ms relies on chemical ionization ( ci ) , a soft ionization method with few or no ion fragments in the mass spectra .
a detailed description of the ptr - ms technology has been published elsewhere ( hansel et al . , 1995 ; de gouw et al . ,
2003 ; boamfa et al . , 2004 ) . here , we briefly outline the main characteristics of the ptr - ms technology in so far as they are essential to be able to evaluate its opportunities and limitations for plant voc analyses . in ptr - ms
the ionized molecules typically form a protonated molecular ion [ m + h ] , in which m is the molecular mass of the parent molecule .
water or a mixture of water and helium is introduced and the h3o ions are produced by a , mostly hollow , cathode discharge in the primary ion source ( fig . 1 , no . 1 ; boamfa et al . ,
thereafter , the h3o ions enter the reaction chamber , the so - called drift tube ( fig . 1 , no .
2 ) , where they are driven by a homogenous electric field and will interact with the trace gas mixture that enters directly via an inlet at low gas flow rate ( ~ 0.5 l / h ) .
typically , only molecules with a proton affinity higher than that of water ( > 166.5 kcal mol ) will be ionized by proton - transfer - reactions with h3o ions .
organic compounds such as aldehydes , ketones , alcohols , oxygenated aromatic and aliphatic compounds will be readily protonated ( warneke et al .
, 2003 ; hartungen et al . , 2004 ; wisthaler et al . , 2005 ; de gouw and warneke , 2007).fig .
the instrument consists of an ion source ( 1 ) in which h3o primary ions are produced , a drift tube ( 2 ) , where the trace gases from samples are ionized by the proton - transfer reaction with h3o ions , a collisional dissociation chamber ( 3 ) , where cluster molecules dissociate , and the detection unit , where ions are mass filtered with a quadrupole mass filter ( 4 ) and quantified by a secondary electron multiplier ( 5 ) schematic representation of a typical ptr - ms .
the instrument consists of an ion source ( 1 ) in which h3o primary ions are produced , a drift tube ( 2 ) , where the trace gases from samples are ionized by the proton - transfer reaction with h3o ions , a collisional dissociation chamber ( 3 ) , where cluster molecules dissociate , and the detection unit , where ions are mass filtered with a quadrupole mass filter ( 4 ) and quantified by a secondary electron multiplier ( 5 ) in addition to the normal proton - transfer - reaction , the h3o and [ m + h ] ions can cluster with water molecules in the drift tube , complicating the interpretation of mass spectra . since the proton affinity of the clusters is higher than that of water , the proton - transfer - reaction with a water cluster will be favored .
an important part of the instrument that serves to reduce problems of cluster formation is the collision dissociation chamber ( fig . 1 , no .
the cluster ions that leave the drift tube dissociate into a neutral moiety and the initial , protonated trace gas molecule [ m + h ] .
cluster formation can be reduced further by adapting the reaction conditions of the ptr - ms instrument for this purpose ( 2 mbar pressure and 120140 td field strength in the drift tube ) . as described above , the proton - transfer results in few or no fragment ions for most trace gas compounds . despite this general rule ,
fragment ions are still detected in the mass spectra for certain compounds , increasingly more with higher kinetic energy in the drift tube ( maleknia et al . , 2007 ) .
for example , alcohols break down easily and lose a water molecule via dehydration , whereas acetaldehyde or acetone is less likely to dissociate ( boamfa et al . , 2004 ) .
although there are extensive resources for ei fragmentation patterns [ e.g. , national institute of standards and technology ( nist , usa ) and wiley ( west sussex , england ) ] , these spectral libraries can not be applied as a reference to ptr - ms , in view of the dissimilar ionization methods .
consequently , one needs to determine the fragmentation behavior of the vocs under study either from the literature , or by reference measurements with authentic standards .
another aspect to be considered is the back diffusion of air from the drift tube into the ion source , which leads to contaminant ions , such as no and o2 + ( de gouw and warneke , 2007 ) .
ptr - ms of plant vocs requires the amount of these ions to be reduced , because they transfer their charge to most vocs without adding a proton , which complicates the identification of compounds .
however , higher levels of no and o2 + ions may also be beneficial for detecting specific compounds , such as sulfur - containing glucosinolate breakdown products ( crespo , 2012 ) . in ptr - ms ,
regular calibration with an authentic gas mixture is a prerequisite for reliable quantification of trace gases , for example , drift tube humidity can vary , which has an impact on the drift tube reactions .
a typical example of a calibration gas mixture consists of acetaldehyde , acetone , isoprene , benzene , toluene , xylene , and -pinene ( covering molecular masses from 32 amu to 136 amu ) , each at a concentration of 1 ppmv ( parts per million volume , 5 % ) .
the calibration factors obtained for the fixed set of compounds in the certified gas mixture can be used to calculate the calibration factors of other compounds , by taking into account their collision rate constants , transmission efficiency factors , and fragmentation ratios . in this way , ion intensities ( expressed as normalized counts per second , ncps )
can be converted to absolute concentrations as gas mixing ratios ( parts per billion volume , ppbv ) .
ptr - ms can operate in two modes , namely the full mass scan and selective ion monitoring ( sim ) .
the first scans the relative abundance of all detectable masses , and should be regarded as a fingerprint of a given trace gas sample ( steeghs et al . , 2004 ) .
in contrast , the sim mode is suitable for recording temporal changes in concentrations of specific trace gas molecules , pre - selected by their mass - to - charge ratios .
the major drawback with ptr - ms remains the identification of compounds , which is notoriously difficult , as each detected mass can either be associated with parent molecules , fragments of parent molecules , and water clusters , or a combination of these .
therefore , the identification of compounds measured by ptr - ms is mostly tentative . nevertheless , if several compounds with the same nominal mass must be considered as possible candidates in a gas mixture , several methods to distinguish between these compounds can be employed .
for example , water clusters can be easily distinguished from compounds undergoing the usual proton transfer reaction by varying the field strength in the drift tube ( e / n ) .
association processes with water are quite sensitive to higher collision energies ( e / n ) , thus , if the intensity of a signal decreases with higher e / n , the signal is contributed by a compound associated with one or more water molecules . in the same way
, the abundance of stable isotopes can provide further information about the identity of a compound .
the probability of c incorporation into a molecule rises in a linear fashion with the number of carbon atoms in that molecule .
for example , with the natural c abundance of 1.1 % , a molecule containing 5 carbon atoms , such as isoprene ( m = 68 ) has a chance of 5.5 % to contain exactly one c. with ptr - ms , isoprene is detected as c5h9 + at m / z = 69 , however , this signal also can be attributed to a water
methanol cluster - ion , ch3oh ( h2o)h . if the ratio between m / z = 69 and its isotope at m / z = 70 indicates a c abundance close to the expected value for a 5-carbon compound ( 5.5 % ) the signal measured at m / z = 69 is more likely to be derived from isoprene . additionally , in complex gas mixtures , such as the ones derived from plant headspaces or human breath , it is common practice to proceed along these lines for compound identification ( lindinger et al .
additional information about the identity of the molecule species also can be obtained from any other element with stable isotopes .
examples are nitrogen with an isotopic n / n ratio of 0.366 % , hydrogen with a h / h ratio of 0.015 % , and sulfur with a s / s ratio of 4.21 %
. however , ion - trap - based ptr - ms with the ability to perform ms / ms , tof - based ptr - ms with high mass resolution , or coupling of gc with ptr - ms , are the preferred options for the unambiguous identification of compounds ( jo et al . , 2010 ) . basically , there are two main issues associated with the identification of compounds .
first of all , the signal of the parent and fragment ions ( isobaric ions ) from different compounds can be superimposed on one m / z in the spectra without the possibility of discrimination .
moreover , compounds with different structures but the same molecular mass appear at the same m / z signal and can not be distinguished with a quadrupole mass filter ( e.g. , different monoterpenoids ) . to overcome these limitations ,
several new technologies have been developed . combining ptr - ms with a gc , in which the vocs are first separated by their retention time in the gc and then detected one by one by ptr - ms , avoids the overlap of different compounds and fragments ( warneke et al . , 2003 ) .
proton - transfer - reaction ion - trap mass spectrometry ( pit - ms ) is another promising development to differentiate between different compounds with similar masses ( steeghs et al . , 2004 ) .
this technique has characteristics similar to those of the ptr - ms , except that an ion trap is used , instead of a quadrupole as a mass analyzer . in pit - ms ,
collision - induced dissociation ( cid ) is performed inside the ion trap , allowing different compounds with an identical mass to be differentiated by their fragmentation pattern ( ms / ms ) .
this approach enables , for example , the identification of different terpenoids and their oxygenated derivatives .
very promising is the recent development of a high - resolution time - of - flight ( tof ) based system , ptr - tof - ms , which is able to distinguish between isobaric molecules and allows unambiguous identification based on exact masses ( blake et al . , 2004 ; ennis et al . , 2005 ; graus et al . ,
only one type of precursor ion ( h3o ) is commonly employed to ionize compounds .
in addition , other ions such as no and o2 + can be produced in the ion source with the switchable reagent ions ( sri ) technology ( jordan et al . , 2009 ) .
these primary ions allow compounds with proton affinities lower than that of water ( e.g. , halogenated hydrocarbons ) to be detected and isomeric compounds to be distinguished .
in ptr - ms , regular calibration with an authentic gas mixture is a prerequisite for reliable quantification of trace gases , for example , drift tube humidity can vary , which has an impact on the drift tube reactions .
a typical example of a calibration gas mixture consists of acetaldehyde , acetone , isoprene , benzene , toluene , xylene , and -pinene ( covering molecular masses from 32 amu to 136 amu ) , each at a concentration of 1 ppmv ( parts per million volume , 5 % ) .
the calibration factors obtained for the fixed set of compounds in the certified gas mixture can be used to calculate the calibration factors of other compounds , by taking into account their collision rate constants , transmission efficiency factors , and fragmentation ratios . in this way
, ion intensities ( expressed as normalized counts per second , ncps ) can be converted to absolute concentrations as gas mixing ratios ( parts per billion volume , ppbv ) .
ptr - ms can operate in two modes , namely the full mass scan and selective ion monitoring ( sim ) .
the first scans the relative abundance of all detectable masses , and should be regarded as a fingerprint of a given trace gas sample ( steeghs et al . , 2004 ) .
in contrast , the sim mode is suitable for recording temporal changes in concentrations of specific trace gas molecules , pre - selected by their mass - to - charge ratios .
the major drawback with ptr - ms remains the identification of compounds , which is notoriously difficult , as each detected mass can either be associated with parent molecules , fragments of parent molecules , and water clusters , or a combination of these .
therefore , the identification of compounds measured by ptr - ms is mostly tentative . nevertheless , if several compounds with the same nominal mass must be considered as possible candidates in a gas mixture , several methods to distinguish between these compounds can be employed .
for example , water clusters can be easily distinguished from compounds undergoing the usual proton transfer reaction by varying the field strength in the drift tube ( e / n ) .
association processes with water are quite sensitive to higher collision energies ( e / n ) , thus , if the intensity of a signal decreases with higher e / n , the signal is contributed by a compound associated with one or more water molecules . in the same way
, the abundance of stable isotopes can provide further information about the identity of a compound .
the probability of c incorporation into a molecule rises in a linear fashion with the number of carbon atoms in that molecule .
for example , with the natural c abundance of 1.1 % , a molecule containing 5 carbon atoms , such as isoprene ( m = 68 ) has a chance of 5.5 % to contain exactly one c. with ptr - ms , isoprene is detected as c5h9 + at m / z = 69 , however , this signal also can be attributed to a water methanol cluster - ion , ch3oh ( h2o)h . if the ratio between m / z = 69 and its isotope at m / z = 70 indicates a c abundance close to the expected value for a 5-carbon compound ( 5.5 % ) the signal measured at m / z = 69 is more likely to be derived from isoprene .
additionally , in complex gas mixtures , such as the ones derived from plant headspaces or human breath , it is common practice to proceed along these lines for compound identification ( lindinger et al . , 1998 ;
additional information about the identity of the molecule species also can be obtained from any other element with stable isotopes .
examples are nitrogen with an isotopic n / n ratio of 0.366 % , hydrogen with a h / h ratio of 0.015 % , and sulfur with a s / s ratio of 4.21 % . however , ion - trap - based ptr - ms with the ability to perform ms / ms , tof - based ptr - ms with high mass resolution , or coupling of gc with ptr - ms , are the preferred options for the unambiguous identification of compounds ( jo et al . , 2010 ) . basically , there are two main issues associated with the identification of compounds .
first of all , the signal of the parent and fragment ions ( isobaric ions ) from different compounds can be superimposed on one m / z in the spectra without the possibility of discrimination .
moreover , compounds with different structures but the same molecular mass appear at the same m / z signal and can not be distinguished with a quadrupole mass filter ( e.g. , different monoterpenoids ) . to overcome these limitations ,
several new technologies have been developed . combining ptr - ms with a gc , in which the vocs are first separated by their retention time in the gc and then detected one by one by ptr - ms , avoids the overlap of different compounds and fragments ( warneke et al . , 2003 ) .
proton - transfer - reaction ion - trap mass spectrometry ( pit - ms ) is another promising development to differentiate between different compounds with similar masses ( steeghs et al . , 2004 ) .
this technique has characteristics similar to those of the ptr - ms , except that an ion trap is used , instead of a quadrupole as a mass analyzer . in pit - ms ,
collision - induced dissociation ( cid ) is performed inside the ion trap , allowing different compounds with an identical mass to be differentiated by their fragmentation pattern ( ms / ms ) .
this approach enables , for example , the identification of different terpenoids and their oxygenated derivatives .
very promising is the recent development of a high - resolution time - of - flight ( tof ) based system , ptr - tof - ms , which is able to distinguish between isobaric molecules and allows unambiguous identification based on exact masses ( blake et al .
only one type of precursor ion ( h3o ) is commonly employed to ionize compounds .
in addition , other ions such as no and o2 + can be produced in the ion source with the switchable reagent ions ( sri ) technology ( jordan et al . , 2009 ) .
these primary ions allow compounds with proton affinities lower than that of water ( e.g. , halogenated hydrocarbons ) to be detected and isomeric compounds to be distinguished .
since its development , ptr - ms has found many applications in a wide range of fields , including medicine ( cristescu et al . , 2011 ) , environmental sciences and atmospheric chemistry ( de gouw and warneke , 2007 ; bamberger et al . , 2010 ; ruuskanen et al . ,
2011 ) , food monitoring ( raseetha et al . , 2011 ) , monitoring for safety and security at the workspace ( hansel et al . , 1995 ) , voc emissions from plants during various abiotic stress conditions ( gray et al . , 2010 ; ruuskanen et al . ,
2011 ) , and , most importantly in the context of this review , in understanding the chemistry of plant - herbivore interactions ( schaub et al . , 2010 ;
it has proven extremely difficult to use conventional sampling techniques and gc platforms to follow the fast conversion processes taking place in the lipoxygenase pathway ( lox ) immediately after leaf wounding . with ptr - ms
, this process has been studied at a high time - resolution , which yielded new insight into the regulation of this pathway ( fall et al . , 1999 ; dauria et al . , 2007 ) .
ptr - tof - ms enabled the timing of the enzymatic conversions in the lox pathway to be elucidated in mechanically wounded dactlylis glomerata plants ( brilli et al .
the conversion processes were analyzed from the initial membrane breakdown , resulting in fast emissions of c6 aldehydes , until the somewhat slower conversion of the intermediate c6 alcohols into hexyl and hexenyl acetates .
mobile ptr - ms equipment also has been used to investigate the timing of herbivore - induced green leaf volatiles , monoterpenoids , and sesquiterpenoids in poplar trees in the field ( schaub et al . , 2010 ) and to monitor voc emissions from complex vegetations such as grasslands or forest canopies ( davison et al . , 2008 ; bamberger et al . , 2010 ; ruuskanen et al . ,
however , the examples above all relate to plant volatiles induced above ground . to our knowledge
this study analyzed voc emissions of in vitro cultured arabidopsis roots after infection with a pathogen , pseudomonas syringae , and the aphid diuraphis noxia .
the infections induced several simple metabolites , such as acetic acid , acetone , and ethanol , and a single monoterpenoid , namely 1,8-cineole ( steeghs et al . , 2004 ) .
interestingly , glvs were not found to be released by damaged arabidopsis roots . as the roots were grown in vitro
, however , the question remains how representative the herbivore - induced responses observed in this experiment are for plants that are growing in the soil .
therefore , we present two examples of preliminary ptr - ms results on herbivore - induced root responses in brassica species obtained with a custom - made ptr - ms described in detail in boamfa et al .
nancy ) during infestation with a belowground herbivore , the larvae of the cabbage root fly ( delia radicum ) .
the root headspace of infested and non - infested plants was sampled from a cuvette fitted around the base of the stem ( fig . 2 ) .
the two parts of the cuvette were sealed together with terostat ix ( henkel , uk ) , a solvent free , rubber - based sealant ( crespo , 2012 ) to prevent ambient air from entering . during measurements ,
an excess flow of hydrocarbon - free air into the cuvette was maintained , similar to a typical dynamic headspace collection setup ( tholl et al .
the resulting mass scan ( fig . 3 ) shows that the intensities of several molecular masses are enhanced in root fly infested b. rapa roots , the identities of which were confirmed by crespo ( 2012 ) by additional gc - ms analysis and ptr - ms measurements of authentic standards .
the induced intensities were detected in several structurally related sulfides , some of which have been shown to be induced in more than one brassica species after root fly feeding , and which are exploited as cues by parasitoids and predators ( ferry et al .
the mass - charge ratios representing dimethyl disulfide ( dmds ; m / z = 63 ) and dimethyltrisulfide ( dmts ; m / z = 95 ) displayed considerable increases in emission rates due to herbivore feeding .
in addition , we also found that the biosynthetically related compound methanethiol ( m / z = 49 ) was emitted at higher rates when root fly larvae were feeding .
previous gc analyses have not detected methanethiol , which might originate from the compound selectivity of the adsorbents that have been used for collection .
interestingly , we also found a considerable increase in m / z = 60 , which is related to glucosinolate breakdown products ( crespo , 2012 ) .
after disruption of the cells , a separately stored enzyme ( myrosinase ) converts the glucosinolates that are stored in the vacuoles into toxic and volatile products , such as isothiocyanates and nitriles ( hopkins et al . , 2009 ) .
after activation of this two - component defense mechanism , the volatile conversion products are detected in the headspace of damaged plants ( soler et al .
our preliminary experiment shows that glucosinolate conversion products also emanate from roots , damaged by soil herbivores.fig .
2cuvette used for dynamic headspace collections from plant roots . a the cuvette which consists of two parts with an air in- and outlet , respectively .
3identification of enhanced signals at masses correlated to volatile organic compounds ( vocs ) from brassica rapa spp .
rapa nancy by ptr - ms ( scan mode ) after root herbivory by delia radicum ( black bars ) vs. control plants ( white bars ) .
[ ncps]normalized counts per second , m / z = 49methanethiol , m / z = 60related to glucosinolate breakdown products , m / z = 63dimethylsulfide ( dms ) , m / z = 95dimethyldisulfide ( dmds ) cuvette used for dynamic headspace collections from plant roots . a the cuvette which consists of two parts with an air in- and outlet , respectively . b cuvette fitted together and tightened with a rubber - based sealant identification of enhanced signals at masses correlated to volatile organic compounds ( vocs ) from brassica rapa spp .
rapa nancy by ptr - ms ( scan mode ) after root herbivory by delia radicum ( black bars ) vs. control plants ( white bars ) .
[ ncps]normalized counts per second , m / z = 49methanethiol , m / z = 60related to glucosinolate breakdown products , m / z = 63dimethylsulfide ( dms ) , m / z = 95dimethyldisulfide ( dmds ) as another example , we monitored the induction of vocs in b. juncea roots after infestation with delia radicum in real - time and compared it to a control treatment ( fig . 4 ) .
we followed the emission of root vocs for several hours in sim mode , starting immediately after ten actively feeding second instar larvae were added to the roots .
based on the previous example , we chose to record specifically the masses which correlate to the three sulfides from the previous experiment and the mass 60 , all of which already revealed differences between the treatments in scan mode ( fig . 3 ) .
initially , we observed a low emission rate of only several ppbv for these compounds , which steadily increased with longer feeding times of the root flies ( fig .
the voc emissions remained at a very low level , which allowed a clear distinction between control and infested plants within a few hours after infestation .
we suggest that further development of ptr - ms methods and sampling set - ups might provide us with the tools to correlate the intensities of the voc emissions directly to the amount of herbivore damage in a quantitative manner .
possibly , the ptr - ms emission patterns can be used to assess the infestation level of root herbivores or to assess the time point when they stop feeding or start pupating by exploiting certain voc related masses as non - invasive markers.fig .
4temporal dynamics of volatile organic compound emission from brassica juncea after root herbivory by delia radicum ( broken lines ) and a control without damage ( continuous lines ) by ptr - ms ( sim mode ) .
m / z = 49methanethiol , m / z = 60related to glucosinolate breakdown products , m / z = 63dimethylsulfide ( dms ) , m / z = 95dimethyldisulfide ( dmds ) temporal dynamics of volatile organic compound emission from brassica juncea after root herbivory by delia radicum ( broken lines ) and a control without damage ( continuous lines ) by ptr - ms ( sim mode ) .
m / z = 49methanethiol , m / z = 60related to glucosinolate breakdown products , m / z = 63dimethylsulfide ( dms ) , m / z = 95dimethyldisulfide ( dmds )
as outlined , ptr - ms has in the recent years opened an avenue for new insight into fast changing , highly dynamic processes involved in plant voc emissions caused by plant - environment interactions . here , we show that , due to its sensitivity and the ability to record real - time responses , ptr - ms is an excellent technique to non - invasively trace the feeding activities of cryptically feeding root herbivores by measuring voc emissions from the root headspace .
certainly , ptr - ms also has its practical and technical limitations . besides difficulties in linking masses without doubt to compounds , many quadrupole - based systems lack sensitivity in the higher mass range ( above 120 amu ) , which is relevant for plant - herbivore interactions , as many biologically important compounds , such as several isothiocyanates or generally hemiterpenoids and sesquiterpenoids are difficult to detect .
these shortcomings can be overcome partially by combining on - line sampling with ptr - ms and off - line gc - ms methods , or by use of high sensitivity ptr - ms instruments with mass analyzers , such as distinctive quadrupoles , triple quadrupole technology , ion trap , or time - of - flight , which can provide sensitivity also in the higher mass range ( tani et al . , 2003 ; kim et al . , 2009 )
we expect that the innovative and fast - evolving field of ms technologies will result in further improvements regarding sensitivity and mass resolution .
consequently , ptr - ms - based technologies may soon approach detection limits even closer to the sensitivity of insect antennae .
a recently developed sensor , for example , which uses antennae of colorado potato beetles ( leptinotarsa decemlineata ) or of jewel beetles ( phaenops cyanea ) , demonstrates that insect antennae are capable of detecting , for instance , the glv ( z)-3-hexen-1-ol at around 1 ppmv and 1 pptv , for the two species , respectively .
compared to that , the detection limits in ptr - ms already are in a similar range of several parts per trillion volume , depending on the properties of the instrumentation . finally , time - resolved and sensitive on - line sampling of root - induced volatiles with ptr - ms will certainly contribute to our understanding of the role of vocs in belowground multi - trophic interactions .
in particular , linking real - time responses in the emission of vocs to immediate behavioral responses of herbivores , and to the higher trophic levels of parasitoids and predators will unravel further details of the voc
language among plants and between plants and insects . this may be achieved by sniffing out the vocs in parallel with olfactometer assays , a prime example of which is the development of a six - arm olfactometer , simultaneously equipped with a voc sampling unit ( turlings et al . , 2004 ) . in a similar way ,
coupling ptr - ms analyses with microbial bioassays may help to disentangle the impact of belowground plant vocs on other soil organisms , such as pathogens and microbes ( effmert et al .
in addition to that , new approaches in multivariate statistical analyses will facilitate discrimination of biologically meaningful information from noise contained in these increasingly complex mixtures ( van dam and poppy , 2006 ; jansen et al . , 2010 ) with steadily increasing numbers of compounds due to the rising sensitivity of instrumentation .
last but not least , improving our methods for non - destructive plant voc sampling from soil environments will complement the knowledge we have gained already from aboveground plant organs , with further discrepancies and similarities being discovered between the two compartments of plants living apart together . with a more complete perspective on plant vocs and their biological roles
, we might later be able to complement our current perceptions of plant defenses , adapted to a perspective of the whole plant .
Output:
| root herbivores are notoriously difficult to study , as they feed hidden in the soil .
however , root herbivores may be traced by analyzing specific volatile organic compounds ( vocs ) that are produced by damaged roots .
these vocs not only support parasitoids in the localization of their host , but also may help scientists study belowground plant - herbivore interactions .
herbivore - induced vocs are usually analyzed by gas - chromatography mass spectrometry ( gc - ms ) , but with this off - line method , the gases of interest need to be preconcentrated , and destructive sampling is required to assess the level of damage to the roots .
in contrast to this , proton - transfer - reaction mass spectrometry ( ptr - ms ) is a very sensitive on - line , non - invasive method .
ptr - ms already has been successfully applied to analyze vocs produced by aboveground ( infested ) plant parts . in this review ,
we provide a brief overview of ptr - ms and illustrate how this technology can be applied to detect specific root - herbivore induced vocs from brassica plants .
we also specify the advantages and disadvantages of ptr - ms analyses and new technological developments to overcome their limitations . |
PubmedSumm118432 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: surgical treatment of coag can be very effective in reducing iop ; however success ratios are still not optimal .
trabeculectomy is the most frequently performed filtering procedure and many variants have been developed , but they often face failure due to conjunctival or scleral fibrosis .
peroperative application of mitomycin c is used to reduce fibrosis of tenon , conjunctiva , and scleral flap .
different kinds of resorbable or nonresorbable implants can be placed underneath the scleral flap to avoid fibrosis of the sclera .
we describe a technique in which the iris of the iridectomy is used as a spacer to prevent fibrosis of the scleral flap .
eleven consecutive patients with medically uncontrolled open angle glaucoma underwent trabeculectomy with the iridenflip technique .
trabeculectomy technique was similar to our classical technique , with the only difference that the iris from the iridectomy was not discharged but used as spacer underneath the scleral flap .
based conjunctival flap , a rectangular scleral flap of 3 by 2,5 mm was made .
a second triangular scleral flap is prepared up to descemet 's membrane and is removed completely including the trabeculectomy . instead of performing a classical iridectomy , an angle based v - shaped iris incision is made .
the scleral flap is closed with 2 releasable sutures ' nylon 10/0 according to khaw 's technique .
the tip of the iris triangle should remain visible after closing the scleral flap ( figure 1 ) .
conjunctiva and tenon are closed with 2 limbal sutures and 1 conjunctival suture vicryl 10/0 .
the anterior chamber was maintained during the procedure by injecting viscoelasticum through paracenteses just before resection of the second scleral flap .
postoperative treatment consisted of atropine 2% 3 times daily and tobramycin combined with dexamethasone 4 times daily .
patients were seen at day 1 , every week for 5 weeks , and then after 2 weeks and every 3 months thereafter . if iop was too high manual pressure
was applied to the eye to stimulate evacuation of aqueous or viscoelasticum towards the bleb .
suture removal was performed if pressure remained above 15 mmhg after one week or after 1 month in all patients .
topical steroids were tapered slowly over 3 to 4 months if pressure was good or increased if the bleb vascularisation increased or bleb size diminished or if pressure raised above 15 mmhg .
complete success rate was defined as iop 16 mmhg without any topical or systemic pressure lowering medication .
one patient was lost to follow - up after 5 months , with a pressure of 10 mmhg , and was excluded .
all had coag with pressure between 19 and 40 mmhg ( with a mean of 27,7 mmhg ) on maximal topical therapy .
male / female ratio was 1/1 and age ranged from 52 to 85 years ( with a mean of 72,9 years ) .
all patients were on topical pressure lowering medications , ranging from 1 to 4 ( mean of 2.7 medications ) .
visual field md defects ranged from 1,5 to 22,8 db ( mean 13,28 db ) .
mmc 0,1 mg / ml was applicated during 1 minute because of a scarred conjunctiva or a low target pressure .
one patient had a wound leak on the first day , which did not heal with a contact lens and was closed by an additional suture .
one patient had hypotony with choroidal effusion in one quadrant the first 2 weeks , which disappeared spontaneously .
in one patient with a low target pressure a needling revision with mmc was performed after 7 weeks because of iop of 18 mmhg .
no late complications were seen . no abnormal inflammatory reaction and no deformation or dislocation of the pupil occurred ( figure 2 ) .
after one year mean pressure was 13,1 mmhg , nine patients had iops ranging from 10 to 16 mmhg and one patient had an iop of 19 mmhg ( patient with combined phacotrabeculectomy in which topical medication was started ) . a pressure of 16 or lower was reached in 90% of patients without any pressure lowering medication after one year . in 70%
after two years mean pressure was 12,1 mmhg , ranging from 6 to 16 mmhg , with identical success rates .
our small series demonstrated a complete success ratio of 90% in achieving iop 16 mmhg after one and two years and in 70% iop was 14 mmhg .
comparing trabeculectomy outcomes between different studies is difficult due to a variety in defining success rates and use of antimetabolites .
the trabeculectomy outcome study group reported a complete success rate of 78% in reaching iop 18 mmhg in 428 patients after 2 years , and antifibrotic agents were used in 93% of all cases .
reported a complete success rate of 55% in reaching a target iop 17 mmhg after trabeculectomy ( n = 18 ) and 33% after phacotrabeculectomy ( n = 15 ) without antimetabolites with a mean follow - up of 22,5 months .
our complete success ratio can compete with the qualified success ( with medication ) of some larger studies . in the trabeculectomy arm of the tvt study
they report a qualified success rate of 86,5% , defined as iop < 21 mmhg and > 20% below baseline .
but we like to stress that our series of 10 patients is too small to draw conclusions on efficacy .
it is known from older reports of the iridencleisis procedure that iris tissue can provide a long lasting fistulisation through the sclera [ 6 , 7 ] . after performing trabeculectomy and iridectomy ,
the small strand of iris tissue with its furrows and crypts is discharged . instead of using resorbable or nonresorbable foreign material as spacer underneath the scleral flap
fibrosis at the level of the scleral flap is not possible if the iris is interposed .
since the tip of the iris reaches further than the scleral flap , the aqueous is drained through the sclera up to the subtenon and subconjunctival space . at the tenon or
following these first 10 cases , no abnormal inflammation or other problems were seen , compared to classical trabeculectomy .
this technique is completely different from the old iridencleisis technique . in the original holth 's iridencleisis
the iris prolapsed through the sclerotomy and was grasped with two forceps at the pupil and torn .
the two iris pillars were pulled through the sclerotomy giving rise to u shaped pupil .
pressure lowering effect was often very good , with reports of up to 90% of patients with chronic glaucoma being controlled . and
only the peripheral iris was prolapsed and incarcerated in the sclerotomy , leaving the pupil intact , but with a lower success rate since aqueous flow could be trapped in the fold of the iris . to avoid this
also the iris root was ruptured while pulling the iris to one side of the sclerotomy , referred to as the lobe - like iridencleisis .
the major drawback of all techniques was a complete distortion of the pupil with pear shaped corectopia pointing towards the 12 o'clock position , often with an upward displacement of the pupil . in case
the iris sphincter was completely sectioned it resulted in a superior coloboma . in all our cases the pupil was round and well
when looking with the slit lamp an iridectomy is visible , but the deference with a classical iridectomy can not be seen . only with gonioscopy
a second reason why iridencleisis may have fell out of use is the possible risk of sympathetic uveitis , although only a total of 4 cases of sympathetic ophthalmia following iridencleisis have been reported . in the same first half of the 20th century ,
at least 652 cases of sympathetic ophthalmia were reported , following trauma , cataract surgery , and many other intraocular surgeries .
sourdille , however , did never encounter sympathetic ophthalmia in his series of 236 iridencleisis procedures and stated that iridencleisis is no more dangerous than other fistulising operations . in later reports presenting modified iridencleisis procedures ,
we did not encounter any iritis or uveitis . in view of this historical threat of sympathetic ophthalmia
, we reduce the amount of pigmented uveal tissue below the conjunctiva , by gently removing the posterior layer of the iris epithelium .
the second reason to remove the pigmented layer was to avoid postoperative spread of these pigmented cells below the conjunctiva due to the aqueous flow .
this can create a visible pigmentation which might be mistaken for a subconjunctival nevus or melanoma .
in this study the iris from the partial iridectomy was used as spacer underneath the scleral flap , in order to prevent fibrosis of this scleral flap .
the data show that no major complications were observed within the short observation period of 2 years .
a major limitation of the study is the small number of patients and the absence of a control group .
Output:
| purpose .
we describe a modified trabeculectomy technique in which the iris is used to prevent fibrosis of the scleral flap .
material and methods .
a retrospective case series of patients with medically uncontrolled open angle glaucoma underwent trabeculectomy . instead of performing a classical iridectomy ,
the iris was used as spacer underneath the scleral flap .
postoperative management was identical to classical trabeculectomy , with suture removal and needling if necessary .
five of the patients underwent simultaneous phacoemulsification through a separate temporal corneal incision .
patients should have two - year follow - up .
results .
data of ten patients were analysed , two had a previous failed trabeculectomy , two had ltp , and one had a corneal transplantation . in 3 patients mmc
0,1 mg / ml was used .
after one and two years mean iop was , respectively , 13,1 and 12,1 mmhg .
iop
16 mmhg was reached in 90% of patients without pressure lowering medication .
no major complications were seen ; no abnormal inflammatory reaction and no deformation or dislocation of the pupil occurred . conclusion . by using the iris from the iridectomy as spacer under the scleral flap , fibrosis of the scleral flap
is no longer possible .
this iridenflip trabeculectomy technique gives an excellent complete success rate ( iop 16 mmhg ) of 90% .
a larger study is currently being done . |
PubmedSumm118433 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: they are used in a multitude of electrochemical devices such as batteries , fuel cells , super capacitors , and electrochromic smart windows [ 15 ] .
blending of polymers is an economical technique to develop new polymeric materials with properties that are superior , intermediate , or just different from those of individual component polymers , it has been reported that the polymer electrolytes developed using polymer blends exhibited higher conductivity .
the enhancement of conductivity has been attributed to the increase in amorphous region in the blend based electrolytes .
it has high tensile strength and flexibility , as well as high oxygen and aroma barrier properties .
however these properties are dependent on humidity , in other words , with higher humidity more water is absorbed .
pva has a melting point of 230 c and 180190 c for the fully hydrolyzed and partially hydrolyzed grades , respectively .
it decomposes rapidly above 200 c as it can undergo pyrolysis at high temperatures .
pedot : pss is one of the most promising conducting polymers for industrial applications [ 911 ] .
pedot : pss has attracted considerable attention because of its superior electrical and good thermal stability , it could be used in organic devices as a hole transport layer ( htl ) and has the potential to substitute for metal electrodes due to its high conductivity [ 1216 ] .
it is a bio - compatible , easily processed and non - toxic material , which is widely used in electronic , optical , electrochemical and biomedical applications .
other advantages of pedot : pss such as high transparency in the visible range , long - term stability , and solution processability .
earlier studies in pedot : pss indicated that the enhancement in conductivity is due to screening effect of the solvents , increased hopping transport , improved connectivity among conducting grains , etc .
magnesium bromide ( mgbr2 ) is the fast conducting salt in a number of crystalline and amorphous materials , its incorporation in a polymeric system may be expected to enhance its electrical performance .
pva / pedot : pss ( pvps ) has been developed to obtain high conductivity equal to 2.79 10 s / cm for the optimum concentration 1.6 wt.% .
this pvps blend has been considered to get pvps / mgbr2 by adding mgbr2 nanoparticles to optimize polymer electrolyte membrane through studying its structural , thermal , electrical and optical properties .
88,00097,000 ) , pedot : pss ( solid concentration 1.2% and conductivity = 1 s / cm ) , mgbr2 were received from sigma .
the solution casting method that is used to prepare the pvps samples could be found in ref . .
the complex electrolytes were prepared by mixing pvps with mgbr2 at several ratios in distilled water to get ( pvps)1x(mgbr2)x complex electrolytes ( x = 0 , 10 , 20 , 30 wt.% ) .
the mixture was then poured into petri dishes and left to dry for four weeks in dry atmospher .
x - ray diffraction has been accomplished to investigate composite samples crystallinity using shimadzu diffractometer type xrd 6000 . the diffraction system based with cu tube anode with voltage 40 kv , current 30 ma & wavelength k1 = 1.5418 .
the start angle ( 2 ) was 5 and the end angle was 70. bragg s law ( n=2dsin ) was used to compute the crystallographic spacing .
the surface morphology of these polymer electrolytes was examined by scanning electron microscopy ( sem , joel - jsm model 5600 ) .
thermogravimetric analysis were carried out by using shimadzu thermal analyzer with heating rate 10 c / min , under n2 ( 20
ac measurements were carried out in the temperature range 303373 k using pm 6304 programmable automatic rcl ( philips ) meter .
the measurements were carried out over a frequency range 100 hz to 100 khz .
the absorption spectra of the pvps / mgbr2 colloidal were recorded in the wavelength range ( 4001100 nm ) using a uv vis spectrophotometer ( pg , t80 ) .
it is clear from the figure that the pure pva shows the presence of a semi - crystalline phase with the characteristic diffraction peak located at 19.4. this peak becomes less intense and more broadening as the mgbr2 content is increased due to transference of pva from semicrystalline to amorphous structure .
it is clear that the weight loss of composite samples occurred in different ranges of temperature has been obtained and plotted in fig .
the first maximum weight loss appeared at tp = 150 c which can be attributed to the dehydration of the inorganic salt ( mgbr2 ) in the polymer composite matrix where the bigger peak of weight loss appear in the range 218.5 and 333.4 c which shifts to relatively temperature range with increasing mgbr2 concentration .
the weight loss in mentioned range of temperature can be attributed to the release of compound water in the composite matrix .
the shift of such peak to lower temperature range can be attributed to the increase of matrix porosity which enhances the water release .
the activation energy for the thermal decomposition of the samples can be calculated using the first order integral equation of coates and redfern , ( 1)log - log(1-)t2=logre1 - 2rte - e2.304rtwhere t is the absolute temperature , e is the activation energy in j / mol , r is the universal gas constant ( 8.3136 j / mol k ) , n is the order of reaction , and is the fractional weight loss at that particular temperature is calculated as(2)=wi - wtwi - wfwhere wi is the initial weight , wt is the weight at given temperature and wf is the final weight of the sample . by plotting -log - log(1-)/t2 against 1000/t for each sample as shown in fig .
3 , we obtain straight lines . then , the apparent activation energies are calculated from the slopes of these lines using the expression:(3)e=2.303rslope values of the apparent activation energy ( ea ) of the samples are listed in table 1 . from this table , it is clear that the activation energy values lie in the range 132189 kj / mole which are less than the binding energy for the pva / pedot : pss essential bonds c o , c
000000000000
000000000000
000000000000
111111111111
000000000000
111111111111
000000000000
000000000000
000000000000
o , c
000000000000
000000000000
111111111111
000000000000
111111111111
000000000000
111111111111
000000000000
000000000000
o and h o ( = 358 , 799 , 1072 and 459 kj / mole respectively ) .
therefore the weight loss of the polymer composites can be attributed to compound water release .
in addition the maximum weight loss temperature is shifted to lower temperature range which can be attributed to the moisture on salt release .
the film at x = 10 wt.% contains some tiny pores at surface morphology relative to pure pvps .
5a shows the complex impedance spectra of ( pvps)1x(mgbr2)x polymer composite at 303 k. the complex plot shows semicircle does pass through the origin , and the equivalent circuit consisting of the parallel resistance ( bulk resistance , rb ) and the capacitance ( bulk capacitance , cb ) network showed in fig .
symbols z and z refer to the real and imaginary components , respectively . the bulk resistance was used subsequently for evaluation the bulk conductivity,(4)b=1rb(l
/ a)where rb is the bulk resistance , a is the cross sectional area of the sample and l is the thickness of the sample .
the extracted values of b for the different mgbr2 concentrations have been plotted versus the concentration , fig .
it is observed that bulk conductivity b obeys the following relation:(5)b=oeccowhere b is the bulk conductivity at c = 0 and co is a characteristic mgbr2 concentrations .
both o and co have been extracted using the least square fitting of eq . ( 5 ) which is equal to 2.74 10 s / cm and 9.35 wt.% .
6a shows the variation of the ac conductivity as a function of inverse temperature for ( pvps)1x(mgbr2)x polymer composite at 1 khz .
this behavior follows arrhenius relation:(6)=oexp - eaktwhere o is the pre - exponential factor , ea is activation energy , k is boltzman constant and t is absolute temperature . as shown in fig .
the increase in conductivity with temperature has been explained in terms of the free volume model . when the temperature increases , the polymer can expand easily and then produce free volume ( i.e. , when the temperature increase , the free volume increase ) .
when the free volume increased the mobility of ions increased leading to increase in the conductivity .
the activation energy for 0 and 10 wt.% are equal to 0.38 and 0.33 ev ( nearly unchanged ) whereas its value for higher concentrations of mgbr2 20 and 30 wt.% , illustrates bigger increase 1.18 and 1.1 ev for 20 and 30 wt.% which reflects the significant effect of inorganic nanoparticles of mgbr2 in the structure network .
the increase of salt concentration leads to an increase of both ionic and protonic components contributing in the conductivity . whereas the addition of the inorganic mgbr2 to the polymer matrix may suppress the composite structure relaxation ( it reduces ionic diffusion through structure network and subsequently charge carriers mobility ) .
in addition the conductivity attenuation can be mainly attributed to the decrease of protonic contribution in conductivity due to water dehydration .
therefore , the competition of the activated part ( mobility activation , region 1 ) and the decreasing of protonic component in conductivity results in the observed turnover in conductivity . fig .
6b shows the frequency dependence of the total conductivity of ( pvps)1x(mgbr2)x polymer composite at 303 k , the behavior follows a universal power law , ( 7)ac()=dc+aswhere dc is the dc conductivity ( the extrapolation of the plateau region to zero frequency ) , a is frequency independent pre - exponential factor , is the angular frequency and s is the frequency exponent . in addition
the relation of total against frequency shifts upward with increasing mgbr2 fractions and the kink shifts toward higher frequency range due to the domination of ionic conductivity in the polymer electrolyte .
the values of the exponent s have been obtained using the least square fitting and listed in table 1 .
the values of s for ( pvps)1x(mgbr2)x films lie in the range 0 < s < 0.3 which s decreases with increasing mgbr2 concentrations . fig .
7a and b shows the variation of the dielectric permittivity and dielectric loss , for ( pvps)1x(mgbr2)x polymer composite versus frequency at room temperature , 303 k. the figure show that and a gradually decrease with increasing frequency for all prepared samples .
the decrease of and with frequency can be associated to the inability of dipoles to rotate rapidly leading to a lag between frequency of oscillating dipole and that of applied field .
the variation indicates that at low frequencies the dielectric constant is high due to the interfacial polarization and the dielectric loss ( ) becomes very large at lower frequencies due to free charge motion within the material .
this behavior can be described by the debye dispersion relation , ( 8)+s-1+22,(s-)1+22where and s are the static and infinite dielectric permittivity , is the relaxation time and is the angular frequency .
8a and b shows the variation of and dielectric loss for ( pvps)1x(mgbr2)x polymer composite with temperature at 1 khz .
the value of and increases with temperature and then decreases at ( x = 20 and 30 wt.% ) , but it was increases with temperature and then fixed at ( x = 0 and 10 wt.% ) . at lower temperature in the dielectric constant , as the dipoles are rigidly fixed in the dielectric , the field can not change the condition of dipoles . as the temperature increases , the dipoles comparatively become free and they respond to the applied electric field .
thus polarization increased and hence dielectric constant is also increased with the increase of temperature , but the dielectric loss increase with temperature , particularly at which dielectric loss due to chain motion of polymers are more effective .
however , the dielectric loss is decreased with increasing temperature because the orientation polarization due to chain motion of polymer can not keep phase with the rapidly oscillating atoms .
the optical band gap is one of the most optical parameters that explain the optical transitions .
it could be defined as the difference between the bottom of the conduction band and the top of the valence band .
the fundamental absorption , which corresponds to the electron excitation from the valance band to the conduction band , can be used to determine the nature and value of the optical band gap . in the present study
, the optical band gap in the visible range can be estimated from the following relationship ( 9)()h=a(h-eg)nwhere is the absorption coefficient , is the frequency , h is the planck s constant , a is a constant , eg is the optical energy band gap between the valence and the conduction bands and n is the power that characterizes the transition process . fig .
9 illustrate the plot of the optical absorption against wavelength in the uv visible range for ( pvps)1x(mgbr2)x polymer composite in the colloidal forms .
the optical absorption of ( pvps)1x(mgbr2)x illustrates , in general , one diffused absorption peaks , their position has been determined by smoothing of absorbance - wavelength relationship , peaks position are listed in table 1 . upon the above consideration
, the maximum wavelength ( max ) is decreased from 918 to 894 nm , which means that the absorption peaks make a blue shift by increasing mgbr2 concentration , which may be attributed to the interaction between mgbr2 and conjugate bonds in pva .
this is due to energy confinement as a result of mgbr2 particle surrounded with polymer which acts as core
the type of transition has been tested by estimating the power n which predicts direct allowed transition from which the direct optical band gap eg is obtained by the least square fitting of eq .
it is evident that the direct band gap eg values are increased from 1.2 to 2.3 ev , so high energy is required to eject the electron from valance to conduction band .
this behavior can be understood on the decrease of polymer shell thickness to the nanosize which results in the increase energy confinement .
in addition the decrease of the area under absorption curve with increasing salt concentration may be attributed to the light scattering .
we have succeeded to increase the ionic conductivity of pvps polymer electrolyte to be 9.8 10 s / cm by adding 30 wt.% mgbr2 .
improving the ionic conductivity by adding mgbr2 is attributed to decrease in the degree of crystallinity and increase in the charge carrier .
the marked improvement of the electrical conductivity with increasing content of doping salt makes it possible to consider this electrolyte system as a potential candidate for electrochemical device applications .
Output:
| a solid polymer electrolyte system based on poly(vinyl alcohol ) ( pva ) and poly(3,4-etylenedioxythiophene):poly(styrenesulfonate ) ( pedot : pss ) complexed with magnesium bromide ( mgbr2 ) salt was prepared using solution cast technique .
the ionic conductivity is observed to increase with increasing mgbr2 concentration .
the maximum conductivity was found to be 9.89 106 s / cm for optimum polymer composite film ( 30 wt.% mgbr2 ) at room temperature .
the increase in the conductivity is attributed to the increase in the number of ions as the salt concentration is increased .
this has been proven by dielectric studies .
the increase in conductivity is also attributable to the increase in the fraction of amorphous region in the electrolyte films as confirmed by their structural , thermal , electrical and optical properties . |
PubmedSumm118434 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: endodontically treated teeth are generally weakened as a result of loss of tooth structure due to decay , previous restorative procedures and endodontic access preparation . further destruction of these teeth can be prevented by a protective restoration .
post and core system is a widely used method for treatment of structurally weakened teeth .
the primary objective of post and core procedure is replacement of the lost tooth structure in order to facilitate crown support and retention .
certain factors become important in the success of posts , such as remaining coronal tooth structure , choice of material , properties of materials like modulus of elasticity , stress distribution , etc . on stress measurement and analysis , a wide range of methods
are available , namely the strain gauge method , the loading test , the photoelastic method and the finite element method . using these methods , several studies on fracture strength and fracture pattern within the tooth structure
a valid index of stress distribution at the root structures has been difficult to create based solely on experimental and clinical observation .
only a few studies have focused on the influence of post diameter on the stress distribution in the remaining radicular tooth structure .
the purpose of this study was to compare stress distribution in a tooth restored with metal and fiber posts of varying diameters by means of three - dimensional finite element analysis ( fea ) .
a freshly extracted , caries - free maxillary central incisor with straight root canal was randomly collected .
a ct scan of the tooth was taken and axial sections at a distance of 1 mm from each other were obtained . the image obtained from the ct scan
was imported into autocad software ( autodesk , inc . , california , usa ) and outline of each individual layer was traced .
the layers were then stacked one on top of the other to obtain outlines of the surface contours of the tooth and a digital model was obtained using pro / engineer software ( parametric technology corporation , usa ) .
the periodontal ligament was modeled as a layer 0.3 mm thick around the root surface .
post length inside canal and apical gutta percha were assumed to be 9 mm and 5 mm , respectively .
two configurations of post diameter were compared-1.2 mm ( gold and fiber post ) and 1.4 mm ( gold and fiber post ) . the model was then altered to accommodate 2 gold posts ( 1.2 mm and 1.4 mm diameters ) and 2 fiber posts ( 1.2 mm and 1.4 mm diameters ) , core , apical 5 mm of gutta percha and all ceramic crown and 4 models were obtained . the digital tooth models with post , core and crown were imported to hypermesh software ( altair engineering , michigan , usa ) .
the models of the surface contours of the tooth were converted into solid models [ figure 1 ] .
these models were then meshed [ figure 1 ] using tetrahedral elements with hypermesh software as a neutral file using the stl ( stereo lithography ) format .
solid virtual model of maxillary central incisor and meshed assembly the cement layer between the post and the dentin was too thin to adequately model in the finite element simulation , but the cement was treated as part of dentin because the mechanical properties of dentin and cement were similar .
nodes were assigned and elements were designed for stress analysis . due to the complicated geometry of the tooth , free meshing technique was adopted .
the completed models consisted of 62,138 three - dimensional tetrahedral elements and 17,189 nodes for models with 1.2 mm posts and 58,525 three - dimensional tetrahedral elements and 16,451 nodes for models with 1.4 mm posts .
the completed models were then converted into an ansys input file and imported into ansys software ( ansys , inc . ,
mechanical properties of materials in finite element analysis model nodes have a tendency to move in different directions and also can rotate based on the direction of the load applied . on loading ,
the shape gets changed which is called as deformation and there will be no stress accumulation . hence , to get the stresses model need to be fixed .
the bottom portion of the cortical bone was fixed and a load of 100 n was applied on the ceramic crown at 45 angle to the long axis of the tooth onto the palatal surface incisal to the cingulum .
the maximum stresses generated in the tooth and post were calculated as von mises stress .
nodes have a tendency to move in different directions and also can rotate based on the direction of the load applied . on loading ,
the shape gets changed which is called as deformation and there will be no stress accumulation . hence , to get the stresses model need to be fixed .
the bottom portion of the cortical bone was fixed and a load of 100 n was applied on the ceramic crown at 45 angle to the long axis of the tooth onto the palatal surface incisal to the cingulum .
the maximum stresses generated in the tooth and post were calculated as von mises stress .
maximum stress ( 15.37 mpa for 1.2 mm fiber post and 15.33 mpa for 1.4 mm fiber post ) in the remaining radicular tooth structure for fiber post and core models were observed on the inner side of the proximal wall at the level of the cervical region irrespective of post diameter [ figure 2a and b ] . as for the metal post and core models , maximum stress ( 15.018 mpa for 1.2 mm metal post and 14.925 mpa for 1.4 mm metal post )
was observed on the inner side around the post apex irrespective of post diameter [ figure 2c and d ] .
the fiber post and core models showed larger maximum von mises stress values occurring in the remaining radicular tooth structure than that of the metal post and core , and the maximum stress was slightly reduced with an increase in fiber post diameter [ graph 1 ] .
distribution of von mises stresses in the remaining radicular tooth structure with ( a ) 1.2 mm fiber post , ( b ) 1.4 mm fiber post , ( c ) 1.2 mm metal post , ( d ) 1.4 mm metal post , distribution of von mises stresses in the internal area of posts ( e ) 1.2 mm fiber post , ( f ) 1.4 mm fiber post , ( g ) 1.2 mm metal post , ( h ) 1.4 mm metal post maximum von mises stresses occurring in the remaining radicular tooth structure for the fiber post and core models , stress concentration ( 8.813mpa for 1.2 mm fiber post and 8.878 mpa for 1.4 mm fiber post ) in the post region was observed at the junction between the fiber post and the core [ figure 2e and f ] . for the metal post and core ,
stress concentration was observed at the outer layer of the post [ figure 2 g and h ] . in the fiber post and core
models , the maximum von mises stress in the fiber post slightly increased with an increase in fiber post diameter [ graph 2 ] .
various methods are available on stress measurement and analysis , namely the strain gauge method , the loading test , the photoelastic method and the finite element method . the finite element method ( fem )
fem was first developed in 1943 by a. hrennikoff and richard courant to solve complex elasticity and structural analysis problems in civil and aeronautical engineering .
davy and co - workers applied fem to the study of post and core restorations .
fea is an accurate numerical method in stress analysis and has been applied to dental biomechanics .
young 's modulus of elasticity and poisson 's ratio of the modeled material are specified for each element .
a system of simultaneous equations is generated and solved to yield predictable stress distributions in each element throughout a structure .
the variables may be manipulated with computer precision , which eliminates variation resulting from sampling error .
fem analysis repeated any number of times will yield identical results 100% of the time .
thus it is certain that the results are always caused by manipulation of the variables and not by chance .
the distribution or pattern of these stresses is the result of the angle of the load and the geometry of the object .
in addition , notches or imperfections present within the material may cause localized increase in the magnitude of the stresses , known as stress concentrations .
these stress concentrations can contribute to the failure of the material through crack formation and an increased likelihood of fatigue failure .
using fea , the stress generated can be analyzed accurately by assessing the stress concentration areas .
in addition , fea allows the investigation of a single variable in a complex structure .
this means that fea is less time - consuming as no time is wasted on standardization issues or on preparing multiple specimens as in mechanical tests . because of these advantages , this method has been used to investigate the mechanical behavior of endodontically treated teeth subjected to different techniques and restorative materials . at this point , a few limitations need to be addressed regarding the present study .
the structures and materials used in this study were considered to be linear elastic , homogeneous , and isotropic .
this meant that the computational simulation was not absolutely same as that of natural tooth structure and supporting tissues .
the elastic modulus and poisson 's ratio values applied for the structures and materials in this study were used as thus determined from study published earlier .
root fractures generally occur due to dynamic loading , which may then result in a fatigue process as in clinical conditions which are different from static loading .
very few studies have investigated on the effect of post diameter on stress distribution in a tooth .
therefore , this in - vitro study was undertaken to compare stress distribution in a tooth restored with metal and fiber posts of varying diameters ( 1.2 and 1.4 mm ) by means of three - dimensional fea ( 3d - fea ) .
fea shows that maximum stresses in the tooth structure for fiber post and core are higher than that for gold - cast post and core .
so to reduce stress in the remaining radicular tooth with a large coronal defect , it is recommended to accompany a composite resin core with a fiber post of a large diameter within clinical limits . increase in fiber post diameter leads to an increase in surface area of the post , which in turn might aid in reducing stress development in the remaining radicular tooth structure by stress dispersion .
except for the force concentration at the cervical margin , the glass fiber post induces a stress field quite similar to that of the natural tooth . with fiber post and core ,
hence , their flexural property leads to stress concentration on the inner side of the proximal wall at the level of the cervix .
this suggests that the elastic modulus influence maximum stress development in the remaining radicular tooth structure .
cast metal post causes a large stress to concentrate around the base of the post while glass fiber post produces the lowest stress concentration and is hence effective in preventing stress concentration in the restored endodontically treated teeth .
fea shows that stress on the fiber post is distributed more evenly in the post tip area , whereas for metal post high stress is concentrated around the post tip .
this was because the metal post with a high elastic modulus is more rigid and reduces the strain on dentin , resulting in stress distribution to the apical third of root canal and into the post leading to fracture of root .
another fea reports that stress is accumulated within the cast post core system and transmission of stress to the tooth and the supportive structures is low .
the fiber post system transfers stress to the tooth and the supportive structures while stress accumulation within post system is low .
fiber posts show more homogenous stress distribution and a better biomechanical performance than metallic posts since stiffness of fiber post is similar to dentin .
fea reports that stainless steel posts present the highest level of stress concentration followed by carbon fiber posts .
steel posts are most dangerous to the root , potentially leading to its fracture , whereas glass reconstruction system gives most benign stressing condition .
fiber posts failed at a certain compressive force but they were repairable unlike the cast posts where the fracture is irreparable .
however , further studies are required to evaluate the effect of post diameter on stress distribution in a tooth .
within the limitations of this study , it has been concluded that :
the maximum von mises stress in the remaining radicular tooth structure for the fiber post was higher than that for metal post and core .
however , it became slightly reduced with the increase in fiber post diameter . hence to reduce stress in the remaining radicular tooth structure , it is better to use a fiber post of a large diameter within clinical limits.the location of maximum stress development in the remaining radicular tooth structure was on the inner side of the proximal wall at the level of cervical region for the fiber post . for the metal post and core , it was on the inner side around the post apex .
hence fracture is induced at the cervical region of tooth restored with fiber post and composite core allowing the repair , whereas vertical root fracture is induced in tooth restored with metal post making the tooth irreparable .
the maximum von mises stress in the remaining radicular tooth structure for the fiber post was higher than that for metal post and core .
however , it became slightly reduced with the increase in fiber post diameter . hence to reduce stress in the remaining radicular tooth structure , it is better to use a fiber post of a large diameter within clinical limits .
the location of maximum stress development in the remaining radicular tooth structure was on the inner side of the proximal wall at the level of cervical region for the fiber post .
for the metal post and core , it was on the inner side around the post apex .
hence fracture is induced at the cervical region of tooth restored with fiber post and composite core allowing the repair , whereas vertical root fracture is induced in tooth restored with metal post making the tooth irreparable .
Output:
| objective : to compare stress distribution in a tooth restored with metal and fiber posts of varying diameters ( 1.2 and 1.4 mm ) by means of three - dimensional finite element analysis ( 3d - fea).materials and methods : four 3d - fea models were constructed : ( 1 ) fiber post ( 1.2 and 1.4 mm ) and ( 2 ) metal post ( 1.2 and 1.4 mm ) .
the material properties were assigned and a force of 100 n was applied at 45 angle to the longitudinal axis of the tooth onto the palatal surface incisal to the cingulum .
analysis was run and stress distribution pattern was studied.results:maximum stresses in the radicular tooth structure for fiber post were higher than that for metal post . in the former models ,
stresses in the tooth structure were slightly reduced with increase in fiber post diameter.conclusions:to reduce stress in the remaining radicular tooth structure , it is better to use a fiber post of a large diameter . |
PubmedSumm118435 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the definition of brain death is " complete irreversible cessation of all brain functions , including the brainstem " but the diagnostic criteria of brain death vary widely among countries ( 1 - 6 ) . on the other hand , the diagnosis of brain death becomes more and more important because the demand for organs for transplantation is increasing worldwide ( 2 ) . in most countries ( united states , canada , united kingdom ,
germany , russia , china , etc ) , the diagnosis of brain death is based on clinical criteria ( 1 , 4 ) .
technical examinations serve exclusively as ancillary tools in the diagnosis of brain death ( 4 ) .
in other countries ( france , italy , the netherland , japan , korea , etc ) , various technical examinations are obligatory ( 1 ) . in korea ,
electroencephalography ( eeg ) is the obligatory test for brain death in addition to clinical criteria ( 5 ) .
an eeg , however , has several limitations ( 2 , 4 , 6 ) .
second , isoelectric eeg findings can occur in patients with hypothermia and drug or toxic ingestion .
third , the use of an eeg makes it difficult to judge brain death in patients with traumatic injuries or who have skull defects .
fourth , there is residual eeg activity in clinically verified brain death in approximately 19.6% of patients ( 6 ) .
therefore , if only residual activity seen on eeg , ancillary tests may replace eeg in exceptional circumstances .
it is known that verifying the loss of brain blood flow is a more accurate ancillary diagnostic tool for assessing brain death ( 4 ) . magnetic resonance imaging ( mri )
is not yet accepted as an accurate ancillary test for brain death ( 7 ) .
clinical applications of 3-tesla ( 3 t ) mri increased after food and drug administration provided approval of 3 t mri , especially in neuroradiology ( 8) . furthermore , t2-weighted gradient recalled echo ( gre ) findings for brain death are unknown , although this sequence is included in routine imaging protocols .
one description of brain death using susceptibility weighted imaging ( swi ) was recently published ( 9 ) , but swi findings for brain death are not fully analyzed since it is a relatively new imaging protocol .
the purpose of this study was to verify 3 t mri including t2 weighted imaging ( t2wi ) , diffusion weighted image ( dwi ) , time - of - flight ( tof ) magnetic resonance angiography ( mra ) , gre , and swi in diagnosing brain death .
therefore , we hypothesize that conventional mri findings are valid on a 3 t machine and gre and swi findings are specific for brain death .
the current study is the first to address the assessment of brain death using 3 t mri .
this retrospective study was approved by our hospital 's institutional review board . between june 2007 and october 2009 , 17 patients ( eight females and nine males ;
mean age , 52.9 years ; range , 16 - 76 years ) were evaluated for the diagnosis of brain death .
( n = 10 ) , all patients met the korean medical association criteria for brain death but did not meet eeg criteria due to the presence of residual waves ( 5 ) .
comatose and stuporous patients in group 2 ( n = 7 ) were enrolled , and none of them met the clinical criteria of brain death .
first , metabolic disorders , hypothermia , drug intoxication , and hypotension must be ruled out .
second , coma , unresponsiveness , complete loss of brainstem - mediated reflexes ( light , corneal , oculocephalic , vestibular - cephalic , ciliocephalic , gag , and cough ) and the apnea test were fulfilled .
fourth , after these processes , a flat wave on eeg must persist for 30 minutes .
all mri studies were performed using a 3 t mr system ( signa vhi ; ge medical systems , milwaukee , wi , usa ) with an 8-channel high - resolution brain coil .
the mri examination consisted of a t2wi fast - spin echo sequence in the sagittal plane , a t2wi fast - spin echo sequence in the axial plane , a gre , and a dwi ( a single - shot , spin echo , echo - planar pulse sequence with b values of 0 and 1000 s / mm ) in the axial plane .
an additional 3d tof - mra was done in each of the lasts seven patients .
the 3d raw data from mra were post - processed with a maximum intensity projection algorithm at a work station included in the mri system ( functool pf ; ge medical systems milwaukee , wi , usa ) . on swi , both magnitude and phase information were used .
all mri studies and the included source images were evaluated by two neuroradiologists ( c - hs and h - wc , with 15 and 5 years of experience , respectively ) who did not have access to the patients ' clinical information .
we evaluated each conventional mri finding and bilateral transcerebral and cortical vein signs ( btcvs ) on both gre and swi in brain dead patients ( group i ) and comatose or stuporous patients without a diagnosis of brain death ( group ii ) .
the conventional diagnostic criteria for brain death on mri are well known and as follows ( 10 ) : tonsillar herniation ; absent intracranial vascular flow void in both conventional mri and mra ; diffuse cortical high signal intensity and swelling of the cerebral sulci on t2wi ; diffuse hemispheric hyperintensities on dwi ; and a drop in the apparent diffusion coefficient ( adc ) due to cytotoxic edema . the bilateral transcerebral vein sign ( fig .
1 ) is defined as multiple and/or branching structures extending through the cerebral hemisphere parallel or perpendicular to the outer wall of both lateral ventricles ( 11 ) . the bilateral cortical vein sign ( fig .
1 ) is defined as visualization of both cerebral hemisphere cortical veins ( 12 - 15 ) . for statistical analysis
, we used the spss software package for windows ( spss , inc . , chicago , il , usa ) .
results were statistically analyzed using fisher 's exact test and considered significant at p < 0.05 .
between june 2007 and october 2009 , 17 patients ( eight females and nine males ; mean age , 52.9 years ; range , 16 - 76 years ) were evaluated for the diagnosis of brain death .
( n = 10 ) , all patients met the korean medical association criteria for brain death but did not meet eeg criteria due to the presence of residual waves ( 5 ) .
comatose and stuporous patients in group 2 ( n = 7 ) were enrolled , and none of them met the clinical criteria of brain death .
first , metabolic disorders , hypothermia , drug intoxication , and hypotension must be ruled out .
second , coma , unresponsiveness , complete loss of brainstem - mediated reflexes ( light , corneal , oculocephalic , vestibular - cephalic , ciliocephalic , gag , and cough ) and the apnea test were fulfilled .
fourth , after these processes , a flat wave on eeg must persist for 30 minutes .
all mri studies were performed using a 3 t mr system ( signa vhi ; ge medical systems , milwaukee , wi , usa ) with an 8-channel high - resolution brain coil .
the mri examination consisted of a t2wi fast - spin echo sequence in the sagittal plane , a t2wi fast - spin echo sequence in the axial plane , a gre , and a dwi ( a single - shot , spin echo , echo - planar pulse sequence with b values of 0 and 1000 s / mm ) in the axial plane .
an additional 3d tof - mra was done in each of the lasts seven patients .
the 3d raw data from mra were post - processed with a maximum intensity projection algorithm at a work station included in the mri system ( functool pf ; ge medical systems milwaukee , wi , usa ) .
all mri studies and the included source images were evaluated by two neuroradiologists ( c - hs and h - wc , with 15 and 5 years of experience , respectively ) who did not have access to the patients ' clinical information .
we evaluated each conventional mri finding and bilateral transcerebral and cortical vein signs ( btcvs ) on both gre and swi in brain dead patients ( group i ) and comatose or stuporous patients without a diagnosis of brain death ( group ii ) .
the conventional diagnostic criteria for brain death on mri are well known and as follows ( 10 ) : tonsillar herniation ; absent intracranial vascular flow void in both conventional mri and mra ; diffuse cortical high signal intensity and swelling of the cerebral sulci on t2wi ; diffuse hemispheric hyperintensities on dwi ; and a drop in the apparent diffusion coefficient ( adc ) due to cytotoxic edema . the bilateral transcerebral vein sign ( fig .
1 ) is defined as multiple and/or branching structures extending through the cerebral hemisphere parallel or perpendicular to the outer wall of both lateral ventricles ( 11 ) . the bilateral cortical vein sign ( fig .
1 ) is defined as visualization of both cerebral hemisphere cortical veins ( 12 - 15 ) .
for statistical analysis , we used the spss software package for windows ( spss , inc . ,
results were statistically analyzed using fisher 's exact test and considered significant at p < 0.05 .
all group i patients ( n = 10 ) showed tonsillar herniation , loss of intraarterial flow signal voids ( lifsv ) , diffuse cortical high signal intensity and swelling of cerebral sulci on t2wi , high signal intensity in cerebral hemisphere on dwi due to cytotoxic edema and btcvs on gre .
all mra in group i ( n = 4 ) showed loss of intracranial arterial flow signal intensities ( liafsi ) .
2 ) . in contrast , all group ii patients ( n = 7 ) showed neither tonsillar herniation nor lifsv ( fig .
3 ) . none of the mra in group ii ( n = 3 ) showed liafsi ( fig .
however , t2wi , dwi , gre , and swi findings of the patients in group ii were variable ( table 1 ) . on t2wi , 6 patients showed cortical high signal intensity and swelling of the cerebral sulci while one did not .
all swi in group ii ( n = 4 ) showed btcvs . table 3 summarizes the statistical analysis of each mri finding of brain death .
the guidelines for brain death were proposed by an ad hoc committee from the harvard medical school faculty in 1968 ( 16 ) . unfortunately , there are no internationally accepted " guidelines for brain death " ( 1 ) . in fact , the recommendations of the harvard committee have never become an internationally accepted guideline ( 1 - 3 ) . the definition and handling of brain death is more a political , ethical , and even religious issue than a medical issue ( 17 ) .
therefore , brain death is defined by legal authorities following recommendations of medical institutions in almost all countries , and the diagnostic criteria for brain death vary among countries ( 1 - 3 ) . however , the diagnostic criteria for brain death are all based on the following three neurologic characteristics ( 3 ) : comatose mentality ; loss of brainstem - mediated reflexes ; and apnea .
as previously described , in korea , eeg is the obligatory test for brain death in addition to the three clinical criteria , but it has several limitations ( 2 , 4 - 6 ) .
therefore , it is known that verifying the loss of brain blood flow is a more accurate ancillary diagnostic tool for assessing brain death ( 4 ) .
single photon emission computed tomography ( spect ) , transcranial doppler ( tcd ) , conventional angiography , computed tomographic angiography ( cta ) , and mri with mra have all been studied for their ability to provide a more accurate and objective diagnosis of brain death ( 2 , 4 , 7 ) .
magnetic resonance imaging has no advantage over cta or spect in that the patient has to be transported to the mri suite and the accessibility of critically sick patients remains a serious problem , but there is no need for contrast media injection and it is always available ( 4 ) .
the recently reported guidelines of the american academy of neurology show insufficient evidence for determining if newer ancillary tests ( such as mri and mra , cta , somatosensory evoked potentials , and bispectral index ) accurately confirm the cessation of the entire brain function ( 7 ) , but controversy remains in other countries worldwide . in diagnosing brain death , a short scan time is very important due to probable serious problems in critically sick patients .
as such , a high field strength scanner is more important . in this study , we evaluated each of the mri findings separately to diagnose brain death . in this way , th , lifsv , and liafsi on mra are accurate findings of brain death with 100% accuracy , but lifsv and liafsi on mra are same phenomena in nature .
as a result , we recommend t1 or t2wi sagittal scan and t2wi axial scan or tof - mra in diagnosing brain death , but further studies involving a larger number of patients are needed .
other brain mri and mra findings of brain death not described here have been well documented as well ( 10 , 18 - 22 ) , including absent intracranial contrast enhancement , carotid artery enhancement , prominent nasal and scalp enhancement ( mr " hot nose " sign ) , but we did not evaluate them since we did not use intravenous contrast media . in brain death , regardless of the cause , increased intracranial pressure decreases cerebral blood flow .
this phenomenon leads to cytotoxic edema and the progression of brain swelling . finally , compression of the entire network of intracranial arteries is observed . as such
diffuse hyperintensities on dwi and adc drop may be non - specific and can occur in other situations , such as bilateral carotid artery occlusion ( 21 ) . with other findings , diffuse hyperintensities on dwi and adc drop
this is the first series on brain death with 3 t mri to be performed , while gre findings for brain death are not known , although the sequence is included in routine imaging protocols .
( 9 ) described an 8-year - old boy who had prominent deep medullary veins throughout the bilateral hemispheres after a traffic accident .
the findings were possibly due to a combination of increased oxygen extraction , venous stasis , and/or possible venous dilatation secondary to release of substances ( such as adenosine ) after cell death .
however , this was only one case , and the study did not show other image protocol findings ( 9 , 23 ) .
the transcerebral vein sign on gre in acute stroke is also well known ( 11 , 12 ) .
the transcerebral vein sign on gre in acute stroke is caused by an increased oxygen extraction fraction and an increase in deoxyhemoglobin in the capillaries and veins .
the cortical vein sign on gre is defined as visualization of both cerebral hemisphere cortical veins .
similar imaging findings are encountered in acute stroke , subarachnoid hemorrhage , cortical vein thrombosis , vascular malformations such as developmental venous anomalies and arteriovenous malformations ( 12 - 15 ) , and patients under general anesthesia .
the signal intensity on swi is quite variable among patients and patients with different physiological conditions ( 24 , 25 ) .
imaging findings can be easily changed with different post - processing parameters ( 26 ) .
our swi parameters were optimized to reduce scan time because of the patients ' conditions .
second , there was no confirmation of brain death by an independent method , such as conventional angiography .
3-tesla mri and mra may be useful for diagnosing brain death . however , swi findings are not specific due to false positive findings .
Output:
| objectiveto demonstrate the usefulness of 3-tesla ( 3 t ) magnetic resonance imaging ( mri ) including t2-weighted imaging ( t2wi ) , diffusion weighted imaging ( dwi ) , time - of - flight ( tof ) magnetic resonance angiography ( mra ) , t2 * -weighted gradient recalled echo ( gre ) , and susceptibility weighted imaging ( swi ) in diagnosing brain death.materials and methodsmagnetic resonance imaging findings for 10 patients with clinically verified brain death ( group i ) and seven patients with comatose or stuporous mentality who did not meet the clinical criteria of brain death ( group ii ) were retrospectively reviewed.resultstonsilar herniation and loss of intraarterial flow signal voids ( lifsv ) on t2wi were highly sensitive and specific findings for the diagnosis of brain death ( p < 0.001 and < 0.001 , respectively ) .
dwi , tof - mra , and gre findings were statistically different between the two groups ( p = 0.015 , 0.029 , and 0.003 , respectively )
. however , cortical high signal intensities in t2wi and swi findings were not statistically different between the two group ( p = 0.412 and 1.0 , respectively).conclusiont2-weighted imaging , dwi , and mra using 3 t mri may be useful for diagnosing brain death
. however , swi findings are not specific due to high false positive findings . |
PubmedSumm118436 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: interleukin-17 ( il-17 ) is the founding member of a new cytokine family that has recently gained prominence due to its involvement in autoimmune and allergic diseases in both human and mouse .
il-17 family consists of 6 members including il-17 ( also called il-17a ) , il-17b , il-17c , il-17d , il-17e ( also called il-25 ) and il-17f .
the three best characterized members of the il-17 cytokine family are il-17a , il-17e and il-17f .
the major function of these 3 members is chemoattractant activity through the induction of cytokines and chemokines . il-17a and
il-17f share the greatest similarity showing 50% identity at the amino acid level , whereas il-25 is most divergent in the family .
il-17 family cytokines are produced by a newly defined lineage of t lymphocytes , th17 t cells .
the receptor for il-17a is expressed in several human cell types , such as a lung epithelial cell line , foreskin fibroblasts , a b - cell line , a myelomonocytic cell line , and an embryonal kidney cell line .
il-17e not only could directly influence nave t cell differentiation , but also enhance effectors th2 cell expansion , and memory th2 cell polarization .
il-17e appears to be a non - t / non - b cell population , expressing class ii major histocompatibility complex ( mhc class ii ) and cd11c molecules , a typical accessory cell phenotype .
both il-17a and il-17e are able to induce the activation of nuclear factor - kappab ( nf-b ) and similar , but not identical , panel of cytokines and chemokines .
new aspects of the biological role of il-17 family cytokines in carcinoma patients have recently been indicated .
il-17 induces expression of a number of chemokines and cytokines including interleukin-6 ( il-6 ) , transforming growth factor - beta ( tgf- ) , granulocyte - colony stimulating factor ( g - csf ) or granulocyte , macrophage - colony stimulating factor ( gm - csf ) , matrix metalloproteinases ( mmp ) and intercellular adhesion molecule-1 ( icam-1 ) in a variety of cell types , including the bone marrow stromal cells .
human dendritic cells are efficient antigen - presenting cells for the induction of polyfunctional th17 - 1 cells , and such cells are the dominant population of il17 producers in the tumor bed in human myeloma .
a recent study suggests that increased numbers of th17 cells along with increased levels of il-17 in mm are an important therapeutic target for both anti - mm responses as well as to improve immune function .
il-17e can inhibit the proliferation of human progenitor bone marrow cells of the granulocyte - macrophage series ( cfu - gm ) , thus reducing the number of mature leukocytes .
il-17e can also induce the secretion of cytokines and increase the recruitment of b cells .
the aim of this study was to estimate the level of the il-17a and il-17e in the blood serum of multiple myeloma patients and healthy donor sera .
we also evaluated the concentration of the il-17a and il-17e in the blood serum of multiple myeloma patients and correlate it to the percentage of plasma cells and other clinical parameters .
peripheral blood samples were collected from 34 newly diagnosed mm patients ( 23 males and 11 females ; median age 70 years , range was 57 to 83 ) .
twenty patients had stage ii disease and 14 patients had stage iii disease according to the durie - salmon classification .
twenty - three patients had monoclonal immunoglobulin igg and 11 patients had monoclonal immunoglobulin iga .
sera collected from patients and controls were put into separate vials and stored at 70c .
the pre - treatment evaluation included a complete blood count , albumin in serum , the concentration of paraprotein in serum , immunoglobulin class subtype ( ig ) and the levels of calcium , beta-2-microglobulin ( 2 m ) , lactate dehydrogenase ( ldh ) and c - reactive protein ( crp ) .
bone marrow aspirates and trephine biopsies ( tb ) were obtained ( table 1 ) . informed written consent
was obtained from all participants and the ethics committee of the medical university of bialystok approved the study .
the concentration of il-17e and il-17a in the blood serum of healthy subjects and patients with mm was assessed by enzyme - linked immunosorbent assay ( elisa ) .
il-17e concentrations in the blood serum were determined by the elisa method using a peprotech kit ( rocky hill , usa ) according to the instructions enclosed .
il-17a levels in the serum were measured by the elisa method using r&d systems kits ( minneapolis , usa ) according to the instructions provided .
the correlations between the various parameters measured were calculated with spearman s rank correlation coefficient . the student s t test was used .
significantly elevated serum levels and statistically significant differences of il-17a ( 14.093.26 pg / ml , p=0.004 ) and il-17e ( 18.963.71 pg / ml , p=0.001 ) were observed in all patients in comparison to the healthy subjects for il-17a ( 11.790.84 pg / ml ) and for il-17e ( 14.741.02 pg / ml ) .
statistically significant differences were observed between il-17e levels in patients from groups with stage ii ( 20.023.73 pg / ml , p=0.001 ) and stage iii disease ( 17.462.61 pg / ml , p=0.001 ) compared to the healthy subjects .
statistically significant differences were observed between il-17a in patients from the group with stage iii disease ( 15.902.15 pg / ml , p=0.002 ) compared to the healthy subjects , but not with stage ii ( 12.833.04 pg / ml , p=0.38 ) .
the correlations between the concentrations of il-17e and il-17a and chosen clinical parameters in mm patients are presented in table 2 . from the various parameters we found statistical positive correlation between serum levels of il-17a in all patients ( r=0.571 , p=0.017 ) and patients from the group with stage iii ( r=0.85 , p=0.037 ) to the percentage of the plasma cells in tb .
we also found a positive correlation between serum levels of il-17a in all patients to the levels of lactate dehydrogenase ( r=0.517 , p=0.006 ) . a positive correlation ( r=0.927 , p=0.003 ) between il-17a serum levels and the concentration of iga in patients from the group with stage iii
we found a negative correlation between serum levels of il-17e in all patients ( r=0.546 , p=0.023 ) and patients from the group with stage iii ( r=0.883 , p=0.008 ) to percentage of the plasma cells in tb .
we also found a negative correlation between serum levels of il-17e in all patients ( r=0.779 , p=0.001 ) and patients from the group with stage iii ( r=0.900 , p=0.037 ) to the 2 m levels ( figure 2a d ) .
tumor growth is regulated by the cytokine networks , which are produced by myeloma cells and the microenvironment of the bone marrow .
it belongs to the indirect angiogenic factors , which promote tumor growth in vivo via the enhancement of angiogenesis . among other factors ,
promotion of angiogenesis by il-17 may result from enhancement of the action of the basic fibroblast ( bfgf ) , the hepatocyte ( hgf ) , and the vascular endothelial - cell ( vegf ) growth factors .
the il-17 family of cytokines may also play a role in bone resorption and lead to osteolytic fractures .
the th17 t cell phenotype is a key predictor of lytic bone disease in mm .
alexandrakis et al . reported increasing serum levels of il-17 in association with higher disease stage .
they found the correlation of il-17 with angiogenic factors vegf and tumor necrosis factor - alfa ( tnf- ) and with microvessel density ( mvd ) in newly diagnosed mm patients .
they also found that the serum levels of il-17 in mm patients were higher than in controls , although the difference did not reach statistical difference .
. also demonstrated that a number of th17-associated cytokines , including il-17 , are significantly elevated in myeloma compared with healthy donors . in our study higher serum levels of il17a and il17e were observed in all patients in comparison to the control subjects .
statistically significant differences were observed between il17e levels in patients from group with stage ii and stage iii disease compared to the control subjects .
the statistical difference between il17a serum levels in the control subjects was observed only in patients from the group with stage iii disease .
prabhala et al . observed that il-17 promotes myeloma tumor cell growth in a cb-17 severe combined immunodeficient ( scid ) mouse model .
they showed that mm cell lines and primary cells express il-17 receptor , providing the biologic mechanism for il-17 effects on mm cells . in our study
we found a correlation between serum levels of il-17a in all patients and patients from the group with stage iii to the plasma cells in tb , suggesting that il-17a may promote myeloma growth in the advanced stage of mm .
. we did not find significant elevated levels of ldh , but we did find a correlation between the serum levels of il-17a and ldh in all patients .
, in the iii stage patient group we observed a correlation between il-17a serum levels and the concentration of iga , which additionally may suggest that il-17a can be associated with a poor prognosis .
the increase in the production of il-17e by leukocytes observed in the group of patients may counterbalance the effects induced by il-17a over - expression and inhibit cellular response ( eg , by stimulating the production of suppressive il-10 ) .
we confirmed that il-17e does not have the same activity as il-17a because in our study we found a negative correlation between serum levels of il-17e in all patients and patients from the group with stage iii to the plasma cells in trephine biopsy .
we also found a negative correlation between levels of il17e in all patients and patients from the group with stage iii to the 2 m levels . the protein 2 m is a strong and useful prognostic parameter because it correlates with the mass of a tumor .
our results showed that if serum levels of il-17e were higher , the percentage of the plasma cells and 2 m levels were lower . both negative correlations between il-17e to the plasma cells and il-17e to the 2 m levels
our data confirm that higher il-17a and il-17e serum levels are significantly elevated in myeloma patients compared with healthy subjects , and are associated with advanced stage of mm .
the role of increased levels of serum il-17e remains unclear , and further investigations are needed to understand its role in mm .
Output:
| summarybackgroundtumor growth in multiple myeloma ( mm ) is regulated by the cytokine networks which are produced by myeloma cells and the microenvironment of the bone marrow .
interleukin-17 ( il-17 ) is implicated in the increased angiogenesis in the bone marrow of mm .
recent studies reported elevated levels of interleukin 17a ( il-17a ) in the sera of patients with advanced stages according to durie - salmon classification.material/methodswe compared the concentration of il-17a and il-17e in the blood serum of 34 newly diagnosed mm patients with healthy subjects sera .
we also evaluated the concentration of il-17a and il-17e in the blood serum of mm patients and the relation to the percentage of plasma cells and other clinical parameters .
the concentration of il-17e and il-17a of healthy subjects and patients with mm was assessed by enzyme - linked immunosorbent assay ( elisa).resultsour data confirm that il-17a and il-17e serum levels were significantly higher in all mm patients and also in patients with advanced stage compared with healthy subjects .
we found the correlation between serum levels of il-17a in mm patients and percentage of plasma cells .
our results also showed that if serum levels of il-17e were higher in mm patients , the percentage of plasma cells and beta-2-microglobulin levels were lower.conclusionsthe il-17 family of cytokines may suppress or promote tumor growth .
there seems to be some balance between the effects of il-17a and il-17e .
the role of increased levels of il-17e needs further investigation to understand its role in the pathobiology of mm . |
PubmedSumm118437 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: its prevalence increases steadily and reaches epidemic magnitude.1 the international diabetes federation ( idf ) has been assessing diabetes prevalence in 216 countries and regions every 3 years since the year 2000 , thus regularly updating the information and extrapolating its trends .
these data help to predict the disease s magnitude and strategically plan its management : risk assessment , diagnostic and therapeutic approaches , and , above all , the devising of prevention programs.1 data on the regional prevalence of diabetes mellitus and impaired glucose tolerance ( igt ) were published in 2003 in the second edition of the idf diabetes atlas . in europe
, there were 48 million diabetic subjects ( prevalence 7.8% ) and 63 million subjects with prediabetes ( prevalence 10.2%).2 the data in the latest idf diabetes atlas published in 2011 and the diabetes at a glance of november 2012 showed that in europe there were currently 55 million diabetics , ie , the prevalence had risen to 8.4% .
the number of undiagnosed diabetic subjects in europe was 21 million or 38% of all subjects with the disease.3 authors from germany reported in 2013 a 7.2% prevalence of the known diabetes ( 7.0% for the males and
the results from the last health population status screening in germany in 2011 demonstrated a 38% increase in the prevalence of the known diabetes as compared to 1998 : from 5.2 to 7.2% .
the authors explain the phenomenon with the changing demographic structure of the population , the obesity pandemic , and other diabetogenic risk factors , as well as earlier diagnosis.4 the diabetes prevalence in the us is 8.3% or 25.8 million americans ( 18.8 million diagnosed or known disease and 7 million with undiagnosed diabetes ) .
the prevalence of the diagnosed diabetes in the adults demonstrated a significant increase from 5.1% in 19881994 to 7.1% in 20052006 , ie , a 39% increase.5 according to the study group of the ministry of health , labour and welfare of japan , the national epidemiological studies of diabetes in japan ( 1997 and 2007 ) have shown an increase in the disease prevalence by 61% ( 1370/10,0002210/10,000).6 the prevalence of diabetes varies among different countries depending on their economic development .
the majority of diabetics in the most economically developed countries are over the age of 60 , while in the developing countries , the majority of the diabetic patients are in the age group of 4060 years .
it has been predicted that the difference will persist in 2030 , though the mean age of the population in the developing countries will increase more than that in the developed ones .
the united nations organization predicts that the number of diabetic subjects will increase till 2030 because of population aging and urbanization , which brings about profound lifestyle
changes.7 global diabetes prevalence is expected to continue to increase as a result of a number of factors : population increase and aging , urbanization , obesity , unhealthy diet , and decreasing physical activity.8 the idf predicts an increase in the number of diabetics worldwide between 2003 and 2025 by 72% , to reach 333 million .
no country can evade this trend.2 the bulgarian society of endocrinology has carried out two population - based screening studies for the most common endocrine disorders , cardiovascular risk factors ( arterial hypertension , obesity , dyslipidemia ) and diabetes as well in 2006 and 2012.9,10 the aim of the current study was to compare the data from the two nationwide cross - sectional studies of diabetes prevalence in bulgaria ( 2006 and 2012 ) and to assess its dynamics and the relationship with certain risk factors : age , gender , obesity , abdominal obesity , and arterial hypertension .
twenty - eight nests were selected in six regions , and 3813 subjects were randomly appointed from the national population registry .
a total of 2396 subjects ( 62.8% ) agreed to participate , signed an informed consent , and were included in the study .
of them , 1348 were females ( 55.8% ) and 1068 were males ( 44.2% ) .
the standardized diabetes prevalence data , as per the who recommendations,11,12 have been published in the idf diabetes atlas ha idf in 2009 as total and weighed by age and gender prevalence.13,14 the second study was carried out in january
thirty - six nests were selected in 12 regions , and 3450 adult subjects were randomly appointed from the national population registry .
a total of 2033 subjects ( 58.8% ) agreed to participate , signed an informed consent , and were included in the study .
of them , 1076 were females ( 52.9% ) and 957 were males ( 47.1% ) .
the age structure of the samples in both the studies was planned according to the idf methodology for diabetes prevalence assessment in adults.15 the participants in both were further divided in age groups by decades ( 2029 ; 3039 ; 4049 ; 5059 ; 6069 ; 70 + years ) .
the comparison of the two data sets was done after weighing for type of settlement and age . according to the reports of the national statistical institute ( nsi ) of bulgaria , the country s population 20 years of age or older
was 6,168,000 as of 31 december 200516 and 6,011,713 , as of february 2011.17 the studied population was adjusted for gender , age , and type of place of living according to the nsi reports .
the sample size was calculated with the expectation of at least 6% prevalence of the studied variable among the target population , confidence level 95% , and an absolute precision 5% .
the geographic regions , the nests , and the gender and age distribution of the sample were planned to represent the adult general population ( 2080 years ) .
all participants signed an informed consent approved by the local ethics committee at the university hospital of endocrinology , and the research was conducted in accordance with the declaration of helsinki .
the participants filled in a questionnaire containing demographic data , current health status , medical history , family history for cardiovascular and thyroid disorders and diabetes , past history and therapies , menstrual status for the females , and current smoking .
body height , weight , waist circumference ( wc ) and sitting arterial pressure at the arm were measured .
increased waist circumference was defined after idf recommendations if > 80 cm for the females and > 94 cm for the males .
hypertension was defined according to the nation institute for health and care excellence / british heart society ( nice / bhs ) hypertension guidelines ( blood pressure ( bp ) cutoff is 140/90 mmhg).18 we ruled out the option to apply the idf consensus for diabetes type 2 recommending arterial pressure levels up to 130/80 mmhg.19 diabetes was diagnosed after the who 1999 criteria when fasting glucose 7.0 mmol / l was measured.20 standard oral glucose tolerance test ( measurement at 120 minutes after a 75 g glucose load ) was performed in subjects with fasting glucose 6.16.9
mmol / l ) , and the results were interpreted after the who 1999 definition :
igt : 120 minutes glucose 7.811.0 mmol / l;impaired fasting glucose ( ifg ) : 120 minutes glucose < 7.8 mmol / l;diabetes mellitus : 120 minutes glucose 11.1
igt : 120 minutes glucose 7.811.0 mmol / l ; impaired fasting glucose ( ifg ) : 120 minutes glucose < 7.8 mmol / l ; diabetes mellitus : 120 minutes glucose 11.1
plasma glucose was measured in both the studies by an automated glucose oxidase analyzer ( glucose analyzer ii , beckman coulter , inc . ) , and all samples were processed by a single laboratory technician .
the daily calibration and quality control was performed as per the manufacturer recommendations with a standard presinorm ( roche)glucose 4.9 0.3
a descriptive analysis was done , and the subjects were grouped by one or more factors . a diagnostic analysis was performed to assess the presence of statistically significant effects by conducting statistical hypothesis tests for certain relationships , also including variables measured at nominal or ordinal scales .
suitable assumptions about the variable distribution were made to measure the significance levels of the analyzed empirical characteristics .
unless otherwise stated , the reference point for significance was 95% ( risk of i type error 5% ) .
a dynamic analysis of the two epidemiological studies ( 2006 and 2012 ) was done .
the raw data from the two studies were first weighed by type of settlement and age , and then comparative analyses were done .
plasma glucose was measured in both the studies by an automated glucose oxidase analyzer ( glucose analyzer ii , beckman coulter , inc . ) , and all samples were processed by a single laboratory technician .
the daily calibration and quality control was performed as per the manufacturer recommendations with a standard presinorm ( roche)glucose 4.9 0.3 mmol / l and presipath ( roche)glucose 12.6 0.5 mmol / l .
a descriptive analysis was done , and the subjects were grouped by one or more factors . a diagnostic analysis was performed to assess the presence of statistically significant effects by conducting statistical hypothesis tests for certain relationships , also including variables measured at nominal or ordinal scales .
suitable assumptions about the variable distribution were made to measure the significance levels of the analyzed empirical characteristics . unless otherwise stated , the reference point for significance was 95% ( risk of i type error 5% )
. a dynamic analysis of the two epidemiological studies ( 2006 and 2012 ) was done .
the raw data from the two studies were first weighed by type of settlement and age , and then comparative analyses were done .
the data on the diabetes prevalence from the two screening studies are presented in table 1 .
the prevalence of diabetes in the subjects in active age ( 2060 years ) was 5.4% ( 90/1675 ) in 2006 and increased to 6.0% ( 86/1429 ) in 2012 . a decrease from 20.7 to 17.9%
was registered for the same period in the elderly ( over 60 years of age ) .
the difference in the prevalence of the risk factors that contribute to diabetes ( increased waist circumference
the comparison of the prevalence of the risk factors in the studied population is presented in table 2 .
the monitoring of the national trends in the course of the diabetic epidemic is important , and it helps assess the severity of the problem , the role of risk factors , and the necessary interventions and design appropriate healthcare measures and structure.21 by monitoring the global epidemic increase in diabetes prevalence , the idf has come to the conclusion that the changes in diabetes epidemiology in certain countries are linked to the fast urbanization and the increased life expectancy.15 the canadian health agency presented in 2011 an analysis of unpublished data , according to which the largest relative increase in diabetes prevalence between 1998/1999 and 2008/2009 was observed in the age groups 3539 and 4044 years .
this observation has been attributed to the increase in overweight and obesity.22 in our comparative analysis of diabetes prevalence in the period 20062012 in bulgaria , we found a marginally significant increase , which is concordant with the already published data .
our initial hypothesis that a significant increase in diabetes prevalence might be found was based on several socioeconomic factors characterizing the past decade in bulgaria .
a continuous large wave of economic emigration involving 2040-year - old population has been observed since 1990 .
the birth rate is continuously declining , and the population is aging . at the same time , the unemployment rate is high and the low - income proportion of the population is increasing.23 the increasing proportion of obese subjects in our population might contribute to the observed increased diabetes .
an increase was observed in the obesity prevalence in the general population from 26.7% ( 640/2392 ) in 2006 to 32.7% ( 661/2021 ) in 2012 , p = 0.02 , a relative increase of 22.4% .
there was no change in the overweight prevalence , and the proportion of the subjects with normal body weight decreased , respectively , from 37.1% ( 863/2392 ) in 2006 to 30.1% ( 609/2021 ) in 2012 , p < 0.02 .
we did not find any changes in the prevalence of increased waist circumference between the total studied populations : 61.7% ( 1480/2396 ) in 2006 and 62.3% ( 1268/2032 ) in 2012 nonsignificant ( ns ) .
similarly , the prevalence of increased waist circumference did not change significantly in the diabetic subjects : 89.4% in 2006 and 88.1% in 2012 ( ns ) .
it can be assumed that this factor hardly contributes to the observed change in diabetes prevalence in bulgaria .
arterial hypertension changed nonsignificantly among the diabetic subjects from 80.5% in 2006 to 84.5% in 2012 , a relative increase by 4.96% ( table 2 ) . the prevalence of arterial hypertension in the general population for the same period did not change significantly either : from 43.9% ( 1053/2396 ) in 2006 to 41.3% ( 839/2020 ) in 2012 , p = ns .
other factors that might contribute to the observed diabetes development in our population include the male gender and the age .
an increase in diabetes prevalence was found in both genders , but more markedly in the males , in whom it was marginally significant ( by 2.3% or a relative increase of 25% : 9.2% in 2006 vs. 11.5% in 2012 , p = 0.06 ) . in the females , the increase was minimal , from 6.9% in 2006 to 7.8% in 2012 , a relative increase of 13% ( p = ns ) .
the canadian health agency reported in 2011 a diabetes prevalence in the country in 2008/2009 of 8.7% ( 95% ci : 8.728.74 ) among the adult population over 20 years of age .
that is , 1 in every 11 canadian citizens was a diabetic , which is similar to our results .
the authors observed an increase in the prevalence of the disorder with age , most markedly after the age of 40 .
this observation might be explained by the decline in insulin production and tissue utilization . therefore unsurprisingly ,
nevertheless , half of the diabetic subjects were in active age ( 2564 years ) .
the canadian health agency reported an increase of diabetes prevalence to 9.2% in 2011 [ unpublished analysis using 2008/2009 data from the canadian chronic disease surveillance system , public health agency of canada ; 2011 ] . in our study
, we found that age was linked strongly with the increase in diabetes prevalence between 2006 and 2012 .
moreover , the age group 5059 seems critical with an increase in the disease prevalence from 9.4% ( 49/523 ) in 2006 to 15.7% ( 53/338 ) in 2012 , p < 0.01 . the diabetes prevalence increased by 6.8% ( a relative increase of 42% ) among the subjects of active age ( 2060 years ) .
we observed a decrease in the proportion of diabetic subjects in the elderly ( 60 + years ) . a similar observation has been reported by authors from asia , who found the highest increase in the rate of diabetes in the younger ( < 55 years ) , but mostly among the females.22 a total change in diabetes prevalence for the studied period from 7.9% ( 190/2396 ) in 2006 to 9.55% ( 194/2033 ) in 2012 ,
the change we observed was similar to the data reported in other countries.13,17 the differences in diabetes prevalence ( slightly over 7% , as reported by the german and the american teams ) are probably because of the fact that they present the known diabetes , while we report the total diabetes prevalence .
bearing this in mind , our data come much similar and we can assume that the course of the disease from population point of view follows the trends in the other developed countries .
our results demonstrated a trend toward an increase in diabetes prevalence that might be expected to continue over the years to come .
age , obesity , and male gender were found to be the major risk factors for diabetes in the bulgarian population .
the observed escalation in the disease prevalence requires a good planning of healthcare and long - term strategies for resource allocation and preventive measures .
Output:
| aimthe aim of this study was to compare two nationwide cross - sectional studies of diabetes prevalence in bulgaria ( 2006 and 2012 ) and to assess its dynamics.material and methodsthe two studies included 2396 and 2033 subjects , respectively .
the international diabetes federation ( idf ) diagnostic criteria were applied , and the data were weighed for type of settlement and age.resultsdiabetes prevalence was found to be 7.9% in 2006 and 9.55% in 2012 , p = 0.06 , showing an increase of 20.9% .
the absolute increase was 0.9% in the females and 2.3% in the males ( p < 0.09 ) .
the increase was the largest in those aged 5059 : [ 9.4% , 2006 vs. 15.7% , 2012 , p < 0.01 ] .
diabetes prevalence increased in the 2060-year olds by 6.8% and decreased in the elderly by 6.1% .
obesity increased from 26.7 to 32.7% , p < 0.02.conclusionsa significant increase in diabetes prevalence was found that necessitates healthcare measures and resources for community - based awareness and prevention programs . |
PubmedSumm118438 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 59-year - old chinese man was admitted on march 24 , 2003 , to the singapore general hospital .
he had previously been hospitalized in tan tock seng hospital , the hospital in which the first sars outbreak in singapore occurred ( 6 ) , from march 5 to march 20 for diabetic nephropathy .
the patient had multiple coexisting conditions including ischemic heart disease with atrial fibrillation , previous stroke with scar epilepsy , diabetes mellitus with nephropathy ( creatinine 242 mol / l ) , and peripheral vascular disease .
he was pale , temperature was 36.5c , blood pressure was 126/70 mm hg , and pulse rate was 110/min .
the patient had a temperature spike ( 38.4c ) on march 26 , and intravenous ( iv ) amoxicillin / clavulanic acid was started .
the source of sepsis was thought to be the necrotic heel ulcer ; wound dbridement was performed on march 30 .
blood cultures drawn on march 28 isolated e. coli of intermediate sensitivity to amoxicillin / clavulanic acid .
further evaluation for the source of bacteremia included urinalysis , which indicated a leukocyte count of 4 and erythrocyte count of 165 .
the patient s medication was changed to iv ceftriaxone ( to which the organism was susceptible ) on april 1 . tissue cultures from the necrotic heel yielded pseudomonas aeruginosa sensitive only to imipenem .
although fever was lower after 1 day of ceftriaxone , the patient s medication was switched to iv imipenem on april 2 .
on april 1 ( 6 days after the patient s first spike of temperature ) , three healthcare workers from the ward into which he had first been admitted became febrile . at this time
he was transferred from the general surgical ward to an isolation room , and healthcare workers used a combination of airborne , contact , and droplet precautions .
three chest x - rays performed on days 1 , 5 , and 7 of hospitalization were normal ( figure 1a , b , and c ) .
the fever could have been attributed to the e. coli bacteremia because it subsided after the patient s antimicrobial drug was changed to an appropriate one . over the subsequent days , 16 healthcare workers from the two wards where this patient was treated became febrile . a , radiograph on admission
; b , radiograph on day 5 of hospital stay ; c , radiograph on day 7 of hospital stay . on day 11 of hospitalization ( april 3 , 14 days after the patient s last day in tan tock seng hospital )
, an ill - defined air space shadow was noted in the right lower zone of his chest x - ray ( figure 2 ) . on may 5
, he was transferred back to tan tock seng hospital , an officially designated sars hospital .
the patient had no further temperature spikes and no respiratory symptoms , despite the chest x - ray abnormalities .
the patient completed a course of imipenem but remains in hospital at the time of writing because of nosocomial sepsis .
on april 8 , his brother was also admitted to tan tock seng hospital for acute respiratory failure and died .
radiograph on day 11 of hospital stay ( day 14 after contact with a sars patient ) .
throat swabs from our patient were collected on april 4 and stool samples were colleted on april 10 , days 9 and 15 after the onset of fever , respectively .
these samples were sent for viral studies that included virus isolation and reverse transcriptase polymerase chain reaction ( rt - pcr ) for the sars - associated coronavirus ( sars - cov ) .
the first two sets were sar1s / as and bniouts2/as as described in the paper by drosten et al .
( 7 ) ; the third primer set was cor1/2 ( 5-cac cgt ttc tac agg tta gct aac ga-3 and 5-aaa tgt tta cgc agg taa gcc taa aa-3 ) from the government virus unit , hong kong . from the throat swab ,
a weak band measuring 310 bp was found by using the cor1/2 primer set only .
positive bands were seen with all three primer sets on the stool sample ; the bands with the sar1s / as and bniouts2/as primers measured 190 and 150 bp , respectively .
the diagnosis of sars in the patient s brother was subsequently confirmed on april 9 when a throat swab was positive for sars - cov by pcr .
multiple postmortem samples were also positive for sars - cov by pcr , and sars - cov was also isolated in the lung tissue .
serum samples from the patient and the healthcare workers who were his contacts were tested for total antibodies to sars - cov with an enzyme immunoassay by using sars - cov vero e6 cell lysate that had been developed by the centers for disease control and prevention .
serum samples were taken from 14 of the 16 healthcare workers at least 21 days after onset of symptoms .
extensive epidemiologic studies identified this patient as the common source for the cluster of healthcare workers in singapore general hospital who were subsequently diagnosed with sars .
a total of 16 healthcare workers ( 13 nurses , one health attendant , one radiographer , and one doctor ) , 12 patients , and eight visitors ( including his brother ) from the wards in which the patient was admitted were eventually diagnosed with probable sars .
in addition , he was linked to a cluster of five healthcare workers ( one radiographer and four health attendants ) , one visitor , and three outpatients at the diagnostic radiology department where he had barium studies and an ultrasound performed .
he was linked to one of the index cases in tan tock seng hospital , had the earliest onset of fever among the cohort of singapore general hospital probable cases , and was the only infected patient who had been in the two wards during the relevant time period .
in addition , all the nurses infected had been assigned to care for him during the incubation period of their illness .
strong supportive evidence that could not otherwise be explained by contact with other patients comes from the cluster from radiology department .
we present this case to highlight the diagnostic as well as public health problems posed by a patient with a rather atypical sars , whose illness was easily explained by a positive blood culture .
classically , sars is described as an illness with an incubation of 2 to 7 days followed by a prodrome of high fever with headache , malaise , and myalgia . at the onset of the illness ,
after 3 to 7 days , a lower respiratory phase with nonproductive cough or dyspnea begins ( 8) .
although the clinical signs and symptoms in otherwise healthy persons are widely known , the full clinical spectrum is not known . in the study by lee
, 78% of patients had abnormal chest radiographs at the onset of fever ( 4 ) .
peiris et al . reported that all their patients had radiologic evidence of consolidation at admission ( 9 ) . in another study of 10 cases , 9 had abnormal chest x - rays ( 3 ) .
repeat chest x - rays were read as normal in these two patients ( 2 ) . without radiographic abnormalities ,
the diagnosis of sars can be difficult , especially if a cause for fever exists . by the time the radiographs became abnormal in our patient , he had infected healthcare workers .
the implications of such a case and its consequences on the practice of medicine are important , even in current sars - free areas because of world travel . although we are taught to apply occam s razor and search for a unifying diagnosis , multiple coexisting conditions are a part of clinical medicine .
sars can coexist with other febrile illnesses . the combination of atypical signs and symptoms and a coexisting diagnosis can have negative public health implications .
close contact is defined by who as having cared for or lived with a sars patient or having had direct contact with respiratory secretions and body fluids of a sars patient .
the only contact elucidated was passing through an emergency department of a hospital with a sars outbreak ( 10 ) .
we are not the first group to have seen atypical sars in a patient with multiple coexisting conditions ( 10 ) . in a sars outbreak , we suggest that all patients with undifferentiated fever or pneumonia be cared for as if they had sars for the safety of healthcare workers and patients , implying the use of full precautions ( n95 respirators , gown , gloves , and goggles ) by healthcare workers for all patient - care activities ( e.g. , ward rounds , baths , wound dressings , performance of radiologic procedures ) .
a powered air purifying respirator should be used when performing aerosol - generating activities , e.g. , chest physiotherapy .
patients with undifferentiated fever or pneumonia should be placed in single rooms that meet generally accepted guidelines for the isolation of infected persons ( 11 ) . establishing an explanation for the fever ( e.g. , a positive blood culture ) in a person with a contact history should not necessitate removing the patient from isolation when a sars outbreak is ongoing .
a detailed contact history should include the travel history of the patient and his family members , as well as of their medical condition , and a much broader definition of contact is necessary , e.g. , being in a hospital in which a sars outbreak occurs .
tests for the sars - cov may be ordered , but their low sensitivity must be considered when deciding on the patient s disposition . extreme measures , such as regarding all patients with respiratory infections as potential sars cases , have also been advocated in other studies ( 12 ) .
nebulizer therapy has been banned in many institutions in hong kong , and a protocol for delivering inhaled bronchodilators without nebulization to patients with asthma has been implemented in singapore general hospital .
issues , such as bed availability , will need to be weighed against the need to keep patients in isolation rooms .
asymptomatic or pauci - symptomatic cases are the norm with most viral infections . with sars
Output:
| we describe a patient with severe acute respiratory syndrome ( sars ) whose clinical symptoms were masked by escherichia coli bacteremia .
sars developed in a cluster of healthcare workers who had contact with this patient .
sars was diagnosed when a chest infiltrate developed and when the patient s brother was hospitalized with acute respiratory failure .
we highlight problems in atypical cases and offer infection control suggestions . |
PubmedSumm118439 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: this study was conducted in the hospital of pointe - - pitre ( 1,100 beds ) , a tertiary referral center for guadeloupe and neighboring islands .
all consecutive patients hospitalized from january 2003 and through december 2004 with confirmed leptospirosis were included ; patients admitted to guadeloupe s other hospital ( 200 beds ) were excluded .
leptospirosis was confirmed if 1 blood culture yielded lesptospira spp . or if specific antibodies were detected with either a single titer of > 400 with the microscopic agglutination test ( mat ) and an in - house enzyme immunoassay ( eia ) with an immunoglobulin ( ig ) m titer > 400 ( 5 ) or at least a 4-fold increase in the mat titer between the acute and convalescent phases .
cases were considered severe if dialysis ( in case of oliguria ) or mechanical ventilation was required or if the patient died .
epidemiologic , clinical , and laboratory data were collected retrospectively from medical records taken at patient s admission .
data were analyzed by using epi info ( centers for disease control and prevention , atlanta , ga , usa ) . a multiple stepwise logistic regression analysis ( spss , chicago , il , usa )
was performed for variables with a p value < 0.2 . during the 2-year period ,
a total of 132 case - patients had specific antibodies ( 49 had a single mat titer > 400 and eia igm titer > 400 , and 83 showed a 4-fold increase in the mat titer in paired serum samples ) ; 36 cases were confirmed only by culture .
of the 132 case - patients testing positive for antibody , 19 were also positive for bacterial culture .
all but 2 case - patients were residents of guadeloupe ; the other 2 were a tourist from paris and a resident of the dominica .
the ethnic distribution of the study population was similar to that of the guadeloupean population .
twenty - four ( 14% ) cases were considered to be severe : 6 ( 25% ) of these were fatal .
female case - patients were significantly older than male case - patients ( mean 58.5 17.9 and 47 15.9 years , respectively ; p = 0.01 ) .
chronic alcoholism was common ( 39% ) , especially among the 6 case - patients who died ( 67% ) .
the most common symptoms were myalgia ( 95% ) , headache ( 77% ) , digestive disorders ( 63% ) , fever ( 57% ) , abdominal pain ( 52% ) , and icterus ( 49% ) .
alveolar infiltrates was the most common feature , accounting for 9 ( 41% ) of 22 anomalies observed in the lung by chest radiograph , followed by interstitial pattern ( 27% ) and pleural suffusion ( 18% ) .
six case - patients with severe disease had cardiac complications : 2 had pericarditis confirmed by echocardiography , 2 had ischemic cardiac shock , and 2 myocardiopathy and myocarditis .
tomodensitometry or ultrasonography showed acute pancreatitis in 10 case - patients , of whom 6 had chronic alcoholism and 3 had severe disease .
10 cells / l ) was common ( 90% of case - patients ) , with severe thrombocytopenia ( < 50 10 cells / l ) observed in 19% of case - patients ( table 2 ) .
one fifth of case - patients exhibited rhabdomyolysis with creatinine phosphokinase levels > 1,000 u / l ( table 2 ) . the l. interrogans serovar icterohemorrhagiae was found in 18 ( 45% ) of the 40 case - patients for whom serovars were identified .
the closely related l. borgpetersenii serovars arborea and castellonis accounted for 35% of identified strains ( table 2 ) . * or , odds ratio ; ci , confidence interval ; sbp , systolic blood pressure .
* hemoptysis , hematuria , purpura , bleeding of the gums , and hematemesis . crackles or ronchi .
urinary volume < 400 ml / d . * or , odds ratio ; ci , confidence interval ; alt , alanine aminotransferase ; ast , aspartate aminotransferase ; cpk , creatinine phosphokinase ; ldh , lactate dehydrogenase .
univariate analysis showed that , after stratification for sex , severity was associated with age for women but not for men . neither occupation ( farming , livestock farming , construction , and gardening ) nor contact with swine , cattle , or rodents was linked to severity ( table 1 ) .
nine host - related factors ( listed in order of decreasing odds ratio ) remained independently associated with severity in the multivariate analysis : history of chronic hypertension , hyperamylasemia , history of chronic alcoholism , abnormalities at chest auscultation , oligoanuria , late initiation ( > 10 days after onset of symptoms ) of antibacterial therapy , elevated aspartate aminotransferase levels , consciousness disorders , and icterus .
the l. interrogans serovar icterohemorrhagiae was isolated in 75% of severe cases , but in only 38% of nonsevere cases , and was independently associated with severity .
the l. interrogans serovars icterohemorrhagiae , canicola , and australis have been linked to severity and multiorgan failure ( 68 ) , but other studies did not confirm any link between serovar and outcome ( 911 ) .
therefore , a diagnostic test specifically detecting this serovar at an early stage of disease could help in the management of leptospirosis in patients in guadeloupe .
we confirmed that the l. borgpetersenii serovars arborea and castellonis , rarely isolated elsewhere , are highly prevalent in guadeloupe ( 3,12 ) .
notably , the serogroup ballum , comprising the serovars arborea and castellonis , also is one of the main serogroups associated with human infections in barbados ( 9 ) .
the serovar arborea has been associated with mice , particularly in barbados ( 1,13 ) . in guadeloupe
, this serovar has been isolated from mice and rats , and the serovars icterohemorrhagiae and bogvere have been isolated from rats ( 3 ; v. michelle , pers .
here , we found it to be the strongest risk factor for severe disease . whether patients with histories of chronic hypertension are especially susceptible remains to be confirmed . in our series of patients ,
acute hepatitis and pancreatitis were severe complications of leptospirosis in those with chronic alcoholism ; chronic alcoholism itself was an independent indicator of poor prognosis .
these results are consistent with findings from other studies conducted in la runion , another french overseas territory , and in continental france ( 14,15 ) .
patients with chronic hypertension or chronic alcoholism , late initiation of antibacterial therapy , consciousness disorders , abnormal features at chest auscultation , oligoanuria , jaundice , hyperamylasemia , or high aspartate aminotransferase levels may benefit from early intensive and specific management .
the predominance of the icterohemorrhagiae serovar , linked to severe disease , and of the arborea and the castellonis serovars highlights the need for rodent control to reduce the effects of leptospirosis in guadeloupe .
Output:
| we evaluated prognostic factors for leptospirosis in 168 consecutive hospitalized patients in guadeloupe .
factors independently associated with severity included chronic hypertension or chronic alcoholism , late initiation of antibacterial therapy , abnormal chest auscultation results , icterus , oligoanuria , disorders of consciousness , elevated aspartate aminotransferase levels , hyperamylasemia , and leptospira interrogans serovar icterohemorrhagiae . |
PubmedSumm118440 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: osteoporosis is a progressive skeletal disease that commonly occurs in women as they age , leading to a reduction in bone mass and quality,13 and ultimately increased susceptibility to bone fractures .
it is a disorder associated with significant fracture - related morbidity in elderly postmenopausal women , including negative effects on quality of life because of chronic pain , depression , and limitations on social activity,47 as well as increased mortality.8 estrogen deficiency is one of the main determinants of osteoporosis in women after menopause.9 epidemiology data from spain suggest a prevalence rate of postmenopausal osteoporosis ( pmo ) of approximately 25% for women aged 6069 years and 40% for those aged 7079 years.10 as such , pmo places a significant burden on health care resources , particularly owing to the increased risk of fractures.1113 in 2009 , it was estimated that the costs of osteoporosis in europe would double from 40 billion in 2000 to almost 80 billion in 2050.14 the cost related to hospitalizations due to osteoporotic vertebral fractures in spain was estimated to be 41 million in 2007.15 a more recent estimate for osteoporotic hip fractures in catalonia put the direct costs in this region alone at 50 million.16 pharmacological treatment options for pmo can generally be classified by their action on bone remodeling as either antiresorptive or anabolic agents , with the primary goal of treatment being a reduction in fracture risk.17 antiresorptive drugs generally act to reduce bone remodeling , and lower fracture risk by preserving the microarchitecture of the skeleton and increasing bone mass.18 antiresorptive drugs such as bisphosphonates are established therapies for pmo.8,12,19 denosumab is a relatively new antiresorptive agent that targets the cytokine system involved in bone turnover regulation ( rankl , a cytokine that is an essential mediator for osteoclast formation , function , and survival).20 denosumab is a human monoclonal antibody with high affinity and specificity for rankl.21 by binding to and inhibiting rankl , denosumab prevents its interaction with its receptor , rank , on osteoclasts and their precursors , thus inhibiting bone resorption .
anabolic treatments , such as teriparatide , have been used more recently to stimulate bone formation.11,18,20,22 in addition , drugs such as strontium ranelate , which work by inhibiting the osteoclast and stimulating the osteoblast , have been approved for the treatment of pmo in europe over the last few years.20,23 oral bisphosphonates are well established as effective first - line therapies for the management of pmo .
however , some forms of bisphosphonate therapy can involve potentially inconvenient dosing regimens , including daily / weekly administration , which may have implications for adherence.8,2428 they may also have adverse effects , such as gastrointestinal irritation29 or nephrotoxicity.30,31 these and other well - known potential adverse effects may limit bisphosphonate use in some women with pmo .
moreover , consideration of these adverse events and lack of adherence may influence their overall cost - effectiveness relative to other guideline - recommended pmo treatments .
the spanish treatment guidelines , issued by the spanish society of rheumatology , have recently been updated to reflect new developments in the management of pmo , and include two new antiresorptive drugs , bazedoxifene and denosumab.32 however , there is a lack of information comparing the cost - effectiveness of these newly recommended treatments with relevant alternative options that would help better inform clinical decision - making in spain .
the objective of this study was to estimate the cost- effectiveness of denosumab for osteoporotic fracture prevention compared with generic bisphosphonates ( alendronate , ibandronate , risedronate ) , strontium ranelate , and no treatment in a cohort of postmenopausal spanish women .
a markov model ( figure 1 ) was created to represent the possible health state transitions of spanish postmenopausal women from initiation of treatment for fracture prevention until age 100 years or death .
the model was developed from a previously published model used to assess the cost - effectiveness of denosumab for the treatment of pmo in different countries.33 the current analyses were conducted from the perspective of the spanish national health system .
the model covered a total of eight health states : well , wrist fracture , vertebral fracture , hip fracture
, other osteoporotic fracture , post - vertebral fracture , post - hip fracture , and
, patients could experience a fracture , remain healthy , or die , and could transition between health states
. if the patient died , they moved to the dead health state and remained there for the rest of the simulation . if the patient incurred a fracture , they moved , depending on fracture type , to either the hip fracture , vertebral fracture , wrist fracture , or
after 1 year in one of these health states , the patient could experience a new fracture , or move to the post - hip fracture , post - vertebral fracture , or
dead health states . those with wrist fractures and other osteoporotic fractures were assumed to have had an impact on costs and morbidity in the first year after the fracture only , and therefore , after 1 year in these health states , these patients moved ( assuming no new fracture had occurred ) back to the well health state .
patients in the post - vertebral fracture state could stay in this state , have a vertebral fracture or hip fracture , or die .
those in the post - hip fracture health state could only stay in this health state , have another hip fracture , or die .
consequently , patients who had a hip fracture could not experience any future wrist , vertebral , or other osteoporotic fractures , and patients in the vertebral and post - vertebral health states could not have a wrist fracture , which highlights a limitation of the model .
the risk of sustaining a fracture in the model depends on three elements : the risk for an individual in the general population of incurring a fracture ( specific input by age and fracture location based on epidemiology data ) ; the increased fracture risk associated with osteoporosis ( relative risk [ rr ] ) ; and a risk reduction , if any , attributed to a treatment .
the rr of fracture in patient groups compared with the general population risk was calculated from age , bone mineral density ( bmd ) , and the prevalence of vertebral fractures using previously described methods.3436 the risk contribution from prior vertebral fracture was re - estimated for each cycle to account for age - dependent changes in the prevalence of vertebral fracture in the general population .
the rr of hip fractures was also adjusted over time to accommodate the decreasing gradient of fracture risk per standard deviation of bmd with age.37 rrs at or below a certain femoral neck t - score were calculated by dividing the distribution below a given t - score into 0.1 standard deviation wide slices , and summarizing the rr .
note that the model estimates consequences of vertebral fractures that come to clinical attention whilst the baseline risk of the patient population also is based on the prevalence of morphometric fractures .
this method was used conservatively because morphometric vertebral fractures contribute to fracture risk,38 but have unclear consequences for costs and quality of life.33 the fracture efficacy data for denosumab were derived from freedom ( fracture reduction evaluation with denosumab in osteoporosis every 6 months ) , the pivotal trial that constituted the basis for approval of denosumab in the usa and european union.39,40 the freedom trial consisted of 7,868 women with a mean age of 72 years .
the mean bmd t - scores were 2.8 at the lumbar spine , 1.9 at the total hip , and 2.2 at the femoral neck .
approximately one quarter ( 24% ) of the women had a vertebral fracture at baseline .
denosumab reduced the fracture risk by 68% ( 95% confidence interval [ ci ] 5974 ) , 40% ( 95% ci 363 ) , 20% ( 95% ci 533 ) , and 16% ( 95% ci 11 , 37 ) for new vertebral , hip , non - vertebral , and wrist fractures , respectively.39,40 the risk reductions for non - vertebral fractures were used as the efficacy values for other fractures .
the efficacy data for the other active treatment comparators were taken from a meta - analysis conducted by the national institute for health and care excellence.41 the efficacy rates for all the comparators included can be seen in table 1 .
the freedom study also included prespecified subgroup analyses of patients at higher risk of fracture , including those with a baseline femoral neck bmd t - score 2.5 or less.39,42,43 we used the efficacy data in this subpopulation of high - risk patients in freedom for sensitivity analyses .
as no other product had reported data in a similar subpopulation , a conservative approach was taken by not varying the efficacy rates for the comparators in sensitivity analyses .
for the multivariate sensitivity analysis , specific efficacy data for denosumab were used for patients older than 75 years .
this was not done for comparators , again following a conservative approach , since risk reductions for this specific population were either not reported or lower than that in the overall population ( table 1 ) .
adverse events associated with osteoporosis medications , including denosumab , are usually mild and transient.40,44,45 the cost and quality of life impact of adverse events would be minor and they were not included in the analysis as in other studies.46 data on the incidence of fractures in spain were taken from either the published literature ( in the case of hip fractures)47 or derived from swedish data after applying a reduction factor based on the reported incidence from both countries ( spain compared with sweden).4851 these were then linearly extrapolated and interpolated with the midpoint values for a range of ages used ( eg , age 52 years in the 5054-year age group ) .
patients with hip or vertebral fractures have an increased mortality risk compared with the general population.52,53 wrist fractures are not associated with increased mortality at any age . increased mortality risks due to hip or vertebral fracture were applied , from published sources,52,53 to the spanish mortality rate for women based on 2009 data.54 the rr of death , in the case of hip and vertebral fractures , declines with age , and this was factored into the model . a study on the rr of death from other fractures showed that the variation in fracture risk did not vary greatly by age,55 so the rr of death remained as a constant for all ages in our model .
evidence suggests that much of the excess mortality associated with osteoporosis is not actually a function of the fracture,53,56 but perhaps of the generally more frail condition of patients with osteoporosis .
as such , the rrs of death after fracture were adjusted for comorbidities , and the duration of the increased mortality used in the model was 8 years , which was the follow - up period of the two studies used here to estimate comorbidity.48,51 the population incidence and risk of fractures by type and age , and the rr of mortality linked to the different fracture types and age , can be seen in table 2 .
the rrs resulting from the model for sustaining a fracture at the hip , spine , wrist , or
other sites for the base - case population ( t - score 2.5 or less , started treatment at age 65 years , and 28% prevalence of osteoporotic fracture ) compared with the overall population were 4.36 , 3.20 , 1.68 , and 2.00 , respectively .
this confirms the higher risk of fracture of the base - case population compared with the overall population .
resource use and resource unit cost were collected separately . the resource use in each health state was obtained from the literature where possible , and , for those where no data had been published , conservative assumptions were made as to the probable level of resource consumption .
data obtained from the literature included hospital admissions , nursing home costs , and drug treatments for osteoporosis .
the costs of resources used were taken from published sources , individual hospitals , or nationally available data sources such as esalud57 and bot plus ( portalfarma , consejo oficial de colegios oficiales de farmacuticos),58 and were inflated to 2013 prices using the spanish consumer price index where appropriate ( not for drug costs ) .
certain assumptions were also made in the absence of published information : all interventions were associated with a single physician visit per year , as part of the standard monitoring of treatment .
in addition , denosumab was associated with the cost of one nurse visit per year due to its 6-month subcutaneous injection cycle ( assuming that 50% of all doses in a year were either self - administered , administered by a relative , or administered during annual physician visits ) and there were no differences in tests or analyses due to the treatment administered . in the base - case analysis , it was assumed that only hip fractures would potentially incur long - term care costs ( associated with residence in nursing homes ) .
the probability of requiring a nursing home was conservatively assumed to be 15% based on two previously published spanish studies.59,60 the other types of fractures ( wrist , vertebral , and others ) were associated only with costs at the time of the event . both costs and benefits
were discounted at 3% in the base case in line with current best practice in spain.61 the costs included in the analyses are reported in table 3 .
the retail price of denosumab and the comparator treatments were used , including a mandatory 7.5% reduction in the cases of strontium ranelate and denosumab , as mandated for branded drugs in spain.58 utility values , which represent the reduction in quality of life , for the various fracture health states were taken from published sources.62,63
the five - dimension european quality of life questionnaire values for the general population in spain were taken from a recent publication.38 these values are shown in table 4 .
it was assumed that only hip and vertebral fractures would have associated disutility beyond the first year post - fracture .
several economic analyses previously undertaken have failed to consider persistence with treatment , which reduces their usefulness to decision - makers.64 the presented model analyses explicitly included treatment persistence and its impact on predicted treatment costs and health outcomes . in the model ,
persistence was defined as the length of time that the medication was taken by the patient .
persistence rates for denosumab treatment were based on the daps ( denosumab adherence preference satisfaction ) study,62 a randomized crossover study that compared the persistence on denosumab with that of weekly alendronate in a cohort of 250 patients observed for 24 months .
this study showed that non - persistence in the first year ( before crossover ) was 9.5% for denosumab and 20.2% for alendronate , which represents a 50% rr reduction in non - persistence with denosumab.65 persistence rates for the bisphosphonates and strontium ranelate were taken from the swedish adherence register analysis study , which included data on over 56,000 patients treated for osteoporosis between 2005 and 2009.66 for the comparators , a composite estimate was used rather than the persistence rates for individual treatments because it was felt that comparator persistence would appear to be too low as many patients may simply have switched to an alternative treatment .
persistence for denosumab was obtained applying the rr reduction obtained in daps to the composite estimate for comparators .
the persistence rates used in the model are also presented in table 4 . in the base - case population
, it was assumed that patients were at risk of discontinuing treatment during the first 3 years only , after which they would remain adherent to their treatment until termination or death .
it has been recognized that treatment effects in osteoporosis persist for a length of time even after the treatment has stopped ( defined as the offset time),67,68 and that this can impact cost - effectiveness.6972 there have been very few studies that evaluate offset time .
could not be determined precisely for fractures . when making assumptions for an economic model , differential effects for treatments should be based on solid evidence . at this time , there is not robust evidence to support differential offsets , so we assume that they are equal for all treatments . in the absence of more conclusive evidence for differential offset time
, the offset time used in the base - case analysis was assumed to be equivalent to the time spent on treatment up to a maximum of 2 years ; this was shorter for patients who discontinued treatment earlier . additionally , the treatment effect decreased linearly during the offset time .
the model assumed that the maximum duration of treatment for a fully persistent patient would be 5 years ; therefore , the maximum treatment effect time would be 7 years ( comprising 5 years of full persistence and 2 years of offset time ) .
the primary endpoints of the model were life - years gained , quality - adjusted life - years ( qalys ) , and incremental cost - effectiveness ratios ( icers ) for denosumab against the comparators .
univariate sensitivity analyses were performed using efficacy data from the denosumab freedom study for a subpopulation of patients with t - scores of 2.5 or less at the femoral neck , and by extrapolating the treatment duration to 10 years .
multivariate analyses were performed using several variables simultaneously : age at treatment initiation , t - score , and fracture prevalence , comparing denosumab with either no treatment or alendronate ( as these were seen as the most likely alternative options ) . using the base - case model ,
the variables selected and included in this analysis were : denosumab effects , comparator effects , difference in persistence between denosumab and other treatments ( daps results ) , and age - dependent costs and utilities for the first year ( for hip , vertebral , wrist , and others ) , age - independent costs , and utilities for the second and subsequent years ( hip and vertebral fractures only ) .
estimates for costs and utilities were sampled from a normal distribution and estimates of hazard ratios for treatment efficacy and the probability of discontinuing treatment were sampled from a log - normal distribution .
input data for the probabilistic sensitivity analyses were taken from the relevant input data sources where possible ( table 5 ) .
denosumab and comparator effect confidence intervals ( cis ) were taken from the national institute for health and care excellence appraisal.41 the rr for non - persistence with denosumab versus other treatments was 0.5 ( 95% ci 0.301.00).65 in the absence of specific data for spain , standard error proportions of the mean for fracture costs were derived from data from sweden and were based on the cis of the whole samples for the respective fracture types.73 the standard error proportions of the mean for hip , vertebral , and wrist fractures were 5% , 13% , and 7% , respectively .
the value for other fractures was assumed to be the same as for vertebral fractures , so it was the type with the greatest uncertainty .
utility multiplier cis from the study by peasgood et al63 were used to calculate the standard error of the mean ( sem ) percentage where applicable .
the cis for hip , vertebral , and wrist fractures were 0.640.77 , 0.460.83 , and 0.861.00 , respectively , and 0.680.96 for year 2 and onwards for hip fractures .
the standard error proportions of the mean for hip , vertebral , and wrist fractures were thus 3% , 6% , and 4% , respectively , and 7% for year 2 and onwards for hip fractures .
other fractures were assumed to have the same sem percentage as vertebral fractures , and the sem percentage for vertebral fractures in year 2 and onwards were assumed to be the same as for vertebral fractures in year 1 .
lastly , in the absence of spanish data , the sem percentage for patients with hip fractures going into long - term care was derived from the study by zethraeus et al74 and was 5% ( table 5 ) .
a markov model ( figure 1 ) was created to represent the possible health state transitions of spanish postmenopausal women from initiation of treatment for fracture prevention until age 100 years or death .
the model was developed from a previously published model used to assess the cost - effectiveness of denosumab for the treatment of pmo in different countries.33 the current analyses were conducted from the perspective of the spanish national health system .
the model covered a total of eight health states : well , wrist fracture , vertebral fracture , hip fracture
, other osteoporotic fracture , post - vertebral fracture , post - hip fracture , and
, patients could experience a fracture , remain healthy , or die , and could transition between health states
. if the patient died , they moved to the dead health state and remained there for the rest of the simulation . if the patient incurred a fracture , they moved , depending on fracture type , to either the hip fracture , vertebral fracture , wrist fracture , or
after 1 year in one of these health states , the patient could experience a new fracture , or move to the post - hip fracture , post - vertebral fracture , or
dead health states . those with wrist fractures and other osteoporotic fractures were assumed to have had an impact on costs and morbidity in the first year after the fracture only , and therefore , after 1 year in these health states , these patients moved ( assuming no new fracture had occurred ) back to the well health state .
patients in the post - vertebral fracture state could stay in this state , have a vertebral fracture or hip fracture , or die .
those in the post - hip fracture health state could only stay in this health state , have another hip fracture , or die .
consequently , patients who had a hip fracture could not experience any future wrist , vertebral , or other osteoporotic fractures , and patients in the vertebral and post - vertebral health states could not have a wrist fracture , which highlights a limitation of the model .
the risk of sustaining a fracture in the model depends on three elements : the risk for an individual in the general population of incurring a fracture ( specific input by age and fracture location based on epidemiology data ) ; the increased fracture risk associated with osteoporosis ( relative risk [ rr ] ) ; and a risk reduction , if any , attributed to a treatment .
the rr of fracture in patient groups compared with the general population risk was calculated from age , bone mineral density ( bmd ) , and the prevalence of vertebral fractures using previously described methods.3436 the risk contribution from prior vertebral fracture was re - estimated for each cycle to account for age - dependent changes in the prevalence of vertebral fracture in the general population .
the rr of hip fractures was also adjusted over time to accommodate the decreasing gradient of fracture risk per standard deviation of bmd with age.37 rrs at or below a certain femoral neck t - score were calculated by dividing the distribution below a given t - score into 0.1 standard deviation wide slices , and summarizing the rr .
note that the model estimates consequences of vertebral fractures that come to clinical attention whilst the baseline risk of the patient population also is based on the prevalence of morphometric fractures .
this method was used conservatively because morphometric vertebral fractures contribute to fracture risk,38 but have unclear consequences for costs and quality of life.33
the fracture efficacy data for denosumab were derived from freedom ( fracture reduction evaluation with denosumab in osteoporosis every 6 months ) , the pivotal trial that constituted the basis for approval of denosumab in the usa and european union.39,40 the freedom trial consisted of 7,868 women with a mean age of 72 years .
the mean bmd t - scores were 2.8 at the lumbar spine , 1.9 at the total hip , and 2.2 at the femoral neck .
approximately one quarter ( 24% ) of the women had a vertebral fracture at baseline .
denosumab reduced the fracture risk by 68% ( 95% confidence interval [ ci ] 5974 ) , 40% ( 95% ci 363 ) , 20% ( 95% ci 533 ) , and 16% ( 95% ci 11 , 37 ) for new vertebral , hip , non - vertebral , and wrist fractures , respectively.39,40 the risk reductions for non - vertebral fractures were used as the efficacy values for other fractures .
the efficacy data for the other active treatment comparators were taken from a meta - analysis conducted by the national institute for health and care excellence.41 the efficacy rates for all the comparators included can be seen in table 1 .
the freedom study also included prespecified subgroup analyses of patients at higher risk of fracture , including those with a baseline femoral neck bmd t - score 2.5 or less.39,42,43 we used the efficacy data in this subpopulation of high - risk patients in freedom for sensitivity analyses .
as no other product had reported data in a similar subpopulation , a conservative approach was taken by not varying the efficacy rates for the comparators in sensitivity analyses .
for the multivariate sensitivity analysis , specific efficacy data for denosumab were used for patients older than 75 years .
this was not done for comparators , again following a conservative approach , since risk reductions for this specific population were either not reported or lower than that in the overall population ( table 1 ) .
adverse events associated with osteoporosis medications , including denosumab , are usually mild and transient.40,44,45 the cost and quality of life impact of adverse events would be minor and they were not included in the analysis as in other studies.46
data on the incidence of fractures in spain were taken from either the published literature ( in the case of hip fractures)47 or derived from swedish data after applying a reduction factor based on the reported incidence from both countries ( spain compared with sweden).4851 these were then linearly extrapolated and interpolated with the midpoint values for a range of ages used ( eg , age 52 years in the 5054-year age group ) .
patients with hip or vertebral fractures have an increased mortality risk compared with the general population.52,53 wrist fractures are not associated with increased mortality at any age . increased mortality risks due to hip or vertebral fracture were applied , from published sources,52,53 to the spanish mortality rate for women based on 2009 data.54 the rr of death , in the case of hip and vertebral fractures , declines with age , and this was factored into the model .
a study on the rr of death from other fractures showed that the variation in fracture risk did not vary greatly by age,55 so the rr of death remained as a constant for all ages in our model .
evidence suggests that much of the excess mortality associated with osteoporosis is not actually a function of the fracture,53,56 but perhaps of the generally more frail condition of patients with osteoporosis . as such
, the rrs of death after fracture were adjusted for comorbidities , and the duration of the increased mortality used in the model was 8 years , which was the follow - up period of the two studies used here to estimate comorbidity.48,51 the population incidence and risk of fractures by type and age , and the rr of mortality linked to the different fracture types and age , can be seen in table 2 .
the rrs resulting from the model for sustaining a fracture at the hip , spine , wrist , or
other sites for the base - case population ( t - score 2.5 or less , started treatment at age 65 years , and 28% prevalence of osteoporotic fracture ) compared with the overall population were 4.36 , 3.20 , 1.68 , and 2.00 , respectively .
this confirms the higher risk of fracture of the base - case population compared with the overall population .
resource use and resource unit cost were collected separately . the resource use in each health state was obtained from the literature where possible , and , for those where no data had been published , conservative assumptions were made as to the probable level of resource consumption .
data obtained from the literature included hospital admissions , nursing home costs , and drug treatments for osteoporosis .
the costs of resources used were taken from published sources , individual hospitals , or nationally available data sources such as esalud57 and bot plus ( portalfarma , consejo oficial de colegios oficiales de farmacuticos),58 and were inflated to 2013 prices using the spanish consumer price index where appropriate ( not for drug costs ) .
certain assumptions were also made in the absence of published information : all interventions were associated with a single physician visit per year , as part of the standard monitoring of treatment .
in addition , denosumab was associated with the cost of one nurse visit per year due to its 6-month subcutaneous injection cycle ( assuming that 50% of all doses in a year were either self - administered , administered by a relative , or administered during annual physician visits ) and there were no differences in tests or analyses due to the treatment administered . in the base - case analysis , it was assumed that only hip fractures would potentially incur long - term care costs ( associated with residence in nursing homes ) .
the probability of requiring a nursing home was conservatively assumed to be 15% based on two previously published spanish studies.59,60 the other types of fractures ( wrist , vertebral , and others ) were associated only with costs at the time of the event . both costs and benefits
were discounted at 3% in the base case in line with current best practice in spain.61 the costs included in the analyses are reported in table 3 .
the retail price of denosumab and the comparator treatments were used , including a mandatory 7.5% reduction in the cases of strontium ranelate and denosumab , as mandated for branded drugs in spain.58
utility values , which represent the reduction in quality of life , for the various fracture health states were taken from published sources.62,63 the five - dimension european quality of life questionnaire values for the general population in spain were taken from a recent publication.38 these values are shown in table 4 .
it was assumed that only hip and vertebral fractures would have associated disutility beyond the first year post - fracture .
several economic analyses previously undertaken have failed to consider persistence with treatment , which reduces their usefulness to decision - makers.64 the presented model analyses explicitly included treatment persistence and its impact on predicted treatment costs and health outcomes . in the model ,
persistence was defined as the length of time that the medication was taken by the patient .
persistence rates for denosumab treatment were based on the daps ( denosumab adherence preference satisfaction ) study,62 a randomized crossover study that compared the persistence on denosumab with that of weekly alendronate in a cohort of 250 patients observed for 24 months .
this study showed that non - persistence in the first year ( before crossover ) was 9.5% for denosumab and 20.2% for alendronate , which represents a 50% rr reduction in non - persistence with denosumab.65 persistence rates for the bisphosphonates and strontium ranelate were taken from the swedish adherence register analysis study , which included data on over 56,000 patients treated for osteoporosis between 2005 and 2009.66 for the comparators , a composite estimate was used rather than the persistence rates for individual treatments because it was felt that comparator persistence would appear to be too low as many patients may simply have switched to an alternative treatment .
persistence for denosumab was obtained applying the rr reduction obtained in daps to the composite estimate for comparators .
the persistence rates used in the model are also presented in table 4 . in the base - case population , it was assumed that patients were at risk of discontinuing treatment during the first 3 years only , after which they would remain adherent to their treatment until termination or death .
it has been recognized that treatment effects in osteoporosis persist for a length of time even after the treatment has stopped ( defined as the offset time),67,68 and that this can impact cost - effectiveness.6972 there have been very few studies that evaluate offset time .
when making assumptions for an economic model , differential effects for treatments should be based on solid evidence . at this time , there is not robust evidence to support differential offsets , so we assume that they are equal for all treatments . in the absence of more conclusive evidence for differential offset time ,
the offset time used in the base - case analysis was assumed to be equivalent to the time spent on treatment up to a maximum of 2 years ; this was shorter for patients who discontinued treatment earlier . additionally , the treatment effect decreased linearly during the offset time .
the model assumed that the maximum duration of treatment for a fully persistent patient would be 5 years ; therefore , the maximum treatment effect time would be 7 years ( comprising 5 years of full persistence and 2 years of offset time ) .
the primary endpoints of the model were life - years gained , quality - adjusted life - years ( qalys ) , and incremental cost - effectiveness ratios ( icers ) for denosumab against the comparators .
univariate sensitivity analyses were performed using efficacy data from the denosumab freedom study for a subpopulation of patients with t - scores of 2.5 or less at the femoral neck , and by extrapolating the treatment duration to 10 years .
multivariate analyses were performed using several variables simultaneously : age at treatment initiation , t - score , and fracture prevalence , comparing denosumab with either no treatment or alendronate ( as these were seen as the most likely alternative options ) . using the base - case model ,
the variables selected and included in this analysis were : denosumab effects , comparator effects , difference in persistence between denosumab and other treatments ( daps results ) , and age - dependent costs and utilities for the first year ( for hip , vertebral , wrist , and others ) , age - independent costs , and utilities for the second and subsequent years ( hip and vertebral fractures only ) .
estimates for costs and utilities were sampled from a normal distribution and estimates of hazard ratios for treatment efficacy and the probability of discontinuing treatment were sampled from a log - normal distribution .
input data for the probabilistic sensitivity analyses were taken from the relevant input data sources where possible ( table 5 ) .
denosumab and comparator effect confidence intervals ( cis ) were taken from the national institute for health and care excellence appraisal.41 the rr for non - persistence with denosumab versus other treatments was 0.5 ( 95% ci 0.301.00).65 in the absence of specific data for spain , standard error proportions of the mean for fracture costs were derived from data from sweden and were based on the cis of the whole samples for the respective fracture types.73 the standard error proportions of the mean for hip , vertebral , and wrist fractures were 5% , 13% , and 7% , respectively .
the value for other fractures was assumed to be the same as for vertebral fractures , so it was the type with the greatest uncertainty .
utility multiplier cis from the study by peasgood et al63 were used to calculate the standard error of the mean ( sem ) percentage where applicable .
the cis for hip , vertebral , and wrist fractures were 0.640.77 , 0.460.83 , and 0.861.00 , respectively , and 0.680.96 for year 2 and onwards for hip fractures .
the standard error proportions of the mean for hip , vertebral , and wrist fractures were thus 3% , 6% , and 4% , respectively , and 7% for year 2 and onwards for hip fractures .
other fractures were assumed to have the same sem percentage as vertebral fractures , and the sem percentage for vertebral fractures in year 2 and onwards were assumed to be the same as for vertebral fractures in year 1 .
lastly , in the absence of spanish data , the sem percentage for patients with hip fractures going into long - term care was derived from the study by zethraeus et al74 and was 5% ( table 5 ) .
the base case in the model assumed patients had been diagnosed with osteoporosis ( t - score 2.5 at any site ) , had a 28% prevalence of osteoporotic fracture ( reported fracture prevalence for patients with t - score 2.5 or less in spain),75 and had started treatment at the age of 65 years .
the comparison between denosumab , bisphosphonates , strontium ranelate , and no treatment in the base - case analysis is presented in table 6 .
denosumab reduced the risk of fractures compared with either no treatment or the other active interventions , and produced the greatest gains in life - years and qalys .
the total cost for denosumab was , however , higher compared with the other treatment options , with the exception of strontium ranelate .
denosumab dominated strontium ranelate because it was both more effective and less costly . with an annual acquisition cost of 417.34 for denosumab,58 the icers for denosumab versus no treatment , alendronate , risedronate , and ibandronate
were estimated at 6,823 , 16,294 , 4,895 , and 2,205 per qaly gained , respectively .
the first sensitivity analysis assessed the impact of using efficacy data from the freedom study for the population of patients with a t - score of 2.5 or less at the femoral neck ( ie , those with a high risk of fracture , table 6 ) .
this sensitivity analysis showed that , compared with the base case , the icer estimates improved as denosumab reduced the fracture risk further . estimated icers for denosumab compared with no treatment , alendronate , and risedronate were 3,311 , 9,492 , and 132 per qaly gained , respectively . as in the base - case analysis , denosumab was a dominant treatment alternative to strontium ranelate .
the second sensitivity analysis , in which the treatment duration was extended to 10 years , showed that denosumab was the dominant treatment option compared with ibandronate or strontium ranelate .
the cost per qaly gained was 3,817 , 11,573 , and 2,077 compared with no treatment , alendronate , or risedronate , respectively .
the multivariate sensitivity analysis , which simultaneously varied previous fracture status , age , and t - score , showed that , compared with no treatment , denosumab was cost - saving in most cases ( table 7 ) . for the results comparing denosumab with alendronate , three key variables were identified : age older than 70 years , a t - score of 3.5 or less , and previous fracture .
hence , denosumab appears as dominant for patients fulfilling at least two of these criteria and dominant or cost - effective for most patients fulfilling one of these criteria .
denosumab was probably not cost - effective for patients aged 60 years without a previous fracture and a t - score 3.0 or more ( table 7 ) .
results of the probabilistic sensitivity analyses using 5,000 simulations on the base case but simultaneously varying the three key variables ( age , t - score , and previous fracture status ) showed that denosumab had a 57% probability of being cost - effective compared with alendronate or no treatment at a willingness - to - pay threshold of 20,000 per qaly gained .
this probability was even greater ( 74% ) if the willingness - to - pay threshold was increased to 30,000 per qaly gained ( figure 2 ) .
the base case in the model assumed patients had been diagnosed with osteoporosis ( t - score 2.5 at any site ) , had a 28% prevalence of osteoporotic fracture ( reported fracture prevalence for patients with t - score 2.5 or less in spain),75 and had started treatment at the age of 65 years .
the comparison between denosumab , bisphosphonates , strontium ranelate , and no treatment in the base - case analysis is presented in table 6 .
denosumab reduced the risk of fractures compared with either no treatment or the other active interventions , and produced the greatest gains in life - years and qalys .
the total cost for denosumab was , however , higher compared with the other treatment options , with the exception of strontium ranelate .
denosumab dominated strontium ranelate because it was both more effective and less costly . with an annual acquisition cost of 417.34 for denosumab,58 the icers for denosumab versus no treatment , alendronate , risedronate , and ibandronate
were estimated at 6,823 , 16,294 , 4,895 , and 2,205 per qaly gained , respectively .
the first sensitivity analysis assessed the impact of using efficacy data from the freedom study for the population of patients with a t - score of 2.5 or less at the femoral neck ( ie , those with a high risk of fracture , table 6 ) .
this sensitivity analysis showed that , compared with the base case , the icer estimates improved as denosumab reduced the fracture risk further . estimated icers for denosumab compared with no treatment , alendronate , and risedronate were 3,311 , 9,492 , and 132 per qaly gained , respectively .
as in the base - case analysis , denosumab was a dominant treatment alternative to strontium ranelate .
the second sensitivity analysis , in which the treatment duration was extended to 10 years , showed that denosumab was the dominant treatment option compared with ibandronate or strontium ranelate .
the cost per qaly gained was 3,817 , 11,573 , and 2,077 compared with no treatment , alendronate , or risedronate , respectively .
the multivariate sensitivity analysis , which simultaneously varied previous fracture status , age , and t - score , showed that , compared with no treatment , denosumab was cost - saving in most cases ( table 7 ) . for the results comparing denosumab with alendronate ,
three key variables were identified : age older than 70 years , a t - score of 3.5 or less , and previous fracture .
hence , denosumab appears as dominant for patients fulfilling at least two of these criteria and dominant or cost - effective for most patients fulfilling one of these criteria .
denosumab was probably not cost - effective for patients aged 60 years without a previous fracture and a t - score 3.0 or more ( table 7 ) .
results of the probabilistic sensitivity analyses using 5,000 simulations on the base case but simultaneously varying the three key variables ( age , t - score , and previous fracture status ) showed that denosumab had a 57% probability of being cost - effective compared with alendronate or no treatment at a willingness - to - pay threshold of 20,000 per qaly gained .
this probability was even greater ( 74% ) if the willingness - to - pay threshold was increased to 30,000 per qaly gained ( figure 2 ) .
considerable uncertainty exists around the relative cost - effectiveness of treatments in osteoporosis . in spain , there is no explicitly stated threshold that defines a point at which a treatment is deemed to be cost - effective .
however , de cock et al76 suggest that a value between 30,000 and 45,000 per qaly gained is reasonable . as with all such thresholds ,
there are some examples of technologies with costs exceeding 30,000 per qaly gained that have achieved
reimbursement.76,77 nonetheless , using this generally accepted threshold , this study shows that denosumab is a cost - effective treatment option for the prevention of osteoporotic fractures in postmenopausal women in spain compared with alendronate , risedronate , ibandronate , or no treatment .
a review of 18 previous studies of bisphosphonate use concluded that these agents were generally cost - effective options for the treatment of pmo , but it was difficult to determine if any one agent was conclusively economically superior to any other.78 a study of oral bisphosphonates in switzerland concluded that they were likely to be cost - saving relative to no treatment,79 while a study of tertiary plus secondary prevention measures found bisphosphonates to be cost - effective compared with secondary prevention alone , according to the perspective of the statutory health insurance system in germany.80 one of the most important challenges for decision - makers in the treatment of pmo is identifying the population of patients for whom the treatment is most cost - effective .
based on the results of the multivariate and probabilistic sensitivity analyses conducted in our study , denosumab appears to be cost - effective or cost - saving in most of the scenarios in which it was compared with either alendronate or no treatment .
furthermore , for patients at high risk of fractures ( aged over 75 years , with a previous fracture , or a t - score of 3.5 or less ) , denosumab was cost - saving against both alternatives in most of the scenarios . in additional analyses
( results not shown in the paper ) , where we assumed that there was 100% persistence with the treatments , an identical pattern was observed compared with no treatment , and denosumab was cost - saving in almost all cases .
however , the results for denosumab compared with alendronate differed , with icers ranging from 25,046 to 98,776 for patients
younger than 75 years and with no previous fracture , and from 6,918 to 35,427 for patients younger than 75 years with a previous fracture .
it is noteworthy that for patients older than 75 years , denosumab still appears to be cost - saving compared with alendronate , both in patients with and without previous fracture .
however , such complete persistence , as assumed in our model , is rarely seen , so these higher figures should be treated with caution .
generally , previously published studies have tended to focus on only one or two active comparators per study .
for example , a markov model of the cost utility of risedronate in the uk suggested a cost per qaly gained of 8,625 per treated woman over a 3-year time period relative to no treatment . in this case , risedronate was found to be cost - saving over an expected lifetime.81 risedronate was also cost - saving compared with ibandronate in italy.82 unfortunately , these approaches are of limited utility to decision - makers , who are generally faced with a much wider range of treatment options to choose from .
there have also been relatively few attempts to examine the cost - effectiveness of osteoporosis treatment in a spanish setting .
a study in spain showed that the incremental cost per qaly gained for risedronate compared with no treatment in a 70-year - old woman at the threshold of osteoporosis
( defined as a t - score of 2.5 ) was 32,515.83 a similar analysis of similar patients using the fracture risk assessment tool ( frax ) reported an icer of 105,450 with bazedoxifene compared with placebo,84 and found bazedoxifene to be dominant compared with raloxifene.85 a comparison of risedronate with alendronate in spain produced estimates of 43,601 to 61,064 per qaly gained for risedronate , and 49,483 to 88,634 for alendronate in patients with and without vertebral fractures , respectively.86 the authors concluded that risedronate was more cost - effective than alendronate .
a large - scale , nine - country study published by strom et al using 2004 costs showed that , compared with no treatment , the cost - effectiveness of alendronate in spanish patients with at least one previous vertebral fracture was 13,193 per qaly gained , and 32,943 per qaly gained in patients with no previous fracture history.34 the results from our analysis show considerably lower cost per qaly estimates for denosumab , which reflects the effect of the superior efficacy and persistence relative to other treatments , although the results of the studies discussed could have been influenced by the use and cost of the branded formulations of bisphosphonates rather than the generic versions which are now available .
the results of our analysis are broadly consistent with other similar attempts to establish the cost - effectiveness of denosumab in various countries .
a previous cost - effectiveness analysis of denosumab in greece showed that the incremental cost per qaly gained ranged between 11,114 and 24,784 compared with no treatment , alendronate , ibandronate , risedronate , or strontium ranelate.87 a study in portugal found denosumab to be cost - effective compared with alendronate - cholecalciferol , with an icer of 14,487.88 in the usa , the icer for denosumab was $ 28,300 per qaly gained compared with generic alendronate , and dominated the other treatment options ( risedronate and ibandronate),89 depending on the populations considered in the analyses .
similar results have been shown in belgium,46 canada,90 and sweden33 and confirmed by a recent review.45 while such similarities in outcomes are not surprising , given the same basic modeling approach in each case , it is notable that the cost - effectiveness estimates , which might be expected to be influenced by local pricing and differences in health care systems , are within the range of values for the icers in spain .
the presented model analyses incorporated persistence with treatment as crucial input for the prediction of cost and outcomes .
this is often missing in osteoporosis models and cost - effectiveness models in general.64 the base case also included a population with a relatively low fracture risk , rather than patients with established osteoporosis , which was modeled more closely in the sensitivity analysis .
therefore , it is likely that our estimates of the potential benefits and cost - effectiveness of denosumab are conservative .
there are also some limitations to our approach . in the absence of spanish - specific data , we relied on estimates and data from other countries to provide some of the inputs into the model . in light of differences in cultures and health care systems ,
however , rigorous testing in the sensitivity analyses of these assumptions confirmed the robustness of the base - case data .
the results of the analyses improve with increased treatment duration , with the results from the 10-year treatment duration better than those from 5 years
. this could be relevant as the long - term efficacy and safety of denosumab has been confirmed in a recent review91 and safety data from 8 years of denosumab use in the extension to the freedom study have recently been presented.92
to our knowledge , this is the first comprehensive attempt to model the cost - effectiveness of the most widely used agents for pmo in spain .
this is an area of increasing interest to both physicians and health care decision - makers , who are seeking to determine the best available treatment options from a large range of available therapies .
previous modeling attempts in spain have tended to focus on only one or two drugs and as such , have only provided limited guidance for clinical decision - making .
the results of our analyses show that denosumab is a cost - effective intervention for fracture prevention in postmenopausal women in spain compared with alendronate , risedronate , ibandronate , or no treatment , and is a dominant treatment option compared with strontium ranelate . additionally , for those patients at the highest risk of fractures ( aged over 75 years , with a previous fracture , or a t - score of 3.5 or less ) , denosumab was generally cost - saving compared with either alendronate or no treatment in most of the scenarios .
Output:
| backgroundthe objective of this study was to estimate the cost - effectiveness of denosumab for fracture prevention compared with no treatment , generic bisphosphonates , and strontium ranelate in a cohort of osteoporotic postmenopausal women in spain.methodsa markov model represented the possible health state transitions of spanish postmenopausal women from initiation of fracture prevention treatment until age 100 years or death .
the perspective was that of the spanish national health system .
fracture efficacy data for denosumab were taken from a randomized controlled trial .
fracture efficacy data for alendronate , ibandronate , risedronate , and strontium ranelate were taken from an independent meta - analysis .
data on the incidence of fractures in spain were either taken from the published literature or derived from swedish data after applying a correction factor based on the reported incidence from each country .
resource use in each health state was obtained from the literature , or where no data had been published , conservative assumptions were made .
utility values for the various fracture health states were taken from published sources .
the primary endpoints of the model were life - years gained , quality - adjusted life - years ( qalys ) , and incremental cost - effectiveness ratios for denosumab against the comparators.resultsdenosumab reduced the risk of fractures compared with either no treatment or the other active interventions , and produced the greatest gains in life - years and qalys . with an annual acquisition cost of 417.34 for denosumab ,
the incremental cost - effectiveness ratios for denosumab versus no treatment , alendronate , risedronate , and ibandronate were estimated at 6,823 , 16,294 , 4,895 , and 2,205 per qaly gained , respectively .
denosumab dominated strontium ranelate .
sensitivity analyses confirmed the robustness of these findings.conclusionour analyses show that denosumab is a cost - effective intervention for fracture prevention in osteoporotic postmenopausal women in spain compared with alendronate and risedronate , and is a dominant treatment option compared with strontium ranelate . |
PubmedSumm118441 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in the recent decades , a considerable decline has been reported in prevalence of dental caries especially in developed countries , which is mainly due to the widespread use of fluoride products systemically or topically [ 1 , 2 ] . according to the center for disease control
the laboratory and epidemiologic research that has led to the better understanding of how fluoride prevents dental caries indicates that fluoride s predominant effect is post - eruptive and topical and that the effect depends on fluoride being in the right amount in the right place at the right time .
fluoride works primarily after teeth have erupted , especially when small amounts are maintained constantly in the mouth especially in saliva and plaque .
this is in contrast to the previously accepted belief that the main benefit of fluoride is pre - eruptive and systemic .
many studies have been conducted in the recent years to assess the dental practitioners knowledge and practice in relation to fluoride . in 2012 , 94% of american dentists
of all , 20% agreed that topical fluoride application is not beneficial for low - risk patients .
for high - risk children under six years of age , 93% correctly responded that topical fluoride should be prescribed every three to six months .
dentists knowledge about the mechanism of action of fluoride was reported to be weak . accordingly , effective use of fluoride was emphasized based on caries risk of patients and adherence to evidence - based guidelines . a similar survey on detection of caries , clinical decision - making process by use of caries risk assessment guidelines and applying preventive techniques showed that 69% of practicing dentists performed caries risk assessment and they were more likely to deliver individualized caries prevention including applying sealant and fluoride . in another study , only 9% of florida residents received at least one fluoride application but 75% received dental cleaning and high - need subjects were less likely to receive preventive services . in a study on 6,681 dentists and dental hygienists practicing in indiana , use of fluoride in children and adults with and without active or recent caries was evaluated .
always to never including do nt know and not applicable . almost all ( 95% ) reported fluoride therapy for children with active caries while 62% of respondents reported the use of fluoride for adult patients with the same conditions . in their study , only one - fourth of the respondents correctly identified the predominant mechanism of action of fluoride with regard to enhancing remineralization of incipient carious lesions .
the results of their study revealed the educational need on the appropriate use of fluoride .
dentists are the main source of health information for their patients and can transfer evidence - based information to the public .
moreover , they play an important role in implementation of community programs . in a study in iran
, it was reported that the level of knowledge of dentists about preventive dental care ( i.e. the efficacy of cutting down sugar consumption , application of sealants and water fluoridation in prevention of caries ) was high while knowledge about the efficacy of fluoride and its use was low this is despite the fact that the prevalence of caries among iranian children and adolescents is high . in 2004 ,
a report by the ministry of health and medical education indicated the mean dmft of 5 for 6-year - olds .
the mean dmft for 15 to 19 year - old adolescents was reported to be 4.1 . among all health promotion interventions
, fluoride has reported to be the most effective in a review study by kay and locker .
however , literature shows inadequate knowledge about fluoride and practice of fluoride therapy . in a study by narendran
et al , only 15% of the responding dentists answered correctly to the proper age to start and discontinue fluoride supplements and only one - third correctly mentioned considerations with regard to patient s weight .
there is not enough information on general knowledge of dentists practicing in iran about fluoride and its applications .
the present study was carried out to assess the self - reported level of knowledge of dentists about systemic and topical effects of fluoride , their attitude towards its use and prescription of fluoride products for high - risk patients .
a cross - sectional survey was conducted among general dentists attending a national annual congress held in march 2009 in tehran .
dentists attending a national annual dental congress were approached by the researcher ( zy ) and briefed about the purpose of study .
the volunteer participants were asked to anonymously fill out the questionnaires after giving their consent and drop it in the collection box .
the collected questionnaires were checked by the researcher . a researcher - made self - administered questionnaire comprised of three sections based on the relevant literature
was used in this survey . the questionnaire consisted of demographic information including age , gender , level of education , work experience and current occupational status .
knowledge about the effects of systemic and topical applications of fluoride ( six questions ) , having access to clear guidelines in the workplace ( one question ) and source of information regarding fluoride ( one open question ) were questioned .
attitude towards fluoride application and its efficacy in children and adults was assessed as well .
the last section evaluated self - reported practice including : ( i ) willingness to prescribe fluoride ( two questions ) ; ( ii ) recent application of fluoride in the past year for patients and self - use ( two questions ) ; ( iii ) preferred management including fluoride prescription ( varnish , mouth - rinse , tablet / drop , gel ) in addition to restorative treatment or no intervention for two paper patients , one child and one adult with high risk of caries [ 7 , 13 ] .
the face validity of the questionnaire was assessed by experts ( three experts with a phd degree in community oral health ) . for assessing the reliability of the questionnaire ,
a pilot study was carried out on 12 volunteer dentists with private practice before the survey and the cronbach s alpha was calculated to be 0.75 , which was within the acceptable range .
descriptive statistics including percentage of correct answers and the sum of scores for each questionnaire domain were calculated using spss ver .
16 ( microsoft , chicago , il , usa ) . chi - square test and the spearman s correlation test were used to assess the correlations .
proper management of each case was entered into the logistic regression model and tested for the effect of demographic variables .
a researcher - made self - administered questionnaire comprised of three sections based on the relevant literature was used in this survey . the questionnaire consisted of demographic information including age , gender , level of education , work experience and current occupational status .
knowledge about the effects of systemic and topical applications of fluoride ( six questions ) , having access to clear guidelines in the workplace ( one question ) and source of information regarding fluoride ( one open question ) were questioned .
attitude towards fluoride application and its efficacy in children and adults was assessed as well .
the last section evaluated self - reported practice including : ( i ) willingness to prescribe fluoride ( two questions ) ; ( ii ) recent application of fluoride in the past year for patients and self - use ( two questions ) ; ( iii ) preferred management including fluoride prescription ( varnish , mouth - rinse , tablet / drop , gel ) in addition to restorative treatment or no intervention for two paper patients , one child and one adult with high risk of caries [ 7 , 13 ] .
the face validity of the questionnaire was assessed by experts ( three experts with a phd degree in community oral health ) . for assessing the reliability of the questionnaire ,
a pilot study was carried out on 12 volunteer dentists with private practice before the survey and the cronbach s alpha was calculated to be 0.75 , which was within the acceptable range .
descriptive statistics including percentage of correct answers and the sum of scores for each questionnaire domain were calculated using spss ver .
. chi - square test and the spearman s correlation test were used to assess the correlations .
proper management of each case was entered into the logistic regression model and tested for the effect of demographic variables .
a total number of 347 dentists completed the questionnaires . of all respondents , 232 ( 73.4% ) were males and 27% were females .
the average work experience was 16.4 years , 92.5% of the participants had an active dental practice at the time of survey .
of those , 58.5% had private practices , 19.9% were working in public health centers , and 50% were working in dental clinics ( more than one answer was allowed ) .
of all respondents , 87% were general dentists and the rest were specialists ; only two had master s degree in pediatric dentistry ( table 1 ) .
knowledge scores about the systemic and topical effects of fluoride are presented in figure 1 . of all respondents ,
agree or strongly agree that application of topical fluoride in the form of gel , foam , or varnish was effective for caries prevention .
this value was 85.3% for the positive preventive effect of fluoridated toothpastes and 84.7% for adding fluoride to drinking water .
strongly agree about the prescription of fluoride in the form of tablet and drop . frequency distribution ( % ) of responses regarding the knowledge about systemic and topical effects of fluoride on caries prevention ( n=347 ) demographic characteristics of respondents mean : 4312 ; range : 2279 in the second domain , 25.1% of respondents agreed / strongly agreed with the statement that they did not have time to take preventive measure due to time - consuming restorative procedures and 86.5% responded disagree / strongly disagree that preventive service including oral hygiene instruction and fluoride therapy are not so effective .
also , 83% of respondents gave a positive answer regarding the effectiveness of fluoride for caries prevention in children younger than 12 years of age but 39.2% believed that fluoride has a preventive effect on caries in adults and adolescents over 12 years of age .
the results also showed that 67.4% of respondents did not have access to clear guidelines on the use of fluoride in their workplace except for a few who used manufacturers brochures ; 94.9% of the respondents did not have previous training in this field and did not attend continuing education courses or related workshops in the past six months .
knowledge about fluoride products was weakly correlated with the respondents attitude ( spearman s rho=0.273 , p<0.05 ) ; 80.57% of dentists used fluoride products for themselves or their own family , whereas 69.5% prescribed that for their patients ; 79% of 277 subjects who used fluoride products for themselves or their families prescribed fluoride products for their patients as well ( chi - square , p<0.05 ) . regarding self - reported practice , of all respondents , 71.5% believed that taking a dental history including past dental caries is essential before prescription of any fluoride product and 30.8% agreed / strongly agreed that they would not prescribe fluoride due to its toxic effects .
for management of paper patients , in the first case ( a child at high risk of caries ) , 52.7% chose the correct answer ( any combination of topical fluoride except for fluoride mouth rinse and none , which were incorrect ) in addition to restorative treatment .
for the adult at high risk of caries , 50.1% chose the correct answer ( any combination of topical fluoride except for fluoride tablet / drop and none , which were incorrect ) in addition to restorative treatment .
logistic regression analysis controlling for the effect of demographic factors including age , gender and having a specialty degree showed that recently graduated dentists were more likely to correctly manage a high - risk child ( or=0.95 , 95% ci 0.890.99 ; p=0.034 ) .
it was also demonstrated that younger dentists were more likely to use appropriate form of fluoride in addition to restorative treatment for the high - risk child ( or=0.95 , 95% ci 0.890.99 ; p=0.043 ) ( table 2 ) .
no significant association was found between proper management of a high - risk adult and demographic variables .
logistic regression analysis of proper management of case 1 ( high - risk child ) with socio - demographic variables age , gender , years since graduation , education ( gp vs. specialist ) , working ( private vs. public sector )
the findings of the current study showed acceptable level of knowledge about the effects of topical and systemic administration of fluoride and positive attitude of dentists towards the preventive effect of fluoride especially in children .
younger and newly graduated dentists were more likely to properly manage high - risk children . in our study , the majority of respondents had high level of knowledge about the preventive effect of topical fluoride on caries , which is in accord with the statement of cdc that the most important effect of fluoride is post - eruptive and topical .
this may enhance the application of fluoride as a remineralizing agent in children and even in adult subjects , although only a few respondents had a positive attitude towards application of fluoride in adults . regarding the systemic effect of fluoride , despite having a positive attitude towards water fluoridation ,
it is important to mention that there is no established fluoridation program in iran and the mean fluoride concentration in the groundwater resources at the national level is reported to be 0.47 ppm . in our study
most respondents mentioned that they would not skip oral hygiene instruction and fluoride therapy due to lack of time . on the other hand ,
concerns regarding the toxic effects of fluoride were reported by about one - third of dentists .
this finding might explain the fact that although dentists acknowledge the caries prevention effects of fluoride , they are reluctant to use it due to its toxic side effects .
it was also believed that preventive measures are effective and dentists correctly responded that patient s caries experience should be considered before fluoride therapy . however , only half of the respondents properly managed the high - risk child and the high - risk adult patients presented as patient scenarios .
this is in line with previous studies reporting that only 40% of senior dental students considered fluoride therapy for high - risk patients .
more than 80% of the respondents considered fluoride therapy to be effective for pediatric patients ; however , less than half of the respondents considered it to be effective for adult patients .
this might reflect the fact that there is uncertainty regarding the positive effects of preventive agents on adults especially regarding the post - eruptive remineralizing effects of fluoride . according to recent guidelines on risk - based management by the american dental association
the current study shows that about only half of respondents properly managed the high - risk child presented as patient scenario ; however , younger dentists and recently graduated ones are more likely to manage that correctly .
it is also shown in the study of riley et al , that recently graduated dentists are more likely to perform caries risk assessment for their patients .
it was also reported in another study that dentists who practiced for fewer years were more likely to provide preventive procedures and educational services for patients .
the other finding of this study is that the majority of the respondents acknowledged that they do not have access to clear guideline on fluoride therapy and a few reported using company s catalogue .
this is due to the fact that there is no evidence - based guideline on fluoride application distributed for use in general practice available for local dentists and hence there is a need to prepare national preventive guideline for use in dental practice .
a valid and reliable instrument was used in this study , in which dentists knowledge was assessed .
self - reported practice of dentists was assessed using paper patient scenario similar to the local study assessing preventive practice of senior dental students ; however , using this method might not reflect the real patient situation .
a large number of dentists responded in our survey ; however , this study was conducted in a national congress and despite the obligation of getting continuing education point for dentists , the representativeness of the sample is not warranted .
there was good level of knowledge about preventive effect of topical fluoride and positive attitude towards fluoride application for children under 12 years of age .
most dentists preferred to prescribe fluoride for themselves and their families and about one - third were afraid to prescribe it due to its toxic effect .
Output:
| objectives : this study aimed to assess the self - reported knowledge and attitude of dentists towards fluoride prescription.materials and methods : a questionnaire survey was conducted at the national annual dental congress in 2010 in tehran - iran .
dentists level of knowledge about the preventive effects of systemic and topical administration of fluoride was assessed as well as their attitudes towards its application .
self - reported practice for two paper patients ( a child and an adult with high risk of dental caries ) was assessed .
data were analyzed using spss , chi - square test and logistic regression.results:a total of 347 dentists including 232 ( 73.4% ) males and 84 ( 26.6% ) females responded ; 84.7% agreed / strongly agreed with addition of fluoride to water and 66% agreed with prescription of fluoride tablets / drops in fluoride - deficient areas .
fluoridated toothpastes were considered useful by 85.3% ; this rate was 78.7% for fluoride rinse and 87.6% for fluoride varnish , foam or gel .
the majority of dentists ( 67.4% ) reported no access to clear guidelines on fluoride application ; 83% considered fluoride to be effective for caries prevention in children less than 12 years and 39.2% believed it was useful for adults and adolescents ; 50% of the respondents correctly managed the high - risk child and adult with respect to appropriate selection of fluoride product .
younger dentists ( or=0.94 ; 95% ci 0.80.9 ; p=0.043 ) and new graduates ( or=0.94 ; 95% ci 0.890.99 ; p=0.034 ) were more likely to correctly manage the high - risk child.conclusion:dentists had good knowledge and positive attitudes towards fluoride application .
new graduates were more likely to correctly manage the young high - risk patient . |
PubmedSumm118442 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| the liquid crystalline phase consisting of the potassium salt of the dinucleotide d(gpg ) is compatible with detergents commonly used for solubilizing membrane proteins , including dodecylphosphocholine , the lysolipid 1-palmitoyl-2-hydroxy - sn - glycero-3-phosphocholine , and small bicelles consisting of dihexanoyl phosphatidylcholine and dimyristoyl phosphatidylcholine .
the chiral nematic liquid crystalline phase of d(gpg ) consists of long columns of stacked g - tetrad structures and carry a net negative charge . for water - soluble systems ,
the protein alignment induced by d(gpg ) is very similar to that observed for liquid crystalline pf1 bacteriophage , but of opposite sign .
alignment of the detergent - solubilized fusion domain of hemagglutinin is demonstrated to be homogeneous and stable , resulting in high quality nmr spectra suitable for the measurement of residual dipolar couplings . |
PubmedSumm118443 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| we investigated the cross - sectional and longitudinal relationships between chronic exposure to lead and physical growth among a cohort of children reassessed 13 years after initial examination .
we measured weight , height , and dentin lead levels of 270 children in 1975 - 78 . in 1989 - 1990
we reexamined 79 of these children for measurement of weight , height , and bone lead levels by means of in vivo k x - ray fluorescence . to avoid potential confounding by race and chelation history , analysis was restricted to white subjects without a history of lead chelation therapy .
a total of 236 subjects provided complete information for the study of cross - sectional relationship between dentin lead levels and changes in physical growth : 58 subjects for the study of longitudinal relationship between dentin lead levels and changes in physical growth and 54 subjects for the study of longitudinal relationship between bone lead levels and changes in physical growth .
dentin lead levels averaged 14.9 micrograms / g ; tibia and patella lead levels averaged 1.2 and 5.0 micrograms / g , respectively .
with control for potential confounders including age , sex , baseline body size , and mother 's socioeconomic status , log10 dentin lead level was positively associated with body mass index as of 1975 - 1978 ( beta = 1.02 , p = 0.03 ) and increase in body mass index between 1975 - 78 and 1989 - 90 ( beta = 2.65 , p = 0.03 ) .
bone lead levels were not significantly associated with physical growth .
this is the first study relating chronic lead exposure to body mass index .
the results suggest that chronic lead exposure in childhood may result in obesity that persists into adulthood.imagesfigure 1 . |
PubmedSumm118444 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: hepatocellular carcinoma ( hcc ) is the fifth most common malignancy in the world and its incidence is increasing.1 but , hcc is usually found in advanced stages and often associated with other comorbidities , making curative therapies only be applicable to less than 30 - 40% of the patients.2 in hcc patients who can not be candidates for curative therapies transcatheter arterial chemoembolization ( tace ) is currently the mainstay of palliative treatment .
multiple trials show that tace increases objective tumor responses , slows tumor progression and improves survival benefits.3,4 however , tace can lead to several possible complications , although lethal result is very uncommon .
common complications include post embolization syndrome , fever , intrahepatic biloma , cholecystitis , splenic infarction , gastrointestinal mucosal lesions , multiple intrahepatic aneurysms , and rare but more severe complications include acute hepatic failure , pulmonary embolism or infarction , tumor rupture , hepatorenal syndrome , and variceal bleeding.5 although the incidence of acute pancreatitis after tace has been reported to be various between 1.7 - 40% , a few case of necrotizing pancreatitis complicating abscess formation after tace have been reported.6,7 the risk factors associated with acute pancreatitis after tace were un - selected angiography , numbers of procedures , and the volume of embolic material .
a 69-year - old man with hcc complicating hepatitis b virus - related cirrhosis ( child - pugh class a ) was admitted for 25th tace . on admission ,
the patient had no clinical symptoms , and clinical examination was normal except mild hepatomegaly .
laboratory findings were as follows : hemoglobin 11.3 g / dl , white blood cell count 4,000/l , platelet count 144,000/l , albumin 3.0 g / dl , ast 38
iu / l , alt 20 iu / l , alkaline phosphatase 150 iu / l , ggt 127 iu / l , total bilirubin 1.02 mg / dl , prothrombin time 15.9 seconds .
abdominal computed tomography ( ct ) confirmed the presence of viable hccs in segment 1 , 3 and 7 , and occlusion of both hepatic arteries was seen due to repetitive tace .
tace was performed with selective catheterization of the dorsal pancreatic artery branches feeding the tumors with a mixture of lipiodol ( 4 ml ) , cytotoxic agent ( adriamycin 15 mg ) , and gelfoam ( fig .
the patient complained of poor appetite , nausea , and abdominal pain . on the post - procedure day , the patient had fever , and his laboratory results showed mildly increased ast ( 50 iu / l ) , alt ( 23
the patient 's symptoms were treated conservatively ; hydration , pain and fever control , accordance with post embolization syndrome . on the 5th day , because his fever and abdominal pain were controlled by oral medications and the patient was discharged .
his vital sign was stable and abdominal examination revealed severe epigastric tenderness with palpable tender mass .
the liver enzyme levels were similar as before admission , but the white blood cell count 10,900/l , c - reactive protein 90.62 mg / l , serum amylase 200 iu / l and lipase 153 iu / l levels were elevated .
abdominal ct images demonstrated swelling of the pancreas and focal areas of low density in the pancreas body , suggesting necrosis .
the patient was treated for 5 days with general management of acute pancreatitis : pain control , hydration , fasting and total parenteral nutrition .
iu / l , 49 iu / l , respectively and oral diet was permitted .
two weeks later , the follow up abdominal ct showed that slightly decreased fluid collection of the peripancreatic space , but a 2.4 cm sized fluid collection in the posterior aspect of stomach was newly developed . because of pancreatic duct amputation was identified in the abdominal ct scan ,
the patient 's condition was stable after oral diet , scheduled ercp was performed with the object of pancreatic duct stenting .
the guide - wire was not able to pass into the main pancreatic duct ( mpd ) of the body portion due to the acute angulation of the mpd of the neck .
since stent insertion through the pancreatic duct failed , two 10 f pigtail - tipped drainage catheters were inserted into the abscess cavities to enable percutaneous catheter drainage ( pcd ) ( fig .
3 ) . blood and bile culture were taken and empirical antibiotics ( ciprofloxacin 200 mg per 12 hour ) were started .
klebsiella pneumoniae that was resistant to quinolone and sensitive to 3rd generation cephalosporin , was identified from the culture of the abscess pocket drainage through the pcd catheter and we changed the antibiotics from ciprofloxacin to cefotaxime .
two weeks after the antibiotic was changed , extended - spectrum beta - lactamase producing klebsiella pneumoniae and cefotaxime resistant citrobacter freundii were identified in the repeated abscess culture .
since both of the bacteriaes were sensitive to carbapenem , the antibiotic was changed to ertapenem .
abdominal ct scan was performed again on hospital day 30 , and fluid collection in the body portion of the pancreas was decreased .
the amount of drainage through pcd was decreased and the drainage catheters were removed . after a week , the superficial cystic lesion was palpable in the drainage catheter removal site of the patient .
abdominal ct showed fluid collection along the previous drainage catheter insertion tract continuous with the previous fluid collection between the stomach and the pancreas .
methicillin - resistant staphylococcus aureus was identified from the culture of the fluid drainage through the pcd catheter , and vancomycin was added to ertapenem .
two weeks later , the patient 's symptoms were improved , the amount of drainage through pcd was decreased , and the serum amylase level was normalized .
the necrotizing pancreatitis with abscess formation was improved but the patient 's liver function deteriorated .
patient was still alive , but the further active treatment of hcc could not be possible because of deterioration of liver function .
currently , tace has been implemented more widely , however , complications of tace are still an issue .
the common complication of tace , the post embolization syndrome , is benign with abdominal pain ( 26 - 55% ) , vomiting ( 17 - 50% ) and fever ( 33 - 55% ) .
severe complications occur in 2 - 7% of the patients.4,8 extrahepatic uptake of chemoembolization material in other organs is relatively common but usually does not cause any problems .
complications related to ischemic injury due to embolic material : acute cholecystitis ( 1 - 8% ) , duodenal ulcerated complications ( 1 - 10% ) and acute pancreatitis are rare . among them , acute pancreatitis has an incidence ranging from 1.7% ( acute clinically overt pancreatitis ) to 40% ( biological pancreatitis ) , but fatal outcome is generally low ( 1 - 2%).9 the risk factors associated with acute pancreatitis after tace were non - selected embolization , the numbers of procedures , and the volume of embolic material.9,10 ischemic damage to the pancreas is usually due to the embolization of the vessels supplying the organ because of the regurgitation of the embolic materials . as the relationship between the catheter tip position and pancreatic tissue damage was clearly established , a lower frequency of acute pancreatitis after tace was shown by performing superselective tace in comparison with non - superselective tace.11,12 hepatic artery injury due to repetitive tace can cause the development of parasitic tumor feeding vessels from the non - hepatic artery , which can increase the extrahepatic ischemic injury . there have been reports that the injecting of more than 2 ml embolic material compared to less than 2 ml caused a significant increase in the incidence of acute pancreatitis . from the anatomic variation aspect , when many vessels arise from a common trunk with early bifurcation , this can affect the chance of developing ischemic injury , and the severity of the injury .
moreover , the performer of the procedure needs to exercise caution because , in advanced atherosclerosis patients , the iatrogenic dissection of the gastroduodenal artery during the procedure can cause acute pancreatitis through the ischemic mechanism because since the anastomosis of the superior pancreaticoduodenal artery and the superior mesenteric artery can be ineffective .
thus , precaution regarding the development of acute pancreatitis after tace is needed in patients who have had repetitive procedures , who have been injected with large amounts of embolic material , and who have had nonselective tace . to prevent this complication
, it is important to reduce backflow embolic material by placing the catheter tip as close to the distal branches of hepatic artery as possible , and embolic materials should be injected carefully to avoid the regurgitation.13 in the case reported herein , repetitive tace caused total occlusion of the proper hepatic artery injury , as such , a parasitic tumor feeding vessel was developed from the dorsal pancreatic artery .
tace with selective catheterization of the dorsal pancreatic artery branches can increase the pancreas ischemic injury . in this case
, the embolic materials were found in the dorsal pancreatic artery in the abdominal ct after tace . even if an embolic regurgitation event is not seen , however , it is important to consider the possibility of the development of acute pancreatitis after tace .
it is difficult to differentiate between early onset pancreatitis and post tace syndrome based on symptoms like abdominal pain and nausea . in the patient in this case report , amylase and lipase levels were not checked early , the delay in the management of acute pancreatitis may have contributed to the worsening of the symptoms .
therefore , in patients who complain of abdominal pain after tace , it is very important consider the possibility of the development of acute pancreatitis and to measure the serum pancreatic enzymes .
the treatment of pancreatitis induced by chemoembolization for the treatment of hcc is conservative , as in acute pancreatitis from other causes .
prophylactic antibiotics were administered in all the cases where pancreatic necrosis was evident in the ct scan , to avoid bacterial translocation from the gut . in the case
reported herein , conservative management was the mainstay of the treatment with external drainage , because infection of the necrotic tissue was suspected .
generally , open surgery is considered the gold standard for infected pancreatic necrosis , but surgical intervention is associated with considerable morbidity .
therefore , a minimally invasive technique , such as pcd has an increasingly important perceived role in the management of pancreatic abscess , and of infected pancreatic necrosis in patients with underlying diseases such as liver cirrhosis.14 in conclusion , necrotizing pancreatitis with abscess formation is a rare complication of tace , and may mimic postembolization syndrome at the early stage .
the awareness of this complication , and in patients complaining of abdominal pain after tace , routine monitoring of the serum pancreatic enzymes , are important in the early detection and treatment of acute post procedural pancreatitis .
Output:
| necrotizing pancreatitis is one of the rare complications of transcatheter arterial chemoembolization ( tace ) .
necrotizing pancreatitis after tace may result from the development of ischemia caused by regurgitation of embolic materials into the vessels supplying the pancreas .
we report a case of post - tace necrotizing pancreatitis with abscess formation in a patient with hepatocellular carcinoma .
the patient had suffered hepatic artery injury due to repetitive tace ; during his 25th tace procedure he had submitted to selective catheterization of the feeding vessel from the dorsal pancreatic artery with a cytotoxic agent and gelfoam particles .
the patient complained of abdominal pain after the tace procedure , and a ct scan led to a diagnosis of necrotizing pancreatitis with abscess formation .
the pancreatic abscess progressed despite general management of the pancreatitis , including antibiotics .
percutaneous catheter drainage was performed , and the symptoms of the patient improved . |
PubmedSumm118445 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a polarized cell has a single axis of asymmetry , which can be thought of as apical and basal ( illustrated in figure 1a ) or front and rear ( figure 1b ) .
this asymmetry encompasses a variety of cellular morphologies that can differ among cell types in a single organism , as well as within a single - celled organism such as saccharomyces cerevisiae .
one example is epithelial initiation , which occurs during development and involves congression of mesenchymal cells into aggregates that differentiate to form polarized apical
basal cell monolayers . at the migratory stage , mesenchymal cells set up a front rear axis of polarity ( figure 1b ) .
these polarity principles contribute to the higher - order organization of cell - based systems , such as shaping the embryo , wiring the developing nervous system , maintaining and regenerating tissue , and developing the immune response ( reviewed in nelson , 2009 ) .
particularly striking examples include neuronal migration disorders ( nmds ) such as schizencephaly , porencephaly , and lissencephaly , which are caused by defects in the polarized migration of neurons ( for a review on nmds , see valiente and marin , 2010 ) .
comparison of cellular polarity in cytokinetic cells , polarized epithelial cells , and migrating cells .
( a ) in polarized cells the exocyst ( orange ) is required for basolateral secretory - vesicle delivery and apical endosomal membrane transport .
the exocyst is localized to the basal body / centrosome at the apical primary cilium .
( b ) in migrating cells the exocyst ( orange ) is enriched at the leading edge and at recycling endosomes ( lime green ) for polarized membrane fusion to occur that assists in cell migration ( arrow ) .
phosphatidylinositols ( pink and teal ) are also polarized in cytokinetic cells , polarized cells , and migrating cells .
( c ) during cytokinesis there is polarized membrane traffic ( arrow ) of rab11-decorated recycling vesicles ( lime green ) to the cytokinetic bridge .
the rab11 recycling endosome compartment ( lime green ) recruits a member of the polarity complex , crumbs , to the cytokinetic bridge ( red ) .
the exocyst complex ( orange ) localizes to the midbody ring ( black ring ) and is required for polarized membrane fusion during cytokinesis .
the main theme shared between polarized cells ( a , b ) and cytokinetic cells ( c ) is that they coordinate the use of polarity proteins and polarized membrane - trafficking pathways either to construct a polarized cell or to complete cytokinesis .
the defined distribution of plasma membrane and cytoskeletal proteins in a polarized cell requires signaling networks and protein complexes comprising the rho and rab family gtpases , their downstream effectors , and polarity complexes ( crumbs , par , and scribble ) .
vesicle trafficking from the endocytic and/or exocytic membrane compartments along a polarized cytoskeleton network is required for the establishment of cellular polarity ( reviewed in nelson , 2009 ) .
this has been elegantly illustrated in the budding yeast , s. cerevisiae , in which bud growth is ensured by polarized secretion of golgi apparatus derived membrane vesicles to cortical actin patches under the regulation of rho gtpases and polarity complexes at the bud tip ( reviewed in chant , 1999 ; irazoqui and lew , 2004 ) . in multicellular eukaryotes , protein - sorting events occur at the endocytic pathway and golgi apparatus to ensure cell polarization ( nelson , 2009 ) .
endocytic recycling is critical for maintaining polarized membrane protein residency to establish appropriate responses to stimuli such as nutrient internalization , junctional protein sorting ( e.g. , e - cadherin ) , and ion channel recycling ( lock and stow , 2005 ; ducharme et al . , 2006 ) . of interest
, recent evidence shows that vesicle trafficking is also required for the establishment of polarized domains during cytokinesis , the final stage of cell division ( figure 1c ) .
recent studies suggest that principles of cell polarity are engaged during the process of cytokinesis .
for instance , a migrating polarized cell requires constant membrane addition via secretion at the leading edge to maintain front rear polarity ( nelson , 2009 ) , just as abscission ( the final stage of cytokinesis ) requires membrane addition at the cytokinetic bridge via secretion and endocytic vesicle delivery ( further discussed in the review by prekeris and gould , 2008 , and depicted in figure 2 ) . in both cases , membrane vesicles may act as a platform for delivering essential regulators ensuring cell polarization .
an actin patch is focused at the bud tip where secretory vesicles are directed , and then the patch dissipates as the bud becomes larger and the cell enters cytokinesis .
prior to spindle disassembly and cell separation , polarized - actin patch proteins and secretory vesicles are redirected to the mother bud neck , a structure analogous to the cytokinetic bridge ( verplank and li , 2005 ) .
the apparent importance of polarized vesicle trafficking to polarity and the final stages of cytokinesis leads one to speculate about a conserved underlying mechanism between the two processes .
this notion will be discussed and proposed throughout this essay . polarized membrane trafficking and membrane fusion at the midbody during abscission .
secretory vesicles ( green ) and rab11-decorated endocytic recycling membranes ( pink ) undergo directed motility to the cytokinetic bridge .
secretory vesicles ( green ) are known to fuse ( green line ) with the plasma membrane adjacent to the midbody .
it is proposed that these vesicles transport to the cytokinetic bridge , dock at the midbody by an exocyst - dependent mechanism , and then fuse .
membrane addition is required for abscission , but the role of this process is unknown .
one possibility is that secretory vesicles ( green ) or recycling endosomes ( pink ) bring proteins needed for abscission .
another idea is that membrane fusion is required to thin the bridge so that the fission step can occur as efficiently as possibly .
asymmetry in an epithelial , neuronal , or migrating cell is reflected in its structural , molecular , and functional polarity .
for example , in a migrating cell the broad leading edge ( front ) of the cell defines the direction of movement , and the more - focused rear trails behind .
when a migrating cell divides , it first rounds up , thus eliminating its preexisting polarity .
this involves vesiculating and dispersing sorting compartments such as the golgi apparatus and the endosomal system . during cytokinesis ,
furrow ingression gives rise to the intercellular bridge , a thin cytoplasmic connection between the two nascent daughter cells that is later resolved in the process of abscission .
each nascent daughter assumes an intracellular organization roughly similar to an interphase cell , where the golgi apparatus and endocytic system have partially reorganized over the mother and daughter centrosomes ( figure 2 ) . at this time
rear polarity such that they need only to sever the bond between them to gain the freedom to migrate .
the morphological front rear polarity observed between migration and cytokinesis is further defined by molecular reorganization specifically , changes in phosphotidylinositol concentration within the plasma membrane ( figure 1 ) .
however , little is known about how lipid domain polarization occurs during polarization or cell division .
possibilities include 1 ) remodeling of existing lipid domains by membrane traffic ( endocytosis , directed secretion ) ; 2 ) cortical flow of specific phosphatidylinositols to and immobilization at a specific region ; and 3 ) targeting of lipid - modifying enzymes to a specific region .
cytokinetic proteomic and rna interference screens have led to the identification of intracellular transport genes required for cytokinesis ( echard et al .
, 2004 ; skop et al . , 2004 ) and subsequently for lipid domain polarization .
these genes included rab gtpase family members and inositol - modifying enzymes , such as phosphatidylinositol 3-kinases ( pi3ks ) , which are rab effectors ( e.g. , rab5 ; vieira et al . , 2003 ) that connect membrane traffic with lipid modification .
for instance , phosphatidylinositol ( 3,4,5)-triphosphate ( pi(3,4,5)p3 ) localizes to the plasma membrane near the spindle poles . on the other hand , phosphatidylinositol ( 4,5)-bisphosphate ( pi(4,5)p2 )
predominantly localizes to the cleavage furrow and then to the intracellular bridge between mother and daughter cells analogous to the rear of the migrating cell ( figure 1c ; janetopoulos et al .
in a migrating cell , polarity is established by local pi(3,4,5)p3 accumulation at the cell 's leading edge ( figure 1b ; parent and devreotes , 1999 ) , which is achieved through localization of pi3 kinases and the tumor suppressor pten ( kolsch et al . , 2008 ) .
this reorganization facilitates pseudopodia extension ( wang et al . , 2002 ) through actin polymerization induced by actin - binding proteins
( wasp , profilin , cofilin , capping protein ) binding to membranous pi(3,4,5)p3 and pi(4,5)p2 ( yin and janmey , 2003 ) and subsequent membrane addition by vesicle transport .
mislocalization of phosphatidylinositols disorganizes polarity of the aforementioned actin - binding proteins ( reviewed in gassama - diagne and payrastre , 2009 ; nelson , 2009 ) and also inhibits cytokinesis by a similar mechanism ( janetopoulos et al . , 2005 ) .
for example , cells lacking pten and pi3k are unable to create a stable actin / myosin based contractile ring , thus failing to form a cleavage furrow between dividing mother and daughter cells ( janetopoulos et al . , 2005 ) .
this finding suggests that polarization of phosphatidylinositols at the midzone is required to initiate cytokinesis .
secretion from the golgi apparatus has been suggested as the primary trafficking route for both cell polarization and cytokinesis ( gromley et al . , 2005 ; nelson , 2009 ) .
however , recent evidence links the secretory and endocytic recycling pathways , making it difficult to dissect their individual functions .
originally , the exocyst vesicle - tethering complex was found at the apex of the lateral membrane domain in polarized epithelial cells ( figure 1a ) , where it specified basolateral secretory - vesicle delivery ( grindstaff et al . , 1998 ) .
more recently , the exocyst was also found at the apical recycling endosome compartment ( oztan et al .
, 2007 ; bryant et al . , 2010 ) and at the basal bodies of the primary cilium ( babbey et al . , 2010 ;
in addition , the exocyst subunit sec15 was identified as a rab gtpase - rab11 effector that colocalizes at the recycling endosome in both drosophila and mammals ( zhang et al . , 2004 ;
thus the exocyst has distinct localizations that include the plasma membrane , secretory vesicles , the basal body , and recycling endosomes , which suggests not only roles in secretory vesicle fusion at the plasma membrane and during endocytic recycling , but perhaps various other functions .
the exocyst may be involved in regulating polarized - vectorial membrane traffic toward the leading edge of a migrating cell during interphase ( figure 1b ) or in the opposite direction toward the midbody during cytokinesis ( figure 1c ) .
a migratory cell requires de novo plasma membrane addition at the leading edge that is driven by membrane traffic ( lim et al . , 2005 ) .
this occurs through use of the small - gtpase ralb to confine vesicle trafficking to the leading edge , achieving directional cell movement ( camonis and white , 2005 ; rosse et al . ,
these vesicles then tether at the leading edge via the ralb - recruited - exocyst complex ( rosse et al . , 2006 ) , suggesting that localized membrane addition is required to create a polarized migrating cell . of interest
, this same process seems to be similar , if not the same , for membrane addition at the cytokinetic bridge .
as in cell migration , ralb recruits the exocyst to the cytokinetic bridge during abscission ( cascone et al . , 2008 ) .
in addition , two independent groups showed that secretory vesicles dock via the exocyst and fuse within the cytokinetic bridge ( gromley et al .
most important , these studies found that vesicle fusion near the midbody ring is required for abscission .
one interesting point that these findings highlight is that vectorial membrane transport toward the midbody is opposite that of membrane transport in a migrating cell , suggesting that cytokinetic cells can reorganize the direction of polarized membrane traffic .
during both cell migration and cytokinesis , plasma membrane addition driven by the exocyst complex is likely coordinated with rab - dependent and soluble n - ethylmaleimide sensitive fusion protein attachment protein receptor ( snare)dependent machinery .
one of the best examples of this possible coordination is with the mother - centriole - localized protein centriolin . during
cytokinesis centriolin localizes to the midbody ring within the cytokinetic bridge ( figure 2 ) . at the bridge
, centriolin can interact with both the exocyst complex and a snare - associated protein , snapin , which can mediate secretory vesicle fusion ( gromley et al . , 2005 ) .
in a separate study , exocyst depletion not only caused inhibition of secretory vesicle fusion at the midbody , but also impaired rab11 localization to the cytokinetic bridge ( fielding et al . ,
these results suggest that the exocyst is required for both endosomal and secretory membrane - trafficking steps during cytokinesis ( fielding et al . , 2005 ; gromley et al . ,
2005 ) , which is similar to the requirement of the exocyst complex for endocytic recycling and secretory traffic to the leading edge in polarized cells ( grindstaff et al . , 1998 ; zhang et al . , 2004
rab gtpases are key regulators of membrane traffic , with more than 60 members in mammalian cells that define particular routes within the secretory and endocytic pathways .
rab11 is a well - established participant in recycling endosomal trafficking . in polarized epithelial cells rab11
is associated with membranes in the apical portion near the centrosome and beneath the apical plasma membrane ( casanova et al . , 1999 ) .
this localization enables rab11 to regulate efficient endosomal recycling to apical plasma membrane domains ( prekeris et al . , 2000 ) .
rab11 is required for cytokinesis in caenorhabditis elegans and drosophila and was the first rab gtpase implicated in cytokinesis in human cells ( reviewed in strickland and burgess , 2004 ) .
drosophila embryogenesis has provided a unique system for studying rab11-dependent membrane trafficking ( discussed in strickland and burgess , 2004 ) .
molecular elements required for cellularization of the drosophila embryo are often homologous to those that drive cytokinesis in mammalian cells .
dominant - negative rab11 caused defects in membrane addition and furrow morphology ( ullrich et al . , 1996 ) .
in fact , nuclear fallout is closely related to the mammalian rab11-binding protein fip3 ( hickson et al . , 2003 ) , which is required for mammalian cytokinesis ( fielding et al . , 2005
; wilson et al . , 2005 ) . the formation and targeting of rab11 vesicles to membrane domains within the cytokinetic bridge may be analogous to the mechanism for targeting rab11 vesicles to the apical plasma membrane .
in fact , rab11-positive recycling endosomes , together with the rab11 effectors fip3 and fip4 , are required for membrane delivery during cytokinesis and abscission , although the site of targeting is unknown ( wilson et al . , 2005 ) .
both fip3 and fip4 bind the small gtp - binding protein arf6 , which binds to the exocyst subunit exo70 and is required for cytokinesis ( fielding et al . , 2005 ) .
one proposed role for these complex interactions is that fip3 and fip4 couple rab11-positive vesicle traffic from the recycling endosome to the midbody , where they are tethered via interactions with arf6 and the exocyst ( fielding et al . , 2005 ) . of interest ,
polarized migrating cells rely on arf6-regulated endosomal trafficking to concentrate active cdc42 at the leading edge and recruit the par6-apkc polarity complex ( osmani et al . , 2010 ) .
rab35 functions at an early ( fast recycling ) endosome , prior to the relatively slow recycling endosome step regulated by rab11 ( kouranti et al . , 2006 ) .
whether a role exists for rab35 in regulating either polarity in migratory cells or epithelial cells is not yet known .
one argument that it may regulate polarity is that rab35 is required during cytokinesis to concentrate pi(4,5)p2 at the cytokinetic bridge ( figure 1c ; kouranti et al . , 2006 ) .
in addition , like rab11 , rab35 is required during cytokinesis after furrow ingression to provide polarized delivery of membrane vesicles derived from recycling endosomes to the cytokinetic bridge .
this membrane could be required during abscission for nascent daughter cell separation ( wilson et al . , 2005 ) . because rab11 and rab35 are localized to different subcellular compartments and control distinct endocytic recycling pathways ( zerial and mcbride , 2001 ) , it is likely that there are multiple endocytic routes that are individually essential for cytokinesis and , hypothetically , polarity .
crumbs proteins are important determinants of apical membrane identity ( mccaffrey and macara , 2009 ) and may be required for cytokinesis .
a recent study found that the apical membrane is established during and after cytokinesis through the delivery of crumbs3-positive membranes from a rab11-regulated recycling endosome compartment at the spindle poles that move centripetally along microtubules toward the plasma membrane ( schluter et al . , 2009 ) .
live - cell imaging revealed crumbs3 localization between the two daughter cells within the cytokinetic bridge ( schluter et al . , 2009 ) .
although these data strongly suggest that polarity is initiated during cytokinesis , a requirement for polarity complexes in cytokinesis has yet to be determined .
( 2009 ) and others ( reviewed in shivas et al . , 2010 ) have shown that the endocytic pathway can play an important role in the localization of polarity proteins during cytokinesis and polarity formation ; there is also evidence for a reciprocal role for polarity proteins in the regulation of endocytic machinery ( balklava et al . , 2007 ) . taken together , these studies suggest a synergistic model in which polarity and endocytosis regulators may cross - regulate one another and mutually contribute to the completion of cytokinesis and the formation and function of polarized cells .
asymmetry in an epithelial , neuronal , or migrating cell is reflected in its structural , molecular , and functional polarity .
for example , in a migrating cell the broad leading edge ( front ) of the cell defines the direction of movement , and the more - focused rear trails behind .
when a migrating cell divides , it first rounds up , thus eliminating its preexisting polarity .
this involves vesiculating and dispersing sorting compartments such as the golgi apparatus and the endosomal system . during cytokinesis ,
furrow ingression gives rise to the intercellular bridge , a thin cytoplasmic connection between the two nascent daughter cells that is later resolved in the process of abscission .
each nascent daughter assumes an intracellular organization roughly similar to an interphase cell , where the golgi apparatus and endocytic system have partially reorganized over the mother and daughter centrosomes ( figure 2 ) . at this time
rear polarity such that they need only to sever the bond between them to gain the freedom to migrate .
the morphological front rear polarity observed between migration and cytokinesis is further defined by molecular reorganization specifically , changes in phosphotidylinositol concentration within the plasma membrane ( figure 1 ) .
however , little is known about how lipid domain polarization occurs during polarization or cell division .
possibilities include 1 ) remodeling of existing lipid domains by membrane traffic ( endocytosis , directed secretion ) ; 2 ) cortical flow of specific phosphatidylinositols to and immobilization at a specific region ; and 3 ) targeting of lipid - modifying enzymes to a specific region .
cytokinetic proteomic and rna interference screens have led to the identification of intracellular transport genes required for cytokinesis ( echard et al .
, 2004 ; skop et al . , 2004 ) and subsequently for lipid domain polarization .
these genes included rab gtpase family members and inositol - modifying enzymes , such as phosphatidylinositol 3-kinases ( pi3ks ) , which are rab effectors ( e.g. , rab5 ; vieira et al . , 2003 ) that connect membrane traffic with lipid modification .
for instance , phosphatidylinositol ( 3,4,5)-triphosphate ( pi(3,4,5)p3 ) localizes to the plasma membrane near the spindle poles . on the other hand , phosphatidylinositol ( 4,5)-bisphosphate ( pi(4,5)p2 )
predominantly localizes to the cleavage furrow and then to the intracellular bridge between mother and daughter cells analogous to the rear of the migrating cell ( figure 1c ; janetopoulos et al .
in a migrating cell , polarity is established by local pi(3,4,5)p3 accumulation at the cell 's leading edge ( figure 1b ; parent and devreotes , 1999 ) , which is achieved through localization of pi3 kinases and the tumor suppressor pten ( kolsch et al . , 2008 ) .
this reorganization facilitates pseudopodia extension ( wang et al . , 2002 ) through actin polymerization induced by actin - binding proteins
( wasp , profilin , cofilin , capping protein ) binding to membranous pi(3,4,5)p3 and pi(4,5)p2 ( yin and janmey , 2003 ) and subsequent membrane addition by vesicle transport .
mislocalization of phosphatidylinositols disorganizes polarity of the aforementioned actin - binding proteins ( reviewed in gassama - diagne and payrastre , 2009 ; nelson , 2009 ) and also inhibits cytokinesis by a similar mechanism ( janetopoulos et al . , 2005 ) .
for example , cells lacking pten and pi3k are unable to create a stable actin / myosin based contractile ring , thus failing to form a cleavage furrow between dividing mother and daughter cells ( janetopoulos et al . , 2005 ) .
this finding suggests that polarization of phosphatidylinositols at the midzone is required to initiate cytokinesis .
secretion from the golgi apparatus has been suggested as the primary trafficking route for both cell polarization and cytokinesis ( gromley et al . , 2005 ; nelson , 2009 ) .
however , recent evidence links the secretory and endocytic recycling pathways , making it difficult to dissect their individual functions .
originally , the exocyst vesicle - tethering complex was found at the apex of the lateral membrane domain in polarized epithelial cells ( figure 1a ) , where it specified basolateral secretory - vesicle delivery ( grindstaff et al . , 1998 ) .
more recently , the exocyst was also found at the apical recycling endosome compartment ( oztan et al . , 2007 ; bryant et al . , 2010 ) and at the basal bodies of the primary cilium ( babbey et al .
in addition , the exocyst subunit sec15 was identified as a rab gtpase - rab11 effector that colocalizes at the recycling endosome in both drosophila and mammals ( zhang et al . , 2004 ;
thus the exocyst has distinct localizations that include the plasma membrane , secretory vesicles , the basal body , and recycling endosomes , which suggests not only roles in secretory vesicle fusion at the plasma membrane and during endocytic recycling , but perhaps various other functions .
the exocyst may be involved in regulating polarized - vectorial membrane traffic toward the leading edge of a migrating cell during interphase ( figure 1b ) or in the opposite direction toward the midbody during cytokinesis ( figure 1c ) .
a migratory cell requires de novo plasma membrane addition at the leading edge that is driven by membrane traffic ( lim et al . , 2005 ) .
this occurs through use of the small - gtpase ralb to confine vesicle trafficking to the leading edge , achieving directional cell movement ( camonis and white , 2005 ; rosse et al . ,
these vesicles then tether at the leading edge via the ralb - recruited - exocyst complex ( rosse et al . , 2006 ) , suggesting that localized membrane addition is required to create a polarized migrating cell . of interest
, this same process seems to be similar , if not the same , for membrane addition at the cytokinetic bridge .
as in cell migration , ralb recruits the exocyst to the cytokinetic bridge during abscission ( cascone et al . , 2008 ) .
in addition , two independent groups showed that secretory vesicles dock via the exocyst and fuse within the cytokinetic bridge ( gromley et al .
most important , these studies found that vesicle fusion near the midbody ring is required for abscission .
one interesting point that these findings highlight is that vectorial membrane transport toward the midbody is opposite that of membrane transport in a migrating cell , suggesting that cytokinetic cells can reorganize the direction of polarized membrane traffic .
during both cell migration and cytokinesis , plasma membrane addition driven by the exocyst complex is likely coordinated with rab - dependent and soluble n - ethylmaleimide sensitive fusion protein attachment protein receptor ( snare)dependent machinery .
one of the best examples of this possible coordination is with the mother - centriole - localized protein centriolin . during
cytokinesis centriolin localizes to the midbody ring within the cytokinetic bridge ( figure 2 ) . at the bridge ,
centriolin can interact with both the exocyst complex and a snare - associated protein , snapin , which can mediate secretory vesicle fusion ( gromley et al . ,
in a separate study , exocyst depletion not only caused inhibition of secretory vesicle fusion at the midbody , but also impaired rab11 localization to the cytokinetic bridge ( fielding et al . ,
these results suggest that the exocyst is required for both endosomal and secretory membrane - trafficking steps during cytokinesis ( fielding et al .
, 2005 ; gromley et al . , 2005 ) , which is similar to the requirement of the exocyst complex for endocytic recycling and secretory traffic to the leading edge in polarized cells ( grindstaff et al . , 1998 ;
rab gtpases are key regulators of membrane traffic , with more than 60 members in mammalian cells that define particular routes within the secretory and endocytic pathways .
rab11 is a well - established participant in recycling endosomal trafficking . in polarized epithelial cells rab11
is associated with membranes in the apical portion near the centrosome and beneath the apical plasma membrane ( casanova et al . , 1999 ) .
this localization enables rab11 to regulate efficient endosomal recycling to apical plasma membrane domains ( prekeris et al . , 2000 ) .
rab11 is required for cytokinesis in caenorhabditis elegans and drosophila and was the first rab gtpase implicated in cytokinesis in human cells ( reviewed in strickland and burgess , 2004 ) .
drosophila embryogenesis has provided a unique system for studying rab11-dependent membrane trafficking ( discussed in strickland and burgess , 2004 ) .
molecular elements required for cellularization of the drosophila embryo are often homologous to those that drive cytokinesis in mammalian cells . of interest ,
dominant - negative rab11 caused defects in membrane addition and furrow morphology ( ullrich et al . , 1996 ) .
these phenotypes were very similar to drosophila nuclear fallout mutants ( rothwell et al . , 1998 ) , suggesting that both genes may be involved in common pathways .
in fact , nuclear fallout is closely related to the mammalian rab11-binding protein fip3 ( hickson et al . , 2003 ) , which is required for mammalian cytokinesis ( fielding et al . , 2005 ; wilson et al . , 2005 ) .
the formation and targeting of rab11 vesicles to membrane domains within the cytokinetic bridge may be analogous to the mechanism for targeting rab11 vesicles to the apical plasma membrane .
in fact , rab11-positive recycling endosomes , together with the rab11 effectors fip3 and fip4 , are required for membrane delivery during cytokinesis and abscission , although the site of targeting is unknown ( wilson et al . , 2005 ) .
both fip3 and fip4 bind the small gtp - binding protein arf6 , which binds to the exocyst subunit exo70 and is required for cytokinesis ( fielding et al . , 2005 ) .
one proposed role for these complex interactions is that fip3 and fip4 couple rab11-positive vesicle traffic from the recycling endosome to the midbody , where they are tethered via interactions with arf6 and the exocyst ( fielding et al . , 2005 ) . of interest ,
polarized migrating cells rely on arf6-regulated endosomal trafficking to concentrate active cdc42 at the leading edge and recruit the par6-apkc polarity complex ( osmani et al . , 2010 ) .
rab35 functions at an early ( fast recycling ) endosome , prior to the relatively slow recycling endosome step regulated by rab11 ( kouranti et al . , 2006 ) .
whether a role exists for rab35 in regulating either polarity in migratory cells or epithelial cells is not yet known .
one argument that it may regulate polarity is that rab35 is required during cytokinesis to concentrate pi(4,5)p2 at the cytokinetic bridge ( figure 1c ; kouranti et al . , 2006 ) .
in addition , like rab11 , rab35 is required during cytokinesis after furrow ingression to provide polarized delivery of membrane vesicles derived from recycling endosomes to the cytokinetic bridge .
this membrane could be required during abscission for nascent daughter cell separation ( wilson et al . , 2005 ) . because rab11 and rab35 are localized to different subcellular compartments and control distinct endocytic recycling pathways ( zerial and mcbride , 2001 ) , it is likely that there are multiple endocytic routes that are individually essential for cytokinesis and , hypothetically , polarity .
crumbs proteins are important determinants of apical membrane identity ( mccaffrey and macara , 2009 ) and may be required for cytokinesis .
a recent study found that the apical membrane is established during and after cytokinesis through the delivery of crumbs3-positive membranes from a rab11-regulated recycling endosome compartment at the spindle poles that move centripetally along microtubules toward the plasma membrane ( schluter et al . , 2009 ) .
live - cell imaging revealed crumbs3 localization between the two daughter cells within the cytokinetic bridge ( schluter et al . , 2009 ) . although these data strongly suggest that polarity is initiated during cytokinesis , a requirement for polarity complexes in cytokinesis has yet to be determined . of interest , the studies of schluter et al .
( 2009 ) and others ( reviewed in shivas et al . , 2010 ) have shown that the endocytic pathway can play an important role in the localization of polarity proteins during cytokinesis and polarity formation ; there is also evidence for a reciprocal role for polarity proteins in the regulation of endocytic machinery ( balklava et al . , 2007 ) . taken together , these studies suggest a synergistic model in which polarity and endocytosis regulators may cross - regulate one another and mutually contribute to the completion of cytokinesis and the formation and function of polarized cells .
establishment of polarity is important for cell migration and partitioning an organism into external and internal compartments .
this is suggested by the organization of polarity complexes to cytokinetic sites and defects in cell division following loss or mutation of polarity complex proteins ( albertson and doe , 2003 ; humbert et al . , 2006 ) .
similarly , although the localization of polarity components such as crumbs and phosphatidylinositols to mitotic structures , as well as directed vesicular traffic , highlight the initial stages of polarity during the final stages of cytokinesis , the functional relevance of this reorganization is unknown . therefore comparing components that are involved in cytokinesis , such as rab35 ,
that are not yet known to be involved in cell polarity and investigating their possible conserved function between cytokinesis and polarity may shed light on novel molecular mechanisms .
the same approach could be used in a reciprocal manner to address whether known polarity proteins not yet shown to be involved in cytokinesis have cytokinetic functions .
we conclude that there is a likely requirement for spatiotemporal orchestration of membrane trafficking and polarity - complex machinery to construct new polarized membranes during both cytokinesis and apical surface formation
. however , the precise spatiotemporal relationships and functional relevance of these factors have yet to be determined . future insights into how endocytic recycling , secretory , and polarity pathways act together during cytokinesis will require careful spatiotemporal analysis of these components at the cytokinetic bridge .
Output:
| cell polarity is important for a number of processes , from chemotaxis to embryogenesis .
recent studies suggest a new role for polarity in the orchestration of events during the final cell separation step of cell division called abscission .
abscission shares several features with cell polarization , including rearrangement of phosphatidylinositols , reorganization of microtubules , and trafficking of exocyst - associated membranes . here
we focus on how the canonical pathways for cell polarization and cell migration may play a role in spatiotemporal membrane trafficking events required for the final stages of cytokinesis . |
PubmedSumm118446 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: craniopharyngiomas are histologically benign epithelial tumors , but their ophthalmological , neurological , and endocrine consequences are very severe
hormone replacement can raise some issues because of possible volume increase and/or tumor recurrence risks under growth hormone ( gh ) or estrogens ( e2 ) and/or progesterone substitution .
if large tumors contraindicate growth hormone substitution , some authors have demonstrated that patients with small or totally calcified lesions can be treated safely with gh , little is known about sex hormones substitution .
our aim was to report three patients with craniopharyngiomas in whom the tumor size increased under gh therapy and/or e2 substitution .
then , a discussion on the possible role of gh and sex hormone receptors , whose presence has been demonstrated in some human craniopharyngiomas , will be done on the basis of literature review .
a young woman , aged 22 , was referred to our department for a large craniopharyngioma .
she was diagnosed at 12 years of age ( in 2001 ) , when she was noted to have severe short stature ( 4 sd compared to children of the same age ) . at that time
cerebral ct scan showed a totally calcified intra- and suprasellar mass measuring 45 17 15 mm suggesting a craniopharyngioma or a pituitary stone with thyreotroph , somatotroph and gonadotroph deficiencies .
the vision was normal . as the pituitary lesion was totally calcified no intervention was performed .
she was treated with levothyroxine and had regular radiological monitoring by magnetic resonance imaging ( mri ) . at
one year later gh was stopped because brain mri revealed a solid , cystic and calcified tumor with discrete increase in its size . after stopping gh ,
17 years old , estrogens were introduced because of an important psychological impact of her hypogonadism .
but , 4 months later , there was a rapid increase of the craniopharyngioma [ figure 1 ] with intracranial hypertension that required a ventricular - peritoneal shunt .
2002 : pituitary process measuring 30 17 22 mm ( height , transverse , and antero - posterior diameters ) .
2006 : tumor increase with hemorrhage under growth hormone therapy ( 40 28 22 mm ) . in 2008
( under estrogens ) , the tumor became larger ( 45 30 25 mm ) with an important cyst a 23-year - old patient consulted for the first time at 18 for a lack of pubertal development with short stature .
her brain mri showed an intra- and suprasellar mass measuring 28 20 20 mm suspect of craniopharyngioma .
she underwent partial transphenoidal resection of the tumor , and the pathological examination confirmed the craniopharyngioma .
the postoperative course was marked by an adrenal insufficiency ( which was properly treated ) with persistence of visual troubles .
radiological reassessment revealed a residual process of 10 11 10 mm , which remained stable for over 2 years .
after that , the estrogens , then progesterone were introduced with a good result on breast development and genital bleeding .
but , after 1 year , the mri showed an increase in the craniopharyngioma size i.e. , 19 17 18 mm [ figure 2 ] . 2007 : before pituitary surgery : intra- and suprasellar tumor measuring 28 20 20 mm .
2008 after surgery ( hemorrhage lesion measuring 10 11 10 mm ) . in 2011 , increase of the hemorrhage lesion after estrogens ( 19 17 18 mm ) a young woman aged 21 was referred for complication of her craniopharyngioma , which was diagnosed at 11 years old when she consulted for severe short stature with excessive weight gain and headaches .
an isolated growth hormone deficiency was diagnosed , and then she received hormone replacement without any radiological exploration !
the mri revealed a pituitary lesion measuring 30 mm in height with solid , cystic , and calcified components pleading for a craniopharyngioma reaching the chiasmatic area . at the age of 12 ,
two years later , visual acuity decreased and the mri revealed a 27 18 mm tumor ( residual or recurrence ? ) with tri - ventricular hydrocephalus needing surgery . at the age of 18 , as her residual tumor seemed stable , she received estrogens for her hypogonadism .
after 8 months , intracranial hypertension with impaired consciousness appeared , and then she was operated on for the third time [ figure 3 ] .
a young woman , aged 22 , was referred to our department for a large craniopharyngioma .
she was diagnosed at 12 years of age ( in 2001 ) , when she was noted to have severe short stature ( 4 sd compared to children of the same age ) . at that time
cerebral ct scan showed a totally calcified intra- and suprasellar mass measuring 45 17 15 mm suggesting a craniopharyngioma or a pituitary stone with thyreotroph , somatotroph and gonadotroph deficiencies .
the vision was normal . as the pituitary lesion was totally calcified no intervention was performed .
she was treated with levothyroxine and had regular radiological monitoring by magnetic resonance imaging ( mri ) . at
one year later gh was stopped because brain mri revealed a solid , cystic and calcified tumor with discrete increase in its size . after stopping gh ,
17 years old , estrogens were introduced because of an important psychological impact of her hypogonadism .
but , 4 months later , there was a rapid increase of the craniopharyngioma [ figure 1 ] with intracranial hypertension that required a ventricular - peritoneal shunt .
2002 : pituitary process measuring 30 17 22 mm ( height , transverse , and antero - posterior diameters ) .
2006 : tumor increase with hemorrhage under growth hormone therapy ( 40 28 22 mm ) . in 2008
( under estrogens ) , the tumor became larger ( 45 30 25 mm ) with an important cyst
a 23-year - old patient consulted for the first time at 18 for a lack of pubertal development with short stature .
her brain mri showed an intra- and suprasellar mass measuring 28 20 20 mm suspect of craniopharyngioma .
she underwent partial transphenoidal resection of the tumor , and the pathological examination confirmed the craniopharyngioma .
the postoperative course was marked by an adrenal insufficiency ( which was properly treated ) with persistence of visual troubles .
radiological reassessment revealed a residual process of 10 11 10 mm , which remained stable for over 2 years .
after that , the estrogens , then progesterone were introduced with a good result on breast development and genital bleeding .
but , after 1 year , the mri showed an increase in the craniopharyngioma size i.e. , 19 17 18 mm [ figure 2 ] .
2007 : before pituitary surgery : intra- and suprasellar tumor measuring 28 20 20 mm .
2008 after surgery ( hemorrhage lesion measuring 10 11 10 mm ) . in 2011 , increase of the hemorrhage lesion after estrogens ( 19 17 18 mm )
a young woman aged 21 was referred for complication of her craniopharyngioma , which was diagnosed at 11 years old when she consulted for severe short stature with excessive weight gain and headaches .
an isolated growth hormone deficiency was diagnosed , and then she received hormone replacement without any radiological exploration ! after 1 year the headaches worsened .
the mri revealed a pituitary lesion measuring 30 mm in height with solid , cystic , and calcified components pleading for a craniopharyngioma reaching the chiasmatic area . at the age of 12 ,
two years later , visual acuity decreased and the mri revealed a 27 18 mm tumor ( residual or recurrence ? ) with tri - ventricular hydrocephalus needing surgery . at the age of 18 , as her residual tumor seemed stable , she received estrogens for her hypogonadism .
after 8 months , intracranial hypertension with impaired consciousness appeared , and then she was operated on for the third time [ figure 3 ] .
craniopharyngiomas are embryonic tumors , which are relatively uncommon as they account for only 9 - 11% of all intracranial tumors diagnosed in childhood , and sometimes , in adulthood .
these embryonic tumors , arising from the remnants of rathke 's pouch , can be developed in the hypothalamus , the pituitary stalk , or inside the sella turcica .
but , according to a recent genetic study , it seems that some human craniopharyngiomas , and especially the adamentinomatous ones , which are very aggressive comparing to the papillary forms , are apparently due to a mutation in the wingless catenin signaling which is a critical regulator of stem cells progenitor .
although histologically benign , craniopharyngiomas are considered as locally very invasive tumors , because of their unfavorable prognosis .
the dire prognosis is due to numerous and serious complications such as visual loss , memory troubles , epilepsy , and endocrine morbidities . among pituitary deficits ,
the most common are growth hormone and gonadal deficiencies as a meta - analysis , performed on 121 cases , showed gh deficiency varies from 88% to 100% and gonadal deficit is observed in 74 - 94% . therefore , hormonal substitution is required to achieve normal growth , bone mineralization , sexual development , and to improve the quality of life .
but , the result of gh replacement on craniopharyngiomas increase and/or recurrence is still debated , and little is known about sex hormones replacement . for growth hormone , although gh receptors are well demonstrated in some craniopharyngiomas , many authors continue to think gh is safe , and craniopharyngiomas volume increase and recurrence are related to the quality of surgery excision and to the natural outcome where male gender , early onset , and cranial hypertension are the most important predictive factors of tumor progression and recurrence .
others , less optimistic , think gh should be indicated only if the craniopharyngioma is stable for at least 1 year after surgery , and growth retardation is clinically evident as some children continue to grow despite a lack of gh response to different stimulation tests .
therefore , when gh therapy is indisputable , the treatment should be carefully weighed to avoid recurrence and/or increase in tumor volume . for sex hormones , little is known about their action on human craniopharyngiomas . in 1994 , thapar was apparently the first to describe oestrogen receptors in human craniopharyngiomas . in 1997 , honegger proved the same thing for progesterone receptors , and demonstrated their activity in vitro .
30% were positive for female sex hormone receptors . a positive correlation between estrogen or progesterone receptors and tumor recurrence rate has been proved in vitro for the first time .
then after , hofmann and colleagues , who analyzed 50 cell culture mediums , obtained from 20 craniopharyngiomas , have confirmed estrogen receptors in some of them , and demonstrated a tumor growth after adding estrogens . in addition , a positive correlation between craniopharyngiomas tumor size , cell proliferation , and expression of estrogen receptors was also proved .
our clinical observations plead for a link between hormonal treatment ( gh or e2 and/or progesterone ) and tumor growth , but we were unable to exclude totally a spontaneous increase of these craniopharyngiomas . in our cases , tumor expansion was observed between 4 months and 1 year after the beginning of hormonal treatment . in two out of three cases ,
so we think that indication of estrogen and/or progesterone or gh therapy must be carefully weighed in patients harboring craniopharyngiomas .
limited literature exists about tumor growth under gh and argues for the safety of gh .
however , to our knowledge there is not any clinical report describing an unfavorable change in the size of craniopharyngiomas under estrogens and/or progesterone .
our observations argue for a link between gh and/or sex hormones therapy and size increase in some craniopharyngiomas .
in addition , in vitro studies have confirmed the existence of estrogen receptors and/or progesterone ones in some craniopharyngiomas too .
these findings should encourage caution for gh and female sex hormones prescription in patients harboring craniopharyngiomas .
on another hand estrogen and progesterone receptors assay maybe useful for additional radiotherapy in patients who had incomplete tumor resection .
Output:
| craniopharyngiomas are rare embryonic tumors with low grade of malignancy that arise in supra - or intra - sellar areas with severe ophthalmological , neurological , and endocrine damages . among pituitary deficits , somatotroph and gonadotroph deficiencies are the most challenging because of potential increased risk of tumor growth and recurrence . while data exist to suggest that growth hormone ( gh ) treatment is safe , very little is known about sex hormones replacement on tumor growth .
our aim was to report 3 craniopharyngiomas with tumor increase under gh and/or estrogen ( e2 ) therapy .
the three patients , aged 21 , 22 , and 23 , were studied for severe short stature related to calcified ( n = 1 ) or apparently stable ( for more than 2 years ) craniopharyngiomas with somatotroph and gonadotroph deficiencies .
after 4 months to 1 year gh ( n = 2 ) and/or e2 replacement ( n = 3 ) , there was an increase in craniopharyngiomas size with signs of intracranial hypertension in two cases . in our three craniopharyngiomas that were
either totally calcified or stable before substitution , the tumor increase seemed to be the result of gh and/or e2 substitution .
but , as spontaneous evolution of these tumors is unpredictable , we could not exclude a mere coincidence . |
PubmedSumm118447 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: fatigue sensation is an indispensable bio - alarm to avoid the exhaustive state caused by overwork or stresses , which may also induce a variety of diseases . therefore , to avoid the exhaustive state , it is important to understand the neural mechanism of fatigue sensation .
in addition , to develop the quantification methods of fatigue sensation , which would also contribute to the establishment of the better treatment methods of fatigue , to know the neural mechanism of fatigue sensation may be useful .
mental fatigue represents a failure to complete mental tasks in the absence of demonstrable cognitive failure or motor weakness .
it is necessary to elucidate neural mechanism of fatigue sensation for managing fatigue properly .
however , although neural mechanism of physical fatigue has been to some extent clarified [ 26 ] , little is known concerning the neural substrates of mental fatigue sensation . limitations of the previous studies to identify the brain regions associated with fatigue had included that the fatigue scores had been obtained only at baseline , prior to the acquisition of functional brain data . as proposed by chaudhuri and behan , dissociation between the level of internal input and that of the perceived signal associated with applied voluntary effort may result in the sense of fatigue .
therefore , in order to determine the brain region , neural assessment of the transient task - induced activation rather than task - independent baseline state may be useful . cook and colleagues performed a functional magnetic resonance imaging ( fmri ) study to determine the brain region associated with fatigue sensation during a fatigue - inducing cognitive task in patients with chronic fatigue syndrome ( cfs ) .
significant positive relationships were found between subjective fatigue sensation and responsiveness in the frontal , temporal , cingulate , and cerebellar regions .
it was reported that patients with cfs showed increased fmri activation in the occipitoparietal cortex , posterior cingulate gyrus and parahippocampal gyrus , and decreased activation in the dorsolateral and dorsomedial prefrontal cortices during provocation of fatigue .
although these findings are useful to identify the brain regions related to fatigue sensation , these were limited to just a specific disorder .
in addition , simultaneous evaluation of subjective fatigue sensation was not performed during the fatigue - inducing task in those fmri studies .
we performed h2 o positron emission tomography ( pet ) scans for the measurement of adjusted regional cerebral blood flow ( rcbf ) as an indicator of neural activation concomitant with simultaneous evaluation of fatigue sensation while subjects were performing fatigue - inducing task trials , in order to determine the brain region associated with fatigue sensation in healthy subjects .
twelve right - handed , male healthy volunteers ( age , 22.4 4.1 years ; mean sd ) participated in this study .
none had a history of psychiatric or neurological illness , and none were taking medications known to affect cerebral blood flow .
a psychiatrist ( m. i. ) carefully interviewed all the subjects in order to exclude potential neuropsychiatric diseases .
this study was approved by the ethics committee of hamamatsu medical center , and all participants provided written informed consent for participation .
during the pet experiment , subjects performed 2 types of mental tasks , which were advanced trail - making tests ( atmts ) . in order to identify the brain regions associated with mental fatigue sensation by using pet technique , it was very important to induce fatigue by performing task trials after relatively short period .
the atmt was chosen as the mentally fatigue - inducing task based on the results of our preliminary studies and a report by kajimoto . in the atmt
, circles numbered from 11 to 35 were first randomly located on the display of a touch - panel screen .
the subjects were required to touch these circles in sequence , starting with circle number 11 . when they touched the first target circle , it disappeared and circle number 36 appeared in a different position on the screen .
in task 1 of atmt , the positions of the other circles remained the same ; in contrast , in task 2 , the positions of all the circles were changed . during the first session ,
subjects performed task 1 of atmt , while during the second session they performed task 2 .
when they touched the circle numbered 99 , the test was ended and then started again without any time intervening .
they were instructed to perform these tasks as quickly and correctly as possible . the mean reaction time to touch the atmt circles during the fatigue - inducing task trials
the session , which included 1 fixation scan and 4 task scans , was performed with 10-min interval . during the fixation time , circles numbered from 1 to 25 were randomly located on the screen , and subjects were asked to fix their eyes on the circle number 1 placed at the center of the screen . immediately after the end of each pet scan
, subjects were asked to rate their subjective fatigue sensation on a visual analogue scale ( vas ) from 0 ( no fatigue ) to 100 ( total exhaustion ) [ 12 , 13 ] , while subjects were performing task trials . in order to minimize interindividual variability in fatigue sensation
, standardized vas score was calculated as ( vas value mean of vas value)/(sd of vas value ) .
just before pet measurement , subjects underwent magnetic resonance imaging ( mri ) using a 0.3 t scanner ( mrp7000ad , hitachi , tokyo , japan ) .
pet scan was performed with a spatial resolution of 3.5 mm at full width at half maximum ( fwhm ) transaxially and 4.2 mm axially , using as shr12000 scanner ( hamamatsu photonics kk , hamamatsu , japan ) in 3d .
each subject received 370 mbq of h2 o intravenously through the left antecubital vein for each scan for the measurement of adjusted rcbf . statistical parametric mapping software ( spm99 ; wellcome department of cognitive neurology , institute of neurology , london , uk ) was used for image realignment , normalization , and smoothing and to create statistical maps of significant rcbf changes [ 14 , 15 ] .
after realignment , all scan images were stereotaxically normalized to the template of the montreal neurological institute using nonlinear transformation , and the normalized images were smoothed using a gaussian filter of 7 mm fwhm and the values of adjusted rcbf expressed as ml/100 g / min .
correlation analysis was performed according to the general linear model at each voxel ( voxel size : 2.0 2.0 2.0 mm ) .
the intensity threshold applied to cluster - level statistics was set at a p - value less than .001 , and the extent threshold in terms of the number of voxels was more than 50 .
the brain region exhibiting a positive correlation in activity with the standardized vas score for fatigue during the fatigue - inducing period was located in the medial orbitofrontal cortex ( brodmann 's area 10/11 ) ( p < .001 , uncorrected ; figure 2(a ) ) . in this brain region ,
adjusted rcbf increased during the fatigue - inducing period in each task session although between the sessions , there was a small reduction in fatigue sensation because of a rest condition ( figure 2(b ) ) .
the task performance assessed by mean reaction time of atmt and the standardized vas score for fatigue was shown in figure 3 . during the time course of the fatigue - inducing period , although subjective level of fatigue was increased , the task performance was not significantly altered .
during the pet experiment , subjects exhibited a significant increase in subjective score of fatigue sensation , suggesting that they in fact experienced increased sensation of fatigue during the mental tasks and that the tasks used in the pet experiment were fatigue - inducing .
as for the subjective sensation of fatigue , we would like to emphasize that we recorded the fatigue vas score while subjects were performing the fatigue - inducing task trials
. this online simultaneous recording of subjective sensation of fatigue enabled us to reliably evaluate the correlation between the fatigue sensation and adjusted rcbf , thereby to identify the brain region associated with subjective fatigue sensation .
we normalized fatigue sensation score in order to minimize between - subject variance in the generalized linear matrix model . since the aim of our study was to find task - independent brain areas associated with fatigue sensation , pairs of adjusted rcbf value and the normalized fatigue sensation score from multiple subjects
the design matrix of the correlation analysis based on this point of view might identify the brain regions related to fatigue sensation independent of types of tasks .
it has been shown that was the tendency that the subject had higher level of fatigue sensation in the latter session . although this design matrix could not eliminate order effect completely , since series of the normalized vas score
were not linearly increased because of the resting condition between task 1 and 2 , the order effect of the fatigue sensation might be minimized .
the medial orbitofrontal cortex may play pivotal roles in terms of feedback from sensory , motor , and cognitive systems .
in addition , as referred to as somatic marker hypothesis , medial orbitofrontal cortex is associated with other types of emotion , feeling , and even decision making .
accordingly , the brain region may also play pivotal roles in terms of controlling work output to avoid further fatigue .
however , since task performance was not altered during the trials , those effects seem to be minimal . in conclusion , we have located a brain region associated with fatigue sensation .
today , there are no proper scales for measuring the level of fatigue sensation , and , in the case of fatigue with little or no fatigue sensation , a very serious problem may occur ; since fatigue sensation is an indispensable bio - alarm to order rest , little or no fatigue sensation might cause further fatigue and the further fatigue might result in a homeostatic catastrophe causing death , which is known in japanese as karoshi . therefore , it is important to obtain comprehensive information about fatigue sensation , to develop objective and quantitative evaluation methods of fatigue sensation , and to establish effective treatment strategies for fatigue and its sensation .
Output:
| fatigue is an indispensable bioalarm to avoid exhaustive state caused by overwork or stresses .
it is necessary to elucidate the neural mechanism of fatigue sensation for managing fatigue properly .
we performed h2 15o positron emission tomography scans to indicate neural activations while subjects were performing 35-min fatigue - inducing task trials twice . during the positron emission tomography experiment , subjects performed advanced trail - making tests , touching the target circles in sequence located on the display of a touch - panel screen . in order to identify the brain regions associated with fatigue sensation
, correlation analysis was performed using statistical parametric mapping
method .
the brain region exhibiting a positive correlation in activity with subjective sensation of fatigue , measured immediately after each positron emission tomography scan , was located in medial orbitofrontal cortex ( brodmann 's area 10/11 ) .
hence , the medial orbitofrontal cortex is a brain region associated with mental fatigue sensation .
our findings provide a new perspective on the neural basis of fatigue . |
PubmedSumm118448 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: laparoscopy is a relatively safe procedure , but complications do occur . a giant parietal wall hematoma is a rare presentation of trocar insertion - related injury . bleeding from insertion sites has been reported and can happen with any procedure .
we report a patient who presented with a giant parietal wall hematoma in the post - laparoscopic appendectomy period , who was successfully treated surgically .
a 34-year - old woman presented with recurrent right iliac fossa ( rif ) pain since three months .
, she underwent laparoscopic appendectomy by a 3-trocar technique one infraumbilical , one suprapubic and the third in rif .
the telescope was shifted from an infraumbilical to a suprapubic port for the operative procedure , and instruments were used from the other two ports .
the mesoappendix was dissected and separated from the appendix by applying clips proximally and using monopolar cautery distally .
the patient was on tablet metronidazole , and she developed severe nausea , vomiting and cough for which she did not seek any treatment . on january , 10 , 1999 , she came back to the hospital with severe weakness , malaise , and pain in the abdomen , with distension of the abdomen .
, she had a fever , pallor , pulse rate of 120/min . , and systolic blood pressure of 100 mm hg with minimal ecchymosis over the right lower abdomen .
her hemoglobin was 8 gm% , and sonography revealed an anechoic mass in the right side of the abdomen , with a suspicion of an extraperitoneal hematoma , as shown in figure 1 .
she was transfused two pints of blood , adequately resuscitated and started on a conservative line of management with analgesics and antibiotics .
two weeks later , there was a localized lump in her abdomen , 10 cm 15 cm in size , palpable in the right lower paramedian region .
about 120 ml of old blood was aspirated from this lump , after which there was a decrease in its size .
the patient was well for a week , when a serosanguinous discharge started oozing from the infraumbilical incision .
a ct scan of the abdomen was done that confirmed the presence of a large , right - sided parietal wall hematoma , 10 cm 15 cm 8 cm in size , as shown in figure 2 .
the patient was then explored by right paramedian incision on the lump ; the hematoma was located extraperitoneally behind the rectus muscle and evacuated .
laparoscopic appendectomy is an accepted procedure , but complications as reported do occur , even with experienced surgeons .
vascular complications occur because of sharp dissection during the procedure or during the insertion of a veress needle and trocars .
minor and self - limiting bleeding from trocar puncture sites has been reported earlier with an incidence of 0.21% .
major vascular injuries do occur and are under reported . until now , 25 cases of major vascular injuries during laparoscopy have been reported . of these , only two have been due to an inferior epigastric artery . in our case ,
trocar - site injury was related to an inferior epigastric artery by infraumbilical trocar , which may have been inserted a little more obliquely , traveling above the peritoneum ; bleeding occurred below the rectus sheath , which was closed effectively .
the patient coughing during the postoperative period may have been one of the factors that initiated the bleeding due to the straining that amounted to loosening of the stitch on the sheath .
the injury to epigastric vessels can at times be noticed immediately , either by visualization of a forming hematoma or due to persistent dripping of blood around the trocar site .
if the vascular injury is detected , the bleeding can be controlled by placing through - and - through sutures on the sheath along the course of vessels , by coagulation at these sites , or by inflating a foley balloon at the trocar site , in case of minimal bleeding .
ultrasonography and ct scan of the abdomen were necessary to correctly diagnose and locate the hematoma .
we attempted conservative management of the hematoma by aspiration , as the patient was stable .
however , she remained symptomatic with pain and oozing of serosanguinous discharge from the trocar site . finally , surgical evacuation was inevitable .
delayed recognition of such vascular injury is associated with significant morbidity and mortality . in both the previously reported cases ,
hence , delayed , severe presentation with failure of conservative management are the conditions that require prompt surgery toward an effective cure .
laparoscopic appendectomy is a safe procedure , one that rarely causes any morbidity and mortality if performed by experienced laparoscopists .
however , laparoscopists should be aware of this rare and serious and potentially lethal complication that we have reported .
Output:
| laparoscopic appendectomy is an established procedure in the treatment of appendicitis
. complications of the procedure are related to the veress needle and trocar insertions or pertain to actual operative procedures .
trocar - related major bleeding is rare , and , if it occurs , is detected on the table or during the immediate postoperative period . delay in recognition may lead to significant morbidity and mortality .
we report a case of giant parietal wall hematoma in a 34-year - old female , presenting one week after discharge from the hospital .
the hematoma was completely evacuated by exploration through paramedian incision , followed by an uneventful recovery . |
PubmedSumm118449 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: many new patients , generally young ( in their 30 's ) and after a recent pregnancy , come to the plastic surgeon to restore their breasts to previous firm appearances and restoration without any scar .
this seems logical for patients coming with moderate ptosis and wishing to have breast augmentation as well or at least their appearance before maternity .
nevertheless , periareolar augmentation mastopexy is one of the leading contributors for malpractice claims in the united states .
high patient expectations combined with less elaborate procedures may not always achieve desired goals . despite the large number of published articles and different surgical techniques described for periareolar augmentation mastopexy the outcomes are still not optimal .
the common complications are [ figure 1 ] : see common complications after standard periareolar mastopexy ( flattened shape with low projection , early formation of waterfall , widening of periareolar scars )
tendency of the implant to cranially migrate due to insufficient space in the lower quadrant and the vertical traction by the pectoralis major muscle.immediate flattened appearance due to inadequate cutaneous envelope.early formation of
waterfall appearance due to glandular drooping during the 1 year post - surgerywidening of periareolar scars .
tendency of the implant to cranially migrate due to insufficient space in the lower quadrant and the vertical traction by the pectoralis major muscle .
waterfall appearance due to glandular drooping during the 1 year post - surgery widening of periareolar scars .
indeed , our patients presented a moderate incidence of these complications . from the need to improve on this much - requested technique , we studied these complications in our patients , taking into account the surgical indications and the outcomes .
we established a hypothesis , and with all the findings noted , we developed a new therapeutic approach .
usually , to justify the indication for a periareolar mastopexy , the patient has to fulfil two basic criteria :
the nipple must lie below the level of the inframammary fold ( otherwise , merely an implant will solve the problem).the distance from the sternal notch to the nipple has to be lesser than or about 2324 cm ( if the distance is more than 2324 cm a mastopexy , with either a vertical scar or with an inverted - t technique is indicated ) .
the nipple must lie below the level of the inframammary fold ( otherwise , merely an implant will solve the problem ) .
the distance from the sternal notch to the nipple has to be lesser than or about 2324 cm ( if the distance is more than 2324 cm a mastopexy , with either a vertical scar or with an inverted - t technique is indicated ) .
the appearance of the ideal breast has an inferior pole ( distance from the nipple to inframammary fold ) of 57 cm and the distance from the sternal notch to the nipple is 1921 cm with the nipple lying above the level of the inframammary fold .
when there is an involution with a resulting ptosis , the nipple lies below the level of the inframammary fold , as shown in the diagram [ figure 2 ] .
involution with a resulting ptosis , where the nipple - areola complex goes beyond the submammary crease . if the distance from nipple to submammary crease ( y , y ' ) is normal ( 68 cm ) , the sternal to nipple distance ( x , x ' ) will be higher than those 2324 cm established to perform a periareolar mastopexy if the inferior pole is normally constituted ( distance from nipple to inframammary fold : 57 cm minimum [ y , y ' ] ) , the distance from the sternal notch to the nipple ( x , x ' ) will obligatorily be higher than those 2324 cm established as a basic criteria to perform a periareolar mastopexy . for a breast to meet the two requirements established above to undergo a periareolar mastopexy ( nipple located below the level of the inframammary fold and distance from sternal notch to nipple < 24 cm ) , it should necessarily have an abnormally short inferior pole , meaning that it would belong to the group of the so - called anomalies of the breast base , widely known as tuberous breasts . from this criteria ,
the medical records and photographs of our patients having undergone a periareolar augmentation mastopexy were reviewed .
it was observed that they already had an abnormally short inferior pole when the pre - operative measures were taken .
checking the pre - operative measurements of these patients ( total amount 137 patients ) , 100% had an abnormally short inferior pole .
the average measurement obtained from these patients was 4.5 cm 0.2 standard deviation ( sd ) from areola to mammary crease , and none of them exceeded the minimum for a normal breast ( 5 cm ) . to fix the indication to perform a periareolar augmentation mastopexy for ptosis correction ,
the breast has to be tuberous at any level and to have an abnormally short inferior pole ( < 5 cm ) .
the above findings may explain the main complications from periareolar augmentation mastopexy with the standard surgical technique ( cranial migration , flattened shape , early formation of waterfall or cascade , widening of periareolar scars ) .
consequently , we decided to tackle the problem differently and began to perform periareolar augmentation mastopexy dealing with the cases as tuberous breasts .
our modified therapeutic plan was as following :
extra - glandular approach , practically subcutaneous , based on freeing all the skin from the glandular complex until the new submammary crease was reached , with minimal invasion of the skin in the belly area to avoid differences between gland and implant and the formation of a
double bubble [ figure 3].freeing of lateral and medial flaps of the gland allowing an adequate rise of the breast per se.gland dissection from the muscle to perform a dual plane type ii to allow an adequate gland rise , to let the gland drape freely over the implant.dissection of sub - muscular pocket.placement of an anatomical implant with maximum projection to create the most horizontal support plane to prevent
, maximum projection is achieved to prevent a truncated cone shape [ figures 46].skin closure of nipple - areola complex with unabsorbable suture ( as it resists mechanical stresses better ) , performing round block technique by freeing all the dermis from the skin to better drape the nipple - areola complex .
these new modifications result in a breast with wider space in the lower quadrants , which allow better adaptation of the implant and a pleasing shape to the breast .
the unpleasant tendency to upper migration is thus avoided [ figures 5 and 6 ] .
extra - glandular approach , practically subcutaneous , based on freeing all the skin from the glandular complex until the new submammary crease was reached , with minimal invasion of the skin in the belly area to avoid differences between gland and implant and the formation of a
freeing of lateral and medial flaps of the gland allowing an adequate rise of the breast per se .
gland dissection from the muscle to perform a dual plane type ii to allow an adequate gland rise , to let the gland drape freely over the implant .
placement of an anatomical implant with maximum projection to create the most horizontal support plane to prevent
, maximum projection is achieved to prevent a truncated cone shape [ figures 46 ] .
skin closure of nipple - areola complex with unabsorbable suture ( as it resists mechanical stresses better ) , performing round block technique by freeing all the dermis from the skin to better drape the nipple - areola complex .
these new modifications result in a breast with wider space in the lower quadrants , which allow better adaptation of the implant and a pleasing shape to the breast .
the unpleasant tendency to upper migration is thus avoided [ figures 5 and 6 ] .
extra - glandular approach , freeing all the skin from the glandular complex , reaching the new submammary crease , treating to invade the skin of upper abdomen as little as possible compare the different placements of the anatomical implants [ figures 4 and 6 ] .
figure 4 shows subglandular placement , which would facilitate breast ptosis as the breast matures , being the prosthesis in the lower part of the breast in
a is showed another incorrect placement of the anatomical implants : the subpectoral implantation at the same level as the gland , it would facilitate cranial migration of the prostheses with drop of the gland and waterfall effect , which can be seen in
b we recommend performing a dual plane type ii and the placement of an anatomical implant with maximum projection to create the most horizontal support plane for the gland , and to prevent truncated cone shape at the same time , high profile implants make possible a support plane that permits the satisfactory evolution of the breast over time and adequate projection . following this new surgical technique
we started a prospective observational study wherein , we included 56 patients who accomplished the former criteria for periareolar mastopexy but considered as tuberous breasts .
usually , to justify the indication for a periareolar mastopexy , the patient has to fulfil two basic criteria :
the nipple must lie below the level of the inframammary fold ( otherwise , merely an implant will solve the problem).the distance from the sternal notch to the nipple has to be lesser than or about 2324 cm ( if the distance is more than 2324 cm a mastopexy , with either a vertical scar or with an inverted - t technique is indicated ) .
the nipple must lie below the level of the inframammary fold ( otherwise , merely an implant will solve the problem ) .
the distance from the sternal notch to the nipple has to be lesser than or about 2324 cm ( if the distance is more than 2324 cm a mastopexy , with either a vertical scar or with an inverted - t technique is indicated ) .
the appearance of the ideal breast has an inferior pole ( distance from the nipple to inframammary fold ) of 57 cm and the distance from the sternal notch to the nipple is 1921 cm with the nipple lying above the level of the inframammary fold .
when there is an involution with a resulting ptosis , the nipple lies below the level of the inframammary fold , as shown in the diagram [ figure 2 ] .
involution with a resulting ptosis , where the nipple - areola complex goes beyond the submammary crease . if the distance from nipple to submammary crease ( y , y ' ) is normal ( 68 cm ) , the sternal to nipple distance ( x , x ' ) will be higher than those 2324 cm established to perform a periareolar mastopexy if the inferior pole is normally constituted ( distance from nipple to inframammary fold : 57 cm minimum [ y , y ' ] ) , the distance from the sternal notch to the nipple ( x , x ' ) will obligatorily be higher than those 2324 cm established as a basic criteria to perform a periareolar mastopexy . for a breast to meet the two requirements established above to undergo a periareolar mastopexy ( nipple located below the level of the inframammary fold and distance from sternal notch to nipple < 24 cm ) , it should necessarily have an abnormally short inferior pole , meaning that it would belong to the group of the so - called anomalies of the breast base , widely known as tuberous breasts . from this criteria ,
the medical records and photographs of our patients having undergone a periareolar augmentation mastopexy were reviewed .
it was observed that they already had an abnormally short inferior pole when the pre - operative measures were taken .
checking the pre - operative measurements of these patients ( total amount 137 patients ) , 100% had an abnormally short inferior pole .
the average measurement obtained from these patients was 4.5 cm 0.2 standard deviation ( sd ) from areola to mammary crease , and none of them exceeded the minimum for a normal breast ( 5 cm ) . to fix the indication to perform a periareolar augmentation mastopexy for ptosis correction ,
the breast has to be tuberous at any level and to have an abnormally short inferior pole ( < 5 cm ) .
the above findings may explain the main complications from periareolar augmentation mastopexy with the standard surgical technique ( cranial migration , flattened shape , early formation of waterfall or cascade , widening of periareolar scars ) .
consequently , we decided to tackle the problem differently and began to perform periareolar augmentation mastopexy dealing with the cases as tuberous breasts .
our modified therapeutic plan was as following :
extra - glandular approach , practically subcutaneous , based on freeing all the skin from the glandular complex until the new submammary crease was reached , with minimal invasion of the skin in the belly area to avoid differences between gland and implant and the formation of a
double bubble [ figure 3].freeing of lateral and medial flaps of the gland allowing an adequate rise of the breast per se.gland dissection from the muscle to perform a dual plane type ii to allow an adequate gland rise , to let the gland drape freely over the implant.dissection of sub - muscular pocket.placement of an anatomical implant with maximum projection to create the most horizontal support plane to prevent
, maximum projection is achieved to prevent a truncated cone shape [ figures 46].skin closure of nipple - areola complex with unabsorbable suture ( as it resists mechanical stresses better ) , performing round block technique by freeing all the dermis from the skin to better drape the nipple - areola complex .
these new modifications result in a breast with wider space in the lower quadrants , which allow better adaptation of the implant and a pleasing shape to the breast .
the unpleasant tendency to upper migration is thus avoided [ figures 5 and 6 ] .
extra - glandular approach , practically subcutaneous , based on freeing all the skin from the glandular complex until the new submammary crease was reached , with minimal invasion of the skin in the belly area to avoid differences between gland and implant and the formation of a
freeing of lateral and medial flaps of the gland allowing an adequate rise of the breast per se .
gland dissection from the muscle to perform a dual plane type ii to allow an adequate gland rise , to let the gland drape freely over the implant .
placement of an anatomical implant with maximum projection to create the most horizontal support plane to prevent
, maximum projection is achieved to prevent a truncated cone shape [ figures 46 ] .
skin closure of nipple - areola complex with unabsorbable suture ( as it resists mechanical stresses better ) , performing round block technique by freeing all the dermis from the skin to better drape the nipple - areola complex .
these new modifications result in a breast with wider space in the lower quadrants , which allow better adaptation of the implant and a pleasing shape to the breast .
the unpleasant tendency to upper migration is thus avoided [ figures 5 and 6 ] .
extra - glandular approach , freeing all the skin from the glandular complex , reaching the new submammary crease , treating to invade the skin of upper abdomen as little as possible compare the different placements of the anatomical implants [ figures 4 and 6 ] .
figure 4 shows subglandular placement , which would facilitate breast ptosis as the breast matures , being the prosthesis in the lower part of the breast in
a is showed another incorrect placement of the anatomical implants : the subpectoral implantation at the same level as the gland , it would facilitate cranial migration of the prostheses with drop of the gland and waterfall effect , which can be seen in
b we recommend performing a dual plane type ii and the placement of an anatomical implant with maximum projection to create the most horizontal support plane for the gland , and to prevent truncated cone shape at the same time , high profile implants make possible a support plane that permits the satisfactory evolution of the breast over time and adequate projection . following this new surgical technique
we started a prospective observational study wherein , we included 56 patients who accomplished the former criteria for periareolar mastopexy but considered as tuberous breasts .
usually , to justify the indication for a periareolar mastopexy , the patient has to fulfil two basic criteria :
the nipple must lie below the level of the inframammary fold ( otherwise , merely an implant will solve the problem).the distance from the sternal notch to the nipple has to be lesser than or about 2324 cm ( if the distance is more than 2324 cm a mastopexy , with either a vertical scar or with an inverted - t technique is indicated ) .
the nipple must lie below the level of the inframammary fold ( otherwise , merely an implant will solve the problem ) .
the distance from the sternal notch to the nipple has to be lesser than or about 2324 cm ( if the distance is more than 2324 cm a mastopexy , with either a vertical scar or with an inverted - t technique is indicated ) .
the appearance of the ideal breast has an inferior pole ( distance from the nipple to inframammary fold ) of 57 cm and the distance from the sternal notch to the nipple is 1921 cm with the nipple lying above the level of the inframammary fold .
when there is an involution with a resulting ptosis , the nipple lies below the level of the inframammary fold , as shown in the diagram [ figure 2 ] .
involution with a resulting ptosis , where the nipple - areola complex goes beyond the submammary crease .
if the distance from nipple to submammary crease ( y , y ' ) is normal ( 68 cm ) , the sternal to nipple distance ( x , x ' ) will be higher than those 2324 cm established to perform a periareolar mastopexy if the inferior pole is normally constituted ( distance from nipple to inframammary fold : 57 cm minimum [ y , y ' ] ) , the distance from the sternal notch to the nipple ( x , x ' ) will obligatorily be higher than those 2324 cm established as a basic criteria to perform a periareolar mastopexy .
for a breast to meet the two requirements established above to undergo a periareolar mastopexy ( nipple located below the level of the inframammary fold and distance from sternal notch to nipple < 24 cm ) , it should necessarily have an abnormally short inferior pole , meaning that it would belong to the group of the so - called anomalies of the breast base , widely known as tuberous breasts .
from this criteria , the medical records and photographs of our patients having undergone a periareolar augmentation mastopexy were reviewed .
it was observed that they already had an abnormally short inferior pole when the pre - operative measures were taken .
checking the pre - operative measurements of these patients ( total amount 137 patients ) , 100% had an abnormally short inferior pole .
the average measurement obtained from these patients was 4.5 cm 0.2 standard deviation ( sd ) from areola to mammary crease , and none of them exceeded the minimum for a normal breast ( 5 cm ) .
to fix the indication to perform a periareolar augmentation mastopexy for ptosis correction , the breast has to be tuberous at any level and to have an abnormally short inferior pole ( < 5 cm ) .
the above findings may explain the main complications from periareolar augmentation mastopexy with the standard surgical technique ( cranial migration , flattened shape , early formation of waterfall or cascade , widening of periareolar scars ) .
consequently , we decided to tackle the problem differently and began to perform periareolar augmentation mastopexy dealing with the cases as tuberous breasts .
extra - glandular approach , practically subcutaneous , based on freeing all the skin from the glandular complex until the new submammary crease was reached , with minimal invasion of the skin in the belly area to avoid differences between gland and implant and the formation of a
double bubble [ figure 3].freeing of lateral and medial flaps of the gland allowing an adequate rise of the breast per se.gland dissection from the muscle to perform a dual plane type ii to allow an adequate gland rise , to let the gland drape freely over the implant.dissection of sub - muscular pocket.placement of an anatomical implant with maximum projection to create the most horizontal support plane to prevent waterfall effect . with this anatomical implant ,
maximum projection is achieved to prevent a truncated cone shape [ figures 46].skin closure of nipple - areola complex with unabsorbable suture ( as it resists mechanical stresses better ) , performing round block technique by freeing all the dermis from the skin to better drape the nipple - areola complex .
these new modifications result in a breast with wider space in the lower quadrants , which allow better adaptation of the implant and a pleasing shape to the breast .
the unpleasant tendency to upper migration is thus avoided [ figures 5 and 6 ] .
extra - glandular approach , practically subcutaneous , based on freeing all the skin from the glandular complex until the new submammary crease was reached , with minimal invasion of the skin in the belly area to avoid differences between gland and implant and the formation of a
freeing of lateral and medial flaps of the gland allowing an adequate rise of the breast per se .
gland dissection from the muscle to perform a dual plane type ii to allow an adequate gland rise , to let the gland drape freely over the implant .
placement of an anatomical implant with maximum projection to create the most horizontal support plane to prevent
skin closure of nipple - areola complex with unabsorbable suture ( as it resists mechanical stresses better ) , performing round block technique by freeing all the dermis from the skin to better drape the nipple - areola complex .
these new modifications result in a breast with wider space in the lower quadrants , which allow better adaptation of the implant and a pleasing shape to the breast .
the unpleasant tendency to upper migration is thus avoided [ figures 5 and 6 ] .
extra - glandular approach , freeing all the skin from the glandular complex , reaching the new submammary crease , treating to invade the skin of upper abdomen as little as possible compare the different placements of the anatomical implants [ figures 4 and 6 ] .
figure 4 shows subglandular placement , which would facilitate breast ptosis as the breast matures , being the prosthesis in the lower part of the breast in
a is showed another incorrect placement of the anatomical implants : the subpectoral implantation at the same level as the gland , it would facilitate cranial migration of the prostheses with drop of the gland and waterfall effect , which can be seen in
b we recommend performing a dual plane type ii and the placement of an anatomical implant with maximum projection to create the most horizontal support plane for the gland , and to prevent truncated cone shape at the same time , high profile implants make possible a support plane that permits the satisfactory evolution of the breast over time and adequate projection . following this new surgical technique we started a prospective observational study wherein , we included 56 patients who accomplished the former criteria for periareolar mastopexy but considered as tuberous breasts .
fifty - six periareolar augmentation mastopexies have been performed during the 3 years with this technique , from 2009 to 2012 [ figures 79 ] , with a minimum follow - up of 1 year .
the patients ' age ranged from 25 to 45 years ( on average 33.32 5.89 sd ) .
all the prostheses were high profiled ; the volume ranged from 170 cc to 420 cc ( average 288.39 79.91 sd ) , and the distance from the nipple to inframammary fold ranged from 4.00 to 5.00 ( on average 4.626 0.228 sd cm ) [ table 1 ] .
there was 1 case of wound infection ( 1.7% ) which settled with antibiotics , removal of sutures and immediate closure after refreshing the skin margins .
there was partial periareolar necrosis as well ( 1.7% ) in one heavy smoker , which needed debridement , advancing and delayed closure , without any major aesthetic sequelae [ table 2 ] .
pre- and post - operative photos of periareolar mastopexy procedure pre- and post - operative photos of periareolar mastopexy procedure pre- and post - operative photos of periareolar mastopexy procedure age , prosthesis volumen and distance nipple to inframammary fold in patients with the procedure of periareolar mastopexy considering breasts as tuberous acute and chronic complications recorded during 1 year follow up , in the group of 56 patients with periareolar mastopexy considering breasts as tuberous breasts regarding patients ' satisfaction , 40 of them ( 71.43% ) described the results as very positive ; 8 patients ( 14.29% ) stated that the results were moderately satisfying ; 6 patients ( 10.71% ) were equivocal and 2 of them ( 3.57% ) did not accept the results ( one of them because of waterfall effect after weight loss , the other patient because of widening of periareolar scars ) [ table 3 ] . both cases required surgical correction to convert a periareolar augmentation mastopexy into augmentation mastopexy with vertical scar. patients satisfaction survey results
tuberous breasts present skin and breast tissue deficiencies , especially in the lower quadrants . type i affects the inferomedial quadrant and type ii affects both lower quadrants .
the article published by deluca - pytell in galveston showed that the prevalence of the pathology affected more than 50% of women attending a plastic surgery clinic for a breast augmentation or mastopexy .
this frequency shows that this is a vast group , usually not diagnosed , camouflaged by the characteristics of the population requiring this surgery .
most of them are young women who have recently delivered , present a moderate ptosis and an involution of the gland , after breastfeeding .
moreover , they present most of the stigmata of tuberous breasts such as a certain level of areolar dysmorphia . when the breasts are measured , and the focus is on the inferior pole , all of them present an abnormally short lower segment as well .
when a patient comes to the surgeon for a regular tuberous breast treatment , a well - defined surgical plan ( pucket ) is devised for her .
why not follow the same procedure in those patients who demand periareolar augmentation mastopexy and present the described features ?
throughout the 3 years that our study has been undertaken , we have modified the therapeutic approach given the following empirical observation : if a periareolar mastopexy can be performed , then it must be a tuberous breast. from this , a new surgical technique has been developed obtaining an improvement in our surgical results , and we have achieved a different view on this pathology , which has not been reported in literature yet .
this clinical study was approved by the ethics committee of instituto de investigacin sanitaria del hospital universitario y politcnico la fe and has been performed in accordance with the ethical standards set forth in the 1964 declaration of helsinki and its later amendments .
this clinical study was approved by the ethics committee of instituto de investigacin sanitaria del hospital universitario y politcnico la fe and has been performed in accordance with the ethical standards set forth in the 1964 declaration of helsinki and its later amendments .
Output:
| background : periareolar augmentation mastopexy is one of the most demanded operations at plastic surgery clinics . nevertheless , it is one of the leads of malpractice claims in united states caused by the high patient expectations and the standard surgical techniques which may result in common complications .
the aim of this report is to present a new surgical approach to solve these complications.methods:after establishing a working hypothesis , we performed a revision study of our patients and we came to the following conclusion : in order to perform a periareolar mastopexy for ptosis correction , breast has to be tuberous at any level and to have abnormally short inferior pole .
these findings may explain the main complications from periareolar augmentation mastopexy with the standard surgical techniques .
consequently , we started a prospective observational study including 56 patients following a new surgical technique which deals the cases as tuberous breasts.results:during three years , fifty - six periareolar mastopexies were performed with this new surgical approach with one year follow - up .
no major complications were observed and 40 of the patients ( 71% ) described the results as very positive.conclusion:if a periareolar mastopexy can be performed , then it must be a tuberous breast . according to this ,
a new surgical technique for periareolar augmentation mastopexy has been developed obtaining an improvement in our surgical results and achieving a totally different view on this pathology , which has not been reported in literature yet . |
PubmedSumm118450 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: star fruit ( averrhoa carambola ) [ figure 1a and b ] , a member of oxalidaceae family , is popular in many tropical and subtropical countries , and its consumption is high in asia , central america , and tropical west africa . in india , it is recognized as kamrakh in hindi and kordoi in assamese .
the plant grows primarily in the northeast , the southern states and along the coast , extending from kerala up to west bengal .
it is a star shaped fruit with sweet and sour flavor . traditionally use for treating diabetes , fever and sooth eye infections , throat infections , cough , asthma , colic , diarrhea , food poisoning , and mouth ulcer .
dilation of renal tubules , interstitial edema , and an interstitial deposition of oxalate crystals ( d : h and e , 40 ) star fruit toxicity in patients with renal failure is well known .
these patients mainly presented as neurological involvement as hiccups , vomiting , mental confusion , seizures , coma , and even death .
individuals with normal renal function , who ingest star fruit in a large amount , main symptoms are intractable and persistent hiccups .
nephrotoxicity in these people is a rare event , and only few case reports publish worldwide . in this report , we present five patients with normal renal function who developed nephrotoxicity after eating star fruit or drinking star fruit juice .
all cases in our report had a history of ingesting star fruit and clinically presented as acute kidney injury ( aki ) .
baseline characteristics , the amount of star fruit ingested , clinical presentation and relevant investigation of all patients are summarized in table 1 .
two patients ( case 1 and 4 ) consumed fruit on an empty stomach and one patient ( case 2 ) after heavy work in hot weather .
patients became symptomatic after 1012 h ( except case 5 ) of eating star fruit .
the severity of renal failure was maximum in case 1 ( serum creatinine 23.7 mg / dl ) who ingested highest amount of star fruit [ table 1 ] .
there was severe interstitial edema along with inflammatory cell infiltration mainly mononuclear cell . in two patients ( case 2 and 3 ) , few irregular crystals were seen in the interstitium and within the tubular lumen [ figure 1c and d ] .
ripe fruits are golden yellow and sweet in taste while unripe fruits are lime green and taste sour , due to its high oxalate content as compared to sweet one . to the best of our knowledge
, there is no report published yet about star fruit induced renal failure from the indian subcontinent . though case reports are available on aki due to other fruits as irumban puli ( averrhoa bilimbi ) which belongs to the same oxalidaceae family as star fruit with high oxalate content .
, oxalate content of various preparations of star fruit is different [ table 2 ] .
ingesting star fruit in large amount can cause secondary oxalosis that presents as nephrocalcinosis , urolithiasis , and renal insufficiency .
oxalate content of star fruit from different preparations all patients ingested the fruit or its juice or both .
the presentation was gastrointestinal ( gi ) upset within hours after ingestion followed by aki , represented as decreased unit output in an otherwise healthy adult .
gi symptoms were not due to uremia as uremic symptom can not develop soon after ingestion and suggest direct corrosive injury of oxalate in the digestive tract .
the reason may be due to the difference in initial clinical presentation . in the present case report , patients mainly presented with gi and renal involvement as compared to previous case reports where the neurological symptom was more common as first clinical presentation .
all patients had a good outcome with complete recovery of their renal function though a long - term follow - up needed to rule out the risk of development of chronic kidney disease in future .
various experimental studies show that plant containing high oxalate content may cause nephrotoxicity in animals like rat . according to these studies , large
the mechanism by which tubular damage occurred is the obstruction of renal tubules by these crystals .
however , it was observed that tubular dilatation was much more extensive than the crystal deposition , especially in human cases and the focal tubular deposition of crystals were not compatible with the profound loss of glomerular filtration rates .
studies found that in addition to the obstructive effect of the crystals , the oxalate alone could act as a cellular toxin capable of producing acute cell damage by increasing apoptotic effect on the renal epithelial cell .
oxalate crystals were found in two biopsies , but severe aki changes were present in all patients .
those patients who ingest star fruit in a large amount , presents as severe aki , though we still do not know the maximum recommended safe amount of star fruit or juice .
consuming large amount of star fruit ( either fruit or juice ) , or even smaller amount on an empty stomach or in a dehydrated state ; should be recognized as a risk factor for star fruit toxicity .
in country like india where star fruit consumed routinely , physician should educate peoples even with normal renal function , not to ingest star fruit in large amount , especially empty stomach or in dehydrated state to avoid oxalate nephropathy .
Output:
| starfruit ( averrhoa carambola ) and its juice are popular in the indian subcontinent as an indigenous medicine .
oxalate concentration in this fruit and it 's freshly prepared juice is very high .
we present a report of patients presenting with acute kidney injury due to oxalate nephropathy admitted in a single center .
all patients had history of ingesting star fruit .
patients became symptomatic after 1012 h of eating and main symptoms were pain abdomen and decrease in urine output .
three patients needed hemodialysis .
all improved with complete renal recovery .
taking star fruit in large amount on an empty stomach and in a dehydrated state is a risk factor for nephrotoxicity . |
PubmedSumm118451 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: road - salt runoff poses an increasing threat to aquatic ecosystems that are influenced by urban land use and transportation corridors .
four broad issues suggest that road - salt runoff is a serious and increasing threat to the nation s receiving waters .
first , there is a multitude of historical evidence documenting detrimental effects of road salt on water chemistry and aquatic life .
studies have continued each decade since then , with more comprehensive evidence of water - quality impacts from road salt .
a small sampling of some representative topics studied includes specific water - quality impacts such as increased chloride and sodium concentrations , seasonality , climatic and land - use influence , vertical density gradients , and influence on sediment pore water , mixing and alteration of turnover in lakes ( 25 ) , and aquatic toxicity impacts ( 2,6,7 ) .
second , road salt usage in the united states has increased steadily beginning in the 1940s through the current decade ( 8,9 ) .
average annual salt sales in the united states for deicing purposes by decade beginning in 1940 were 0.28 ( 1940s ) , 1.1 ( 1950s ) , 4.1 ( 1960s ) , 8.7 ( 1970s ) , 8.8 ( 1980s ) , 13.0 ( 1990s ) , and 16.0 ( 20002008 ) million metric tons per year .
third , urban development is increasing each year ( 10 ) , which increases the amount of impervious area on which winter deicing operations are conducted .
this collective information suggests that the increasing road - salt usage trends of the previous seven decades will likely continue under current management conditions .
fourth , chloride , and to a large degree sodium , the two primary ions in road salt , remain in solution , making it difficult with present - day technology to design effective management practices for reduction of road - salt loadings to receiving waters after application .
currently , reduction in usage appears to be the only effective road - salt - runoff management strategy .
the objective of this study was to investigate the influence of road - salt runoff on surface water and aquatic organisms .
water - quality sampling was conducted on a local and regional scale . in the milwaukee metropolitan area ( local scale ) , streams were sampled for chloride , specific conductance , and aquatic toxicity to assess direct impact on aquatic organisms . in southern and eastern wisconsin ( regional scale ) , streams were monitored continuously for specific conductance , a surrogate for chloride , to assess potential impact on aquatic organisms . on a national scale , analysis of historical data was conducted for 17 metropolitan areas .
data were retrieved from the u.s . geological survey ( usgs ) national water information system ( nwis ) for chloride concentrations from streams sampled between 1969 and 2008 .
environmental protection agency ( usepa ) water - quality criteria and analyzed for seasonal differences .
twelve streams in the milwaukee metropolitan area and one reference stream north of milwaukee were sampled in february and march 2007 for determination of water chemistry and aquatic toxicity ( table 1 , figure 1 ) .
twelve of the streams had substantial urban land - use contribution and the reference stream had 80% natural areas and no urban land use ( parnell creek ) .
drainage areas of these streams ranged from 16.4 km ( 6.33 mi ) at willow creek to 1833 km ( 872 mi ) at the milwaukee river ( table 1 ) .
a 14th stream , wilson park creek , was monitored selectively from 1997 through 2007 during deicing periods .
sample results from these 14 streams include chloride concentrations , specific conductance values , and bioassays using pimephales promelas and ceriodaphnia dubia .
location of study sites in wisconsin and metropolitan areas in the united states used for aquatic toxicity evaluation from road salt .
eleven streams in southeast wisconsin were monitored using continuous specific conductance sensors with resulting data used as an indication of road - salt runoff ( table 1 , figure 1 ) .
these streams represent a gradient of land use with urban influence ranging from 6.0 to 100% .
individual water - quality samples for chloride in 17 major metropolitan areas around the country were retrieved from nwis , the u.s .
candidate streams were selected based on the latitude and longitude of the monitoring location and its proximity to major urban land - use areas .
streams ultimately chosen for this study included those that were sampled for chloride between 1969 and 2008 , had at least 12 samples in the cold - weather months ( november to april ) , 12 samples in the warm - weather months ( may to october ) , and a drainage area of less than 2600 km .
a total of 12 005 samples from 162 sites in the northern part of the united states and 2378 samples from 50 sites in the southern part of the united states ( south of st .
for the 13 milwaukee area streams , sampling periods were targeted at runoff events during road - salt application periods .
real - time specific conductance data from wilson park creek were used as an indicator of road salt in milwaukee area streams and used to initiate this sample collection .
water - quality samples were collected manually during the february 26 and march 7 , 2007 sampling periods .
samples were collected either by submerging sample bottles directly into the center of the channel for wadeable streams or by using a weighted - bottle sampler to collect cross - section integrated samples from a bridge for nonwadeable streams ( 11 ) .
comparison of the relation between chloride and specific conductance was used to assess potential bias in results .
all samples were within 10% of the resulting linear regression except those with chloride concentrations less than 230 mg / l , where chloride and sodium were a less dominant influence on specific conductance .
flow - weighted composite samples were collected at wilson park creek from 1997 through 2007 .
specific details of the sampling protocol used from this site have been previously published ( 12 ) .
weather data were retrieved from three nearby noaa weather stations ( general mitchell international airport , mount mary , and germantown ) . on february 24 , 25 , and 26 , 2007 ,
average snowfall was 16 , 15 , and 2 cm ( 0.9 , 1.7 , and 0.2 cm water equivalent ) , and maximum air temperatures were 0.5 , 2.8 , and 2.8 c , respectively .
on march 7 , there was an average of 5.7 cm of snow ( 0.4 cm water equivalent ) , and maximum air temperature of 0.5 c .
this was not enough snow to trigger general plowing ; however , salt was applied on paved surfaces to melt snow and ice .
salt application and temperatures greater than 0 c for both of these events resulted in runoff from impervious areas flowing to storm sewers and receiving streams .
measurements from continuously deployed specific conductance sensors were recorded at least every hour and as frequently as every 5 min depending on the individual site and specific hydrologic conditions .
instantaneous specific conductance was measured in the 13 milwaukee area streams at the time of the 2007 sampling periods .
all specific conductance sensors were maintained in accordance with standard usgs methods ( 13 ) .
chloride and toxicity tests were conducted at the wisconsin state laboratory of hygiene using well established methods that are presented in the supporting information .
toxicity was exhibited in samples from 7 of the 12 urban - influenced watersheds in the milwaukee metropolitan area that were collected during road - salt application periods in february and march , 2007 ( figure 2 ) .
adverse response in c. dubia tests occurred in samples with chloride concentrations of 1610 mg / l or greater .
adverse response in p. promelas tests occurred in samples with chloride concentrations of 2940 mg / l or greater .
the ic25 values ( the concentration at which there is 25% inhibition ) computed using measured chloride concentrations in these stream samples were 1050 mg /
chloride concentrations were elevated above the epa acute water - quality criteria concentration of 860 mg / l in eight of these samples and above the epa chronic water - quality criteria concentration of 230 mg / l ( 14 ) in 11 of these samples , indicating potential for aquatic toxicity effects . a sample collected at the rural reference site during the february sampling period had a chloride concentration of 20.4
chronic bioassay results in relation to chloride concentration in samples collected from 13 streams in the milwaukee , wi metropolitan area , februarymarch , 2007 : ( a ) c. dubia survival and mean young produced , and ( b ) p. promelas survival and mean weight .
specific conductance results from continuous monitoring in wilson park creek in milwaukee during 2007 indicate that conditions similar to the february and march 2007 sampling periods were common during the cold - weather period of 2007 ( figure 3 ) .
specific conductance in wilson park creek in milwaukee , wi during 2007 in reference to aquatic toxicity sampling periods ( triangles ) for 13 milwaukee area streams .
results from 37 samples collected from 1997 to 2007 at wilson park creek in milwaukee demonstrate long - term toxicity effects in numerous samples and a distinct relation to chloride concentration ( figure 4 ) .
concentrations at which chronic result effects were observed from this long - term sampling program were very similar to corresponding concentrations where chronic effects were observed from the 2007 sampling events in the milwaukee metropolitan area . in chronic c. dubia assays ,
mg / l or greater ( 43% of samples ) and complete mortality was observed at chloride concentrations of 2420 mg / l and greater ( 38% of samples ) .
initial toxic effects began between 600 and 1100 mg / l . mortality was observed in acute c. dubia assays for all samples with chloride concentrations greater than 1900 mg / l . in chronic p. promelas assays ,
reduced weight and survival was present when concentrations were 2920 mg / l or greater .
results for both of these organisms in chronic bioassays indicate scatter or uncertainty with lower chloride concentrations .
this could be due to variability in the actual test , confounding contaminants in urban runoff , or a combination of these factors .
it was difficult to determine the exact concentration at which road - salt effects began for chronic c. dubia assays due to this variability . in p. promelas
acute assays , only two samples were influenced with initial effects occurring between 4660 and 6290
bioassay results in relation to chloride concentration in samples collected from wilson park creek in milwaukee , wisconsin , 19972007 : ( a ) c. dubia survival and mean young produced in chronic bioassays , ( b ) p. promelas survival and mean weight in chronic bioassays , ( c ) c. dubia survival in acute bioassays , and ( d ) p. promelas survival in acute bioassays .
eleven streams in urban regions of wisconsin were monitored with continuous specific conductance sensors during cold- and warm - weather periods from 1998 to 2008 ( table 1 ) . between 1 and 10 years of data were available depending on the individual site .
linear regression was conducted from results of concurrent analysis of chloride and specific conductance in samples from these streams . to reduce negative bias in residuals when other ions influence this relation at low concentrations ( specific conductance < 1400 s / cm ) , data in the regression
this resulted in a slope of 0.374 and intercept of 328 ( r = 0.997 , supporting information figure s1 ) .
this regression is used for the remainder of this paper to provide chloride concentration estimates ( referred to as clest ) from measurement of specific conductance .
the maximum observed specific conductance in these streams increased with increasing urban land use ( figure 5 ) .
the maximum clest for seven of these sites exceeded the usepa acute water - quality criteria value of 860 mg / l .
mg / l at each of the 11 sites with a maximum clest of 289 mg / l for the least impacted stream .
maximum specific conductance compared to urban land - use percentage in 11 wisconsin streams with reference to u.s .
environmental protection agency water quality criteria for chloride ( 19 ) . the highest continuous specific conductance results at these eleven sites occurred during cold - weather months ( figure 6 ) .
the most dramatic impacts from road - salt runoff were observed in the two highly urban watersheds lincoln and wilson park creeks in milwaukee with specific conductance often exceeding 10 000 s / cm ( clest = 3410 mg / l ) and at times exceeding 20 000 s / cm ( clest = 7150 mg / l , figure 6a ) .
maximum monthly specific conductance at four sites with intermediate influence ranged between 3000 and 8000 s / cm ( figure 6b ) .
maximum monthly values at four sites with low influence were still substantially impacted by chloride in cold - weather months , but maximum monthly specific conductance was less than 3000 s / cm ( figure 6b ) .
although most of these watersheds were small to medium in size with a drainage area of 25280 km , the milwaukee river at milwaukee has a drainage area of 1800 km and still was impacted by road - salt runoff with a maximum specific conductance of 2850 s / cm . in all months , the average monthly maximum specific conductance was greatest in the sites with urban land use of 98% or greater , followed by those with 2669% urban land use , and least in sites with less than 26% urban land use ( table 1 , figure 6 ) .
monthly maximum specific conductance from continuous monitoring at 11 sites in wisconsin over a gradient of urban influence . in some cases , specific conductance decreased through the warm - weather months , reaching a minimum in october ( figure 6c ) .
specific conductance in the two highly urban watersheds decreased from may through october by 34% and 39% .
the average monthly maximum in these two streams was greater than 1200 s / cm throughout the entire year .
specific conductance data from oak creek ( 63% urban land use ) also decreased by 26% from may through october .
other sites either did not have sufficient data to evaluate warm - weather conditions or did not exhibit this effect .
usgs chloride sample results from streams near metropolitan areas were retrieved from 1969 to 2008 for assessment of potential road - salt influence throughout the country and to provide context for the more intensive wisconsin study results ( figure 7 ) .
the maximum number of sites per metropolitan area was 29 ( denver ) and the maximum number of samples per metropolitan area was 1690 ( cleveland ) .
comparison of chloride concentrations to chronic ( a ) and acute ( b ) usepa water - quality criteria for warm - weather months and cold - weather months in streams from northern and southern urban areas .
bars indicate the percent of sites for each metropolitan area that had at least one sample result greater than the water - quality criteria . a total of 898 samples were collected and analyzed for chloride at 21 monitoring locations within the milwaukee area .
results exceeded 230 mg / l chloride in at least one sample at 90% of monitoring sites during cold - weather months and 33% of monitoring sites during warm - weather months ( figure 7a ) .
similarly , 57% of these monitoring sites exceeded 860 mg / l chloride in at least one sample during cold - weather months , and none during warm - weather months ( figure 7b ) .
most northern metropolitan areas included in the analysis demonstrated the same pattern as the milwaukee area sites .
a total of 51% of all 168 northern monitoring locations had at least one sample with concentrations exceeding 230 mg /
l during cold - weather months and 15% exceeded that concentration during warm - weather months .
a total of 23% of northern monitoring locations had at least one sample with concentrations exceeding 860 mg / l during cold - weather months and 1% exceeded that concentration during warm - weather months .
ten of 13 metropolitan areas had more monitoring sites that had a chloride sample result exceeding 230 mg / l during cold - weather months than during warm - weather months . nine metropolitan areas had more monitoring sites with sample results that exceeded 860 mg / l during cold - weather months than during warm - weather months .
l during warm - weather months . at monitoring locations in the four southern metropolitan areas
, few samples exceeded the water - quality criteria concentrations and no common seasonal pattern was detected . only 2 and 4% of monitoring locations had samples exceeding 230 mg / l during warm- and cold - weather months , respectively ; samples from the southern sites did not exceed 860 mg / l .
several other southern metropolitan areas were analyzed but not included in this study because monitoring locations either had insufficient data or marine influence .
detrimental impacts from road - salt runoff to surface water presented in this study were evident on local , regional , and national scales .
the presented long- and short - term runoff sampling programs in wisconsin demonstrate a substantial effect from road salt on streamwater quality and aquatic life .
bioassay results from runoff events confirm that the observed high concentrations of road salt caused acute and chronic toxicity to aquatic organisms .
in addition , continuous specific conductance results indicate that elevated levels of road salt were present multiple times per year each year of monitoring .
populations of aquatic organisms in these streams and others with such road - salt influence are likely limited to salt - tolerant species .
effects on aquatic organisms have previously been demonstrated using a salt tolerance biotic index ( chloride contamination index , cci ) in toronto area streams ( 15 ) . when compared to a review published by environment canada including laboratory and field assessments of road salt impact on aquatic species , concentrations observed in the present research indicate that detrimental effects would be present over numerous taxa in addition to the organisms used in this study ( 7 ) .
this review of road salt effects concluded that high concentrations may have immediate or long - term ecosystem population effects , and that lower levels of increased chloride concentrations may affect community structure , diversity , and productivity ( 7 ) .
results from continuous specific conductance monitoring in lincoln and wilson park creeks in milwaukee indicate that elevated levels of chloride in these streams were common for extended periods of time , even through the summer months .
similar to results from lincoln and wilson park creeks in milwaukee , study of groundwater influence on stream chemistry in massachusetts confirmed that chloride from highway - deicing applications persisted throughout the year as a source of contamination in groundwater , interflow , and streamwater even during warm - weather months ( 16 ) .
the analysis of historical chloride data from urban areas around the country indicated potential for considerable and widespread impact from road salt on surface water quality and aquatic life . despite the limitation that sample results from these selected areas were from numerous studies
not necessarily designed to capture periods of road - salt runoff , the influence of road salt was clear . streams with urban influence throughout the country in areas where road salt is applied are at risk for substantial contamination and detrimental effect on aquatic life .
impacts of road salt are present in other geographic regions that commonly apply these deicers as well .
for instance , in a study of urban streams in finland , chloride concentrations during road - salt runoff periods varied over 9-fold within one day with nacl concentrations from weekly composite samples observed as high as 567 mg / l ( 17 ) .
salinity in these streams increased in direct proportion to accumulated application of road salt ( 18 ) .
research on the influence of urban land use on aquatic life in streams has identified a level of 712% impervious surface where decreases in biological integrity were observed ( 1921 ) .
much work investigating aquatic life degradation has focused on ambient water chemistry , habitat , and other physical , hydrologic , and hydraulic factors ( 22 ) .
the relation of chloride concentrations and specific conductance with urban land use shown in this study and a recent study of the northern united states ( 23 ) indicates that road - salt runoff and other anthropogenic uses of chloride are important factors in the biological integrity of urban streams in the northern united states .
although chloride sampling has been included in previous evaluations of urban streamwater quality ( 21 ) , water - quality sampling did not specifically focus on periods of winter runoff and may not fully represent the severity of road - salt influence . to better understand the relation between urban land use and stream biology , focused monitoring
would be needed to characterize the range of chloride concentrations and duration of road - salt influence in streams during deicing periods . however , because of the episodic nature of road - salt runoff , the full range of in - stream road - salt influence is difficult to characterize without use of continuous- and event - based monitoring focusing on deicing periods .
a periodic or fixed - interval sampling plan will not fully characterize road - salt influence except by happenstance . environmental management or mitigation of this issue
solutions would require consideration of environmental , political , economic , and safety issues . added to this complexity is the diversity of applicators in urban areas .
city maintenance crews de - ice roadways , public parking lots , and sidewalks while a host of private applicators de - ice commercial , institutional , and industrial areas , and homeowners apply de - icers to residential driveways and sidewalks .
for example , use of organic salts such as calcium magnesium acetate would reduce chloride loading , but may increase biochemical oxygen demand thereby increasing potential for oxygen depletion in receiving waters .
greater aquatic toxicity and water - quality impacts seem likely if increasing trends in road - salt usage and expanding urban development continue .
regardless of methods chosen , reducing the impact of road salt on the environment would take a substantial and sustained effort coupled with consideration of numerous interconnected factors .
Output:
| a new perspective on the severity of aquatic toxicity impact of road salt was gained by a focused research effort directed at winter runoff periods .
dramatic impacts were observed on local , regional , and national scales .
locally , samples from 7 of 13 milwaukee , wisconsin area streams exhibited toxicity in ceriodaphnia dubia and pimephales promelas bioassays during road - salt runoff . another milwaukee stream was sampled from 1996 to 2008 with 72% of 37 samples exhibiting toxicity in chronic bioassays and 43% in acute bioassays .
the maximum chloride concentration was 7730 mg / l .
regionally , in southeast wisconsin , continuous specific conductance was monitored as a chloride surrogate in 11 watersheds with urban land use from 6.0 to 100% .
elevated specific conductance was observed between november and april at all sites , with continuing effects between may and october at sites with the highest specific conductance .
specific conductance was measured as high as 30 800 s / cm ( cl = 11 200 mg / l ) .
chloride concentrations exceeded u.s .
environmental protection agency ( usepa ) acute ( 860 mg / l ) and chronic ( 230 mg / l ) water - quality criteria at 55 and 100% of monitored sites , respectively .
nationally , u.s . geological survey historical data were examined for 13 northern and 4 southern metropolitan areas .
chloride concentrations exceeded usepa water - quality criteria at 55% ( chronic ) and 25% ( acute ) of the 168 monitoring locations in northern metropolitan areas from november to april .
only 16% ( chronic ) and 1% ( acute ) of sites exceeded criteria from may to october . at southern sites , very few samples exceeded chronic water - quality criteria , and no samples exceeded acute criteria . |
PubmedSumm118452 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| a new and general
strategy for the synthesis of sequence - defined
polymers is described that employs relay metathesis to promote the
ring opening polymerization of unstrained macrocyclic structures .
central to this approach is the development of a small molecule
polymerization
trigger which when coupled with a diverse range of sequence - defined
units allows for the controlled , directional synthesis of sequence
controlled polymers . |
PubmedSumm118453 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the online version of this article ( doi:10.1007/s40266 - 016 - 0408 - 8 ) contains supplementary material , which is available to authorized users .
prescriptions classed as inappropriate on the basis of impaired renal function is prevalent among older people with cognitive impairment and dementia.impaired renal function is common among older people with cognitive impairment and dementia.continuous estimation of renal function is important in this group .
ageing populations are characterised by an increased proportion of older people [ 1 , 2 ] . in older populations , chronic diseases , including dementia and mild cognitive impairment , and comorbidity are common [ 2 , 3 ] .
this situation is of particular concern as older people are more sensitive to drugs and adverse drug reactions ( adrs ) than younger individuals [ 2 , 4 ] .
the changes in neurotransmitter substances that occur in people with dementia make this patient group especially vulnerable to the effects of drugs , including adrs [ 1 , 2 , 5 ] .
age - related physiological changes affect the pharmacokinetic parameters of a drug , and the elimination of drugs is particularly affected by impairment of renal function [ 1 , 2 ] .
renal mass declines with age as do the number and size of nephrons , and this process results in reduced glomerular and tubular filtration
. chronic kidney disease ( ckd ) , defined as estimated glomerular filtration rate ( egfr ) < 60 ml / min , is a common and growing problem in older populations [ 68 ] .
renally excreted drugs with narrow therapeutic indices , such as digoxin and lithium , can accumulate and concentrations can become toxic .
drugs such as morphine and glibenclamide that have active metabolites may cause adrs [ 10 , 11 ] .
estimation of renal function is thus important when prescribing renally excreted drugs to older people to avoid inappropriate prescribing , which is defined as a situation where risk from the adverse effects of a prescribed medication outweighs the desired clinical benefits of treating a particular condition .
the use of serum creatinine level alone as a measure of renal function is not reliable because creatinine production , which is dependent on muscle mass , decreases with age ; thus , the use of serum creatinine level alone leads to overestimation of renal function [ 1 , 6 ] .
two commonly used methods for calculating egfr on the basis of serum creatinine level are the cockcroft
gault ( cg ) equation and the chronic kidney disease epidemiology collaboration ( ckd - epi ) equation [ 2 , 13 ] .
most recommendations published in dosage handbooks are based on renal function estimated by the cg equation [ 2 , 6 ] .
the ckd - epi equation calculates the relative egfr ( ml / min/1.73 m ) and is used to detect and characterise ckd [ 1315 ] .
estimates of renal function obtained via creatinine - based equations are less accurate in certain patients such as those who are malnourished , amputees and the morbidly obese [ 2 , 12 ] .
debate concerning the most suitable equation for calculating egfr is ongoing [ 6 , 13 , 16 , 17 ] . as people with dementia
are particularly vulnerable to drugs , evaluation of whether medications need to be adjusted according to renal function is especially important in this group .
several studies have evaluated older people s prescriptions in relation to their renal function [ 4 , 6 , 8 , 16 , 1822 ] . to our knowledge , no similar study has been conducted among people with dementia or cognitive impairment .
the purpose of this study was to estimate the prevalence of impaired renal function and inappropriate prescription of renally cleared medications among older people , aged 65 years , with dementia or cognitive impairment .
this cross - sectional study used data collected in a randomised controlled intervention study conducted in two hospitals in northern sweden .
the purpose of the intervention was to investigate whether drug - related readmissions were reduced when clinical pharmacists conducted medication reviews as part of ward teams .
patients admitted to the acute internal medicine or orthopaedic ward at norrland university hospital and to a medical ward at the county hospital in skellefte were recruited between 9 january 2012 and 2 december 2014 .
the most common reasons for admission were fractures / falls , heart failure or pneumonia .
patients were considered to have cognitive impairment if sufficient information related to memory , orientation or executive function was noted in their medical records prior to the index hospitalization .
in addition , patients in whom dementia was suspected and medical investigation had been or would be commenced were included . ambiguous or uncertain cases were excluded . the procedure described was chosen to avoid the risk of including people without dementia who had developed a delirious or confused state during the hospital stay ( gustafsson m et al . , 2016 , unpublished observations ) .
each patient in the intervention group received an additional medication review by a clinical pharmacist , while the control group received standard care .
data for the present study were gathered from the intervention study , with the patients assigned to the intervention and control groups treated as a single study sample .
people who died ( n = 31 ) or withdrew from the intervention study ( n = 1 ) before discharge from the index hospitalization were excluded , resulting in a final sample of 428 people .
data about the patients medications were extracted from the medical records at the time of the patients index hospitalization , before any medication review was performed .
the geriatric dosage handbook ( gdh ) was used to identify renally cleared medications from among all prescribed drugs to obtain internationally applicable results .
doses , strengths and drug formulations were noted for every drug at the individual patient level .
pro re nata medications , over - the - counter medications and formulations designed for local administration were not included in the analysis .
the gdh guidelines were used to evaluate whether prescriptions were inappropriate relative to patients renal function .
another guideline was used for morphine prescriptions as the gdh guideline was considered unclear for this specific drug . moreover ,
mirabegron prescriptions were evaluated according to another guideline because the gdh did not include guidelines regarding this drug .
angiotensin - converting enzyme inhibitors were excluded because of the large pharmacodynamic variations and because these drugs are monitored after clinical response .
digoxin and dalteparin were excluded , as consideration of serum concentrations and therapeutic responses to these drugs is important [ 23 , 26 ] .
inappropriate prescriptions were classified as representing excessive doses ( more than the maximum daily dosage ) or contraindications for patients with renal impairment according to previous research [ 4 , 6 , 19 ] . prescriptions not requiring dosage adjustment were classified as having appropriate doses relative to renal function .
renal function was considered to be impaired in stages 35 ( i.e. egfr < 60 ml / min[/1.73 m]).table 1classification of the different stages of chronic kidney disease based on glomerular filtration rate stagephysiologic changegfr ( ml / min/1.73 m)at increased risk for ckd90 with risk factors1ckd with normal or increased kidney function902ckd with mild impairment of kidney function60893moderate impairment of kidney function30594severe impairment of kidney function15295terminal renal failure<15
ckd chronic kidney disease , gfr glomerular filtration rate
classification of the different stages of chronic kidney disease based on glomerular filtration rate
ckd chronic kidney disease , gfr glomerular filtration rate the cg equation , shown in table s1 of the electronic supplementary material ( esm ) , was used to calculate the egfr ( egfrcg ) to estimate the prevalence of impaired renal function and inappropriate prescription . to compare the frequencies of patients at different ckd stages using different estimation methods ,
the relative egfr was calculated using the ckd - epi equation , and the absolute egfr was calculated from the relative egfr values ( equations shown in esm table s1 ) .
data were collected on the date of randomisation , which was usually within 2 days ( maximum 22 days ) of admission date .
we recorded patients age , sex , serum creatinine level , weight ( actual ) and height as well as the type of dementia , classified as alzheimer s disease , vascular dementia or other or unspecified ( uns ) dementia .
frequencies and proportions were calculated for dichotomous variables , and continuous variables are presented as mean values with standard deviations .
simple logistic regression analyses were conducted to investigate the association between impaired renal function and factors extracted from the medical record : age , sex , living situation and mmse score .
a multiple logistic regression analysis was conducted including all variables from the simple models except mmse score because of the large proportion of missing values and the absence of any differences found on univariate analysis . further
, simple logistic regression analyses were conducted to investigate the association between inappropriate prescription and factors extracted from the medical record ( age , sex , living situation and mmse score ) .
a multiple logistic regression analysis was conducted including all variables from the simple models except mmse score because of a large proportion of missing values and the absence of any differences found on univariate analysis .
results are presented as odds ratios ( ors ) with 95 % confidence intervals ( cis ) .
all analyses were conducted using ibm spss statistics 22 ( somers , ny , usa ) .
this cross - sectional study used data collected in a randomised controlled intervention study conducted in two hospitals in northern sweden .
the purpose of the intervention was to investigate whether drug - related readmissions were reduced when clinical pharmacists conducted medication reviews as part of ward teams .
patients admitted to the acute internal medicine or orthopaedic ward at norrland university hospital and to a medical ward at the county hospital in skellefte were recruited between 9 january 2012 and 2 december 2014 .
the most common reasons for admission were fractures / falls , heart failure or pneumonia .
patients were considered to have cognitive impairment if sufficient information related to memory , orientation or executive function was noted in their medical records prior to the index hospitalization .
in addition , patients in whom dementia was suspected and medical investigation had been or would be commenced were included . ambiguous or uncertain cases were excluded . the procedure described was chosen to avoid the risk of including people without dementia who had developed a delirious or confused state during the hospital stay ( gustafsson m et al . , 2016 , unpublished observations ) .
each patient in the intervention group received an additional medication review by a clinical pharmacist , while the control group received standard care .
data for the present study were gathered from the intervention study , with the patients assigned to the intervention and control groups treated as a single study sample .
people who died ( n = 31 ) or withdrew from the intervention study ( n = 1 ) before discharge from the index hospitalization were excluded , resulting in a final sample of 428 people .
data about the patients medications were extracted from the medical records at the time of the patients index hospitalization , before any medication review was performed .
the geriatric dosage handbook ( gdh ) was used to identify renally cleared medications from among all prescribed drugs to obtain internationally applicable results .
doses , strengths and drug formulations were noted for every drug at the individual patient level .
pro re nata medications , over - the - counter medications and formulations designed for local administration were not included in the analysis .
the gdh guidelines were used to evaluate whether prescriptions were inappropriate relative to patients renal function .
another guideline was used for morphine prescriptions as the gdh guideline was considered unclear for this specific drug .
moreover , mirabegron prescriptions were evaluated according to another guideline because the gdh did not include guidelines regarding this drug .
angiotensin - converting enzyme inhibitors were excluded because of the large pharmacodynamic variations and because these drugs are monitored after clinical response .
digoxin and dalteparin were excluded , as consideration of serum concentrations and therapeutic responses to these drugs is important [ 23 , 26 ] .
inappropriate prescriptions were classified as representing excessive doses ( more than the maximum daily dosage ) or contraindications for patients with renal impairment according to previous research [ 4 , 6 , 19 ] . prescriptions not requiring dosage adjustment were classified as having appropriate doses relative to renal function .
( i.e. egfr < 60 ml / min[/1.73 m]).table 1classification of the different stages of chronic kidney disease based on glomerular filtration rate stagephysiologic changegfr ( ml / min/1.73 m)at increased risk for ckd90 with risk factors1ckd with normal or increased kidney function902ckd with mild impairment of kidney function60893moderate impairment of kidney function30594severe impairment of kidney function15295terminal renal failure<15
ckd chronic kidney disease , gfr glomerular filtration rate
classification of the different stages of chronic kidney disease based on glomerular filtration rate
ckd chronic kidney disease , gfr glomerular filtration rate the cg equation , shown in table s1 of the electronic supplementary material ( esm ) , was used to calculate the egfr ( egfrcg ) to estimate the prevalence of impaired renal function and inappropriate prescription . to compare the frequencies of patients at different ckd stages using different estimation methods ,
the relative egfr was calculated using the ckd - epi equation , and the absolute egfr was calculated from the relative egfr values ( equations shown in esm table s1 ) .
data were collected on the date of randomisation , which was usually within 2 days ( maximum 22 days ) of admission date .
we recorded patients age , sex , serum creatinine level , weight ( actual ) and height as well as the type of dementia , classified as alzheimer s disease , vascular dementia or other or unspecified ( uns ) dementia .
frequencies and proportions were calculated for dichotomous variables , and continuous variables are presented as mean values with standard deviations .
simple logistic regression analyses were conducted to investigate the association between impaired renal function and factors extracted from the medical record : age , sex , living situation and mmse score .
a multiple logistic regression analysis was conducted including all variables from the simple models except mmse score because of the large proportion of missing values and the absence of any differences found on univariate analysis .
further , simple logistic regression analyses were conducted to investigate the association between inappropriate prescription and factors extracted from the medical record ( age , sex , living situation and mmse score ) .
a multiple logistic regression analysis was conducted including all variables from the simple models except mmse score because of a large proportion of missing values and the absence of any differences found on univariate analysis .
results are presented as odds ratios ( ors ) with 95 % confidence intervals ( cis ) .
all analyses were conducted using ibm spss statistics 22 ( somers , ny , usa ) .
of the 428 people included in the study , 270 ( 63.1 % ) were women ; the mean age was 83.2 6.6 years . the mean standard deviation ( sd ) serum creatinine level was 89.0 39.7
the mean egfr , calculated using the cg equation , was 55.3 22.6 ml / min .
the absolute and relative egfrs using the ckd - epi equation were 64.8 22.0 ml / min and 64.6 21.1 ml / min/1.73 m , respectively .
the most common type of cognitive impairment was other or uns dementia ( n = 225 [ 52.6 % ] ) , and the majority of patients ( n = 304 [ 71.0 % ] ) lived at home ( table 2).table 2descriptive statistics of the study samplecharacteristics of study sample cases ( n)428 women270 ( 63.1 ) age ( years)83.2 6.6 ( 6599 ) weight ( kg)68.2 15.4 ( 32.8130.0 ) bmi ( kg / m)25.1 4.9 ( 13.346.6 ) number of medications at admission7.8 3.5 ( 020)renal function cs , cr ( mol / l)89.0 39.7 ( 28.0311.0 ) egfrcg ( ml / min)55.3 22.6 ( 12.8144.3 ) egfrckd - epi
( ml / min)64.8 22.0 ( 11.3126.2 ) egfrckd - epi ( ml / min/1.73 m)64.6 21.1 ( 11.8115.2)mmse ( 030)19.8 4.6 ( 729)type of dementia alzheimer s disease131 ( 30.6 ) vascular dementia72 ( 16.8 ) other or uns dementia225 ( 52.6)living situation living at home304 ( 71.0 ) nursing home124 ( 29.0)data are presented as frequencies , n ( % ) or mean standard deviation ( range ) unless otherwise indicated
bmi body mass index , c
s , cr serum creatinine concentration , egfr
cg estimated glomerular filtration rate using the cockcroft
gault equation , egfr
ckd - epi estimated gfr using chronic kidney disease epidemiology collaboration equation , mmse mini - mental state examination , uns unspecified
n = 422 due to lack of height data when calculating the bmi and absolute egfr
n = 155 because the test was not performed in every patient
descriptive statistics of the study sample data are presented as frequencies , n ( % ) or mean standard deviation ( range ) unless otherwise indicated
bmi body mass index , c
s , cr serum creatinine concentration , egfr
cg estimated glomerular filtration rate using the cockcroft
gault equation , egfr
ckd - epi estimated gfr using chronic kidney disease epidemiology collaboration equation , mmse mini - mental state examination , uns unspecified
n = 422 due to lack of height data when calculating the bmi and absolute egfr
n = 155 because the test was not performed in every patient the distribution of the five ckd stages in the study sample is presented in table 3 . according to the absolute egfr calculated using the ckd - epi equation , 173 ( 41.0 % ) patients
were estimated to have ckd stages 35 ( i.e. egfr < 60 ml / min ) .
calculation of the relative egfr indicated that 173 ( 40.4 % ) patients had egfrs < 60 ml / min/1.73 m. according to the cg equation , 280 ( 65.4 % ) patients were estimated to have impaired renal function ( i.e. egfr < 60 ml / min ) .
impaired renal function was more common among women ( or 2.046 [ 95 % ci 1.3583.082 ] ) and in older patients ( or 1.204 [ 95 % ci 1.1541.256 ] ) .
there were no significant differences between people with and without impaired renal function in relation to living situation or mmse score . in a multivariable model in which impaired renal function was the dependent variable and sex , age and living situation were independent variables , age remained significant ( or 1.203 [ 95 % ci 1.1521.257 ] ) ( table 4).table 3frequency of patients at different chronic kidney disease stages using the ckd - epi equation as the renal function estimation methodckd stageckd - epi
ckd - epi
156 ( 13.3)42 ( 9.8)2193 ( 45.7)213 ( 49.8)3148 ( 35.1)149 ( 34.8)423 ( 5.5)23 ( 5.4)52 ( 0.5)1 ( 0.2)total422 ( 98.6)428 ( 100)data are presented as n ( % )
ckd chronic kidney disease , ckd - epi chronic kidney disease epidemiology collaboration equation
absolute value ( ml / min )
relative value ( ml / min/1.73 m )
table 4comparison between patients with an egfrcg > 60 and < 60 ml / min in the total samplepatient characteristicsegfrcg > 60 ml / min ( n = 148)egfrcg < 60 ml / min ( n = 280)simple ormultiple orsex men71 ( 48.0)87 ( 31.1)reference women77 ( 52.0)193 ( 68.9)2.046 ( 1.3583.082)1.502 ( 0.9412.398)age ( years)78.9 6.485.4 5.51.204 ( 1.1541.256)1.203 ( 1.1521.257)living situation living at home105 ( 70.9)199 ( 71.1)reference nursing home43 ( 29.1)81 ( 28.9)0.994 ( 0.6411.542)0.687 ( 0.4101.151)mmse ( 030)20.2 5.119.6 4.30.970 ( 0.9001.046)data are presented as n ( % ) or mean standard deviation or odds ratio ( 95 % confidence interval ) .
mmse is not included in the model because of the small number of values obtained ( n = 155 ) , and the lack of a significant difference between the groups
egfr
cg estimated glomerular filtration rate using cockcroft gault equation , mmse mini - mental state examination , or odds ratio
frequency of patients at different chronic kidney disease stages using the ckd - epi equation as the renal function estimation method data are presented as n ( % )
ckd chronic kidney disease , ckd - epi chronic kidney disease epidemiology collaboration equation
absolute value ( ml / min )
relative value ( ml / min/1.73
m ) comparison between patients with an egfrcg > 60 and < 60 ml / min in the total sample data are presented as n ( % ) or mean standard deviation or odds ratio ( 95 % confidence interval ) .
mmse is not included in the model because of the small number of values obtained ( n = 155 ) , and the lack of a significant difference between the groups
egfr
cg estimated glomerular filtration rate using cockcroft gault equation , mmse mini - mental state examination , or odds ratio of the drugs prescribed to the 428 patients , 58 were classified as renally cleared medications ; 547 prescriptions of these 58 drugs were recorded ( table 5 ) . of these 547 prescriptions , 50 ( 9.1 % ) were classified as inappropriate and 497 prescriptions ( 90.9 % ) were considered appropriate on the basis of the patient s renal function . when absolute and relative egfr were calculated according to the ckd - epi equation ,
the corresponding prevalences of inappropriate prescriptions were 28 ( 5.1 % ) and 32 ( 5.9 % ) , respectively .
inappropriate prescriptions were found for 20 ( 34.5 % ) of the 58 identified drugs .
of the 50 inappropriate prescriptions , 17 were for doses that were too high and 33 were for contraindicated drugs ; these constituted 3.1 % ( 17/547 ) and 6.0 % ( 33/547 ) , respectively , of all identified prescriptions .
eight ( 47.1 % ) prescriptions with excessive doses were for allopurinol and 12 ( 36.4 % ) contraindicated prescriptions were for metformin ( table 5).table 5renally cleared medications , together with dose recommendations , and frequency , n ( % ) , of total and inappropriate prescriptions for each identified drug drug / gdh dosage recommendationtotal prescriptionstoo high dosecontraindicated prescriptionstotal inappropriate prescriptionsacamprosate1 ( 0.2) clcr < 30 ml / min : contraindicatedacetylsalicylic acid152 ( 27.8) clcr < 10 ml / min : contraindicatedalendronate15 ( 2.7)2 ( 6.1)2 ( 4.0 ) clcr < 35 ml / min : contraindicatedalfuzosin20 ( 3.7)1 ( 3.0)1 ( 2.0 ) clcr < 30 ml / min : contraindicatedallopurinol21 ( 3.8)8 ( 47.1)8 ( 16.0 ) clcr > 140 ml / min : 400 mg / day clcr 121140 ml / min : 350 mg / day clcr 101120 ml / min : 300 mg / day clcr 81100 ml / min : 250 mg / day clcr 6180 ml / min : 200 mg / day clcr 4160 ml / min : 150 mg / day clcr 2140 ml / min : 100 mg / day clcr 1120 ml / min : 100 mg every 2nd day clcr 10 ml / min : 100 mg every 3rd dayamiloride5 ( 0.9) clcr 1050 ml / min : 20 mg / day clcr < 10 ml / min : contraindicatedamoxicillin7 ( 1.3)1 ( 5.9)1 ( 2.0 ) clcr 1030 ml / min : 1000 mg / day clcr < 10 ml / min : 500 mg / dayampicillin1 ( 0.2)1 ( 5.9)1 ( 2.0 ) clcr 10 ml / min : 2000 mg / day clcr < 10 ml / min : 1000 mg / dayatenolol10 ( 1.8) clcr 1535
ml / min : 50 mg / day clcr < 15 ml / min : 50 mg every 2nd dayazathioprine2 ( 0.4) clcr 1050 ml / min : 75 % of 3 mg / kg / day clcr < 10 ml / min : 50 % of 3 mg / kg / daybendroflumethiazide19 ( 3.5)1 ( 3.0)1 ( 2.0 ) clcr < 30 ml / min : contraindicatedcefadroxil1 ( 0.2) clcr 1025 ml / min : 1000 mg / day clcr < 10 ml / min : 1000 mg every 36th hcefotaxime9 ( 1.6)1 ( 5.9)1 ( 2.0 ) clcr 1030 ml / min : 2000 mg / day clcr < 10 ml / min : 2000 mg every 2nd daycetirizine2 ( 0.4)1 ( 5.9)1 ( 2.0 ) clcr 1131 ml / min : 5 mg / day clcr < 11 ml / min : contraindicatedciprofloxacin4 ( 0.7)1 ( 5.9)1 ( 2.0 ) clcr 3050 ml / min : 1000 mg / day clcr 529 ml / min : 500 mg every 18th hcodeine5 ( 0.9) clcr 1050 ml / min : er 450 mg / day , ir 360 mg / day clcr
< 10 ml / min : er 300 mg / day , ir 240 mg / daydabigatran2 ( 0.4) clcr < 30 ml / min : contraindicateddiclofenac1 ( 0.2) clcr
< 30 ml / min : contraindicateddihydroergotamine2 ( 0.4) clcr 29 ml / min : contraindicatedfesoterodine1 ( 0.2) clcr < 30 ml / min : 4 mg / dayfluconazole2 ( 0.4) clcr
< 50 ml / min : 400 mg / dayfondaparinux2 ( 0.4) clcr < 30 ml / min : contraindicatedgabapentin12 ( 2.2) clcr 60 ml / min : 3600 mg / day clcr 3059 ml / min : 1400 mg / day clcr 1629 ml / min : 700 mg / day clcr 15 ml / min : 300 mg / day clcr
< 15 ml / min : reduce daily dose ( from 300 mg ) in proportion to clcr
galantamine28 ( 5.1)1 ( 5.9)1 ( 2.0 ) clcr 1059 ml / min : 16 mg / day clcr < 9 ml / min : contraindicatedglibenclamide8 ( 1.5)2 ( 6.0)2 ( 4.0 ) clcr < 50 ml / min : contraindicatedglipizide7 ( 1.3) clcr < 10 ml / min : contraindicatedhydralazine1 ( 0.2) clcr 1050 ml / min : 225 mg / dayhydrochlorothiazide17 ( 3.1)2 ( 6.1)2 ( 4.0 ) clcr < 30 ml / min : contraindicatedibuprofen1 ( 0.2) clcr < 30 ml / min : contraindicatedketoprofen2 ( 0.4)1 ( 5.9)1 ( 2.0 ) clcr 2589 ml / min : 150 mg / day clcr < 25 ml / min : 100 mg / daylevetiracetam2 ( 0.4) clcr > 80 ml / min : 3000 mg / day clcr 5080 ml / min : 2000 mg / day clcr 3049 ml / min : 1500 mg / day clcr < 30 ml / min : 1000 mg / daylithium2 ( 0.4) clcr 1050 ml / min : 1800 mg / day clcr < 10 ml / min : 1200 mg / daymemantine25 ( 4.6)2 ( 11.8)2 ( 4.0 ) clcr 529 ml / min : 10 mg / daymethenamine1 ( 0.2) clcr <
50 ml / min : contraindicatedmetformin34 ( 6.2)12 ( 36.4)12 ( 24.0 ) clcr < 60 ml / min : contraindicatedmethotrexate4 ( 0.7) clcr < 10 ml / min : contraindicatedmetoclopramide3 ( 0.5) clcr < 40 ml / min : 30 mg / daymirabegron3 ( 0.5) clcr < 15 ml / min : contraindicatedmorphine40 ( 7.3)5 ( 15.2)5 ( 10.0 ) clcr < 30 ml / min : contraindicatednaproxen1 ( 0.2) clcr < 30 ml / min : contraindicatednitrofurantoin5 ( 0.9)3 ( 9.1)3 ( 6.0 ) clcr < 60 ml / min : contraindicatednorfloxacin1 ( 0.2) clcr 30 ml / min : 400 mg / daypiperacillin / tazobactam1 ( 0.2) clcr 2040 ml / min : 8000/1000 mg / day clcr < 20 ml / min : 6000/750 mg / daypramipexole3 ( 0.5) er formulations : clcr 3050 ml / min : 2.25 mg / day clcr < 30 ml / min : contraindicated ir formulations : clcr 3050 ml / min : 2.25 mg / day clcr 1529 ml / min : 1.5 mg / day clcr < 15 ml / min : contraindicatedpregabalin5 ( 0.9) clcr 60 ml / min : 600 mg / day clcr 3059 ml / min : 300 mg / day clcr 1529 ml / min : 150 mg / day clcr < 15 ml / min : 75 mg / dayraloxifene1 ( 0.2)1 ( 3.0)1 ( 2.0 ) clcr < 59 ml / min : contraindicatedranitidine1 ( 0.2) clcr < 50 ml / min : 150 mg / dayrisedronate2 ( 0.4) clcr < 30 ml / min : contraindicatedrosuvastatin1 ( 0.2) clcr < 30 ml / min : 10 mg / daysaxagliptin1 ( 0.2) clcr 50 ml / min : 2.5 mg / daysolifenacin6 ( 1.1) clcr < 30 ml / min : 5 mg / dayspironolactone27 ( 4.9)3 ( 9.1)3 ( 6.0 ) clcr < 30 ml / min : contraindicatedsulfamethoxazole / trimethoprim1 ( 0.2) clcr 1530 ml / min : 1600/320 mg / day clcr < 15 ml / min : contraindicatedtolterodine4 ( 0.7) clcr 1030 ml / min : 2 mg / daytramadol4 ( 0.7)1 ( 3.0)1 ( 2.0 ) clcr < 30 ml / min : er contraindicated , ir 200 mg / daytrimethoprim1 ( 0.2) clcr 1530 ml / min : 100 mg every 18th h clcr < 15 ml / min : 100 mg / dayvenlafaxine5 ( 0.9) clcr 1070 ml / min : 168.75 mgzoledronic acid3 ( 0.5) clcr
< 30 ml / min : contraindicatedtotal , n ( row % ) 547 ( 100)17 ( 3.1)33 ( 6.0)50 ( 9.1)data are presented as n ( % )
cl
cr creatinine clearance , er extended release , gdh geriatric dosage handbook , ir immediate release
the number of inappropriate prescriptions shown in this table is not equal to the number of patients having identified inappropriate prescriptions
renally cleared medications , together with dose recommendations , and frequency , n ( % ) , of total and inappropriate prescriptions for each identified drug data are presented as n ( % )
cl
cr creatinine clearance , er extended release , gdh geriatric dosage handbook , ir immediate release
the number of inappropriate prescriptions shown in this table is not equal to the number of patients having identified inappropriate prescriptions the majority ( 326/428 [ 76.2 % ] ) of patients in the study sample were prescribed one or more renally cleared medications .
of these 326 patients , 44 ( 13.5 % ) had inappropriate prescriptions on the basis of their renal function ; these patients constituted 10.3 % of the total study sample . among the 326 patients prescribed one or more of the identified medications , 15 ( 4.6 % ) had one or more prescriptions with excessive doses and 31 ( 9.5 % ) had one or more contraindicated prescription .
inappropriate prescriptions were more common among people living in nursing homes ( or 2.060 [ 95 % ci 1.0733.954 ] ) .
no significant difference was seen between people with and without inappropriate prescriptions in terms of sex , age or mmse score . nor were any significant associations seen in a multivariable model in which inappropriate prescriptions was the dependent variable and sex , age and living situation were independent variables ( table 6).table 6comparison between those with correct versus inappropriate prescriptions among patients being prescribed a renally cleared medicationpatient characteristicscorrect prescriptions ( n = 282)inappropriate prescriptions ( n = 44)simple ormultiple orsex men113 ( 40.1)17 ( 38.6)reference women169 ( 59.9)27 ( 61.4)1.062 ( 0.5532.038)0.933 ( 0.4771.826)age ( years)82.7 6.584.8 6.61.051 ( 0.9991.105)1.044 ( 0.9911.100)living situation living at home206 ( 73.0)25 ( 56.8)reference nursing home76 ( 27.0)19 ( 43.2)2.060 ( 1.0733.954)1.889 ( 0.9743.663)mmse ( 030)19.5 4.420.8 4.01.074 ( 0.9551.206)data are presented as n ( % ) , mean standard deviation or or ( 95 % confidence interval ) .
mmse is not included in the model because of the small number of values obtained ( n = 122 ) , and the lack of a significant difference between the groups
mmse mini - mental state examination , or odds ratio
comparison between those with correct versus inappropriate prescriptions among patients being prescribed a renally cleared medication data are presented as n ( % ) , mean standard deviation or or ( 95 % confidence interval ) .
mmse is not included in the model because of the small number of values obtained ( n = 122 ) , and the lack of a significant difference between the groups
mmse mini - mental state examination , or odds ratio
in the present study , nearly two - thirds of patients had impaired renal function , which was associated with advancing age .
close to 10 % of the identified prescriptions were inappropriate , affecting more than 10 % of patients .
the drugs most commonly involved were metformin , representing the majority of the contraindicated prescriptions , and allopurinol , representing the majority of the prescriptions with excessive doses . according to values calculated using the cg equation ,
the reported prevalence of impaired renal function among older people ranges from 12 to 66 % [ 15 , 17 , 27 ] .
the wide variation in this parameter may be due to differences in study setting , individual parameters and the estimation equations used .
the association between impaired renal function and advancing age found in the present study was expected and has been reported in several other studies [ 8 , 19 , 28 , 29 ] .
the rate of decline in renal function has been found to be greater in people with concomitant diseases ; diabetes , for example , is one of the most common diseases associated with impaired renal function [ 30 , 31 ] . in this study
, no significant difference was seen between people with and without impaired renal function regarding degree of cognitive impairment .
a similar result was seen in another study , which found no association between ckd and cognitive decline or the incidence of all - cause dementia . as the prevalence of impaired renal function in this group was high , and as impairment is often under - recognised among older people , routine monitoring to detect deteriorating renal function is important to avoid the consequences of inappropriate prescriptions .
in the present study , close to 10 % of the identified prescriptions were inappropriate when the cg equation was used to estimate renal function ; one - third of these prescriptions had excessive doses given the patient s renal function and two - thirds were contraindicated .
when the ckd - epi equation was used , the prevalence of inappropriate prescriptions was between 5 and 6 % .
these prevalence figures differ from those reported in previous studies of drug prescriptions that were inappropriate given impaired renal function . in one study of patients aged 70 years , 42.2 % of identified prescriptions had doses exceeding current guidelines .
another study found 13 % of prescriptions to be potentially inappropriate , similar to our results .
while the chosen renal function estimation method might have affected the end result , we also found that the ckd - epi equation overestimates and the cg equation underestimates renal function , which may explain the differences in prevalence seen in the present study [ 13 , 15 , 16 ] .
differences in the reported prevalence of inappropriate prescriptions may also be because prescribers and researchers use different prescribing or dosage guidelines [ 4 , 6 , 8 , 1821 ] .
for example , recommendations on dosage limits for metformin differ between guidelines [ 23 , 26 , 32 ] . in the present study ,
the majority of contraindicated prescriptions were for metformin , probably because it is commonly prescribed and considered contraindicated for patients with an egfr < 60 ml / min , according to the gdh .
other guidelines continue to recommend low - dose metformin in patients with egfrs > 30 ml / min , which would alter the prevalence of inappropriate prescription of this drug .
when metformin was excluded from the analysis , the prevalence of inappropriate prescription was 7.4 % .
metformin is considered the first - line treatment for type 2 diabetes mellitus , and monitoring of renal function is essential to avoid lactic acidosis in patients receiving this drug [ 26 , 32 ] .
in addition to metformin and allopurinol , we also documented more than one inappropriate prescription each for alendronate , glibenclamide , hydrochlorothiazide , memantine , morphine , nitrofurantoin and spironolactone .
in other studies , the most frequently inappropriately prescribed drugs were non - steroidal anti - inflammatory drugs , atenolol , gabapentin , glyburide , ranitidine and nitrofurantoin [ 6 , 8 ] .
glibenclamide has been associated with an increased risk of hypoglycaemia compared with other sulfonylureas , and other drugs in this class should be used for patients with impaired renal function [ 23 , 32 ] .
patients with dementia or cognitive impairment are especially vulnerable to adrs , and it is essential to avoid adverse reactions .
hypoglycaemia as an adverse reaction to glibenclamide or worsening symptoms of urinary infection due to decreased nitrofurantoin efficacy may have particularly harmful consequences in this group .
older people with dementia are , on average , prescribed more medicines than older people without dementia .
this means it is even more important and urgent to evaluate prescriptions of renally excreted drugs to ensure that the correct doses are used and further adrs are avoided . in this study ,
multiple logistic regression analysis showed that age , sex and living in a nursing home were not significantly associated with the record of one or more potentially inappropriate prescription .
in contrast , other studies have found that inappropriate prescription in relation to renal function is more common in older people and among those living in nursing homes [ 6 , 22 ] .
our univariate model showed that living situation was associated with inappropriate prescription , but this association was not significant in the multivariable model .
people who live in nursing homes may be older and have more concomitant diseases that affect renal function than older people living at home
no baseline data about serum creatinine were collected , nor were changes in values followed - up during hospitalization .
therefore , we could not determine whether patients gfrs were stable because we analysed only one serum creatinine level measurement per patient .
only one patient was admitted to the acute internal medicine ward because of acute kidney injury ( aki ) , but more people could possibly have suffered from aki even if the admission was classified otherwise .
serum creatinine level was recorded on the date of randomisation , which may have differed slightly from the date of hospital admission from which the medication prescription data were taken .
actual body weight was also used for all patients , regardless of body composition , which may have affected egfr values for patients with unusual muscle mass .
pro re nata drugs were not included in the analysis , which may have led to underestimation of the prevalence of inappropriate prescription ; for example , pro re nata doses of morphine are often prescribed .
the gdh was chosen because of its international application and because it specifically addresses recommended doses for older people . however , the ranges for renal function were quite narrow for some of the drug dosage guidelines , which may have led to significant confounding in the present study . the cross - sectional design of the study , which involved assessment of patients prescriptions at the time of the medication record review , means we can not comment on the appropriateness of medications when they were initially prescribed .
height data were lacking for six patients , which affected the absolute egfr values calculated from the relative gfrs estimated using the ckd - epi equation .
the study s strengths include the examination of a well - defined group of patients and the collection of data from hospital settings and medical records , which are reliable sources of information for cross - sectional studies .
data such as serum creatinine level , weight and prescribed medications were current . the cg equation was used to estimate renal function for the purpose of estimating dosages in a medical care setting at the time the study was conducted . however , only serum creatinine was reported in the medical records and prescribers then had to calculate the egfr themselves .
subsequent to completion of the study , the ckd - epi equation has become the current standard method used to calculate the egfr in medical records .
the results thus provide a representative picture of clinical reality at the time of the study [ 6 , 17 , 23 , 25 ] .
impaired renal function is common and inappropriate prescription is prevalent among old people with cognitive impairment in northern sweden . when prescribing medications , continuous consideration of renal function is important to avoid adrs among older people with dementia or cognitive impairment .
below is the link to the electronic supplementary material .
supplementary material 1 ( docx 58 kb )
supplementary material 1 ( docx 58 kb )
this study was supported financially by grants from the swedish dementia association and the county council of vsterbotten .
eva snnerstam , maria sjlander and maria gustafsson have no conflicts of interest to disclose .
Output:
| backgroundolder people are more sensitive to drugs and adverse drug reactions than younger people because of age - related physiological changes such as impaired renal function . as people with dementia
are particularly vulnerable to the effects of drugs , it is especially important to evaluate the dosages of renally cleared medications in this group.objectivethe aim of this study was to estimate the prevalence of impaired renal function and inappropriate prescriptions on the basis of renal function among older patients with dementia or cognitive impairment.methodsthe medical records of 428 patients aged 65 years who were admitted to two hospitals in northern sweden were reviewed and renally cleared medications were identified .
the cockcroft
gault equation was used to evaluate renal function .
doses were evaluated according to the geriatric dosage handbook.resultsrenal function was impaired ( estimated glomerular filtration rate < 60 ml / min ) in 65.4 % of the study population .
impaired renal function was associated with increasing age . among 547 prescriptions identified as renally
cleared medications , 9.1 % were inappropriate based on the patient s renal function ; 13.5 % of the 326 patients prescribed renally cleared medications had inappropriate prescriptions .
inappropriate prescriptions were more common among patients living in nursing homes.conclusionsimpaired renal function is common and inappropriate prescription is prevalent among old people with cognitive impairment in northern sweden .
continuous consideration of renal function is important when prescribing medications to this group.electronic supplementary materialthe online version of this article ( doi:10.1007/s40266 - 016 - 0408 - 8 ) contains supplementary material , which is available to authorized users . |
PubmedSumm118454 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| estimating the carcinogenic potential of exposure to diesel - engine exhaust particulates ( deps ) is problematic . in rats ,
high concentrations of deps ( > 1,000 microg / m(3 ) ) inhaled over a lifetime result in excess lung tumors .
however , data for rats exposed to dep at concentrations not associated with lung overload are consistent with no tumorigenic effect .
individual rat studies have only a limited number of exposure groups ; therefore , we combined the tumor data from eight chronic inhalation studies in a meta - analysis . statistical analysis identified a threshold of response between 200 and 600 microg / m(3 ) average continuous lifetime exposure , consistent with biological - effect thresholds reported by other investigators .
our exposure - response analysis of all rats with < 600 microg / m(3 ) average continuous lifetime exposure found no tumorigenic effect of dep in these rats .
when we evaluated all rat studies , accounted for a threshold and for inhomogeneity between experiments , and expressed the results in terms of human unit risk ( ur ) , we found a negative maximum - likelihood human ur of -32 ( times ) 10(-6 ) per microgram per cubic meter ( microg / m(3 ) ) , but this was not statistically significantly different from zero . extrapolating the rat upper 95th percentile confidence limit to humans gave an upper - bound human ur of 9.3 ( times ) 10(-6 ) per microg / m(3 ) ] .
this upper - bound human ur , derived from all of the data points ( including 1,087 animals below the estimated threshold and 1,433 in the control groups ) , falls entirely below the range of estimates derived from lung - overloaded rats or from epidemiology of railroad workers .
our meta - analysis of the low - exposure data in rats does not support a lung cancer risk for dep exposure at nonoverload conditions .
average ambient concentrations of dep ( 0 - 3 microg / m(3 ) ) are < 1% of the concentration associated here with a threshold of tumor response in the rat bioassay.imagesfigure 1figure 2figure 3 |
PubmedSumm118455 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: during pregnancy , women have a four- to five - fold increased risk of thromboembolism compared with women who are not pregnant.1,2 eighty percent of thromboembolic events in pregnancy are venous,3 with an absolute risk of venous thromboembolism ( vte ) during pregnancy of between 0.5 and 2.0 per 1000 women.39 the most important risk factor for vte in pregnancy is a history of thrombosis . besides this ,
the next most important risk factor for vte in pregnancy is thrombophilia.3,10 thrombophilia is present in 20%50%1113 of women who experience vte during pregnancy and the postpartum period .
antithrombin ( at ) deficiency was the first inherited thrombophilia to be described in 1965.14 since then , multiple reports have documented the association between inherited at deficiency and an increased rate of vte.15 in pregnancy , the rate is correspondingly higher .
historic case series have reported rates of 18%70%.1618 the variation in these rates can be attributed to the relatively small numbers in each series and to the varied definitions of at deficiency .
although a systematic review including more recent studies ( some with more liberal thresholds of at deficiency and not all requiring a positive family history ) found a lower risk of thrombosis in pregnancy than did the initial studies ( odds ratio 4.76 [ 95% confidence interval 2.15 , 10.57 ] ) ; the high rates in the initial studies prompted obstetricians and hematologists to recommend full anticoagulation during pregnancy for women with at deficiency.19,20 more recent recommendations from the american college of chest physicians do not endorse anticoagulation unless a woman has had a history of thrombosis , but continue to describe at deficiency as a high - risk thrombophilia.21 despite full anticoagulation during pregnancy and the postpartum period , women with at deficiency are still vulnerable to developing vte , particularly at the time of childbirth , when anticoagulation is withheld to prevent bleeding complications . at is a natural anticoagulant that inactivates thrombin by covalently binding to the active serine of thrombin and activated factor x ( fxa).15 at can also inactivate other coagulation factors , including factors ixa , xia , and xiia15 ( figure 1 ) . at
has a binding site for heparin and , in the absence of heparin , has low inhibitory activity against thrombin . in contrast , when heparin is present , inhibitory activity can be induced at least 1000-fold.22 importantly , in the absence of at , heparin has little effect . at concentrates
have been available since 1979.23 of the two at concentrates currently available , one is purified from human plasma ( thrombate iii , grifols therapeutics , clayton , nc , usa ) and the other is a recombinant product produced in transgenic goat mammary glands ( atryn , gtc biotherapeutics , framingham , ma , usa ) .
women with at deficiency may be candidates for at concentrates during pregnancy or the postpartum period when anticoagulation is desired , but contraindicated , for example during : invasive procedures such as egg retrieval , cerclage , chorionic villus sampling , or amniocentesis ; miscarriages and ectopic pregnancies ; episodes of bleeding ; surgical procedures ; neuraxial anesthesia ; childbirth , including cesarean delivery ; postpartum tubal ligation ; thrombocytopenia . at concentrates
can also be utilized to normalize antithrombin levels in women with current thrombosis or recurrent thrombosis despite anticoagulation . at deficiency
is a rare disease affecting between 1 in 50027 and 1 in 5000 individuals,24 so large trials have not been conducted .
the clinical trials that were conducted to obtain approval for at concentrates were carried out on patients with inherited at deficiency who were undergoing surgery or giving birth . in these small trials,2628 efficacy
was demonstrated by the low rate of thrombosis when anticoagulation was withheld during the perioperative or peripartum periods .
pregnant patients were included in these trials , but details that could provide guidance have not been published . the purpose of this paper is to provide detailed descriptions from six pregnant subjects in one of these trials , discuss the other published case series and case reports , and provide general guidance for the use of at concentrates for inherited at deficiency in pregnancy .
in the late 1980s , 31 at - deficient subjects at high risk of thrombosis were enrolled in a prospective treatment trial of the plasma - derived at concentrate thrombate iii.29 all participating sites had the approval of their respective institutional review boards .
doses were based on the following formula : plasma at levels were generally measured 12 hours after the initial dose to ensure that the level remained above 80%.29 if necessary , a second dose of at was administered at that time . once predictable peak and trough levels were achieved , daily maintenance doses of the at concentrate were administered in the amount of 60% of the loading dose in order to maintain plasma at levels in the range of 70%120% of normal . although these six cases were mentioned in the publication from the original study,26 detailed descriptions were not published . since that time
detailed treatment data are provided in table 1 and the cases are summarized in the results section . for the discussion , a computer - assisted search of the sciverse scopus electronic database ( which includes embase , medline , and medline daily updates ) from 1980 until february 2011
atiii , antithrombin deficiency , pregnancy , clinical study ,
prospective study , controlled study , complications , thrombophilia , thrombosis , and thrombotic complications .
a 17-year - old woman with a strong family history of deep vein thrombosis ( dvt ) was admitted to the hospital at 20 weeks gestation with right leg dvt and pulmonary embolism ( pe ) . an emergency inferior vena caval ligation was performed and she subsequently received intravenous ( iv ) and , later , subcutaneous ( sc ) heparin for the duration of her pregnancy .
she was treated prophylactically with at concentrate prior to delivery and for 6 days postpartum .
an 18-year - old woman was diagnosed with at deficiency following dvt during her first trimester of pregnancy .
her plasma at level was 38% at that time , and it was noted that both a brother and sister had histories of at deficiency . she was maintained on sc heparin until admission for labor , when she was believed to be preeclamptic and in early labor . to raise her at level
, she received four units of fresh frozen plasma ( ffp ) , but her plasma at level remained at 48% .
therefore , the patient was given a loading dose of at concentrate and was continued on heparin .
the next day she was started on a maintenance dose of at concentrate for 5 days .
a 23-year - old woman with a strong family history of at deficiency had been treated with chronic oral anticoagulation since 11 years of age .
she discontinued warfarin therapy because of pregnancy , but 1 month later , in her eighth week of pregnancy , was admitted to the hospital with massive thrombosis of the left leg .
iv heparin treatment over 26 hours failed to raise the activated partial thromboplastin time ( aptt ) above 51.5 seconds .
a daily maintenance course for 3 days was followed by a twice - weekly course with sc heparin over 19 days . despite this regimen ,
therefore , her at concentrate dose was increased , resulting in trough plasma levels generally remaining above 70% .
subsequently , she was maintained on the new dose twice weekly with sc heparin every 8 hours for the entire duration of the pregnancy as well as postpartum , when she was bridged to oral anticoagulant therapy .
the delivery ( vaginal ) was uneventful , without thrombotic complications . a 27-year - old woman , with known at deficiency , was admitted to the hospital at 12 weeks gestation with pe and right upper lobe pulmonary infarction .
she had a strong family history of at deficiency , with eight maternal aunts and uncles with documented at deficiency , mostly with recurrent vte .
the patient was treated with two units of ffp and started on iv heparin after receiving a bolus .
however , heparin treatment caused only transient increases in the aptt , despite administration of another bolus within 12 hours .
therefore , at concentrate was initiated with a loading dose , which increased the plasma at level from 50% to 110% .
the aptt lengthened to 68 seconds , and subsequent measurements demonstrated much less variability than had been noted prior to initiating at concentrate therapy . within 3 days , the patient was symptomatically much improved .
a maintenance program was begun that consisted of sc heparin and at concentrate twice weekly . ultimately , the aptt , measured just prior to each at dose , stabilized at > 50 seconds and the at concentrate was discontinued 41 days after initiation of therapy .
after 1 month , at concentrate therapy was resumed once weekly along with sc heparin .
this regimen was continued until 4 weeks prior to delivery , after which the dosing frequency was increased to twice weekly .
a 28-year - old woman was first treated for bilateral dvt at 20 years of age .
approximately 6 years later , she became pregnant , at which time her warfarin treatment was stopped and sc heparin substituted , but she miscarried 1 week later . during follow - up , her plasma at level was found to be as low as 18% .
she became pregnant again 2 months later and was switched from warfarin to sc heparin every 8 hours . at approximately 9 weeks gestation , she presented with a 2-day history of right thigh pain .
she was diagnosed as having acute dvt , with laboratory parameters indicating active disseminated intravascular coagulation . following treatment with ffp ,
her heparin therapy was discontinued , she was switched back to warfarin , and treatment with at concentrate was started .
a 35-year - old woman with a history of dvt and pe at 23 years of age , as well as a family history of thrombosis ( two sisters , a mother , and aunt had recurrent vte ) , was admitted with pe at 12 weeks gestation .
her plasma at level was 58% . while being treated with heparin , she developed recurrent pe and was found to be heparin resistant .
iv heparin was administered when her plasma at level was 43% and she was continued concomitantly on at concentrate .
except for one patient who was diagnosed in the current pregnancy and had an at level of 18% , at levels at the time of initial treatment ranged from 38% to 59% . besides full anticoagulation with iv or sc heparin ,
four of the six patients were treated with plasma - derived at concentrate at the time of diagnosis of vte , two after receiving ffp .
this was followed by a maintenance dose of 50%100% of the loading dose for 310 days .
the other two received an extended course with twice - weekly infusions 62 units / kg in one case and 7276 units / kg in the other to maintain trough plasma at levels > 70% .
one patient ( who did not receive either ffp or at concentrate ) underwent inferior vena caval ligation .
she and the other remaining woman only received at concentrate at the time of labor , with a loading dose of 4650 units / kg followed by a maintenance dose of 50%75% of the loading dose for 57 days .
none of the women experienced recurrent thrombosis while receiving treatment with at concentrate ( table 1 ) .
a 17-year - old woman with a strong family history of deep vein thrombosis ( dvt ) was admitted to the hospital at 20 weeks gestation with right leg dvt and pulmonary embolism ( pe ) . an emergency inferior vena caval ligation was performed and she subsequently received intravenous ( iv ) and , later , subcutaneous ( sc ) heparin for the duration of her pregnancy .
she was treated prophylactically with at concentrate prior to delivery and for 6 days postpartum .
an 18-year - old woman was diagnosed with at deficiency following dvt during her first trimester of pregnancy .
her plasma at level was 38% at that time , and it was noted that both a brother and sister had histories of at deficiency . she was maintained on sc heparin until admission for labor , when she was believed to be preeclamptic and in early labor . to raise her at level
, she received four units of fresh frozen plasma ( ffp ) , but her plasma at level remained at 48% .
therefore , the patient was given a loading dose of at concentrate and was continued on heparin .
the next day she was started on a maintenance dose of at concentrate for 5 days .
a 23-year - old woman with a strong family history of at deficiency had been treated with chronic oral anticoagulation since 11 years of age .
she discontinued warfarin therapy because of pregnancy , but 1 month later , in her eighth week of pregnancy , was admitted to the hospital with massive thrombosis of the left leg .
iv heparin treatment over 26 hours failed to raise the activated partial thromboplastin time ( aptt ) above 51.5 seconds .
a daily maintenance course for 3 days was followed by a twice - weekly course with sc heparin over 19 days . despite this regimen ,
therefore , her at concentrate dose was increased , resulting in trough plasma levels generally remaining above 70% .
subsequently , she was maintained on the new dose twice weekly with sc heparin every 8 hours for the entire duration of the pregnancy as well as postpartum , when she was bridged to oral anticoagulant therapy . the delivery ( vaginal ) was uneventful , without thrombotic complications .
a 27-year - old woman , with known at deficiency , was admitted to the hospital at 12 weeks gestation with pe and right upper lobe pulmonary infarction .
she had a strong family history of at deficiency , with eight maternal aunts and uncles with documented at deficiency , mostly with recurrent vte .
the patient was treated with two units of ffp and started on iv heparin after receiving a bolus .
however , heparin treatment caused only transient increases in the aptt , despite administration of another bolus within 12 hours .
therefore , at concentrate was initiated with a loading dose , which increased the plasma at level from 50% to 110% .
the aptt lengthened to 68 seconds , and subsequent measurements demonstrated much less variability than had been noted prior to initiating at concentrate therapy . within 3 days , the patient was symptomatically much improved .
a maintenance program was begun that consisted of sc heparin and at concentrate twice weekly . ultimately , the aptt , measured just prior to each at dose , stabilized at > 50 seconds and the at concentrate was discontinued 41 days after initiation of therapy .
after 1 month , at concentrate therapy was resumed once weekly along with sc heparin .
this regimen was continued until 4 weeks prior to delivery , after which the dosing frequency was increased to twice weekly .
a 28-year - old woman was first treated for bilateral dvt at 20 years of age .
approximately 6 years later , she became pregnant , at which time her warfarin treatment was stopped and sc heparin substituted , but she miscarried 1 week later . during follow - up , her plasma at level was found to be as low as 18% .
she became pregnant again 2 months later and was switched from warfarin to sc heparin every 8 hours . at approximately 9 weeks gestation , she presented with a 2-day history of right thigh pain .
she was diagnosed as having acute dvt , with laboratory parameters indicating active disseminated intravascular coagulation . following treatment with ffp ,
her heparin therapy was discontinued , she was switched back to warfarin , and treatment with at concentrate was started .
a 35-year - old woman with a history of dvt and pe at 23 years of age , as well as a family history of thrombosis ( two sisters , a mother , and aunt had recurrent vte ) , was admitted with pe at 12 weeks gestation .
her plasma at level was 58% . while being treated with heparin , she developed recurrent pe and was found to be heparin resistant .
iv heparin was administered when her plasma at level was 43% and she was continued concomitantly on at concentrate .
in this case series , the patients ranged in age from 17 to 35 years . none had given birth previously .
except for one patient who was diagnosed in the current pregnancy and had an at level of 18% , at levels at the time of initial treatment ranged from 38% to 59% . besides full anticoagulation with iv or sc heparin ,
four of the six patients were treated with plasma - derived at concentrate at the time of diagnosis of vte , two after receiving ffp .
this was followed by a maintenance dose of 50%100% of the loading dose for 310 days .
the other two received an extended course with twice - weekly infusions 62 units / kg in one case and 7276 units / kg in the other to maintain trough plasma at levels > 70% .
one patient ( who did not receive either ffp or at concentrate ) underwent inferior vena caval ligation .
she and the other remaining woman only received at concentrate at the time of labor , with a loading dose of 4650 units / kg followed by a maintenance dose of 50%75% of the loading dose for 57 days .
none of the women experienced recurrent thrombosis while receiving treatment with at concentrate ( table 1 ) .
in this case series of difficult - to - manage at - deficient women with new - onset or recurrent thrombosis during pregnancy , plasma - derived at concentrate was administered to normalize at levels during initial treatment of vte or to provide thromboprophylaxis when anticoagulation was withheld at the time of childbirth . at concentrate
loading doses and maintenance doses were prescribed according to protocol , which succeeded in raising at levels to 60 iu / dl .
two reported on pregnancy outcomes in cohorts of women with at deficiency,32,33 one reported on the prevalence of at deficiency among women with pregnancy - related vte,34 and a number of case series and case reports have reported specifically on the course and treatment during pregnancy of women with at deficiency27,28,3245 ( table 2 ) .
different regimens have been used for antepartum and peripartum thromboprophylaxis . between 1981 and 1992 ,
the published regimens for antepartum thromboprophylaxis or treatment were for sc heparin or oral anticoagulants.27,3237 subsequently , the only anticoagulant used alone for antepartum prophylaxis was low - molecular - weight heparin.4245 there were two reports from japan of at concentrate being used for antepartum thromboprophylaxis . in two cases
it was used alone,38 and in one case it was used with heparin.39 in one case , at concentrate was used in conjunction with sc heparin for the treatment of vte.41 in one report , no at concentrate was given at the time of delivery,40 while , in another report , ffp was given but no at concentrate.37 in five reports , peripartum at concentrate was given just at the time of delivery32,34,36,42,45 and in another five , at concentrate was given for several days surrounding the time of delivery.16,27,28,35,43 one study reported the administration of at concentrate for 6 weeks
postpartum.44 when doses were repeated , they were repeated at varying intervals ( eg , daily , every 48 hours , two times per week , three times per week ) .
when at concentrate was administered , in twelve reports , plasma - derived concentrate was used ( n = 47 cases ) and in two reports recombinant concentrate was used ( n = 10 cases ) . for
plasma - derived at concentrate , reported doses ranged from 550 to 6000 units or were weight - based . in one report , loading doses of 50 units / kg were administered , with maintenance doses of 25 units / kg every 48 hours . for recombinant at concentrate , loading doses ranged from 21 to 81 units / kg and maintenance infusions ranged from 160 to 436 iu / kg / day and
were administered for 310 days29 or , in one case report , 3091 units followed by a maintenance infusion of 712 units per hour.43 as for indications , only 29/53 cases had a personal history of vte , with the others diagnosed with at deficiency based on a family history .
fewer ( four ) had current vte 19,30,31,35,373948 plasma - derived at concentrates are well tolerated , with minimal adverse reactions , and pose an extremely low risk for transmission of infectious agents .
the initial dose is calculated as : initial dose = ( [ desired at level
maintenance doses are then calculated using approximately 60% of the loading dose and are given once every 24 hours to maintain peak and trough at activity levels in the range of 80% and 120% , respectively15 with minor glycosylation differences , recombinant at has an identical amino acid structure to endogenous at .
the clinical difference is in the mean half - life , which is estimated to be 10.49 7.19 hours for recombinant at , in comparison to 56.868.0 hours for plasma - derived at15 therefore , recombinant at is administered as a continuous infusion . in a study by tiede et al , the initial dose was calculated as : ( [ 100 pre - treatment at activity level in % ] body weight in kg)/2.28 .
maintenance infusion ( iu / h ) is then calculated as : ( [ 100 pre - treatment at activity level in % ] body weight in kg)/10.22.28 the prescribing information for atryn provided by gtc biotherapeutics has the loading dose in pregnancy as : ( [ 100 baseline at activity ] body weight in kg)/1.3 .
the maintenance infusion ( iu / hr ) is : ( [ 100 baseline at activity ] body weight in kg)/5.4.46
in contrast to the other reports in the literature , the six patients discussed here each had a personal history of vte , were dosed according to a weight - based protocol , and were treated concomitantly with anticoagulation
. limitations of this series are the relatively small number of cases and the fact that the cases were treated some time ago with anticoagulation regimens that have been replaced by low - molecular - weight heparin . despite the fact that the series comprises only six cases ,
this is one of the larger series , and , as is true for other rare diseases for which randomized trials and even large cohort studies are unavailable , small case series or even individual cases can be instructive . otherwise , there are few data and little guidance on the management of at concentrates in pregnancy and at the time of delivery .
our current guidance would be that women with at deficiency who are pregnant or postpartum and have a personal history of vte or new - onset or recurrent vte receive at concentrates .
we would suggest that women with low levels of at ( < 60% ) with a compelling family history , and those with very low levels of at ( < 40% ) , also receive at concentrates .
Output:
| objectivethe aims of the study reported here were to provide data from six pregnant subjects who were enrolled in a clinical trial of antithrombin ( at ) concentrate , discuss other published case series and case reports , and provide general guidance for the use of at concentrate for inherited at deficiency in pregnancy.methodsin the late 1980s , 31 at - deficient subjects were enrolled in a prospective treatment trial of the plasma - derived at concentrate thrombate iii. herein , newly available treatment data about the six pregnant subjects in the trial is tabulated and summarized.resultsall six experienced venous thromboembolism ( vte ) during pregnancy , were dosed according to a weight - based protocol , and were treated concomitantly with anticoagulation . loading doses of at concentrate of 5462 units / kg were followed by maintenance doses of 50%100% of the loading dose for 310 days . at the time of labor , loading doses of 4650 units / kg were followed by maintenance doses of 50%75% of the loading dose for 57 days .
none of the six experienced recurrent thrombosis while receiving treatment with at concentrate.conclusioncurrently we suggest that women with at deficiency who are pregnant or postpartum and have a personal history of vte or current vte receive at concentrates . |
PubmedSumm118456 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
the mobile insert was introduced because it is believed to reduce polyethylene wear , to reduce interface stresses at the tibial plateau , and to improve kinematics by increasing range of motion ( rom ) and facilitating axial rotation .
the possible disadvantages of the mobile insert are dislocation and increased wear from the interface between the insert and the tibial component . however , review of the literature revealed no evidence of superiority of either design with respect to improvement of kinematics as defined by flexion or range of motion [ 10 , 15 ] haas et al
. showed a group with lower flexion for a mobile bearing group compared to a fixed bearing group .
other randomised trials found no statistical significant difference in passive flexion as measured by the knee society score [ 12 , 13 , 17 , 22 ] .
. found an influence of femur position on the tibia on weight - bearing flexion with several implant designs with mobile bearings having a relative anterior position and less flexion .
improved movement possibilities , among which active flexion is most important one is the working mechanism for the mobile bearing knee . with regard to active flexion , the relative effectiveness of these two prostheses with the different bearing types has not yet been established .
the goal of this study is , therefore , to evaluate the difference in active flexion at 1 year between mobile and fixed bearing total knee arthroplasty ( tka ) .
the hypothesis was that mobile bearing total knee arthroplasty would result in a better flexion at 1 year than fixed bearing tka .
a multi - centre , randomised trial with two treatment arms was performed in two centres : sint maartenskliniek in nijmegen , the netherlands and ziegler spital in bern , switzerland . in the netherlands ,
the null hypothesis was that there is no difference in active rom between mobile and fixed bearing total knee prostheses .
the study was conducted in compliance with the study protocol , declaration of helsinki , ich - gcp , en 540 : the european standard on clinical investigation of medical devices for human subjects , and applicable regulatory requirements .
patients selected were informed and asked for consent by auto - reply mail.table 1inclusion and exclusion criteriainclusion criteriadiagnosed with osteoarthritis ( also referred to as gonarthrosis).candidate for primary total knee arthroplasty for this reasonexpected to undergo only one arthroplasty procedure within next 12 monthswilling to attend all the follow - up examinationsexpected to make a full recovery6075 years oldpreoperative alignment ( varus or valgus ) <
10bmi < 30live independentlyexclusion criteriamissing or having an insufficient posterior cruciate ligamentneed cementing of the tibial stem due to osteoporosiscurrently enrolled in a clinical investigation with either a drug or an investigational device or has been enrolled in such an investigation during the last 6 months.suffer from heart or lung disease inclusion and exclusion criteria surgeon - dependent block ( size 4 ) randomisation was performed with computer - generated randomisation lists by the trial coordinator ( wj ) .
treatment allocation was concealed to all persons in the patient selection process with opaque closed envelopes kept and opened at the order of the sequential randomisation number .
absence of the pcl excludes the mobile bearing as a treatment option , so these patients had to be excluded before randomisation .
the two interventions under investigation were the mobile and the fixed bearing total knee arthroplasties of the balansys type , mathys medical ltd bettlach , switzerland
posterior gliding ( 79 mm ) and rotational ( 15 ) degrees of freedom .
the fixed and mobile bearing types of this system are identical in all other factors .
the proximal tibial bone cut was performed perpendicular to the mechanical axis of the tibia with external guide , and the distal femoral bonecut was performed with an intramedullary guide corrected for radiographic deviation of the mechanical axis from the anatomical axis . rotational alignment ( anterior and posterior bone cuts ) of the femoral implant was determined during flexion balancing with 100 n with the balansys tensioner .
the primary outcome parameter , active flexion , was assessed by an independent nurse . to assess the active flexion ,
the patient was asked to stand upright and to flex the knee as much as possible using patients own muscle force .
radiological parameters were assessed by one independent surgeon according to the knee society radiological scoring system .
radiolucent lines were scored as absent , being less than 1 mm , 12 mm and more than 2 mm on lateral radiographs made under fluoroscopic guidance .
all outcome parameters were assessed preoperatively and at 3 , 6 , and 12 months postoperatively .
sample size was calculated to be 122 , 61 in each group , in order to be able to detect a clinically relevant difference of 10 in range of motion with a power of 0.90 and a significance level of 0.05 .
this sample size was estimated to provide adequate power for the secondary outcome parameters to a cumulative significance level of 0.05 .
active flexion was analysed with analysis of covariance ( ancova ) with preoperative flexion as a covariate .
a repeated measures design with preoperative values included was used for secondary variables ( kss clinical , kss functional and subscores , passive flexion ) .
a test was used to test the occurrence of radiolucent lines and extension deficit at final follow - up .
the two interventions under investigation were the mobile and the fixed bearing total knee arthroplasties of the balansys type , mathys medical ltd bettlach , switzerland .
posterior gliding ( 79 mm ) and rotational ( 15 ) degrees of freedom .
the fixed and mobile bearing types of this system are identical in all other factors .
the proximal tibial bone cut was performed perpendicular to the mechanical axis of the tibia with external guide , and the distal femoral bonecut was performed with an intramedullary guide corrected for radiographic deviation of the mechanical axis from the anatomical axis .
rotational alignment ( anterior and posterior bone cuts ) of the femoral implant was determined during flexion balancing with 100 n with the balansys tensioner .
the primary outcome parameter , active flexion , was assessed by an independent nurse . to assess the active flexion ,
the patient was asked to stand upright and to flex the knee as much as possible using patients own muscle force .
secondary outcome parameters were clinical and radiological outcome . knee society clinical and functional score by insall et al . were assessed by independent nurse trained in the assessment .
radiological parameters were assessed by one independent surgeon according to the knee society radiological scoring system .
radiolucent lines were scored as absent , being less than 1 mm , 12 mm and more than 2 mm on lateral radiographs made under fluoroscopic guidance .
all outcome parameters were assessed preoperatively and at 3 , 6 , and 12 months postoperatively .
sample size was calculated to be 122 , 61 in each group , in order to be able to detect a clinically relevant difference of 10 in range of motion with a power of 0.90 and a significance level of 0.05 .
this sample size was estimated to provide adequate power for the secondary outcome parameters to a cumulative significance level of 0.05 .
active flexion was analysed with analysis of covariance ( ancova ) with preoperative flexion as a covariate .
a repeated measures design with preoperative values included was used for secondary variables ( kss clinical , kss functional and subscores , passive flexion ) .
a test was used to test the occurrence of radiolucent lines and extension deficit at final follow - up .
one centre with 30 patients was excluded from the analysis due to randomisation error : loss of allocation envelopes made the validity of the allocation untracable . the remaining sample
( n = 14 ) was too small and statistically different from the other , larger centre .
the number of patients recruited , included and excluded at the various stages are represented in fig . 1 according to the consort statement .
in conclusion , 100 patients were randomised , of whom 51 with a mobile bearing and 49 with a fixed bearing total knee prosthesis .
one patient in each group was lost during randomisation , one due to randomisation error and one was excluded because of missing pcl . in the mobile bearing group ,
4 patients were lost to follow - up after randomisation because of refusal to attend any further visits ( 3 ) and one patient presented with rheumatoid arthritis after the surgery . in the fixed bearing group ,
two patients were lost after randomisation because of consent withdrawal . in the mobile bearing group ,
data from three patients were incomplete because of death ( 2 ) and revision ( 1 ) , in the fixed bearing group one patient died.fig .
1consort statement flowchart consort statement flowchart demographic characteristics of the patients are shown in table 2 .
for the results at all follow - up moments for active flexion , kss clinical and functional score , see table 3 .
the difference of 1.0 ( 95% ci 3.9 to 5.8 ) at 12 months for active flexion ( primary question ) was not significant ( ancova with preoperative flexion as covariate ; n.s . ) . also , repeated measures analysis did not reveal any significant effects .
post hoc power to detect a 10 difference was 0.996 . for the kss clinical score
, no statistically significant differences were found at 12 months or with repeated measures analysis .
for the kss functional score , the repeated analysis showed a significant difference between the two groups ( p = 0.017 ) .
further analysis showed that this was mainly attributable to the stair climbing score , which showed a difference in favour of the fixed bearing design between preoperative and 3 months ( 7.3 point difference ; 95% ci 2.312.5 ; p = 0.005 ) as well as 12 months ( 4.8 point difference ; 95% ci 0.19.6 ; p = 0.045 )
. the passive flexion component of the kss was also not significantly different between the two groups ( mobile : 110 vs. fixed : 112 ; n.s.).table 2demographicsmobile bearing ( n = 46)fixed bearing ( n = 46)age at surgery ( years)67.6 ( 4.4)66.7 ( 4.6)male / female13:3314:32left / right18:2823:23operating time ( min)84 ( 14)86 ( 14)other knee with implant ( n)1919one or both hip implants ( n)43average ( sd)table 3results for average active flexion , kss clinical , and functional score for both allocated groupsoutcomeallocationpreoperative3 months6 months12 monthsactive flexionmobile bearing94.6 ( 15.8)91.8 ( 9.7)95.0 ( 11.7)99.9 ( 13.1)fixed bearing97.1 ( 13.2)95.0 ( 13.0)97.9 ( 11.3)101.0 ( 9.8)kss clinical scoremobile bearing51.5 ( 13.2)85.2 ( 14.7)91.3 ( 10.7)90.9 ( 13.5)fixed bearing53.6 ( 13.4)88.5 ( 12.2)90.3 ( 11.6)93.1 ( 9.5)kss functional scoremobile bearing53.6 ( 11.0)70.4 ( 21.8)81.2 ( 14.6)84.9 ( 17.3)fixed bearing46.9 ( 16.0)79.7 ( 17.1)83.7 ( 16.2)88.8 ( 12.8)sd in brackets results for average active flexion , kss clinical , and functional score for both allocated groups none of the prostheses were radiologically loose . twenty - four knees ( 53% ) in the fixed group and 21 ( 49% ) in the mobile group showed radiolucent lines . five knees in the fixed bearing group showed radiolucent lines of 12 mm as opposed to six in the mobile group . in the mobile group ,
only three knees had slightly progressive radiolucent lines ( two mobile ; one fixed ) .
occurrence of radiolucent lines was not different between the two groups ( : df = 2 ; n.s . ) .
there was one distal femur fracture due to unknown cause in the fixed bearing group . in the mobile group
also in the mobile group , there was also one suspicion of an infection that resolved after treatment with genta beads .
the most important finding of the present study was that there is no statistically significant difference between mobile and fixed bearing knee arthroplasty on active knee flexion .
the amount of active flexion that could be achieved by the patients is lower than the passive flexion reported by other studies , but these findings with regard to passive flexion are in line with the literature where there are also no statistically significant differences in five meta - analyses [ 10 , 15 , 16 , 19 , 21 ] .
both component types were posterior cruciate retaining . an earlier review on pcl retention versus sacrifice showed that pcl sacrifice only resulted in better rom if a post and cam ( posterior stabilised ) system was added .
. showed in a fluoroscopy study that posterior contact point of the femur on the tibia produced a greater weight - bearing flexion .
they also found that posterior stabilised designs facilitated this posterior position . in another fluoroscopy study , they showed that a posterior stabilised design had a more posterior contact point during stair stepping .
a significant difference was found in the stair climbing aspect of the knee society functional score favouring the fixed bearing design .
[ 17 , 18 ] , who found a more natural patella tendon angle for the mobile bearing devices . in another gait study ,
mockel et al . found a higher flexion for the mobile bearing device , indicating a better biomechanical situation .
. found less interindividual variability for a mobile bearing design , but only in a loaded condition .
although a more natural patella tendon angle and better biomechanics are among the goals of a mobile bearing insert , this was not investigated these in this study . if present in this study , this was not translated in better stair climbing abilities ( use of rail ) for the mobile bearing design .
mobile bearings might show a paradoxical roll - back of the femur causing fat - pad impingement .
the freedom of anterior movement also allows a more anterior tibiofemoral contact point in flexion causing increased pressure on the patella . in a fluoroscopic study during stair stepping , banks et al
. found a more anterior contact point for mobile bearing knees compared to fixed bearing knees .
the third possible explanation is rotation of the tibia plateau causing maltracking of the patella . in this study ,
maltracking or anterior knee pain was not studied , so these explanations can not be excluded .
knee society clinical subscore is the common outcome parameter for evaluation of total knee arthroplasty .
it is a composite score including pain , range of motion and laxity characteristics of the patient and the knee .
several studies could not find a difference between fixed and mobile bearing knees prostheses [ 8 , 1214 , 22 ] , except price et al . who found a better kss and oxford knee score for mobile bearing implants , but does not mention which aspect of the composite score was responsible for the difference . in this study ,
a higher percentage of radiolucent lines was found than in other randomised controlled trials on the subject [ 8 , 12 , 13 , 22 ] .
most of the lines were minimal , less than 1 mm . because of the cemented components , it is difficult to distinguish narrow radiolucent lines from sclerotic lines related to the cement .
watanabe et al . found 14% for fixed bearing and 27% for mobile bearing , but this only involves lines of 1 mm or larger , the total percentage could therefore be higher .
kim et al . found in two studies [ 12 , 13 ] 17 and 34% for fixed bearing and 12 and 25% for mobile bearing .
the wide range of these findings implies the problems of inter - rater variability with the measurement of radiolucent lines .
regardless of these problems , as in this study , none of the studies found a significant difference between the two prosthesis types in the occurrence of radiolucent lines .
however , the power of the remaining sample remains adequate for detecting a clinically relevant difference in active flexion .
in addition , the difference observed ( 1 , 95% confidence interval 3.9 to 5.8 ) is far below the predefined clinically relevant difference of 10. to prevent publication bias , there is an obligation to adhere to the policy to present all trials , including those with negative results .
the primary interest of the study was active flexion , a functional measure which is clinically relevant within the first year postoperative . however , long - term outcome is also important , especially because it is believed that contact stresses and therefore loosening could be improved by the mobile bearing .
for that reason , the patients will be followed - up until 10 years postoperatively .
there is no statistically significant difference on active flexion between the mobile and fixed bearing total knee arthroplasty types . from the secondary parameters , stair climbing was better with the fixed bearing type .
Output:
| purposethe primary goal of this study was to assess the difference in active flexion between patients with a mobile versus a fixed bearing , cruciate retaining , and total knee arthroplasty .
the study was designed as a randomised controlled multi - centre trial.methodsparticipants were assigned to interventions by using block - stratified , random allocation .
outcome parameters were active flexion , passive flexion , and knee society score ( kss ) .
outcome parameters were assessed preoperatively and at 3 , 6 , and 12 months postoperatively by an independent nurse.resultsninety-two patients from one centre were included , 46 in each group .
active flexion was comparable for the two groups , 99.9 for the mobile bearing group and 101 for the fixed bearing group with a baseline controlled difference of 1.0 ( 95% ci 3.9 to 5.8 , n.s . ) .
the clinical kss was comparable between the two bearing groups ( mobile 90.0 vs. fixed 92.4 , n.s . ) .
the functional kss showed a difference that was attributable to the stair climbing subscore , which showed a difference in favour of the fixed bearing design between preoperative and 3 months ( 7.3 point difference ; 95% ci 2.312.5 ; p = 0.005 ) as well as 12 months ( 4.8 point difference ; 95% ci 0.19.6 ; p = 0.045).conclusionsthere were no short - term differences in active flexion between fixed bearing and mobile bearing total knee arthroplasty.level of evidencei . |
PubmedSumm118457 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: out of 10 million cancer survivors alive in the united states today , at least 270,000 were diagnosed when they were under the age of 21 1 . with the advancement of cancer treatment over the past few decades ,
new interest focuses on late effects , chronic and progressive conditions associated with successful completion of cancer therapy , which are now prevalent among long - term cancer survivors .
such effects usually present three or more years post - diagnosis , with only one in three survivors remaining free of any long - term problems 2,3 .
late effects among childhood cancer survivors are so pervasive that the children 's oncology group has issued a recommendation for regular evaluation to monitor development after treatment , a guideline that is often difficult to follow due to time - consuming and expensive assessments 4 . included among a plethora of chronic medical conditions are cognitive late effects , presumably resulting from chemotherapy administered to the central nervous system ( cns ) during a time of rapid brain development 3,5 .
for instance , childhood cancer survivors , compared to siblings , are 10 times more likely to have severe cognitive deficits , and are significantly less likely to complete high school or to complete higher education after graduation 3,6 . in adulthood ,
frequency of impairment in areas of task efficiency , memory , and emotional regulation is 50 percent higher among survivors of childhood cancer compared to siblings 7 . among childhood cancer survivors , acute lymphoblastic leukemia ( all ) is the most common diagnosis 8 . due to the advancement of treatment regimens
, it is now expected that over 90 percent of children diagnosed with all will enter into long - term remission , giving it the highest survival rate for pediatric cancers 9 .
extensive reviews of the clinical literature surrounding cognitive late effects associated with all treatment exist 10,11 , whereas evaluation of cognitive late effects in preclinical models of young rodents is lacking .
therefore , the objective of the current review is to highlight the benefits of using preclinical models to complement clinical research in this area .
leukemias represent about one - third of childhood cancers , with all accounting for 75 percent of pediatric leukemia cases , making it the most common form of cancer in children and adolescents 12 . out of 4,000 cases diagnosed annually in the united states , two - thirds
all , a malignant disorder of lymphoid cells , results when a surplus of stem cells develop into lymphocytes , a type of white blood cell also referred to as leukemic cells .
these cells are not able to fight infection and leave less room for healthy cells and platelets 9 .
additionally , since these cells are found in bone marrow they are transported by the circulatory system to nearly every organ system , including the cns . despite possible environmental , genetic , and viral influences ,
while all is less prevalent in adults , the mortality rate among this population is much higher than in adolescents and children .
treatment for the majority of all subtypes consists of three phases : induction , intensification ( consolidation ) therapy , and continuation ( maintenance ) treatment .
although two - thirds of childhood cases are curable with only 12 months of treatment , the vast majority of patients undergo therapy for two years or more 9 . across medical institutions ,
chemotherapeutic agents used vary in type and amount , with the most common being methotrexate ( mtx ) , cytosine arabinoside ( cytarabine ) , anthracyclines ( such as doxorubicin ) , asparaginase , mercaptopurine , vincristine , and corticosteroids , presented alone or in combination 9 .
cranial irradiation , or cranial radiation therapy ( crt ) , once the most common form of cns prophylaxis , has largely been replaced by intrathecal ( it ) and systemic chemotherapy . this change has been made in an effort to eliminate radiation - specific damage to the cns 14 .
recent regimens have tested whether crt can be eliminated completely from standard treatment . to date , this has been successful , although alterations in long - term outcome are just beginning to unfold 15 .
childhood all and its treatments are associated with poor academic outcome , with age at diagnosis being the most important education - related risk factor
. one study of infant leukemia , defined as children diagnosed at age 12 months or younger , found that 50 percent exhibited learning deficits more than five years after diagnosis , and the risk increased for each month younger in age at the time of treatment 16 .
survivors of all have a greater likelihood of being placed in a special education program , earn lower grades in school on average , and reach a lower educational level than their siblings 17,18 .
while all treatment during childhood is related to overall poor academic performance , clear learning deficits may not arise until four or five years after the initiation of treatment 19 .
interestingly , poor academic performance is not correlated with frequent absenteeism from school , as may seem to be a plausible explanation due to intensive treatments 20 .
given the fact that past treatment for all commonly included crt , the majority of studies on this topic have included radiation as part of participant treatment , but rarely without simultaneous use of chemotherapy 2 .
general measures of intellectual functioning were used in these studies , such as the wechsler intelligence scales 21 .
reports of scores declining for at least seven years following treatment including cranial irradiation have been noted 22 .
it has been suggested that childhood cancer survivors display a decreased rate of learning new information and acquiring new skills , leading to a decline in iq score 2,23 .
comparisons between cns prophylaxes involving crt or it therapy have yielded mixed results , with several studies finding no significant difference between treatment groups .
for example , while a 12-point difference in mean iq score was found between all patients and controls , including sibling and solid tumor control groups , this result was irrespective of cns prophylaxis type 24 .
the observation that the radiation and non - radiation treatment groups both demonstrated deficits may indicate synergistic effects between mtx and cytarabine , with the latter increasing the neurotoxic effects of the former , creating a result similar to crt . along these lines ,
no significant influence of treatment group was found between children who received it mtx in addition to systemic ( iv ) mtx , a lower dose of crt , or a higher dose of crt , although 22 to 30 percent of children displayed a clinically significant decline in iq 23 .
other chemotherapeutic agents were used in later phases of treatment , however , which may have played a role in the findings . alternatively , systemic mtx may potentiate the neurotoxic effects of it mtx by affecting the brain via indirect pathways 25 .
high doses of mtx administered iv may reduce vascularization of the brain , particularly hippocampal blood vessel density 26 .
loss of intellectual functioning , characterized by iq level , is considered to be secondary , resulting from a range of core deficits . among these
most studies examining neurocognitive impairments in all survivors have focused on deficits in attention , since severe attentional problems occur in approximately one - quarter of survivors , though findings vary depending on the specific subtype of attention examined 27 .
deficits in the targeting , recalling , and manipulating of information to guide goal - directed behavior have been noted up to seven years post - treatment 28,29 .
in addition , all survivors performed poorly on a visual attention task , which required the child to shift attention between the local and global level of stimuli 30 .
children diagnosed younger than 54 months of age exhibit difficulties in both fundamental and complex attention skills .
children diagnosed older than 54 months of age have difficulty with more complex skills only , such as active mental switching and sustained attention 31 .
it should be noted , however , that deficits in more complex skills likely arise from reduced fluency in simpler , component skills , even if these types of deficits did not reach significance .
in addition to age at diagnosis , treatment intensity also may impact attentional functioning , with children given intensified treatments displaying more extensive and widespread difficulties 32 . from a developmental standpoint , disruption in basic skills may not become apparent until difficulties with higher - level abilities surface years later , when emergence of complex repertoires from component skills do not occur in normal progression .
one proposed theory of all survivors ' decrease in iq level links the cognitive skills of processing speed , working memory , and fluid intelligence , with processing speed playing a significant role in the development of working memory 33 . in turn , working memory underlies the development of higher - level reasoning and fluid intelligence .
evidence for impaired working memory and slowed information processing has been found for all survivors given chemotherapy - only treatment , especially when multiple pieces of information are involved 34,35,36,37 .
although the substitution of it chemotherapy for cranial irradiation has possibly reduced the severity of the impairments outlined above 38,39 , evidence of long - term neurocognitive deficits in all survivors still exists 10,11,36 .
one such study examined the learning and academic functioning of children who received chemotherapy alone as treatment for all .
as compared to newly diagnosed patients , children who had completed a 3-year chemotherapy - only regimen showed greater cognitive impairments and were more likely to have diagnosable learning disabilities as well , despite the fact that no learning difficulties had been identified for these children prior to their all diagnosis 19 . in a comparison of it mtx and triple it therapy ( including mtx , cytarabine , and hydrocortisone ) , no significant difference in level of cognitive impairment was found between groups , although the mtx group displayed a slightly slower processing speed 40 .
recent studies suggest that up to 40 percent of childhood cancer survivors given chemotherapy - only treatment may experience neurocognitive deficits years later 4 .
much of the clinical findings from longitudinal studies on the impact of chemotherapy - only treatment for all have been inconsistent , possibly because of differences among methodological approaches and medical protocols .
there are multiple methodological challenges in longitudinal cognitive assessment , such as selection of appropriate neurocognitive domains and control groups , differences in criteria for impairment , and repeated testing 41 .
it is suggested that the percentage of all survivors experiencing neurocognitive deficits may rise to 70 percent depending on the specific type of cognitive domain assessed , particularly in the area of working memory 42 .
in addition , all treatment protocols often differ in a multitude of ways , leaving the question of which agents and doses affect neurocognitive outcome largely unknown 11,12 . given that treatment
is comprised of multiple phases , each with a unique combination of drugs , it has been demonstrated that even a single agent substitution within the complex protocol alters whether or not cognitive late effects appear 43 .
neurophysiological evidence for deficits common among childhood all survivors have implicated white matter abnormalities , which may result from a disruption of the myelinization process occurring during childhood 2 . along with white matter hypodensity , mtx also causes leukoencephalopathy , multiple necrotic lesions in the periventricular white matter 13,44 .
behavioral symptoms correlated with this type of injury occur gradually over time , beginning with decreased attentiveness and leading to intellectual decline 45 .
impairment in attentional abilities accounted for a significant amount of the variance relating to reduced volumes of normal - appearing white matter and iq 46 .
moreover , cumulative ( 12 to 30 ) it doses of mtx correlates positively with deficits observed in neuropsychological tests of iq , attention , and concentration 47 .
the identification of folate pathway genetic polymorphisms that predict childhood cancer patients at - risk for developing attentional impairment following mtx treatment is underway 27 . in general , myelinization appears to follow functional maturation across brain regions 48 . during childhood ,
one area of the brain undergoing a significant amount of myelinization is the frontal lobe 2 .
since myelinization in this area typically occurs later in development , and the mature frontal lobe characteristically has a high volume of white matter , it may be more vulnerable to damage early in life . volumetric reductions of the dorsolateral prefrontal cortices , along with the mammillary bodies and caudate nuclei , were examined in survivors three years post - treatment who had received it chemotherapy 49 . despite no significant difference in global volumetric brain size , a reduction was found in both the mammillary bodies and dorsolateral prefrontal cortices .
the caudate nuclei , thought to develop earlier , were not significantly different in structure from controls .
this pattern of abnormality corresponds to noted deficits of memory , processing speed , distractibility , and attention in childhood all survivors .
advanced neuroimaging techniques that allow for more precise measurement of myelin integrity and degradation have been proposed for use in this population , which include diffusion tensor imaging , quantitative magnetization transfer imaging , and quantitative multiple exponential t2 measurements 42 . when studied in vitro , primary , non - cancer cells were more vulnerable to the toxic effects of cytarabine , bcnu , and cisplatin than cancer cells . at a dose equivalent to a low - dose cancer treatment regimen ,
similarly , at a dose equivalent to the lower end of a high - dose cancer treatment regimen , nearly all oligodendrocytes were killed along with 50 percent of glial - restricted precursor cells 50 .
recent evidence supports that chemotherapeutic agents once thought unable to readily cross the blood - brain barrier , including doxorubicin , reduce neural cell proliferation in the dentate gyrus 51 .
this mechanism has not yet been evaluated from a developmental standpoint , which is important to consider since the blood - brain barrier of a child is still undergoing development and is therefore more susceptible to chemotherapy - induced cns damage . a multitude of potential mechanisms underlying chemotherapy - induced cognitive deficits have been proposed , although not specifically in relation to childhood cancer survivors .
in addition to white matter damage and reduced cell proliferation discussed above , proposed additional mechanisms include increased oxidative stress , neuroinflammation , reduced blood flow , deregulation of the immune response , and deficits in dna - repair mechanisms [ 52,53 for extensive reviews ] .
examining the deleterious effects of chemotherapeutic agents and correlating these effects with behavioral measures using neural cells , immature brains , and mature brains may provide valuable insight into the mechanisms underlying cognitive late effects in all survivors .
it is not feasible in a human patient population to conduct the type of empirically valid research study that is needed to answer the interrelated questions of which drugs , combinations , or doses are most at risk . besides the ethical implications of tampering with treatment regimens that have proven successful in curing all , assessment of improved cognitive outcome would take years 54
additionally , it is difficult to separate drug effects from other factors , such as physiological consequences of cancer or patient depression 55 .
another option , that of retrospective studies , does not take into consideration the most recent treatment protocols currently in use .
furthermore , this type of evaluation does not capture the developmental trajectory of the drug effects in question , a particularly important factor related to childhood cancer survivors .
an alternative method to study disruption of learning processes by chemotherapeutic agents is through the use of preclinical models .
this type of paradigm allows drug effects to be addressed independently of other possible contributing factors , and provides a rapid way to evaluate many drugs , both in terms of type and dosage . with an average lifespan of about two years ,
although many past studies involving chemotherapeutic agents and rodent models have involved drug administration of a single agent 56,57,58 , rodent models make it possible to study drug combinations , thus providing a more accurate model of current protocols for childhood cancer treatment . underlying mechanisms of chemotherapy - induced neurotoxicity such as decreased cell proliferation can only be studied using preclinical models .
drugs that may prevent or alleviate deleterious effects resulting from chemotherapeutic treatment also can be evaluated .
for example , there is an emerging literature examining methylphenidate as a possible treatment for cognitive late effects in the childhood cancer survivor population 59,60,61 .
in addition , sex differences among drug effects can be examined in rodents , for there is some evidence to suggest that girls are more susceptible to the neurotoxic effects of these agents 62 . while studies examining the mechanisms for chemotherapy - induced neurotoxicity in clinical studies are limited , preclinical models in adult rodents have demonstrated that mtx and cytarabine manage to cross the blood - brain barrier following various routes of administration .
for instance , cell death and disruption of cell division occurs in vivo following three systemic injections of cytarabine in mice 50 . a single iv dose of mtx ( 37.5 - 300 mg / kg ) dose - dependently reduces hippocampal cell proliferation in rats . as the hippocampus is important for learning and memory , detrimental effects on cognitive performance are likely to result if neurogenesis is disrupted .
this theory was supported by impairment following mtx treatment on the morris water maze and novel object recognition tasks , designed to measure spatial and working memory , respectively 63 .
furthermore , intracerebroventricular injections of mtx administered for three alternative days to rats resulted in lowered concentrations of hippocampal brain amines .
these findings correlated with results from a conditioned avoidance task , in which adult rats treated with mtx failed to learn to avoid an aversive stimulus relative to controls 64 .
rodent studies have also examined the impact of mtx on the younger , developing brain .
for example , mtx ( 0.05 mg / kg or 0.1 mg / kg , i.p . ) administered during a critical period of brain development in rat pups leads to a reduced density of synapses in the ca3 field of the hippocampus 65 .
additionally , a model of mtx encephalopathy in young rats was developed by administering intraventricular injections of mtx ( 1 or 2 mg / kg ) .
five repeated doses produced neuropathological changes similar to the damage seen in human patients 66 . however , no behavioral measures of learning were included in these studies .
preclinical models have been useful to investigate chemotherapy - induced deficits in learning and memory using adult models of breast cancer treatment within a variety of behavioral assays 67,68,69,70 .
these studies have important implications for other treatment protocols composed of multiple drug agents , such as all .
for instance , the use of rodent models has highlighted the possibility of drug synergisms , i.e. , drug combinations that have a greater effect than either drug alone .
while some regimens include drugs known to have specific synergistic effects that aid in treating the cancer itself , unwanted side effects , including cognitive deficits , may result as well 67 .
strategies for attenuating chemotherapy - induced cognitive deficits have been examined in rodent models , including the use of anti - depressants such as fluoxetine to block decreased cell proliferation following treatment with 5-fluorouracil 71 .
findings from these types of studies will help physicians make informed choices about treatment options that reduce or eliminate chemotherapy - induced cognitive deficits , as well as ways in which to treat these impairments should they arise 69 .
studies using rodent models to elucidate the effects of childhood cancer treatment in young pups have been much more limited .
it is exceedingly important to study treatment in developing rodent brains , since neonatal damage has been found to have more severe long - term effects than identical damage in the mature adult rodent brain 73 .
although studies addressing the influence of mtx on the developing rodent brain exist , few include behavioral measures . additionally , previous models of childhood treatment have generally focused on an acute administration of a single chemotherapeutic agent , typically mtx . of the studies that do include behavioral measures of young pups , many entail assays that seem loosely tied and functionally disconnected from the actual deficits displayed in human childhood cancer survivors .
for instance , the first assessment of cancer treatment on developing brains used young rat pups at pnd 17 , an age selected because of developmental similarities to human infants .
treatment included crt alone ( 1,000 r ) , mtx alone ( 5 mg / kg , i.p . ) , or a combination of crt and mtx .
testing with a simultaneous discrimination task began when the rats were 12 - 14 weeks old .
findings demonstrated that only animals receiving a combination treatment were significantly slower to reach criterion , compared to the rest of the groups 57 .
however , in contrast to all treatment protocols that include multiple phases of therapy , typically over the course of two years , this study tested a single dose of radiation and/or mtx . according to the authors , this
was done because the cns of rats this age develops at an exceedingly fast rate .
this limitation is shared among the majority of studies using rodent models to investigate childhood cancer treatment in young pups . in another study ,
rat pups 16 - 17 days old were treated with a single dose of mtx ( 0.005 mg / kg , i.p . ) . at 12 - 14 weeks of age ,
rats also were tested on a conditioned taste aversion task , in which a previously highly palatable fluid was paired with illness .
mtx - treated animals failed to display a taste aversion following the first trial , compared to controls , but were equal to controls by the second trial .
given the above results , it was concluded that neonatal rats administered mtx were slower to learn about environmental events 58 .
in contrast , no impairments were found in 17-day - old rat pups treated with mtx ( 0.005 mg / kg , i.p . ) in a similar conditioned taste aversion task , although a different strain of rats was studied .
likewise , no impairment was found on a more complex pavlovian conditioning task focusing on negative discrimination 56 .
as already addressed , given the fact that childhood cancer regimens consist of an array of drugs , it is essential to examine possible interactions that may exist among them .
this issue was tackled by studying rats in nine different treatment combinations of mtx ( 2 or 4 mg / kg , i.p . ) , prednisolone ( 18 or 36 mg / kg , i.p . ) , and crt ( 1000 cgy ) , treated at pnd 17 - 18 74 .
steroids such as prednisolone are commonly included among the drugs used in all treatment , particularly in double and triple it therapy , and there is evidence to suggest that glucocorticoid steroids potentiate hippocampal damage caused by neurotoxins 75 . in this study ,
spontaneous behavior was measured for behavioral initiations , as well as time distribution and the sequence of behavioral acts .
effects also were dose and sex - dependent , with females displaying altered behavior at lower doses than males 74 .
this is consistent with clinical literature suggesting girls may be more susceptible to the aversive effects of these drugs 62 . while prednisolone antagonized mtx , thereby preventing behavioral alterations , at low doses , prednisolone enhanced mtx and crt - related deficits at high doses 74 .
in addition to mtx , cytarabine , vincristine , doxorubicin , and l - asparaginase are commonly mentioned in clinical studies as being part of all chemotherapeutic treatment , but information pertaining to the individual contributions of these agents to neurocognitive deficits is limited .
these types of evaluations are difficult to assess through clinical studies given that chemotherapeutic agents are often combined .
therefore , the potential involvement of cytarabine , vincristine , doxorubicin , and l - asparaginase can not be dismissed for their contributions to neurocognitive deficits .
preclinical models have provided evidence of cognitive disruption following administration of these drugs , though research remains limited to adult rodents . to date , cytarabine produced impairment in long - term spatial memory in rats 30 days post - training , but not 1 day post - training , on the morris water maze 76 .
preclinical research involving vincristine has largely been discussed in relation to disrupted sensory processing , including neuropathies and mechanical sensitivity 77 , but impairment in spatial learning as measured by the morris water maze has been noted at high doses 78 .
when administered alone , doxorubicin treatment led to impairment in inhibitory avoidance conditioning in rats , but not on a passive avoidance task in mice 79,80 . in combination with cyclophosphamide ,
the link between l - asparaginase and cognition has not yet been examined , but is an important factor to consider for future research in this area .
the individual effects of specific corticosteroids , commonly used in combination with chemotherapeutic agents , are correlated with poor cognitive outcome as well .
for example , children treated with dexamethasone may be at greater risk for neurocognitive late effects , compared to children treated with prednisone 43 .
limitations of preclinical models of childhood cancer treatment are obvious as several factors complicate this type of research .
for instance , the early stages of rodent life are not yet definitively mapped out , although there are some guidelines about developmental milestones such as reflexes and locomotor behavior 83 , and age equivalences for the adolescence period in rodents have been proposed 84 .
development of the blood - brain barrier and lack of certain enzymes at early stages will impact how chemotherapeutic agents are metabolized by the body , as well as how the brain is affected .
decisions about dosage and route of administration also need to take these developmental aspects into account and limited pharmacokinetic and pharmacodynamic models are available .
additionally , the short lifespan of rodents means that progression through stages occurs at an accelerated rate .
this fact needs to be taken into consideration when choosing behavioral assays , as well as when selecting the points along the lifespan that rodents are to be tested .
nevertheless , use of adult rodents to study the effects of childhood cancer does not take into consideration treatment impact on a developing brain , as opposed to one that is already matured , and is therefore a less valid model .
translational research entails basic science and clinical practice working together , with each informing the other . building a bridge between clinical and preclinical research
would greatly improve the study of chemotherapy - induced cognitive effects of childhood cancer treatment . while this philosophy has been applied to models of adult cancer ,
future preclinical research in this area should aim to provide a more accurate model of clinical treatment through alterations in drug selection , treatment regimen , and behavioral measures .
since mtx and cytarabine are commonly administered together during cns prophylaxis in all treatment , it would be valuable to investigate the effects of this specific combination of chemotherapeutic agents .
preclinical models are ideal for parsing apart the individual and combined effects on learning and memory of lesser - studied chemotherapeutic agents used in all treatment , such as vincristine , doxorubicin , and asparaginase
. repeated administration of these agents can be examined by treating pre - weanling pups on multiple consecutive days early in development , rather than a single administration of treatment .
rodents can be assessed during various stages of development , including adolescence ( pnd 35 ) and adulthood ( pnd 60 ) , to examine long - term effects of early neurotoxicity . in order to advance this area of research ,
appropriate behavioral assays need to be selected that characterize the neurocognitive deficits experienced by all survivors .
since the exact mechanisms of chemotherapy - induced cognitive impairment are not yet fully understood , a battery of preclinical assays of learning and memory should be studied , as sensitivity to chemotherapy - induced cognitive deficits differs among tasks in models of adult chemotherapeutic treatment 53 .
paradigms used in rodent models of childhood cancer treatment are much more limited and have typically focused on respondent conditioning .
evaluating effects on instrumental conditioning will provide new insight into the type of learning processes impaired by chemotherapeutic treatment .
impairment on an autoshaping - operant procedure has been demonstrated following treatment with mtx and 5-fluorouracil in adult mice 67 , whereas no impairment was found on the five choice serial reaction time task following treatment with paclitaxel 85 . while both of these tasks measure instrumental conditioning , the two procedures differ in terms of length of training .
this distinction would be interesting to examine within a developmental context , both in regard to learning deficit as well as potential rehabilitation .
other cognitive assessments that have demonstrated impairments following adult chemotherapeutic treatment are useful for a developmentally - focused model of all , such as novel object recognition and the morris water maze , which measure working and spatial memory , respectively 76,86 .
it is particularly important to include tasks of sustained attention or vigilance , as these deficits are pervasive among childhood cancer survivors .
in addition to the five choice serial reaction time task previously discussed , the go / no - go task also measures sustained attention through reinforcer delivery being contingent upon responding in the presence of a cue 87 .
the validity of using healthy animals to study chemotherapy - induced neurotoxicity is supported by the finding that tumor presence does not potentiate a mtx - induced decrease of cell proliferation in the hippocampus 88 .
a logical next step will be to investigate learning deficits using a model bearing an all - related cancer .
however , using immunosuppressed rodents may create a new set of challenges for conducting behavioral testing , particularly if equipment is shared with rodents that do not have a compromised immune system .
in summary , with survival rate for childhood cancers on the rise , it is imperative that new research focuses on what happens after a child enters into remission .
as has been recommended by the children 's oncology group , it is essential that children and their parents be informed of potential late effects 1 .
survivors need to be closely monitored by healthcare workers and school personnel for emerging medical complications and/or academic difficulties , which , as noted in the current review , may not arise until several years after treatment has ended .
further guidelines relating to childhood cancer survivors are outlined in the long - term follow - up program resource guide , available online from the children 's oncology group 1 .
attempts to create reliable and valid assessment tools that can quickly identify at - risk survivors are currently underway 89 .
additionally , assessment of current multiple - phase treatment protocols is needed to evaluate specific drug effects that may contribute to cognitive late effects .
these findings will help physicians make informed choices about treatment options that reduce or eliminate chemotherapy - induced neurocognitive deficits , including attention and working memory , the presence of which have been supported by both behavioral and neurophysiological evidence .
this effort will be greatly facilitated through converging lines of research from both the clinical and preclinical literatures .
currently , a child 's fight with cancer does not end with remission , but hopefully , with new efforts focusing on research in the area of late effects , one day it will .
Output:
| objective : with the survival rate of acute lymphoblastic leukemia ( all ) surpassing 90 percent within this decade , new research is emerging in the field of late effects .
a review of the research investigating the relationship of treatment regimens for all to specific late effect deficits , underlying mechanisms , and possible remediation is warranted to support continued studies.methods : the clinical literature was briefly surveyed to describe the occurrence and topography of late effects , specifically neurocognitive deficits .
additionally , the preclinical literature was reviewed to uncover potential underlying mechanisms of these deficits .
the advantages of using rodent models to answer these questions are outlined , as is an assessment of the limited number of rodent models of childhood cancer treatment.results : the literature supports that childhood survivors of all exhibit academic difficulties and are more likely to be placed in a special education program .
behavioral evidence has highlighted impairments in the areas of attention , working memory , and processing speed , leading to a decrease in full scale iq .
neurophysiological and preclinical evidence for these deficits has implicated white matter abnormalities and acquired brain damage resulting from specific chemotherapeutic agents commonly used during treatment.conclusions : the exact role of chemotherapeutic agents in learning deficits remains mostly unknown .
recommendations for an improved rodent model of learning deficits in childhood cancer survivors are proposed , along with suggestions for future directions in this area of research , in hopes that forthcoming treatment regimens will reduce or eliminate these types of impairments . |
PubmedSumm118458 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input:
Output:
| virus capsids are
protein shells that package the viral genome .
although their morphology and biological functions can vary markedly ,
capsids often play critical roles in regulating viral infection pathways .
a detailed knowledge of virus capsids , including their dynamic structure ,
interactions with cellular factors , and the specific roles that they
play in the replication cycle , is imperative for the development of
antiviral therapeutics .
the following perspective introduces an emerging
area of computational biology that focuses on the dynamics of virus
capsids and capsid protein assemblies , with particular emphasis
on the effects of small - molecule drug binding on capsid structure ,
stability , and allosteric pathways . when performed at chemical detail
,
molecular dynamics simulations can reveal subtle changes in virus
capsids induced by drug molecules a fraction of their size . here ,
the current challenges of performing all - atom capsid drug simulations
are discussed , along with an outlook on the applicability of virus
capsid simulations to reveal novel drug targets . |
PubmedSumm118459 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: tumor necrosis factor alpha ( tnf ) antagonists are an effective treatment for a variety of inflammatory and autoimmune diseases , and they are commonly administered to patients with rheumatoid arthritis ( ra ) , ankylosing spondylitis and psoriatic arthritis . however , in some cases , treatment with tnf antagonists induces the onset of a new autoimmune disease . as these agents are being used for an expanding number of diseases and for longer periods , this phenomenon has also been increasingly noticed .
these agents have been reported to induce lupus , vasculitis , interstitial lung disease , psoriasis , sarcoidosis , autoimmune hepatitis and myopathy [ 1 , 2 ] .
sarcoidosis is characterized by noncaseating granulomas , and although it primarily affects the lungs and lymph nodes , any organ may be involved .
induced sarcoidosis has been reported in association with infliximab , etanercept and adalimumab [ 1 , 2 , 4 ] .
certolizumab is a new tnf antagonist which has been proven to be effective in the treatment of ra .
a review of the literature revealed no previous occurrence of sarcoidosis induced by this agent .
we report the first case of certolizumab - induced uveitis , highly suggestive of ocular sarcoidosis , and review the literature relevant to the pathogenesis of this adverse effect .
a 64-year - old woman was referred to our clinic due to bilateral reduced visual acuity ( va ) , mainly in her left eye .
the patient 's medical history was significant for seropositive ra , which had been well controlled for the previous 3 years under treatment with methotrexate and certolizumab ( cimzia ) .
the patient complained of a mild reduction in va in both eyes during the previous year and noticed a significant reduction in her left eye ( which occurred 1 week prior to her presentation ) .
initial examination revealed a va of 20/32 in the right eye and 20/100 in the left eye .
anterior segment examination revealed no corneal keratic precipitates , mild ( + 1 ) flare in the anterior chambers and posterior synechiae bilaterally ( fig .
dilated fundus examination revealed vitreal cells and haze , which were present bilaterally , but more distinct in the left eye .
1c , d ) and peripheral retinal punched - out lesions were visible ( fig .
intraocular pressure ( iop ) was 21 mm hg in the right eye and 30 mm hg in the left eye .
the integration of the clinical signs at presentation led to a working diagnosis of ocular sarcoidosis , possibly associated with anti - tnf treatment .
angiotensin - converting enzyme ( ace ) levels were mildly elevated ( 61 u / l , normal range 1051 u / l ) .
physical examinations and chest x - rays were normal , and so was the pulmonary function test .
the patient was also examined by an expert pulmonologist who ruled out any lung disease .
she was treated with topical steroid drops as well as anti - glaucoma medication . by doing so
, an improvement of the anterior uveitis and a normalization of the iop were achieved . in coordination with the rheumatologist ,
two months after the discontinuation of certolizumab , the uveitis had decreased and va had improved to 20/32 in both eyes . nevertheless , the macular edema persisted and the patient underwent periocular injections of 40 mg triamcinolone acetonide ( triesence ; alcon inc . ) in both eyes , with a partial resolution of the macular edema ( fig .
one year after her initial presentation , the patient 's ra is well controlled , and the change in systemic treatment did not result in any exacerbation .
her va remains 20/32 in both eyes , and iop is 17 mm hg in both eyes ( under topical treatment ) .
the macular edema has improved , but still remains significant and is likely the cause of her impaired va ( fig .
tnf has a significant role in the pathogenesis of granulomas ; tnf antagonists have been reported to be effective in the treatment of refractory sarcoidosis .
it is therefore paradoxical that such agents would also induce sarcoidosis , but this complication has been previously documented [ 1 , 2 , 4 ] .
tnf-induced sarcoidosis may not demonstrate all the systemic manifestations of the disease and may involve only 1 organ .
several case reports have been published describing pulmonary [ 7 , 8 , 9 ] or cutaneous [ 10 , 11 ] sarcoidosis following treatment with tnf antagonists .
it is a recombinant , polyethylene glycolylated , antigen - binding fragment of a humanized monoclonal antibody that selectively targets and neutralizes tnf .
infliximab and adalimumab are monoclonal antibodies directed toward tnf , and etanercept is a tnf - receptor - fusion protein conjugated to the fc portion of human igg .
certolizumab is essentially different from these other tnf antagonists since it is not a full antibody and does not include an fc portion that may be immunogenic .
our patient had no previous history of sarcoidosis and had not received any other tnf antagonists that may have induced it .
the patient presented with 4 ocular signs of sarcoidosis ( synechiae , vitreous opacities , multiple peripheral chorioretinal lesions and a bilaterality of involvement ) , associated with a mildly elevated ace . according to the international criteria for the diagnosis of ocular sarcoidosis ,
3 suggestive intraocular signs and 2 positive investigational tests are required to diagnose a probable ocular sarcoidosis .
since our patient had no other typical signs and only 1 positive test , a diagnosis of ocular sarcoidosis could not be made with any certainty , but it was evident that significant bilateral uveitis was present and the constellation of ocular findings and elevated ace are suggestive of ocular sarcoidosis .
the fact that the onset of ocular involvement followed the initiation of certolizumab supports the observation that the uveitis was induced by this agent and improved after its cessation .
although uveitis is a possible complication of ra , the ocular findings in this case are not typical for ra , but instead are highly suggestive of a diagnosis of sarcoidosis .
it is worthwhile to note that the simultaneous occurrence of ra and sarcoidosis is extremely rare .
these facts further imply certolizumab as the cause of induced uveitis in this patient . following cessation of certolizumab ,
the macular edema did not resolve completely ; however , residual edema may persist after the inflammatory process is stopped , and in this patient , it is also possible that the presence of an epiretinal membrane precluded its complete resorption .
the patient had a normal chest x - ray and pulmonary function ; only her eyes were involved in the induced inflammation .
for this reason , there was also no way to perform a biopsy to pathologically demonstrate the diagnosis of sarcoidosis .
it should be noted that sarcoidosis may involve any organ or it can be limited to the eyes only . the same is true for induced sarcoidosis , which may be limited to 1 organ [ 4 , 7 , 8 , 9 , 10 , 11 ] .
for example , it has been reported to present very atypically and involve just the hypopharynx .
this is the first case report of induced uveitis , suggestive of ocular sarcoidosis , secondary to treatment with certolizumab .
ocular involvement associated with autoimmune disease induced by tnf antagonists is relatively rare , and ocular involvement from tnf-induced sarcoidosis has only been reported once .
cessation of certolizumab resulted in gradual improvement and should be recommended in similar cases ; its use caused a new autoimmune disease .
it should be noted that the patient required additional topical treatment as well as periorbital injections of steroids ; extraocular involvement may have required systemic therapy .
rheumatologists and ophthalmologists should be aware of the possibility of induced uveitis by tnf antagonists , and this case report demonstrates that this complication may also occur with certolizumab .
rheumatologists should also be aware that it may only involve 1 organ and inquire about changes in va .
they should refer their patients for an ophthalmic examination if any ocular involvement is suspected .
Output:
| we report the case of a 64-year - old woman with rheumatoid arthritis and bilateral visual deterioration .
the patient had been treated with certolizumab , a new tumor necrosis factor alpha ( tnf ) antagonist , and her findings were consistent with bilateral uveitis , suggestive of sarcoidosis . here , we review the literature on tnf antagonist - induced sarcoidosis and report the first case of uveitis induced by certolizumab .
awareness of the possibility of this unique complication is important for both rheumatologists and ophthalmologists who treat patients with this new agent . |
PubmedSumm118460 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the organic anion transporting polypeptides ( oatps ) are a family of membrane transport proteins capable of transporting an array of structurally diverse endogenous and xenobiotic compounds [ 13 ] .
the proteins are expressed in a variety of tissues , including absorptive / excretory cells of the liver and kidney , acting as both a drug delivery and a drug detoxification system .
the human organic anion transporting polypeptide 1b1 ( oatp1b1 ) ( gene symbol slco1b1 , previously oatp2 , oatp - c , and lst-1 ) is expressed solely on the basolateral membrane of hepatocytes , facilitating the uptake of clinically relevant compounds such as antibacterial drugs , statins , and chemotherapeutic drugs .
as well as playing an important role in hepatic drug disposition , oatp1b1 also acts as an active drug delivery system for statins to the liver as a target organ .
the protein has been implicated in many drug - drug interactions , including those with cyclosporine a , rifampicin , and statins [ 810 ] .
many individual dna nucleotide changes known as single nucleotide polymorphisms ( snps ) have also been located in oatp1b1 , contributing to changes in the absorption , distribution , metabolism , and excretion ( adme ) of compounds [ 5 , 11 ] .
finally , studies have shown that in tumour tissues the normal liver specific oatp1b1 is highly expressed [ 12 , 13 ] , suggesting that this transporter may be a suitable target for tumour immunotherapy .
therefore knowledge of the structure and function of this transporter is imperative to understand how the delivery of xenobiotic compounds occurs .
oatp1b1 has been previously predicted by topology prediction analyses to contain 12 transmembrane domains ( tms ) and intracellular amino ( n ) and carboxyl ( c ) termini [ 2 , 14 ] .
meier - abt et al . modeled oatp1b3 on the major facilitator superfamily transporters , glycerol-3-phosphate ( glpt ) and lactose permease , also predicting the 12-tm topology .
experimental analyses with epitope tagging have inferred that rat oatp1a1 has 12 tms and confirmed that the c - terminus of oatp1b1 is located intracellularly [ 16 , 17 ] .
the oatps are also characterized by a conserved 13 amino acid signature sequence ( d - x - rw-(i , v)-gaww - xg-(f , l)-l ) ( table 1 ) at the border between the extracellular loop 3 and tm 6 .
the position of this sequence at the tm interface , combined with the presence of three highly conserved tryptophan residues , suggests a potential role in stabilizing the protein within the membrane [ 19 , 20 ] . to date , only the portion of the sequence predicted to encompass tm6 has been studied ( a257 , w258 , w259 , l260 , n261 , f262 , and l263 ) [ 21 , 22 ] . mutation of w258 , w259 , and f262 to alanine in oatp1b1 showed a significant decrease in transport , suggesting a role in protein function .
tryptophan could be an important amino acid for determining the structure of a transmembrane protein owing to its nonpolar surface area , the capability for hydrogen bond formation , and a high electrostatic potential .
individual mutation of tryptophans w258 and w259 in human oatp1b1 to alanine however had differing effects on the transport of different substrates , but surface expression was unaffected .
in contrast , when the equivalent tryptophans were mutated individually and as a double mutant to phenylalanine in rat oatp1c1 , protein function was preserved [ 21 , 22 ] . in this study ,
the topology of oatp1b1 was predicted using homology modelling software and the consensus of 10 topology prediction programs .
these results were used to predict the position of the tms and the signature sequence .
the programs predicted a 12-tm protein with the signature sequence spanning the extracellular loop 3 and tm 6 .
these results were then used to place a flag epitope into the extracellular loop 2 of oatp1b1 , for the detection of protein on the membrane .
the function of the oatp1b1 signature sequence was investigated by site - directed mutagenesis of the most conserved amino acids within the sequence d251 , w254 , w258/w259 , and n261a ( table 1 ) .
this included those predicted within extracellular loop 3 , d251 , and w254 , which have not been previously studied .
conservative mutations were made to the chosen amino acids to assess the importance of the amino acid for protein function .
therefore , the polar aspartic acid was mutated to glutamic acid ( d251e ) , both being negatively charged polar residues . the nonpolar tryptophans w254 and w258/259 were mutated to the structurally similar and aromatic phenylalanine ( w254f and w258/259f , resp . ) . in addition ,
asparagine 261 ( n261 ) in the oatp1b1 sequence is not conserved among the vast majority of the other oatps , where this residue is a nonpolar glycine . therefore n261 was mutated to alanine to investigate the role of this amino acid in the sequence .
transport function by oatp1b1 was measured using the radiolabelled substrate [ h]estrone-3-sulfate ( [ h]e3s ) and surface expression was detected via the flag epitope in hek293 t cells using luminometry , a quantitative chemiluminescence method , and confocal microscopy following immunofluorescence .
results revealed a significant reduction in surface expression and transport for the d251e , w254f , and w258/259f signature sequence mutants , with confocal microscopy revealing the protein to be retained intracellularly .
radiolabeled [ h]estrone-3-sulfate ( [ h]e3s ) ( 54.3 ci / mmol ) was purchased from perkin elmer ( ma , usa ) .
all other chemicals including the anti - flag antibodies were purchased from sigma aldrich ( dorset , uk ) , unless stated otherwise .
the topology of oatp1b1 was predicted using the online prediction programs topcons , phobius , tmpred , toppred ii , membrain , phdhtm , split 4.0 , philius , hmmtop , svmtm , conpred ii , sosui , tmhmm , tseg , pred - tmr , and memsat3 .
a homology model was generated using the protein homology / analogy recognition engine v 2.0 ( phyre2 ) , which modeled the oatp1b1 sequence on the known structure of glpt .
the slco1b1 gene was cloned into the mammalian vector pcdna3.1/hygro(- ) ( life technologies ltd . ,
an overlap extension pcr method was used to insert the 24-base dna sequence for the flag epitope ( dykddddk ) into the putative extracellular loop between tms 3 and 4 ( termed oatp1b1-flag ) .
the signature sequence mutations were made using overlap extension site - directed mutagenesis of the extracellularly tagged oatp1b1-flag construct , which was then used as the wild type .
flag primers were as follows : oatp1b1 n - term , 5-ttttttctcgaggccaccatggaccaaaatcaac-3 ; oatp1b1 c - term , 3-aaaaaaggtacctcccttaacaatgtgtttc-5 ; oatp1b1-flag , 5-caacatcaaccttatccactgattataaggacgacgacgacaagtgtttaattaatcaaattttatc-3 ( complementary ) .
complementary forward primers for the signature sequence mutants were as follows : d251e , 5-ggataactcctactgagtctcgatgggttgg-3 ; w254f , 5-ctactgattctaaatttgttggagcttggtgg-3 ; w258/259f , 5-cgatgggttggagctttcttccttaatttccttgtg-3 ; n261a , 5-ttggagcttggtggcttgctttccttgtgtctggactattctc-3. human embryonic kidney 293 t ( hek293 t ( atcc , manassas , va ) ) cells were grown at 37c with 5% co2 in dulbecco 's modified eagles medium , supplemented with 10% fbs ( life technologies , paisley , uk ) , 1x penicillin - streptomycin , 250 g / ml amphotericin - b , 2 mm l - glutamine , and 1x nonessential amino acids solution .
cells at ~80% confluence were harvested using 1x accutase solution ( millipore , watford , uk ) and transfected with the amaxa cell line nucleofector kit v using a nucleofector ii device ( lonza , preston , uk ) as per the manufacturer 's instructions , before plating at 1.6 10 cells / well in 12-well plates for transport assays and immunofluorescence or 3.3 10 cells per 35 mm dish for luminometry .
plates and dishes were precoated with 0.1 mg / ml poly - d - lysine .
cells in 12-well plates at 72 hours after transfection were removed from the incubator and the media were aspirated .
wells were washed three times with 300 l uptake solution ( 142 mm nacl , 5 mm kcl , 1 mm kh2po4 , 1.2 mm mgso4 , 1.5 mm cacl2 , 5 mm glucose , and 12.5 mm hepes to ph 7.3 ) , prewarmed to 37c .
cells were then incubated in 300 l 0.1 m [ h]e3s plus 01.5 m unlabeled substrate in uptake solution for 3 min at 37c .
each well was washed a further three times with ice cold uptake solution before the addition of 200 l 1% sds/0.5 m naoh and shaken overnight at room temperature to lyse the cells . for quantification 50
l cell / sds / naoh solution was removed and 200 l optiphase supermix scintillation cocktail ( perkin elmer , witney uk ) was added before measuring in a perkin elmer 1450 microbeta trilux liquid scintillation counter . the remaining solution was used to quantify protein levels using the bca protein assay kit ( merck , feltham uk ) . the [ h]e3s uptake was normalized to the protein content in each well , to give transport in pmol / mg protein/3 min .
kinetic parameters for transport of [ h]e3s by oatp1b1 were determined under initial rate conditions .
transport of [ h]e3s was measured in the presence of unlabeled e3s ( 01.5 m ) and mediated transport calculated by subtracting the uptake seen after transfection with the empty vector . the michaelis - menten equation was applied to obtain estimates of the maximal uptake rate ( vmax ) and the apparent affinity constant ( km ) .
cells in 35 mm dishes at 72 hours after transfection were washed and fixed with 1 ml 4% paraformaldehyde .
cells were then blocked with 1 ml 2% dry nonfat milk in pbs for 30 min , before incubating with 1 ml hrp - conjugated anti - flag antibody ( 1 : 1000 in milk buffer ) for 2 hours at room temperature .
dishes were washed twice with milk buffer then once with pbs before adding substrate ( pierce , loughborough , uk ) and analysing in a td-20/20 luminometer ( turner designs , alton , uk ) .
the cells were lysed with 1 ml of 1% sds/0.5 m naoh and shaken overnight at room temperature .
protein was quantified using the bca protein assay kit ( merck , feltham , uk ) to allow normalization of the luminescence values ( relative light units ( rlu ) to the protein content ( rlu / mg protein ) in each dish .
t cells were grown on 15 mm cover slips in 12-well plates for 48 hours after transfection .
wells were washed and cells were fixed by the addition of 4% paraformaldehyde , 4% sucrose for 15 minutes .
wells were washed with pbs three times for 5 minutes per wash . after blocking with 10% bsa in pbs for 30 minutes at 37c , cells were incubated with primary monoclonal mouse anti - flag antibody ( 1 : 2000 in 5% bsa / pbs ) for 2 hours at 37c .
wells were washed with pbs three times/5 min , followed by incubation with anti - mouse igg - fluorescein isothiocyanate ( fitc ) rabbit secondary antibody ( 1 : 1000 in 5% bsa / pbs ) for 45 minutes at 37c .
wells were washed with pbs three times/5 min . before mounting , wells were incubated with 1 g / ml 4,6-diamidino-2-phenylindole ( dapi ) for 2 minutes .
cover slips were mounted face down over mounting media containing 1,4-diazabicyclo[2.2.2 ] octane ( dabco ) on a standard glass slide .
slides were visualized on the x40 lens of a zeiss lsm 510 meta confocal microscope .
images were acquired with fixed settings to allow comparison between samples . statistical significance of data
was calculated using a two - tailed unpaired student 's t - test ( graphpad prism 5 , ca usa ) and statistical significance of normalized data was calculated using a two - tailed one sample t - test ( sigmaplot 11.0 , systat software , ca , usa ) , both with p < 0.05 as significant .
a screen of all available topology prediction programs was made to accurately predict the topology of oatp1b1 , to allow identification of an insertion site for the flag eiptope .
16 programs were evaluated , 10 of which predicted oatp1b1 to contain 12 tms with intracellular n and c termini ( topcons , phobius , tmpred , toppred ii , membrain , phdhtm , split 4.0 , philius , hmmtop , and svmtm ) .
the remaining 6 programs predicted 11 tms ( conpred ii , sosui , tmhmm , tseg , pred - tmr , and memsat3 ) , with tm4 from the 12-tm model not present in the 11-tm model .
homology modelling with the program phyre2 also gave a 12-tm prediction based on glpt , against which 65% of the oatp1b1 residues were modeled with > 90% confidence .
the tm regions were consistent with those predicted by the topology prediction software ( figure 1 ) .
the software giving 12 tms predicted the signature sequence to span the extracellular loop 3 from d251-a257 and tm 6 from w258-l263 ( figure 2 ) .
the combined topology results identified the putative extracellular loop between tms 3 and 4 for the insertion of the flag epitope ( figure 3 ) .
transport function of oatp1b1 was quantified by measuring the uptake of the radiolabeled substrate [ h]e3s into oatp1b1 transiently transfected hek293 t cells .
[ h]e3s uptake was linear up to 5 minutes ( figure 4 , inset ) ; therefore kinetic experiments were performed using a 3-minute uptake .
although biphasic kinetics is associated with oatp1b1 [ 44 , 45 ] , only the high affinity binding site was apparent under our experimental conditions ( 0.1 m [ h]e3s ) , with a km of 0.105 0.008 m and vmax of 50.1 10.9 pmol / mg protein/3 min ( figure 6(a ) ) , comparable to those found by other studies [ 46 , 47 ] .
luminometry experiments were performed to validate the extracellularly located flag epitope on the oatp1b1 protein in nonpermeabilized cells . a significant increase in luminescence
was observed in the oatp1b1-flag construct from the wild type oatp1b1 ( figure 5(a ) ) , confirming that the flag epitope was placed in an extracellular portion of the protein .
transport experiments with [ h]e3s were conducted to confirm that the oatp1b1-flag construct maintained function following the addition of the epitope .
[ h]e3s uptake was measured alongside the oatp1b1 wild type ( figure 5(b ) ) .
the oatp1b1-flag construct retained transport function , with rates of uptake comparable to the untagged ( no epitope ) oatp1b1 .
transport kinetics were performed with the oatp1b1-flag construct ( figure 6(b ) ) , producing a km of 0.159 0.049 m and vmax of 79.6 6.5 pmol / mg protein/3 min .
there was no significant difference between the km values obtained for the flag - tagged construct and the wild type transporter .
transport experiments were conducted to elucidate whether the oatp1b1-flag signature sequence mutants maintained function following site - directed mutagenesis .
uptake of [ h]e3s by the mutants was measured alongside the oatp1b1-flag construct ( figure 7 ) .
transport was significantly reduced from the oatp1b1-flag for d251e , w254f , and w258/259f mutants .
there was no significant difference in transport for n261a , nor were the kinetic parameters changed from the oatp1b1-flag ( n261a km 0.084 0.033 m , vmax 47.0 19.4 pmol / mg protein/3 min ) .
the low transport levels for the remaining mutants meant that kinetic data could not be accurately determined .
luminometry was performed on the d251e , w254f , w258/259f , and n261a signature sequence mutants to quantitatively measure surface expression in comparison to the nonmutated oatp1b1-flag construct ( figure 7 ) .
surface expression was reduced significantly compared to the nonmutated oatp1b1-flag for d251e , w254f , and w258/259f .
oatp1b1 expressing hek293 t cells were incubated with a primary anti - flag and secondary - fitc conjugated antibody .
figure 8 shows the confocal microscopy images recorded from each mutant , for comparison with the oatp1b1-flag positive control and oatp1b1 negative control .
the oatp1b1-flag control displayed predominantly membrane specific fitc fluorescence , as the n261a mutant did . for the remaining mutants , d251e , w254f , and w258/259f ,
oatp1b1 is one of the most influential members of the oatps , owing to its role in the transport of many clinically relevant compounds into the hepatocyte .
the transporter is central to the targeted drug delivery of statins , complicated by the presence of approximately 40 snps in the slco1b1 gene sequence .
it is likely that along with other hepatic transporters and enzymes oatp1b1 plays an important part in the adme of compounds .
therefore this particular transporter was apt for studying the structural characteristics responsible for protein function and surface expression .
oatp1b1 was predicted by 10 topology prediction programs and by glpt homology modelling to contain 12 tms with intracellular n and c termini .
this information allowed the introduction of a flag epitope in extracellular loop 2 to facilitate the detection of surface expression .
the 13 amino acid signature sequence is present in all oatps and is highly conserved between species .
its location at the interface between extracellular loop 3 and tm 6 suggests a structural role in protein folding and/or stability within the membrane .
unfortunately this region of oatp1b1 is not represented in the best phyre2 generated homology model , that with the crystal structure of glpt as the template , so site - directed mutagenesis was used to investigate the role of conserved residues in the signature sequence .
the highly conserved amino acids which form the signature sequence of oatp1b1 were found to be important for surface expression .
the introduction of d251e , w254f , and w258/259f to oatp1b1 significantly reduced surface expression and transport of [ h]e3s .
confocal microscopy showed that protein was in fact produced but was predominantly retained in the cytoplasm , suggesting a role of d251 , w254 , and w258/9 for protein folding and/or membrane localization .
these amino acids therefore are likely to have a structural rather than functional role in the protein .
tryptophan is a unique amino acid , exhibiting a large nonpolar surface area , the capability for hydrogen bond formation from the indole n h moiety and the greatest electrostatic potential for noncovalent interactions .
mutating tryptophan to phenylalanine dramatically reduced transport function , suggesting that the indole ring may be an important feature for hydrogen bonding and membrane stability in oatp1b1 [ 20 , 23 ] . in a previous study ,
our results therefore suggest that at least one tryptophan is required in this region of the protein , as functional expression is not affected upon single mutation of w258 or w259 to phenylalanine , but is abolished upon the double mutation .
however the double tryptophans in rat oatp1c1 retained wild type characteristics when mutated to phenylalanine , suggesting that different oatps may be able to function with the phenylalanine substitution .
the mutation of aspartic acid to glutamic acid ( d251e ) significantly reduced transport and surface expression .
as both amino acids are negatively charged polar residues , it may be that the extra methylene group in glutamic acid disrupted protein folding .
it has previously been reported that aspartic acid may interact with tryptophan more frequently than glutamic acid , following analysis of the spatial contacts and solvent accessibility of the amino acids .
therefore it may also be that mutating to glutamic acid may have changed the interactions with tryptophan , disrupting the structure .
d251e along with w254 was predicted to form part of the extracellular loop 3 , a region of the signature structure which has not previously been studied .
n261a was the only mutant to retain transport function and expression on the membrane , supported by a previous study , suggesting that the maintenance of a neutral charge is sufficient at this position .
the amino acids d251 , w254 , and w258/9 within the signature sequence of oatp1b1 are important for protein surface expression . site - directed mutagenesis and topology predictions are powerful tools for analyzing protein topology and structural and functional roles of amino acids as currently no mammalian drug transporters have been crystallized .
these results will contribute to the growing database of structural and functional information on the oatps and will inform their role in drug delivery .
Output:
| the organic anion transporting polypeptides ( oatps ) encompass a family of membrane transport proteins responsible for the uptake of xenobiotic compounds .
human organic anion transporting polypeptide 1b1 ( oatp1b1 ) mediates the uptake of clinically relevant compounds such as statins and chemotherapeutic agents into hepatocytes , playing an important role in drug delivery and detoxification .
the oatps have a putative 12-transmembrane domain topology and a highly conserved signature sequence ( human oatp1b1 : dsrwvgawwlnfl ) , spanning the extracellular loop 3/tm6 boundary .
the presence of three conserved tryptophan residues at the tm interface suggests a structural role for the sequence .
this was investigated by site - directed mutagenesis of selected amino acids within the sequence d251e , w254f , w258/259f , and n261a .
transport was measured using the substrate estrone-3-sulfate and surface expression detected by luminometry and confocal microscopy , facilitated by an extracellular flag epitope .
uptake of estrone-3-sulfate and the surface expression of d251e , w254f , and w258/259f were both significantly reduced from the wild type oatp1b1-flag in transfected hek293 t cells .
confocal microscopy revealed that protein was produced but was retained intracellularly .
the uptake and expression of n261a were not significantly different .
the reduction in surface expression and intracellular protein retention indicates a structural and/or membrane localization role for these signature sequence residues in the human drug transporter oatp1b1 . |
PubmedSumm118461 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: emerging evidence has indicated that cancer is a genomic disease caused by diverse alterations in oncogenes and tumor suppressors associated with oncogenic signaling pathways ( garraway et al . , 2013 ) .
recent advances in high - throughput sequencing technologies have elucidated the mutational landscape of several cancers and provided a comprehensive catalogue of cancer genes ( bell et al .
, 2011 ; koboldt et al . , 2012 ; muzny et al . , 2012 ; verhaak et al . , 2010 ; weinstein et al . ,
2013 ) . these and other genomic analyses of cancers have demonstrated that cancer is often a highly heterogeneous disease , even with respect to genomic mutation levels and tumor histology in the same cancer type .
however , traditional cancer classification based on the cellular origin of tumors and on tumor histology can not explain these heterogeneous characteristics .
this widespread heterogeneity can explain , to some degree , why some patients with a given cancer type are more or less resistant to a particular therapy than other patients .
the concept of precision medicine , whereby patients are grouped into subpopulations based on sophisticated genomic profiling , aims to address this problem by enabling development of therapies designed to specifically target the unique cancer of an individual or subgroup of individuals .
for some cancers , extensive genomic profiling has yielded identification of many cancer - related genes , which in turn , has led to identification of genomic alterations that can be targeted for therapy .
examples of drugs that target specific genomic alternations and have been translated to the clinic include imatinib , which targets the bcr - abl1 fusion protein in chronic myeloid leukemia ( quintas - cardama and cortes , 2009 ) , trastuzumab , which targets her2 amplification in breast and gastric cancer ( slamon et al . , 2011 ) , gefitinib and erlotinib targeting the egfr mutation in lung cancer ( pao et al . , 2004 ) , and crizotinib targeting the eml4-alk fusion protein in lung cancer ( shaw et al . , 2011 ) .
in addition to enabling the translation of such drugs to the clinic , the accelerated development of targeted therapies has promoted the concept that treatment decisions might eventually be guided by the molecular profiling of individual tumors ( macconaill and garraway , 2010 ) .
the integration of genomic profiling and targeted therapy are now broadly investigated in almost all kinds of cancer types .
however , drug development in oncology is usually hampered by high clinical attrition rates ( dimasi et al . , 2013 ) .
the clinical approval success rates of cancer drugs are lower than 15% , especially lower in solid tumors ( dimasi et al . , 2013 ) . despite the great promise of genomic alteration targeted therapy ,
it has proven difficult to identify targetable genomic alterations in quite a lot of cancers .
genomic instability of cancer increases the complexity of the cancer phenotype , as genomic instability in a given cancer can result in simultaneous alterations in several oncogenes and tumor suppressors involved in various cancer - associated signaling pathways .
in addition , a tumor is a mixture of heterogeneous cells including cancer cells , fibroblasts , vessel cells , and immune cells
. even cancer cells from a single patient exhibit diverse characteristics in the genomic and transcriptomic signature , contributing to the phenomenon of the intra - tumoral heterogeneity of cancer .
therefore , in many cases , drug responses can not be fully anticipated via simple genetic profiling . to overcome these limitations , more precise and comprehensive profiling of genomic alterations in tumors , and of drug responsiveness , is needed .
patient - derived xenografts ( pdx ) , a research platform whereby patient tumors are transplanted into immunodeficient mice , are designed to meet this need by providing clinically predictive models of human cancers .
this review delineates recent advances of pdx models and their significance for precision cancer medicine .
pdx models are generated by implanting sectioned patient tumor fragments into immunodeficient mice , subcutaneously or orthotopically ( into the organ of the cancer origin ) .
although previously used methods for drug testing such as in vitro cell culture and organoid cultures are advantageous in easy genetic manipulation and high - throughput screening , they showed strong selective proliferation , adaptation to culture condition and loss of tumor heterogeneity ( gao and chen , 2015 ) . an important advantage of pdx models is that they retain key characteristics of patients tumors .
the histologic characteristics and genomic signature of the patient tumor , and the heterogeneity of cancer cells , are highly preserved in pdx tumors ( kopetz et al . , 2012 ) .
pdx tumors also contain stromal and immune cells originating from the patient ( kopetz et al . , 2012 ) .
thus , pdx models are the most clinically relevant cancer models developed to date , and represent a highly predictive drug response platform that recapitulates the therapeutic outcome in human patients .
the procedures for the generation of pdx are very straight - forward , comprising the collection of fresh surgical tumor - containing tissue , division of the tumor into pieces , and then implantation , either subcutaneously or orthotopically , into an immunodeficient mouse ( fig . 1 ; tentler et al . ,
2012 ) . in some cases , investigators put tumors into the renal capsule for effective blood flow .
the tumors , which are established in immunodeficient mice , are cut into 24 mm fragments and reimplanted into new hosts for next passage .
several different mouse strains are used for generation of pdx models , and they differ with respect to the degree of immunosuppression , research benefits , and experimental considerations ( table 1 ) .
nude , b6 rag 1 and balb scid mice have intact innate immunity and nk cells , and can be used for engraftment of human and mouse cancer cell lines . on the contrary ,
nod scid and nod / scid / il2-receptor null ( nsg ) mice have defects in both humoral and innate immunity , and support implantation of human hematopoietic cells and solid tumors .
human acute myeloid leukemia and acute lymphoblastic leukemia primary cells showed faster leukemic symptom and more leukemic cells in nsg mice compared to other immunodeficient mice ( agliano et al . , 2008 ) .
the time needed for engraftment of pdx mice differs according to tumor type , site of implantation , and mouse strain , but in general it takes between two and four months ( morton and houghton , 2007 ) . for drug treatment testing
reported success rates of pdx models estimated by obtaining successful pdx tumors for next passages have ranged between 23% and 75% , depending on the tumor type ( table 2 ; siolas and hannon , 2013 ) .
generally , colorectal ( 6489% ) and pancreatic ( 62% ) tumors have had high engraftment rates , but breast cancers ( 1327% ) , especially estrogen receptor - positive breast cancers , have shown low success rates , even in the laboratories most successful with pdx engraftment in general ( hidalgo et al . , 2014 ; williams et al . , 2013 ) .
clinically aggressive and metastatic cancers have exhibited high pdx model engraftment rates compared to less aggressive and nonmetastatic cancers ( zhao et al . , 2012 ) , and patients with tumors that had a high engraftment rate in pdx mice showed lower overall survival and increased metastatic characteristics compared to patients whose tumors showed a low engraftment rate ( garrido - laguna et al . , 2011 ) , suggesting that the engraftment rate can sometimes be considered a predictive marker of disease prognosis ( derose et al . , 2011 ) .
supplementation with estradiol pellets enhanced stable xenograft take rate from 2.6% to 21.4% ( zhang et al . , 2013 ) , and in prostate cancer , male nod scid mice supplemented with testosterone showed successful engraftment in 38.9% ( 7/18 ) of samples ( lin et al . , 2014 ) .
among immunodeficient mouse strains , scid - based strains , such as balb scid , nod scid , and nod / scid / il2-receptor null ( nsg ) , demonstrated more successful engraftment compared to nude ( nu ) mutation - based strains due to further immune suppression ( landis et al . , 2013 ) .
therefore , tumor type , cancer aggressiveness , hormonal supplements and mouse host strains are important experimental factors to determine the engraftment rates .
the tumor implantation site is one of considering factors for the generation of pdx models .
subcutaneously transplanted pdx models have been widely developed due to their simple procedure and easy measurement of tumor size , and suitable for massive expansion of pdx models .
orthotopic models are anticipated to show more similar behavior of patient tumors , especially in metastasis ( hoffman , 2015 ) , but well - trained surgical skill is required for appropriate pdx models generation .
the subrenal capsule site is considered as tumor plantation site due to its hypervascularity ( lin et al . , 2014 ) , and exhibited successful pdx generation in several cancers including prostate and ovarian cancer ( lin et al . , 2014 ; scott et al . , 2013 ) .
considerable evidence indicates that pdx tumors retain the histological and genomic characteristics of the original human tumor ( rosfjord et al . , 2014 ) . at low passages ,
the morphological features and chromosomal stability of pdx tumors are comparable with the corresponding patient tumors ( fig .
2 ; derose et al . , 2011 ; rosfjord et al . , 2014 ; zhang et al . , 2013 ) . in addition
, comprehensive gene - expression data analyses have indicated that pdx tumors cluster with their original tumors in clustering studies , and that the majority of the key genes and signaling pathway activity in original tumors are preserved in pdx models ( reyal et al . , 2012 ; tentler et al . , 2012 ) .
in breast cancer pdx models , even spontaneous metastatic patterns appear to be recapitulated to clinically relevant sites including thymus , lung , bone , and peritoneum ( derose et al . , 2011 ) .
in serial passage experiments in which the repeated transplantation of the same tumor has been performed , a relatively high degree of genomic aberration has been preserved in colorectal , breast , and pancreatic cancers ( julien et al .
2012 ) , but the degree of preservation is dependent on the particular cancer indication studied ( rosfjord et al . ,
in addition , some studies have reported pdx - unique single nucleotide mutations , which are caused either by adaptation of tumor cells to a new microenvironment or by overgrowth of subclones below detectable limits in the original tumor ( ding et al .
from these studies shows a notable similarity of drug activity between pdx mice and patients , indicating remarkable predictive value of pdx models for clinics ( hidalgo et al .
for example , pdx models and human patients exhibited comparable responsiveness rates in anti - egfr antibody cetuximab treatment for colorectal cancers and gemcitabine treatment for pancreatic cancers ( bertotti et al .
, 2011 ; garrido - laguna et al . , 2011 ; julien et al . , 2012 ) .
in addition , selected drugs that were effective in pdx models produced similar responsiveness for patients in terms of resistance and sensitivity ( hidalgo et al .
, 2011 ) . in predicting the therapeutic effects in clinic , pdx models are valuable research tools which can overcome well - recognized limitations of conventional cell line - derived xenograft ( cdx ; johnson et al . , 2001 ; kung , 2007 )
. although the anti - angiogenic agent , bevacizumab prolonged survival in glioblastoma ( gbm ) cdx study ( de groot et al . , 2010 ) , bevacizumab failed to extend overall survival of patient in clinic ( lai et al . ,
, the survival length of gbm pdx was not altered by bevacizumab treatment and tumor became more aggressive and invasive ( joo et al . , 2013 ) .
in sum , these evidences indicate that pdx models can be a stable preclinical research platform that retains the characteristics of original patients tumors with regard to histology , genomic and transcriptomic signatures , and drug responsiveness .
pdx models have proven to be valuable platforms for preclinical drug testing in many types of cancer .
the effectiveness of the combination of nab - paclitaxel and gemcitabine in pancreatic cancer was demonstrated in a pdx experiment ( von hoff et al . , 2011 ) , and
later this regimen was reported to provide a survival benefit for patients with advanced pancreatic cancer in a randomized phase iii study ( von hoff et al . , 2013 ) .
pdx models are especially advantageous in preclinical studies of targeted agents , because , after evaluating the genomic characteristics of a pdx model , a subset of pdx models with the same genomic characteristics can be tested for targeted therapeutics .
for example , the effect of the pan - raf and src - family kinase dual inhibitor was evaluated by previously known raf inhibitor - sensitive and resistant melanoma pdx models ( girotti et al . , 2015 ) .
in addition , combination treatments of targeted drugs and cytotoxic drugs can also be tested in previously characterized pdx models .
for example , our group recently validated the efficacy of combination therapies using a bcl2l1 inhibitor and irinotecan in genomically defined gastric cancer pdx models ( fig .
3 ; park et al . , 2015 ) . for more systematic application of pdx models to drug development process , biorepositories , or biobank of pdx tumors
are required . especially , genomically well - characterized pdx repositories are valuable resources for developing improved diagnotics and therapeutics of cancers ( dowst et al . , 2015 ) .
recently , several groups , both in academia and industry , developed pdx repositories , and have now tried to develop collaborative networks for pdx biobanking ( hidalgo et al . , 2014 ) .
for example , europdx is a consortium of centers working on pdx models in europe , and aims at the development of network of clinically relevant and annotated pdx models ( hidalgo et al . , 2014 ) .
with genomically well - defined pdx collections , biomarkers associated with drug sensitivity and resistance can be identified , which facilitates precision cancer medicine ( fig .
4 ) . pdx tumors recapitulated previously known sensitive biomarkers including kras wild - type status for cetuximab sensitivity in colorectal cancers ( bertotti et al . , 2011 ; julien et al . , 2012 ) and kras wild - type status for erlotinib sensitivity in lung cancers ( fichtner et al . , 2008 ) .
by comparing drug - sensitive and -resistant pdx groups in colorectal cancers , amplification of her2 was identified as a resistant biomarker for cetuximab treatment ( bertotti et al . , 2011 ) .
pdx models are also valuable tools for generating drug - resistant tumor models , which is achieved by repeated administration of a given drug .
these resistant tumors are more clinically relevant compared to previous in vitro cancer cell culture systems , and are used for investigation of drug resistance mechanisms and identification of drug resistance biomarkers . for example , continuous administration of the braf inhibitor vemurafenib resulted in vemurafenib - resistant melanoma models with braf mutations , and elevated mutant braf protein resulting from this continuous drug treatment was reported as a critical factor in vemurafenib resistance ( das thakur et al . , 2013 ) .
the predictive power of pdx models is now being applied to co - clinical trials for novel cancer therapeutics .
phase i / ii clinical trials take more than 5 years to complete , and during these trials , real - time analysis and integration of data for stratification of responders and resistant populations are limited . to overcome this hurdle ,
co - clinical trials are carried out , whereby drug treatment experiments for mouse tumor models are performed in parallel with clinical trials , and preclinical and clinical data are integrated ( nardella et al . , 2011 ) .
the concept of co - clinical trials was first developed for genetically engineered mouse models , but this strategy can be applied to genetically well - defined pdx models ( hidalgo et al . , 2014 ) .
the co - clinical trial approach using pdx models will facilitate rapid stratification of responders , prioritization of attractive drug combinations , identification of resistance mechanisms , and determination of biomarkers ( nardella et al . , 2011 ) .
although genomic profiling of tumors provides significant improvement in patient stratification and targeted drug selection , additional decision - making processes may be required when multiple potential targets are identified or no targetable mutation is found . to facilitate drug selection in such cases ,
in one prospective study , avatar models were generated from 14 patients , and effective treatment options were explored with 63 drugs in 232 treatment regimens ( hidalgo et al . , 2011 ) . following identification of the most effective treatment regimens in the xenograft model ,
the 17 regimens were tried in 11 patients , and durable partial remission was detected in 15 treatments . and in another study , pdx clinical trial ( pct ) was demonstrated to be assessed by comparing the targeted drug response in pdx to responses in patients .
the 67% melanoma pdx with braf mutation showed response to encorafenib , a selective braf inhibitor and this was concordant with the reported phase ii clinical trial response rates in patients . and also , insensitive braf - mutated melanoma pdx to braf inhibitor responded to combined therapy with mek inhibitor .
this is consistent with combination phase i / ii trial in braf - mutant melanoma patients ( gao et al . , 2015 ) .
thus , personalized pdx models showed high positive predictive value for drug testing , and can be beneficial for therapeutic decision - making and guiding treatment options .
pdx tumors can recapitulate the intratumoral heterogeneity of original patients tumors , and a growing body of evidence shows that tumors contain a distinct subpopulation , usually termed cancer stem cells ( cscs ) .
cscs have the capacity for self - renewal and differentiation , and have been reported to be more resistant than other cancer cells to chemotherapy and radiation ( rosen and jordan , 2009 ) .
a large number of cscs can be obtained through expansion of pdx tumors in mice without compromising the heterogeneity of the original tumor ( rosfjord et al . , 2014 ) . using specific surface markers ,
cscs have been purified and characterized in several types of pdx tumors ( bertolini et al . , 2009 ;
in addition , the heterogenetic profiles of patients tumors evolve in response to environmental changes , and the microenvironment of tumors in a mouse background provides selection pressure for tumors , recapitulating tumor evolution and clonal selection in patients ( whittle et al . , 2015 ) . pdx tumor from primary basal - like breast cancer retained the primary tumor mutations and showed additional de novo mutations similar with the brain metastatic lesion , suggesting that the pdx models exhibit genomic adjustments compatible with cancer evolution in patients ( ding et al . , 2010 ) . the clonal dynamics in pdx propagation
was evaluated through deep - genome and single - cell sequencing , and the results showed that the degree of clonal selection varied from extremely selective engraftment of minor clones to moderate , polyclonal engraftment , and similar clonal expansion patterns were reproduced in independent grafts of the same tumors ( eirew et al . , 2015 ) . in sum , the above studies demonstrate that pdx models can be applied to the study of tumor heterogeneity , cscs , and cancer evolution .
pdx models in early passages retain stromal components and acidic conditions of microenvironment in patient tumors , and can be used to study the effects of microenvironment on tumor biology ( choi et al . , 2014 ) . the microenvironment - targeting agent , ibrutinib was effective at inhibiting tumor growth and increasing survival in pdx models of pancreatic ductal adenocarcinoma ( masso - valles et al . , 2015 ) .
tumor architecture can be conserved through multiple passages by recruitment of murine stromal cells instead of human stromal elements ( delitto et al . , 2015 ) .
for example , mice engrafted with patient - derived gastric cancer tissue and peripheral mononuclear cells from same patient exhibited slow tumor growth by combination therapy of anti - hcd137 and anti - hpd1 antibodies ( fernandez de sanmamamed et al . , 2015 )
. however , humanized pdx models , which have patient - derived tumor and full repertoire of human immune cells by engrafting human hematopoietic stem cells , are required for proper preclinical models of cancer immunotherapy .
although pdx models maintain the histology , genomic architecture , and drug responsiveness of the original tumors , during engraftment into immunodeficient mice the clonal profiles of pdx tumors can change , in comparison to the patients tumors . analysis of genome - wide variant allele frequencies in serial passages of pdx tumors showed that clonal selection occurs more frequently in initial engraftment steps than in propagation steps , but the detailed clonal dynamics differs depending on the different tumor samples of the same tumor type ( eirew et al . , 2015 ) .
this clonal dynamics in pdx tumors is probably generated by selection acting on preexisting clones , rather than the generation of new clones ( aparicio et al . , 2015 ) . as a result , it is probable that the more aggressive clones become dominant in pdx tumors , and in some cases , pdx models indeed showed the genomic and transcriptomic signature of metastatic and relapsed cancers ( rosfjord et al . , 2014 ) .
for use of pdx models in decision - making processes of cancer therapeutics , engraftment failure and the long periods of time required for pdx establishment are limiting factors . because success rates of pdx models vary depending on the cancer type and tumor aggressiveness as detailed above , there is a probability that pdx collections are skewed toward more aggressive type of cancers ( hidalgo et al . , 2014 ) .
the time for establishment and expansion of pdx models for drug efficacy testing four to eight months , as noted above is usually not feasible for immediate application in patient decision - making for therapeutics .
an alternate strategy would be to perform pdx - based drug testing during the period of initial standard therapy and pursue the second - line treatments based on pdx drug screening .
the depletion of human stromal and immune cells in engrafted tumors of late passages is a major limitation of pdx models for studies of tumor microenvironments and metastasis .
the interaction of tumor - associated cells , such as vascular cells , fibroblasts , and inflammatory cells , with malignant cells plays an important role in tumor biology , and recent studies have shown that tumor microenvironments are also associated with drug responsiveness ( ostman , 2012 ) .
in addition , the application of immune - modulating agents such as anti - pd1 antibody into pdx models is limited , as immunocompromised mice used for pdx generation lack the essential components of an immune system ( hidalgo et al . , 2014 ) .
to overcome this hurdle , immunocompromised mice that are transplanted with human hematopoietic stem and progenitor cells , i.e. , humanized mice , are promising options .
some studies have demonstrated that diverse lineages of functional human immune cells have developed via the infusion of human hematopoietic stem cells , and of human immune and stromal cells , in tumor xenografts ( morton et al . , 2015 ; rongvaux et al . ,
this phenomenon has been reported in pdx models of several cancer types including non - small cell lung cancers , hepatocellular carcinomas , prostate cancers , and gastric cancers ( chen et al . , 2012 ; john et al . , 2012 ;
most of these lymphomas were human - derived lymphomas expressing human cd45 markers , consistent with b - cell subtype lymphomas ( chen et al .
further , epstein - barr virus ( ebv ) infections are highly associated with lymphomagenesis ( chen et al . , 2012 ;
tissue inflammation in parent tumors increases the risk of having a human - derived lymphoma in the pdx models , and gastric cancers exhibit a much higher rate of lymphoma proliferation than colorectal cancers partly due to higher rate of baseline inflammation ( zhang et al . , 2015 ) .
a suggested mechanism of lymphoma formation is that , without immunosurveillance in immunodeficient mice , ebv can infect and transform b lymphocytes into a proliferative state ( zhang et al . , 2015 ) .
therefore , exclusion of human lymphomagenesis in pdx models requires validation of established pdx tumors in immunodeficient mice by histology and human cd34 markers ( zhang et al . , 2015 ) .
precision medicine for cancer treatment requires the integration of massive volumes of diverse data from genomic profiling and drug responsiveness .
recent advances in high - throughput sequencing techniques have enabled genomic analysis of individual patients cancer .
pdx models retain the histology , genomic characteristics , and even drug responsiveness of the original human patient tumors , and can be used as
these models are valuable for diverse drug development processes including biomarker development , preclinical drug testing , co - clinical trials , and personalized drug selection . finally ,
development of mutation - specified pdx collections by integrating sequencing data and avatar experiments will provide novel opportunities for therapeutic optimization , improved clinical outcomes , and precision cancer medicine .
Output:
| cancer is a heterogeneous disease caused by diverse genomic alterations in oncogenes and tumor suppressor genes . despite recent advances in high - throughput sequencing technologies and development of targeted therapies ,
novel cancer drug development is limited due to the high attrition rate from clinical studies .
patient - derived xenografts ( pdx ) , which are established by the transfer of patient tumors into immunodeficient mice , serve as a platform for co - clinical trials by enabling the integration of clinical data , genomic profiles , and drug responsiveness data to determine precisely targeted therapies .
pdx models retain many of the key characteristics of patients tumors including histology , genomic signature , cellular heterogeneity , and drug responsiveness .
these models can also be applied to the development of biomarkers for drug responsiveness and personalized drug selection .
this review summarizes our current knowledge of this field , including methodologic aspects , applications in drug development , challenges and limitations , and utilization for precision cancer medicine . |
PubmedSumm118462 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: this study was based on a nationwide open cohort of girls and women aged 10 to 44 years living in sweden between january 1 , 2006 , and december 31 , 2010 . to assess effectiveness against incident gw , all individuals with a gw before individual follow - up ( n = 15 656 )
individuals were censored at time of death ( n = 3377 ) or their 45th birthday .
we did not have access to data on emigration status after december 31 , 2002 .
therefore , girls and women who emigrated up to this date were excluded ( n = 152 896 ) .
girls and women who received the bivalent hpv vaccine ( n = 1381 ) were censored at vaccination . in total , 2 209 263 girls and women were included in the study .
the average follow - up time was 4.4 years ( sd 1.3 years ) .
ethical approval for this study was granted by the ethical review board of karolinska institutet , solna , sweden .
every resident has a unique personal identification number , which enables individual record linkage from the total population register with multiple registers ( 13 ) .
data on vaccination exposure status with either the quadrivalent or bivalent vaccine were retrieved by the prescribed drug register ( pdr ) and from the swedish vaccination register ( svevac ) , a national hpv vaccination register that started in 2006 ( supplementary material , available online ) .
the pdr contains all drug prescriptions dispensed at pharmacies in sweden since july 1 , 2005 , including subsidized hpv vaccines for girls aged 13 to 17 years .
we assumed that almost 100% of the hpv vaccines are registered in the pdr for this group .
data on gw status were obtained from the pdr and the patient register ( pr ) ( see case definition ) .
the pr includes nationwide information on all in- and outpatient hospital visits since 1987 and 2001 , respectively .
emigration status was derived from the migration register , which contains all immigration and emigration dates until december 31 , 2002 .
mother s and father s highest education level a proxy for socioeconomic status was obtained from the education register , and the parents themselves were identified from the multigeneration register .
gw cases were defined as the first diagnosis of gw either by the pr and/or a gw treatment prescription identified by the pdr .
the international classification of diseases , tenth revision code a63 was used to identify gw as a main or contributory diagnosis in the pr ( 14 ) .
reporting for inpatient hospital care in the swedish patient register has been estimated to be valid in 85% to 95% of all cases , depending on the diagnosis ( 15 ) .
for outpatient hospital care , register coverage is estimated to be 85% for somatic care , but no figures on validity of international classification of diseases reporting are available .
podophyllotoxin and imiquimod , pharmaceuticals used to treat gw , were identified by the anatomical therapeutical chemical codes d06bb04 and d06bb10 , respectively .
podophyllotoxin is used exclusively for the treatment of external gw , whereas imiquimod is also used to treat other skin pathologies that mostly affect older individuals .
age - specific prescription trends for podophyllotoxin and imiquimod were identical in those aged less than 45 years .
imiquimod trends differed in older middle - aged and elderly groups , in whom use of imiquimod as treatment of non - gw skin pathologies is more common , so follow - up was excluded over age 44 years ( 2 ) .
we could not identify cases of gw treated in primary care if no drugs were used .
vaccination dates were primarily derived from svevac , but because not all vaccinations were registered there , the pdr was also used .
prescriptions were identified for the quadrivalent and the bivalent vaccines using anatomical therapeutical chemical codes j07bm01 and j07bm02 , respectively .
if a woman had more than three recorded dates for the qhpv vaccine , we assumed that the first three unique dates matched with the first , second , and third doses of the vaccine .
a total of 926 individuals identified by the pdr had multiple prescription dispensations recorded for the same date .
it was assumed that individuals with two unique dates and more than three dispensation dates received their first and second dose or their second and third dose at the same date .
twenty - one women with only one unique date listed three times were considered to have all three doses on the same date .
vaccination status was assessed as a time - varying exposure , with full effectiveness of the vaccine assumed after three doses . using vaccination status as a time - varying exposure allowed for the same woman to contribute person - time to multiple dose categories ( ie , 0 , 1 , 2 , or 3 ) depending on whether she received some , all , or any vaccine doses during individual follow - up .
a woman was considered unvaccinated if she was not vaccinated at all , was considered partially vaccinated if she had one or two doses , and was considered fully vaccinated if she had all three doses . because person - time for the unvaccinated individuals contributed to 97.5% of total person - time , we decided to include the partially vaccinated girls and women ( 0.9% ) in the reference group because excluding them did not alter the results .
individuals who were diagnosed with gw during follow - up and before first vaccination would only contribute person - time in the unvaccinated group .
the association between parental education level and vaccine uptake was modeled by multinomial logistic regression with outcomes of no vaccination , first vaccinated before age 20 years , and first vaccinated at age 20 years or older and is reported as the relative risk ratio ( rrr ) .
subjects with missing parental education level were retained in the missing category for the analysis .
crude incidence rates ( irs ) of gw were calculated as the number of cases per accrued person - time for unvaccinated , partially vaccinated , and fully vaccinated individuals .
poisson regression analysis was used to estimate the incidence rate ratio ( irr ) between vaccinated and partially vaccinated or unvaccinated individuals , adjusted for attained age ( time - scale ) , age at vaccination , and highest parental education level .
individuals were stratified into six age - at - vaccination groups ( aged 1013 , 1416 , 1719 , 2022 , 2326 , and 2744 years ) , splitting person - time based on attained age , and those who received the vaccine were categorized based on their age at first vaccination .
cutpoints for age - at - vaccination groups were chosen based on a previous study of underlying age- and sex - specific gw incidence trends .
vaccination was included as a time - varying exposure , so individuals could contribute both vaccinated and unvaccinated risk time to the model .
poisson regression stratified by age was also used to assess vaccination self - selection bias in the population cohort under study by comparing irs before vaccination availability in sweden with irs at the end of follow - up among those unvaccinated . the potential impact of population - wide vaccination programs at different ages
was assessed by predicting irs for the whole study cohort under two assumptions : 1 ) no vaccination at all and 2 ) complete vaccination of all girls and women in the age categories defined above . in both cases ,
the predicted age - specific irs and the estimated associations with parental education level were averaged over the whole study population .
data management was done with sas statistical software version 9.2 ( sas institute inc , cary , nc ) .
statistical analyses were done with stata software ( version 11 ; statacorp , college station , tx ) .
this study was based on a nationwide open cohort of girls and women aged 10 to 44 years living in sweden between january 1 , 2006 , and december 31 , 2010 . to assess effectiveness against incident gw , all individuals with a gw before individual follow - up ( n = 15 656 )
individuals were censored at time of death ( n = 3377 ) or their 45th birthday .
we did not have access to data on emigration status after december 31 , 2002 .
therefore , girls and women who emigrated up to this date were excluded ( n = 152 896 ) .
girls and women who received the bivalent hpv vaccine ( n = 1381 ) were censored at vaccination . in total , 2 209 263 girls and women were included in the study .
the average follow - up time was 4.4 years ( sd 1.3 years ) .
ethical approval for this study was granted by the ethical review board of karolinska institutet , solna , sweden .
every resident has a unique personal identification number , which enables individual record linkage from the total population register with multiple registers ( 13 ) .
data on vaccination exposure status with either the quadrivalent or bivalent vaccine were retrieved by the prescribed drug register ( pdr ) and from the swedish vaccination register ( svevac ) , a national hpv vaccination register that started in 2006 ( supplementary material , available online ) .
the pdr contains all drug prescriptions dispensed at pharmacies in sweden since july 1 , 2005 , including subsidized hpv vaccines for girls aged 13 to 17 years .
we assumed that almost 100% of the hpv vaccines are registered in the pdr for this group .
data on gw status were obtained from the pdr and the patient register ( pr ) ( see case definition ) .
the pr includes nationwide information on all in- and outpatient hospital visits since 1987 and 2001 , respectively .
emigration status was derived from the migration register , which contains all immigration and emigration dates until december 31 , 2002 .
mother s and father s highest education level a proxy for socioeconomic status was obtained from the education register , and the parents themselves were identified from the multigeneration register .
gw cases were defined as the first diagnosis of gw either by the pr and/or a gw treatment prescription identified by the pdr .
the international classification of diseases , tenth revision code a63 was used to identify gw as a main or contributory diagnosis in the pr ( 14 ) . reporting for inpatient hospital care in the swedish patient register has been estimated to be valid in 85% to 95% of all cases , depending on the diagnosis ( 15 ) . for outpatient hospital care ,
register coverage is estimated to be 85% for somatic care , but no figures on validity of international classification of diseases reporting are available .
podophyllotoxin and imiquimod , pharmaceuticals used to treat gw , were identified by the anatomical therapeutical chemical codes d06bb04 and d06bb10 , respectively .
podophyllotoxin is used exclusively for the treatment of external gw , whereas imiquimod is also used to treat other skin pathologies that mostly affect older individuals .
age - specific prescription trends for podophyllotoxin and imiquimod were identical in those aged less than 45 years .
imiquimod trends differed in older middle - aged and elderly groups , in whom use of imiquimod as treatment of non - gw skin pathologies is more common , so follow - up was excluded over age 44 years ( 2 ) .
we could not identify cases of gw treated in primary care if no drugs were used .
vaccination dates were primarily derived from svevac , but because not all vaccinations were registered there , the pdr was also used .
prescriptions were identified for the quadrivalent and the bivalent vaccines using anatomical therapeutical chemical codes j07bm01 and j07bm02 , respectively .
if a woman had more than three recorded dates for the qhpv vaccine , we assumed that the first three unique dates matched with the first , second , and third doses of the vaccine .
a total of 926 individuals identified by the pdr had multiple prescription dispensations recorded for the same date .
it was assumed that individuals with two unique dates and more than three dispensation dates received their first and second dose or their second and third dose at the same date .
twenty - one women with only one unique date listed three times were considered to have all three doses on the same date .
vaccination status was assessed as a time - varying exposure , with full effectiveness of the vaccine assumed after three doses . using vaccination status as a time - varying exposure allowed for the same woman to contribute person - time to multiple dose categories ( ie , 0 , 1 , 2 , or 3 ) depending on whether she received some , all , or any vaccine doses during individual follow - up .
a woman was considered unvaccinated if she was not vaccinated at all , was considered partially vaccinated if she had one or two doses , and was considered fully vaccinated if she had all three doses . because person - time for the unvaccinated individuals contributed to 97.5% of total person - time , we decided to include the partially vaccinated girls and women ( 0.9% ) in the reference group because excluding them did not alter the results .
individuals who were diagnosed with gw during follow - up and before first vaccination would only contribute person - time in the unvaccinated group .
the association between parental education level and vaccine uptake was modeled by multinomial logistic regression with outcomes of no vaccination , first vaccinated before age 20 years , and first vaccinated at age 20 years or older and is reported as the relative risk ratio ( rrr ) . subjects with missing parental education level were retained in the missing category for the analysis .
crude incidence rates ( irs ) of gw were calculated as the number of cases per accrued person - time for unvaccinated , partially vaccinated , and fully vaccinated individuals .
poisson regression analysis was used to estimate the incidence rate ratio ( irr ) between vaccinated and partially vaccinated or unvaccinated individuals , adjusted for attained age ( time - scale ) , age at vaccination , and highest parental education level .
individuals were stratified into six age - at - vaccination groups ( aged 1013 , 1416 , 1719 , 2022 , 2326 , and 2744 years ) , splitting person - time based on attained age , and those who received the vaccine were categorized based on their age at first vaccination .
cutpoints for age - at - vaccination groups were chosen based on a previous study of underlying age- and sex - specific gw incidence trends .
vaccination was included as a time - varying exposure , so individuals could contribute both vaccinated and unvaccinated risk time to the model .
poisson regression stratified by age was also used to assess vaccination self - selection bias in the population cohort under study by comparing irs before vaccination availability in sweden with irs at the end of follow - up among those unvaccinated .
the potential impact of population - wide vaccination programs at different ages was assessed by predicting irs for the whole study cohort under two assumptions : 1 ) no vaccination at all and 2 ) complete vaccination of all girls and women in the age categories defined above . in both cases ,
the predicted age - specific irs and the estimated associations with parental education level were averaged over the whole study population .
data management was done with sas statistical software version 9.2 ( sas institute inc , cary , nc ) .
statistical analyses were done with stata software ( version 11 ; statacorp , college station , tx ) .
the population cohort included 2 209 263 girls and women aged 10 to 44 years living in sweden between 2006 and 2010 , contributing 9 640 542 person - years ; 33 178 participants had gw during follow - up .
more than 5% of the study population received at least one dose of the qhpv vaccine , with 124 000 girls and women vaccinated , 90% of whom were in the subsidized target group . of all vaccinated girls and women ,
the highest vaccination coverage was among those aged 18 to 19 years ( vaccination coverage = 31.9% ) and 13 to 17 years ( vaccination coverage = 24.7% ) ( table 1 ) .
girls and women who had at least one university - educated parent were approximately 15 times more likely to be vaccinated before age 20 years than girls and women whose parents did not complete high school ( rrr = 15.45 , 95% ci = 14.65 to 16.30 ) ( table 2 ) .
maternal university education level was more strongly associated with vaccination status outcome than paternal university education level ( rrr = 8.58 , 95% ci = 8.32 to 8.85 ; vs rrr = 4.31 , 95% ci = 4.22 to 4.41 ) .
similar patterns for associations with education were seen for those vaccinated at age 20 years and older ( table 2 ) .
vaccination status , genital warts cases , and parental education level among all girls and women in sweden aged 10 to 44 years between january 2006 and december 2010 relative risk ratios ( rrrs ) from a multinomial logistic model for the effect of parental education on vaccination status *
ci = confidence interval .
two - sided wald test of the hypothesis that within the stated education rrr within the same educational level is the same for women first vaccinated before age 20 and for women first vaccinated age 20 or older .
less than high school indicates a maximum of 9 years in school and high school indicates a maximum of 13 years .
defined as highest education level of either parent or as the education level of the nonmissing parent . to assess
whether there was a self - selection bias among those who were vaccinated , we compared the rate of gw before commercial availability of qhpv with rate of gw at the end of follow - up in the unvaccinated population .
no statistically significant difference in the rates were found in the age category with highest vaccine coverage ( aged 1419 years ) ( irr = 1.00 , 95% ci = 0.98 to 1.02 ) . among women aged 20 years or older ,
the gw rates declined over time in the unvaccinated population ( irr = 0.96 , 95% ci = 0.95 to 0.97 ) , suggesting a self - selection bias in which individuals at a higher risk for gw were more likely to seek vaccination ( data not shown ) .
vaccine effectiveness was 76% ( 95% ci = 73% to 79% ) among those who received three doses of the vaccine with their first dose before age 20 years .
vaccine effectiveness was highest in girls vaccinated before age 14 years ( effectiveness = 93% , 95% ci = 73% to 98% ) .
effectiveness was 80% ( 95% ci = 75% to 83% ) for girls vaccinated at ages 14 to 16 years , 71% ( 95% ci = 65% to 76% ) at ages 17 to 19 years , and 48% ( 95% ci = 22% to 65% ) for women vaccinated at ages 20 to 22 years .
no effectiveness was measureable in fully vaccinated women who received their first dose when they were aged older than 22 years ( table 3 ) .
observed incidence , estimated incidence rate ratios ( irrs ) and effectiveness rates , and predicted incidence rates ( irs ) per 100 000 person years for different vaccination scenarios * * we compared fully vaccinated girls and women with not fully vaccinated girls and women , combining both unvaccinated and partially vaccinated girls and women .
estimates and predictions are based on poisson regressions stratified by age - at - vaccination and adjusted for attained age and parental education level as a proxy for socioeconomic status .
predicted irs are for the whole study population , under the assumption of either no vaccination at all or complete vaccination of the whole population in the indicated age category .
ir was estimated under the assumption that all girls and women within the specific age - at - vaccination group were fully vaccinated .
ir was estimated under the assumption that girls and women within the specific age - at - vaccination group were partially vaccinated ( 1 or 2 doses ) or had 0 doses .
maximum reduction in ir was denoted as the difference between ir fully vaccinated and irpartially and nonvaccinated .
|| the value was negative . when comparing the ir predicted under the assumption of complete vaccination with that predicted under no vaccination , the greatest reduction in ir was for complete vaccination among the earliest age group considered ( 1013 years ) , with a maximum reduction in ir of 332.35 per 100 000 .
the maximum reduction in ir decreased with each subsequent older age category and was nonexistent for the group aged 27 years or older ( table 3 ) .
vaccine effectiveness was 76% ( 95% ci = 73% to 79% ) among those who received three doses of the vaccine with their first dose before age 20 years .
vaccine effectiveness was highest in girls vaccinated before age 14 years ( effectiveness = 93% , 95% ci = 73% to 98% ) .
effectiveness was 80% ( 95% ci = 75% to 83% ) for girls vaccinated at ages 14 to 16 years , 71% ( 95% ci = 65% to 76% ) at ages 17 to 19 years , and 48% ( 95% ci = 22% to 65% ) for women vaccinated at ages 20 to 22 years .
no effectiveness was measureable in fully vaccinated women who received their first dose when they were aged older than 22 years ( table 3 ) .
observed incidence , estimated incidence rate ratios ( irrs ) and effectiveness rates , and predicted incidence rates ( irs ) per 100 000 person years for different vaccination scenarios * * we compared fully vaccinated girls and women with not fully vaccinated girls and women , combining both unvaccinated and partially vaccinated girls and women .
estimates and predictions are based on poisson regressions stratified by age - at - vaccination and adjusted for attained age and parental education level as a proxy for socioeconomic status .
predicted irs are for the whole study population , under the assumption of either no vaccination at all or complete vaccination of the whole population in the indicated age category .
ir was estimated under the assumption that all girls and women within the specific age - at - vaccination group were fully vaccinated .
ir was estimated under the assumption that girls and women within the specific age - at - vaccination group were partially vaccinated ( 1 or 2 doses ) or had 0 doses .
maximum reduction in ir was denoted as the difference between ir fully vaccinated and irpartially and nonvaccinated .
|| the value was negative . when comparing the ir predicted under the assumption of complete vaccination with that predicted under no vaccination , the greatest reduction in ir was for complete vaccination among the earliest age group considered ( 1013 years ) , with a maximum reduction in ir of 332.35 per 100 000 .
the maximum reduction in ir decreased with each subsequent older age category and was nonexistent for the group aged 27 years or older ( table 3 ) .
this first effectiveness study of the qhpv vaccine in an entire population showed that vaccination offered high protection against gw among girls and women who were fully vaccinated before age 20 years . by including more than 2.2 million girls and women ranging in age from 10 to 44 years
, we could , for the first time , discern nuanced effects of age at vaccination .
effectiveness declined as the age at first vaccination increased . in the age group vaccinated before age 14 years ,
in which there is presumably little prior hpv exposure , the effectiveness against gw seen in this study ( 93% ) was higher than efficacy among hpv - naive subjects reported in the qhpv vaccine clinical trials ( 83% ) ( 4 ) .
similarly , the effectiveness among all girls and women aged younger than 20 years ( 76% ) appeared higher than the any - type gw efficacy reported in intention - to - treat clinical trial populations ( 62% ) ( 4 ) .
however , women in the trials were older at enrollment ( age range = 1626 years ) than individuals included in our study .
also , because the trials did not present age - specific results , age - at - vaccination differences could not be ascertained .
a plausible explanation for effectiveness being higher than efficacy would be if hpv6 or hpv11 is preferentially associated with clinically significant gw and nonvaccine hpv types are preferentially associated with minor gw lesions that were found because of the more intense surveillance in the clinical trials . considering
that vaccinated individuals are known to be almost completely protected against incident vaccine - specific hpv infection , indirect protection from herd immunity can not possibly have contributed to further increasing the effectiveness among the vaccinated women because the vaccine coverage was not high enough .
effectiveness studies extend beyond clinical trial restrictions present in efficacy studies and instead examine reduction of disease burden in the population at large .
we compared our results with efficacy in trials because these comparisons are interesting and are advisable in vaccination program assessments .
the 5-year follow - up in this study is comparable with that in other hpv vaccine studies investigating efficacy or effectiveness ( 47,16,17 ) . interpreting the crude estimates of effectiveness for those aged 20 years or older at first vaccination
is difficult because we found evidence suggesting a self - selection bias with women at high risk preferentially seeking vaccination .
nevertheless , our failure to find any effectiveness at all for women aged older than 22 years suggests that this group had exposure to hpv before vaccination and therefore the impact of vaccination was lower .
it is well known that the vaccine does not alter the course of an already existing hpv infection , which means that the vaccine will appear less effective if a woman is already infected with one or more of the hpv types targeted by the vaccine at the time of vaccination ( 6 ) .
individuals with gw history before individual follow - up were excluded , but because the pdr was not available before 2005 , misclassification is likely , especially among older individuals , leading to underestimation of the effectiveness for this group .
previous studies ( 18,19 ) have examined parental attitudes toward hpv vaccinations and the influence of parental education level on these attitudes , but this is the first study examining the relationship between parental education level and actual vaccination status of children on a national , population - based level .
one swedish study showed that a higher parental education level was associated with a decreased willingness to vaccinate daughters , an attitude which is in contrast to the real - life results in this study ( 20 ) .
that parents education influences vaccine uptake when out - of - pocket costs are involved may be anticipated , but the magnitude of the relative effect found in this study was surprising .
a potential limitation related to vaccine exposure is that vaccine dispensation dates from the pdr were used as a proxy measure to classify a woman s vaccination date when there was no information available from svevac .
this will slightly overestimate the actual vaccination dose status because individuals with multiple identical dates were considered fully vaccinated at the earliest date .
however , given that unique vaccination dose dates were found for more than 99% of individuals , multiple identical dates is expected to be a minor issue .
some individuals with clinical symptoms will not seek treatment , leading to an underestimation of the total number of gw cases .
also , regardless of how disease - specific a treatment is , using prescriptions as proxy for actual disease is not as precise as clinical diagnostics .
furthermore , individuals who visit nonhospital care for gw but who do not receive any pharmacological treatment are not included in the registers .
although this register limitation will result in an underestimation of the total number of gw cases , we expect it to be nondifferential with regard to vaccination exposure , which would tend to dilute our effectiveness estimates .
we did not have adequate statistical power to assess vaccination effectiveness on recurrent gw among those with known gw history .
to our knowledge , this is the first population - based study investigating effectiveness of the qhpv vaccine that used nationwide linkage of individual vaccination status to gw care and treatment for all girls and women aged 10 to 44 years .
given that the time between hpv infection and diagnosis of gw is shorter than the time between hpv16 and/or hpv18 infection and the development of related precancerous lesions and cancer , the study of vaccination effectiveness against gw can provide an early feedback about whether there has been an adequate use of the hpv vaccines .
for example , the hpv vaccine was licensed and made commercially available for individuals outside the recommended target group of girls aged 13 to 17 years .
although individuals needed to pay the entire vaccine cost themselves , there was still a large number vaccinated outside the target age .
we found that among women first vaccinated at age 20 years or older there was low to immeasurable effectiveness and suggestive evidence that vaccinations tended to reach women at high gw risk .
this suggests that vaccinations in this age group were not adequate for achieving the intended health benefit .
however , the effectiveness for other outcomes , such as cervical intraepithelial neoplasia 1 and 2 , might be different from that of gw .
in conclusion , this study shows that opportunistic qhpv vaccinations in sweden have led to a substantial reduction in gw among girls and women vaccinated before age 20 years .
however , the program had severe limitations because it preferentially reached individuals from families with higher socioeconomic status .
the data collection for this study was funded by a research grant from the investigator initiated studies program of merck sharp & dome corp ( to lad ) .
Output:
| backgroundincidence of condyloma , or genital warts ( gw ) , is the earliest possible disease outcome to measure when assessing the effectiveness of human papillomavirus ( hpv ) vaccination strategies .
efficacy trials that follow prespecified inclusion and exclusion criteria may not be fully generalizable to real - life hpv vaccination programs , which target a broader segment of the population .
we assessed gw incidence after on - demand vaccination with quadrivalent hpv vaccine using individual - level data from the entire swedish population.methodsan open cohort of girls and women aged 10 to 44 years living in sweden between 2006 and 2010 ( n > 2.2 million ) was linked to multiple population registers to identify incident gw in relation to hpv vaccination . for vaccine effectiveness ,
incidence rate ratios of gw were estimated using time - to - event analyses with adjustment for attained age and parental education level , stratifying on age at first vaccination.resultsa total of 124 000 girls and women were vaccinated between 2006 and 2010 . girls and women with at least one university - educated parent were 15 times more likely to be vaccinated before age 20 years than girls and women whose parents did not complete high school ( relative risk ratio = 15.45 , 95% confidence interval [ ci ] = 14.65 to 16.30 ) . among those aged older than 20 years , gw rates declined among the unvaccinated , suggesting that hpv vaccines were preferentially used by women at high risk of gw .
vaccination effectiveness was 76% ( 95% ci = 73% to 79% ) among those who received three doses of the vaccine with their first dose before age 20 years .
vaccine effectiveness was highest in girls vaccinated before age 14 years ( effectiveness = 93% , 95% ci = 73% to 98%).conclusionsyoung age at first vaccination is imperative for maximizing quadrivalent hpv vaccine effectiveness . |
PubmedSumm118463 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: more than a century of allergology has been dedicated to the discovery of allergenic sources that cause ige - mediated diseases .
this has involved a step - by - step process moving from identification of raw material causing allergic reactions ( i.e. house dust ) to organisms and tissues as triggers ( i.e. pollen , fruits , mites , fungi ) .
raw materials , organisms and their tissues have been used and are still in use for diagnostic and therapeutic purposes as allergenic extracts .
although considerable efforts have been made by manufacturers and authorities to control allergenic extract composition , the best definition for an allergenic extract is still an unpredictable mixture of allergenic and non - allergenic compounds. the application to allergen discovery of new biochemical methods during the late 1970s and the 1980s has led to the identification of the real primary sensitizer and trigger , the allergenic molecule .
a further spike in allergenic molecule research has been brought about by the progressive and rapid introduction of molecular biology techniques into this research field . neither the environmental allergenic source identification process nor the characterization of allergenic molecules has reached a plateau phase , the former being a consequence of both the increasing exposure to novel organisms or the increasing awareness of allergy as the cause of symptoms , and the latter being the consequence of an increasing number of research centres working on allergenic molecule identification and characterization . both processes are further influenced by an increasing world - wide interest in the field of allergic diseases , mostly in emerging countries
. such a historical trend is readily depicted by monitoring and reporting the number of newly identified allergenic molecules and the number of papers published in the scientific literature from 323 papers in 2000 compared with 870 in 2007 ( fig .
this has involved an increasing range of publications from allergy and immunology to biochemical , agricultural and environmental journals .
this increase in the knowledge of potentially allergenic molecules requires a systematic organization and a clear definition of the criteria for defining what comprises an allergen , starting from the very first questions : what are we going to classify? or which is the structure to be defined as allergenic? or
should we consider all the ige - binding structures? to address the need to bring sense and organization to the increasing amount of data on potential allergens we need to briefly consider some critical aspects of the ige immune response , report on the current diagnostic and epidemiological tools used for allergic disease studies and the need to implement them and lastly discuss the usefulness of novel biotechnology , information technology and microtechnology tools .
( a ) last 40 years ' time course of new allergen identification reported by either the cumulative number ( line ) or the newly identified one ( shaded area ) .
( b ) last 40 years ' time course of published papers reporting on any aspect related to allergenic molecules , as cumulative number ( left graph ) and by years ( right graph ) .
ige as a defence provided by the human system seems to be evolutionarily linked to parasite infections , not least because of the very high ige levels generally detected in parasite infection - affected subjects .
it is interesting that allergic reactions are rarely described in such patients although they have specific ige and antigen exposure at the same time . besides the relevance to infection with helminthic parasites
such an ige response differs markedly from the response to parasite antigens as it does not protect from any infective agent and can instead cause disease .
thus , we have the same antibody recognizing different structures depending on the involved organism and playing or not playing a pathogenic role .
this distinction is not exclusive to the dichotomy between parasite and allergenic organisms , but also exists within the ige recognition of allergenic sources themselves .
it is now accepted that ige from allergic individuals can recognize antigenic non - parasite - related structures from allergens and non - allergens without any related symptoms .
such ige seems to be unable to trigger allergic symptoms as shown by the negative double - blind placebo - controlled oral challenge with recombinant human lactoferrin produced in rice as a model of plant multiple glycosylation ige - binding structure .
overall , the condition of having ige with or without clinical symptoms can be reported for almost any allergen . at the end of this first section
, we can assume that ige can recognize allergenic and non - allergenic structures and may or may not trigger allergic symptoms .
compared with other human diseases , where two conditions are recorded as the absence or the presence of a symptomatic disease ( i.e. diabetes , hypertension ) , measured by the alteration of a single parameter ( i.e. blood glucose , blood pressure ) , if a general population is examined we might record three conditions by using specific ige detection : ( 1 ) no specific ige ; ( 2 ) specific ige sensitization to a given allergen without any clinical symptoms upon exposure ; and ( 3 ) specific ige sensitization with different severity degrees of clinical symptoms upon exposure to different levels of allergenic molecules .
these three conditions should be kept in mind when defining a molecule as an allergen along with the assumption that the ige - binding property is not an intrinsic feature of any protein but it is by definition the interaction of two molecules : the antigen and the ige .
for routine diagnostic purposes or to define the magnitude of allergic sensitization within a given cohort examined for epidemiological purposes , we currently use the skin prick test ( which indirectly shows us the presence of specific ige ) and direct ige detection on serum samples by several in vitro methods . in either case
, we never make any conclusion about the clinical relevance of the findings based solely on in vivo and in vitro tests .
we need to carefully explore the patient 's history searching for evidence of a reliable temporal relationship between allergen exposure and symptom appearance or the individual reactivity by challenging target organs . in the absence of a positive clinical or challenge history , we conclude that the subject is asymptomatic for that given ige - binding structure .
the immunological dichotomy described above is thus defined by the clinical perspective , but it is only from the same testing procedures that we can start the process of classifying compounds as ige - binding structures . historically , it is from evidence that exposure causes allergy symptoms that we start the process of identifying the involved allergenic molecules .
once sensitization is identified , several steps are required before the protein can be fully documented as an allergen .
table 1 reports an ideal process for a comprehensive definition of the characteristics of an allergenic molecule .
if we take as for example some allergens that have been identified 20 years ago or more , like der p 1 or bet v 1 , we see from the literature that they could reach the + 4 evaluation stage nowadays , having only occasional studies in the + 5 or the + 6 evaluation stages . in an almost 10-year range ,
pru p 3 has reached 124 publications with just one epidemiological study , leading the allergen to be scored + 4 .
if we apply the 12-step approach to the allergen identification and characterization process , allergens listed in any online publicly accessible repository would range between the 1 and + 2 stages .
two different approaches are currently identifiable within the allergen characterization process : immunochemical identification lacking any biochemical characterization and the direct cloning of the molecule . the former is mostly applied when a polyclonal , igg or ige isotype , from either humans or experimental animals , or a monoclonal antibody are available for an already characterized homologous molecule .
if the antibody is purified and the allergen specificity is known , the presence of the allergen can be deduced .
antibodies other than ige give us just the idea that the molecule is in the extract , rather than information about its allergenic nature .
ige inhibition by a previously purified allergen is another immunochemical method to detect and describe an ige - binding structure within a given allergenic extract .
the direct cloning of the allergen is the second strategy adopted when the amount of molecule recoverable from the allergenic extract is too low for any analytical and preparative use or to speed up allergenic protein characterization . as reported in table 1 for the natural forms
, recombinants should undergo the same stepwise process for characterization plus the validation against the natural form , when available .
because of the assumption reported above , about the presence or the absence of clinical disease in allergen - specific ige - bearing individuals , the definition of the symptomatic / asymptomatic ratio would most likely be defined at stages + 5 and + 6 of the allergen characterization process .
allergen identification and full characterization process characterization stages defined by the minus sign refer to pre - allergenic structure definition ; those defined by the plus sign refer to the post - allergenic structure definition . at the end of this second section
, we can conclude that , having an extended although not yet exhaustive knowledge on allergenic molecules , the identification process can also be somewhat different from the
as reported above and from a survey of the literature , this process is always dispersed on several papers published in more than one journal depending on the leading topic .
we can still certainly distinguish an identification process for a very new compound , which is almost unchanged since the very early days of allergen identification and today called
proteomics , but at the same time several different approaches can be applied to homologous allergen identification by using molecular cloning technique .
the stepwise process seems to be a reliable way to collect accumulating data on each allergenic molecule .
from the first two sections , we have learned that we need to organize our knowledge on structures and let them be defined as ige binding or not , and as causing allergic diseases or not .
biotechnology procedures , which include all the molecular biology techniques , might lead us to potentially identify all the ige - binding structures regardless of whether they are either rarely expressed in the allergenic organism tissue or are rarely ige recognized within a general average population , or are rarely but constantly ige recognized by selected subsets of genetically prone subjects . the advantage of any rapid high - throughput system for allergen identification or even the genomic identification of related genes [ 8 , 9 ] is to give us access to hundreds of potentially related or putative allergenic molecules . in the case of the 12-step approach described in table 1 ,
the allergen identification and characterization starts at stage + 1 , but lacks the definition of the ige - binding property .
we expect to have more of these studies leading to an extended genomic knowledge of known allergenic organisms and taxonomic related and unrelated ones .
we must thus implement strategic tools to classify the structures since the beginning of their description by extensively using information technology tools . at the same time , we must step up the characterization stage of every single molecule using high - throughput ige detection systems .
there are several internet - based resources aiming to regulate and classify ige - binding structures [ 1012 ] .
the allergen nomenclature web site ( http://www.allergen.org ) is devoted to report the work of the specific who - iuis subcommittee .
being an official organ of an international health authority organism , the expert work of the subcommittee should be advised as the most critical one in a blasting situation of allergen identification as reported in fig .
fulfilling the given criteria , the new allergen receives a name and is put in the list .
looking at the last who - iuis - released allergen list ( 28 january 2008 ) , 580 allergens and 876 isoallergens are classified .
it is noteworthy that if not submitted , many well - characterized allergens are not in the who - iuis list ( i.e. buckwheat allergens ) .
the allergen recruitment mechanism is the basis of the discrepancy between the who - iuis allergen list and the others .
the overall data processing sometimes leads to allergens classified before any public document appears in the scientific literature .
the food allergy research & resource program ( faarp ) at the university of nebraska releases a web - based database ( http://www.allergenonline.com ) whose aim is to classify proteins as allergens .
this work is based on a panel of scientists and clinicians actively involved in reviewing literature data by comparing peer - reviewed publications following predetermined guidelines .
pre - defined criteria lead to classify proteins into three categories as allergens , putative allergens and those having insufficient evidence of allergenicity .
the last released database , version 8.0 , lists 1313 peer - reviewed sequences included in the first two categories .
allergenicity or putative allergenicity of a given sequence is evaluated , but assignment to the two categories is not reported in the accessible database .
further , considering the given criteria for allergenicity ( i.e. specifically bind ige using sera from individuals with clear allergies to the source of the gene / protein and further that the protein causes basophil activation or histamine release , skin test reactivity or challenge test reactivity using subjects allergic to the source ) , many of the listed isoforms should not be considered either allergens or putative allergens as for instance they have never been shown to bind ige .
reference documentation is given for allergen groups generating confusion when reaching a putative allergen sometimes having just a sequence similarity to a given allergen , thus seeming to be well documented .
the availability of sequence similarity search tools , either customized or not , increases the usefulness of the database , particularly if the main purpose of the database is to evaluate allergenicity of novel proteins from genetically modified organisms .
the allergome platform ( http://www.allergome.org ) is an independent project aiming to classify allergens , ige - binding antigens and non - ige - binding structures .
the only pre - defined criterion used for the entry of a new structure is that it has to be tested at least once for its ige - binding capacity or has any structural relationship with known allergens .
this strategy leads to classify the largest set of molecules among online available web sites ( 1400 allergens , 939 isoallergens , as of february 2008 ) .
each classified structure is fully documented in terms of published papers , each study is assigned to a specific scientific documentation category ( i.e. biochemistry , molecular biology , diagnosis , epidemiology , etc . ) , allowing the user to understand whether the molecule has just a sequence reported in protein databases or has been fully documented , somewhat helping to comply with the classification stage as described in table 1 .
references may be retrieved either by searching for the specific molecule or by the allergome customized literature mining tool , the refarray .
data on allergenicity are also extracted from the literature and reported in detail in the molecule monograph . at the moment , no search tools are available to discriminate between molecules on the basis of the documentation extent .
a tool allowing dynamic refined searches among classified structures would certainly increase the usefulness of the allergome platform , fulfilling the need and requirements for a more critical view of allergenic structure classification and characterization level .
none of the internet - based databases has adopted any post - identification criteria for a further characterization of a given allergenic molecule .
allergens should undergo an extensive evaluation based on their use during the clinical workup in world - wide allergy centres or within large epidemiological studies .
dealing with hundreds of allergenic molecules would be difficult or almost impossible using skin test or singleplex testing currently available in laboratory systems to support this idea .
following the application of microarray technology to genomics , the same technology is now applied to proteomics .
a large collaborative study involving world - wide researchers gave us the proof of concept that proteomic microarray can be dedicated to ige detection based on allergenic molecules .
further reports describe this new powerful tool [ 1517 ] now available as a commercial product for routine multiplex ige detection ( isac system , vbc - genomics , vienna , austria ) .
the intrinsic feature of the allergenic molecule - based multiplex test is to allow any single allergy centre adopting the tool for routine diagnostic purposes to produce a wealth of data related to all the tested molecules on all the tested patients .
this molecule - based microarray ige testing , adopted in our centre since march 2006 , has generated almost 2 000 000 data on an average of 80 allergens , giving a detailed magnitude of sensitization prevalence for each allergen and linking them to clinical features .
further expansion of available allergenic molecules spotted on the microarray , regardless of being common or uncommon allergens in a given geographical area , would further expand our knowledge .
it is noteworthy that additional powerfulness will be added to such testing when the isac system will be fully interfaced with the allergome - retime platform , a module for raw data mining allowing to store and retrieve real - time produced data .
complementing these networked systems with an electronic record for the allergy patient would allow any world - wide allergy specialist to contribute towards increasing the knowledge on allergens .
additional bioinformatics analysing tools will help in evaluating protein reciprocal biochemical and immunochemical relationships by showing for instance the clustering behaviour of previously undefined structure .
it is highly realistic to say that the definition of the biological feature of any given protein to be or not an ige - binding protein , and to be capable of giving rise to clinical symptoms in a certain percentage of the sensitized population , comes from a stepwise approach combining bench and bedside studies , starting from still relevant isolated case reports to selected cohort studies .
classical tools can now be integrated by biotechnology , microtechnology and bioinformatics tools in an attempt to dynamically describe the allergen / non - allergen ontology .
the stepwise approach for defining a molecule as an allergen or not may require months to years , but a dynamically defined platform integrating the best feature of currently available web - based resources could speed up our process to acquire the most comprehensive knowledge on allergenic structures ever , leading most of the allergenic molecules to step up their characterization level in a short time frame , and to be classified between the highest stages of the arbitrary scale reported in table 1 . in the future , considerable effort should be directed towards designing the broadest world - wide project in order to classify ige- and non - ige - binding structures using most of the technological resources as reported in the present article and involving health authorities , scientific associations and companies .
although it could seem too visionary a hypothesis for the future , too far from a realistic application , the opinions reported herein are based on their development and their practical current application .
all the data and information used in the present paper have been extracted from the allergome platform and related archives as of february 2008 .
he acts as chief scientific and business administrator of allergy data laboratories s.c . , a non - for - profit company devoted to managing allergy - related data .
the allergome platform is currently the main independent project financially supported by allergy data laboratories s.c .
Output:
| since the early beginning of allergology as a science considerable efforts have been made by clinicians and researchers to identify and characterize allergic triggers as raw allergenic materials , allergenic sources and tissues , and more recently basic allergenic structures defined as molecules .
the last 1520 years have witnessed many centres focusing on the identification and characterization of allergenic molecules leading to an expanding wealth of knowledge .
the need to organize this information leads to the most important question when does a protein become an allergen? in this article , i try to address this question by reviewing a few basic concepts of the immunology of ige - mediated diseases , reporting on the current diagnostic and epidemiological tools used for allergic disease studies and discussing the usefulness of novel biotechnology tools ( i.e. proteomics and molecular biology approaches ) , information technology tools ( i.e. internet - based resources ) and microtechnology tools ( i.e. proteomic microarray for ige testing on molecular allergens ) . a step - wise staging of the identification and characterization process , including bench , clinical and epidemiological aspects , is proposed , in order to classify allergenic molecules dynamically .
this proposal reflects the application and use of all the new tools available from current technologies . |
PubmedSumm118464 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: nonsmall cell lung cancer ( nsclc ) remains a leading cause of death worldwide among patients diagnosed with malignancy . despite new chemotherapy regimens and new cytotoxic combinations investigated in multiple randomized clinical trials in recent years
the five - year survival rate for all patients diagnosed with nsclc is about 15% , only 5% better than 40 years ago .
significant progress has been made in the recent years in understanding the molecular mechanism of lung cancer .
new therapeutic approaches that target various different aspects of tumor progression and metastasis have been intensively investigated in nsclc , with benefit / advantage on median overall survival , recently increased to more than one year .
many drugs that block tumor vascularization ( angiogenesis ) or interfere with the activity of growth factor receptors and molecular pathways downstream triggered are already used in clinical practice , and more are on study . in this paper
we will discuss the basic mechanism of activity and rationale for using those new drugs .
in 1971 , dr . judah folkman put forward the theory that malignant tumors can not grow beyond a certain size without recruiting their own blood vessels ( tumor angiogenesis ) through a process that involved production of a soluble growth factor that was secreted by the tumor itself .
he also proposed that the local tumor growth and formation of metastases could be prevented by inhibiting the tumor angiogenesis . among the list of factors that induce tumor angiogenesis ,
the most important is vascular endothelial growth factor a ( vegf ) , discovered in 1983 .
vegf is the primary survival factor of vascular endothelial cells , stimulates proliferation , and migration and inhibits apoptosis and modulates their permeability .
those biological functions are mediated upon binding to receptor tyrosine kinases : vascular endothelial growth factor receptors 1 , 2 , and 3 ( vegfr 1,2,3 ) [ 69 ] .
expression of vegf within tumors is regulated by multiple factors including the level of oxygen within the tumor , growth factors and cytokines produced by the tumor , and mechanism involving oncogene / tumor suppressor inactivation .
hypoxia and hypoxia - inducible factor ( hif ) in the microenvironment are the most important factors driving angiogenesis , tumor cell proliferation , cell survival and progression , metastatic spread , and apoptosis .
there are two major way of blocking the vegf pathways blocking the activation of extracellular part of vegf receptor by inhibiting antibodies against vegf molecule or blocking the activation of tyrosine kinase within the intracellular part of vegf receptor by tyrosine kinase inhibitors [ 12 , 13 ] .
in particular the majority of patients having tumors with squamous histology and centrally located in close vicinity to major blood vessels had serious pulmonary bleeding . following this trial ,
eastern cooperative oncology group conducted a phase iii trial ( e4599 ) comparing paclitaxel and carboplatin chemotherapy alone and the same chemotherapy combined with bevacizumab .
after completion of 6 cycles of treatment , patients receiving bevacizumab with chemotherapy continued on bevacizumab as single agent until disease progression or intolerable toxicity occurred .
patients with squamous histology , brain metastases , and central localization were excluded from the study .
the combination of chemotherapy and bevacizumab resulted in the significant improvement in median survival by 2 months when compared with chemotherapy alone group , 12.3 versus 10.3 months , respectively .
the avail trial investigated similar approach as ecog 4599 study in advanced nsclc patients , comparing cisplatin and gemcitabine alone versus the same chemotherapy combination with bevacizumab in two different doses .
although the study was powered for overall survival ( os ) , the primary endpoint was changed from os to progression - free survival ( pfs ) during accrual .
median pfs improved upon adding bevacizumab to chemotherapy both with 7.5 mg / kg dose and 15 mg / kg when compared with chemotherapy alone .
however , no survival benefit was observed with adding bevacizumab to standard chemotherapy as shown in ecog trial .
there are multiple different reasons for this different result including insufficient statistical power of the study or the different platinum - based doublet combined with bevacizumab that may matter .
there are ongoing trials with new antiangiogenic molecules as the vascular disrupting agent asa404 , just concluded and press - released to be negative , and oral small - molecule tyrosine kinase inhibitors . among those tkis ,
vandetanib ( zd6474 , astrazeneca ) , an inhibitor of vgfr2/3 , ret , and egfr , has the more advanced development program ; in second - line , phase iii trial zodiac , vandetanib showed a slightly improvement of pfs when combined with docetaxel , 4 and 3.2 months , respectively ; there was no statistical difference in the pfs when combined with pemetrexed in another randomized phase iii trial ( zeal ) for second - line treatment .
vandetanib was compared to erlotinib in a phase iii trial for pretreated patients affected by advanced nsclc , zest trial .
the study did not meet its primary objective of demonstrating pfs prolongation . in the zephyr trial vandetanib
was compared to placebo in patients resistant to chemotherapy and egfr inhibitors ; any statistically significant advantage was reported neither for the progression - free survival nor for the overall survival .
many other trials are ongoing with sunitinib , multityrosine kinase inhibitor of vegf , kit , flt3 , pdgfr , and raf , sorafenib , inhibitor of pdgfr- , raf , c - kit , flt3 , and all vegfrs , bibf1120 , a potent triple inhibitor of vegfr 1,2,3 , fibroblastic growth factor , and pdgfr , axitinib , a potent inhibitor of all three vegfrs . in particular the results of the sun
1087 trial have been recently reported ; in this phase iii trial sunitinib in combination with erlotinib was compared to erlotinib in patients with previously treated advanced nsclc , bringing a statistically significant improvement in pfs but not in os .
nexus , a phase iii , randomized , double - blind , placebo - controlled study evaluated sorafenib versus placebo in combination with two chemotherapeutic agents , gemcitabine and cisplatin , in treatment - naive nonsmall cell lung cancer patients .
no advantage in os was demonstrated ; however , a slight improvement in pfs was shown , although this was not the primary endpoint of the study .
the epidermal growth factor ( egf ) pathway was discovered by stanley cohen in the sixties ; later in 1980 involvement of its receptor , egfr , in the tumor genesis was demonstrated .
the egfr pathway can be modulated by monoclonal antibodies that block egfr ( cetuximab , panitumumab ) or by small molecule tyrosine kinase ( tkis ) ( erlotinib , gefitinib ) that interfere with activation of egfr .
the first important trials were designed with tki gefitinib , ideal 1 and 2 , two large phase ii trials , demonstrating an antitumoral activity of gefitinib in the treatment of advanced nsclc , in particular in adenocarcinoma , females , nonsmokers and asian population [ 25 , 26 ] .
although two north american groups reported the importance of egfr mutations ( exon 19 and exon 21 l858r ) for prediction of higher response rate and their prevalence in nonsmoker , asian , female population with adenocarcinoma [ 27 , 28 ] , two large randomized clinical trials , placebo - controlled , phase iii were already started , assessing gefitinib or erlotinib in second or further line of therapy , respectively , the isel and br.21 trials [ 29 , 30 ] .
response rate was similar in both trials , 8% ; however , only the erlotinib trial reached a significant impact on overall survival . later on , clinically or molecularly enriched trials confirmed the role of mutations and as predictive and prognostic positive biomarker . in the ipass trial , east asian patients who were never or light smokers were randomized to receive chemotherapy or gefitinib as first - line treatment .
patients who were egfr mutation positive benefited more from gefitinib , whereas the mutation - negative patients did better with chemotherapy .
the same result was obtained from a korean trial , first signal , showing the consistence of those results .
the west japan and north east japan groups conducted parallel trials , where molecularly selected population for egfr mutations was randomized to receive chemotherapy of gefitinib as first - line treatment .
both trials demonstrated the significant superiority in time to progression of the patients receiving gefitinib [ 33 , 34 ] .
overall survival did not differ between the two arms , likely for a crossover effect .
the same result , for example , no difference in overall survival despite the significant benefit in pfs , was obtained in the ipass trial .
two phase iii trials , flex and bms 099 , combined chemotherapy with or without cetuximab in the treatment of chemo - naive patients with advanced nsclc .
patients on the flex trial had to be egfr positive by immunohistochemistry ( ihc ) , and patients who received the cetuximab had a modest but significant survival benefit . on the bms 099 trial
, there was no patient selection and no survival advantage for the cetuximab arm ; however , the lack of a significant survival advantage could be due to the small sample size of the study .
bib9229 ( afatinib ) is an oral irreversible tki of both egfr and her2 , and it demonstrates activity in egfr mutants resistant to erlotinib , gefitinib , and lapatinib .
it has demonstrated single agent activity in patients with egfr mutations ( lux - lung2 ) and in egfr tkis failures .
kras mutations are found predominately in the adenocarcinoma histologic subtype of nsclc ( approximately 30% ) and less frequently in the squamous cell carcinoma subtype ( approximately 5% ) .
kras mutations are associated with a history of tobacco use , and the frequency of kras mutations varies among different ethnic groups [ 40 , 41 ] .
the mutant kras genes in human cancers encode mutated proteins that harbor single amino acid substitutions , in lung cancer primarily at codons 12 and 13 .
mutant kras proteins are constitutively activated , leading to stimulus - independent , persistent activation of downstream effectors , in particular , the raf - mek - erk cascade [ 42 , 43 ] .
it has been recently investigated the role of kras mutations and egfr in 1081 patients , and those patients with kras mutations had a shorter survival than patients with egfr mutations or egfr / kras wild type . although there is a reasonable biologic rationale to support the hypothesis that nsclc tumors with kras mutations are resistant to egfr - tkis , the clinical data confirming it have been elusive .
this might be a result of the very low prevalence of kras and egfr mutations in nsclc and the low rate that tumor tissue has been available for kras
the c - met ( hereafter referred as met ) receptor tyrosine kinase was originally identified as the cellular homologue of the tpr - met oncoprotein .
met can be overexpressed in a number of malignancies , sometimes mutated , or sometimes even amplified .
met located on chromosome 7 encodes for a single precursor that is posttranscriptionally modified , forming a transmembrane protein .
ligation of met receptor to hgf leads to activation of its intrinsic tyrosine kinase . activating mutations of met
have been reported in a variety of cancers such as lung cancer , melanoma , mesothelioma , and pancreatic cancer ; met can also be amplified in lung cancer .
several met inhibitors are currently under evaluation , like arq 197 or pf 23411066 ; promising results of a phase ii trial with arq 197 associated to chemotherapy were recently presented at the asco meeting .
a new fusion oncogene , named eml4-alk , has been described in about 4% of nsclc patients , mostly in never smokers , young , male , usually not harboring egfr mutations .
the oncogene is due to a translocation within chromosome 2 bringing to a fusion between the n - terminus of the echinoderm microtubule - associated protein - like 4 ( eml4 ) and the intracellular domain of anaplastic kinase ( alk ) , and its tyrosine kinase activity can be triggered by alk , met , and hgf .
the activity of eml4-alk can be abolished by an oral compound , pf 02341066 ( crizotinib , pfizer ) .
eml4-alk can be tested by fish , the recommended dose is 250 mg twice daily and after the promising results of a phase ii trial , a phase iii trial is ongoing .
the insulin growth factor receptor ( igfr ) is involved in essential steps of cancer development such as survival , proliferation and metastases .
predictive factors , that is , predictive biomarkers , are yet not identified , although it has been suggested that pretreatment levels of circulating free igf1 could help in selecting responsive patients .
several compounds , including monoclonal antibodies and tyrosine kinase inhibitors , are currently under clinical investigation in nsclc .
the figitumumab ( cp-751,871 ) is the only anti - igf1r monoclonal antibody whose phase iii trial has already finished , and no statistical improvement was demonstrated by adding figitumumab to standard chemotherapy in advanced nsclc patients .
more trials are ongoing with other antibodies with different affinity to igf1r , like imc - a12 and mk-0646 .
although a platinum doublet remains the standard treatment for advanced nsclc patients and histology drives the choice of the drugs , biomarkers are useful for prognostic and predictive information . up to now , the lack of established predictive biomarker to select patients for the antiangiogenic drugs may be the cause of the modest results observed with vegfr inhibitors small molecules ; the data obtained with bevacizumab are significant only when bevacizumab is combined with taxanes , likely for a synergistic activity ; however , the lack of a predictive marker is a big issue for all those drugs .
egfr mutations are present in 35% of the asian population and in 15% of the caucasian population ; patients affected by advanced nsclc with sensitizing mutations in the egfr gene are highly responsive to egfr - tkis with dramatical improvement of their os , and they should receive those drugs during their treatment .
eml4-alk and egfr mutations are reported to be mutually exclusive ; therefore , eml4-alk should be checked in patients egfr negative , for the outstanding results obtained with crizotinib in the phase ii trial , to be confirmed .
other molecular markers and target drugs are advancing rapidly , so the molecular analysis of tumor tissue for molecular characterization is a crucial step in defining the best treatment strategy .
Output:
| targeting intracellular signaling molecules is an attractive approach for treatment of malignancies .
in particular lung cancer has reached a plateau regarding overall survival , and target therapies could offer the possibility to improve patients ' outcome beyond cytotoxic activity .
the goal for target therapies is to identify agents that target tumor - specific molecules , thus sparing normal tissues ; those molecules are called biomarkers , and their identification is recommended because it has a predictive value , for example , provides information on outcome with regard to a specific treatment .
the increased specificity should lead to decreased toxicity and better activity .
herein we provide an update of the main target therapies in development or already available for the treatment of nonsmall cell lung cancer . |
PubmedSumm118465 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: hyper - stretching
of the lateral collateral ligament of the ankle often occurs while descending stairs and
landing incorrectly on the foot .
this leads to pain and swelling , which interferes with
activities of daily living1,2,3 .
the tibialis
anterior ( ta ) and peroneus longus and brevis ( pl and pb ) muscles play important roles in the
dynamic stability of the ankle .
a medial wedge
in the shoe induces ankle joint inversion and stimulates evertor activation more than
invertor activation5 .
ankle inversion
causes reflex contraction of the peroneus longus6 , which controls ankle mobilization and protects against lateral
ankle sprain7 .
exercise sandals
( orthopedic physical therapy products , minneapolis , mn , usa ) with hemispherical soles
increase ta and pl muscle activation during one - leg standing10 , and decrease movement of the anteroposterior and mediolateral
pressure centers in patients with functional ankle instability through functional balance
training ( including walking , lunging , and squatting)11 .
however , because the hemispherical structures in those studies
were attached to the soles of the exercise sandals , the evertors could not stimulate
selective muscle activation preventing lateral ankle sprains . in this study ,
the exercise sandals were modified using a rod instead of a hemispherical
structure attached to the middle of the soles from the heel to the toe , to increase eversion
muscle activation ( the medio - lateral unstable sole ; mlus ) .
the purpose of this study was to
compare the activation of the pl , pb , and ta muscles with the mlus or bare feet while
descending stairs .
the participants ( 14 males , 16 females ; age 1925 years ) had no history of ankle sprain in
the previous 6 months , or lower extremity surgery or fracture .
foot size was 260270 mm
( males ) and 230240 mm ( females ) .
the project received approval from the human research
ethics committee of silla university , and informed consent was obtained from each
participant .
a myotrace 400 and myoresearch xp ( noraxon , scottsdale , az , usa ) were used to
collect and process electromyography ( emg ) data .
the emg signal was sampled at 1,000 hz and
a frequency bandwidth of 25450 hz .
the signal around 60 hz was removed to eliminate
artificial noise , and the root mean square was calculated ( window 300 ms ) .
surface emg
electrodes were placed on the bellies of the ta , pl , and pb muscles , at a 2-cm
inter - electrode distance . for the ta
, the electrodes were placed over the area of greatest
muscle activation while resisting inversion and dorsiflexion ; for the pl , they were placed
in the lateral plane over the superior one - third of the fibula ; and for the pb , they were
located one - fourth of the distance from the lateral malleolus to the fibular head . for
normalization
, a maximal voluntary isometric contraction was conducted in a standardized
manual muscle position12 .
the mlus was made by attaching a hemispherical rod ( 4 cm long ) to the middle of the sole of
the shoe .
it was not necessary to change the participants shoes because the mlus was
removable .
the participants stood on a step ( 27 cm high ) and maintained their balance while
looking to the front13 .
the participants
were instructed to step down off the stair onto the testing leg while moving forward .
the
participants kept looking forward and were not allowed to look down , with the knee joint in
flexion .
as the dominant leg moved toward the floor while descending , the non - dominant leg
maintained balance14 .
the independent variables were bare feet
and using the mlus and the dependent variables were activation of the pl , pb , and ta
muscles .
paired t - tests were used to compare pa , pb , and ta activation .
18.0 ; norusis / spss , chicago , il , usa ) and the
significance level was set at 0.05 .
table 1table 1.activation of invertor and evertor ( % ) while descending stairtibialis anteriorperoneus longusperoneus brevisbare foot7.80 ( 3.74)20.92 ( 10.41)11.63 ( 6.29)mlus15.91 ( 8.44)*29.86 ( 13.82)*29.88 ( 13.79)*mlus : medio - lateral unstable sole , * p<0.05 summarizes muscle activation with the mlus or bare feet while descending
stairs .
most studies of ankle sprain begin by noting that ankle sprains are the most common sports
injury10 , 15 , 16 and suggest that there
should be measures to prevent ankle sprains .
it is important to prevent than treat damage ,
as it is more difficult for a damaged joints to regain full function . in a study on
volleyball athletes ,
the biomechanical ankle
platform system ( baps ) is effective at preventing further damage as it improves lower - limb
muscle strength and proprioception sense18 .
this study examined whether the attachment of the mlus instead of a hemisphere , to the sole
of exercise sandals stimulated activation of the evertors to a greater degree . unlike
standard exercise sandals , the modification was designed to stimulate more movement in the
frontal plane ( inversion and eversion ) .
there is no need to buy a new pair of shoes because
the mlus is made with velcro and is easily attached to the shoes , regardless of size .
this
study observed significantly more activation of the pl and pb , and the ta muscles with the
mlus .
this is consistent with findings that subjects wearing exercise sandals showed
improved ta , soleus , and pl muscle activation during one - leg standing10 .
our study may have a more practical application as it
involved exercises that are similar to daily activities , such as descending stairs .
hence , exercises
to increase dorsiflexion and eversion are needed to prevent ankle sprains . because the ta
muscle causes both dorsiflexion and inversion ,
the mlus was designed to decrease movement of
plantar flexion and increase the movement of inversion and eversion while descending stairs .
this study detected more activation of the eversion muscles , although there was also more
activation of the ta muscle , as reported previously15 . in this study
however , it is not clear whether balance and
muscle - strengthening exercises with the mlus to prevent ankle sprains would enhance
stability of the ankles and entire body . therefore , future studies should examine whether
balance and muscle - strengthening exercises with the mlus increase this stability .
this study
suggests that the mlus can be used with exercises to prevent further damage to the ankles by
stimulating activation of both the inversion and eversion muscles .
Output:
| [ purpose ] this study examined the effects of a medio - lateral unstable sole on invertor
and evertor activation while descending stairs . [ subjects and methods ] the subjects were
30 university students with no history of ankle sprain .
they descended stairs while
wearing the medio - lateral unstable sole or with bare feet .
electromyography was used to
record the activity of the tibialis anterior and peroneus longus and brevis muscles and
paired t - tests were used to assess statistical significance .
[ results ] the medio - lateral
unstable sole group showed increased tibialis anterior and peroneus longus and brevis
muscle activation compared to the barefoot group .
[ conclusion ] medio - lateral unstable sole
can be used with exercises to prevent further ankle damage by activating both the
inversion and eversion muscles . |
PubmedSumm118466 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: friction is the force that resists against the movement of one surface in relation to another and that acts on the opposite direction of the desired movement .
this frictional force is always parallel to the surfaces that are in contact and its magnitude is dependent upon the amount of the normal force pushing the two surfaces together .
the nature of friction in orthodontics is multifactorial , derived from both a multitude of mechanical and biological factors .
many studies have been carried out to evaluate the factors that influence frictional resistance : bracket and archwire materials , surface structure of archwire , surface condition of the archwire and the bracket slot , bracket width , archwire size and shape , torque at the wire - bracket interface , type and amount of force exerted by ligation , use of self - ligating brackets , number of brackets inter bracket distance , saliva , and influence of oral functions , etc . in modern society , the esthetic aspect of orthodontic therapy is important due to the number of adults undergoing orthodontic therapy are increasing .
therefore , the development of appliance that combines both esthetic and adequate technical performance is an important goal .
ceramic brackets were developed to improve the esthetics during orthodontic treatment ; however , in clinical use , they have high frictional resistance to sliding mechanics .
ceramic brackets with metal slot were recently developed to minimize the frictional characteristics of ceramics brackets .
coating or refining the wire surface with other materials has an influence on frictional behavior .
since teflon has a low coefficient of friction , so archwires with teflon coating could possibly reduce frictional resistance at the bracket - archwire interface .
there were limited numbers of studies on frictional behavior of teflon coated archwires and metal slot ceramic brackets .
therefore , the purpose of the present study was to evaluate and compare the frictional resistance generated by three types of brackets ( stainless steel , ceramic , and metal slot ceramic ) with seven different archwires ( stainless steel , teflon coated stainless steel , stainless steel with the reverse curve of spee ( rcs ) , teflon coated stainless steel with rcs , nickel - titanium ( niti ) , teflon coated niti , niti rcs ) ligated by two different ligation materials ( stainless steel ligature and elastomeric modules ) .
on the basis of bracket material , three types of brackets of mbt prescription with 0.022 0.028 inch slot were used : stainless steel brackets ( di - mim , mini - twin brackets , ortho organizers , san marcos , ca ) , ceramic brackets ( illusion plus , ortho organizers , san marcos ca ) and ceramic brackets with metal slot ( metal slot illusion plus , ortho organizers , san marcos , ca ) [ figure 1 ] . tested brackets : ( a ) stainless steel ; ( b ) ceramic ; ( c ) ceramic with metal slot seven different rectangular archwires of 0.019 0.025 inch were used in the study as follows : low : stainless steel , teflon coated stainless steel , stainless steel with rcs , teflon coated stainless steel with rcs , niti , teflon coated niti , niti rcs ( all archwires from ortho organizers , san marcos , ca ) .
the ligation materials used were : stainless steel ligature 0.009 inch ( ortho organizers , san marcos , ca ) and regular clear elastomeric module , 0.120 inch ( ortho organizers , san marcos , ca ) .
frictional resistance was measured in grams with a universal testing machine ( model 3382 , instron , canton , ma , usa ) . to simulate fixed appliance in the oral cavity a typodont model ( api , ashoo sons , new delhi , india )
testing models were prepared the maxillary jaw of typodont model . for canine retraction mechanics ,
testing models were prepared by removing 1 premolars from their position to simulate the condition of an extraction case .
the canines were cut at the level of cervical line to facilitate its distal movement during sliding mechanics over the archwire . on the typodont model 's teeth (
central incisors , lateral incisors , canines , and 2 premolars ) brackets and buccal tubes ( 1 molars ) were bonded at the clinically appropriate position using a cyanoacrylate adhesive ( fevi kwik , pidilite industrial ltd , mumbai , india ) .
study model used in the study : ( a ) side view ; ( b ) occlusal view brackets and archwires were cleaned with acetone wipe to remove any surface impurities .
the archwires to be tested were ligated to the brackets by stainless steel ligature and elastomeric module .
the stainless steel ligatures were initially fully tightened and then slightly slackened to allow the bracket to slide freely , the end of the ligature was then tucked in under the archwire . in case of elastomeric ligature
, the elastomeric modules were placed immediately before each test ran to avoid ligature force decay .
the testing model was positioned vertically on the lower fixed member of the floor mounted universal testing machine .
for the movement of canine , a loop of 0.018 ss was made and loop was engaged in the hook of canine bracket .
free end of 0.018 ss wire was held by upper cross head of testing machine during testing [ figure 3 ] .
the upper cross head member of the testing machine was adjusted to move upwards at a constant speed of 0.5 mm / min .
movement was started when canine was in contact with the distal surface of lateral incisor and stopped when canine just touched the mesial surface of 1 premolar .
the resulting frictional resistance was recorded on a computer in the form of a force - distance graph .
the tests were carried out in dry condition ( to achieve the result in non - contaminated condition ) and at room temperature .
testing model on universal testing machine the data thus obtained were summarized as meansd the effect of variables ( bracket materials , ligation materials and seven different archwires ) on frictional resistance were observed and compared together by three - way way analysis of variance and the significance of mean difference between the groups was done by duncan multiple range test after ascertaining the normality and homogeneity of variance by shapiro wilk test and levene 's test , respectively .
the frictional resistance was found normally distributed after square root transformation and thus analyzed on transformed data .
a two - tailed ( =2 ) probability p value less than 0.05 was considered statistically significant .
to simulate fixed appliance in the oral cavity a typodont model ( api , ashoo sons , new delhi , india ) was taken as a testing model .
testing models were prepared the maxillary jaw of typodont model . for canine retraction mechanics ,
testing models were prepared by removing 1 premolars from their position to simulate the condition of an extraction case .
the canines were cut at the level of cervical line to facilitate its distal movement during sliding mechanics over the archwire . on the typodont model 's teeth (
central incisors , lateral incisors , canines , and 2 premolars ) brackets and buccal tubes ( 1 molars ) were bonded at the clinically appropriate position using a cyanoacrylate adhesive ( fevi kwik , pidilite industrial ltd , mumbai , india ) .
study model used in the study : ( a ) side view ; ( b ) occlusal view brackets and archwires were cleaned with acetone wipe to remove any surface impurities .
the archwires to be tested were ligated to the brackets by stainless steel ligature and elastomeric module .
the stainless steel ligatures were initially fully tightened and then slightly slackened to allow the bracket to slide freely , the end of the ligature was then tucked in under the archwire . in case of elastomeric ligature
, the elastomeric modules were placed immediately before each test ran to avoid ligature force decay .
the testing model was positioned vertically on the lower fixed member of the floor mounted universal testing machine . for the movement of canine , a loop of 0.018
free end of 0.018 ss wire was held by upper cross head of testing machine during testing [ figure 3 ] .
the upper cross head member of the testing machine was adjusted to move upwards at a constant speed of 0.5 mm / min .
movement was started when canine was in contact with the distal surface of lateral incisor and stopped when canine just touched the mesial surface of 1 premolar .
the resulting frictional resistance was recorded on a computer in the form of a force - distance graph .
the tests were carried out in dry condition ( to achieve the result in non - contaminated condition ) and at room temperature .
the data thus obtained were summarized as meansd the effect of variables ( bracket materials , ligation materials and seven different archwires ) on frictional resistance were observed and compared together by three - way way analysis of variance and the significance of mean difference between the groups was done by duncan multiple range test after ascertaining the normality and homogeneity of variance by shapiro wilk test and levene 's test , respectively .
the frictional resistance was found normally distributed after square root transformation and thus analyzed on transformed data .
a two - tailed ( =2 ) probability p value less than 0.05 was considered statistically significant .
the mean friction and standard deviation for each bracket - archwire - ligation combination is summarized in table 1 .
the highest mean frictional resistance was found in ceramic brackets with niti rcs archwire ( 279.606.35 g ) ligated with elastomeric modules while minimum frictional resistance was found in stainless steel brackets with tc ss archwire ( 65.204.66 g ) ligated with ss ligature .
mean ( sd ) frictional resistance ( g ) of the bracket - ligature - archwire combinations there was a statistically significant interaction ( p<0.0001 ) between the archwires , brackets and ligation which indicates that the frictional characteristics depending on the particular combination used .
this required that an individual comparison be made of each combination to identify differences [ table 2 ] .
the effect of bracket materials , ligature materials and different archwires on frictional resistance by three way anova the duncan 's multiple range test showed a significant bracket , archwire and ligature effect ( p<0.001 ) .
the ceramic bracket had the highest frictional force value ( 181.5854.15 g ) , with statistical significance ( p<0.001 ) , followed in decreasing order by the ceramic bracket with metal reinforced slot ( 136.4440.63 g ) and the stainless steel bracket ( 129.8341.57 g ) [ table 3 ] .
descriptive statistics of frictional resistance ( g ) nickel titanium rcs archwires exhibited the highest mean frictional resistance ( p<0.001 ) , followed in decreasing order by nickel titanium , stainless steel rcs , stainless steel , teflon coated nickel titanium , teflon coated stainless steel rcs and teflon coated stainless steel archwires with the least mean frictional resistance [ table 3 ] . among all the bracket materials with different archwires
when ligated with stainless steel ligature showed significantly less ( p<0.001 ) frictional resistance than elastomeric module [ table 3 ] .
orthodontic tooth movement is dependent on the ability of the clinician to use controlled mechanical forces to stimulate biologic responses within the periodontium .
the clinician should be aware of the characteristics of the orthodontic appliances , wires and ligature material that contribute to friction during sliding mechanics and the extent of the amount of force expected to be reduced by friction . in the present study ,
the effect of three variables - bracket material , ligation material , and different archwires on frictional resistance was studied . since frictional resistance at the bracket - archwire interface
majority of investigators used straight length archwire and fixed the bracket over models and draw the straight length archwire through the brackets in the instron universal testing machine only few studies used typodont model .
this does not fully simulate the clinical reality , because clinically moving teeth during sliding mechanics do not occur in a straight line . the method used in the present study
the present study was carried out in dry conditions ; to achieve results in non - contaminated conditions , as observed in many previous studies .
the variety of experimental methods used throughout the literature makes it difficult to compare the results of different studies of this type .
frictional resistances measured in the present study were comparable in magnitude and range with those reported by other investigators .
the ceramic brackets showed the significantly higher frictional resistance ( p<0.001 ) compared with stainless steel brackets and ceramic brackets with metal slot .
a possible explanation is that ceramics have a higher coefficient of friction than stainless steel because of increased surface roughness , hardness , stiffness and porosity of the material surface .
manufacturing process , finishing , and polishing are also difficult ; this might explain the granular and pitted surface of the ceramic brackets .
the ceramic bracket with metal slot showed the intermediate values of the frictional resistance , probably because its slot is reinforced with metal , which prevents direct contact between ceramic and archwire .
the metal slot appears to cause the ceramic bracket to behave more like a stainless steel bracket than a conventional ceramic bracket in terms of static and kinetic frictional resistance as reported by dickson and jones .
the difference of the frictional force values between the ceramic bracket with the metal slot and the stainless steel brackets can be due to the difficulty in adjusting the metal to the ceramic and to their different expansion coefficients .
among all the bracket materials with different archwires when ligated with stainless steel ligature showed significantly less frictional resistance than elastomeric module , this finding was in correlation with certain previous studies .
stainless steel ligature tying is subjective and can be variable , but in the present study all the ligations were done by the same individual and by the same pattern . in the present study , the bracket - archwire combinations were tested immediately after ligation with elastomeric modules so not much of force decay would have occurred .
the present study also demonstrated that different archwires used in the study have a significant influence on frictional resistance .
significant differences were found between stainless steel and nickel - titanium archwires in the present study .
nickel - titanium archwires shows higher frictional resistance ( p<0.001 ) then stainless steel archwires these findings were in accordance with the findings of previous studies .
stainless steel archwires have the smoother surface then nickel - titanium so they have less frictional resistance .
niti archwires are more flexible than stainless steel archwires so they can bind during sliding mechanics and produce more resistance to movement . in the present study ,
one determinant of friction is the angulation of the archwire to the bracket that might create more contact areas or friction components .
redlich et al . , reported that higher frictional forces are developed when bracket - archwire angulations increases .
since the bracket - wire angulation was higher in the curved archwire ( rcs ) compared with the flat archwire , the higher frictional forces with the former could be attributed to that .
nishio et al . , also stated that the magnitude of frictional forces is directly proportional to the angulation increase between the bracket and the archwire .
husmann reported that teflon coating of archwire significantly reduced the frictional resistance compared with uncoated archwire of the same alloy .
this finding was consistent in the present study for both stainless steel and niti teflon coated archwires .
this result of the present study was also in agreement with the result of few previous studies .
from an orthodontic point of view , teflon is an anti - adherent and aesthetic material that has excellent chemical inertia as well as good mechanical stability .
since teflon has a low coefficient of friction , archwires with teflon coating could possibly reduce frictional resistance .
the practical relevance of this finding might be interesting , given that coating with teflon has excellent aesthetic properties : the tooth - like colour of teflon - coated archwires , together with their improved frictional performance , may lead to widespread use of this type of archwires in future orthodontic practice .
the least frictional resistance was observed between stainless steel bracket and teflon - coated - stainless - steel archwire combination ligated by stainless steel ligaturethe highest frictional resistance was observed between ceramic bracket and niti rcs archwire combination ligated by elastomeric moduleceramic brackets with metal slot and teflon coated ss archwires seem to be a good alternative to conventional stainless steel brackets and archwires in space closure with sliding mechanics in patients with esthetic demandsthe archwires with rcs significantly increase the frictional resistance and therefore , other means should be used to control the bite deepening during sliding mechanics , instead of using them .
the least frictional resistance was observed between stainless steel bracket and teflon - coated - stainless - steel archwire combination ligated by stainless steel ligature the highest frictional resistance was observed between ceramic bracket and niti rcs archwire combination ligated by elastomeric module ceramic brackets with metal slot and teflon coated ss archwires seem to be a good alternative to conventional stainless steel brackets and archwires in space closure with sliding mechanics in patients with esthetic demands the archwires with rcs significantly increase the frictional resistance and therefore , other means should be used to control the bite deepening during sliding mechanics , instead of using them .
Output:
| objectives : frictional resistance is an important counterforce to orthodontic tooth movement during sliding mechanics .
this study was carried out to evaluate the effect of different bracket - archwire - ligation combinations on resistance to sliding during simulated canine retraction on typodont model.materials and methods : the frictional resistance was tested between three modern orthodontic brackets - stainless steel , ceramic , and ceramic with metal slot ( 0.022-inch ) , and seven different archwires ( 0.019 0.025-inch)-stainless steel , nickel - titanium , teflon coated stainless steel , stainless steel with the reverse curve of spee ( rcs ) , teflon coated stainless steel with rcs , teflon coated nickel - titanium and nickel - titanium with rcs ligated with stainless steel ligature wire and regular clear elastomeric modules .
all tests were carried out in a dry state on an instron universal testing machine ( crosshead speed : 0.5 mm / min ) .
10 measurements were made from each bracket - archwire - ligature combinations.results:the highest mean frictional resistance was found in ceramic brackets with nickel - titanium rcs archwire ligated with elastomeric modules while minimum frictional resistance was found in stainless steel brackets with teflon coated stainless steel archwire ligated with stainless steel ligature .
metal slot ceramic brackets generated significantly lower frictional forces than ceramic brackets , but higher values than stainless steel brackets .
teflon coated archwires shows highly significant reduction of the frictional resistance than their corresponding uncoated archwires .
archwires with rcs had the higher frictional resistance than normal counterpart archwires.conclusion:ceramic brackets with metal slot and teflon coated ss archwires seem to be a good alternative to conventional stainless steel brackets and archwires in space closure with sliding mechanics in patients with esthetic demands . |
PubmedSumm118467 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: lipoid congenital adrenal hyperplasia , is the rarest and usually the most severe form of adrenal steroidogenic defect , which may presents as infantile cholestasis .
here we present a 45 days old infant who came to our attention with cholestasis and severe intractable vomiting and electrolyte disturbances .
congenital adrenal hyperplasia as one of the causes of neonatal cholestasis should be kept in mind , whenever there are also electrolytes abnormalities .
it results from diminished bile flow and/or excretion , which can be caused by a number of disorders .
neonatal cholestasis affects approximately one in 2500 births [ 1 , 2 ] the evaluation of neonatal cholestasis may appear complicated because of the large number of potential diagnoses , the similar clinical presentations of a variety of conditions and the non specificity of diagnostic tests .
however , reduction of bile secretion into bile canaliculi with similar mechanism to hypocortisolism in idiopathic hypopituarism and congenital lipoid adrenal hyperplasia ( cah ) can result in cholestasis .
cah is characterized by deficiency of all adrenal and gonadal steroid hormones , increased adrenocorticotropin hormone ( acth ) secretion , and marked adrenal hyperplasia with progressive accumulation of cholesterol esters .
although cah occasionally presents later in infancy , patients with severe form of congenital lipoid hyperplasia who have typically severe adrenal insufficiency present very soon after birth , with vomiting , diarrhea , volume depletion , hyponatremia and hyperkalemia .
male infants usually have female external genitalia due to lack of testicular androgen production , but female infants are normally developed at birth [ 5 , 6 ] .
a 45 days old infant with female appearing genitalia was admitted because of recurrent vomiting , poor feeding and cholestasis .
problems started from third day of life with recurrent vomiting and poor intake which led to poor weight gain .
intermittent clay colored stool was reported by parents , with changing to completely acholic type a few days before admission .
no similar presentation or family history of other features of liver or edocrine disease was reported . on physical examination length measured 50 cm ( < 5 percentile ) , weight 3000 g ( < 5 percentile ) , and head circumference 36.5 cm ( 510 percentile ) .
she had a weak pulse , with a heart rate of about 130 beats per minute .
initial resuscitation including ; rehydration therapy and correction of blood glucose and electrolyte abnormalities started .
sepsis workups including blood culture and urine culture were performed , which later results showed both negative .
cosidering cholestasis presentation , other investigation including tyrosine level , laboratory assessment for metabolic disorders including serum and urine amino acid chromatography , urinary organic acid profile and nh3 and lactate levels were evaluated with all in normal range but serum alpha1 antitrypsin concentration was mildly increased .
the laboratory tests were as follows : serum sodium 102 meq / lit and serum k level 9 meq / lit .
total and direct bilirubin was 13.9 mg / dl and 5.4 mg / dl retrospectively .
thyroid function test was normal and serum glucose level by either glucose oxidas or orthotoloidas method were lower than normal but with no significant difference .
pelvic sonography revealed the testicles in the inguinal canal , moreover , a uterus was not detected in pelvis .
ophthalmic fundoscopy in view of corioretinitis , cataract was not conclusive ; chromosome study showed 46xy pattern .
laboratory findings of our patient with congenital lipoid adrenal hyperplasia and infantile cholestasis alk : alkalan phosphatase .
ast : aspartate aminotransferase , ggt : gama glutamil transpeptidase severe electrolytes abnormalities guided us to possible diagnosis of cah , and further evaluation including findings in table 2 proved this diagnosis .
electrolyte abnormalities and blood sugar was corrected during first week of treatment ( na=130 and k=4.5 meq / lit ) .
one week later , the total and direct bilirubin declined to 5 and 2.5 mg / dl respectively .
after one month , bilirubin levels and all of the liver function tests returned to normal , jaundice disappeared and acholic stools changed to normal pattern . in the following 6 months
results of laboratory tests of the patient on her most recent visit at the age of 15 months , the patient had no obvious problem .
her height was 75 cm ( 25 percentile ) , weight 9.5 kg ( 1025 percentile ) and head circumference 46 cm ( 25 percentile ) ; her neurodevelopment was appropriate for age .
however , only few patients have been described with liver disease and a primary adrenal disorder . of these
routine evaluation including assessment of tyrosinemia , galactosemia , neonatal hepatitis and other common causes of cholestasis showed absence of known causes of neonatal cholestasis .
hyperpigmentation and recurrent hypoglycemia , severe electrolytes derangement with low level of cortisol and aldostrone , increased level of acth and rennin activity , suggested an adrenal hyperplasia .
congenital lipoid adrenal hyperplasia has been proved to be a fatal condition in infancy in two - thirds of reported patients , but some patients survive to go through puberty [ 9 , 10 ] .
patients with congenital lipoid adrenal hyperplasia have very low serum cortisol and aldosterone concentrations and very high plasma acth concentrations and rennin activity[9 , 10 ] . production of gonadal steroids is also impaired , and serum gonadotropin concentration is high ( for age ) in children as young as 4.5 years old .
glucocorticoid and mineralocorticoid deficiency has been managed by replacement therapy in a few cases . for reasons that are not clear , serum adernocorticotropic hormone ( acth ) concentration and plasma rennin activity may remain elevated during treatment with supra physiologic doses of glucocorticoid and mineralocorticoids . the cause of cholestasis in cah is not clear yet , but lack of glucocorticoied that may result in decreased bile secretion into the canaliculi have been explained as a possible reason . since corticosteroids appeared promising to improve bile flow after portoenterostomy and long - term survival , based on initial uncontrolled trials , it seems that low level of cortisol may result in decreased bile flow which led to acholic stools in our patient .
it is also suggested that cortisol deficiency is the primary disturbance leading to disturbed liver function in infants with hypopituitarism and adrenal insufficiency .
lacy et al reported a case with neonatal hepatitis and congenital insensitivity to adrenocorticotropin , and suggested that cortisol deficiency occurring during development , might delay hepatic maturation in the first months of life .
a designed study by lee and chai , reinforced the overlapping nature of the presenting clinical features of biliary atresia and other etiologies of neonatal cholestasis .
as a result of his prospective , descriptive study conducted on 146 infants with neonatal cholestasis , congenital adrenal hyperplasia was diagnosed in only one of 146 patients .
to our knowledge there are few reports of cah as a cause of neonatal cholestasis .
disturbance of the pituitary adrenal axis , whatever the cause , may occasionally be associated with neonatal cholestasis .
hypoglycemia and electrolytes disturbances in the presence of neonatal cholestasis should be considered for a possible congenital adrenal hyperplasia as a main pathology .
Output:
| backgroundlipoid congenital adrenal hyperplasia , is the rarest and usually the most severe form of adrenal steroidogenic defect , which may presents as infantile cholestasis.case presentationhere we present a 45 days old infant who came to our attention with cholestasis and severe intractable vomiting and electrolyte disturbances .
evaluation resulted in diagnosis of congenital adrenal hyperplasia .
hydrocortisone and flodrocortisone improved the symptoms including jaundice and vomiting .
hyponatremia and hyperkalemia also resolved with above mentioned treatment.conclusioncongenital adrenal hyperplasia as one of the causes of neonatal cholestasis should be kept in mind , whenever there are also electrolytes abnormalities . |
PubmedSumm118468 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: esophageal melanosis was described for the first time in 1963 by de la pava and its prevelance was reported to be 4% in autopsy series .
esophageal melanosis which is characterized by melanocytic proliferation in the squamous epithelium of the esophagus and melanin accumulatin of esophageal mucosa ( em ) is a rare a disease of the digestive system .
however , aberrant melanocyte migration during embryogenesis or reflux esophagitis chronic inflammatory reasons differentiation of stem cells in the basal layer of melanocytes occur are thought to result [ 2 , 3 ] .
while generally considered to be benign , primary esophageal melanomas and the precursors can be found together with esophageal malignancies reported in several publications [ 1 - 3 ] .
typically , these lesions are detected by screening endoscopy and observed in 0.7 - 2.1% of the upper gastrointestinal endoscopy .
a 55-year - old female patient , with brackish water in the mouth intermittently for about 3 years , difficulty in swallowing , burning behind the breastbone , heartburn , heartburn , indigestion , and pain in the upper abdomen was admitted to our general surgery clinic . in 2011 ,
the patient had a history of diagnosis of papillary thyroid carcinoma treated with total thyroidectomy and radioactive iodine and 100 g / day of levothyroxine .
there were no alcohol and smoking habits . eating habits of animal foods such as meat and dairy products were weighted .
using fujinon eg-250wr5 endoscope ( fujinon optical , tokyo , japan ) with upper gastrointestinal endoscopy in the mid - em , the front incisor teeth from 20 cm to the starting 30 cm , which continued until dark ( brown , black ) color , linear , punctuate , etc . in various forms , ranging in diameter from 2 to 10 mm ,
the stomach contained bile and gastric juice and alkaline reflux gastritis was observed ( fig .
forceps biopsy of the esophagus was seen in the hyperpigmented areas , distal esophagus , and stomach , multiple biopsies were taken from the antrum and corpus was sent for histopathologic examination .
helicobacter pylori ( hp ) urease test was two positive ( + + ) respectively .
histopathological examinations with hematoxylin - eosin ( h&e ) stained sections of squamous character acanthosis and intercellular edema showing the covering epithelium located under the lamina propria of the support tissues dense lymphocytic infiltration , as well as numerous dense melanin laden histiocytes were detected .
in addition , chronic esophagitis compatible with roand hp ( + ) chronic pangastritis was revealed .
hyperpigmentation was not detected on skin , eyes , mouth , throat , genital and anal mucosa . for hp eradication and anti - reflection therapy ,
the 14-day amoxicillin , clarithromycin , lansoprazole triple therapy with a combination comprising 250 mg of ursodeoxycholic acid / night was given at a single dose .
maintenance therapy for 6 months to the patient in the proton pump inhibitor ( pantoprazole 40 mg / day ) was given .
endoscopy showed that los angeles stage ro , esophageal ( les ) relaxation , and still have alkaline reflux gastritis . by endoscopy of the esophagus seen in the area of hyperpigmentation
histopathological examination showed esophageal melanosis , reflux esophagitis consistent with chronic esophagitis and hp ( - ) revealed mild chronic pangastritis .
the patient recommended to continue to follow , still anti - reflux therapy , ursodeoxycholic acid , and dietary practices have been asked to continue .
esophageal melanosis , non - atypical melanocytic proliferation of cells in the basal mucous layer and mucous membranes of esophagus , characterized by the accumulation of melanin is a benign pathology .
esophageal melanosis was described for the first time in 1963 by de la pava and its prevelance was reported to be 4% in autopsy series .
esophageal melanosis has been reported 0.1% in japan , and 2.1% in india with endoscopic screening [ 4 , 5 ] .
esophageal melanosis is found 0.07 - 2.1% of overall consecutive gastrointestinal endoscopy . in autopsy ,
esophageal melanosis has been identified 4% in the us and 7.7% in japan [ 1 , 5 ] . in japan ,
primary malignant melanoma of the esophagus containing 25 - 30% of the surgical specimen was found in the esophageal melanosis [ 2 , 3 ] .
according to another opinion , esophagus multipotential stem cells in the basal epithelial layer are thought to occur keratinocytic differentiation with the development of hyperplasia such as reflux , chronic effect being exposed to inappropriate eating [ 2 , 6 ] .
melanogenesis process in normal skin prevents intracellular lipids , proteins and nucleotides damage by neutralizing reactive oxygen molecules .
for example , in western and asian populations , in approximately 20% of the oral mucosa of smokers , cigarettes melanose has been reported to occur .
upper gastrointestinal chronic epithelial proliferation stimulatory factors such as alcohol use increase melanogenesis . by endoscopic screening in men alcoholics in japan , esophageal melanosis rate of 7% was observed .
several factors stimulated by proliferating keratinocytes with epithelial proliferation through autocrine and paracrine effects play a role in enhancing melanogenesis .
chronic alcohol use , cigarette smoking , diet and hereditary factors such as life style have contributed to the development of neoplasms , and this factor may be associated with development as melanosis [ 6 , 10 ] .
likely , smoking , gerd , race , and type of citrus fruit are effective on high - calorie eating habits reported in several studies that play a role in the formation of esophageal squamous cell carcinoma .
also , some studies that mainly meat diet increases the risk of esophageal carcinoma have been reported . in this case
however , case with a diet rich in meat and animal food had the habit .
the effect of this condition is the formation of esophageal melanosis , which needs further research .
esophageal melanosis is seen as often during the middle and lower endoscopy or at autopsy , macroscopic examination of the esophagus flat , irregularly shaped lesions .
histopathological examination of the em dense melanin laden macrophages in the lamina propriaya and melanocytes in the basal layer is observed . with hematoxylin - eosin staining melanocytes
melanocyts are painted with melanocytic markers such as melanocytes s-100 , melan a and hmb-45 .
fontana - masson staining positive by the method and with periodic acid - schiff method and perls is negative .
esophageal melanosis is often seen with chronic esophagitis , acanthosis and basal cell hyperplasia is associated with reactive epithelial changes [ 1 - 5 ] . in this case ,
melanin laden macrophages dense in places with atypical melanocytes with non - chronic esophagitis and acanthosis were found in the mucosa detected in h&e staining in biopsies .
scientific studies mainly have been reported to occur that chronic effects like bile and gastric fluid gastroesophageal reflux , cause esophageal melanosis [ 2 , 5 , 12 ] . gastric acid , bile and trypsin reflux depending on the nf - kb , ap-1 , il-8 , etc .
inflammatory cytokines , leukocytes and oxidative stress mediators , such as pro - inflammatory factors , erosive and non - erosive gerd pathogenesis to be effective is shown .
gerd , esophageal cancer , particularly in the formation , has been found to be associated with the development of esophageal adenocarcinoma .
the endoscopic examination in this case found has a reflux esophagitis in phase with los angeles phase b and chronic esophagitis was found on pathologic examination .
proton pump inhibitors in the treatment of patients with long - term and proper diet were given . in vitro ,
the conjugated bile salts have been shown to cause in esophageal epithelial cells a number of events like increased mrna expression , inflammatory cytokines tnf - alpha , il-1 beta and cdx1 . also by the action of bile salts in esophageal squamous cell cd95 mediated
bile acids have been found to be effective , gerd esophagitis , barrett s metaplasia and in carcinogenesis development [ 17 , 18 ] .
this case was found in the alkaline reflux pangastritis . enhancing effect of chronic bile reflux esophagitis shows and
250 mg / day was used . in several studies , particularly cag a ( + ) hp infection esophageal epithelial cells , to cause dna strand breaks , has been reported to contribute to the formation of esophageal squamous cell carcinoma . between hp infection and squamous cell carcinoma of the esophagus , statistically significant correlation was found .
these chronic effects can contribute to the formation of em . in this case , hp infection has also been identified and eradication therapy was applied . depending on gerd , acid and bile reflux in the esophagus may lead to intestinal metaplasia , dysplasia , and eventually to esophageal carcinoma .
em reported was seen in association with laugier - hunziker syndrome , addison s disease and esophageal with systemic diseases such as melanoma , esophageal squamous cell carcinoma was seen [ 2 , 3 , 22 , 23 ] .
ishida et al have found that in their study of esophageal squamous cell carcinoma in situ , 3.8% of patients with carcinoma in situ had the melanocytosis pigment around in non - neoplastic squamous epithelium .
iwanuma et al reported that primary malignant melanomas usually present together with melanocytosis , melanoma in situ or intramural metastasis .
sanchez et al have been reported to be important to separate primary esophagus melanomas from metastatic melanoma with the presence of in situ melanoma , radial growth phase , mixed epithelioid , spindle cell morphology and the presence of esophageal melanosis . in the differential diagnosis of esophageal melanosis , that should be considered ,
primary malignant melanoma of the esophagus , accounting for only 0.1 - 0.2% of malignant esophageal tumors , more mid and lower esophageal endoscopic pigmented or unpigmented is emerging as a polypoid mass .
em is investigated in clinical and endoscopic diagnosis of pigmented lesions with other antracosis , hemosiderosis or accumulation of lipofuscin pigments , should be considered and necessarily should be questioned uptake of exogenous dye or paint .
however , differential diagnosis of these entities with the aid of histological and histochemical stains may be made [ 2 , 3 ] .
again in the diagnosis of esophageal melanosis , other lesions can be useful in the separation magnifying endoscopy .
endoscopic differential diagnosis in mind to keep other underlying entity of ischemic causes ( arteriosclerosis , atrial thrombosis , aortic dissection , etc . ) and necrosis associated with
black esophagus which pigmented lesions associated with separation from endoscopic and pathologic is easier . depending on chronic esophagitis , melanocytosis of the basal epithelial layer
may play a role in the development of the primary malignant melanoma [ 2 , 3 , 5 ] .
walter et al have reported that melanoctytosis has emphasized the need to be taken into account in development of esophageal malignancy . also , yokoyama et al reported that esophageal melanosis is precursor to esophageal dysplasia , esophageal melanoma and esophageal carcinoma .
a patient with 8 years of follow - up with a diagnosis of benign melanocytosis in esophagus was reported .
unverdi et al reported esophageal melanosis may be the precursor lesion in the esophagus melanomas , suggesting clinical and endoscopic follow - up .
esophageal melanosis is a rare disease of esophagus , is considered to be benign and shows hyperpigmented lesions .
opportunities created by the recent technological advances in the medical field with the selected cases with localized disease , for the applicability of local therapy ( endoscopic mucosectomy , superficial lesions , such as extraction ) do not support the literature .
because of high mortality and morbidity rates of highly radical esophageal surgery may not be recommended for the benign nature of a disease . however , considering the reported cases as a potential cause premalignancy of em patients is necessary following up in frequent intervals .
esophageal melanosis is a rare disease of esophagus , is considered to be benign and shows hyperpigmented lesions . recently , several studies reported esophageal melanosis may be a precursor to malignancy .
opportunities created by the recent technological advances in the medical field with the selected cases with localized disease , for the applicability of local therapy ( endoscopic mucosectomy , superficial lesions , such as extraction ) do not support the literature . because of high mortality and morbidity rates of highly radical esophageal surgery may not be recommended for the benign nature of a disease .
however , considering the reported cases as a potential cause premalignancy of em patients is necessary following up in frequent intervals .
Output:
| esophageal melanosis which is characterized by melanocytic proliferation in the squamous epithelium of the esophagus and melanin accumulatin of esophageal mucosa ( em ) is a rare disease of the digestive system .
although esophageal melanosis is considered to be a benign disease , its etiology is not cleared and has been reported to be the precursor lesion of esophageal primary melanomas . in this report , we aimed to note esophageal melanosis in a 55-year - old female case who applied to our clinic with difficulty in swallowing , burning behind the breastbone in the stomach , heartburn , indigestion , and pain in the upper abdomen after endoscopic and pathologic evaluation .
complaints dropped with anti - acid therapy and case was followed by intermittent endoscopic procedures because of precursor melanocytic lesions . |
PubmedSumm118469 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: adolescence has been defined by the world health organization as the period of life spanning the ages between 10 and 19 years . since decades , a female from birth till death has been a neglected segment of population .
health of the girls of today will affect the health and survival of the future generation .
adolescent girls are the mothers of tomorrow , and no edifice can be built on a foundation that is weak , and if we could not give a safe and secure today to the mother of tomorrow , it will be futile to expect the future generation to be mentally and physically healthy .
although there are many programs that focus on the needs of adolescent girls , but as the health needs of them are tremendous and these have seldom been met , as a consequence of this , their health status is low .
there is no comprehensive study to assess factors influencing the prevalence of morbidity of adolescent girls in lucknow district , the capital of most populated state , which has prompted to undertake the present study .
this study brings out the present morbidity pattern by age and related underlying factors influencing the prevalence of morbidity among school - going adolescent girls in lucknow district .
it will also provide baseline information for carrying out future interventional studies to deal with the problems of adolescent girls .
this study was undertaken among school - going adolescent girls with the following objectives :
to find out the morbidity status of school - going adolescent girls.to find out the status of general personal hygiene.to analyze factors influencing the prevalence of morbidity among school - going adolescent girls .
to find out the morbidity status of school - going adolescent girls . to find out the status of general personal hygiene . to analyze factors influencing the prevalence of morbidity among school - going adolescent girls .
informed consent of the principals of schools was taken before the study and assent from the selected adolescents was also obtained , before initiation of the study .
the present cross - sectional study was carried out among school - going adolescent girls in lucknow district from october 2008 to september 2009 .
an optimum sample size of 847 ( 593 urban and 254 rural ) school - going adolescent girls of lucknow district , aged 1019 years , were interviewed and examined .
the sample size was calculated using the formula , n = z(1-/2)pq / d ( where z(1-/2)=1.96 at 95% confidence level ; p = prevalence of morbidity , q=1-p ; d = allowable error ) . for this study , we assumed 50% prevalence of morbidity , hence p=0.5 ; q=0.5 ; d=5% .
as the subjects are chosen by multistage random sampling , a design effect due to complex sample design comes into picture .
taking into account the design effect of 2 and 10% as nonrespondents , the total number came out to be 847 .
the urban area is spread equally on both sides of gomti river known as cis gomti and trans gomti . according to nagar nigam lucknow , urban area
two zones were randomly selected and similarly from trans gomti two zones were randomly selected . at the second stage , from each zone one senior secondary school was selected randomly from the listed senior secondary schools .
similarly two blocks were selected randomly from eight blocks of the rural lucknow . from each block ,
one senior secondary school was selected randomly from listed senior secondary schools . at the third stage ,
students within the class were selected through systematic random sampling . in some schools of rural area ,
the numbers of students in the classes were not enough ; therefore , all the students of the class were invited to participate in the study as systematic random sampling was not possible .
a total of six senior secondary schools , four schools from urban area and two schools from rural area were randomly selected from listed senior secondary schools . from these schools ,
593 adolescent girls from urban schools and 254 adolescent girls from rural schools were selected for the study .
a structured interview schedule was developed and pre - tested on adolescent girls of a school other than the ones selected for the study .
the pre - tested schedule was modified after pre - testing and finalized . the demographic status , which consisted of information on religion , caste , type of family , birth order , and ses , was also recorded in order .
every girl was examined physically from head to toe and any signs and symptoms of illness were recorded .
social class was calculated using modified kuppuswamy scale in urban area and pareek scale in rural area . socio - demographic profile ( religion , caste , type of family , birth order , and ses ) , living status of girls with parents , general personal hygiene , and morbidity status were studied .
data were entered in microsoft office excel and analyzed with statistical package for the social sciences ( spss ) version 16.0 .
data were analyzed using percentages and pearson 's chi - square test for normal distribution .
the urban area is spread equally on both sides of gomti river known as cis gomti and trans gomti . according to nagar nigam lucknow , urban area
two zones were randomly selected and similarly from trans gomti two zones were randomly selected . at the second stage , from each zone one senior secondary school was selected randomly from the listed senior secondary schools .
similarly two blocks were selected randomly from eight blocks of the rural lucknow . from each block ,
one senior secondary school was selected randomly from listed senior secondary schools . at the third stage ,
students within the class were selected through systematic random sampling . in some schools of rural area ,
the numbers of students in the classes were not enough ; therefore , all the students of the class were invited to participate in the study as systematic random sampling was not possible .
a total of six senior secondary schools , four schools from urban area and two schools from rural area were randomly selected from listed senior secondary schools . from these schools ,
593 adolescent girls from urban schools and 254 adolescent girls from rural schools were selected for the study .
socio - demographic data were collected on all girls at baseline . a structured interview schedule was developed and pre - tested on adolescent girls of a school other than the ones selected for the study .
the pre - tested schedule was modified after pre - testing and finalized . the demographic status , which consisted of information on religion , caste , type of family , birth order , and ses ,
every girl was examined physically from head to toe and any signs and symptoms of illness were recorded .
social class was calculated using modified kuppuswamy scale in urban area and pareek scale in rural area .
the urban area is spread equally on both sides of gomti river known as cis gomti and trans gomti . according to nagar nigam lucknow , urban area
two zones were randomly selected and similarly from trans gomti two zones were randomly selected .
at the second stage , from each zone one senior secondary school was selected randomly from the listed senior secondary schools .
similarly two blocks were selected randomly from eight blocks of the rural lucknow . from each block ,
at the third stage , students from classes vi to xii of age group 1019 years were selected .
students within the class were selected through systematic random sampling . in some schools of rural area ,
the numbers of students in the classes were not enough ; therefore , all the students of the class were invited to participate in the study as systematic random sampling was not possible .
a total of six senior secondary schools , four schools from urban area and two schools from rural area were randomly selected from listed senior secondary schools . from these schools ,
593 adolescent girls from urban schools and 254 adolescent girls from rural schools were selected for the study .
socio - demographic data were collected on all girls at baseline . a structured interview schedule was developed and pre - tested on adolescent girls of a school other than the ones selected for the study .
the pre - tested schedule was modified after pre - testing and finalized . the demographic status , which consisted of information on religion , caste , type of family , birth order , and ses , was also recorded in order .
every girl was examined physically from head to toe and any signs and symptoms of illness were recorded .
social class was calculated using modified kuppuswamy scale in urban area and pareek scale in rural area .
socio - demographic profile ( religion , caste , type of family , birth order , and ses ) , living status of girls with parents , general personal hygiene , and morbidity status were studied .
data were entered in microsoft office excel and analyzed with statistical package for the social sciences ( spss ) version 16.0 .
data were analyzed using percentages and pearson 's chi - square test for normal distribution .
of 847 adolescent girls , around 64.8% were found to be sick at the time of the study . a maximum of 16.4% girls were suffering with hair problems followed by teeth and gum problems , which was 14.2% [ table 1 ] .
distribution of morbidity pattern by age in urban hindu school girls , the total morbidity was 61.4% , and in muslim school girls , it was 69.2% . in rural hindu school girls ,
the total morbidity was 70.2% , and in muslim school girls , it was 62.5% .
distribution of total morbidity according to religion and caste among adolescent school girls in urban schools , the other backward class ( obc ) girls had a maximum of 74.0% total morbidity followed by schedule caste / schedule tribe ( sc / st ) girls .
the caste in urban school girls had significant role in total morbidity , but it was insignificant in rural school girls [ table 2 ] . in urban schools ,
a maximum of 74.1% total morbidity was in girls with birth order five or more .
similarly , in rural schools , a maximum of 85.2% total morbidity was in girls with birth order five or more [ table 2 ] . in urban schools , the girls belonging to nuclear families had more , that is , 63.9% total morbidity , whereas in rural schools , the girls belonging to joint families had more , that is , 88.9% total morbidity .
the type of family had significant role in total morbidity in rural school girls [ table 2 ] .
in urban schools , a maximum of 78.7% total morbidity was in girls belonging to ses - iv and a minimum of 45.8% total morbidity in ses - i .
in rural schools , a maximum of 73.0% total morbidity was in girls belonging to ses - iii and a minimum of 50.0% total morbidity in ses - ii girls . in both urban and rural school girls , ses was significantly associated with total morbidity [ table 2 ] . in urban schools ,
a maximum of 77.8% total morbidity was in girls living with only mothers / father , and in rural schools , a maximum of 75.0% total morbidity was in girls living with single parent . in urban schools , the living status of girls with parents was significantly associated with total morbidity . in rural schools ,
no significant association was observed between total morbidity and living status with parents / guardian [ table 3 ] .
distribution of total morbidity among adolescent school girls according to living status with parents / guardian overall , the girls with poor general personal hygiene had a maximum of 80.6% total morbidity and general personal hygiene was significantly associated with total morbidity . in urban schools ,
the girls with satisfactory general personal hygiene had a maximum of 72.8% total morbidity , whereas in rural schools , the girls with poor general personal hygiene had a maximum of 89.5% total morbidity [ table 4 ] .
the government of india has made the adolescent health as a part of reproductive and child health package since 1997 .
the health problems of adolescent girls vary from place to place , and several studies conducted in india and abroad revealed that the main morbidity conditions include malnutrition , dental caries , diseases of skin , problem of eye and ear , and reproductive problems . in the present study ,
the leading causes of morbidity were hair problems ( 16.4% ) , teeth and gums problems ( 14.2% ) , and eyes problems ( 11.7% ) in all age group girls due to poor personal hygiene . in a study conducted by srinivasan ( 2000 ) , in tirupati in 598 children aged 617 years , the common morbid conditions found were skin disorders 25.7% and dental caries 21.5% .
singh et al . reported inadequate oral hygiene of 55.4% . in the present study , morbidity due to
. these differences may be due to differences in the study area and other associated factors .
the study revealed that the overall prevalence of morbidity was more among muslim girls , but this difference is insignificant .
adolescent girls belonging to general caste have less morbidity than other backward classes and scheduled caste , and this difference is statistically significant .
the reason for high morbidity in lower caste could be due to lack of money , either due to poverty or due to more number of children in the family , lack of knowledge about child care practices , and poor personal hygiene . in the present study
, it was found that morbidity is increasing gradually with increase in birth order and this is statistically significant .
this difference may be due to dilution of household resources and mother 's attention , as the birth order in the family increases .
girls belonging to joint family have more morbidity than the girls living in nuclear families .
this difference is statistically significant in rural area . a significant association between ses and morbidity
was also observed ( p=0.000 ) , which may be because of better living standards with better ses and better awareness among parents . in this study , it was seen that living status of girls with parents was significantly associated with total morbidity .
the two - parent family has traditionally been assumed to offer a better environment for the children 's development than a single - parent family .
morbidity was significantly higher in the group with poor personal hygiene score . in a study conducted by agrawal et al .
in mumbai among 1,144 girls , common health problems were hygiene related ( 62.2% ) .
hence , care should be taken to improve the status of personal hygiene of school girls through coordinated primordial and primary preventive measures like health education .
health education programs on hygiene and common diseases have to be carried out regularly in schools in consultation with concern health authorities .
a significant association of morbidity with caste , birth order , family type , ses , living status with parents , and personal hygiene suggests a need to develop strategies for intensive adult education and to improve the living standards of the population .
health education may be useful for improving the health status of adolescent girls , and this could be imparted in all the schools with the help of heath personnel , and non - governmental organizations and teachers of the school may be trained regarding health education .
simple measures like improvement of personal hygiene and following safe , hygienic practices by adolescent girls can go a long way in reducing morbidities .
in addition to awareness , there is an urgent need for accessible health services for adolescent girls in rural areas .
adolescent should be considered high - risk group of society ( next only to infants and children ) , so , although they have been neglected till date , still there is time , to provide them helping hands and loving heart , else we will lose millions of perfect women of future .
Output:
| background : the adolescent girls are more vulnerable , particularly in developing countries including india , due to various adverse socio - cultural and economic reasons .
majority of the health problems affecting adolescent girls are preventable by promotion of hygienic practices through proper health education by the teachers.aim:this study was designed to examine the various factors influencing the prevalence of morbidity among school - going adolescent girls of lucknow district in north india.materials and methods : a cross - sectional study was carried out in urban and rural schools of lucknow district from 2008 to 2009 .
multistage random sampling was used to select the requisite number of girls .
a total of 847 adolescent girls between 10 and 19 years of age were interviewed , and information regarding their socio - demographic characteristics was collected and clinical examination was carried out .
statistical analyses were done using percentage and chi - square test.results:of 847 adolescent girls , around 64.8% were found to be sick at the time of the study .
significant association of morbidity was observed with caste , birth order , type of family , socioeconomic status ( ses ) , living status with parents / guardian , and general personal hygiene ( p<0.05).conclusion : this study reveals a high prevalence of morbidity . a strong need exists for planning and programming intervention activities for health needs in the area . |
PubmedSumm118470 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the cardiac rhythm is regulated or modulated by sympathovagal balance . heart rate variability ( hrv )
is a commonly used noninvasive measurement of cardiac autonomic modulation ( cam ) [ 16 ] .
several studies in patients have shown that lower hrv calculated from short - term normal rr intervals was a strong and independent predictor of mortality after an acute myocardial infarction ( mi ) [ 79 ] and sudden cardiac death .
it has been reported in prospective population - based studies that lower hrv calculated from short - term normal rr intervals , ranging from several minutes to several hours , is associated with significantly higher risk of mortality [ 11 , 12 ] and incidence of coronary heart disease [ 13 , 14 ] .
it has been recognized from previous studies that autonomic modulation fluctuates on a 24-h basis like a biological clock , or exhibits a circadian rhythm [ 1518 ] .
for example , bonnemeier et al . reported the differences of mean hrv at different times of the day , particularly the night - time and day - time differences in hrv .
none of these previous studies of the fluctuation of hrv provided the quantitative normative data of the nonlinear fluctuation of hrv over the entire 24-h time . although it has been proposed to use more quantitative approaches , such as cosine periodic regression models , to detail the mathematical properties of the normal cam circadian variation over 24 h in order to better understand the effects of various conditions on cam , such as chronic disease , medication , and
jet - lag , very few studies have used cosine periodic regression to quantify the overall 24-h circadian pattern of hrv .
a cosine periodic regression curve contains three major parameters : the mean ( m ) , amplitude ( a ) , and acrophase ( ) , where m measures the overall average of a hrv index , which is similar to the mean hrv used in previous literature [ 118 ] , a measures the amplitude of the oscillation of an hrv index , and measures the clock time when the highest oscillation ( amplitude ) is reached .
nakagawa et al . reported the cosine - shaped circadian pattern of hrv in a small group ( n = 20 ) of young adult volunteers .
massin et al . reported the cosine pattern of hrv in a group of children .
however , both studies used the group - level time - specific averages of the hrv index to calculate the cosine function parameters , which did not account for between - subjects variability . as a result
, these studies can not provide the reference ranges of these cosine parameters , e.g. 95% confidence intervals ( cis ) .
in fact , it is possible that the between - subjects variation of hrv is larger than the within - subject variation over time , which can only be analyzed using an approach that accounts for both between- and within - subject variations .
thus , the objective of this study is to obtain the quantitative measures of the hrv circadian pattern and their normative ranges in a middle - aged community - dwelling sample , specifically the normative ranges of the three cosine regression parameters the mean ( m ) , amplitude ( a ) , and acrophase ( ) .
a secondary objective is to examine the influence of age and gender on the circadian patterns of hrv in this population .
the data collected for the air pollution and cardiac risk and its time course ( apacr ) study are used for this report . the apacr study , funded by niehs ( 1 r01 es014010 ) ,
briefly , all study participants were recruited from community - dwelling individuals residing in central pennsylvania , mostly from the harrisburg metropolitan area .
the inclusion criteria for the apacr study included age 45 years , not smoking , and not having severe cardiac problems ( defined as diagnosed valvular heart disease , congenital heart disease , acute myocardial infarction or stroke within 6 months , or congestive heart failure ) .
all study participants , after providing written informed consent , were examined between november , 2007 and june , 2009 .
study participants were examined in the penn state college of medicine general clinical research center ( gcrc ) in the morning between 8 and 10 am .
all participants fasted for at least 8 h before the clinical examination . after completing a health history questionnaire , a trained research nurse measured seated blood pressure three times , height , and weight , and drew 50 ml of blood for blood biomarker assays according to the blood sample preparation protocols .
a trained investigator hooked up the holter ecg recorders between 9 and 10 am .
participants were given an hourly activity log to record special events that occurred in the next 24 h. participants were then released to go on with their regular daily routines in the period of ongoing holter recording .
the next morning the participants came back to the gcrc to unhook the holter monitors and return the completed activity log .
penn state university college of medicine irb approved the study protocol . a high fidelity ( sampling frequency 1,000 hz )
, wi , usa ) was used for 24-h beat - to - beat ecg data collection .
the high fidelity ecg significantly increases the resolution and enhances the accuracy of various wave form measurements .
the standardized operation procedures for the apacr study developed by the study investigators were followed rigorously in the data collection , retrieval , and offline processing .
the main objective of the offline processing was to verify the holter - identified ecg waves , and to identify and label additional electronic artifacts and arrhythmic beats in the ecg recording .
after removing artifacts and ectopy beats with standardized visional inspection , we obtained beat - to - beat normal rr interval data for hrv analysis . the entire 24-h normal beat - to - beat rr interval data were divided into 5-min segment rr data .
the rr data for hrv analysis were processed according to current recommendations . within each segment ,
any rr interval < 400 ms , > 2,000 ms , or where the ratio from two adjacent rr intervals was < 0.80 or > 1.20 were excluded from the hrv analysis .
the time- and frequency - domain hrv analyses were performed on the remaining normal rr interval data if the total length of such normal rr intervals was > 4 min ( 80% of original data ) , using a software program ( hrv analysis software ; department of physics , university of kuopio , finland ) . when performing frequency - domain hrv analysis , we used fast fourier transformation ( fft ) .
briefly , the adjacent rr interval data were interpolated using a piecewise cubic spline interpolation approach , with a 2 hz sampling rate .
we used a second order polynomial model to remove the slow non - stationary trends of the hrv signal .
the following hrv indices were calculated as measures of cam : standard deviation of all rr intervals ( sdnn , ms ) , square root of the mean of the sum of the squares of differences between adjacent rr intervals ( rmssd , ms ) , power in the high frequency range ( 0.150.40 hz , hf ) , power in the low frequency range ( 0.040.15 hz , lf ) , and the ratio of lf to hf ( lf / hf ) .
power in the very low frequency range ( 0.04 hz ) was not studied here because of the short - duration of the window used ( 5 min ) . following current recommendations , we performed logarithmic transformations on hf and lf prior to statistical analysis . from the 115 individuals
, we excluded 20 individuals from this report because of the following reason(s ) : technical problems with the holter recording ( n = 1 ) , insufficient normal rr intervals for hrv analysis ( < 20 h of ecg data ) ( n = 2 ) , a history of diabetes ( n = 9 ) , and a history of cardiovascular disease ( cvd , n = 8) . as a result , this report used the data from the remaining 95 individuals .
each individual contributed up to 288 segments of 5-min rr interval data within 24 h , resulting in up to 27,360 data segments .
we analyzed 26,714 segments of hrv data after excluding segments with less than 4 min of normal rr interval data .
we used a two - stage modeling approach to achieve the objectives of this study . in the first stage , we fit one cosine periodic regression model for each individual to get the individual - level parameters ( m , a , and ) of the cosine curves as the indicators of nonlinear fluctuation of hrv . specifically , in the first stage , we fit each hrv variable based on all available 5-min segments within 24 h from each participant to a cosine periodic regression model using nonlinear least squares : \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{hrv}}_{i } \left ( t \right ) = m_{i } + a_{i } \cdot { \cos } \left [ { { { 2\pi \cdot \left ( { t - \theta_{i } } \right ) } \mathord{\left/ { \vphantom { { 2\pi \cdot \left ( { t - \theta_{i } } \right ) } t } } \right . \kern-\nulldelimiterspace } t } } \right ] + \varepsilon_{i } $ $ \end{document } , i = 1 , , 95 , in which mi is the daily average of hrv of the ith subject , ai is the fluctuation amplitude of hrv of the ith subject around mi , t is the time - specific segment order number , t is the total number of 5-min segments in 24 h , i is the acrophase ( the lag from the reference time point ( 9 am ) to the time of the zenith of the cosine curve fit to the data of the ith subject ) , and i is the error term of the ith subject .
one unit of t corresponds to 5 min , with 1 indicating 9:00 am to 9:05 am , 2 indicating 9:05 am to 9:10 am etc . in the second stage
, we used random - effects meta - analysis to obtain the population estimates of m , a and , and their 95% cis from the individual cosine parameters obtained from the first stage to achieve the first objective of this study . unlike a fixed - effects meta - analysis , which would account for only within - subject variability
, the random - effects meta - analysis allows for both within- and between - subject variability .
the random - effects meta - analysis method was also used to test a = 0 ( zero amplitude test ) and assess the impact of the population attributes , such as age and sex , on the three cosine parameters of the hrv variables ( the secondary objective ) . to visualize the circadian pattern of each hrv variable ,
we plotted the two - stage model predicted circadian pattern of each hrv variable over the 24-h clock time , with the corresponding time - specific segment average of the hrv variable superimposed .
the time - specific segment averages are derived from a linear mixed - effects model , where time is treated as a fixed , categorical variable and the within - subject covariance matrix has a first - order autoregressive structure . this model places no specific functional form on the relationships between the hrv variables and time .
all analyses were performed using sas version 9.1 software ( sas institute inc . , cary , nc , usa ) .
the data collected for the air pollution and cardiac risk and its time course ( apacr ) study are used for this report . the apacr study , funded by niehs ( 1 r01 es014010 ) ,
briefly , all study participants were recruited from community - dwelling individuals residing in central pennsylvania , mostly from the harrisburg metropolitan area .
the inclusion criteria for the apacr study included age 45 years , not smoking , and not having severe cardiac problems ( defined as diagnosed valvular heart disease , congenital heart disease , acute myocardial infarction or stroke within 6 months , or congestive heart failure ) .
all study participants , after providing written informed consent , were examined between november , 2007 and june , 2009 .
study participants were examined in the penn state college of medicine general clinical research center ( gcrc ) in the morning between 8 and 10 am .
all participants fasted for at least 8 h before the clinical examination . after completing a health history questionnaire , a trained research nurse measured seated blood pressure three times , height , and weight , and drew 50 ml of blood for blood biomarker assays according to the blood sample preparation protocols .
a trained investigator hooked up the holter ecg recorders between 9 and 10 am .
participants were given an hourly activity log to record special events that occurred in the next 24 h. participants were then released to go on with their regular daily routines in the period of ongoing holter recording .
the next morning the participants came back to the gcrc to unhook the holter monitors and return the completed activity log .
a high fidelity ( sampling frequency 1,000 hz ) 12-lead h - scribe holter system ( mortara instrument , inc .
, wi , usa ) was used for 24-h beat - to - beat ecg data collection .
the high fidelity ecg significantly increases the resolution and enhances the accuracy of various wave form measurements .
the standardized operation procedures for the apacr study developed by the study investigators were followed rigorously in the data collection , retrieval , and offline processing .
the main objective of the offline processing was to verify the holter - identified ecg waves , and to identify and label additional electronic artifacts and arrhythmic beats in the ecg recording .
after removing artifacts and ectopy beats with standardized visional inspection , we obtained beat - to - beat normal rr interval data for hrv analysis .
the entire 24-h normal beat - to - beat rr interval data were divided into 5-min segment rr data .
the rr data for hrv analysis were processed according to current recommendations . within each segment ,
any rr interval < 400 ms , > 2,000 ms , or where the ratio from two adjacent rr intervals was < 0.80 or > 1.20 were excluded from the hrv analysis .
the time- and frequency - domain hrv analyses were performed on the remaining normal rr interval data if the total length of such normal rr intervals was > 4 min ( 80% of original data ) , using a software program ( hrv analysis software ; department of physics , university of kuopio , finland ) . when performing frequency - domain hrv analysis , we used fast fourier transformation ( fft ) .
briefly , the adjacent rr interval data were interpolated using a piecewise cubic spline interpolation approach , with a 2 hz sampling rate .
we used a second order polynomial model to remove the slow non - stationary trends of the hrv signal .
the following hrv indices were calculated as measures of cam : standard deviation of all rr intervals ( sdnn , ms ) , square root of the mean of the sum of the squares of differences between adjacent rr intervals ( rmssd , ms ) , power in the high frequency range ( 0.150.40 hz , hf ) , power in the low frequency range ( 0.040.15 hz , lf ) , and the ratio of lf to hf ( lf / hf ) .
power in the very low frequency range ( 0.04 hz ) was not studied here because of the short - duration of the window used ( 5 min ) . following current recommendations
from the 115 individuals , we excluded 20 individuals from this report because of the following reason(s ) : technical problems with the holter recording ( n = 1 ) , insufficient normal rr intervals for hrv analysis ( < 20 h of ecg data ) ( n = 2 ) , a history of diabetes ( n = 9 ) , and a history of cardiovascular disease ( cvd , n = 8) . as a result , this report used the data from the remaining 95 individuals .
each individual contributed up to 288 segments of 5-min rr interval data within 24 h , resulting in up to 27,360 data segments .
we analyzed 26,714 segments of hrv data after excluding segments with less than 4 min of normal rr interval data .
we used a two - stage modeling approach to achieve the objectives of this study . in the first stage , we fit one cosine periodic regression model for each individual to get the individual - level parameters ( m , a , and ) of the cosine curves as the indicators of nonlinear fluctuation of hrv .
specifically , in the first stage , we fit each hrv variable based on all available 5-min segments within 24 h from each participant to a cosine periodic regression model using nonlinear least squares : \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{hrv}}_{i } \left ( t \right ) = m_{i } + a_{i } \cdot { \cos } \left [ { { { 2\pi \cdot \left ( { t - \theta_{i } } \right ) } \mathord{\left/ { \vphantom { { 2\pi \cdot \left ( { t - \theta_{i } } \right ) } t } } \right . \kern-\nulldelimiterspace } t } } \right ] + \varepsilon_{i } $ $ \end{document } , i = 1 , , 95 , in which mi is the daily average of hrv of the ith subject , ai is the fluctuation amplitude of hrv of the ith subject around mi , t is the time - specific segment order number , t is the total number of 5-min segments in 24 h , i is the acrophase ( the lag from the reference time point ( 9 am ) to the time of the zenith of the cosine curve fit to the data of the ith subject ) , and i is the error term of the ith subject .
one unit of t corresponds to 5 min , with 1 indicating 9:00 am to 9:05 am , 2 indicating 9:05 am to 9:10 am etc . in the second stage , we used random - effects meta - analysis to obtain the population estimates of m , a and , and their 95% cis from the individual cosine parameters obtained from the first stage to achieve the first objective of this study . unlike a fixed - effects meta - analysis , which would account for only within - subject variability
, the random - effects meta - analysis allows for both within- and between - subject variability .
the random - effects meta - analysis method was also used to test a = 0 ( zero amplitude test ) and assess the impact of the population attributes , such as age and sex , on the three cosine parameters of the hrv variables ( the secondary objective ) . to visualize the circadian pattern of each hrv variable , we plotted the two - stage model predicted circadian pattern of each hrv variable over the 24-h clock time , with the corresponding time - specific segment average of the hrv variable superimposed .
the time - specific segment averages are derived from a linear mixed - effects model , where time is treated as a fixed , categorical variable and the within - subject covariance matrix has a first - order autoregressive structure
. this model places no specific functional form on the relationships between the hrv variables and time .
all analyses were performed using sas version 9.1 software ( sas institute inc . , cary , nc , usa ) .
the demographic data , cvd risk factors , and the hrv indices of the entire study population are shown in table 1 .
the mean age of the participants was 56 ( sd 8) years , with 63% female , 76% non - hispanic white , and 24% minorities ( including blacks , hispanics , and chinese ) .
the data showed that their general health and chronic cvd risk factors are similar to that of the middle - aged american general population.table 1the study population characteristicstotalmale ( n = 35)female ( n = 60)non - hispanic white ( n = 72)non - white ( n = 23)age ( years)56.5 ( 8.1)54.6 ( 7.7)57.5 ( 8.1)57.7 ( 8.1)52.6 ( 6.5)body mass index ( kg / m)26.8 ( 4.9)26.8 ( 3.3)26.8 ( 5.7)26.4 ( 4.9)28.2 ( 4.8)systolic blood pressure ( mmhg)121.7 ( 15.1)122.9 ( 15.4)121.0 ( 15.0)122.5 ( 15.1)119.1 ( 15.1)diastolic blood pressure ( mmhg)75.0 ( 8.9)76.9 ( 9.1)73.9 ( 8.7)74.9 ( 8.5)75.3 ( 10.4)fasting blood glucose ( mg / dl)84.8 ( 10.6)88.9 ( 11.1)82.5 ( 9.6)83.3 ( 9.6)89.6 ( 12.4)total cholesterol ( mg / dl)206 ( 36)206 ( 34)208 ( 37)206 ( 31)204 ( 50)high density lipoprotein cholesterol ( mg / dl)56.9 ( 16.8)45.5 ( 12.1)63.4 ( 15.7)59.5 ( 17.3)48.6 ( 12.1)low density lipoprotein cholesterol ( mg / dl)124.5 ( 31.9)125.9 ( 31.1)123.7 ( 32.6)124.6 ( 28.4)124.3 ( 42.1)triglyceride ( mg / dl)120.4 ( 77.6)151.2 ( 96.6)102.9 ( 58.5)109.8 ( 71.8)155.0 ( 87.1)hrv variables ln hf ( ms)3.6 ( 0.8)3.5 ( 0.7)3.7 ( 0.9)3.6 ( 0.7)3.7 ( 1.0 ) ln lf ( ms)4.8 ( 0.7)4.9 ( 0.5)4.7 ( 0.8)4.8 ( 0.7)4.6 ( 1.0 ) lf / hf ratio4.7 ( 2.1)5.6 ( 2.2)4.2 ( 1.8)5.0 ( 2.2)3.7 ( 1.0 ) sdnn ( ms)43.3 ( 13.3)44.1 ( 12.5)42.8 ( 13.8)43.5 ( 12.4)42.8 ( 16.4 ) rmssd ( ms)22.3 ( 8.7)21.4 ( 8.5)22.9 ( 8.9)22.1 ( 8.5)23.3 ( 10.0 ) heart rate ( beats / min)75.8 ( 9.7)75.9 ( 11.0)75.7 ( 8.9)75.0 ( 9.0)77.6 ( 11.3)continuous variables are presented as mean ( sd ) ; categorical variables are presented as percentage ( % ) overall average of the intra - subject means of 5-min segments the study population characteristics continuous variables are presented as mean ( sd ) ; categorical variables are presented as percentage ( % ) overall average of the intra - subject means of 5-min segments the estimates of the three cosine periodic regression parameters and their 95% cis for each hrv variable are presented in table 2 .
the acrophases of log hf and rmssd ( both are reflective of the vagal modulation ) were very similar the point estimates are around 3:30 am 20 min .
the acrophases of log lf and sdnn ( both are reflective of sympathetic and vagal modulation ) also were very similar the point estimates are around 5:00 am 10 min .
the acrophase of lf / hf ratio was 3:30 in the afternoon , and that of heart rate was 2:15 in the afternoon .
the tests of zero amplitude were highly significant ( p < 0.0001 ) for every hrv variable , clearly suggesting a significant circadian variation .
the circadian variation of hrv indices are graphically presented in fig . 1 , overlaying the time - specific segment averages and the periodic curve fit from the point estimates of the three cosine periodic regression parameters calculated from the random - effects meta - analysis .
these plots show a distinctive day night variation on all hrv variables analyzed on a 24-h basis.table 2the parameter estimates ( and 95% ci ) of the cosine periodic regression model of hrv indicesmean ( 95% ci)amplitude * ( 95% ci)acrophase ( 95% ci)log hf ( ms)3.59 ( 3.433.76)0.61 ( 0.540.68)3:10 ( 2:253:55 ) amlog lf ( ms)4.75 ( 4.604.91)0.44 ( 0.390.49)4:55 ( 3:506:00 ) amsdnn ( ms)43.2 ( 40.545.9)9.4 ( 8.110.7)5:10 ( 4:205:55 ) amrmssd ( ms)22.3 ( 20.524.1)6.5 ( 5.47.5)3:45 ( 2:554:35 ) amlf / hf ratio4.68 ( 4.265.10)1.35 ( 1.151.56)3:30 ( 2:204:35 ) pmheart rate ( bpm)75.8 ( 73.877.8)10.8 ( 9.911.7)2:15 ( 1:552:35 ) pm * p < 0.0001 for zero amplitude tests of all hrv indicescalculated as the unit to zenith 2 se , and translated into clock timefig . 1the circadian periodic curves of hrv variables overlaid with time - specific segment averages .
overall periodic curve derived from random - effects meta - analysis ( solid line ) .
time - specific segment average values ( dots ) the parameter estimates ( and 95% ci ) of the cosine periodic regression model of hrv indices * p < 0.0001 for zero amplitude tests of all hrv indices calculated as the unit to zenith 2 se , and translated into clock time the circadian periodic curves of hrv variables overlaid with time - specific segment averages . overall periodic curve derived from random - effects meta - analysis ( solid line )
. time - specific segment average values ( dots ) the association between each cosine parameter and participant s age , ethnicity , and gender are presented in table 3 , as the regression coefficients ( ) , standard errors ( se ) , and p values .
the between gender comparison of the ms in table 3 indicate that there is no significant gender difference , except for lf / hf ratio , where m is significantly higher in males than in females . for between gender comparisons of the as ,
males have higher fluctuation amplitude of log hf ( p = 0.08 ) , log lf ( p = 0.01 ) , sdnn ( p = 0.04 ) , and lf / hf ratio ( p = 0.04 ) than females .
the between gender comparison of the s in table 3 indicate that there is no significant gender difference , except for lf / hf ratio , where the in males is significantly delayed for almost 3 h ( p = 0.01 ) .
meanwhile , older age is significantly associated with lower m for log hf ( p < 0.01 ) , log lf ( p < 0.01 ) , sdnn ( p < 0.05 ) , and rmssd ( p < 0.05 ) . age is not significantly associated with the a of any hrv index , except for the lf / hf ratio , where older age is associated with significantly lower a ( p = 0.04 ) .
interestingly , older age is significantly associated with delayed in rmssd ( approximately 1 h , p < 0.05 ) and lf / hf ratio ( approximately 2 h , p < 0.01 ) .
the very few that are statistically significant or marginally significant , namely lf , sdnn , lf / hf ratio , and hr , the non - hispanic white showed a similar pattern to the male gender in these data.table 3the regression coefficient ( ) estimates and se of major population attributes on mean , amplitude , and acrophase of the circadian periodic curves of hrv from random - effects meta - analysismaleage ( per 10 years)non - hispanic whitesep valuesep valuesep valuelog hf ( ms ) m0.300.170.080.330.100.0020.060.190.74 a0.130.070.080.030.040.550.0020.080.98 3.79.50.703.95.90.5112.310.90.26log lf ( ms ) m0.110.160.460.290.100.0030.310.180.09 a0.140.050.010.020.030.570.130.060.03 20.813.10.1214.38.20.0830.515.30.05sdnn ( ms ) m0.412.820.884.401.750.012.993.250.36 a2.781.350.040.210.830.802.711.550.08 18.610.10.079.46.20.135.411.60.64rmssd ( ms ) m2.271.860.222.571.150.030.212.140.92 a1.301.080.230.730.670.280.581.240.64 2.110.50.8414.16.50.038.512.10.49lf / hf ratio m1.660.39<0.0010.060.240.791.540.450.001 a0.430.210.040.270.130.040.180.230.44 35.013.20.0122.28.20.0087.315.10.63heart rate ( bpm ) m0.52.10.801.81.30.161.62.40.50 a0.71.00.440.30.60.611.31.10.24 4.63.70.220.0012.31.008.44.30.05age was analyzed as a continuous variable ; thus , the regression coefficients correspond to the changes for every 10-year increase in agem , a , and : parameters of the cosine periodic curvemean , amplitude , and acrophase ; 1 unit of corresponds to 5 min , with a positive of 1 unit indicating 5 min later , a positive of 6 units indicating 30 min later , 12 units indicating 1 h later , and so on the regression coefficient ( ) estimates and se of major population attributes on mean , amplitude , and acrophase of the circadian periodic curves of hrv from random - effects meta - analysis age was analyzed as a continuous variable ; thus , the regression coefficients correspond to the changes for every 10-year increase in age m , a , and : parameters of the cosine periodic curvemean , amplitude , and acrophase ; 1 unit of corresponds to 5 min , with a positive of 1 unit indicating 5 min later , a positive of 6 units indicating 30 min later , 12 units indicating 1 h later , and so on
the estimates of the three cosine periodic regression parameters and their 95% cis for each hrv variable are presented in table 2 .
the acrophases of log hf and rmssd ( both are reflective of the vagal modulation ) were very similar the point estimates are around 3:30 am 20 min .
the acrophases of log lf and sdnn ( both are reflective of sympathetic and vagal modulation ) also were very similar the point estimates are around 5:00 am 10 min .
the acrophase of lf / hf ratio was 3:30 in the afternoon , and that of heart rate was 2:15 in the afternoon .
the tests of zero amplitude were highly significant ( p < 0.0001 ) for every hrv variable , clearly suggesting a significant circadian variation . the circadian variation of hrv indices are graphically presented in fig . 1 , overlaying the time - specific segment averages and the periodic curve fit from the point estimates of the three cosine periodic regression parameters calculated from the random - effects meta - analysis .
these plots show a distinctive day night variation on all hrv variables analyzed on a 24-h basis.table 2the parameter estimates ( and 95% ci ) of the cosine periodic regression model of hrv indicesmean ( 95% ci)amplitude * ( 95% ci)acrophase ( 95% ci)log hf ( ms)3.59 ( 3.433.76)0.61 ( 0.540.68)3:10 ( 2:253:55 ) amlog lf ( ms)4.75 ( 4.604.91)0.44 ( 0.390.49)4:55 ( 3:506:00 ) amsdnn ( ms)43.2 ( 40.545.9)9.4 ( 8.110.7)5:10 ( 4:205:55 ) amrmssd ( ms)22.3 ( 20.524.1)6.5 ( 5.47.5)3:45 ( 2:554:35 ) amlf / hf ratio4.68 ( 4.265.10)1.35 ( 1.151.56)3:30 ( 2:204:35 ) pmheart rate ( bpm)75.8 ( 73.877.8)10.8 ( 9.911.7)2:15 ( 1:552:35 ) pm * p < 0.0001 for zero amplitude tests of all hrv indicescalculated as the unit to zenith 2 se , and translated into clock timefig .
overall periodic curve derived from random - effects meta - analysis ( solid line ) .
time - specific segment average values ( dots ) the parameter estimates ( and 95% ci ) of the cosine periodic regression model of hrv indices * p < 0.0001 for zero amplitude tests of all hrv indices calculated as the unit to zenith 2 se , and translated into clock time the circadian periodic curves of hrv variables overlaid with time - specific segment averages .
overall periodic curve derived from random - effects meta - analysis ( solid line ) .
the association between each cosine parameter and participant s age , ethnicity , and gender are presented in table 3 , as the regression coefficients ( ) , standard errors ( se ) , and p values .
the between gender comparison of the ms in table 3 indicate that there is no significant gender difference , except for lf / hf ratio , where m is significantly higher in males than in females . for between gender comparisons of the as , males have higher fluctuation amplitude of log hf ( p = 0.08 ) , log lf ( p = 0.01 ) , sdnn ( p = 0.04 ) , and lf / hf ratio ( p = 0.04 ) than females .
the between gender comparison of the s in table 3 indicate that there is no significant gender difference , except for lf / hf ratio , where the in males is significantly delayed for almost 3 h ( p = 0.01 ) .
meanwhile , older age is significantly associated with lower m for log hf ( p < 0.01 ) , log lf ( p < 0.01 ) , sdnn ( p < 0.05 ) , and rmssd ( p < 0.05 ) .
age is not significantly associated with the a of any hrv index , except for the lf / hf ratio , where older age is associated with significantly lower a ( p = 0.04 ) .
interestingly , older age is significantly associated with delayed in rmssd ( approximately 1 h , p < 0.05 ) and lf / hf ratio ( approximately 2 h , p < 0.01 ) .
the very few that are statistically significant or marginally significant , namely lf , sdnn , lf / hf ratio , and hr , the non - hispanic white showed a similar pattern to the male gender in these data.table 3the regression coefficient ( ) estimates and se of major population attributes on mean , amplitude , and acrophase of the circadian periodic curves of hrv from random - effects meta - analysismaleage ( per 10 years)non - hispanic whitesep valuesep valuesep valuelog hf ( ms ) m0.300.170.080.330.100.0020.060.190.74 a0.130.070.080.030.040.550.0020.080.98 3.79.50.703.95.90.5112.310.90.26log lf ( ms ) m0.110.160.460.290.100.0030.310.180.09 a0.140.050.010.020.030.570.130.060.03 20.813.10.1214.38.20.0830.515.30.05sdnn ( ms ) m0.412.820.884.401.750.012.993.250.36 a2.781.350.040.210.830.802.711.550.08 18.610.10.079.46.20.135.411.60.64rmssd ( ms ) m2.271.860.222.571.150.030.212.140.92 a1.301.080.230.730.670.280.581.240.64 2.110.50.8414.16.50.038.512.10.49lf / hf ratio m1.660.39<0.0010.060.240.791.540.450.001 a0.430.210.040.270.130.040.180.230.44 35.013.20.0122.28.20.0087.315.10.63heart rate ( bpm ) m0.52.10.801.81.30.161.62.40.50 a0.71.00.440.30.60.611.31.10.24 4.63.70.220.0012.31.008.44.30.05age was analyzed as a continuous variable ; thus , the regression coefficients correspond to the changes for every 10-year increase in agem , a , and : parameters of the cosine periodic curvemean , amplitude , and acrophase ; 1 unit of corresponds to 5 min , with a positive of 1 unit indicating 5 min later , a positive of 6 units indicating 30 min later , 12 units indicating 1 h later , and so on the regression coefficient ( ) estimates and se of major population attributes on mean , amplitude , and acrophase of the circadian periodic curves of hrv from random - effects meta - analysis age was analyzed as a continuous variable ; thus , the regression coefficients correspond to the changes for every 10-year increase in age m , a , and : parameters of the cosine periodic curvemean , amplitude , and acrophase ; 1 unit of corresponds to 5 min , with a positive of 1 unit indicating 5 min later , a positive of 6 units indicating 30 min later , 12 units indicating 1 h later , and so on
our first objective in this study was to quantitatively describe the circadian pattern of cam using cosine periodic regression models and to obtain the normative range of these cosine parameters .
to this aim , the data presented in table 2 and fig . 1
demonstrate the circadian patterns , which can be appropriately captured by these three cosine function parameters .
in general , higher values of hf , lf , rmssd , and sdnn are indicative of more parasympathetic modulation .
overall , these hrv variables follow a very similar circadian pattern decreasing during the am hours and reaching the lowest levels in the afternoon , and turning upwards in the evening and reaching the acrophase in the early morning 3:005:00 , and finally starting to decline again after the acrophase . on the other hand ,
hr and lf / hf , where higher values are indicative of more sympathetic modulation , showed an opposite diurnal pattern increasing during the am hours and reaching the highest levels in the afternoon 2:004:00 , then turning downwards after that and reaching the lowest points after midnight before the early morning hours , and finally starting to increase again after the lowest points .
most importantly , the tests of zero amplitude were highly statistically significant ( all p < 0.0001 ) for every hrv variable analyzed .
the point estimates of the three cosine parameters of log hf and lf / hf from our data and from nakagawa et al .
are similar , except that they did not involve time - domain hrv and did not observe a significant circadian variation of lf .
we only found two previous studies in healthy individuals that examined the circadian pattern of hrv as a cosine function
one involved 20 healthy young adult volunteers and another was based on 57 children .
this study used a two - stage analytic approach , which represents an important improvement over previous studies .
specifically , this two - stage modeling approach allowed us to first capture within individual variation of hrv over time for each participant and allowed for between individual differences in the circadian variation , which in turn was accounted for in the final stage of obtaining study sample - level cosine parameters and their 95% cis . in contrast , previous studies calculated the time - specific averages from the sample , and used such averages to estimate the cosine parameters .
such an approach is computationally efficient in estimating the average of the cosine parameters , but it eliminated the between - subjects differences in hrv on any time point , and as a consequence , it can not provide the 95% ci of the cosine parameters . for the same reason , the cosine parameters estimated from the previous approach can not be easily analyzed in terms of the impact of population attributes .
other factors such as physical activity , obesity , and cardiac co - morbidity are known to have an adverse impact on cardiac autonomic modulation .
as illustrated in the associations between age , ethnicity , sex , and hrv circadian pattern in this study ( secondary objective ) , the two - stage approach we used can be used to effectively compare the effects of various factors on the circadian pattern of hrv .
furthermore , this report is based on a community - dwelling sample of healthy middle - aged individuals , which is a traditional high risk
group for acute cardiac events , such as myocardial infarction and sudden cardiac death . as such
previous studies sampled much younger individuals , and were based on smaller sample sizes [ 20 , 21 ] .
a secondary objective of this study was to examine the influences of population attributes , such as gender , age , and ethnicity , on the three cosine regression parameters .
for the between gender comparisons of the cosine parameters of hrv , our data suggest that there is no significant gender difference in the ms of hrv curves , except for lf / hf ratio , where the m is significantly higher in males than in females , indicative of a higher sympathetic and lower parasympathetic modulation in males than in females ( table 3 ) .
we did not find significant gender difference for the ms of hf , lf , sdnn , and rmssd in our sample .
this is consistent with previous reports of the disappearance of gender differences of mean hrv at approximately 50 years of age [ 2628 ] .
for the comparisons of the as of hrv curves , males have higher amplitude than females on almost every hrv variable analyzed ( table 3 ) .
to our knowledge , this is the first study to report that males have higher fluctuation amplitude of hrv than females . for the comparisons of the s of hrv curves
, there is no significant gender difference in the acrophase time , except for lf / hf ratio , where the acrophase is significantly delayed for almost 3 h ( p = 0.01 ) in males .
the association between age and the three cosine parameters in our data is very consistent with the literature [ 18 , 2628 ] : in general , older age is significantly associated with lower mean levels , lower amplitude , and later acrophase time of hrv .
these findings confirm the adverse age effects on the balance of parasympathetic and sympathetic modulation of heart beats . in our data , there were very few non - consistent associations between white and non - white groups .
this may be due to the non - white population in our sample consisting of one african american , eleven chinese , and eleven hispanics .
we did not have a large enough sample size to compare white with each of the individual ethnicities .
others have reported that persons with angina , type 2 diabetes , and elevated blood pressure had impaired circadian pattern of hrv .
having established the effects of age and gender on the circadian parameters of hrv , future studies are needed to quantify the effects of these chronic conditions on the circadian parameters of hrv , and to investigate beneficial effects on the circadian parameters of hrv from physical activity or pharmacological treatment of various chronic conditions .
we excluded individuals with a history of cvd or diabetes from this report , which is consistent with our primary objective to obtain the normal circadian pattern of hrv in an apparently healthy middle - aged population .
as a consequence , the generalizability of our data to individuals with such chronic conditions may be limited .
, individuals were carrying on their regular routines , including any habitual physical activity , which is known to influence cam .
in this community - based sample of middle - aged individuals , the hrv variables , as measures of the balance of autonomic modulation , exhibit a distinct circadian rhythm over the 24-h period .
the hrv circadian rhythm follows a cosine periodic function , which can be quantified with three parameters the mean , the amplitude , and the acrophase time .
the three cosine function parameters together with their respective 95% cis estimated from our data can be used as normal ranges of 5-min period time- and frequency - domain hrv circadian variations .
population attributes , such as gender and age , are associated with the hrv cosine circadian parameters .
Output:
| objectivesto examine the circadian pattern of cardiac autonomic modulation ( cam ) and its attributes in general population.methodswe obtained 24-h beat - to - beat rr data using a high resolution 12-lead holter ecg in a community - dwelling sample of 115 non - smokers .
we performed heart rate variability ( hrv ) analysis on the normal rrs from each 5-min segment to obtain time - specific hrv indices : high ( hf ; 0.150.40 hz ) and low ( lf ; 0.040.15 hz ) frequency powers , standard deviation of rr intervals ( sdnn ) , and the square root of the mean of the sum of the squared differences of the adjacent rr intervals ( rmssd ) .
for each individual , we fit the segment - specific hrv data to a cosine periodic function , and estimated 3 individual - level cosine function parameters to quantify the circadian variation : the mean ( m ) , amplitude ( a ) , and acrophase ( ) .
we then used a random - effects meta - analysis to summarize the m , a , and , and their 95% confidence intervals ( ci).resultsthe mean age was 56 ( sd 8) years , with 63% female and 76% white . the averages of m , a and ( 95%ci ) of log hf were 3.59 ( 3.433.76 ) ms2 , 0.61 ( 0.540.68 ) ms2 , and 3:10 ( 2:253:55 ) am , respectively , and that of rmssd were 22.3 ( 20.524.1 ) ms , 6.5 ( 5.47.5 ) ms , 3:45 ( 2:554:35 ) am , respectively . older age is associated with lower mean of hrv .
males have higher oscillation amplitude than females .
the acrophase of lf / hf was earlier in females than in males , and in younger individuals than in older individuals.conclusionsthe circadian pattern of cam can be quantified by 3 cosine parameters of hrv , which are correlated with age and gender . |
PubmedSumm118471 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: lipoma is a thinly encapsulated benign tumour of mesenchymal origin and is found within parts of the body where fat is normally present . accounting for 0.15% of all benign tumours , lipomas may occur either as single or multiple entities .
, lipomas tend to arise mainly in the posterior cervical triangle and forehead , commonly in the fourth to sixth decades of life . on rarer occasions
, lipomas may occur in the pharynx , larynx , oral cavity , parotid and submandibular areas [ 1 , 2 ] .
comprising 0.64.4% of all parotid tumours , a lipoma of the parotid gland is a rare entity .
preoperative evaluation techniques including the use of ultrasound ( us ) , fine needle aspiration cytology ( fnac ) , magnetic resonance imaging ( mri ) and computed tomography ( ct ) have enabled a more accurate assessment of these tumours and a rational approach to their management .
the aetiology remains largely idiopathic , but literature suggests a plausible genetic predisposition [ 2 , 4 ] .
histologically , lipomas contain fat cells although morphological variants containing other mesenchymal tissues can be present such as angiolipoma and osteolipoma .
we present a rare case of a post - traumatic lipoma of the parotid gland , describing the diagnostic workup and surgical removal .
a 53-year - old female initially presented to the emergency department following an assault in which she sustained a punch to the left side of her jaw .
clinical and radiographical examination revealed a left high condylar head fracture ( fig . 1 ) .
on 2-month review , she complained of a persistent , painless , slow growing mass in the left pre - auricular area .
clinical examination revealed a soft , mobile , non - tender , non - fluctuant , regular mass within the left parotid gland with normal overlying skin and normal sensation .
figure 1:orthopantomographic image showing a left high condylar head fracture and a stable occlusion with adequate posterior contact .
orthopantomographic image showing a left high condylar head fracture and a stable occlusion with adequate posterior contact .
an us scan showed a well - defined non - vascular hypoechoic lesion in the left superficial parotid lobe measuring 3.2 2.2 2.6 cm ( fig . 2 ) .
mri showed high signal intensity on t1-weighted images ( fig . 3 ) and a branching vessel - like central structure traversing the lesion .
the tumour comprised of a well - circumscribed , soft yellow , fatty mass covered in a thin fibrous capsule ( fig . 4 ) .
histopathology showed a homogenous proliferation of mature adipocytes , confirming the diagnosis of a lipoma .
figure 2:ultrasound of the left parotid gland showing a well - circumscribed hypoechoic lesion .
figure 3:coronal mri showing the extent of the lipoma and vessel - like structure traversing it ( arrow ) .
coronal mri showing the extent of the lipoma and vessel - like structure traversing it ( arrow ) .
adipose tissue is normally present in the parotid gland ; however , the incidence of lipomas here is very low .
different causes of lipomas are mentioned in the literature : heredity , obesity , diabetes , radiation , endocrine disorders , insulin injection , corticosteroid therapy and trauma . as in this case
, a preceding trauma to the soft tissues has been hypothesized to result in a haematoma , with subsequent lymphatic effusion , fat necrosis and lipoma formation . as for their rarity in the parotid gland ,
the principle consideration of an intraparotid mass is to differentiate between benign and malignant salivary gland neoplasia .
there is , however , no unique clinical feature by which the lipoma can be separated from other parotid gland tumours . with a sex ratio of 5 : 1 ,
the majority of patients present with a single lesion usually without any predisposing causal factors .
they progress slowly as soft well - delineated asymptomatic masses where the main patient concern is of the associated cosmetic asymmetry . on average , 75% of the lesions
are located within the superficial lobe with a further 6.5% in the deep lobe , and 16.5% occurring in both the deep and superficial lobes .
as is standard in the workup of parotid masses , us and fnac provide combined imaging and cytological diagnosis although in lipoma the cytology is often inconclusive .
an mri scan is the imaging modality of choice for further assessment prior to any planned surgical excision .
it will identify soft tissue margin characteristics and accurately help differentiate between benign and malignant lesions .
the surgical approach to a parotid lipoma excision should be the same as for any other suspected benign tumour , with due regard to the presence of the facial nerve in the operative field .
it is unusual for the facial nerve to be involved preoperatively ; however , a single case with complete palsy has been reported in the literature . during surgery ,
the facial nerve is identified and followed up to its peripheral branches as far as necessary for complete tumour dissection . as in this case
surgeons and physicians alike should be aware of the possibility of lipomas presenting within the parotid gland , and should recognize its formation in the post - trauma situation and its inclusion in the differential diagnosis of parotid lesions .
surgeons should be familiar with its management which is in keeping with the overall workup of any parotid mass .
Output:
| lipoma of the parotid gland is a rare entity .
trauma with soft tissue haematoma formation and subsequent lymphatic effusion , fat necrosis and lipoma formation have been postulated as an aetiological pathway .
we report a case of a post - traumatic lipoma of the parotid gland to add to the available literature on this uncommon pathology . |
PubmedSumm118472 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the online version of this article ( doi:10.1007/s00239 - 008 - 9111 - 7 ) contains supplementary material , which is available to authorized users .
collagen is the most abundant protein as measured by the total mass present in humans ( di lullo et al .
fibrillar collagen is highly organized at critical mechanical stress locations such as bones , tendons , ligaments , nerve sheaths , skin , and cornea . in single - celled organisms ,
exceptions are the collagen - like fragments found in streptococcus equi ( liden et al .
nevertheless , collagen may have been one of the key emergent bridges from single - celled prokaryotes to multicellular eukaryotes . for a review of the importance of the triglycine repeat and how it is maintained in fibrillar collagens , see kadler et al .
current consensus holds that the collagen gene began as a relatively short sequence that allowed for small groups of cells to organize into larger systems and perhaps eventually differentiate into complex colonies . through the process of mutation and natural selection
this gene eventually lengthened , diversified through gene duplication events , and was refined into its characteristic triple - helical , self - interacting structure , allowing for greater mechanical stresses to be sustained among cells ( boot - handford and tuckwell 2003 ; buehler 2006b ; wada et al .
this conferred the ability of the organism to maintain cellular diversity , accelerate quickly , absorb mechanical energy , and resist fracture ( buehler 2006b ) , allowing organisms that possessed it to rise to the top of the food chain .
the recently predicted , but yet undetected collagen - like gene found in trichodesmium erythraeum by orcutt et al .
it has a triglycine repeat region that is approximately 10% longer than that of most vertebrates , and it shares several identical or similar residues in its n and c termini .
an intriguing possibility is that it acquired this gene through viral - mediated interdomain transfer from a larger marine organism .
t. erythraeum is a colonial marine cyanobacterium that can be seen with the naked eye . during periods of low wind stress and warm temperatures it forms blooms of surface aggregations that can be tens of thousands of kilometers wide ( capone et al . 1997 ) . from nasa satellite images , blooms of this size
as the cells age , they become positively buoyant and rise to the surface ( walsby 1994 ) . once these segmented structures reach a critical length , they fracture , allowing new growth to occur at a new set of free ends as they enter their exponential growth phase ( bell et al . 2005 ) .
its collagen - like gene may serve the purpose of maintaining colony contact even as individual cells lose direct contact with each other . these blooms or
rafts consist of healthy and aged cells mixed with detritus in a mucilaginous matrix ( endean and monks 1993 ) . according to observations from the tropical and subtropical north atlantic , trichodesmium produces more nitrogen than any other macroscopic ( 0.54 mm ) cyanobacteria and about half of the new nitrogen used for primary production ( capone et al . 1997 ) .
in fact , the biological productivity of large expanses of the ocean is often limited by the availability of nitrogen and trichodesmium as an n2 fixer , thus making it of critical importance for supporting the metabolic requirements of a fast number of non - nitrogen - fixing organisms .
genetic characterization of trichodesmium species suggests that two distinct clades are present in the oceans : one including the closely related species t. thiebautii , t. tenue , t. hildebrandtii , and k. spiralis and the other containing only t. erythraeum as determined primarily by comparing introns and intein presence ( orcutt et al .
the t. erythraeum ribonucleotide reductase ( rir ) gene was found to encode four inteins and three group ii introns , which is extremely unlikely to have occurred by chance , considering the rarity of inteins and introns ( liu et al . 2003 ) within this genus .
if early collagen genes were to survive as the protein of choice in large , multicellular organisms to maintain the mechanical integrity of tissues together under static loading conditions , and under extreme loading conditions such as avoiding predators or pursuing prey , then they must have been selected or
purified by the two competing metrics : the ability to avoid rupture at high mechanical stress and the ability to self - assemble rapidly .
we present a theoretical framework for how the collagen translation length is balanced by the competing metrics of being long to support tensile loads while , at the same time , being short enough to robustly self - assembly .
we also present experimental results demonstrating the presence of a collagen - like protein in t. erythraeum and a phylogenetic analysis .
experimental methods include immunogold atomic force microscopy , sequence alignment , and phylogeny tree construction .
the amount of mechanical stress , , a biological tissue can sustain is 1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ \sigma = f \mathord{\left/
{ \vphantom { f a } } \right . \kern-\nulldelimiterspace } a $ $ \end{document}where f is the force applied to the tissue , and a is the tissue s cross - sectional area .
organisms rely on mechanical integrity of their constituents insofar as these constituents do not have unjustifiable metabolic expenses . recasting the stress equation as
\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \sigma _ { { max } } \propto { ma } \mathord{\left/ { \vphantom { { ma } a } } \right .
\kern-\nulldelimiterspace } a $ $ \end{document } , where m is the organism mass , and a is the acceleration experienced by the organism , it is seen that organisms with greater mass and/or higher acceleration rates , must have tissues that can withstand greater stresses .
galileo ( galilei 1638 , 1991 ) and later huxley ( 1932 , 1993 ) observed that the larger an organism becomes , the more of its mass must be structural .
their scaling laws take the form , 2\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ y = kx^{\alpha } $ $ \end{document}where y represents the dimension of an organ or subsystem of an organism ( measured in units of mass , length , area or volume ) , x represents the organism s body size ( measured in mass or volume ) , k is the
for example , it may be approximately cubic if x represents a linear dimension and y represents a volumetric dimension . for the present application
, we cast the allometric formula ( huxley 1932 ; martin 1981 ) as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \sigma = kl^{\alpha } $ $ \end{document } , where is the maximum mechanical stress an organism is likely to experience and l is the contour length of the collagen gene transcript . combining the allometric equation with the stress equation yields 3\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ l = { \left ( { \frac{{ma } } { { ak } } } \right)}^{{\frac{1 } { \alpha } } } $ $ \end{document } restated , the contour length , l , of the collagen triglycine repeat should have a tendency to increase as the mass , m , of an organism , and the accelerations , a , it is subjected to increase . however , having a tissue with a large cross - sectional area , a will diminish the need for long fibril - forming molecules .
the relatively nonmotile organism t. erythraeum uses gas vesicles rather than flagella to stratify ( walsby 1994 ) .
thus forces generated by its environment such as wind and ocean currents likely to rend its colonies apart , are represented by the ma term of eq .
this force could also be expressed as being proportional to stokes drag : 6rv , where is the fluid viscosity , r is the cell radius , and v is the fluid velocity . although t. erythraeum has not been observed to manufacture true collagen fibrils , this does not preclude the presence of single- , double- , or triple - helical collagen at the cell surfaces that provide a cohesive material for maintaining colony integrity . at the molecular scale ,
a contour length that is significantly longer than the persistence length may become a liability to self - assembly . restated , the contour length l competes with the persistence length lp .
once l surpasses lp , the probability of self - entanglement increases , thus diminishing the probability of a molecule such as collagen to aggregate radially and axially into fibrils .
recent work by buehler ( 2006a ) indicates qualitatively that longer molecules do have higher probabilities for their two ends to come into close proximity through the accumulation of molecular - scale bends .
the persistence length is an important parameter in determining self - assembly mechanics of structural proteins at the molecular scale ( wilhelm and frey 1996 ) . for triple - helical type ii collagen , lp = 11.2 nm ( sun et al . 2004 ) , and for type i collagen lp = 14.4 nm for triple - helical ( sun et al .
the persistence length for triple - helical collagen has been predicted by buehler ( 2006a ) to be 23.4 nm . indeed , persistence length and bending stiffness are related through the relationship 4\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ l_{p } = \frac{{ei } } { { k_{b } t } } $ $ \end{document}where e is the elastic modulus ( with dimensions of energy per unit volume ) , i is the second moment of inertia ( with dimensions of length to the fourth - power , l [ gere 2004 ] ) , kb is boltzmann s constant , and t is temperature measured in kelvins .
the persistence length thus represents the ratio between the order - preserving energy of the structure ei and its entropy - creating thermal energy kbt . by comparison , a microtubule s persistence length is 100 m to 5 mm ( pampaloni et al .
tropocollagen triple helix is whether the contour length - to - persistence length ratio allows for the possibility of self - interaction and , thus , circular structure formation rather than fibril aggregation .
similar events have been observed in other filament - forming proteins such as actin ( tang et al .
2001 ) . if this self - binding were to occur at an appreciable rate , fibrillogenesis would be impeded , thus reducing collagen s efficacy at performing its structural role .
since the persistence length is the length at which the direction of one end becomes uncorrelated with that of the other ( doi and edwards 1986 ) , a molecular structure with a contour length of alp may be approximated as the length at which a looping self - interaction becomes likely , where a is a scalar .
the distribution of entropically driven shapes is dependent on a variety of conditions such as solvent media , local molecular interactions , and microenvironmental constraints . to proceed with a formal analysis ,
the creation or simulation of tropocollagen molecules of increasing lengths with the n and c termini cleaved and lysines and hydroxylysines at appropriate locations to form cross - links is required .
experimental work or simulations at appropriate temperatures would produce probability curves of loop - structure formation .
triglycine repeat ranking we performed searches in the ncbi database for the term collagen .
all returned protein sequences were then purified by eliminating the n and c termini upstream and downstream of the gxy portion , using a custom - written bourne shell script ( fig .
the script counts the total number of characters in the triglycine repeat portion , then divides this number by three to obtain the triglycine repeat length .
collagen in the description were downloaded , along with ascension number , species name , and collagen type .
these were then filtered according to species and collagen type , their n and c termini were cleaved , and the triglycine repeat numbers ranked by length algorithm for producing data depicted in fig . 2 .
all current sequences listed in the ncbi database with collagen in the description were downloaded , along with ascension number , species name , and collagen type .
these were then filtered according to species and collagen type , their n and c termini were cleaved , and the triglycine repeat numbers ranked by length light microscopy samples of t. erythraeum were provided by john waterhouse , woods hole oceanographic institute . upon receipt , samples of t. erythraeum suspended in 50-ml vials of native ocean water were aliquoted into 1.5-ml vials and immediately stored at 70c .
frozen samples were thawed at room temperature and centrifuged at 10,000 g for 5 min .
pellets were then pipetted onto standard microscopy slides ( fisher scientific , usa ) , coverslipped , and imaged in phase - contrast mode at 200 on an olympus ix81 inverted light microscope .
images were captured digitally with a spot - rt camera ( diagnostic instruments , sterling heights , mi ) .
environmental scanning electron microscopy samples from the same aliquot as used for light microscopy were also prepared for environmental scanning electron microscopy in a phillips xl30 esem ( fei , hillsboro , or ) with a gaseous secondary electron detector ( gsed ) at a chamber pressure of 4.0 torr and 15 kv .
samples were placed directly on an aluminum stub , which was then placed on a sample holder inside the esem chamber in environmental ( wet ) mode .
excess water was evaporated from the sample to facilitate observation of the sample . by circulating water molecules and maintaining the pressure of the chamber within the range of 210 torr
, esem allows for observation of samples that are insulating without the need for a coating and keeps hydrated samples moist .
immunogold afm bovine collagen was used as a control and e. coli were used as a negative control .
this technique was chosen after initial efforts with immunohistochemistry revealed that t. erythraeum emits strong autofluorescence at each of the three standard fluorescence microscopy colors , fitc , tritc , and rhodamine , making standard immunofluorescence techniques impractical .
five hundred microliters of t. erythraeum and 200 l of e. coli were each pipetted into separate microcentrifuge tubes .
the two specimens were then placed in a microcentrifuge for 2 min at 10,000 g. after the supernatant was removed , 500 l of 1.8% formaldehyde ( diluted from fisher scientific bp531 - 500 ) was added .
specimens were then vortexed and kept at 5c . bovine collagen strands ( sigma c9879 ) ( einbinder and schubert 1951 )
were teased apart into a single fragment of approximately 100 m and placed in a 1.5-ml microcentrifuge tube .
all three specimens were then spun for 1 min at 13,000 rpm and the supernatant was removed .
two hundred microliters of pbs ( 0.01 m , ph 7.4 ) was added to each while the samples were kept at 5c .
fifty microliters of rabbit collagen ( i + ii + iii + iv + v primary antibody ab24117 ; abcam , cambridge , ma ) was diluted in 1.5 ml of pbs ( 0.01 m , ph 7.4 ) .
there is some contention as to what the specific binding sites are for collagen antibodies .
it is generally assumed that the triglycine repeat portion is nonimmunogenic , and that the globular n and c termini are antigenic .
thus we chose a polyclonal antibody with a high likelihood of binding to a wide array of collagens , since the t. erythraeum collagen is yet to be classified .
the mixture was vortexed and then centrifuged at 10,000 g for 5 min to remove any impurities .
the specimens were centrifuged for 1 min at 10,000 g and the supernatant was removed .
two hundred fifty microliters of the supernatant of the diluted primary antibody was added to each specimen .
next the specimens were vortexed and kept at 5c for 30 min . to prepare the anti - rabbit igg ( whole - molecule ) gold colloid secondary antibody ( sigma g7402 ) , 1400 l of 0.5 m nacl ( diluted from ricca chemical 7215 - 16 ) , 1.4 mg of bsa ( sigma a7030 )
, 0.7 l of tween 20 , and 70 l of fbs ( fisher scientific bw-14 - 503f ) were added to a microcentrifuge tube and vortexed .
seventy - two microliters of this solution was discarded , 100 l of secondary antibody was added , and then the mixture was vortexed .
the three specimens were centrifuged for 2 min at 13,000 rpm and the supernatant was removed .
three hundred microliters of pbs was added to t. erythraeum and e. coli and the specimens were centrifuged for 2 min at 10,000 g. the supernatant was removed , and the wash was repeated .
six hundred microliters of pbs was added to the bovine collagen and the specimen was centrifuged for 2 min at 10,000 g. the supernatant was removed , and 250 l of diluted 1000:1 secondary antibody was added to all three specimens .
the specimens were then vortexed and kept in the dark at 5c for 1 h. the specimens were centrifuged for 5 min at 10,000 g and the supernatant removed .
three hundred microliters of pbs was then added to each specimen and the samples were vortexed .
the specimens were centrifuged for 5 min at 10,000 g and the supernatant was removed .
this process was repeated two more times , for a total of three washes with pbs .
fifty microliters of pbs was added to each specimen , which were kept at 20c in the dark until imaging .
samples were imaged on a digital instruments series 3100 nanoscope in air - tapping mode with dnp - s tips ( veeco probes ) at resonance frequency ( 300 khz ) .
image sizes ranged from 153 to 500 nm , and all were sampled at a resolution of 256 256 pixels .
individual features with diameters between 2 and 15 nm were selected visually and counted in four images from each of the three samples : positive control , bovine collagen ( bc ) , negative control , e. coli ( ec ) , and the experimental samples , t. erythraeum .
homology scoring and phylogenetic tree construction to determine the likely evolutionary path of t. erythraeum collagen , we employed a blast query ( altschul et al .
1990 ; gish 2006 ; karlin and altschul 1990 ) to find homologous sequences throughout the ncbi database .
this returned approximately 8000 sequences from 547 different organisms . in order to limit the size of our tree we selected 26 collagen expressing organisms for the phylogenic tree ( table 1 ) .
sequences were chosen on the following basis : ( 1 ) their identity to the t. erythraeum sequence ( these primarily included fibrillar collagen found in vertebrates ) , ( 2 ) their environment ( for example , in the analysis we included collagen sequences from several nonvertebrate , marine - dwelling organisms such as the thermal tubeworm , riftia pachyptila , mueller s freshwater sponge , ephydatia muelleri , the hydrothermal worm , alvinella pompejana , and the common mussel , mytilus edulis ) , and ( 3 ) their physiology ( or likely phylogenetic relationship to t. erythraeum ) .
for this reason we included streptococcus equi , shrimp white spot syndrome virus , and bacillus cereus .
these three sequences , which are also intron - free , were included to examine likely divergence points of the respective sequences .
table 1collagen sequence ascession numbers and organisms used for t. erythraeum collagen phylogeny tree constructionentrez - idspecies typechainseq .
( hydrothermal worm)collagen89042783914bacillus cereus atcc 10987collagen132138649122danio rerio ( zebrafish ) type i 1144734784485danio rerio ( zebrafish)type i31449157030drosophila melanogaster ( fruit fly)type iv117751920343aephydatia muelleri ( mueller s freshwater sponge ) collagen10955921192gallus gallus ( chicken ) type i2136215546070gallus gallus ( chicken )
type ii11420124056487homo sapiens ( human ) type i 1 1464450394homo sapiens ( human ) type ii11487124056490homo sapiens ( human ) type iii1146683301500mus musculus ( house mouse ) type i 11453200215mus musculus ( house mouse ) type ii11459aab96638mytilus edulis ( common mussel ) collagen 92214164347oncorhynchus mykiss ( rainbow trout ) type i 1144914164351oncorhynchus mykiss ( rainbow trout)type i 2135614164349oncorhynchus mykiss ( rainbow trout ) type i 3145856565281paralichthys olivaceus ( bastard halibut ) type i 1144756565283paralichthys olivaceus ( bastard halibut ) type i2135282123471rana catesbeiana ( bullfrog)type i1144518202034rana catesbeiana ( bullfrog)type i21355aab24972riftia pachyptila ( thermal tubeworm)collagen102715021422shrimp white spot syndrome viruscollagen168437498968streptococcus equicollagen491cag02093tetraodon nigroviridis ( pufferfish)collagen139971671489trichodesmium erythraeum ims101 collagen1340these sequences were multiply aligned using the clustalw program ( higgins et al .
1994 ) and then refined using the treerefiner program ( manohar and batzoglou 2005 ) .
the final tree was created using the jukes - cantor ( 1969 ) method of determining evolutionary distance and then using the sequence neighbor - joining ( nj ) method ( gascuel 1997 ) as implemented in the matlab r2007a bioinformatics toolbox ( cai et al . 2005 ) .
bootstrap values were obtained from the clustalw program using the default parameters of 1000 bootstrap repetitions and are reported as percentages ( higgins et al .
1994).we used the nj method since we are comparing multiple organisms from vastly different environmental niches .
this is justified since it is likely that the selection criteria for the maintenance of the triglycine repeat region of marine cyanobacteria are as different from those for a fibrillar vertebrate collagen as are the selection criteria for afibrillar versus fibrillar collagens .
we chose the nj method rather than the unweighted pair group with arithmetic mean ( upgma ) method , since upgma only provides information about the relative order of the evolutionary path ( e.g. , wiersma et al . 2005 ) , whereas the nj method provides an estimate of evolutionary distance.finally , to test whether the triglycine region artificially forced alignment between the t. erythraeum sequence and the other sequences included in the tree construction , we ran clustalw with the glycine weight set to zero . this more rigorous approach was performed to evaluate the phylogeny purely on the nonglycine regions .
with the glycines , which comprise nearly one - third of the sequence , absent from the analysis alignment and phylogeny , tree construction is more stringent , thus making the results more compelling .
afibrillar collagens such as type iv were returned by the script but were not among the longest because of their imperfect gxy repeats .
we found that the predicted translation from the intron - free gene for the collagen - like gene found in t. erythraeum has a triglycine repeat length that is approximately 10% longer than that of any other sequenced organism ( fig . 2 ) .
present at approximately 454 repeats may represent the molecular contour length where loop assembly becomes more likely than fibril assembly , thus offering evidence as to why this length is not surpassed in nature .
the apparent lack of fibrils , combined with the lack of posttranslational modification enzymes for collagen , suggests that t. erythraeum may be using its collagen - like protein in a manner similar to the nonfibrillar basement membrane collagens , where lattice - like structures are prevalent .
2a log - linear plot of the triglycine repeats present in all of the presently sequenced collagen - gene containing organisms .
the abrupt shelf at 344 triglycine repeats may represent an optimization whereby the necessity to have a long molecule for strong , compliant tissues competes with the necessity to have a short molecule for robust self - assembly . in the labels ,
roman numerals indicate collagen types and u indicates an unclassified collagenthe shelf in the graph in fig .
2 indicates that this critical length for the collagen triple helix occurs at about 344 triglycine repeats .
the obvious outlier , t. erythraeum , at 383 triglycine repeats suggests that this shelf is created by the necessity for the contour length , l , to be less than some critical multiple of the persistence length , lp .
indeed , buehler ( 2006b ) has predicted that past a contour length of 200 nm , extra length becomes a liability .
a single collagen triple helix has a rupture force of approximately 22.5 nn ( buehler 2006a ) .
by contrast , hydrogen bonds have a rupture forces three orders of magnitude lower ( gao et al .
2002 ) , and individual cross - link rupture forces are approximately one order of magnitude lower ( sulchek et al . 2006 ) .
thus , to break a single collagen triple helix , approximately 1000 hydrogen bonds , or approximately 10 cross - links , must be present .
therefore , a single collagen triple helix with a fixed cross - sectional area that accumulates more cross - links than the covalent bonds of its triple helix can support is more likely to rupture than a shorter triple helix with fewer cross - links . from this
we conclude that there is no evolutionary advantage for individual triple helices to grow beyond a length that permits excessive accumulation of cross - links . a log - linear plot of the triglycine repeats present in all of the presently sequenced collagen - gene containing organisms .
the abrupt shelf at 344 triglycine repeats may represent an optimization whereby the necessity to have a long molecule for strong , compliant tissues competes with the necessity to have a short molecule for robust self - assembly . in the labels ,
roman numerals indicate collagen types and u indicates an unclassified collagen light microscopy under light microscopy , the rod - like appearance of t. erythraeum is apparent ( fig
its cell duplication modality is one of linear aggregation , with daughter cells being produced axially .
although maintenance of laboratory cell culture is difficult , presumably all cells under natural and laboratory conditions are capable of division ( bell et al . 2005 ) , thus a breakage along the length of the axially aggregating structure allows for accelerated growth of the colony at the newly formed ends .
scale bar = 30 m under light microscopy , the rod - like appearance of t erythraeum is apparent .
scale bar = 30 m environmental scanning electron microscopy under higher magnification using environmental scanning electron microscopy ( fig . 4 ) , the axial aggregation of the cells is clearly present .
a buttressed appearance is present , suggesting a polarity that may indicate the direction of growth . at this magnification ,
scale bar = 10 m atomic force microscopy the cell junctions seen under both light microscopy and electron microscopy are also clearly seen under air - tapping - mode atomic force microscopy ( fig .
an alternative explanation for the presence of the fibrous structures seen along the lengths of the cells is that they are the result of precipitates formed during drying onto the mica surface .
5under atomic force microscopy , boundaries separating the individual cells are readily visible . also noticeable in this sample preparation are fibrous - like structures that appear to bridge these cell junctions .
scale bar = 5 m under atomic force microscopy , boundaries separating the individual cells are readily visible . also noticeable in this sample preparation are fibrous - like structures that appear to bridge these cell junctions .
scale bar = 5 m immunogold atomic force microscopy the expression of a protein in t. erythraeum with an affinity for polyclonal collagen antibodies has not previously been reported . here , we present the first results indicating that such a protein is being expressed and is present at the cell surface .
the density of immunolabeled gold nanospheres in t. erythraeum was approximately 0.3 particle / nm .
bovine collagen , which was used as a positive control , showed a nanosphere density of approximately 0.4 particle / nm .
according to the antibody manufacturer , the specific location of reaction between the antibody and the collagens in this study is unknown .
the antibody to collagen types i v we selected is a cocktail of antibodies prepared by mixing semispecific antibodies to all these types .
rabbits were immunized with individual types but cross - response of antisera to several collagen types was typical .
all the individual collagen types were generated as native molecules separated by differential salt precipitation after extraction into mild acidic media from pepsin - digested washed tissue ( placenta , skin , cartilage ) .
the antibody reacts predominantly to native collagen ( some common determinants of five types ) but somewhat less binding was observed to heat - denatured collagen types also .
finally , the manufacturer states that the reactivity to telopeptides can not be excluded because pepsin digestion was minimal .
it is commonly held that the triglycine region of collagen is nonimmunogenic : its telopeptide region is likely responsible for antibody binding .
however , since trichodesmium erythraeum does not appear to have the posttranslational enzymes necessary to cleave its n and c termini , these are likely still present and prevent fibrillogenesis
. however , it may be that t. erythraeum s collagen - like protein still maintains some ability to self - assemble and perhaps behaves more like the basement membrane collagens , e.g. , types iv and vi .
6examples of immunogold atomic force microscopy labeling results for ( a ) bovine collagen ( bc ; positive control ) , ( b ) t. erythraeum ( te ; experimental ) , and ( c ) e. coli flagellum ( ec ; negative control ) .
7immunogold atomic force microscopy labeling results for bovine collagen ( bc ; positive control ) , t. erythraeum ( te ; experimental ) , and e. coli ( ec ; negative control ) .
* p < 0.05 , student s t - test examples of immunogold atomic force microscopy labeling results for ( a ) bovine collagen ( bc ; positive control ) , ( b ) t. erythraeum ( te ; experimental ) , and ( c ) e. coli flagellum ( ec ; negative control ) .
scale bar = 15 nm immunogold atomic force microscopy labeling results for bovine collagen ( bc ; positive control ) , t. erythraeum ( te ; experimental ) , and e. coli ( ec ; negative control ) . * p < 0.05 , student s t - test alignment the protein alignment of homo sapiens ( human ) i1 , mus musculus ( mouse ) i1 , oncorhynchus mykiss ( trout ) type i 1 , shrimp white spot syndrome virus collagen of an unclassified type , streptococcus equi collagen - like sequence , and bacillus cereus collagen - like sequence , with the predicted sequence from t. erythraeum , indicates that the identity shared with shrimp white spot virus , human , bovine , and trout is the greatest ( fig . 8) .
the long , uninterrupted triglycine repeat regions similar among humans , mouse , shrimp white spot syndrome virus , and t. erythraeum suggest the intriguing hypothesis that t. erythraeum inherited its collagen - like gene via a viral - mediated interdomain transfer . the majority of genes found in wssv share homologues with eukaryotes rather than prokaryotes ( yang et al .
2001 ) , indicating that wssv may indeed be a predominant vector for gene transfer from eukaryotes .
beginning with residue 91 for both human and bovine , residue 170 for shrimp white spot virus , and residue 2 for t. erythraeum , the triglycine repeat region runs uninterrupted for 383 gxys .
the two other prokaryotes included in the analysis , streptococcus equi and bacullis cereus , have 102 and 100 triglycine repeats , respectively .
this was primarily due to the shared identity at the n and c termini as well as the result that many of the differences between the t. erythraeum sequence and the others analyzed involved substitutions of residues with similar physiochemical properties .
8alignment of the predicted t. erythraeum collagen sequence with three vertebrates with high identity scores : homo sapiens ( human ) type i 1 , mus musculus ( mouse ) type
also included are the collagenous sequences found in shrimp white spot syndrome virus , streptococcus equi , and bacillus cereus .
numbers appearing above the sequences indicate the number of triglycine repeats alignment of the predicted t. erythraeum collagen sequence with three vertebrates with high identity scores : homo sapiens ( human ) type i 1 , mus musculus ( mouse ) type i 1 , and oncorhynchus mykiss ( trout ) type i 1 .
also included are the collagenous sequences found in shrimp white spot syndrome virus , streptococcus equi , and bacillus cereus .
numbers appearing above the sequences indicate the number of triglycine repeats phylogeny the phylogeny tree for t. erythraeum s collagen gene , in which we included several of its most similar fibrillar collagens , indicates that the acquisition of t. erythraeum s collagen - like gene occurred at a time when fibrillar and nonfibrillar collagens were diverging ( fig .
it sits at a very interesting intersection in the phylogeny tree , namely , at the junction between several invertebrates ( below ) and several vertebrates with clade a fibrillar collagens ( above ) .
also notable is that the collagen - like sequences from the prokaryotes streptococcus equi and bacillus cereus appear on more distant branches .
these sequences were included primarily just to examine where these degenerate collagen - like sequences might fall within a phylogenetic tree .
their remoteness from the fibrillar collagens included indicates an ancient divergence . near the bottom of fig .
9 is a type iv collagen , which is separated by a relatively large distance from the fibrillar collagens at the top of the figure , and is consistent with results from others who indicate that the divergence of fibrillar and afibrillar collagens is more ancient that divergences of individual fibrillar collagens ( e.g. , aouacheria et al .
( aouacheria et al . 2006 ) since the tree structure was not affected by gaps , and tree - branch lengths represent approximations for divergence times , the placement of the divergence time of t. erythraeum s collagen - like gene from that of its closest neighbors such as thermal worms and swssv , indicates that the collagen - like gene of t. erythraeum had a common ancestor that predates modern vertebrates , but that it may have inherited its collagen - like gene from a now extinct vertebrate .
the tree that resulted from the unweighted glycine analysis showed no difference in divergence order , and only slight differences in divergence times .
9evolutionary distance between the collagen gene(s ) found in t. erythraeum and the collagen genes in several disparate organisms .
scale bar = 0.1 substitution per site evolutionary distance between the collagen gene(s ) found in t. erythraeum and the collagen genes in several disparate organisms .
we have provided the first evidence that the collagen - like gene in the marine cyanobacterium t. erythraeum is expressed and present on the cell surface .
we have also provided theoretical evidence that the collagen translation length may be determined by competing metrics of strength and self - assembly .
phylogenetic analysis indicates that the collagen - like gene appeared in this organism after the divergence of fibrillar and afibrillar collagens , but before the divergence of the fibrillar collagens . finally , we argue that the maintenance of this gene within the genome of t. erythraeum provides it with a selective advantage in that it allows aggregations that enable it to prey on larger organisms through concentration of its neurotoxin and through mechanical gill - clogging mechanisms .
theoretical the triglycine portion of the collagen gene transcript appears to have reached an evolutionary ledge at approximately 340 gxy .
this ledge likely appears at this specific length for two reasons : ( 1 ) if it were to become longer , this would represent a liability for self - assembly ; and ( 2 ) a longer triple helix would not necessarily increase fibril strength , as additional length would allow the possibility of additional cross - links and hydrogen bonds to accumulate along its length in excess of what the covalent bonds of the triple helix itself can support.long collagen transcripts are driven by the need for a sufficient number of cross - links to develop between a single triple helix and its approximately 24 neighboring triple helices through hydrogen bonding and hydroxyproline - lysine cross - links .
however , the need to self - assemble keeps the collagen molecule from becoming too long so that self - interaction prior to fibrillogenesis is less likely .
the persistence length / contour length ratio has recently been discussed , but not systematically studied to determine the likelihood of self - interaction ( buehler 2006a).in rope building , long subfibers are clearly an asset for developing great tensile strength .
shear lag theory ( weitsman and beltzer 1992 ) states that the tensile force within a subcomponent of a tension member is proportional to the amount of shear stress developed within it .
this theory remains valid for the molecular scale within and among individual collagen triple helices : the ratio between the sum of the strength of collagen s cross - links and that of the triple helix itself determines its success or failure as an effective molecular rope .
adding additional binding sites along a triple helix might overwhelm the bond strength along a single triple helix ( buehler 2006b ) .
experimental we have provided the first evidence that the abnormally long triglycine repeat within the collagen - like gene of t. erythraeum is being expressed .
the collagen of t. erythraeum , which shares a great deal of identity with the clade a fibrillar collagens of large vertebrates , apparently does not form fibrils .
other discoveries of superlong collagen molecules from the cuticle of marine tube worms and annelids ( gaill et al .
1991 ) , interpreted from histograms taken from rotary - shadowed tem images , indicate that there may be collagen molecules up to 2.4 m in length .
however , since this publication , the full collagen sequence data for the two organisms riftia pachyptila and alvinella pompejana , from which these samples were taken , indicate that their collagen protein sequences are substantially shorter : 1027 and 890 , respectively .
( 1991 ) indicated that these two marine organisms do have massive collagens and that banded fibrils are present in the cuticle and interstitial tissues of both .
however , the possibility exists that the molecular lengths measured by gaill et al .
were fibril fragments rather than individual triple helices.the lack of fibrils present in our samples indicates that although the collagen - like sequence of t. erythraeum shares a great degree of identity with the clade a fibrillar collagens , the lack of posttranslational enzymes required for n- and c - terminal cleavage prevents fibrillogenesis .
clearly further work is required to determine if the n termini of the t. erythraeum collagens are capable of performing the trimerizing required to initiate tropocollagen formation .
bioinformatic there are multiple alternatives for the origin of the collagen - like gene of t. erythraeum .
one possibility is that it acquired its collagen - like gene intron - free through a horizontal transfer at a time when large vertebrates were prevalent , during the devonian or silurian epochs .
the second alternative is that it evolved from a shorter prokaryotic version of the protein via repeat expansion .
the relative likelihood of these two alternatives may be evaluated through more exhaustive phylogenetic analyses once additional sequence data become available from a greater number of organisms .
( 2004 ) ( nakamura et al . 2004 ) found , in analyzing whole genomes of 116 prokaryotes , that 14% of open reading frames were subjected to recent horizontal gene transfer .
the most frequently transferred genes were those related to cell surface function , dna binding , and pathogenicity.support for the former alternative is that shrimp white spot syndrome virus also carries a long , intron - free collagen sequence , with a length of 5054 bp ( van hulten et al .
. lateral gene transfer from within a given species , from organelles to the nucleus , is a commonly observed occurrence ( e.g. , adams et al .
1999 ) and has been used to estimate the amount of time organelles such as mitochondria have inhabited eukaryotic cells ( parkinson et al .
recently , lateral gene transfer has also been observed and discussed among prokaryotes , p p , among eukaryotes , e e , from prokaryotes to eukaryotes , p e , and , recently , from eukaryotes to prokaryotes , e p ( jenkins et al . 2002 ) . an e p event , however , might help explain why the gene for an extracellular matrix protein typically associated with vertebrates or multicellular metazoans might have found its way into contemporary prokaryotes through an event such as viral infection or naked dna transfer . if this occurred in t. erythraeum , it may have happend via a spliced mrna intermediate as discussed by andersson ( 2005 ) .
the lability of exposed rna makes this less likely , but the abundance of introns in eukaryotic collagen dna ( 50 for human type i i ) and the lack thereof in t. erythraeum make it likely that the infectious agent path is the only way for interdomain transfer to have occurred ( e.g. , davis 2002 ) .
another alternative is that this event occurred via a viral transfection event as mentioned by gogarten ( 2003 ) .
the ecological relationships among viral phages and prokaryotes is vast and complex and may offer a viable explanation as to how this particular collagen - like gene entered the prokaryotic genome ( weinbauer 2004).regarding the second alternative , namely , that the origin of trichodesmium erythraeum s collagen - like gene was from a repeat expansion mechanism , the probability of this happening compared to the probability of transfection is difficult to estimate , but is presumably less involved and more probable in an organism with a plasmid - based dna instruction set .
similar hypotheses have been put forth as an explanation for the large variety of collagen genes currently observed naturally ( boot - handford and tuckwell 2003).the primary argument against our contention that the collagen - like gene found in t. erythraeum was inherited through horizontal gene transfer is that two vertebrate species such as human vs. fish ( trout ) sequences are nearly identical , whereas less identity is shared between t. erythraeum and any of the three vertebrates in fig . 8 . more specifically ,
400 million years of evolution between two vertebrates such as trout and human has not greatly changed the amino acid sequence of the repeat region . however , with a few notable exceptions , such as the approximately 15% identity in the c terminus , and a few tenuous identities in the n terminus , the nonglycine residues of t. erythraeum within the triglycine region appear to share little identity with those of the vertebrates .
why , then , should t. erythraeum maintain such a long , interrupted , intron - free collagen - like sequence in its genome ?
this may be partially explained as follows : the fibrillar and afibrillar collagens have diverged to a much greater extent within individual species than , for example , human type i collagen and trout type i collagen have .
thus it is not merely the presence of a perfectly uninterrupted triglycine repeat region , but also the preservation of other critical residues such as prolines and lysines that make triple - helix formation and fibrillogenesis possible .
this is reasonable since greater selective pressure is placed on organisms that rely on perfect triglycine repeats and their associated cross - bridge - forming lysines and rotationally stiff prolines to maintain fibril - forming collagens .
indeed , fibril formation confers a selective advantage : osteogenesis imperfecta . in an organism such as t. erythraeum that apparently does not form fibrils , but does apparently rely on its collagen - like protein for survival , the maintenance of the identity of its second and third residues is likely not critical , whereas the maintenance of its triglycine repeat appears to be especially valued .
ecological based on prior satellite imagery and our own evidence of filamentous structures found in unlabeled atomic - force microscopy preparations , we have presented evidence suggesting that this filamentous type of collagen might be a mat - forming matrix similar to other afibrillar collagens .
a gene does not long remain within a genome unless it is serving the purpose of increasing organism ( and gene ) survivability ( dawkins 1989 ) .
any excessive genes that do not contribute to fitness are quickly eliminated from the genome ( pal et al .
we suggest that the remarkably long collagen - like protein found in t. erythraeum confers a selective advantage to its host organism by enabling it to maintain large colonies that give it the selective advantage of concentrating its secreted toxin ( cox et al .
2005 ; wolk 1973 ) , thus potentially enriching its available food supply.early in life s history , when there were no multicellular organisms , organic energy supplies were likely scarce and diffuse .
in this environment , it would likely have been to a single - celled organism s advantage to diffuse or actively move away from its neighbors to reduce competition for resources .
however , if a large , swimming energy source were present , the ability to colonize might prove to be advantageous ( burchard 1981 ; martin 2002 ) . a single bacterium attempting to intoxicate and kill an organism in the ocean would have little chance of success .
but if colonization were to be made possible by the inclusion of an extracellular matrix protein , and large volumes and high concentrations of toxin could be produced , a larger food source might be killed and used as a food source . this purported selective advantage to colonize in a community that lacks signaling and
this extraordinarily long collagen - like triglycine sequence may have provided this early glue , effectively creating the earth s first fishing net.while other collagen fragments appear in bacteria such as bacillus cereus , these are likely used to attach to host extracellular matrix rather than for colonization purposes .
indeed , no other marine species of prokaryote has been shown to colonize to the extensive degree that t. erythraeum does .
this cooperative nature of a group of primitive cells may even provide clues as to the origins of multicellular primitive organisms such as the hydra and sponges.interestingly , the triglycine repeat motif of collagen shares similar characteristics with two diseases : fragile x syndrome ( fu et al .
genes responsible for both of these diseases cause the repeat of either a single amino acid or a triad of amino acids . while the molecular machinery that enables the gene stuttering necessary for producing collagen , the glue of multicellular life
Output:
| two competing effects at two vastly different scales may explain collagen s current translation length .
the necessity to have long molecules for maintaining mechanical integrity at the organism and supraorganism scales may be limited by the need to have small molecules capable of robust self - assembly at the nanoscale .
the triglycine repeat regions of all 556 currently cataloged organisms with collagen - like genes were ranked by length .
this revealed a sharp boundary in the gxy transcript number at 1032 amino acids ( 344 gxy repeats ) .
an anomalous exception , however , is the intron - free trichodesmium erythraeum collagen gene .
immunogold atomic force microscopy reveals , for the first time , the presence of a collagen - like protein in t. erythraeum . a phylogenetic protein sequence analysis which includes vertebrates , nonvertebrates , shrimp white spot syndrome virus , streptococcus equi , and
bacillus cereus predicts that the collagen - like sequence may have emerged shortly after the divergence of fibrillar and nonfibrillar collagens .
the presence of this anomalously long collagen gene within a prokaryote may represent an interdomain transfer from eukaryotes into prokaryotes that gives t. erythraeum the ability to form blooms that cover hundreds of square kilometers of ocean .
we propose that the collagen gene entered the prokaryote intron - free only after it had been molded by years of mechanical selective pressure in larger organisms and only after large , dense food sources such as marine vertebrates became available .
this anomalously long collagen - like sequence may explain t. erythraeum s ability to aggregate and thus concentrate its toxin for food - source procurement.electronic supplementary materialthe online version of this article ( doi:10.1007/s00239 - 008 - 9111 - 7 ) contains supplementary material , which is available to authorized users . |
PubmedSumm118473 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: neurofibromatosis type 1 ( nf1 , also known as von recklinghausen disease ) is one of the most common autosomal - dominant genetic disorders with many associated ocular findings / disorders , most typically lisch nodules , retinal / choroidal hamartomas , congenital glaucoma , and optic pathway gliomas [ 1 , 2 , 3 ] . nf1
may also be associated with other various ocular abnormalities [ 1 , 2 , 3 ] including , rarely , retinal ischemia or anterior scleral staphyloma .
the staphyloma had been missed during repeated previous examinations by ophthalmologists and was eventually found by the patient himself .
a 38-year - old man noticed a lump under his left eyebrow after palpation with his finger .
he had been diagnosed with unilateral high myopia ( left eye ) as a child , and was seen yearly by an ophthalmologist .
he had no difficultly with vision in the right eye , and therefore did not wear refractive correction . however , this time , investigation of the lump led an ophthalmologist to identify a principal lesion in his left eye .
1a ) ; however , when the top lid was pulled up on downward gaze , a dark brown bulge emerged ( fig .
the bulge was 10 mm circumferentially , 7 mm radially , and approximately 4 mm in height , and covered by the extended superior rectus muscle ( fig .
the proximal end corresponded to the insertion of the superior rectus muscle , approximately 8 mm away from the limbus ; the distance had probably previously hindered detection of the lesion at examinations .
the pupil in the left eye was shifted upward , and the iris ectropion was observed on the upper pupillary border ( fig .
iris pattern was absent and multiple subtle protuberances were scattered on the pupillary border without apparent nodules .
the diagnosis of equatorial staphyloma was made based on coronal t1-weighted magnetic resonance imaging of the orbit showing dilatation of the vitreous cavity ( fig .
visual acuity was 20/15 in the right eye without correction and 20/25 in the left eye with 10.00 spheres and 4.00 80 degrees cylinders , and the intraocular pressure was 15 mm hg in both eyes .
his past and family medical histories were unremarkable ; his only ailment was myopia in the left eye , and none of his relatives had a known inheritable disease . however , small neurofibromas and caf au lait spots all over his body led to the diagnosis of nf1 .
the staphyloma was adjacent to the cornea , and easily to be found on a 28-year - old woman with neurofibromas , caf au lait spots , scoliosis , and intellectual disability .
they did not find a precedent report of staphyloma in nf1 and , thus , mentioned that the association between staphyloma and nf1 might be a coincidence .
however , they also speculated that the staphyloma might share a similar pathogenetic mechanism as the absence of the greater wing of the sphenoid or orbital roof reported in nf1 , as regional scleral dysplasia is associated with staphyloma .
nf1 is caused by a defect in the nf1 gene located on the long arm of chromosome 17 at position 17q11.2 , that encodes a 2,818-amino acid protein , neurofibromin 1 [ 1 , 2 , 3 ] .
neurofibromin 1 is a complicated protein with multiple functions involved in the regulation of cellular proliferation .
it works as a tumor suppressor ; thus , its absence leads to abnormal cellular proliferation [ 1 , 2 , 3 ] . besides causing various tumors
, nf1 may indicate organ dysplasia [ 1 , 3 ] , although the pathogenesis is not fully explained .
chen et al . reported a case of anophthalmia ( absent of the whole globe from the orbit ) in a 27-year - old woman with nf1 .
similar to kremer and gaton , they also hypothesized that anophthalmia may have been a coincidence finding .
in addition , we admit the possibility of coincidence ; however , we still postulate that both staphyloma and anophthalmia could be caused by eyeball dysplasia , a rate phenotype of nf1 .
either way , the previous reports [ 5 , 6 ] and unusual staphyloma in this case epitomized the manifestations associated with nf1 , which are extremely variable and unpredictable [ 1 , 2 , 3 , 4 , 5 , 6 ] .
Output:
| we report a case of a 38-year - old man who presented with a recently self - detected lump under his left eyebrow . previous ophthalmological history was unremarkable except for unilateral high myopia ( left eye ) since childhood .
the appearance of the left eye was seemingly normal ; however , with the top lid pulled up on downward gaze , a dark brown bulge emerged .
the bulge was 10 7 mm and approximately 4 mm in height , and was covered by the extended superior rectus muscle .
the diagnosis of equatorial staphyloma was made after coronal t1-weighted magnetic resonance imaging of the orbit revealed the dilatation of the vitreous cavity .
ocular movements were fully maintained and visual acuity was largely spared : 20/15 in the right eye without correction and 20/25 in the left eye with 10.00 spheres and 4.00 80 degrees cylinders . his past and family histories were unremarkable ; however , small neurofibromas and caf au lait spots all over his body led to the diagnosis of neurofibromatosis type 1 ( nf1 ) . from this case ,
similar to previous reports , we suggest that manifestations of nf1 are extremely variable and unpredictable . |
PubmedSumm118474 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a 65-year - old man with chronic depression and diabetes mellitus of 25 years and 15 years duration , respectively , presented to us with decrease in vision in both eyes .
he was on insulin injections for diabetes mellitus and oral imipramine ( 25 mg twice daily ) for depression over the previous 25 years .
preoperatively , the pupil dilated to 6.0 mm . during the phacoemulsification procedure , characteristics of ifis developed : iris stroma was flaccid , which undulated , billowed , and prolapsed through the main and side incisions , and progressive miosis occurred .
intracameral adrenaline was injected , however the miosis and floppy iris did not improve appreciably .
the phacoemulsification procedure was completed and intraocular lens was successfully implanted into the capsular bag . a 60-year - old man presented for painless progressive decrease in vision in both eyes .
he gave a history of being on antidepressant , imipramine therapy ( 25 mg once daily ) for 10 months , which he stopped 4 months prior to undergoing surgery .
partial ifis characteristics developed i.e. progressive miosis occurred and iris undulated , however there was no iris prolapse through the corneal incisions .
intracameral adrenaline was used , however iris hooks had to be resorted to as pupillary size decreased to 3 mm and intracameral adrenaline did not appreciably decrease the ifis features .
the phacoemulsification procedure was completed and intraocular lens was successfully implanted into the capsular bag . a 58-year - old man presented to us for painless progressive decrease in vision in both eyes .
he also had a history of depression , for which he was on oral imipramine ( 25 mg once daily ) for a year . however , he had discontinued imipramine 2 months prior to presentation .
the phacoemulsification procedure was completed and intraocular lens was successfully implanted into the capsular bag .
the cataract surgery could be completed without any intra - operative complication and postoperative vision was 20/20 in all the three patients .
a 65-year - old man with chronic depression and diabetes mellitus of 25 years and 15 years duration , respectively , presented to us with decrease in vision in both eyes .
he was on insulin injections for diabetes mellitus and oral imipramine ( 25 mg twice daily ) for depression over the previous 25 years .
preoperatively , the pupil dilated to 6.0 mm . during the phacoemulsification procedure , characteristics of ifis developed : iris stroma was flaccid , which undulated , billowed , and prolapsed through the main and side incisions , and progressive miosis occurred .
intracameral adrenaline was injected , however the miosis and floppy iris did not improve appreciably .
the phacoemulsification procedure was completed and intraocular lens was successfully implanted into the capsular bag .
a 60-year - old man presented for painless progressive decrease in vision in both eyes .
he gave a history of being on antidepressant , imipramine therapy ( 25 mg once daily ) for 10 months , which he stopped 4 months prior to undergoing surgery .
preoperatively , the pupil dilated to 5.0 mm . during the phacoemulsification procedure , partial ifis characteristics developed i.e. progressive miosis occurred and iris undulated , however there was no iris prolapse through the corneal incisions .
intracameral adrenaline was used , however iris hooks had to be resorted to as pupillary size decreased to 3 mm and intracameral adrenaline did not appreciably decrease the ifis features .
the phacoemulsification procedure was completed and intraocular lens was successfully implanted into the capsular bag .
a 58-year - old man presented to us for painless progressive decrease in vision in both eyes .
he also had a history of depression , for which he was on oral imipramine ( 25 mg once daily ) for a year . however , he had discontinued imipramine 2 months prior to presentation .
the phacoemulsification procedure was completed and intraocular lens was successfully implanted into the capsular bag .
the cataract surgery could be completed without any intra - operative complication and postoperative vision was 20/20 in all the three patients .
it is suggested that tamsulosin and other -1 ar - blocking agents cause blockage of the -1 ar in the dilator muscle of the iris .
-this prevents the iris from dilating and on their long - term use results in disuse atrophy of iris stroma leading to the loss of iris tonicity .
this bestows floppy nature to the iris and causes iris billowing and prolapse through the incision .
intracameral adrenaline has been used successfully to achieve intraoperative dilation of the pupil as well as to increase the tonicity of iris .
this consequently reduces the billowing and prolapse of the iris . however , intracameral adrenaline was ineffective in all of our cases .
alternatively , the iris hooks or iris rings can be used successfully to mechanically stretch the pupil and hold the iris .
we used iris hooks in two of our patients and found them to be very effective in allowing us to continue with phacoemulsification .
imipramine continues to be one of the commonly used antidepressant drugs despite its well - documented adverse effects .
this is especially seen in developing countries , where the cost of the drugs is important .
imipramine has antagonistic effects on -1 ars and agonist at serotonin 5-ht2 receptors , and dopamine d1 and d2 receptors .
its -1 ars blocking activity is very prominent , and is responsible for some of the side effects including orthostatic hypotension and high - resting pulse rates .
imipramine leads to chronic blockage of -1 ars of pupillary dilator muscle , which might result in atrophy of the iris stroma and hence can lead to the occurrence of ifis .
our first patient was on imipramine for a long time over the previous 25 years but the other two patients were on imipramine for 10 months and 1 year , respectively . since , this is the first report describing the occurrence of ifis with imipramine , we can not be sure of the duration of imipramine therapy required for ifis .
the first patient had diabetes mellitus and was on regular insulin therapy over the previous 15 years while the third patient was hypertensive and was on regular amlodipine therapy for the past 8 years .
the manifestations of ifis with 1-ar blocking agents can occur within weeks of their first usage and on the other hand , it may occur even years after cessation of adrenergic antagonist therapy .
this is probably due to the atrophy of the dilator muscle caused due to the chronic usage of the drug , although complex signaling pathways might be involved .
the latter might be the reason for having occasional occurrence of ifis after a short course of the incriminated drug .
thus cessation of therapy prior to undergoing cataract surgery is not recommended . in our series of patients , despite discontinuation of imipramine therapy , two of our patients had manifestations of ifis .
tamsulosin is highly selective for the 1a adrenoreceptors and hence has very high propensity to cause ifis . on the other hand ,
non - selective adrenoreceptor antagonists like terazosin , prazosin doxazosin , alfuzosin are also incriminated in the causation of ifis , although to a much lesser extent and may exhibit only partly ifis features .
this was also seen in our second patient , where partial ifis features were present .
ugarte et al . , reported ifis in a patient on mianserin for 20 years .
fine et al . , reported the occurrence of ifis in a patient on a dopamine agonist , ropinirole , however the duration of therapy is not mentioned .
ugarte et al . , in their report did not consider the dopamine agonist activity as contributing factor towards ifis .
we speculate that the dopamine agonist activity can also have a contributing role in the occurrence of ifis , although further research is required to be certain .
diseases like diabetes mellitus and hypertension were thought to have a contributory or causative effect role in ifis , however subsequent studies failed to prove any causative or contributory of either of the diseases in ifis conclusively .
only our first patient was on imipramine at the time of surgery , while other two patients had stopped imipramine 4 months and 2 months prior to cataract surgery , respectively .
thus , longer the duration of discontinuation of the drug prior to undergoing cataract surgery , milder should be the features of ifis . since , this is an anecdotal report , conclusions can not be drawn based on this report and further research is required to conclusively prove the duration of discontinuation of imipramine required to completely abate the manifestations of ifis , if at all .
in conclusion , although there is a possible association between ifis and oral imipramine therapy , it can not be established based on this case series .
this report envisages in making operating surgeons aware of this possible association and thus they can safeguard against ifis and reduce intra - operative complications due to ifis .
Output:
| intraoperative floppy iris syndrome ( ifis ) has commonly been seen with long - term use of 1-adrenoceptor blocking agents .
we observed ifis in three patients during phacoemulsification due to oral imipramine therapy .
the three patients took imipramine for 25 years , 10 months and 1 year , respectively .
however , only the first patient was on oral therapy at the time of surgery , while the other two patients had stopped 4 months and 2 months prior to undergoing phacoemulsification .
the first and third patients developed complete ifis features , while the second had only partial ifis characteristics .
phacoemulsification could be completed in all three patients without any complication .
none of these patients had history of taking any of the 1-adrenoceptor blocking agents .
this is the first anecdotal report of ifis with the oral use of imipramine and hence further evidences are required to ascertain the association of oral imipramine therapy and ifis .
however , ophthalmologists undertaking phacoemulsification on patients on imipramine therapy should be alert for the occurrence of ifis . |
PubmedSumm118475 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: infectious bronchitis virus ( ibv ) is a positive sense single - stranded rna virus , belonging to the genus coronavirus , group 3 ( gamma coronaviruses ) .
infectious bronchitis virus is not only an important pathogen of the respiratory system , but also can be nephropathogenic and cause infection of the reproductive system [ 24 ] .
ibv was first recognised as avian respiratory pathogen in 1930 , after that many ibv vaccines were introduced to tackle this problem ( h52 , h120 , m41 , 4/91(793/b ) , and other strains ) .
recently , different ibv variants have emerged causing nephropathogenic and reproductive problems which require a dramatic change in vaccination programmes [ 5 , 6 ] .
this strain was first implicated in proventriculitis in chickens , but in recent studies , this strain has been isolated from the trachea of infected chickens .
ck / ch / ldl/97i strain accounts for 3.2% of total ibv strains found in china in the last 15 years .
the spike glycoprotein gene is the most variable gene in the ibv genome and is composed of s1 and s2 subunits .
the s1 protein is highly variable ; it can differ from 20% to 25% and even up to 50% in the amino acid sequence among ibv serotypes .
this variability makes the s1 gene an ideal target in molecular assays to type ibv strains by rt - pcr and sequencing .
the level of homology of the s1 subunit or part of it can predict cross - protection , that is , the higher the homology , the higher the chance of cross - protection [ 12 , 13 ] , but this rule is not always fulfilled .
heterologous protection against the ck / ch / ldl/97i strain has not been achieved , since the nucleotide and amino acid homology of the ck / ch / ldl/97i s1 gene is only around 79% compared to the ibv vaccine strains .
only homologous protection has been achieved against ck / ch / ldl/97i . in the middle east , the common circulating ibv strains are mass serotype vaccine isolates , h120 serotype vaccine isolates , d274 , ibv variant 1 strains ( 793/b , is/222/96 , is/251/96 , and is/64714/96 ) , and variant 2 strains ( is/223/96 , is/572/98 , is/585/98 , and is/589/98 ) , along with other unique strains like is/885/00 and the egypt / beni - seuf/01 strain found in egypt . by the end of 2009 , variant 2 and variant
2-like strains appeared in jordan ( unpublished data ) and in northern iraq ( sul/01/09 ) . in the early months of 2011 we noticed ibv outbreaks in spite of massive vaccination , this was due to the presence of a new strain of ibv . in this study , we documented the presence of the ibv strain ck / ch / ldl/97i for the first time in three middle eastern countries .
trachea , kidney , ovarian tissues , and cecal tonsils samples were collected from suspected ibv outbreaks in iraq , jordan , and saudi arabia .
these samples were stored at 70c in rnalater solution ( qiagen , germany ) until rna extraction was performed .
homogenised tissues were subjected to viral rna extraction using the viral gene - spin viral dna / rna extraction kit ( intron biotechnology , korea ) .
the reverse - transcription ( rt ) step was performed using an rt system ( promega , usa ) .
briefly , viral rna was denatured at 70c for 10 minutes , followed by the addition of a reaction mix including 4 l mgcl2 , 2 l reverse transcription 10x buffer , 2 l dntp mixture ( 10 mm ) , 0.5 l random primers , 0.75 l amv reverse transcriptase enzyme , 1 g rna , and nuclease - free water to a final volume of 20 l .
then , the reaction was incubated at 42c for 60 minutes , then 94c for 5 minutes .
the cdna was diluted up to 100 l with nuclease - free water for pcr amplification .
first , a diagnostic - nested rt - pcr assay based on the amplification of the nucleocapsid ( n ) gene .
ibv - specific oligonucleotides for the n gene were obtained according to a published primers sequences ; the ibv primers sequences are presented in table 1 . the diagnostic n gene amplification was done in a final volume of 25 l gotaq green master mix ( promega , usa ) in which the final concentration of the n gene primers was 0.5 mmol .
rt - pcr amplification was performed with a thermal profile of 94c for 45 sec , 60c ( first step ) and 53c ( second step ) for 1 min and 72c for 2 min for 40 cycles .
next , a phylogenetic rt - pcr was performed using nested spike gene primers according to published protocols [ 4 , 18 ] .
the amplification profile was the same as that used for n gene - nested rt - pcr , but the annealing temperature for both rt - pcr steps was 50c .
nested s1 gene rt - pcr products were sequenced using an abi prism 310 genetic analyser at the princess haya biotechnology centre ( jordan university of science and technology , jordan ) .
maximum likelihood ( ml ) phylogenetic analysis with bootstrap values for n = 100 replicates was performed using the phyml phylogenetic interface .
the nucleotide sequence identities were prepared using clustal w in the megalign programme of the lasergene software .
two ibv isolates were from jordan ( joa2 and joa4 ) , two were from saudi arabia ( saudi-1 and saudi-2 ) , and one isolate was from iraq ( iraqi ibv ) .
the jordanian isolates were isolated from layer farms at their peak of egg production , the saudi strains were obtained from broilers and the iraqi ibv isolate was obtained from a breeder farm as shown in table 2 . according to the clinical and gross examination coupled with the rt - pcr results from the different tissues ( trachea , kidney , ovarian tissues , and cecal tonsils ) , these isolates had an extensive tissue tropism , different than the ck / ch / ldl/97i strain , which has tropism only for the respiratory system .
the clinical signs ranged from respiratory to reproductive symptoms ; two isolates ( joa2 , iraqi ibv ) were implicated in kidney pathology in affected birds .
rt - pcr products of the diagnostic n gene assay were detected ( 380 bp ) and for the phylogenetic s1 gene ( 392 bp ) .
direct - automated sequencing of the second rt - pcr product of nested s1 ( sx3 and sx4 primers ) was performed .
the reference ibv strains included in the s1 sequence analysis from the united states were m41 , connecticut , del072 , ark/15c/96 , and beaudette .
the chinese strains were ibv lx4 , qx ibv , j2 , q1 , ck / ch / ldl/97i , and ck / ch / scya/10i
. middle eastern ibv strains were is/1201 , is/1366 , is/1464 , is/885 , variant 1 , variant 2 , and sul/01/09 as shown in table 3 .
all five ibv isolates ( joa2 , joa4 , saudi-1 , saudi-2 , and iraqi ibv ) were found to be of the ibv strain ck / ch / ldl/97i and therefore they are ck / ch / ldl/97i - like strains . the ck / ch / ldl/97i strain is known to be endemic in china and taiwan . the nucleotide identity between these five ibv isolates ranged from 96.9 to 99.7% with the saudi-2 isolate being the most divergent .
the identity of relatedness between the isolated ibv strains , ck / ch / ldl/97i , and the related strain ck / ch / scya/10i is shown in table 4 .
the jordanian ibv isolate ( joa2 ) had a nucleotide identity of 98.1% and 99.4% to the ck / ch / ldl/97i and ck / ch / scya/10i strains , respectively .
for the isolate joa4 , it had 98.8% and 99.7% nucleotide identity to the ck / ch / ldl/97i and ck / ch / scya/10i strains , respectively .
the saudi ibv isolates had a unique feature , in which isolated saudi-1 shared 99.1% and 100% nucleotide identity to the ck / ch / ldl/97i and ck / ch / scya/10i strains , respectively , while the saudi-2 had only 96.6% and 97.5% nucleotide identity to the ck / ch / ldl/97i and ck / ch / scya/10i strains , respectively .
the iraqi ibv isolate shared 98.8% and 99.7% nucleotide identity to the ck / ch / ldl/97i and ck / ch / scya/10i strains , respectively .
the five ibv isolates were aligned with other reference and related ibv strains as shown in figure 1 .
it showed that all five ibv isolates were grouped with ck / ch / ldl/97i , ck / ch / scya/10i , j2 , and q1 ( both j2 and q1 were isolated from the proventriculus ) in one group .
the nucleotide identity of these five isolates to the ibv vaccine strains in the three countries ( m41 , h120 , and 4/91 ) were in the range of 7882.1% , to variant 1 ibv strains in the range of 78.981.5% , to variant 2 ibv strains in the range of 81.783.6% , and to the is/885 and sul/01/09 strains in the range of 78.380.9% ( data not shown ) .
also , these ibv isolates represent a group distinct from the lx4 ibv type and from qxibv and is/1201 ( a middle eastern strain ) related to it .
the lowest nucleotide identity was seen with the del072 strain ( 58% ) and with the n1/88 strains ( 63% ) from australia .
in this study , the ck / ch / ldl/97i - like strains were isolated from three different middle eastern countries ( jordan , saudi arabia , and iraq ) in 2011 .
the ck / ch / ldl/97i - like strains were isolated from broilers in saudi arabia , layers in jordan , and from breeders in iraq . the ck / ch / ldl/97i - like strain
the ibv ck / ch / ldl/97i strains showed slight variability in the partial s1 sequence among ibv isolates from these three countries .
the mode transmission of this strain from china to the middle east is not clear ; one reason might be that chinese poultry vaccines and products have recently been registered and used in the middle east .
all isolates came from flocks vaccinated with mass - type h120 , and 4/91 vaccines , which implies insufficient protection against these isolates .
the poor relationship in the partial s1 sequence between the five ibv isolates and the vaccine strains ( average nucleotide identity of 80% ) could explain the failure of the mass 41 , h120 , and 4/91 vaccination programmes to control ibv in these flocks .
there is no solution to tackle infection coming from these five ibv isolates except to make a homologous vaccine against this strain .
homologous vaccine was made for the ibv , ck / ch / ldl/97i strain found in china , for ibv qx strain and a nephropathogenic ibv strain in korea [ 7 , 21 , 22 ] . in summary , this is the first paper indicting the presence of the ibv ck / ch / ldl/97i strain outside mainland china and taiwan ( in three middle eastern countries ) . in the near future
, we expect that this strain might represent a serious problem for the poultry industry and there will be an urgent need to develop a homologous vaccine against this strain .
Output:
| infectious bronchitis virus ( ibv ) is a very dynamic and evolving virus , causing major economic losses to the global poultry industry . in early 2011
, respiratory disease outbreaks were investigated in iraq , jordan , and saudi arabia .
five ibv isolates ( joa2 , joa4 , saudi-1 , saudi-2 , and iraqi ibv ) were detected by diagnostic - nested nucleocapsid rt - pcr .
strain identification was characterised by sequencing and phylogenetic analysis of the amplified hypervariable region of the spike 1 ( s1 ) gene .
these five ibv isolates were found to be of the ibv strain ck / ch / ldl/97i .
nucleotide identity between these five ibv isolates ranged from 96.9% to 99.7% , and between these isolates and the ck / ch / ldl/97i strain in the range of 96.699.1% .
the sequenced fragment of the s1 gene of the ck / ch / ldl/97i strain had less than 80% nucleotide identity to the ibv vaccine strains commonly used in the middle east ( m41 and h120 ) .
the presence of these ck / ch / ldl/97i - like strains may account for vaccination failure against ibv , since all ibv isolates were from vaccinated chickens . in this paper
, we documented for the first time the presence of ibv strain ck / ch / ldl/97i in the middle east .
this strain is known to have originated in china and taiwan . |
PubmedSumm118476 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the aging of japan shows no sign of slowing down . the statistics bureau of the japanese
ministry of internal affairs and communications estimates that there are 31,898,000 elderly
people aged 65 years old or older ( final estimate based on the preliminary count as of
october 2013 ) , accounting for 25.1% of japan s total population .
the population aging rate
was 22.7% in 2012 ; there is now more than one elderly person among every four persons1 . according to the interim report on the
long - term care ( ltc ) insurance projects issued by the ministry of health , labour and welfare
in december 2013 , 5,800,000 people are certified as requiring long - term care2 .
such rapid population aging and the
accompanying increase in elderly people requiring long - term care and assistance are becoming
social issues .
effective use of assistive products helps home - bound elderly disabled persons
to rebuild their lives , expand the range of their activities , and participate more in
society . in order to use assistive products effectively , users must acquire appropriate
knowledge and techniques , and in order to effectively improve the daily lives of the
home - bound elderly disabled , appropriate equipment and devices must be introduced .
few studies ,
however , have reported on the roles pts play in introducing such products4 , 5 .
therefore , we conducted a questionnaire survey to discover how pts participate in
introducing assistive products and the problems they experience when doing so and examined
how their participation can be more effective .
a questionnaire on introducing assistive products was given to pts working at randomly
selected hospitals , health - care facilities for the elderly requiring long - term care ,
home - visit nursing stations , and other such facilities and to pts providing physical therapy
directly to the home - bound elderly disabled .
the questions about their duration of included clinical experience as pts , awareness of
systems for introducing assistive products , and whether and how they handled introducing
assistive products . for clinical experience duration
, the subjects were divided into two groups : one with less
than ten years of clinical experience and the other with ten or more years .
based on the awareness of systems for introducing assistive products , we divided the
subjects into two groups : high and low awareness .
the high awareness group was well aware
of , or sufficiently aware of , social welfare measures for the elderly ( benefits for daily
life equipment )
, purchase of assistive products based on the long - term care insurance
act , and rental of assistive products based on the long - term care insurance act , and the
low awareness group was marginally aware of , not well aware of , or unaware of such
systems .
concerning the subjects introduction of assistive products , we asked about their
experience , trials and fittings , and follow - ups after introduction . for their experience in
introducing assistive products , we asked whether they had introduced assistive products to
the home - bound elderly disabled . for those who answered yes , we asked how many times .
they
were then divided into two groups : the less introduction group ( li group ) consisting of pts
who introduced assistive products less than 20 times and the more introduction group ( mi
group ) consisting of pts who assistive products 20 times or more . regarding the places where trial fittings of assistive products took place , the subjects
chose one of the following three answers : at the user s home , hospital / institution , and
other places . for follow - ups , we asked about the timing and method of follow - up . for timing , the subjects
chose from immediately after introduction , within 1 week , within 1 month , within 6 months ,
and after 6 months . for follow - up methods , the subjects selected from phone , questionnaire ,
visit , and other methods .
the answers were divided into two groups : follow - ups with visits
and follow - ups without visits . concerning the ethics of this study
, we explained to the pts in writing that any
information obtained from the questionnaire survey would only be used for this study and
that no secrets obtained from the survey would be disclosed to any third parties .
the correlations between respondent attributes and their answers to two questions , one
about their knowledge of social systems for assistive product s introduction for the
home - bound elderly disabled and the other about their roles , if any , in assistive product s
introduction and how they handle such roles , were examined using the test .
if
the test suggested that the answers did not differ depending on the basic
respondent information , the answers were simply aggregated , and percentages were calculated .
for statistical analysis , we used the statistica 2000 pro statistical analysis software from
stat soft . a significance level of 5%
the subjects were 58 male ( 75% ) and 19 female ( 25% ) pts .
their years of clinical experience
varied from 1 to 35 years , with an average of 12.06.4 years .
thirty - eight subjects ( 49% )
had less than 10 years of clinical experience , and 39 subjects ( 51% ) had 10 or more years of
clinical experience .
as for subject awareness of systems for introducing assistive products , the high awareness
group accounted for 53% of the pts aware of systems for purchase of assistive products based
on the long - term care insurance act and also 53% of the pts aware of systems for rental of
assistive products based on the long - term care insurance act . for social welfare measures
for the elderly ( benefits for daily life equipment )
, however , the high awareness group
accounted for only 24% of the pts .
the subjects were more aware of the systems based on the
long - term care insurance act than the social welfare measures for the elderly .
no
statistical correlation was observed between the awareness of such systems and subject
attributes ( gender and years of clinical experience ) .
asked whether they had introduced assistive products to the elderly , 70 subjects ( 91% )
answered yes . among them , 37 subjects ( 53% ) introduced products less than 20 times , and 33
subjects ( 47% ) introduced them 20 times or more .
no statistical correlation was observed between the number
of times assistive products were introduced and subject attributes , except that subjects
with longer clinical experience had introduced assistive products a larger number of times
( p<0.05 ) ( table 1table 1 .
the correlations between clinical experience duration and
the number of times pts introduced assistive productsclinical experience durationnumber of timesless than ten years ( % ) ten or more years ( % ) less than twenty times ( n=37)64.935.1*twenty times or more ( n=32)31.268.8*:p<0.05 ) . as for the locations for trial and fitting of assistive products , trial fittings were
conducted at the user s home in 55 cases ( 61% ) and at hospital / institution in 35 cases
( 39% ) .
approximately 60% of trial fittings were conducted in places where the products would
be used , suggesting that trial fitting of assistive products is conducted under conditions
similar to those of actual use .
no statistical correlation was observed between the places
of trial fitting and subject attributes , except that subjects with less experience in
introducing assistive products tended to conduct trial fittings at users homes , i.e. , where
the products would be used , and subjects with more introduction experience tended to conduct
trial fittings at hospitals / institutions , without visiting users homes ( p<0.05 ) ( table 2table 2 .
the correlations between fitting place for assistive
products and the number of times pts introduced assistive productsclinical experience durationnumber of timesoutside hospital ( % ) in hospital ( % ) less than twenty times ( n=37)64.935.1*twenty times or more ( n=33)33.366.7 * : p<0.05 ) . as for the timing of follow - ups after introducing assistive products , follow - ups were
conducted immediately after introduction in 29 cases ( 37% ) .
this was followed by within 1
week in 24 cases ( 30% ) , within 1 month in 21 cases ( 26% ) and within 6 months in 5 cases
( 6% ) . over 90% of follow - ups
follow - ups
were conducted by interviewing users or their families when they visited the
hospital / institution in 31 cases ( 38% ) .
this was followed by follow - ups conducted by
visiting users in 28 cases ( 35% ) , telephone interviews in 14 cases ( 17% ) , other methods in 7
cases ( 9% ) and questionnaires in 1 case ( 1% ) . over 70% of follow - ups
no statistical correlation was observed
between the follow - up method and subject attributes , except that subjects with more
experience in introducing assistive products tended to conduct follow - ups by visiting users
( p<0.05 ) ( table 3table 3 .
the correlations between follow - up method after assistive
product s introduction and the number of times pts introduced assistive
productsclinical experience durationnumber of timeswithout visiting ( % ) visiting ( % ) less than twenty times ( n=37)7327*twenty times or more ( n=33)45.554.5 * : p<0.05 ) .
in order to improve the daily life of the home - bound elderly disabled , improving their
mental and physical functions is important . at the same time , introducing assistive products
is very effective for improving the daily life of the home - bound elderly disabled and their
families4 .
for this reason , pts treating
the home - bound elderly disabled are required to have broad , deep , and current knowledge
concerning introduction of assistive products , including relevant laws and systems . claiming that it is important for pts to have knowledge of systems for introducing
assistive products
, nagano6 wrote that
most pts in japan are working under health - care insurance , long - term care insurance , and
other such systems , and they must have a certain level of understanding and knowledge of
such systems in order to offer their physical therapy skills to japanese nationals . without
such understanding and knowledge ,
according to the current
survey , the high awareness group for the social welfare measures for the elderly accounted
for only 24% of all the subjects , whereas the high awareness group for the long - term care
insurance act accounted for 53% .
we are concerned that pts have poor understanding and
knowledge of the act on social welfare for the elderly , although they know the long - term
care insurance act well .
this may suggest that pts are more aware and have better knowledge
of the long - term care insurance system than social welfare measures , particularly measures
to prevent frail elderly people , who are likely to need long - term care in the future , from
needing such care . considering that such preventive measures will be increasingly encouraged
in the future
, pts must improve their knowledge and understanding of the social welfare
measures to the same level as their knowledge and understanding of the long - term care
insurance system7 .
for this , we suggested
that undergraduate training and education of pts must include government systems and
measures .
seventy subjects ( 91% ) answered that they had introduced assistive products to the elderly ,
and approximately half of them had introduced the products 20 times or more .
this suggests
that introducing assistive products is a common assistance service that pts offer .
years of
clinical experience were significantly longer in the mi group than the li group , revealing
that pts with longer clinical experience introduced assistive products a larger number of
times .
as for places for trial and fitting of assistive products , pts with less experience in
introducing assistive products tended to conduct trial fittings at users homes , i.e. , where
the products would be used , and pts with more introduction experience tended to conduct
trial fittings at hospitals / institutions .
the results , however , suggests that experienced pts with practical know - how
obtained from experience can conduct trial fittings at hospitals / institutions , imagining the
environments of the users homes . as for follow - ups , pts with more introduction experience
tended to visit users homes for follow - ups more than those with less introduction
experience , showing results opposite to those for trial fittings .
pts with more introduction
experience visit users homes for follow - ups to confirm the practical know - how they have
obtained from experience and to take into consideration the differences in users home
environments .
it is presumable that they observe , assess , and analyze the activities in
which the users make use of the assistive products and obtain new know - how .
assistive products work appropriately only when they fit in well with the physical
functions and lifestyle of the user .
pts are good at , more than anything else , observing ,
assessing , and analyzing such physical functions .
it is desirable for pts to acquire the
latest knowledge and skills pertaining assistive products and continue to work to achieve
comfortable living environments for the home - bound elderly disabled .
Output:
| [ purpose ] this study explored the roles of physical therapists ( pts ) in introducing
assistive products , which are essential for living securely and stably at home , and
examined how pts can fulfill these roles more efficiently and effectively . [ subjects and
methods ] a questionnaire on introducing assistive products was administered to pts working
at randomly selected hospitals , health - care facilities for the elderly requiring long - term
care , home - visit nursing stations , and other such facilities and to pts providing physical
therapy directly to the home - bound elderly disabled .
the subjects of the study were 77 pts
who returned valid responses .
[ results ] for awareness of systems for assistive product s
introduction , pts were more aware of the system based on the long - term care ( ltc )
insurance act than the system based on the act on welfare for the home - bound elderly
disabled . for pts handling assistive product s introduction for the home - bound elderly
disabled , approximately 91% of the respondents answered that they had handled some cases
of assistive product s introduction , and pts with longer clinical experience had handled
more assistive product s introduction cases .
[ conclusion ] the results demonstrated that
pts understand the work involved in introducing assistive products work well and that they
handle it .
the results , however , also suggested that educational and operational
improvements are urgently required for pts introducing assistive products essential for
the lives of the home - bound elderly disabled . |
PubmedSumm118477 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: study area - the ar is the southern region of mainland portugal (
figure ) .
it has an area of 5,412 km
with 451,005 permanent inhabitants and incorporates 16 counties
( inc 2011 ) .
figs (
ficus carica ) , almonds ( prunus amygdalus ) ,
oranges ( citrus sinensis ) , carobs ( ceratonia
siliqua ) , strawberries trees ( arbutus unedo ) and cork
oak ( quercus suber ) are the most common crops in the region ( franco 1994 ) .
the ar has a mediterranean climate with warm weather ( annual average
temperature of 18c ) and low rainfall almost the entire year ( annual average of 500
mm ) .
summer ( june - september ) is the driest and warmest season , with average monthly
temperatures between 16 - 28/30c ( -meteo.pt ) .
sandfly collection and identification - from march - november 2007 ,
cdc miniature light traps were set out from sunset to sunrise in 175 biotopes
located at altitudes between 2 - 209 m above sea level and monitored for sandfly
presence .
captures were made in the counties of albufeira , aljezur , lagoa , lagos ,
portimo , silves and vila do bispo in the west area of the ar ( barlavento ) , as well
as in alcoutim , faro , olho , loul and tavira in the east area ( sotavento ) ( table i ) .
collections were made in farms and
cottage houses with yards and gardens . in most of the studied biotopes , in addition
to humans and dogs , the major vertebrates available within a 50 m radius were cats ,
cows , sheep , goats , pigs , donkeys , rabbits and birds ( poultry and exotic ) . in 41 of
the 175 biotopes , insecticides ( collars , spot - on or spray ) were used on dogs .
table icharacteristics of the sandfly collecting sitescountyaltitude ( m)hosts available within a
50 m radiuswest area
( barlavento)albufeira195humans , dogsaljezur2humans , dogs , catslagoa2humans , dogslagos2humans , dogs , catsportimo2humans , dogs , cats , cows ,
chickenssilves15humans , dogs , sheep ,
chickensvila do bispo2humans , dogseast area
( sotavento)alcoutim2humans , dogs , donkeys ,
cows , goats , sheep , pigs , chickensfaro209humans , dogs , cats ,
domestic and wild rabbits , chickens , geese , ducks , exotic
birdsloul181humans , dogs , cats ,
sheep , chickensolho35humans , dogs , cats ,
chickenstavira2humans , dogs , cats
a total of 1,663 sandfly adults were collected .
the specimens were
preserved in 70% ethanol and maintained at room temperature ( 22 - 26c ) for further
analysis .
phlebotomine specimens of both genders were identified by their
morphological characteristics at the species level according to pires ( 1979 ) .
in addition , for each female , it
was determined if it was gravid ( with eggs in the abdomen ) , engorged ( blood in the
abdomen , total or partial ) or unfed ( no visible blood in the abdomen ) .
leishmania spp detection in female sandflies - after microscopic
species identification , the body of each female ( minus genitalia ) was used for
molecular analysis . the individual female s body was homogenised in lysis buffer
( 200 l ) from a polymerase chain reaction ( pcr ) kit ( pcr - template preparation kit ,
roche diagnostics gmbh , germany ) and incubated with the buffer and proteinase k ( 40
l ) .
pcr
amplification for the identification of leishmania spp in females
was performed using specific primers for two molecular markers : the internal
transcribed spacer 1 of the ribosomal operon of leishmania and the
kinetoplastid minicircle dna ( kdna ) sequence of the leishmania
donovani complex ( schonian et al .
amplification of 314 base pair ( bp ) and 447 bp pcr products was analysed on a 1.5%
agarose gel stained with ethidium bromide .
positive ( l. infantum
and leishmania tropica dna ) and negative controls were
included .
sandfly blood meal identification - blood meals were identified
using the modified vertebrate - universal specific primers cytb1-f and cytb2-r to
amplify a 350 bp segment of the host mitochondrial cytochrome b
gene ( svobodova et al .
pcr - amplified
products were sequenced on both strands using a bigdyeterminator v1.1 applied
biosystem abi prism 3700 dna analyzer ( stabvida sequence service ,
portugal ) .
sequences were compared with sequences deposited in the genbank database
using vertebrate standard nucleotide blast searches .
canine leishmaniasis ( canl ) serosurvey - in parallel with the
phlebotomine survey , a total of 193 adult dogs of both genders were analysed ,
including both mongrel and pedigree animals ; 129 animals were from official and
private kennels and 64 attended veterinarian clinics .
serum samples for serological testing were separated by centrifugation
and preserved at -20c until use .
determination of the total anti-
leishmania antibodies was performed by an indirect
immunofluorescence antibody test ( ifat ) , counterimmunoelectrophoresis ( cie ) and an
immunochromatographic dipstick test rk39 ( inbios , usa ) .
briefly , for cie , all reactions with at least one precipitation
were considered positive .
the ifat cut - off value was established at a serum dilution
of 1/64 . in both tests ,
the appearance of two pink
lines indicated a positive result , while the appearance of only one line indicated a
negative result .
dogs were considered seropositive if at least two of the techniques
were positive ( maia & campino 2008 ) .
a
bone marrow biopsy was performed in 13 animals ( seropositive and/or with clinical
signs compatible with canl ) for in vitro culture in novy - macneal - nicolle medium .
the study was approved by the ethical committee of the institute of
hygiene and tropical medicine , nova de lisboa university , and followed portuguese
legislation guidelines ( lei 92/95 , 12.9 ) .
in this work , four sandfly species were captured : p. perniciosus ,
p. ariasi , p. sergenti and s. minuta .
sandflies survey - a total of 1,663 sandflies ( 888 females and 775
males ) were collected in 55 of the 175 monitored biotopes and identified
morphologically .
the prevalence was 86.59% for p. perniciosus
( 1,440 specimens ) , 10.35% for s. minuta ( 172 specimens ) and 2.4%
for p.
a few ( 11 ) of p.
sergenti specimens ( 0.66% ) were also collected .
p. perniciosus was
the dominant species and was collected in all biotopes from western ar - eastern ar ,
except in lagoa ( table iii ) .
table iiphlebotomine sandfly densities in algarve regionmonth
phlebotomine species march april may june july august september october november
phlebotomus perniciosus
0.750.000.0019.9016.840.2011.213.890.00
phlebotomus ariasi
0.000.000.000.200.880.000.190.170.00
phlebotomus sergenti
0.000.000.000.300.200.000.000.000.00
phlebotomus papatasi
0.000.000.000.000.000.000.000.000.00
sergentomyia minuta
0.330.000.000.254.640.200.900.220.00total
1.080.000.0020.6522.560.4012.304.280.00
a : sandfly density = total number of sand
flies / cdc light trap ( month ) .
a : sandfly density = total number of sand
flies / cdc light trap ( month ) .
table iiisandfly specimens collected , number of fed , gravid and infected
females detected per countysandfly speciesf
phlebotomus
perniciosus
phlebotomus
ariasi
phlebotomus
sergenti
sergentomyia
minuta
totalcountyfmfmfmfmfmf + mbloodfedgravidinfectedwest area
( barlavento)albufeira1881227500211921614636225110aljezur283344005313768105200lagoa00000000000000lagos51000000516210portimo11000000112030silves130113200000132113245430vila do bispo3044000032334679020east area
( sotavento)alcoutim627533005470821521030faro12000001134040loul18610003122729120olho229214427111825122547612211tavira815632213424120832037220total77366724169282908887751,66363721f : female ; m : male .
leishmania spp detection in sandflies - one p.
perniciosus female was found to be infected with
leishmania dna ; thus , there was a 0.13% ( 1/773 ) overall
infection rate for this species .
gene sequences of the kdna products were compared with
leishmania sequences available in genbank and the specimen was
found to have a 98% homology with l. infantum .
although humans ,
poultry and dogs ( 1 of which had clinical and laboratory - confirmed leishmaniasis )
were present in the biotope where the infected sandfly female was captured , no blood
( fresh or digested ) was visible in its midgut .
sandfly blood meal identification - sixty - four ( full or partial )
blood - fed females were tested for host blood identification .
after sequencing the
amplified part of the cytochrome b gene , 37 ( 57.81% ) blood meals
were identified .
one cat , 27 rodents , six chickens and three lizards were identified
as blood sources ( table iv ) .
table ividentification of sandfly blood meal sourcesblood meal sourcespeciesblood meal
identification / fed femaleschickenrodentscatlizard
phlebotomus perniciosus
31/5632710
phlebotomus ariasi
3/32001
phlebotomus sergenti
1/31000
sergentomyia minuta
2/20002total37/6462713
canl survey - a simultaneous canl survey revealed that 31 of the
193 ( 16.06% ) screened dogs were seropositive for leishmania
infection ( table v ) .
a prevalence of 3.88%
( 5/129 ) was found in kennelled dogs and 40.69% ( 26/64 ) in dogs that were taken to
veterinarian clinics .
parasites were isolated from one dog and identified as
l. infantum mon-1 by iso - enzymatic typing at the national
reference center for leishmania , montpellier university ( rioux et al .
table vanti- leishmania antibodies analysed by rk39 , cie
and ifat in dogs from algarve regionpositivesourcedogs ( n)negative ( n)rk39 + cierk39 + ifatcie + ifatrk39 + cie + ifattotalveterinarian clinics64382107726kennels12912421025total1931624117931cie : contraimmunoelectrophoresis test ; ifat : indirect
immunofluorescence antibody test ; rk39 : immunocromatographic
test .
cie : contraimmunoelectrophoresis test ; ifat : indirect
immunofluorescence antibody test ; rk39 : immunocromatographic
test .
phlebotomine sandflies are present in periurban , rural and sylvatic
environments and distributed in all countries around the mediterranean basin .
therefore , human populations and domestic animals living in these areas are
potential targets of sandfly - borne diseases , such as leishmaniasis .
an updated
analysis of the distribution , relative abundance , leishmania
infection rate and blood feeding preferences of phlebotomine sandflies was performed
in the ar , which is the most popular summertime tourist destination in portugal and
one of the most popular tourist destinations in europe .
simultaneously , a canl
seroprevalence survey was also performed because dogs are considered the main host
of leishmania .
four sandfly species previously known to be present in ar were captured :
p. perniciosus , p. ariasi , p. sergenti and s.
minuta .
l. infantum was detected in one p.
perniciosus female , resulting in a 0.13% ( 1/773 ) infection rate of this
species .
the presence of l. infantum demonstrates that p.
perniciosus remains a vector of leishmania in this
region .
this result , which is similar to the 0.35% and 0.52% infection rates
observed previously ( alves - pires et al .
2001
, maia et al . 2009 ) , was expected because no
phlebotomine control strategies have been developed . in the present study ,
the
infected sandfly was detected in september , confirming that the probability of
leishmania vectorial transmission is higher during summertime .
we observed by microscopy that the infected sandfly did not contain either fresh or
digested blood in its midgut .
knowledge of the host preferences of phlebotomine sandflies under natural
conditions is essential to understand their role as vectors and detect other
potential reservoir hosts .
the lack of identification of the blood sources in 27 of
the 64 blood - fed sandfly females was likely related to the inherent requirement of
pcr for relatively fresh blood .
in fact , it was observed microscopically that blood
was partially or almost completely digested in some specimens .
the results of the blood meal analyses suggest that p.
perniciosus appears to be an opportunistic feeder , as females were
found to be engorged with chicken , rodent and cat blood .
this result is partially in
agreement with previous reports from spain ( colmenares et al .
the high number of rodents found to be blood
sources for p. perniciosus was likely because this work was
primarily conducted in rural areas , including several sylvatic biotopes .
p.
sergenti and s. minuta exhibited blood meal
preferences for chickens and lizards , respectively .
these sandflies
are considered vectors of sauroleishmania and they frequently feed
on reptiles , such as tarentola mauritanica and hemydactilus
turcicus , which are abundant in southern portugal and widely
distributed around the mediterranean area ( bates
2007 , alves - pires et al .
surprisingly , in our study , no dog or human blood was found in engorged sandfly
females .
the absence of blood from dogs could have been due to the use of
insecticides and repellents in approximately 23% of the animals present in the
studied biotopes .
alternatively , this result could be related to the fact that in
rural areas , humans and dogs might not be the major blood source target for
sandflies due to the presence of a high number of other vertebrates , such as the
great predominance of rodents .
our results clearly showed that females preferred to
take their blood meals from small animals , such as rodents , lizards and chickens ,
rather than from bigger / larger vertebrates . to confirm this conclusion ,
further work
should be carried out to specifically determine such a preference and to determine
if rodents play any role in the maintenance of leishmania in the
algarve focus , which has observed in other endemic areas ( quinnell & courtenay 2009 ) . in the canl survey ,
each sample was screened by three tests and to
improve diagnosis , only dogs with specific anti- leishmania
antibodies detected by at least two techniques were considered seropositive ( maia & campino 2008 ) .
the high prevalence of
40.63% ( 26/64 ) in dogs that attended veterinarian clinics likely reflects the fact
that all animals were clinically suspected of having leishmania
infection .
this canl seroprevalence was higher than the 5.02% obtained in 2009 in
206 randomly screened animals from the ar that attended veterinarian clinics ( cortes et al .
2012 ) and the 25.7% obtained in
105 dogs with clinical signs compatible with vector borne diseases in 2010 - 2011 (
cardoso et al .
this discrepancy
could be related to the small number of the animals screened in our study and the
fluctuation of the prevalence of infection between transmission seasons .
our results
indicate the maintenance of leishmaniasis in the ar and reinforce the importance of
p. perniciosus as a vector of l. infantum in
southern portugal .
these results are in contrast with what has been observed in the
central and northern regions , where p. ariasi specimens were also
found to be infected ( campino et al .
this geographical
distribution of known vectors may be related to the high density of p.
perniciosus in the ar and/or due to bioecological aspects that should
be determined in future work .
the gap between the number of human and canl cases
observed in this region emphasises the fact that leishmania can be
considered an accidental or opportunistic infection in humans ( 3 adult cases
notified in 2006 - 2007 ) .
nevertheless , it is also important to note that global
climate changes associated with a higher density and activity of sandfly species
over a longer period might ( i ) enhance the number of days favourable for the
transmission of parasites and therefore ( ii ) increase leishmaniasis incidence not
only in animals , but also in humans .
moreover , it is important to alert tourists
from non - endemic countries who are spending their summer holidays in the ar with
their dogs that they should implement prophylactic measures prior to travelling to
ensure their pets are not infected ( shaw et al .
the p. sergenti vector of l. tropica
was identified in the ar ; however , no l. tropica dna was amplified
from the p. sergenti specimens collected in this study .
although
human cases of l. tropica have not been recorded in portugal , the
risk of the potential introduction of new leishmania species from
travellers or immigrants from north africa should not be neglected given that its
vector is already present in the country ( afonso et
al . 2005 ) .
programmes and/or monitoring projects should be developed to detect areas
at risk for vector transmission to enable the implementation of specific and
effective control measures .
to do so , it is necessary that the local population ,
technicians , public and private institutions and institutions of local and regional
management be aware of these problems and to actively participate in the control of
sandflies , particularly in facilitating the placement of material to capture
sandflies ( i.e. , the maintenance of collecting stations and participation in local
canl surveys ) . according to the illustrious parasitologist killick - kendrick ( 2010 )
Output:
| the algarve region ( ar ) in southern portugal , which is an
international tourist destination , has been considered an endemic region of
zoonotic leishmaniasis caused by leishmania infantum since the
1980s . in the present study ,
phlebotomine and canine surveys were conducted to
identify sandfly blood meal sources and to update the occurrence of
leishmania infection in vectors and dogs .
four sandfly
species were captured : phlebotomus perniciosus ,
phlebotomus ariasi , phlebotomus sergenti
and sergentomyia minuta . in one p. perniciosus
female , l. infantum dna was detected .
blood meal tests showed
that this species had no host preferences and was an opportunistic feeder .
an
overall canine leishmaniasis ( canl ) seroprevalence of 16.06% was found ; the
seroprevalence was 3.88% in dogs housed in kennels and 40.63% in dogs that
attended veterinary clinics .
the simultaneous occurrence of dogs and p.
perniciosus infected with l. infantum in the ar
indicates that the region continues to be an endemic area for canl .
our results
reinforce the need for the systematic spatial distribution of phlebotomine
populations and their leishmania infection rates and the need
to simultaneously perform pathogen monitoring in both invertebrate and
vertebrate hosts to investigate the transmission , distribution and spreading of
leishmania infection . |
PubmedSumm118478 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: apolipoprotein e ( apoe ) was first discovered in 1970s and identified as a component of triglyceride - rich lipoprotein complexes . since then
, apoe has been widely studied in lipid metabolism , cardiovascular diseases , and neurodegenerative disorders such as alzheimer 's disease ( ad ) and parkinson disease ( pd ) .
in addition to its well - established role in lipid transportation and atherosclerostic pathogenesis , apoe bears immunomodulatory properties and is associated with multiple sclerosis ( ms ) and psoriasis .
apoe can modulate the functions of macrophages , suppress the proliferation of t cells , maintain the integrity of blood - brain barrier ( bbb ) and blood - nerve barrier ( bnb ) , inhibit the proliferation of smooth muscle ( sm ) cells , upregulate the production of nitric oxide ( no ) of platelets , facilitate the presentation of lipid antigen by cd1 molecules to natural killer t ( nkt ) cells , and so forth , ( figure 1 ) .
cytokines are crucial in human inflammatory and autoimmune disorders and apoe might affect these disorders through interacting with cytokines .
apoe is produced by liver , brain , spleen , kidney , lung and muscle tissues , and so forth .
hepatic parenchyma cells produce 2/3 to 3/4 of the apoe in plasma . in the nervous system ,
apoe mrna is present in astrocytes , microglia , schwann cells ( scs ) , neurons , and so forth , ( figure 2 ) .
there are three major isoforms of human apoe ( apoe2 , apoe3 , apoe4 ) encoded by the 2 , 3 , and 4 alleles on chromosome 19q13 .
differences in the amino acid residues ( positions 112/158 ) of apoe distinguish the apoe2 ( cys / cys ) , apoe3 ( cys / arg ) , and apoe4 ( arg / arg ) isoforms .
the apoe alleles show a peculiar distribution throughout the world ; the apoe3 allele is the most frequent in populations with a long - established agricultural economy , whereas the apoe4 allele is the ancestral allele , with a higher frequency in pygmies , khoi san , papuans , lapps , and some native americans .
the structural polymorphism in apoe influences its conformation and bindings to lipoprotein particles and cellular receptors .
apoe4 preferentially binds to lower density lipoproteins and is associated with increased risk of atherosclerosis and neurodegenerative disorders , including ad .
this binding preference is due to domain interaction ( the presence of arg-112 causes arg-61 in the amino - terminal domain to interact with glu-255 in the carboxyl - terminal domain ) ( table 1 ) .
additionally , physiological properties of apoe , such as antioxidant , antiapoptotic , immunomodulatory , and atheroprotective capacities are significantly influenced by apoe polymorphism .
apoe exerts its biological functions , especially lipid transportation , by binding to its receptors , the low - density lipoprotein receptor ( ldlr ) family .
the ldlr family includes ldlr , ldlr - related protein 1 ( lrp1 ) , very low density lipoprotein receptor ( vldlr ) , apoe receptor ( apoer)2 , megalin ( also known as lrp2 ) and lrp1b , and so forth , .
as the prototype of this family , ldlr is the main receptor for cholesterol metabolism , to which apoe3 and apoe4 bind with 50-fold greater affinity than apoe2 .
the interaction of apoe and ldlr determines the removal of apoe - rich lipoproteins ( vldl , chylomicron remnants , intermediate density lipoproteins ) , and the homeostasis of cholesterol and triglycerides . besides direct signal transduction , the ldlr family functions as signal modulators and integrators in several signaling pathways .
the distribution of lipids among different body compartments occurs by means of different lipoprotein particles in the blood circulation .
host responses to infections involve changes in lipid levels and lipid metabolism in the plasma .
these plasma lipid changes might be mediated by three cytokines interleukin ( il)-1 , il-6 , and tumor necrosis factor ( tnf)- , which induce elevated levels of triglycerides and vldl , decreased levels of cholesterol , hdl and ldl [ 23 , 24 ] or increased levels of cholesterol in the serum , depending on the nature of the infectious agents .
lipoproteins and lipids present in the serum may contribute to the host innate immunity against pathogens .
studies using apoe deficient mice confirmed the role of apoe in host susceptibility to endotoxemia and klebsiella pneumoniae infection , while transgenic ( tg ) mice expressing human apoe3 and apoe4 genes revealed an isoform - specific effect of apoe on the proinflammatory response to lipopolysaccharide ( lps ) .
infection of apoe knockout ( ko ) mice with listeria monocytogenes or klebsiella pneumoniae leads to an increased susceptibility to death as well as increased serum levels of tnf- as compared with wild - type ( wt ) mice [ 29 , 30 ] .
binding of bacterial endotoxin to either hdl , ldl , or vldl results in a redirection of endotoxin uptake from kupffer cells to parenchymal hepatocytes where the endotoxin is deactivated .
apoe facilitated sepsis - induced mortality in a dose - dependent manner and increased natural killer t-(nkt)-cell proliferation in the spleen .
apoe deficient mice were markedly more susceptible to tuberculosis , evidenced by 100% mortality within 4 weeks of infection with tuberculosis .
apoe 4/4 genotype was associated with an aggravated disease course of acquired immunodeficiency syndrome ( aids ) , especially with accelerated progression to death .
compared with apoe3 , apoe4 enhanced human immunodeficiency virus ( hiv ) fusion / cell entry of both r5 and x4 hiv strains in vitro .
apoe4 competes less efficiently than the other isoforms for entry into neuronal cells through heparan sulphate proteoglycan proteoglycans , which are involved in hiv attachment and entry into cells .
hiv produces a chronic viral infection in the central nervous system ( cns ) that elicits chronic glial activation and cytokines overproduction .
showed that hiv - infected subjects with an apoe4 allele had excess peripheral neuropathy . as a well - known risk factor for ad , an 4 allele along with the presence of herpes simplex virus ( hsv ) 1 in the brain confers an increased risk of developing to ad [ 36 , 37 ] .
the production of infectious hepatitis c virus ( hcv ) was significantly reduced by the knockdown of apoe .
the genotypes carrying the apoe2 were associated with the equivalent of a 35-fold reduction in the risk of chronic hcv infection .
another study , however , showed that the expression of the apoe2 resulted in poorer recovery of infectious hcv than did apoe3 and apoe4 isoforms .
either subjects without apoe3 or with a single apoe3 with high serum cholesterol are prone to a better prognosis .
apoe gene polymorphism was also associated with hepatitis b virus ( hbv ) infection , and the 2 allele , compared with the other alleles , showed positive correlation with different hbv infection models .
apoe suppressed inflammation through vldlr or apoer2 in macrophages by converting proinflammatory m1 to the antiinflammatory m2 phenotype .
exogenous apoe suppressed lps and polyinosine - polycytidylic acid ( pic , a double - stranded rna that serves as a viral mimetic and a toll - like receptor ( tlr)3 agonist ) induced secretion of il-6 , il-1 and tnf- by raw 264.7 cells via repressing tlr - agonist - induced phosphorylation of c - jun n - terminal kinase ( jnk ) and c - jun .
apoe peptide ( 141155)2 inhibits lps- and pic - induced macrophage inflammatory responses in a similar manner .
apoe also reduces inflammatory signaling in astrocytes and microglia in response to proinflammatory stimuli [ 44 , 45 ] .
th precursor ( thp ) cells can differentiate into th1 , th2 , or th0 cells .
th0 cells can differentiate to th1 and th2 subpopulations depending primarily on the cytokines provided exogenously or from dendritic cells .
th1 cells are involved in cellular immunity and immunoglobulin class switching to the igg2a isotype , whereas th2 cells are mainly associated with humoral immunity and immunoglobulin class switching to igg1 and ige . moreover ,
th1 cells promote the induction of complement - fixing , opsonizing antibodies and of antibodies involved in antibody - dependent cell cytotoxicity , for example , igg2a in mice .
th1 cytokines include interferon ( ifn)- , il-12 , and tnf-. they can activate macrophages to produce reactive oxygen intermediates and no , stimulate their phagocytic functions , and enhance their antigen presenting capacity by upregulating major histocompatibility complex ( mhc ) class molecules .
th2 cytokines include il-4 , il-5 , il-10 , and il-13 , which provide potent help for b - cell activation , immunoglobulin class switching to ige and igg1 in the mouse , and downregulation of macrophage activation ( figure 3 ) .
imbalance of the th1/th2 can result in autoimmune disorders . in experimental autoimmune neuritis ( ean ) , an animal model of human guillain - barr syndrome ( gbs ) ,
th1 cytokines predominate and mediate inflammatory damage to the peripheral nerves , whereas th2 cytokines are associated with recovery from the disease [ 4648 ] .
proinflammatory cytokines such as il-1 , il-6 , il-12 , il-17 , il-18 , il-23 , tnf- , ifn- , and macrophage inhibitory factor ( mif ) significantly contribute to disease development of ean by recruiting effector cells to the peripheral nervous system ( pns ) and by enabling in situ release of other products toxic for scs and myelin such as free radicals , oxygen intermediates , and no [ 46 , 47 , 4951 ] .
antiinflammatory cytokines from th2 cells such as il-4 and il-10 may suppress the disease by playing an important antiinflammatory role [ 52 , 53 ] .
the balance of functionally distinct t - cell subsets between th1 and th2 has a direct relevance to autoimmune disorders .
recently , the th1/th2 paradigm has been challenged , following the discovery of a third subset of effector th cells that produce il-17 ( termed th17 cells ) and exhibit effector functions distinct from th1 and th2 cells .
th17 cells are potent inducers of tissue inflammation and have been associated with the pathogenesis of many autoimmune diseases and rheumatic disorders .
il17-producing th17 cells have been found to play an important role in many autoimmune diseases including experimental autoimmune encephalomyelitis ( eae ) , an animal of ms , while thymic regulatory t ( treg ) cells have a suppressive role , although their roles in ean and gbs need further investigation . increased mrna level of il-1 , il-2 , il-6 , ifn- , intercellular adhesion molecule ( icam)-1 , vascular cell adhesion molecule ( vcam)-1 , monocyte chemoattractant protein ( mcp)-1 , nuclear factor ( nf)b ( p65 ) and inhibitory ( i)b- and decreased mrna level of il-4 , il-10 , and granulocyte - macrophage colony - stimulating factor ( gm - csf ) in apoe ko mice compared with wt mice imply that lacking apoe promotes th1 immune responses by changing these cytokines .
il-6 , il-12 , tnf- , and ifn- were upregulated to a significantly greater level in apoe - deficient mice than in wt mice at both the mrna and protein levels in response to lps administration .
apoe selectively regulates tlr4- and tlr3-mediated signaling of il-12 production and apoe may suppress the th1 immune response by modulating il-12 production .
macrophages from apoe - deficient mice stimulated by exogenous antigens are more effective in upregulating mhc class molecules and cd80 , with elevated secretion of ifn- in responding t cells .
severe hypercholesterolemia can induce a switch of autoimmune responses from th1 to th2 effector type in atherosclerotic apoe ko mice .
apoe - deficient mice injected with lps produced elevated levels of il-1 , il-6 , and tnf- , when compared with wt mice , and exogenous apoe could reverse this effect .
apoe targets myeloid differentiation primary response gene ( myd)88 and interleukin-1 receptor - associated kinase ( irak)1 activation whereby interrupting il-1 and il-18 signaling in vascular smooth muscle cells ( vsmcs ) . as a consequence
il-1 signaling intermediates nfb transactivation was inhibited by apoe in myd88- and irak1- but not in traf6-transfected cells .
no is a principal effector of macrophage - mediated inflammatory / immune responses . in the mononuclear - phagocyte system ,
no is formed enzymatically from l - arginine by inducible nitric oxide synthase ( inos ) .
treatment of microglia and peripheral macrophages with apoe increased no production stimulated by ifn- and lps .
apoe per se , however , seems unable alone to induce the production of either inos ; it functions via alteration of arginine availability .
furthermore , upon proinflammatory stimulation , peripheral macrophages from male apoe4 tg mice could produce significantly higher levels of no than from apoe3 tg mice .
is coupled with an increased arginine uptake in male apoe4 tg mice and is dependent on p38 mitogen - activited protein kinase ( mapk ) , whereas it is not the case in female mice .
macrophages from female apoe tg mice produce higher levels of no than male ones , without any isoform - dependent differences .
scs can secrete cytokines like il-6 and il-10 and actively participate in immune responses as facultative antigen presenting cells in the pns .
the antigen presenting properties of scs were enhanced in apoe ko mice , concomitant with downregulated production of intracellular il-6 . in the recovery stage of ean , no produced by scs is pivotal for the termination of local immune responses by inducing apoptosis of effector t cells in the pns .
apoe might act as an inhibitor for ean by suppressing the th1 response and shifting the th1/th2 to the th2 direction .
an increased susceptibility to ean after upregulation of the autoreactive t - cell response to peripheral nerve component with higher levels of ifn- , il-12 , and tnf- and lower levels of il-10 was seen in apoe ko mice than wt mice . significantly increased secretion of th17-related cytokines ( il-17 and il-6 ) and expression of transcription factor retinoid - related orphan receptor gamma ( ror)t levels and obviously decreased number in treg cells , secretion of treg - related cytokines ( tgf-1 ) and expression of transcription factor ( foxp3 ) levels were found in apoe ko mice .
th17/treg functional imbalance exists in apoe ko mice , suggesting a role of th17/treg imbalance in apoe functioning .
il-17a was also found to be elevated in the plasma and tissues of apoe null mice .
cog133 , a mimetic of apoe protein , when binding to a protein transduction domain creates cog112 , an antennapedia - linked apoe - mimetic peptide , improves therapeutic effects on eae through decreasing demyelination and diminishing the number of peripheral cells infiltrating into the spinal cord , as well as other inflammatory processes [ 74 , 75 ]
. increased mrna level of inos , tnf- , ifn- , and il-17 and decreased nuclear translocation of nf-b and ib kinase ( ikk ) activity in colitis models suggest that cog112 inhibits inflammation through the nfb pathway .
furthermore , intravenous administration of a small apoe - mimetic peptide derived from the receptor - binding region of the apoe holoprotein ( apoe-(133149 ) ) similarly suppressed both systemic and local brain inflammatory responses in mice after lps administration . however , different genetic basis determines modified immunological processes .
lrp is implicated to mediate the immunomodulatory effects of apoe , although there seems to be no difference in the binding affinity of apoe isoforms to lrp [ 79 , 80 ] .
apoe suppressed the secretion of tnf- and il-1 in an isoform - specific fashion ( e2 > e3 > e4 ) . a markedly higher level of tnf- was observed in supernatant of cultured macrophage derived from adult male apoe4 tg mice compared with macrophages from apoe3 ones . in the presence of lps ,
apoe3-expressing cells produce less tnf- and il-6 than apoe2 and apoe4-expressing cells which might be related with the extracellular signal - regulated kinases ( erk)1/2 signaling pathways .
pronouncedly affects the cellular immune response in stably transfected murine macrophages . in apoe4 versus apoe3 macrophage cell line cells higher levels of proinflammatory cytokines including tnf- appeared evident followed by lps stimulation .
preincubation with human recombinant apoe blocked glial secretion of tnf- in mixed neuron - glial cultures in response to lps stimulation in a dose - dependent manner ( apoe3 > apoe4 ) .
this effect was the greatest when apoe was preincubated for 24 hours and was not dependent on any direct effect of apoe on cell viability . twice as many apoe4 carriers were demented ( 30% versus 15% ) or had peripheral neuropathy as compared with non - apoe4 carriers in the hiv infection .
if there are apoe isoform - dependent differences in the antiinflammatory function of apoe in vivo , such differences might in part explain the differential risk for ad caused by apoe isoforms .
however , several studies demonstrated that exogenously applied apoe4 had robust proinflammatory activity in astrocytes and microglial cells [ 85 , 86 ] . in mice receiving the basal diet without quercetin supplementation , levels of tnf- in whole blood stimulated ex vivo with lps were higher in apoe3 than apoe4 tg mice .
apoe displayed an isoform - specific effect on inflammation in primary adult microglia culture , with apoe4 the most potent to stimulate production of prostaglandin - e2 and il-1 .
activation of primary astrocytes from apoe targeted replacement ( tr ) mice with lps led to genotype - dependent differences in cytokine secretion that were the greatest in apoe2 tr mice ( apoe2 >
activation of primary astrocytes from apoe tr mice with lps led to apoe - dependent differences in cytokine secretion that were greatest in apoe2 tr mice and that were associated with differences in nfb subunit activity . transforming growth factor
( tgf)-1 contains similar structure with apoe and lipoproteins containing the apoe3 isoform have higher tgf- levels and bioactivity than those containing apoe4 .
association of tgf- with different types of lipoproteins may be beneficial to diseases like atherosclerosis and ad .
intraventricular administration of lps resulted in higher production of proinflammatory cytokines , along with greater activation of nfb - regulated genes in the apoe4 than in apoe3 tg mice .
inflammatory responses of apoe4 tr mice following intravenous administration of lps expressing the human apoe4 allele had higher systemic and brain levels of the proinflammatory cytokines tnf- and il-6 than their apoe3 counterparts , suggesting an isoform - specific effect of the immunomodulatory properties of apoe .
cog1410 , an apoe - mimetic peptide , was also associated with a reduction in tnf- , il-1 , il-6 , and il-12 levels in both apoe3 tr and apoe4 tr mice assessed at 24 hours in the caecal ligation and puncture model of peritonitis . peripheral blood mononuclear cells ( pbmcs ) from ad patients with apoe4 allele produced higher spontaneous and phorbol-12-myristate-13-acetate-(pma- ) induced levels of il-1 after controlling for confounders .
apoe4 carriers showed higher concentrations of il-1 than their counterparts without apoe4 after pma - stimulation .
the apoe4 allele was associated with lower serum levels of il-10 in both acute coronary syndrome and chronic stable angina patients .
recombinant apoe suppresses chemokine ( c c motif ) ligand ( ccl)2 and vascular endothelial growth factor ( vegf ) expression in retinal pigment epithelium ( rpe ) cells in an isoform - dependent manner ( apoe4 > apoe3 ) . the exact molecular mechanisms by which apoe isoforms differentially alter the immune responses have been postulated to influence different signaling pathways .
apoe isoforms might be in part responsible for the differential modulation of nfb and mapk pathways [ 89 , 91 , 96 ] .
a significant interaction between apoe genotype and the response to 17-estradiol was observed for no and tnf- production from microglia activated by recombinant mouse ifn- plus either lps or pic .
the antiinflammatory activity of 17-estradiol is pronouncedly reduced in apoe4 tr mice compared with apoe3 tr mice .
apoe genotype may affect the neuroprotective role of 17-estradiol and of hormone replacement therapy on brain function when the apoe4 gene is expressed .
classical activation of macrophages by proinflammatory cytokines such as ifn- and tnf- can downregulate apoe production [ 9799 ]
. however , antiinflammatory stimuli such as tgf- and estrogen promote apoe synthesis and release .
gm - csf stimulated macrophages had a 35-fold reduction in apoe secretion , comparable with that observed for ifn- , while tnf- and il-1 resulted in a 2-fold decrease .
in contrast to the reduction in apoe secretion by these cytokines , tgf- stimulated macrophages secreted 3-fold greater amounts of apoe than controls [ 100103 ] .
treatment of primary rat astrocyte and mixed glial cell cultures with tnf- markedly reduced extracellular apoe protein levels .
the effects of apoe in adipose tissue on body lipid homeostasis and atherosclerosis have been widely studied .
tnf- may activate the binding of nfb p50 to a binding site at -43 in the apoe promoter .
treatment of adipocytes with tnf- led to increased binding of nfb p50 , decreased binding of p65 and sp1 to this region of the apoe promoter , and repression of adipocyte apoe gene expression .
reduction of p50 expression using sirna completely eliminated tnf--mediated reduction of endogenous apoe gene expression in adipocytes .
ifn- dramatically increased the degradation of intracellular apoe and inhibited the accumulation of apoe in the supernatants of human monocyte - derived macrophages and human acute monocytic leukemia cell line ( thp-1 ) cells via post - translational modification of apoe [ 97 , 108 ] .
ifn-1b has inhibitory effects on the production of apoe mrna , cellular protein , and secreted protein in blood monocytes .
treatment of primary mixed glial cell cultures with il-1 induced a marked increase of extracellular apoe protein .
tgf- can induce the expression of apoe in the thp-1 cell line by activating jnk , mapk p38 and caseine kinase ( ck)2 pathways .
classical activation of macrophages by proinflammatory cytokines can downregulate apoe production and antiinflammatory stimuli can promote apoe synthesis and release , indicating a key role of apoe and cytokines in immunomodulation .
apoe suppressing proinflammatory signalings , and vice versa , indicate an intricate apoe - mediated feedback regulation of inflammatory and immune responses .
Output:
| apolipoprotein e ( apoe ) is a multifunctional glycosylated protein characterized by its wide tissue distribution . despite its importance in lipid transport and atherosclerosis pathogenesis
, apoe is associated with neurodegenerative disorders such as alzheimer 's disease ( ad ) and parkinson disease , and autoimmune disorders such as multiple sclerosis and psoriasis . among others ,
the role of apoe in modulating inflammation and oxidation is crucial in elucidating the risk factors of the above diseases since the function of apoe is closely linked with both proinflammatory and antiinflammatory cytokines .
moreover , apoe modulates inflammatory and immune responses in an isoform - dependent manner .
correspondingly , inflammatory cytokines can either upregulate or downregulate the production of apoe in various tissue types .
however , studies on the interactions between apoe and cytokines occasionally yield conflicting results , highlighting the complex roles of apoe and cytokines in various disorders .
the present paper summarizes the current knowledge about the cross - talk between apoe and cytokines , with emphasis on the effects of apoe on the th1/th2 balance . |
PubmedSumm118479 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: dynamic organization of protein - protein interactions in signaling networks is essential to coordinate cellular functions in response to extrinsic and intrinsic signals .
affinity purification coupled with mass spectrometry ( ap - ms ) has been the method of choice to identify protein - protein interactions and protein complexes in various model systems ( hauri et al . , 2013 , glatter et al . , 2011 ) .
the majority of ap - ms studies to date used epitope - tagged bait proteins expressed exogenously in transformed cell lines . the use of exogenous bait expression may , in most cases , result in the correct identification of physiological binding partners , but the measured binding stoichiometries are likely to be affected upon exogenous overexpression compared to the corresponding endogenous protein .
although cell lines provide many advantages in terms of flexibility and scalability , they may not reflect molecular processes and signaling events occurring in vivo under physiological conditions ( astoul et al . , 2001 ) .
cellular transformation , clonal selection of cell lines , and adaptation to in vitro cell - culture conditions result in changes in protein abundances as well as in posttranslational modifications , which , in turn , are likely to affect the quality and kinetic behavior of signaling interaction networks as compared to primary cells .
therefore , it remains difficult to extend the conclusions reached in such cell lines to primary cells .
moreover , a given signaling pathway often operates in different cell types or at different developmental stages .
for instance , the t cell antigen receptor ( tcr ) functions both in the thymus during t cell development and in mature t cells found in secondary lymphoid organs .
it may , therefore , be hazardous to use models of tcr signaling established in mature t cells to interpret results corresponding to developing t cells ( fu et al . , 2014 ) . to circumvent these limitations
, we have developed knockin mice that bear an epitope tag that permits ap - ms of protein complexes isolated from primary cells belonging to various tissues or representing various developmental stages ( roncagalli et al . , 2014 ) .
growth - factor - receptor - bound protein 2 ( grb2 ) is an essential adaptor protein made of one sh2 domain and two sh3 domains .
grb2 interacts through its central sh2 domain with phosphorylated tyrosines found in the cytoplasmic tail of activated tyrosine kinase receptors ( rtks ) ( songyang et al . , 1994 ) , linking them to son of sevenless ( sos ) , a family of guanine nucleotide exchange factors ( gefs ) that act on ras small gtpases and regulate the mitogen - activated protein kinase ( mapk ) signaling pathway ( mccormick , 1993 ) . in t lymphocytes , grb2 is also part of the tcr signaling network and involved in both the control of t cell development and the activation of mature t cells ( jang et al . , 2009 ) .
given the central role played by grb2 in signal initiation and diversification , knowledge of the composition and dynamics of the signalosomes that form around it in distinct signaling cascades and cell types is , thus , key to understanding the scope of its actual functions .
we , therefore , selected grb2 as a model for evaluating whether swath ( sequential window acquisition of all theoretical fragment ion spectra)-ms ( gillet et al . , 2012 , gillet et al . , 2016 ) could enable rapid , reliable , and accurate quantitative analysis of protein interaction dynamics in two types of primary cells that were extemporaneously isolated from mouse ( figure 1 ) .
to identify the proteins that interact with grb2 prior to or after tcr - mediated activation of primary mouse t cells , we first generated a line of gene - targeted mice expressing a one - strep - tag ( ost ) at the carboxyl terminus of endogenous grb2 proteins ( called grb2 mice ) ( figure s1a ) .
we showed that primary t cells from grb2 mice are normal and amenable to ap - swath analysis ( figure s1 ; supplemental experimental procedures ) .
we then measured the abundance of affinity - purified proteins from grb2 mice and compared it with their corresponding abundances from ap using wild - type ( wt ) control mice , which do not express the ost affinity tag . cd4
primary t cells from grb2 and wt mice were lysed before or after activation with anti - cd3 and anti - cd4 antibodies for 0.5 , 2 , 5 , and 10 min and subjected to single - step ap and subsequent ms analysis .
our ms workflow involved data - dependent acquisition ( dda ) for protein identification and generation of a spectral library containing 3,577 target peptides and 25,356 transitions , which we used for targeted analysis of the acquired data - independent acquisition ( dia ) data . among the 658 proteins identified with a false discovery rate ( fdr ) < 1% , 53 qualified as high - confidence grb2 interactors based on their enrichment in grb2 relative to wt control purifications ( for details on filtering ,
see the supplemental experimental procedures ) . taking into account already described physical protein - protein interactions and incorporating protein functionalities and data provided by the literature allowed us to highlight protein modules potentially relevant to understanding the grb2 roles ( figure 2 ; data s1 ) .
although the cd4 t cells used in this study have been solely stimulated via the tcr and cd4 , the proteins associated with grb2 following tcr - cd4 engagement contained several transmembrane receptors distinct from the tcr .
the intracytoplasmic segment of most of them constitutes substrates for protein tyrosine kinase and may have thus provided docking sites for the grb2 sh2 domain .
consistent with published reports , itb2 , a subunit of the integrin lfa-1 , was part of the grb2 interactome .
interestingly , leuk ( also known as cd43 or leukosialin ) and the cd5 and cd6 cell - surface receptor constituted additions to the grb2 interactome .
following tcr - cd4 engagement , grb2 also interacted with the transmembrane adaptors lat and lax , the slp76 ( also known as lcp2 ) and grap2 cytosolic adaptors , and the gefs sos1 and sos2 and vav1 and vav3 , reinforcing the view that grb2 connects several receptors expressed at the surface of cd4 t cells to key players of t cell activation .
the grb2 interactome also comprised proteins involved in endocytosis ( wipf1 and sh3k1 ) , actin cytoskeleton remodeling ( the gtpase - activating proteins [ gaps ] arap1 and the adaptor shc1 ) , and lysosomal degradation ( the e3 ubiquitin - protein ligase cblb ) .
an ap - mrm - based study using egfr ( epidermal growth factor receptor)-stimulated fibroblasts also suggested that shc1 acts as a cytoskeleton organizer through the recruitment of ptpn12 ( also known as ptp - pest ) and peak1 ( also known as sgk269 ) , both of them having also been found in the grb2 interactome of primary t cells .
some grb2 interactors can be grouped in a distal module ( figure 2 ) that is primarily made of proteins containing nucleotide - binding domains , the function of which remains to be established in the context of tcr signaling .
overall , 22 of the 53 high - confidence interactors have not been previously reported , and 41 of them have not been previously observed in t cells ( figure 2 ; data s1 ) . whereas some of the 22 grb2-interacting partners identified here have been reported to be involved in t cell activation ( e.g. , satb1 and grab ) , several of them ( rpn1/2 , sh3l1 , and sc61b ) have not been characterized in the context of the tcr signaling pathway yet . to independently confirm the grb2 interactions identified through ap - swath , we performed co - immunoprecipitation ( co - ip ) and western blotting experiments and focused on cd5 and arap-1 , two grb2 partners identified in t cells for which commercial antibodies were available .
co - ip of cd5 and arap1 from cell lysates of wt cd4 t cells stimulated with anti - cd3 plus anti - cd4 antibodies for 2 min independently validated the interaction between cd5 and arap-1 with grb2 identified by ap - swath ( figure s3d ) .
cd5 is an important organizer of ubiquitylation following tcr stimulation ( voisinne et al . , 2016 ) , and
, these results and the ones provided by the ap - swath analysis of the grb2 molecule delineate comprehensive maps of the grb2 interactome in both resting and activated primary mouse cd4 t cells .
the development of methods that enable precise and robust quantitative measurements of protein abundances is important in facilitating statistics and downstream computational analysis for the identification of meaningful protein interaction patterns ( collins et al . , 2013 , lambert et al . , 2013 ) .
generation of highly precise and reproducible ap - swath data from primary cells is , therefore , crucial for understanding dynamic complex formation at the physiological level . here , we assessed the reproducibility of ap - swath analysis to quantify the dynamics of the grb2 interactome 0.5 , 2 , 5 , and 10 min after tcr - mediated t cell activation .
targeted analysis of ap - swath data was performed using a refined assay library consisting of 604 peptides and 4,020 transitions specific for grb2 and 53 high - confidence grb2 interactors identified earlier , followed by manual validation of the extracted peak groups in skyline ( maclean et al . , 2010 )
the 53 proteins were consistently quantified across the time series ( figures 3a and s4a ) , i.e. , before and after t cell stimulation , in all four biological replicates , and the median coefficient variation ( cv ) ranged from 19.7% to 33.2% , a finding comparable to cvs calculated from ap - swath studies conducted using transformed cell lines ( collins et al . , 2013 , lambert et al . , 2013 ) ( figure 3c ; data s1 ) . of note ,
highly reproducible and accurate quantification was not compromised using a short liquid chromatography ( lc ) gradient of 30 min , thereby enhancing the throughput of time course experiments ( figure s4e ) .
therefore , rapid and robust quantitative measurements of high - confidence , time - resolved grb2 protein interactions can be achieved from primary mouse cd4 t cells .
generation of robust quantitative measurements , together with transparency and reproducibility of downstream computational analysis including statistics analysis is fundamental for rigorous validation of findings within the scientific community from complex high - dimensional data ( peng , 2011 ) . toward this goal ,
ap - swath data were analyzed in this study using two open - source software systems : the graphical user interface msstats in skyline for raw data analysis ( choi et al . , 2014 ) and
the garuda platform for further data processing and visualization ( ghosh et al . , 2011 ) , both supporting reproducibility of statistics and computational analysis . using these software tools , we generated heatmaps , protein clusters , and statistics demonstrating that protein assemblies of increasing complexity formed around grb2 within the first seconds of t cell activation ( figures 3a , 3b , and s4 ) . among the clustered interactors ( figure s5 ) ,
77% were recruited by grb2 complexes post - stimulation , with significant fold changes ranging from 1.3 ( tpsn ; p = 0.012 ) to 118 ( lat ; p = 4 10 ) when compared to unstimulated t cells ( data s1 ) . more precisely , a subset of 18 interactors involving known components of the tcr signaling pathway ( e.g. , lat , lcp2 , sos1 , vav1 , and itk ) showed maximal association with grb2 30 s post - stimulation and then disassembled from the bait with different kinetics ( figures 3d and s4 ) .
interestingly , the adaptor shc1 was the sole protein that significantly reached its maximal association with grb2 at a later time point ( fold change = 14.3 , and p = 4 10 at 5 min after stimulation ) ( figure 3d ) .
in contrast , two proteins ( arap1 and ptpra ) disassembled from grb2 complexes after tcr stimulation ( figure 3d ) .
moreover , network - based analysis revealed a high level of functional interconnectivity between established components of the tcr signaling pathway and the clustered grb2 interactors ( figure s5 ) .
interestingly , prc2a ( proline rich coiled - coil 2a , also known as bat2 ) , a poorly characterized protein , strongly associated with grb2 30 s after t cell activation ( fold change = 6.1 ; p = 3.8 10 ) and slowly disassembled over time a kinetic similar to the one observed for well - established components of the tcr signaling pathway , e.g. , lat , sos1 , vav1 , slp-76/lcp2 , and cblb ( figure 3d ) . since functionally related proteins may show similar kinetics of assembly - disassembly in response to cell stimulation ( garca - marqus et al . , 2016 ) , this result suggests a role for prc2a in tcr signaling . collectively , these quantitative ap - swath data provided a systematic and accurate view of the temporal reorganization of the grb2 protein interaction network after tcr - mediated activation of peripheral cd4 t cells .
further experiments would be needed to assess the functional significance of these kinetics as well as the potential role of poorly characterized grb2 interactors in tcr - mediated t cell activation .
t cell development occurs in the thymus and proceeds through discrete stages defined on the basis of the expression of cd4 and cd8 molecules .
immature double - negative ( cd4cd8 ) thymocytes develop into double - positive ( cd4cd8 ) thymocytes . after receiving tcr - mediated signals ,
a few cd4cd8 thymocytes mature further into cd4 and cd8 single - positive thymocytes that migrate to the periphery , where they give rise to mature cd4 and cd8 t cells . considering that the tcr signals driving the differentiation of double - positive thymocytes are conveyed via grb2 ( radtke et al . , 2016 ) and that those thymocytes constitute over 90% of the tcr cd4 cells present in a thymus , we tested next whether the dynamics of the grb2 interactome differ between developing and mature t cells following activation with anti - cd3 plus anti - cd4 antibodies .
thymocytes were purified from grb2 mice and grb2-ost protein complexes isolated prior to and at various time points after tcr stimulation .
three biological replicates were prepared for each time point as described earlier for mature cd4 t cells .
the corresponding grb2 samples were subjected to swath - ms , and we concurrently analyzed the ap - swath datasets in skyline for quantitative comparison using the established high - confidence grb2-interactor - specific assay library ( data s1 ) . among the proteins that constituted the grb2 interactome ,
only 14 grb2 interactors were consistently detected in both developing and mature t cells and can , thus , be used for comparative analysis across the entire kinetic ( figures 4 and s6 ; data s1 ) .
the number of grb2 interactors identified in both mature and developing t cells is relatively low , and further experiments would be needed to evaluate whether many high - confidence grb2 interactors in developing t cells were lost during the experimental procedures .
nevertheless , similar temporal profiles were observed between developing and mature t cells for 6 of the 14 time - resolved grb2 interactors ( lat , grap , mpcp , prc2a , shc1 , and thms1 ) ( figures 4 and s6 ; data s1 and s2 ) .
for instance , shc1 associated with grb2 in a progressive fashion in both mature and developing t cells and reached maximal interaction with grb2 5 min post - tcr activation in both t cell populations ( figure 4b ) .
interaction profiles between grb2 and themis remained relatively stable across the time series in both mature and developing t cells ( figure 4b ) .
in contrast , arap1 , grap2 , m4k1 , ptpra , satb1 , ship1 , sos1 , and usb3a showed a significant differential kinetics of grb2 association between developing and mature t cells for at least one stimulation time point ( figures 4 and s6 ; data s1 ) .
for instance , the association of the receptor - protein tyrosine phosphatase ptpra with grb2 transiently increased in a significant manner 30
s after stimulation of developing t cells ( fold change = 1.94 , p = 0.005 ) , whereas a slight but significant transient dissociation of ptpra and grb2 was found in peripheral cd4 t cells ( fold change = 1.31 , p = 0.03 ) .
interestingly , this particular kinetic pattern was also observed with satb1 and arap1 ( figure s6 ) .
this observation might suggest the existence of a complex that involves grb2 , ptpra , satb1 , and arap1 , since correlations in protein association with a given bait as a function of time of tcr stimulation support the occurrence of physical association between them ( voisinne et al . , 2016 ) .
although further experiments would be needed to test this hypothesis , our results led us to conclude that the workflow presented in this study provided a sufficient level of quantitative accuracy to distinguish similar and differential protein interaction dynamics between two functionally distinct primary t cell populations .
canonical signaling pathways , as defined by the analysis of transformed cell lines grown in vitro , do not reflect the properties of cell - signaling systems operating in vivo in primary cell types of our tissues . given differential protein expression across tissues , it is conceivable that a canonical core pathway that acts in different tissues may operate in a context - specific fashion , leading to tissue - specific differences in the quality and kinetics of processes controlled by the signaling system .
this , in turn , may cause differential phenotypic consequences in response to the same cellular signal .
systematic analysis of context - dependent properties of signaling systems is , therefore , essential for rationalizing and predicting differential phenotypic outcome in response to the same signals across different tissues .
specific and dynamic formation of protein - protein interaction represents a key mechanism for regulating properties of cellular signaling .
however , building pathway models that correctly reflect the properties of a signaling system in primary cells on the basis of public protein interaction data is compromised by the shortcomings of established methods to systematically retrieve protein interaction data .
most systematic protein - protein interactions studies , to date , do not address the dynamic nature of protein complex formation .
moreover , the vast majority of data on protein interactions has been obtained by the analysis of a heterogeneous set of transformed cell lines , which complicates the development of coherent pathway models .
altogether , cell signaling depends on tissue - context - dependent formation of transient signaling complexes , but precise , quantitative , and reproducible information on context - specific complex formation is vastly missing in the literature . here
, we introduced a workflow that combines genetic engineering and swath - ms to address these shortcomings . using the sh2 and sh3 domains containing versatile signaling adaptor grb2 as a model
, we could demonstrate that the presented method provided a sufficient level of precision and robustness to accurately probe the remodeling of signaling complexes following the activation of primary t cells and established context dependencies of grb2-associated signaling in developing and mature t cells .
we anticipate that our generic method could be broadly applied to rapidly expedite the robust temporal profile of protein interactomes from a range of cell and tissue types . when combined with the recent possibility to edit the mouse genome in a fast - track manner via crispr / cas9 ( yang et al . , 2013 ) , our approach will permit the deciphering of how tissue - specific context impacts cell - signaling events at the organismal level .
a brief summary of experimental procedures is provided in the following text ( refer to the supplemental information for detailed procedures ) .
knockin mice expressing endogenous grb2 proteins tagged at their carboxyl terminus with an ost were generated as described in the supplemental experimental procedures .
mice were maintained in specific pathogen - free conditions , and all experiments were done in accordance with institutional committees and french and european guidelines for animal care .
cd4 t cells were isolated from pooled lymph nodes and spleens with a dynabeads untouched mouse cd4 t cell kit and were stimulated for 0.5 , 2 , 5 , and 10 min with anti - cd3 and anti - cd4 antibodies , followed by ap of grb2 protein complexes using strep - tactin sepharose beads .
data acquisition ( dda and dia modes ) , assay library generation , and targeted extraction of ap - swath data were performed as described previously ( collins et al . , 2013 , schubert et al . , 2015 ) ,
high - confidence grb2 interactors were identified using a three - step filtering with both dda and swath ap - ms data , followed by manual validation of high - confidence grb2 interactors in skyline ( see figures s2 and s3 ) .
statistical and computational analyses were performed using msstats in skyline ( broudy et al . , 2014 , choi et al . , 2014 ) and the garuda platform ( ghosh et al . , 2011 ) .
both skyline and garuda are open - source software systems supporting the reproducibility of statistics and computational analysis by the scientific community .
generated and analyzed the data and wrote a draft of the manuscript ; m.g.m . and
prepared ms samples ; b.m . supervised the generation of the grb2 mice ; i.f .- m .
designed the study and finalized the writing of the manuscript with contributions from all authors .
Output:
| summaryspatiotemporal organization of protein interactions in cell signaling is a fundamental process that drives cellular functions . given differential protein expression across tissues and developmental stages , the architecture and dynamics of signaling interaction proteomes is , likely , highly context dependent .
however , current interaction information has been almost exclusively obtained from transformed cells . in this study
, we applied an advanced and robust workflow combining mouse genetics and affinity purification ( ap)-swath mass spectrometry to profile the dynamics of 53 high - confidence protein interactions in primary t cells , using the scaffold protein grb2 as a model .
the workflow also provided a sufficient level of robustness to pinpoint differential interaction dynamics between two similar , but functionally distinct , primary t cell populations .
altogether , we demonstrated that precise and reproducible quantitative measurements of protein interaction dynamics can be achieved in primary cells isolated from mammalian tissues , allowing resolution of the tissue - specific context of cell - signaling events . |
PubmedSumm118480 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: they are the most common cause of severe long - term pain and physical disability , and affect hundreds of millions of people s quality of life all around the world .
osteoarthritis ( oa ) , a progressive , degenerative disease of the ( articular ) joints ( hips , knees , neck , lower back , or small joints of the hands ) , represents the most common musculoskeletal disease .
the etiology of the disease is not well understood and oa is considered a complex disease to which both genetic and acquired or environmental factors contribute .
misalignment of the joint and joint instability resulting from ( untreated ) cartilage defects , previous surgery ( e.g. , partial or total meniscectomy ) or from other traumas and injuries to the joint , as well as intensive loading due to obesity or intensive sports activities , are all particular risk factors to develop the disease .
oa affects all structures within the joint , but an early hallmark is a progressive degeneration of the articular cartilage accompanied by bony remodeling ( subchondral bone sclerosis and osteophyte formation ) , occasional flares of inflammation , mild synovitis ( in some patients ) , and osteitis .
localized loss of cartilage can increase focal stress across the joint leading to further cartilage destruction .
this then eventually results in a misalignment and destabilization of the whole joint and progression and aggravation of the disease
. early diagnosis of oa - associated cartilage alterations would be very beneficial for disease prevention and control , not at the least because current treatment of established oa is symptomatic and palliative with an emphasis on control of joint pain and maintenance of function .
the lack of a cure and associated huge unmet medical need provide an opportunity for the development of novel approaches and medicines to treat oa , especially for disease - modifying therapies that can halt and/or reverse the onset and progression of the disease .
however , the development of therapeutic approaches is largely hampered by the lack of quantifiable readouts in preclinical models .
refinement and validation of the readout technology for oa biology would be tremendously valuable for the animal studies on joint degeneration , and should allow us capturing subtle differences and thus broader hallmarks of the disease , carefully map the disease progression in the different tissues and animal models and , ultimately , asses the beneficial changes of those hallmarks when testing the candidate disease - modifying treatment . currently , preclinical efficacy of novel therapies for cartilage repair in small animal models is commonly assessed by histopathology .
the modified mankin scoring system is often used for semiquantitative histological assessment of oa because of its already widespread adoption , ease of use , and its similarity to scoring systems used for oa in humans .
this method focuses , among others , on the structural changes observed , such as lesions or brillations and losses in proteoglycan staining .
histopathology has a high discriminative power but is destructive , labor intensive , costly in terms of time and resources , and , in standard settings it only provides 2-dimensional ( 2d ) information because of the loss of data by the thickness of the sections , thus spatial and quantitative 3d assessment of the cartilage structure and quality are not feasible .
additionally , the modified mankin scoring is currently not annotated automatically , with consequent interreader variability .
the said limitations prompt the current need for a 3d imaging technique that is able to quantify the cartilage properties in the murine joint and can replace histopathology with a more efcient , high throughput , longitudinal imaging method .
recent advances in 3d imaging techniques , such as high - resolution microfocus x - ray computed tomography ( microct ) imaging , have led to successful quantification of the changes in the subchondral bone structure in the mouse knee joint during the progression of oa . the use of ionic partition equilibrium contrast agents , such as anionic ( i.e. , hexabrix ; covidien , hazelwood , mo ) or cationic contrast agents , as well as lead - based contrast agents have shown to allow quantification of functional and structural information of the cartilage . however , the limited spatial image resolution of most microct devices does not allow distinguishing calcified cartilage from the subchondral bone . additionally , most studies implementing new structural and functional readouts refrain to show equivalence to standard histopathological scorings
. moreover , although several 3d cartilage characteristics have been quantified , no validation compared with the golden standard of histopathological scoring was performed yet . in a previous study
, we evaluated the potency of contrast - enhanced nanofocus x - ray computed tomography ( ce - nanoct ) to simultaneously image in 3d the subtissue architecture of cartilage at high contrast and spatial image resolution without invasive , labor - intensive sample preparation . in this study , we have shown , in an established mouse model for oa , that ce - nanoct can be used as an imaging tool for virtual 3d histopathology . by direct comparison with standard histopathology
we showed equivalence of ce - nanoct images for the scoring of the structure , quality , and pathophysiology of the chondro - osseous junction .
additionally , the quantitative nature of the 3d ce - nanoct data sets allowed the development of an empirical model based on a limited set of 3d cartilage characteristics measured by 3d image analysis , which is predictive for the cartilage quality and structure as can be evaluated by histopathological scoring .
this model thus could be a potential replacement of or complimentary tool for the modified mankin scoring when assessing preclinical efficacy of novel therapies for cartilage repair .
destabilization of the medial meniscus ( dmm ) by medial meniscotibial ligament transection leads to mild oa with various degrees of cartilage lesions . to show the potential of ce - nanoct for virtual histopathology and 3d quantification of cartilage characteristics , 4 treatment groups were assessed .
right knee joints were harvested from adult ( rj : nmri - foxn1/foxn1 ) mice that were sham operated ( sham ) , or that underwent a medial meniscus destabilization procedure ( dmm ) and were sacrificed 8 weeks later . as a third group ( dmm / ha ) , right knee joints were harvested after 8 weeks from mice that underwent a dmm procedure and were injected after 2 and 5 weeks with hyaluronic acid , which is in clinical use as viscosupplementation treatment . a final group contained age - matched nonsurgical controls ( am ) .
we have worked with the nude mouse model to assess the effect of dmm on the cartilage structure and quality , because it allows testing a cellular therapy in the mouse using human cells ( ongoing work ) .
these 4 research - relevant groups were selected to obtain a broad spectrum of cartilage defects on a per - animal basis ( i.e. , from bad to unaffected ) that one might encounter in preclinical oa research , thus to show the potency of ce - nanoct to be implemented as a standard technique in the oa field rather than to interpret the biology behind dmm - induced oa .
all knee joints were imaged using ce - nanoct , after which some were randomly sampled to allow a comparison with the histological gold standard .
animal experiments were performed in accordance with the belgian legislation under the national authorization number la1210530 and were approved by the ethical committee of the faculty of biomedical sciences of ku leuven . to enable ce - nanoct from the 4 mouse knee joint groups ,
briefly , the knee joint capsules were dislocated to expose the tibial and femoral cartilage layers .
subsequently , all joints were immersed for 30 minutes in a solution of hexabrix 320 diluted 4/5 in phosphate - buffered saline , then wrapped in parafilm , and were stably positioned in the nanoct system . as the negatively charged ioxaglate of which
hexabrix 320 is partially composed , will be locally repelled by the anionic glycosaminoglycans ( sgag ) in the cartilage , ioxaglate accumulation in the cartilage is inversely related to the sgag content .
the nanoct system applied in this study was a phoenix nanotom s ( ge measurement and control solutions , munich , germany ) .
it was equipped with a tungsten target and was operated , for all scans , at a voltage of 60 kv and a current of 140 a .
the exposure time was 500 ms and a frame averaging of 1 and image skip of 0 was applied , resulting in a scanning time of 20 minutes per sample .
as described in kerckhofs et al . , to quantify the 3d characteristics of the noncalcified and underlying calcified cartilage layers , the cartilage region was selected using ctan software ( bruker micro - ct , kontich , belgium ) by manually drawing a consistent region of interest ( roi ) in every 20th cross - section throughout the whole tibial plateau . briefly , delineating the total cartilage area ( i.e. , both noncalcified and calcified ) was performed based on ( a ) the difference in grayscale between the noncalcified cartilage and the surrounding ( i.e. , liquid ) and ( b ) the difference in structure compared with the subchondral bone and noncalcified cartilage for the calcified cartilage ( i.e. , having a porous structure ) .
after automatic otsu segmentation , the noncalcified and calcified cartilage were segmented and analyzed in 3d by calculating the volume , the thickness distribution , and the average thickness .
dataviewer ( bruker micro - ct , kontich , belgium ) was used on the ce - nanoct images to perform the modified mankin scoring for cartilage structure and quality , as well as to quantify the loss in sgag content . after ce - nanoct imaging , a set of representative knee joints were processed for histology .
they were fixed in 10% formalin , decalcified in 4% formic acid , and embedded in paraffin .
sections of 5 m were made every 60 m and were stained with safranin - o and counterstained with fast green .
the medial side of the tibial plateau in the histological sections ( n = 10 per joint ) and coronal ce - nanoct images ( n = 10 with a 60 m interspacing ) was graded using a modified mankin scoring system specifically for cartilage structure and quality . in brief , for both the histological sections and the ce - nanoct images , articular cartilage structure was graded from 0 to 11 . concerning the cartilage quality , the safranin - o staining for the histological sections and the hexabrix staining for the ce - nanoct images were graded between 0 and 8 . for both parameters , grade
a grade of 11 for the cartilage structure was indicative for clefts / loss of articular cartilage extending into the subchondral bone .
grade 8 for cartilage quality implied a severe loss in safranin - o ( or increase in hexabrix ) staining in more than half of the depth of the noncalcified cartilage thickness and involving more than half of the plateau .
grades of each sample ( n = 10 ) were averaged and summed for the 2 scoring parameters , whereby 0 represented completely unaffected hyaline cartilage and the maximum mankin score of 19 represented a highly degenerated oa knee . to quantify the sgag content in the hyaline cartilage , the intensity of the hexabrix excluded signal in the noncalcified layer of the hyaline cartilage was normalized to the signal of the growth plate cartilage ( i.e. , in the same coronal ce - nanoct cross - sections ) .
a grayscale histogram was plotted along an arbitrary 600 m line through the noncalcified cartilage on the medial side of the tibial plateau ( fig .
the normalized sgag content in the cartilage compared to the healthy growth plate cartilage was then calculated according to equation ( 1 ) .
the normalized sgag content was measured in the same coronal ce - nanoct cross - sections as used for the modified making scoring .
( a ) a typical coronal contrast - enhanced nanofocus computed tomography ( ce - nanoct ) image and ( b ) the corresponding grayscale histogram along the white line drawn in ( a ) through the noncalcified cartilage on the medial ( left ) side of the tibial plateau ( gray curve ) with the average grayscale value ( black curve ) .
( c ) a typical coronal ce - nanoct image and ( d , e ) the corresponding grayscale histograms ( d ) along the white line annotated with 1 drawn in ( c ) through the background of the image ( gray curve ) with the average grayscale value ( black curve ) and ( e ) along the white line annotated with 2 drawn in ( c ) through the growth plate cartilage ( gray curve ) with the average grayscale value ( black curve ) .
1b ) along an arbitrary line through the noncalcified cartilage on the medial side of the tibial plateau ( fig .
1d ) along a 600 m long line through the background in the same image ( i.e. , liquid , fig .
1e ) along a 400 m long line through the growth plate cartilage in the same image ( fig .
a computational model was used to determine whether a combined set of morphological cartilage characteristics could quantitatively and in 3d predict the level of cartilage damage in a comparative manner to histological cartilage pathology scoring ( using the modified mankin scoring as a measure for cartilage structure and quality ) .
a linear modeling formalism was used that was already shown to be capable of relating quantitative contributions of multiple signals to a ( single ) measured response , namely partial least square regression ( plsr ) .
plsr is able to identify the information content within the set of measured characteristics that most closely maps onto the output response ( i.e. , modified mankin score ) .
the resulting mapping of lumped signals to corresponding responses allowed to identify the most important structural cartilage characteristics
plsr uses linear algebra to reduce the dimensionality of multivariate data sets by defining principal component axes from the original data set that contain the most important information on a specific output variable . for the optimization of the number of model dimensions ,
the root mean squared error ( rmse ) between the measured level of cartilage damage and the level predicted by plsr models with increasing numbers of principal components was investigated .
each cartilage characteristic was individually withheld from the training set to construct a cross - validation model , in which an rmse of the prediction could be assessed by predicting the withheld sample . the predicted rmse was minimal in this study when using two principal components . to generate the plsr model , the software package jmp 8 ( sas institute inc .
statistical analysis was done using a statistical software add - in for microsoft excel for windows , namely , analyse - it version 2.26 excel 12 + .
to evaluate the significance level between the groups , one - way analyses of variance were used with a confidence level of 95% .
destabilization of the medial meniscus ( dmm ) by medial meniscotibial ligament transection leads to mild oa with various degrees of cartilage lesions . to show the potential of ce - nanoct for virtual histopathology and 3d quantification of cartilage characteristics , 4 treatment groups were assessed .
right knee joints were harvested from adult ( rj : nmri - foxn1/foxn1 ) mice that were sham operated ( sham ) , or that underwent a medial meniscus destabilization procedure ( dmm ) and were sacrificed 8 weeks later . as a third group ( dmm / ha ) , right knee joints were harvested after 8 weeks from mice that underwent a dmm procedure and were injected after 2 and 5 weeks with hyaluronic acid , which is in clinical use as viscosupplementation treatment . a final group contained age - matched nonsurgical controls ( am ) .
we have worked with the nude mouse model to assess the effect of dmm on the cartilage structure and quality , because it allows testing a cellular therapy in the mouse using human cells ( ongoing work ) .
these 4 research - relevant groups were selected to obtain a broad spectrum of cartilage defects on a per - animal basis ( i.e. , from bad to unaffected ) that one might encounter in preclinical oa research , thus to show the potency of ce - nanoct to be implemented as a standard technique in the oa field rather than to interpret the biology behind dmm - induced oa .
all knee joints were imaged using ce - nanoct , after which some were randomly sampled to allow a comparison with the histological gold standard .
animal experiments were performed in accordance with the belgian legislation under the national authorization number la1210530 and were approved by the ethical committee of the faculty of biomedical sciences of ku leuven .
to enable ce - nanoct from the 4 mouse knee joint groups , samples were processed as described in kerckhofs et al .
briefly , the knee joint capsules were dislocated to expose the tibial and femoral cartilage layers .
subsequently , all joints were immersed for 30 minutes in a solution of hexabrix 320 diluted 4/5 in phosphate - buffered saline , then wrapped in parafilm , and were stably positioned in the nanoct system . as the negatively charged ioxaglate of which hexabrix 320 is partially composed , will be locally repelled by the anionic glycosaminoglycans ( sgag ) in the cartilage , ioxaglate accumulation in the cartilage is inversely related to the sgag content .
the nanoct system applied in this study was a phoenix nanotom s ( ge measurement and control solutions , munich , germany ) .
it was equipped with a tungsten target and was operated , for all scans , at a voltage of 60 kv and a current of 140 a .
the exposure time was 500 ms and a frame averaging of 1 and image skip of 0 was applied , resulting in a scanning time of 20 minutes per sample .
as described in kerckhofs et al . , to quantify the 3d characteristics of the noncalcified and underlying calcified cartilage layers , the cartilage region was selected using ctan software ( bruker micro - ct , kontich , belgium ) by manually drawing a consistent region of interest ( roi ) in every 20th cross - section throughout the whole tibial plateau . briefly , delineating the total cartilage area ( i.e. , both noncalcified and calcified ) was performed based on ( a ) the difference in grayscale between the noncalcified cartilage and the surrounding ( i.e. , liquid ) and ( b ) the difference in structure compared with the subchondral bone and noncalcified cartilage for the calcified cartilage ( i.e. , having a porous structure ) .
the roi was automatically interpolated for the 19 intermediate cross - sections . after automatic otsu segmentation ,
the noncalcified and calcified cartilage were segmented and analyzed in 3d by calculating the volume , the thickness distribution , and the average thickness .
dataviewer ( bruker micro - ct , kontich , belgium ) was used on the ce - nanoct images to perform the modified mankin scoring for cartilage structure and quality , as well as to quantify the loss in sgag content .
after ce - nanoct imaging , a set of representative knee joints were processed for histology .
they were fixed in 10% formalin , decalcified in 4% formic acid , and embedded in paraffin .
sections of 5 m were made every 60 m and were stained with safranin - o and counterstained with fast green .
the medial side of the tibial plateau in the histological sections ( n = 10 per joint ) and coronal ce - nanoct images ( n = 10 with a 60 m interspacing ) was graded using a modified mankin scoring system specifically for cartilage structure and quality . in brief , for both the histological sections and the ce - nanoct images , articular cartilage structure was graded from 0 to 11 . concerning the cartilage quality , the safranin - o staining for the histological sections and the hexabrix staining for the ce - nanoct images were graded between 0 and 8 . for both parameters , grade
a grade of 11 for the cartilage structure was indicative for clefts / loss of articular cartilage extending into the subchondral bone .
grade 8 for cartilage quality implied a severe loss in safranin - o ( or increase in hexabrix ) staining in more than half of the depth of the noncalcified cartilage thickness and involving more than half of the plateau .
grades of each sample ( n = 10 ) were averaged and summed for the 2 scoring parameters , whereby 0 represented completely unaffected hyaline cartilage and the maximum mankin score of 19 represented a highly degenerated oa knee .
to quantify the sgag content in the hyaline cartilage , the intensity of the hexabrix excluded signal in the noncalcified layer of the hyaline cartilage was normalized to the signal of the growth plate cartilage ( i.e. , in the same coronal ce - nanoct cross - sections ) .
a grayscale histogram was plotted along an arbitrary 600 m line through the noncalcified cartilage on the medial side of the tibial plateau ( fig .
the normalized sgag content in the cartilage compared to the healthy growth plate cartilage was then calculated according to equation ( 1 ) .
the normalized sgag content was measured in the same coronal ce - nanoct cross - sections as used for the modified making scoring .
( a ) a typical coronal contrast - enhanced nanofocus computed tomography ( ce - nanoct ) image and ( b ) the corresponding grayscale histogram along the white line drawn in ( a ) through the noncalcified cartilage on the medial ( left ) side of the tibial plateau ( gray curve ) with the average grayscale value ( black curve ) .
( c ) a typical coronal ce - nanoct image and ( d , e ) the corresponding grayscale histograms ( d ) along the white line annotated with 1 drawn in ( c ) through the background of the image ( gray curve ) with the average grayscale value ( black curve ) and ( e ) along the white line annotated with 2 drawn in ( c ) through the growth plate cartilage ( gray curve ) with the average grayscale value ( black curve ) .
1b ) along an arbitrary line through the noncalcified cartilage on the medial side of the tibial plateau ( fig .
1d ) along a 600 m long line through the background in the same image ( i.e. , liquid , fig .
1e ) along a 400 m long line through the growth plate cartilage in the same image ( fig .
in this study , a computational model was used to determine whether a combined set of morphological cartilage characteristics could quantitatively and in 3d predict the level of cartilage damage in a comparative manner to histological cartilage pathology scoring ( using the modified mankin scoring as a measure for cartilage structure and quality ) .
a linear modeling formalism was used that was already shown to be capable of relating quantitative contributions of multiple signals to a ( single ) measured response , namely partial least square regression ( plsr ) .
plsr is able to identify the information content within the set of measured characteristics that most closely maps onto the output response ( i.e. , modified mankin score ) .
the resulting mapping of lumped signals to corresponding responses allowed to identify the most important structural cartilage characteristics
plsr uses linear algebra to reduce the dimensionality of multivariate data sets by defining principal component axes from the original data set that contain the most important information on a specific output variable . for the optimization of the number of model dimensions ,
the root mean squared error ( rmse ) between the measured level of cartilage damage and the level predicted by plsr models with increasing numbers of principal components was investigated . each cartilage characteristic was individually withheld from the training set to construct a cross - validation model , in which an rmse of the prediction could be assessed by predicting the withheld sample . the predicted rmse was minimal in this study when using two principal components . to generate the plsr model , the software package jmp 8 ( sas institute inc . , cary , nc ) was used .
statistical analysis was done using a statistical software add - in for microsoft excel for windows , namely , analyse - it version 2.26 excel 12 + . to evaluate the significance level between the groups , one - way analyses of variance were used with a confidence level of 95% .
in kerckhofs et al . , it was already shown that ce - nanoct has a similar discriminative power as histology with safranin - o staining to differentiate bone , noncalcified and calcified cartilage in mouse knee joints , and to identify and assess local alterations in cartilage sgag content ( i.e. , a decrease in sgag content vs. chondral lesions ) . to validate the potency of the ce - nanoct images to be used for the modified mankin scores , that is , the gold standard for histological assessment with safranin - o staining , these scores were determined on the histological sections and on the ce - nanoct coronal sections ( fig .
since full histological scoring was only performed on animals that were not imaged by ce - nanoct , no comparison for the same animal was possible .
however , figure 2a shows that , within one treatment group , there were no significant differences between the histology - based and the ce - nanoct - based scoring for cartilage structure .
this supports the equivalence of ce - nanoct images to safranin - o stained histological sections for modified mankin score determination .
the apparent difference between both scores was rather a result of the large variability in manifestations of the symptoms between different animals within one treatment group .
( a ) the modified mankin ( mm ) scoring for the cartilage structure , determined on histological and contrast - enhanced nanofocus computed tomography ( ce - nanoct ) sections for the different treatments groups .
the animals used for the histological scoring ( n = 3 or 4 per group ) were not the same individuals that than the ones assessed by the ce - nanoct scoring ( n = 3 or 4 per group ) .
the score for the cartilage structure only and the sum for cartilage structure and quality are shown for the different treatments groups .
( c ) correlation plot between the percentage of sgag ( anionic glycosaminoglycans ) loss normalized to the growth plate cartilage and the mm scoring for the cartilage quality ( as measured by hexabrix staining intensity ) , both determined on the individual 2-dimensional sectional ce - nanoct images throughout the different treatments groups and ( d ) the same correlation plot as ( c ) but the % sgag loss and mm score were averaged over all scored sections of each animal ( n = 10 ) .
the modified mankin subscore for the cartilage structure on the 2d ce - nanoct images , as well as the sum of the cartilage structure and quality ( fig .
2b ) , showed significant differences between the am group and the animals that had undergone a dmm procedure ( i.e. , dmm and dmm / ha ) , as well as between the sham - operated group and the group that had received a 2-fold injection of hyaluronic acid after dmm ( i.e. , dmm / ha ) .
this indicates that for the 4 different groups , having a broad spectrum of cartilage defects ( i.e. , from bad in case of the dmm group to almost unaffected for the am and sham - operated groups ) , ce - nanoct provides valid readouts over this whole range , thus showing the potency of ce - nanoct to be implemented as a standard technique for evaluation and quantification of cartilage damage in the oa field .
next , instead of visually scoring in a semiquantitative way the degree of noncalcified cartilage staining in the ce - nanoct images , as was done for the modified mankin subscore for cartilage quality , the normalized sgag loss was quantified by image analysis on the same images ( fig .
every data point in figure 2c represents one ce - nanoct image . for the dmm group , ce - nanoct images with both a low and a high modified mankin scoring ( and sgag loss )
although a strong correlation ( r = 0.79 ) was found between this analysis and the cartilage quality score , the latter sometimes varied for the same percentage of normalized sgag loss .
moreover , for the same cartilage quality score , a range in percentage of normalized sgag loss was found , thus showing the higher sensitivity of the quantification of the normalized sgag loss by ce - nanoct image analysis compared to the modified mankin scoring for cartilage quality . when plotting the averaged modified mankin score per animal ( n = 10 ) , an even higher correlation was found ( r = 0.92 ) . within the dmm group ,
some animals had a high modified mankin scoring ( and sgag loss ) , while there was one animal that had a modified mankin scoring ( and sgag loss ) comparable to animals in the sham and dmm / ha groups .
ce - nanoct scoring thus allows not only to discriminate intact versus highly damaged cartilage ( fig .
the in vivo medial meniscus destabilization , which serves as a model for oa , is characterized by cartilage lesions of various degrees of severities on the medial side ( fig .
, creating 3d ce - nanoct models of the different cartilaginous layers allowed a straightforward quantification of the defects . a representative ( a ) cross - sectional ,
( b ) coronal , and ( c ) sagittal contrast - enhanced nanofocus computed tomography ( ce - nanoct ) image of a tibial plateau of a mouse of which 8 weeks in vivo medial meniscus destabilization ( dmm ) resulted in a local chondral defect ( indicated by the crossed lines ) .
scale bars = 1 mm . while no significant differences were found between the different groups for both calcified cartilage volume ( fig .
4b ) , the overlying noncalcified hyaline cartilage showed significant differences between the dmm group and all other groups .
( a ) the volume and ( b ) average thickness of noncalcified and calcified cartilage on the medial tibial plateau of the 4 different treatments groups ( n = 3 or 4 ) ( p < 0.05 = significantly different ) , based on quantitative analysis of 3-dimensional ce - nanoct images . the data for the sham and dmm ( destabilization of the medial meniscus ) group have already been presented in kerckhofs et al .
the averaged thickness distribution plots ( n = 3 or 4 per group ) of noncalcified and calcified cartilage ( fig . 5a and b , respectively ) showed similar findings . for the calcified cartilage thickness , the distribution plots for all different treatment groups coincided , and the distribution maxima were not significantly different ( fig .
the noncalcified cartilage thickness of the dmm group displayed a wide spread distribution with a higher frequency of small thicknesses compared with the other groups ( fig .
5a ) , reflecting a higher presence of thinner cartilage ( in particular lesions ) and loss of sgags throughout the noncalcified cartilage . consequently , the maximum of the distribution
the ( a ) noncalcified and ( b ) underlying calcified cartilage thickness distribution on the medial tibial plateau of the different treatments groups ( n = 3 or 4 ) .
the data for the sham and dmm ( destabilization of the medical meniscus ) group have already been presented in kerckhofs et al .
plot averaged per animal group ( n = 3 or 4 ) , both for the noncalcified and calcified cartilage layers ( p < 0.05 = significantly different ) . to determine whether a specific combination of quantitative 3d structural and quality cartilage parameters could quantitatively predict the severity of cartilage damage as determined by the modified mankin scoring for cartilage structure and quality , a plsr model was developed .
the resulting 2-component plrs model was used to examine the correlation between the measured modified mankin score , as was assessed by multiple blinded readers on histological sections , and the predictions for each 3d cartilage parameter ( fig .
the plsr model combined the ( a ) noncalcified hyaline cartilage volume , ( b ) maximum of the noncalcified cartilage thickness distribution , and ( c ) averaged normalized sgag loss ( fig .
a high predictability of 90.26% was obtained for the model . including more measured characteristics ( e.g. , total cartilage volume [ noncalcified and calcified cartilage ] , average thickness of the total cartilage layer , and calcified cartilage volume and average thickness ) led to a lower predictability of the model due to inclusion of irrelevant information ( noise ) .
inclusion of less measurement characteristics than the 3 mentioned above also led to a reduction in predictability due to the omission of relevant information .
( a ) the measured modified mankin ( mm ) score versus the cross - validated predictions for each 3-dimensional cartilage parameter , ( b ) the residuals for the cross - validated predictions , and ( c ) the three 3-dimensional cartilage parameters that comprise the partial least square regression model , resulting in the following predictive equation : mm scoring = 3.55 + 33.70 * ( noncalcified cartilage volume in mm ) 0.0375 * ( maximum of the noncalcified cartilage thickness distribution plot in m ) + 14.41 * ( average sgag loss , nondimensional value ) .
in kerckhofs et al . , it was already shown that ce - nanoct has a similar discriminative power as histology with safranin - o staining to differentiate bone , noncalcified and calcified cartilage in mouse knee joints , and to identify and assess local alterations in cartilage sgag content ( i.e. , a decrease in sgag content vs. chondral lesions ) . to validate the potency of the ce - nanoct images to be used for the modified mankin scores , that is , the gold standard for histological assessment with safranin - o staining , these scores were determined on the histological sections and on the ce - nanoct coronal sections ( fig .
since full histological scoring was only performed on animals that were not imaged by ce - nanoct , no comparison for the same animal was possible .
however , figure 2a shows that , within one treatment group , there were no significant differences between the histology - based and the ce - nanoct - based scoring for cartilage structure .
this supports the equivalence of ce - nanoct images to safranin - o stained histological sections for modified mankin score determination .
the apparent difference between both scores was rather a result of the large variability in manifestations of the symptoms between different animals within one treatment group .
( a ) the modified mankin ( mm ) scoring for the cartilage structure , determined on histological and contrast - enhanced nanofocus computed tomography ( ce - nanoct ) sections for the different treatments groups .
the animals used for the histological scoring ( n = 3 or 4 per group ) were not the same individuals that than the ones assessed by the ce - nanoct scoring ( n = 3 or 4 per group ) .
the score for the cartilage structure only and the sum for cartilage structure and quality are shown for the different treatments groups .
( c ) correlation plot between the percentage of sgag ( anionic glycosaminoglycans ) loss normalized to the growth plate cartilage and the mm scoring for the cartilage quality ( as measured by hexabrix staining intensity ) , both determined on the individual 2-dimensional sectional ce - nanoct images throughout the different treatments groups and ( d ) the same correlation plot as ( c ) but the % sgag loss and mm score were averaged over all scored sections of each animal ( n = 10 ) .
the modified mankin subscore for the cartilage structure on the 2d ce - nanoct images , as well as the sum of the cartilage structure and quality ( fig .
2b ) , showed significant differences between the am group and the animals that had undergone a dmm procedure ( i.e. , dmm and dmm / ha ) , as well as between the sham - operated group and the group that had received a 2-fold injection of hyaluronic acid after dmm ( i.e. , dmm / ha ) .
this indicates that for the 4 different groups , having a broad spectrum of cartilage defects ( i.e. , from bad in case of the dmm group to almost unaffected for the am and sham - operated groups ) , ce - nanoct provides valid readouts over this whole range , thus showing the potency of ce - nanoct to be implemented as a standard technique for evaluation and quantification of cartilage damage in the oa field .
next , instead of visually scoring in a semiquantitative way the degree of noncalcified cartilage staining in the ce - nanoct images , as was done for the modified mankin subscore for cartilage quality , the normalized sgag loss was quantified by image analysis on the same images ( fig .
every data point in figure 2c represents one ce - nanoct image . for the dmm group , ce - nanoct images with both a low and a high modified mankin scoring ( and sgag loss )
although a strong correlation ( r = 0.79 ) was found between this analysis and the cartilage quality score , the latter sometimes varied for the same percentage of normalized sgag loss .
moreover , for the same cartilage quality score , a range in percentage of normalized sgag loss was found , thus showing the higher sensitivity of the quantification of the normalized sgag loss by ce - nanoct image analysis compared to the modified mankin scoring for cartilage quality . when plotting the averaged modified mankin score per animal ( n = 10 ) , an even higher correlation was found ( r = 0.92 ) . within the dmm group ,
some animals had a high modified mankin scoring ( and sgag loss ) , while there was one animal that had a modified mankin scoring ( and sgag loss ) comparable to animals in the sham and dmm / ha groups .
ce - nanoct scoring thus allows not only to discriminate intact versus highly damaged cartilage ( fig .
the in vivo medial meniscus destabilization , which serves as a model for oa , is characterized by cartilage lesions of various degrees of severities on the medial side ( fig .
, creating 3d ce - nanoct models of the different cartilaginous layers allowed a straightforward quantification of the defects . a representative ( a ) cross - sectional , ( b ) coronal , and ( c ) sagittal contrast - enhanced nanofocus computed tomography ( ce - nanoct ) image of a tibial plateau of a mouse of which 8 weeks in vivo medial meniscus destabilization ( dmm ) resulted in a local chondral defect ( indicated by the crossed lines ) .
scale bars = 1 mm . while no significant differences were found between the different groups for both calcified cartilage volume ( fig .
4b ) , the overlying noncalcified hyaline cartilage showed significant differences between the dmm group and all other groups .
( a ) the volume and ( b ) average thickness of noncalcified and calcified cartilage on the medial tibial plateau of the 4 different treatments groups ( n = 3 or 4 ) ( p < 0.05 = significantly different ) , based on quantitative analysis of 3-dimensional ce - nanoct images . the data for the sham and dmm ( destabilization of the medial meniscus ) group have already been presented in kerckhofs et al .
the averaged thickness distribution plots ( n = 3 or 4 per group ) of noncalcified and calcified cartilage ( fig . 5a and b , respectively ) showed similar findings .
for the calcified cartilage thickness , the distribution plots for all different treatment groups coincided , and the distribution maxima were not significantly different ( fig .
the noncalcified cartilage thickness of the dmm group displayed a wide spread distribution with a higher frequency of small thicknesses compared with the other groups ( fig .
5a ) , reflecting a higher presence of thinner cartilage ( in particular lesions ) and loss of sgags throughout the noncalcified cartilage . consequently ,
plot for the am group was significantly different compared with the other groups . the ( a ) noncalcified and ( b ) underlying calcified cartilage thickness distribution on the medial tibial plateau of the different treatments groups ( n = 3 or 4 ) .
the data for the sham and dmm ( destabilization of the medical meniscus ) group have already been presented in kerckhofs et al .
plot averaged per animal group ( n = 3 or 4 ) , both for the noncalcified and calcified cartilage layers ( p < 0.05 = significantly different ) .
to determine whether a specific combination of quantitative 3d structural and quality cartilage parameters could quantitatively predict the severity of cartilage damage as determined by the modified mankin scoring for cartilage structure and quality , a plsr model was developed .
the resulting 2-component plrs model was used to examine the correlation between the measured modified mankin score , as was assessed by multiple blinded readers on histological sections , and the predictions for each 3d cartilage parameter ( fig .
the plsr model combined the ( a ) noncalcified hyaline cartilage volume , ( b ) maximum of the noncalcified cartilage thickness distribution , and ( c ) averaged normalized sgag loss ( fig .
a high predictability of 90.26% was obtained for the model . including more measured characteristics ( e.g. , total cartilage volume [ noncalcified and calcified cartilage ] , average thickness of the total cartilage layer , and calcified cartilage volume and average thickness ) led to a lower predictability of the model due to inclusion of irrelevant information ( noise ) .
inclusion of less measurement characteristics than the 3 mentioned above also led to a reduction in predictability due to the omission of relevant information .
( a ) the measured modified mankin ( mm ) score versus the cross - validated predictions for each 3-dimensional cartilage parameter , ( b ) the residuals for the cross - validated predictions , and ( c ) the three 3-dimensional cartilage parameters that comprise the partial least square regression model , resulting in the following predictive equation : mm scoring = 3.55 + 33.70 * ( noncalcified cartilage volume in mm ) 0.0375 * ( maximum of the noncalcified cartilage thickness distribution plot in m ) + 14.41 * ( average sgag loss , nondimensional value ) .
current diagnostics for oa usually do not discover the disease until it is in advanced stages when joint damage may already have occurred and the patient presents with pain . a method for early diagnosis could open a window of opportunity for prevention , thereby reducing further damage . measuring subtle alterations in cartilage structure and quality
is equally needed to evaluate the ( pre)clinical efficacy of new treatment options for cartilage damage .
small animal models of oa are essential and thus quantitative readouts with functional relevance are key for advancing skeletal research . nowadays , preclinical efficacy of novel therapies for cartilage repair in small animal models is still commonly assessed by histopathology , and quantified by using scoring systems such as the modified mankin scoring .
such scoring systems are already in clinical use to assess the severity of the cartilage damage .
although validated for being an accurate and user - independent technique , histopathology remains a visual , subjective , and nonquantitative scoring approach and might not allow one to distinguish small differences in therapeutic response because of the restricted 2d character . as demonstrated in kerckhofs
, ce - nanoct provides equivalent images compared to safranin - o staining on histological sections , with a high contrast between noncalcified and calcified cartilage . in this study
, we have shown that this allows performing the modified mankin scoring also on ce - nanoct images of a murine knee joint , which can be assessed immediately as it avoids time - consuming and destructive histoprocessing steps , such as decalcification , embedding , or sectioning , which may take several weeks or , for larger species , even months
. moreover , ce - nanoct generates much more sections throughout the tibial plateau than histology and allows objective and quantitative scoring .
grayscale quantification of the noncalcified cartilage has shown a good correlation with the modified mankin scoring for cartilage quality , with the advantage of being user independent and quantitative .
although in this study the calculation of the normalized sgag content was still limited to manual image analysis , by implementation of more sophisticated image analysis algorithms this could evolve toward a semiautomated tool . therefore , ce - nanoct is a valuable tool for virtual histopathology .
it has to be mentioned that , when the noncalcified cartilage is fully depleted of sgags , the ce - nanoct images might not allow detection of the difference with a cartilage lesion , and histological sectioning might be required .
however , as shown by the quantitative measurements of the sgag loss based on the hexabrix staining , very low concentrations of sgags can still be discriminated from the conditions where cartilage is absent or fully depleted of sgags .
additionally , ce - nanoct does not yet allow visualization of the cartilage at the cellular level .
ce - nanoct also allows , because of its 3d character , analysis of different morphological parameters of the bone cartilage unit .
although many studies have used epic - ct ( i.e. , equilibrium partitioning of an ionic contrast agent via microct ) images to quantify 3d cartilage parameters , their correlation to validated histopathological scoring techniques has not been shown . nor has it been shown which of the measured 3d cartilage parameters should be included to correlate with validated histological scores . in this study , we have shown , using plsr modeling , that a limited set of easily quantifiable 3d morphological parameters ( volume and maximum thickness of the noncalcified cartilage and the averaged normalized sgag loss ) is predictive for the mm scoring of the cartilage structure and quality .
these 3d parameters are thus minimally required to draw conclusions on the severity of the damage of the articular cartilage in the knee joint .
the model could potentially replace the mm scoring based on visual inspection as the latter does not involve any quantification of cartilage quality or structure .
the 3d measurements give more information on size and shape ( and thus severity ) of the cartilage damage compared with 2d histopathology . in this study
however , as microct images ( and thus also ce - nanoct ) do allow for this quantification , including these analyses in the plsr model could even enhance the correlation of the ce nanoct analysis with the gold standard mm scoring above 90% . finally , this study assessed 4 treatment groups using ce - nanoct that were selected because they serve in many studies as control groups to assess the efficacy of a cell therapy for cartilage repair , and they represent a broad range of cartilage defects ( i.e. , from bad to unaffected ) .
mice with a destabilized meniscus displayed lesions with different degrees of severity and loss in sgag content .
twofold injection of hyaluronic acid after dmm ( dmm / ha ) was proven to be a valid positive control group for this model and follow - up period , since the cartilage characteristics , both determined in 2d and 3d , were similar to the ones of nonoperated or sham - operated animals .
ce - nanoct - based virtual histopathology and 3d morphological quantification of a limited set of 3d cartilage parameters allowed us to distinguish the 4 groups , and thus it is a valid tool to be implemented as a standard technique for the evaluation and quantification of cartilage damage in the oa field .
this study has shown the potential of a noninvasive 3d imaging methodology , namely ce - nanoct , for virtual 3d histopathology as it provides images equivalent to safranin - o - stained histological sections of murine knee joints .
because of its noninvasive and 3d character , and because it reveals differences in structure and composition between calcified , noncalcified cartilage , and the underlying bone in small animal models with high spatial and contrast resolution , ce - nanoct provides faster and more quantitative data on cartilage structure and quality compared with standard histopathology .
moreover , it was shown that a limited set of these quantitative 3d measures is able to reproduce the standard histopathological scoring , with the advantage of being user independent and semiautomated , thus being a potential replacement of the histopathological scoring . to conclude
, ce - nanoct has demonstrated its equivalence to standard histopathology in preclinical small animal studies addressing cartilage - related pathologies and therapeutic interventions .
Output:
| objective : one of the early hallmarks of osteoarthritis ( oa ) is a progressive degeneration of the articular cartilage
. early diagnosis of oa - associated cartilage alterations would be beneficial for disease prevention and control , and for the development of disease - modifying treatments .
however , early diagnosis is still hampered by a lack of quantifiable readouts in preclinical models.design:in this study , we have shown the potency of contrast - enhanced nanofocus x - ray computed tomography ( ce - nanoct ) to be used for virtual 3-dimensional ( 3d ) histopathology in established mouse models for oa , and we compared with standard histopathology.results:we showed the equivalence of ce - nanoct images to histopathology for the modified mankin scoring of the cartilage structure and quality .
additionally , a limited set of 3d cartilage characteristics measured by ce - nanoct image analysis in a user - independent and semiautomatic manner , that is , average and maximum of the noncalcified cartilage thickness distribution and loss in glycosaminoglycans , was shown to be predictive for the cartilage quality and structure as can be evaluated by histopathological scoring through the use of an empirical model.conclusions:we have shown that ce - nanoct is a tool that allows virtual histopathology and 3d morphological quantification of multitissue systems , such as the chondro - osseous junction .
it provides faster and more quantitative data on cartilage structure and quality compared with standard histopathology while eliminating user bias .
ce - nanoct thus should allow capturing subtle differences in cartilage characteristics , carefully mapping oa progression and , ultimately , asses the beneficial changes when testing a candidate disease - modifying treatment . |
PubmedSumm118481 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: protein dynamics plays
an essential role in many biophysical / biochemical
processes in living organisms , like excitation energy and electron
transfer in photosynthesis and in catalysis . in photosynthesis
, proteins tune the optical
properties of the pigments and dissipate the excess energy of electronic
excitations of the pigments on their way from the light - harvesting
antennae to the reaction center , where the conversion of light energy
into chemical energy starts .
the dissipation is possible by a dynamic
modulation of transition energies of the pigments by the protein vibrations . besides this dynamic modulation that appears
in the homogeneous optical line shapes of the pigments , any conformational
motion that is slower than the lifetime of excited pigment states
( femtoseconds to nanoseconds ) , leads to static disorder that masks
the homogeneous line shape by inhomogeneous broadening .
the latter
may be visualized , e.g. , as spectral diffusion in single molecule
experiments .
line narrowing spectroscopy is a valuable tool
for deciphering
the homogeneous line shape of inhomogeneously broadened systems . in fluorescence line narrowing ( fln ) spectroscopy ,
an energetically
narrow laser excites a subensemble , the homogeneous fluorescence of
which is recorded . in nonphotochemical
hb spectroscopy , a conformational transition of the protein is induced by selective
optical excitation ( burning ) of the pigments .
the conformational transition
of the protein , in turn , leads to a change in optical transition energy
of the pigments . in the hb spectrum ( which is the postburn absorption
spectrum minus the preburn absorption spectrum )
, a hole appears at
the initial absorption frequency of the pigments and a positive contribution
( termed antihole ) is visible at the spectral position where the initially
excited pigments absorb after their frequency was shifted by the conformational
transition of the protein .
hb spectroscopy allows one to obtain information
on both the homogeneous line shape of pigment protein complexes
( ppcs ) and spectral diffusion processes of the pigment transition
energies due to the optically induced conformational transitions of
the protein .
line narrowing spectroscopy is usually performed at cryogenic
temperatures , where the homogeneous broadening is small .
since the parameters of the hamiltonian of ppcs ( site energies , excitonic
coupling , spectral densities ) in good approximation are temperature - independent ,
the temperature dependence of optical spectra can be well described
by the line shape theory discussed below . in this way , it is possible
to characterize a ppc by low - temperature spectroscopy and use the
parameters to describe the biological function at physiological temperatures .
it has been a challenge to describe hb spectra of excitonically
coupled pigments in proteins .
the reason is 2-fold : on the one hand ,
a simple theory for homogeneous line shapes of multipigment complexes
was missing , and on the other hand , it was not clear how the photoproduct
can be described . for a long time , the standard theory of an electronic
two - level system coupling to an infinite number of harmonic oscillators ,
developed originally by lax and independently
by kubo and toyozawa half a century ago ,
has been applied to study the signature of the lowest exciton state
in the hole burning spectra of various ppcs .
often , quantitative agreement with experimental
data could be obtained . the underlying assumption that the lowest
exciton state can be treated as an effective two level system of displaced
free energy surfaces got support from a recent normal - mode analysis
( nma ) of the spectral density of the exciton
vibrational coupling were found to
be significantly larger than the off - diagonal elements . neglecting
the latter effectively results in the kubo
toyozawa lax
( ktl ) theory . combining an exact treatment
of the diagonal elements with a markov and secular treatment of the
off - diagonal elements , as suggested by renger and marcus ( rm ) ,
yields a multipigment line shape expression
that includes both vibrational sidebands of exciton transitions and
lifetime broadening of the transitions due to exciton relaxation processes .
whereas ktl theory can treat the lowest exciton transition , rm theory
describes the whole spectrum .
early successes of rm theory concern
the description of fln spectra of dimeric b820 complexes , using the
spectral density extracted before on the monomeric subunit ( the b777
complex ) , for which ktl theory applies , and the structure prediction
of chlorophyll dimers in the water - soluble protein complex ( wscp ) , which will be discussed in more detail below .
we note that , in a recent extension of rm theory , the nonsecular non - markov
contributions from the off - diagonal elements of the exciton - vibrational
coupling were indeed found to be small .
recently , reppert applied rm
theory
to the analysis of hb spectra of excitonically coupled systems and
reported interesting results on model dimers . when burned into the
low - energy exciton state ,
the dimers show a sharp hole at the burn
frequency and , in addition , a lifetime - broadened sine function - shaped
feature at the frequency of the upper exciton state .
the latter feature ,
which can not be obtained with ktl theory , reflects the fact that when
a pigment changes its site energy , both exciton states of the dimer
change their energy ( the upper exciton state shifting on average to
larger energies ) and the zero - phonon transition of the upper exciton
state is strongly homogeneously broadened by its finite lifetime .
the study by reppert paved the way for
a quantitative understanding of hb spectra of excitonically coupled
systems and has stimulated the present work . besides the appropriate
homogeneous line shape theory , a second
problem in the description of hb spectra concerns the spectrum of
the photoproducts , as mentioned above . in the case of nonphotochemical
hb
, a photoproduct is a complex in which one of the pigments ( let
us say pigment m ) has changed its local transition
energy ( site energy ) .
a crucial
question in this respect is which new site energy em shall be assigned ? does the pigment
remember its original site energy em or does it lose all its memory in the hb transition ?
this question is directly related to the free energy landscape of
the protein in the excited state of the ppc .
reppert took an intriguing simple approximation and assumed that
the pigment will lose the memory about its initial state completely
and the protein can reach any of its preburn conformational substates
with distribution p(em em ; ) that is centered around the mean site energy em of this pigment , with
inhomogeneous width . such conformational cycling most likely
involves multiple pigment excitations and de - excitations , as illustrated
in figure 1 . as will
be shown in the present work , this approximation is valid only if
during the electronic excitation ( burning ) some excess energy is deposited
in the system , either by exciton relaxation between the upper and
lower exciton state , after excitation of the former , or by vibrational
relaxation , after excitation of the vibrational sideband of the lower
exciton state .
however , for so - called resonant excitation , that is
excitation ( burning ) of the zero - phonon transition of the lowest exciton
state , any roughness of the free energy surface will provide barriers
that can only be tunneled through or overcome slowly by thermal fluctuations .
therefore , it is likely that the pigment will keep memory of its original
( preburn ) site energy and the protein can not cycle through its whole
conformational substates .
consequently , the distribution function p(em em ; res ) of the postburn
transition energy em is
centered around the preburn site energy em and is expected to be much narrower than the original site energy
distribution function p(em em ; ) , that is , it holds that res
( as illustrated in figure 1 ) .
( left ) illustration of free energy surfaces of ground
state |g and exciton states |m
and of conformational transitions induced by multiple excitation / de - excitation
processes .
the optical transitions to the vibrational ground state
of the lowest exciton state ( resonant excitation ) are shown in red ;
the transitions to higher excited states ( nonresonant excitation )
are shown in blue .
( right ) probability distributions for the postburn
site energy of pigment m corresponding to the different
excitation conditions in the left part ( same color code ) .
hb spectra of recombinant class
iia wscp from cauliflower that was
reconstituted with either chlorophyll a ( chla ) or chlb were reported by pieper et al .
the linear optical spectra of this complex were
used earlier by krausz and co - workers to infer an open sandwich geometry of chl dimers , with an opening
angle of 60. later , we refined this angle to 24 for chla homodimers and 35 for chlb homodimers
by taking into account the homogeneous line shape functions of exciton
transitions , using rm theory . in parallel ,
a crystal structure of the related class iib wscp complex from lepidium virginicum was published that contains four chla pigments , which are indeed
arranged in two open - sandwich dimers with an opening angle of 30
between transition dipole moments .
recent 2d electronic spectra were
measured on class iib wscp from l. virginicum and
revealed an excited state lifetime of 50 fs of the upper exciton state , in good agreement with earlier predictions
for class iia wscp from redfield and modified redfield theory . besides structure prediction and the development of theory , wscp
has been an important model system for the study of intersystem crossing
in chla and chlb .
it has also been used for a theoretical demonstration of
the capability of nonlinear polarization spectroscopy in the frequency
domain to reveal the homogeneous broadening and thereby the lifetime
of the upper exciton state . in the present
work ,
we show that this lifetime is also accessible from hb spectra
for resonant excitation of the upper exciton state .
in the following , a short survey
of the theory of optical spectra is given .
for a detailed discussion ,
we refer to refs ( 3 , 18 , 30 , and 31 ) .
the theory
is based on a standard hamiltonian hppc for the pigment protein complex that describes the pigments
as coupled two - level systems interacting with vibrational degrees
of freedom of the pigments and the protein .
it is composed of three parts , hppc = hex + hex vib + hvib .
the exciton part hex includes the site energies em of the pigments , defined as the optical transition
energies at the equilibrium position of nuclei in the electronic ground
state , and the excitation energy transfer couplings vmn .
vib describes the modulation of site
energies and excitonic couplings by the vibrations . in the spirit
of a nma
, it is assumed that the site
energies and excitonic couplings depend linearly on the displacements
of the vibrational coordinates from their equilibrium values .
the
vibrational part hvib describes uncoupled
harmonic oscillators . for the calculation of optical spectra
,
the hamiltonian of the ppc is transformed to the basis of delocalized
exciton states |m which are given as linear
combinations of local excited states |m.1the exciton coefficients cm(m ) and
excitation energies , are
obtained from the solution of the
eigenvalue problem of the exciton hamiltonian hex .
the
absolute square of the exciton coefficient cm(m ) describes the probability
that the mth pigment is excited when the ppc is in
the mth exciton state .
vib contains diagonal
elements , which lead to vibrational sidebands and off - diagonal elements ,
which cause lifetime broadening of the optical lines . the
linear absorption2is
obtained from the dipole dipole
correlation function , as described in ref ( 18 ) . the exciton transition dipole moment 0 m is given as a linear
combination of local transition dipole moments d0 m of the pigments 0 m = mcm(m)d0 m .
the line shape function dm( ) was derived in ref ( 18 ) by using a non - markovian
partial ordering prescription ( pop ) theory and can be expressed as dm( ) = dm(0)( ) + dmvib( ) with the
so - called zero - phonon line ( zpl ) dm(0)( ) that
describes the excitation of electronic degrees of freedom only3and the vibrational sideband dmvib( ) that contains the vibronic transitions , that is
a simultaneous excitation of electronic and vibrational degrees of
freedom4the time - dependent function gm(t ) describes
the vibrational
sideband of the exciton transition and is related to the spectral
density of the exciton
vibrational coupling jmnkl( ) by5where n( )
= 1/(e 1 )
is the bose
einstein distribution function of vibrational quanta ,
which gives the mean number of vibrational quanta with energy
excited at a given temperature t and contains boltzmann s
constant k. the inverse dephasing time constant
m1 is obtained from the redfield rate
constants kmn of exciton relaxation between exciton state |m and the other exciton states |n and contains also an empirical inverse pure dephasing time
constant pd16the redfield rate constant kmn is given
by7with the
transition frequency
mn = m n between the mth and the nth exciton state .
we note
that pd in eq 6 in principle can be obtained by taking into account a quadratic
dependence of transition energies on the vibrational coordinates and
is responsible for the finite width of the zpl of the lowest exciton
state at low temperature . here
, pd is treated as
a free parameter that is obtained from a fit of the hb spectra .
the frequency m in eqs 3 and 4 is the transition frequency between the ground state |0
and the exciton state |m that contains a
renormalization due to the diagonal and off - diagonal parts of the
exciton vibrational coupling8where e(m ) is the reorganization
energy of the mth
exciton state defined as9and p.v .
a recent
nma of the spectral density of a pigment protein complex has
shown that the fluctuations in excitonic couplings are negligible
and the correlation in site energy fluctuations has practically no
influence on exciton relaxation .
therefore ,
the spectral density is approximated as jmnkl( ) = mnklmkj( ) where we use a function j( ) that was extracted from fln spectra of b777 complexes
as10and compare our results also with
those obtained
from an alternative j( ) from the literature .
the huang rhys factor s equals the integral over the spectral density s = 0 d j( ) . whereas the functional form
of j( ) is very similar for different pigment
protein
complexes , s differs somewhat and needs to be determined ,
for example , from the temperature dependence of the linear absorption
( see below ) .
as discussed in the introduction , protein
dynamics occur on many different
time scales and lead to fluctuations in excitonic couplings and site
energies .
the fluctuations , which are fast compared with excited state
lifetimes , lead to homogeneous broadening of optical line shapes ,
as described above .
the slow fluctuations cause static disorder , that
is , every complex in an ensemble will exhibit a different exciton
hamiltonian .
it seems reasonable to assume that the order of magnitude
difference between fluctuations of site energies and excitonic couplings
found for the dynamic disorder also holds
for static disorder .
therefore , we only include variations in site
energies . in order to describe the absorption spectra measured
on an inhomogeneous ensemble ,
the homogeneous absorbance is averaged
over different realizations of static disorder of local transition
frequencies i of the pigments:11where n is
the number of pigments and the distribution function p is assumed to be a gaussian function , which for simplicity is assumed
to be the same for all pigments,12with a full width at half - maximum .
the distribution functions are
centered
around the mean local transition frequencies i of the pigments that depend on their local binding
site in the protein .
we note that
the assumption of independent gaussian disorder in
site energies , although it is common practice in the field , has not
been proven yet by a microscopic theory . from electrostatic calculations
of site energy shifts in pigment protein complexes , it is known
that the site energies depend on interactions with a large number
of amino acid residues of the protein .
if the local conformations of the side chains of the latter are
independent , we expect , in the spirit of the central limit theorem
of statistical mechanics , gaussian distributions of the site energies .
there is indeed support for this assumption from zpl hole depth measurements
( also termed zero phonon action spectroscopy ) of localized lowest
excited states in pigment protein complexes . in hb spectroscopy
the
spectral width of the burning laser is negligible small compared with
the width of the zpl ; hence we assume monochromatic excitation with
frequency exc .
since the complexes in the sample
are inhomogeneously broadened , a certain selection of excited complexes
can be achieved by this excitation . in nonphotochemical hb , the protein
changes conformation when the pigments are excited .
due to this conformational
transition , after the ppc has returned to its ground state , the transition
energies of the pigments and thereby the absorption spectrum of the
complex have changed . in general
, the probability of a conformational
transition is low , which means the complex has to be excited many
times until a measurable change in the absorbance occurs .
we will
denote the postburn absorption spectrum of a complex as m( ) , where pigment m has changed its transition energy .
, only the lowest
exciton state is populated after the relaxation and the conformational
transitions of the local protein environments of the pigments start
from there .
the probability to find pigment m excited
in the lowest exciton state is given by the respective square of the
exciton coefficient |cm(1)| . for
simplicity , we assume that the intrinsic hb efficiency of all local
protein environments of the pigments is the same . therefore , the postburn
absorbance is proportional to mm()|cm(1)|
. please note that the hb efficiency is sufficiently
low that at most one pigment changes its site energy per excitation
by the burn laser .
note that the factor |cm(1)| takes into account a reduction of the local reorganization
of the protein environment due to delocalization of excited states .
that is , a delocalized lowest exciton state will exhibit a lower hb
efficiency at a given site than a lowest exciton state that is localized
at that site . in order to calculate m( ) , we have to assign a new site energy to pigment m. the simplest approximation , used also by reppert , is to assume that after the hb transition , the
protein can end up in any of the conformational substates that are
present in the original inhomogeneous ensemble . in this case , the
hb signal , that is , the difference between the absorbance after burning
and the original absorbance of the sample , reads13where (exc ) is the homogeneous absorbance
at the excitation ( burning )
frequency and ... dis denotes an average
over static disorder in site energies that will be performed numerically
by using a monte carlo method , as usual .
although no explicit expression
was given by reppert , in essence eq 13 describes his approach . in the approach by reppert
,
a monte carlo procedure is used not just for the disorder average
but also to describe every step in the hb experiment .
therefore , many
events that do not contribute to the actual hb spectrum had to be
included , whereas in eq 13 only the relevant events are considered .
we will see below that eq 13 holds well for excitation
energies that are larger than the zero - phonon transition energy of
the lowest exciton transition , that is , for so - called nonresonant
( nr ) burning conditions , but it can not describe resonant hb spectra . in the latter case ,
the energy of the burn laser is resonant to
the zero - phonon transition of the lowest exciton state , and there
is no excess energy available that can be used for the conformational
transition of the protein .
therefore , the jumps in the optical transition
energy of the pigments are smaller . to take into account this circumstance ,
we describe the hb spectrum including resonant and nonresonant burning
conditions as14where mres( ) denotes
the homogeneous absorption spectrum of a complex
that was excited ( burned ) resonantly into the zero - phonon transition
of its lowest exciton state , described by d1(0)(exc ) , given in eq 3 . in this case
, the postburn transition frequency m is not taken from the original distribution function p(m m ; ) but instead from a distribution
function p(m
m ; res ) that is centered around the
preburn site energy m of pigment m ( see figure 1 ) . in
addition
, we assign a smaller width res to this
distribution function , to take into account the reduced conformational
flexibility , as discussed above .
the second part of eq 14 takes into account nonresonant
burning processes , that is excitation of the remaining exciton states m = 2 , ... ,
n at higher energies , described
by dm(exc ) , and excitation
of the vibrational sideband of the lowest exciton state m = 1 , described by d1vib(exc ) . in these cases ,
we assume that there is enough excess energy available after excitation ,
either by exciton relaxation or by vibrational excitation , that all
conformational substates of the protein can be reached and , therefore ,
the preburn distribution function p(m m ; ) of the transition energy of pigment m applies also to the postburn site energy .
we note that for nonresonant
excitation conditions practically only the second part of eq 14 contributes to the hb
signal , which then becomes identical to the simple expression in eq 13 , describing the nonresonant
hb signal .
a crystal structure exists
for the class
iib wscp complex of l. virginicum containing chla , as discussed in the introduction .
the four chlorophylls are arranged
in two open sandwich dimers with strong intradimer and weak interdimer
excitonic couplings . as shown in recent publications
wscp from cauliflower . in case of chlb wscp , an increase in opening angle between transition dipole
moments of strongly coupled chls by 9 was suggested as compared
with chla wscp , based on simulations of optical
spectra at a temperature of 77 k. in
the present work , we take the pigment geometry for chla
wscp from the crystal structure of l. virginicum and reinvestigate the change in opening angle between transition
dipole moments for chlb wscp , by including
4 k absorbance data .
the parameters of the present model , determined
as described below ,
are summarized in table 1 and are compared there to those used in our earlier work . in the present work , the excitonic couplings
were inferred directly from the splitting between the peaks , seen
in absorbance and circular dichroism spectra . in the case of chla , we arrive at a value of 83 cm , which
is very close to the value 84 cm , obtained before .
in case of chlb
, we find that the earlier value of
72 cm should be somewhat increased to 82 cm for a better fit of low - temperature spectra . the
integral exciton
vibrational coupling strength , that is , the
huang rhys factor s = 0.8 , has been determined
earlier from the temperature dependence of the absorption spectrum ,
in agreement with the present calculations shown in figure s1 of the supporting information .
the inhomogeneous width
inh for the distribution function of site energies ,
as well as the mean site energy has been determined
from the fit of low temperature absorbance spectra in figure 2 .
please note that the values
of = 64 and 66 cm correspond to inh = 150 and 155 cm ( fwhm ) , respectively .
the values are close to those determined earlier . concerning the angle between transition dipole
moments , a value of = 30 results from the crystal structure ,
assuming the transition dipole moments to be oriented along the nb nd axis of the chls .
as discussed already
recently , the chlb wscp
spectra can be better described by increasing the opening angle between
the transition dipole moments .
here we arrive
at an optimal value of = 36 , as shown in the lower part
of figure 2 .
besides
the parameters determined from the linear spectra discussed above ,
there are two additional adjustable parameters , namely , the width
res of the distribution function p(em em ; res ) of the photoproduct
for resonant excitation of the zpl of the lowest exciton states and
the pure dephasing time constant pd .
. low temperature linear absorption ( t = 4 k ) of
chla wscp ( upper part ) and chlb wscp ( lower part ) .
the dots show the experimental data from
pieper et al . ; lines show the calculations
using the parameters given in table 1 . in the lower part , in addition
, a calculation is
shown in which the opening angle = 30 between transition
dipole moments from the crystal structure of class iib wscp ( containing
chla ) was applied , assuming that the latter are oriented
along the nbnd axis of chls .
hb spectra at 4 k were calculated
for two different burn conditions , exciting either the low- or the
high - energy exciton state . in the calculation of the disorder average
for excitation of the low - energy exciton
state ( burn = 664.9 nm , upper part of figure 3 ) , a sharp hole results at
the burn wavelength that is accompanied by two sharp positive features
at both sides of the sharp bleach . from the width of the sharp hole ,
a pure dephasing time pd = 2750 fs is inferred .
toward longer wavelengths , a sideband , the so - called pseudo - phonon
sideband ( ppsb ) , appears as a negative bleach around 666 nm .
at shorter
wavelengths , where the upper exciton state absorbs , a broad sine - shaped
feature results with a bleaching around 659 nm and positive absorbance
around 653 nm .
the overall agreement between calculations and experimental
data is excellent if eq 14 is used . using eq 13
instead gives only qualitative agreement for the short wavelength
part of the spectrum but misses completely the ppsb at long wavelengths .
close inspection of the ppsb reveals that it is more prominent in
the experiment than in the calculations .
so far , all our attempts
to obtain a better agreement by varying the shape of the spectral
density have failed .
for example , we have tested a j( ) that was extracted by pieper et al . from experimental delta - fln spectra of wscp , using standard ktl theory , as discussed in detail
in the supporting information .
low temperature
( t = 4 k ) linear absorption ( od )
and hole - burning ( hb ) spectra of chlb wscp .
black dashed and solid lines show experimental absorption and hb data ,
respectively , from pieper et al . , red
solid lines show the calculations using eq 14 , and blue dashed lines show the calculation
using eq 13 , which corresponds
to the approach by reppert . in the lower
part
the
in the lower part denotes the fwhm of the high - energy bleaching , which
is used in the main text to obtain an upper bound to the lifetime
of the upper exciton state .
if the upper exciton state is excited by the burn laser ( lower
part of figure 3 ) ,
there is a broad bleaching around the burn wavelength and positive
absorbance at shorter wavelength ( as for low - energy burning ) .
in addition ,
another broad bleaching appears at longer wavelength around 665 nm ,
where the low - energy exciton state absorbs .
no sharp feature is obtained ,
in contrast to the hb spectrum resulting for low - energy excitation
( burning ) shown in the upper part of figure 3 .
the only experimental feature
that is not obtained in the calculations is a small dip at the burn
wavelength .
since for the high - energy burning frequency the zpl of
the low - energy exciton state is not excited , both eqs 13 and 14 give
identical results . for chla
wscp , hb spectra
at low - energy burning conditions ( exc = 682.0 nm )
are compared in figure 4 with the experimental data .
wscp
spectrum but is shifted toward longer wavelengths , due to the difference
in site energies between chla and chlb . the overall agreement between calculations
and experimental data is good , but not as excellent as for chlb wscp .
we have no explanation for the larger discrepancy ,
at the moment . low temperature ( t = 4 k ) linear absorption
( od )
and hole - burning ( hb ) spectra of chla wscp .
black dashed and solid lines show experimental absorption and hb data ,
respectively , from pieper et al . ;
so far , it has not been possible to describe
hb spectra of excitonically
coupled systems over a spectral range that is larger than that of
the lowest exciton state .
here we present a theory that changes this
situation . besides applying a homogeneous line shape theory for ppcs ,
containing vibrational sidebands and lifetime broadening due to exciton
relaxation , developed and tested earlier , it was important to relate the amount of excess energy
provided by the burn laser to the magnitude of the conformational
transition of the protein .
we find that excitation of the electronic
degrees of freedom of the lowest exciton state only , that is , burning
into the zero - phonon transition of this state , does allow the protein
only to reach conformational substates in the close neighborhood of
its original conformation . in striking contrast ,
any higher excitation
gives the protein the freedom to cycle through its free energy landscape
and reach any conformational substate present in the original inhomogeneous
ensemble .
please note that even excitation of the vibrational sideband
of the lowest exciton transition , which has a maximum near 25 cm , provides enough excess energy .
this result may be
surprising at first glance , since at least some of the free energy
barriers are most likely larger than this value .
however , as illustrated
in figure 1 , in a hole - burning
experiment , one can make use of multiple excitation and de - excitation
reactions of the chromophores that will ultimately drive the protein
through its conformational substates . from our phenomenological modeling
of the hole - burning spectra , we have to conclude that in the case
of resonant excitation of the zpl of the lowest exciton state , the
missing excess energy hampers the initial phase of the conformational
cycle such that only conformational substates in the neighborhood
of the preburn substate are available . it should be noted also that
for such resonant excitation the excited state population may be partially
quenched by stimulated emission induced by subsequent burn photons ,
since there is no fast relaxation in the excited state that could
bring the system out of resonance with respect to the burn laser . in order to point out the influence of these effects on the calculated
hb spectrum ,
( ) , where +( ) contains all the terms
with positive sign in eqs 13 or 14 and ( ) contains those with negative sign , see also the supporting information for a definition of +( ) and ( ) .
+( ) is the absorbance of the photoproduct
and ( ) is the preburn absorbance ,
both weighted by the absorbance (exc ) at
the burn frequency exc . as explained before , eq 13 assumes that the protein
can end up in any of its original conformational substates , that is
therefore ,
as seen in the middle part of figure 5 , in the postburn spectrum +( ) ,
the sharp peak at the burn frequency has completely vanished and no
ppsb results in the difference spectra +( )
( ) . in contrast , taking
into account the limitation in conformational motion that occurs if
the purely electronic zero - phonon transition of the lowest exciton
state is excited , let the pigments remember their
original site energies and diminished and slightly broadened the sharp
peak at the burn frequency and also the low - energy shoulder .
the latter
contains zpls of those complexes that were burned into their vibrational
sideband . the difference +( )
( ) in this case reveals the ppsb in nice agreement
with the experimental data ( figures 3 and 4 ) .
please note also that
on average the high - energy part of the postburn spectrum +( ) is shifted to the left of the preburn spectrum ( ) , explaining the sine function shape in the
difference .
calculated absorption spectrum ( black dotted curve ) , as well as
the calculated positive ( +( ) , red curve )
and negative ( ( ) , green curve ) contributions
to the hole burning spectrum hb( ) = +( )
( ) ( blue
curve ) are shown , assuming resonant burning conditions in the upper
and middle parts and nonresonant burning conditions in the lower part .
the hb spectra in the upper part were calculated with eq 14 , in the middle part eq 13 ( corresponding to reppert s
theory ) was used , and in the lower part eqs 13 and 14 yield identical
results . since the upper exciton state
is strongly lifetime - broadened , many
different complexes in the inhomogeneous ensemble absorb at the burn
wavelength of 656.2 nm ( lower part of figure 5 ) , and the low - energy exciton state , therefore ,
keeps a large part of its inhomogeneous broadening in the hb spectrum .
however , the width of the high energy bleaching reflects the homogeneous
broadening of the upper exciton state and may be used to infer the
lifetime of this state . from eq 3
, it follows that the full width at half - maximum ( fwhm )
of this curve equals 2m1 .
taking into account
that the lifetime equals the inverse rate constant 1/k21 , we obtain from eq 6 ( neglecting the small pd1 )
a lifetime of the upper exciton state as 1/. the
= 80 cm that can be extracted from figure 3 results in a lifetime of 65
fs , in good agreement with the 50 fs lifetime estimated from recent
2d spectra .
as seen in the lower part
of figure 5 , the actual
homogeneous width of the pre- and postburn spectra are somewhat larger
than that of the hb spectra because in the latter we have partial
cancellation due to the difference .
therefore , the lifetime obtained
from the experimental in hb should be considered as
an upper bound . from an average over the inverse rate constant
1/k21 , we obtain
the average theoretical
lifetime of 75 30 fs in agreement with the above values .
the
relatively large standard deviation of 30 fs of the theoretical average
reflects the fact that the exciton states in the wings of the distribution
function are more localized than in the center and , therefore , live
longer . since in the experiment
the burn laser was resonant with the
maximum of the distribution function of the high - energy exciton state ,
the short - lived exciton states were selected .
although there
is almost quantitative agreement between calculated
and measured hb spectra , in particular for chlb
wscp
( figure 3 ) , we still
need to understand the origin of the more pronounced ppsb observed
for excitation of the low - energy exciton state and the origin of the
additional sharp feature at the burn frequency for high - energy excitation .
whereas the former feature could be due to a more complicated postburn
spectrum than assumed here ,
the origin of the latter could be twofold .
on the one hand , the markov approximation applied to the off - diagonal
elements of the exciton
vibrational coupling in the line shape
theory might be too simple . the m determining the width of the zero - phonon transition in eq 3 becomes frequency dependent if
non - markov effects in the nondiagonal elements of the exciton vibrational
coupling are taken into account , which
could explain a more complicated line shape than a simple lorentzian .
please note , however , that the non - markovian treatment of the off - diagonal
elements in the exciton
vibrational coupling in ref ( 32 ) allowed only for a perturbative
description of the diagonal part of the exciton vibrational
coupling and
high - frequency intramolecular
vibronic transitions of the pigments , neglected so far , might be responsible
for the sharp dip in the experiment .
as seen in the linear absorbance
( figure 2 ) , there are
deviations between the calculated and measured spectra at high energies
( short wavelengths )
. those deviations could be due to intramolecular
vibrational degrees of freedom of the pigments , which have not been
taken into account in the calculations .
since the deviations are not
observed in the cd spectra , it is likely that these
intramolecular vibronic transitions do not mix strongly with the exciton
transitions and , therefore , could exhibit a larger lifetime and hence
a smaller line width in the hb spectra .
hb experiments detecting the
change in circular dichroism might be helpful to distinguish excitonic
from nonexcitonic contributions to the homogeneous line shape .
inspiration
may be taken also from ab initio multimode vibronic coupling theories
on molecular dimers .
we note that an
improved line shape theory can readily be inserted into eq 14 and the hb spectrum obtained ,
as long as it is possible to separate the expression for the zpl from
that of the vibrational sideband .
the main
result of the present
paper is eq 14 , which
is found to describe experimental hb data of excitonically coupled
pigment protein complexes quantitatively for all burning conditions .
for nonresonant burning ,
this equation becomes identical to eq 13 , which summarizes a
monte carlo scheme used by reppert before
to investigate model systems but is numerically more efficient than
reppert s scheme .
the key idea of the present paper ,
which allows us to describe also resonant burning , is to relate the
change in site energy during the hb transition to the excess energy
deposited by the burn laser in the protein .
the simplest possible
assumption is to distinguish burning with and without excess energy .
the latter applies if the zero - phonon transition of the lowest exciton
state is excited , and the former includes any excitation with higher
energy .
interestingly , this simple approximation allows for a good
quantitative description of experimental hb spectra of wscp .
obviously , in the electronic excited state of the complex , intermolecular
vibrational excitations with energies in the 10 cm range are enough to initiate subsequent conformational transitions
that are driven by multiple excitation and de - excitation reactions
of the pigments in the hole - burning process . in the course of these
conformational transitions , all conformational substates are reached
contributing to the inhomogeneous distribution function of the site
energies in the electronic ground state of the complex . an interesting
question for future work is to provide a microscopic picture of the
inhomogeneous distribution function of the site energies in a pigment
protein
complex and to identify the relevant conformational substates of the
protein , as well as the mechanisms that drive these transitions .
so
far , methods have been developed to calculate site energies for a
given structure including also fluctuations due to vibrational motion
of the protein that are fast compared with the lifetime of excited
pigment states ( for a recent review , see ref ( 3 ) ) .
the next step will be
to include slow conformational motion of the protein , like reorientation
of polar side chains or fluctuations in the protonation pattern of
titratable residues .
under resonant burning conditions , there is no
excess energy available to drive the conformational motion and only
the conformational substates in the neighborhood of the preburn state
are available . in principle , these states could be reached either
by thermal fluctuations or by tunneling . in order to distinguish between
these two processes ,
lowering the temperature even further than 4
k , used in the present hb experiments , toward the millikelvin range
would be helpful .
if tunneling is the major process , the width res of the postburn site energy distribution function should
be temperature - independent , whereas in the case of thermal activation
res should become smaller with decreasing temperature .
in the latter case
, it might be possible to determine the barrier
heights of the free energy landscape of the protein in the excited
state .
pioneering work in this direction has been published by wiersma ,
friedrich and co - workers , who investigated
the free energy landscape of myoglobin by temperature - dependent hole - burning
and photon echo spectroscopy and were able to infer details of the
free energy landscape .
the present work provides the theory to interpret
similar experiments on multipigment protein complexes .
Output:
| a theory for the calculation of resonant
and nonresonant hole - burning
( hb ) spectra of pigment protein complexes is presented and
applied to the water - soluble chlorophyll - binding protein ( wscp ) from
cauliflower .
the theory is based on a non - markovian line shape theory
( renger and marcusj .
chem .
phys.2002 , 116 , 9997 ) and includes exciton delocalization , vibrational
sidebands , and lifetime broadening . an earlier approach by reppert
( j. phys .
chem .
lett.2011 , 2 , 2716 ) is found to describe nonresonant hb spectra only .
here we present
a theory that can be used for a quantitative description of hb data
for both nonresonant and resonant burning conditions .
we find that
it is important to take into account the excess energy of the excitation
in the hb process .
whereas excitation of the zero - phonon transition
of the lowest exciton state , that is , resonant burning allows the
protein to access only its conformational substates in the neighborhood
of the preburn state , any higher excitation gives the protein full
access to all conformations present in the original inhomogeneous
ensemble .
application of the theory to recombinant wscp from cauliflower ,
reconstituted with chlorophyll a or chlorophyll b , gives excellent agreement with experimental data by pieper
et al .
( j. phys .
chem .
b2011 , 115 , 405321417356 ) and allows us to obtain an upper bound of the lifetime of the upper
exciton state directly from the hb experiments in agreement with lifetimes
measured recently in time domain 2d experiments by alster et al .
( j. phys .
chem .
b2014 , 118 , 352424627983 ) . |
PubmedSumm118482 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: dry eye disease is one of the most common public health problems in the field of ophthalmology that causes decreased physical , psychological , social and occupational functioning , and interferes with daily activities like reading , driving , computer work and watching tv .
the effect of this disease on quality of life is similar to severe migraine and angina .
outbreaks are increasing with the use of contact lenses and refractive surgery such as lasik .
the purpose of this paper is to assess the causes of dry eye and its prevention by the principles of hygiene .
in this review study , traditional medicine resources like al canon fil tibb , sharh - al - al asbab and exir - e - azam have been studied with engine motors such as google scholar and pubmed .
from the perspective of iranian traditional medicine , the principles of maintaining health include air , food and drink , exercise and rest , sleep and wakefulness , mental state , retention of essential materials and depletion of wastes from the body .
proper performance of each principle is useful for the prevention of disease in different organs , including the eyes .
recommendations for the prevention or treatment of dry eye disease include the prevention of dryness in the eye or the entire body .
accordingly , one of the most effective managements of dry eye disease is avoiding foods that affect the eye in this way ; for example garlic and onion .
maintaining eye health is related to aspects of physical and mental health of the whole body .
therefore , codification of an integrated plan that contains eating and sleeping patterns , exercise , general clearing , eye clearing , and mental health is essential for treating dry eye disease .
Output:
| background : dry eye disease is one of the most common public health problems in the field of ophthalmology that causes decreased physical , psychological , social and occupational functioning , and interferes with daily activities like reading , driving , computer work and watching tv .
the effect of this disease on quality of life is similar to severe migraine and angina .
in addition , the severity of the disease is closely related to depression .
outbreaks are increasing with the use of contact lenses and refractive surgery such as lasik .
the purpose of this paper is to assess the causes of dry eye and its prevention by the principles of hygiene.methods:in this review study , traditional medicine resources like al canon fil tibb , sharh - al - al asbab and exir - e - azam have been studied with engine motors such as google scholar and pubmed.results:from the perspective of iranian traditional medicine , the principles of maintaining health include air , food and drink , exercise and rest , sleep and wakefulness , mental state , retention of essential materials and depletion of wastes from the body .
proper performance of each principle is useful for the prevention of disease in different organs , including the eyes .
recommendations for the prevention or treatment of dry eye disease include the prevention of dryness in the eye or the entire body .
in addition , the stomach and brain are important to eye health .
accordingly , one of the most effective managements of dry eye disease is avoiding foods that affect the eye in this way ; for example garlic and onion.conclusion:maintaining eye health is related to aspects of physical and mental health of the whole body .
therefore , codification of an integrated plan that contains eating and sleeping patterns , exercise , general clearing , eye clearing , and mental health is essential for treating dry eye disease . |
PubmedSumm118483 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: spinal tuberculosis ( tb ) is one of the oldest human diseases ; it has been found in egyptian mummies dating back 5000 years ; the first case of spinal tb was described by percival pott in 1779.1,2 in the developing countries , spinal tb is one of the primary causes of spinal deformity and paralysis . according to the latest global ( tb ) report by the world health organization , an estimated 9.0 million people developed tb and 1.5 million died from tb in 2013 alone.3 tb affects the spine in 3%5% of patients,4 and spinal tb
if patients are diagnosed early , they can be treated with the proper pharmaceutical drugs , such as antibiotics only .
early and definite diagnosis of this disease is not easy , as the disease progression is slow and insidious . due to this difficulty
, many patients in the early stages of the disease receive treatments , such as nonsteroidal anti - inflammatory drugs , physical therapy , or a corset ( spinal support ) , prior to correct diagnosis.6,7 a positive skin test and elevated erythrocyte sedimentation rate ( esr ) may be useful for diagnosing spinal tb , biopsy evaluation and dna amplification techniques ( polymerase chain reaction ) may also facilitate the diagnosis . for histopathological examination ,
formalin - fixed and paraffin - embedded tissue blocks of biopsied specimens are stained with hematoxylin
eosin.8 conventional radiography methods are used as first - step diagnostic methods , providing a good overview .
advanced imaging methods , such as magnetic resonance imaging ( mri ) , play an important role in detecting spinal tb earlier than other techniques and provide the possibility of earlier and more effective treatment before significant defects develop.9 three - dimensional computed tomography ( ct ) scans and mri reveal the involved vertebrae and attachments clearly.10 they can also exhibit the degree of intervertebral disk destruction , the scope of central lesions , the locations and number of cavities and abscesses , and spinal cord compression.11 mri and ct facilitate and allow the diagnosis of spinal tb , but histopathological diagnosis remains essential.12,13 pharmacological therapy usually consists of triple - drug antituberculous chemotherapy ( p - aminosalicylic acid , streptomycin , and isoniazid ) and plays a main role in tb treatment,12 if the lesion is without complications and limited to the vertebrae .
some studies14,15 have reported the worsening of existing symptoms or the appearance of new lesions in patients who initially responded well to antituberculous therapy . however , with the appropriate indications , surgery is considered superior for preventing neurological deterioration , maintaining stability , and early recovery.1618 surgical treatment of spinal tb aims at abscess debridement , which involves removing purulent necrotic tissues from normal tissue , spinal cord decompression , permanent spinal stabilization , and preventing or correcting deformity . considering the serious burden caused by the high cost of medical treatment and surgical trauma , early diagnosis and treatment to avoid multivertebral destruction are critical to improve the outcomes in spinal tb.11
spinal tb is one of the most challenging diseases for surgeons to treat , and some guidelines are needed for appropriate decision making and treatment .
currently , there are few widely accepted classification systems based on objective data that can guide the selection of the proper treatment approach for patients with spinal tb . in 2008
, oguz et al19 developed a classification system ( gulhane askeri tp akademisi [ gata ] ) for spinal tb based on seven clinical and radiological criteria ( abscess formation , disk degeneration , vertebral collapse , kyphosis [ unnatural curvature of the upper back that creates a hunchback appearance ] , sagittal index , instability , and neurological problems ) .
they also recommended specific techniques for each type . per the gata classification system , spinal tb
is divided into three types ( ia / b , ii , and iii ) using the abovementioned criteria ( table 1 ) .
surgery is recommended for type ib ( abscess formation , one or two level disk degeneration , no collapse , and no neurologic deficit ) , type ii , and type iii patients with or without neurological deficit .
analgesic therapy alone can not prevent the extensive destruction of vertebral bone and disk material .
after cold abscess and two - level disk degeneration , immediate drainage along with medical therapy can protect the patient from vertebral collapse .
as long as the treatment plan is fully prepared , the surgical option can achieve a satisfactory curative effect in treating spinal tb , despite some complications .
we believe that the appropriate treatment method should be implemented at the early stage of this disease and that the gata classification system can be considered as a practical guide for spinal tb treatment planning in all countries .
current treatment modalities ( medical and surgical ) have improved outcomes in the management of spinal tb , even in patients with neurological deficits and spinal deformities
. however , there are various surgical or conservative treatment options , and heterogeneous outcomes have been described , which render the decision - making and selection of specific treatment options by surgeons difficult .
future investigations and publications require clear definitions of spinal tb to help guide the appropriate decisions and treatment by surgeons .
Output:
| spinal tuberculosis ( tb ) is a significant form of tb , causing spinal deformity and paralysis .
early diagnosis and treatment are crucial for avoiding multivertebral destruction and are critical for improving outcomes in spinal tb .
we believe that appropriate treatment method should be implemented at the early stage of this disease and that the gulhane askeri tp akademisi classification system can be considered a practical guide for spinal tb treatment planning in all countries . |
PubmedSumm118484 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: . therefore early detection of hypoglycemia in infants at risk is of utmost value to prevent the sequelae arising from neonatal hypoglycemia .
various factors influence newborn blood glucose concentrations even in healthy term newborns , such as birth weight , gestational age , presence or absence of disease , perinatal complications , mode of delivery and feeding behavior .
uncertainty exists with regard to optimal timing of blood glucose screening and intervals of glucose monitoring .
various studies in this regard has been conducted in urban setup but , detail conclusive data is lacking from semi urban setup in india . hence the present study attempts to envisage , assessment of blood glucose levels in newborns and various factors influencing it with special reference to signs of hypoglycemia in semi urban set up .
the results of this study may broaden our knowledge with regard to blood glucose assessment in semi urban setup .
a hospital - based prospective study conducted in a rural hospital , after obtaining the institutional ethics committee approval .
a total of 100 mothers and newborns irrespective of gestational age , weight , sex and mode of delivery were enrolled after taking informed consent .
babies were divided into different groups based on sex , mode of delivery and parity .
ballard 's score was calculated and they were divided into 4 groups based on the gestational age as 34 - 36 weeks , 36 - 38 weeks , 38 - 40 weeks and 40 - 42 weeks . they were divided into groups based on weight for gestational age based on charts from seton medical center , austin . after taking patients consent blood glucose levels were measured using a standard glucometer in mother delivering babies within half an hour of delivery and in newborns at 0 , 3 , 6 , 12 , 24 h of life .
a note was made about the amount and type of intravenous ( iv ) fluid given to the mother .
the blood glucose levels were below 40 mg / dl ( 2.2 mmol / l ) the signs of hypoglycemia were noted and the baby was treated with a trial of additional breastfeed or expressed breast milk and glucose levels were monitored .
all the data was calculated applying descriptive statistics such as mean , percentage , student 's t - test , anova and pearson correlation .
of the 100 babies enrolled in the study , 58 were male and 42 were female .
66 belonged to appropriate for gestational age ( aga ) group , 17 to small for gestational age ( sga ) and 17 to large for gestational age ( lga ) group .
of the 100 babies , 5 were admitted to newborn intensive care unit and were on iv fluids .
4 babies were on nasogastric feeds and 91 babies were breast fed immediately after delivery .
the blood glucose levels were low at 0 h. then there was mild increase in the mean blood glucose levels at 3 h followed by a minimal increase at 6 h and the maximum blood glucose levels were reached by 24 h [ figure 1 ] .
blood glucose levels in newborns at 5 different time points ( n-100 neonates ) maternal blood glucose was measured within half an hour or at the time of delivery .
figure 2 shows correlation between the maternal and neonatal blood glucose level taken at birth .
figure 3 shows that pre - term and post - term babies were more prone for hypoglycemia compared to term babies .
the mean blood glucose levels were high in babies delivered vaginally , at all the time points compared to the babies delivered by lower segment caesarean section ( lscs ) .
nearly 19.6% of babies delivered by lscs were hypoglycemic compared to 14.2% of the babies delivered vaginally .
scatter diagram showing correlation between maternal and newborn blood glucose levels at birth variation in blood glucose levels in mmol / l at different time points based on gestational age variation in blood glucose levels in mmol / l at different time points based on weight for gestational age neonates with a blood glucose level < 40 mg / dl ( 2.2 mmol / l ) at any time point were taken to be hypoglycemic .
of the 100 , 17 babies were hypoglycemic at birth , though none of them showed signs of hypoglycemia .
the blood glucose levels were monitored and at 3 h 11 babies were hypoglycemic and were started on iv fluids at 5 mg / kg / min .
7 babies were hypoglycemic , of whom 6 were on iv fluids and 1 baby who was euglycemic until 6 h and was being breastfed , had hypoglycemia .
all the 6 babies who were on iv fluids resolved of hypoglycemia at 12 h and 1 baby who was initially euglycemic till 6 h , continued to have hypoglycemia at 12 h even after expressed breast milk and additional breastfeeding .
this baby was started on iv fluids at 5 mg / kg / min and glucose levels were monitored .
other 6 babies , who were initially hypoglycemic and became euglycemic at 12 h , were slowly weaned of iv fluids and put on direct breastfeeding .
the glucose levels normalized and all these babies were euglycemic by 24 h. only 1 baby who was initially euglycemic till 24 h was hypoglycemic , which got resolved after giving expressed breast milk along with direct breastfeeding .
of the 100 babies studied 4 babies were born to diabetic mother , of whom 3 were hypoglycemic at birth .
the other 2 babies were put on iv fluids and glucose levels were normalized by 12 h. slowly they were weaned of iv fluids and put on direct breastfeeding .
blood glucose levels were studied in 100 mothers and newborns irrespective of gestational age , weight for gestational age , sex and mode of delivery . there was a negative correlation between the maternal blood glucose taken within half an hour of delivery or at the time of delivery and neonatal blood glucose level taken at birth .
this correlates with the study done by singhi who found a negative correlation between the maternal blood glucose and neonatal blood glucose levels taken at birth .
we noticed the babies of the mother , who had increased blood glucose levels , were found to be more prone for hypoglycemia as also observed by curet et al . though the p value was not significant , it was observed that there was influence of mode of delivery on the neonatal blood glucose levels .
the mean blood glucose levels were high in babies delivered vaginally , at all the time points compared to the babies delivered by lscs .
the cesarean section involves less stress for the baby and the possible impact of perinatal anesthesia and shifting of mother from operation theatre may further delay breastfeeding and result in lower plasma glucose levels in babies delivered by lscs compared to babies delivered vaginally as they are breastfed immediately or within half an hour after birth . and
also the babies delivered vaginally undergo stress which releases catecholamines which in turn increases the blood glucose . at birth the mean blood glucose levels
were noted to be low in 34 - 36 weeks and 40 - 42 weeks neonates .
however later at 3 h the mean blood glucose levels were high in 34 - 36 weeks neonates , but remained low in 40 - 42 weeks neonates .
this correlates with the other studies where the pre - term babies had a lower mean blood glucose concentration in the first few postnatal hours compared with term babies .
in contrast to kayiran and grakan we noticed glucose levels increased with the gestational age up to term and then decreased in post - term neonates .
this can be correlated with study done in iran where the incidence of hypoglycemia was 15.15% .
we observed that pre - term and post - term babies were more prone for hypoglycemia when compared to term babies in contrast to a study done by burdan et al .
, in this study , lga babies were more prone for hypoglycemia followed by sga neonates and aga neonates at birth .
the major signs noted were jitteriness , high cry , lethargy , tremors , limpness , apathy , weak cry and poor feeding , thus suggesting that there is a wide variation in signs associated with hypoglycemia . all babies whose mothers have high blood glucose levels or babies having signs of hypoglycemia should be identified and monitored for blood glucose levels .
mothers should not be given excess of dextrose containing iv fluids and if given then neonates should be monitored for hypoglycemia .
blood glucose levels should be monitored in neonates delivered by lscs , pre - term and post - term babies .
all babies whose mothers have high blood glucose levels or babies having signs of hypoglycemia should be identified and monitored for blood glucose levels .
mothers should not be given excess of dextrose containing iv fluids and if given then neonates should be monitored for hypoglycemia .
blood glucose levels should be monitored in neonates delivered by lscs , pre - term and post - term babies .
Output:
| hypoglycemia is one of the common metabolic problems in neonatal medicine .
there is association between blood glucose levels and neurological development .
the study involved 100 mothers and neonates blood glucose levels were measured using a standard glucometer in mother delivering babies within half an hour of delivery and in newborns at 0 , 3 , 6 , 12 , 24 h of life .
blood glucose levels were low at 0th and 6th h and maximum at 24th h. neonates born to mothers with high maternal blood glucose levels were hypoglycemic showing a negative correlation .
the mean blood glucose levels were low in pre - term and post - term compared with term babies and range of blood glucose levels were wide in preterm and post term babies . |
PubmedSumm118485 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: fragile x syndrome ( fxs ) is the most common heritable form of intellectual disability ( i d ) known .
characteristic physical features include large and prominent ears , long narrow face , macroorchidism , high - arched palate , hyperextensible finger joints , double - jointed thumbs , single palmar crease , flat feet often with pronation and hand calluses .
fxs causes a variety of learning , emotional and behavior problems including autism ( hagerman 2002 ; chonchaiya et al .
the prevalence of the full mutation was estimated to be 1 in 3600 males ( crawford et al .
2002 ) , although the allele frequency was found to be 1 in 2633 in newborn screening in spain ( fernandez - carvajal et al .
fxs is caused by a cgg repeat expansion located in 5 untranslated region of the fragile x mental retardation 1 ( fmr1 ) gene .
normally the repeat size is 544 cgg repeats , while premutation alleles have 55200 repeats and full mutation alleles have more than 200 cgg repeats . with expansion beyond 200 repeats ,
the surrounding promoter region of the fmr1 gene is hypermethylated , inhibiting fmr1 transcription and resulting in absence or reduction of the protein product , fragile x mental retardation protein ( fmrp ) ( oostra and willemsen 2009 ) . as a result of x - linkage ,
affected males have a more severe phenotype than affected females , in whom phenotype is modulated by the activation ratio of the normal x chromosome .
the variation in the clinical phenotype is also related to variability of the mutation , such as lack of methylation and size mosaicism leading to higher levels of fmrp than are observed in individuals with only a fully methylated full mutation ( jin and warren 2000 ; loesch et al .
many studies have focused on the behavior and cognitive problems in young patients with fxs .
there are a few reports of declining iq as patients progress through childhood and into adulthood ( wright - talamante et al .
1996 ; lachiewicz et al . 1987 ) and one case of a neurodegenerative course in fxs thought to be due to an additional diagnosis of amyotrophic lateral sclerosis ( als ) ( desai et al .
there have also been reports of rare sudden death in fxs in adulthood and these are presumed to be related to cardiac arrhythmias exacerbated by mitral valve prolapse which is common in adults with fxs ( hagerman 2002 ) . a neuropathological study of 2 older males with fxs demonstrated loss of purkinje cells and bergman gliosis in the cerebellum in one of the cases ( sabaratnam 2000 ) .
our neuropathological studies in three cases of older males with fxs have also demonstrated purkinje cell loss in the cerebellum suggesting a more pronounced affect of aging in those with fxs compared to age matched controls without fxs ( greco et al .
2009 ) . the discovery of the fragile x - associated tremor ataxia syndrome ( fxtas ) ( hagerman et al .
2007 ) in elderly men and some women ( coffey et al . 2008 ) with the premutation intensified the need for more detailed aging studies in fxs .
persons with fxs would not be expected to be at risk for fxtas , since generally they do not usually produce fmr1 mrna .
however , approximately 40% of males with fxs have repeat size mosaicism ( nolin et al . 1994 ) and some of these individuals also have elevated levels of fmr1-mrna ( allen et al .
the latter would theoretically be at risk for fxtas . although fxtas has never been reported in a person with fxs ( harris et al .
2008 ) , some families are concerned about cognitive decline in their older members with fxs .
these concerns have been intensified because of the recent report that fmrp regulates the translation of amyloid precursor protein ( app ) , such that the absence of fmrp leads to up - regulation of app ( westmark and malter 2007 ) .
thus persons with fxs and absent or diminished fmrp may be at greater risk for alzheimers disease ( ad ) .
the behavior problems in fxs include mood instability and aggression in approximately 75% ( hessl et al .
2008 ) , often resulting in treatment with atypical antipsychotic medication ( hagerman et al .
prolonged use of antipsychotics in fxs puts individuals at risk for antipsychotic - induced movement disorders including tardive dyskinesia and parkinsonism ( caligiuri et al .
1999 ; miller et al . 2005 ) that can reduce the quality of life in elderly patients . in addition , the dysregulation of dopamine function in the absence of fmrp ( wang et al .
2008 ) also may put those with fxs at risk for parkinson s disease ( pd ) .
although patients with fxs have not previously been reported to have pd or a loss of dopamine in the substancia nigra , there is a dysregulation of dopamine in the neurons in hippocampal slice preparations that can be normalized by adding fmrp or by adding a stimulant medication ( wang et al .
, we have surveyed all of the aging patients with fxs that we have followed over the years ( from 1991 to 2009 ) to begin to clarify the medical complications of individuals with fxs over 40 .
this is a retrospective uncontrolled study of a convenience sample ( patients were either clinically referred for an evaluation of fxs or seen as part of a research protocol ) .
data was collected from 62 individuals with the fxs full mutation who were at least 40 years old at their most recent clinical examination .
the subjects included 62 patients ( 44 males and 18 females ) , ranging from 4071 years of age , with mean age of 49.7 8.0 year .
data was identified from clinical and research evaluations of subjects with fxs at one of three sites spanning from 1991 to 2009 .
patients and their families consented to use of medical data under specifications of each institution s research review board .
patients were seen at the university of california , davis , medical investigation of neurodevelopmental disorders ( m.i.n.d ) institute ( n = 23 ) , university of colorado , denver ( n = 24 ) , and rush university medical center , chicago ( n = 15 ) .
a common medical history and examination data form was used at all of the centers .
this form had been implemented for data collection in previous collaborations and an earliar version of this data sheet was used to collect information for past reports ( riddle et al .
full scale iq , comprehensive medical history , physical characteristics , and current and past medication use were collected from medical records .
the number of cgg repeats , percentage of methylation , and percentage of fmrp and mrna were measured , if samples were available .
bmi ( weight ( kg)/height ( m)2 was used to assess obesity ; bmi cutoff criteria for overweight and obese were 25 - < 30 and 30 , respectively ( ogden et al .
the statistical method used was the fisher exact test to compare the medical problems between male and female patients and also between full mutation and mosaic individuals .
the mean age in males 50.2 8 y and females 48.5 7.8 y were not significantly different ( p = 0.451 ) .
there was no significant differences ( p = 0.752 ) between mean age of the patients with full mutation alleles ( 49.6 7.4 year ) compared with patients with mosaic alleles ( 50.4 10.3 year ) .
of 52 patients for whom measurement of body mass index ( bmi ) was available , the mean of the bmi was 28.5 5 ( 28.8% obese and 53.8% overweight ) .
the molecular studies of 60 patients showed that 46 patients ( 76.7% ) had a hypermethylated full mutation whereas 14 ( 23.3.% ) were mosaic patients ( either size or methylation mosaicism ) .
two ( 3.2% ) patients were dna positive for fragile x ( > 200 repeats ) but their exact cgg repeat number was unavailable .
five of 18 ( 27.8% ) females and 9 of 44 ( 20.5% ) males were mosaics .
there was no significant difference between males and females in the percentage with a full mutation or mosaicism ( p = 0.412 ) .
the full scale iq was assessed by the wechsler adult intelligence scale - third edition ( wais - iii ) , wechsler adult intelligence scale - revised ( wais - r ) , wechsler abbreviated scale of intelligence ( wasi ) , or stanford binet from 44 patients who completed this testing ranged from 36 to 122 with a mean of 58 19 .
the mean iq was significally higher in the group of female patients ( 77 17.4 ) than in the male patients ( 51.5 14.3 , p < 0.001 ) .
of 43 patients who have iq data and dna category available , the iq of those with mosaicism ( 69.2 18.6 ) was significantly higher than those with the full mutation only ( 55.4 18 ; p = 0.036 ) .
we found that the five most frequent medical problems in patients with fxs 40 years of age were neurological problems ( 38.7% ) , gastrointestinal problems ( 30.6% ) , obesity ( 28.8% ) , hypertension ( 24.2% ) and heart problems including mitral valve prolapse ( mvp ) , cardiac conduction abnormalities , heart attack , and heart rhythm disorder ( 24.2% ) ( see table 1 ) .
males had a significantly higher percentage of neurological problems compared with females ( 47.7% vs 16.7% , p = 0.021 ) . however , only movement disorders were significantly different between males ( 38.6% ) and females ( 10.2% , p = 0.029 ) .
the symptoms / diagnoses that were included in movement disorders are tremor ( 9 patients , 14.5% ) , parkinson s disease ( pd ) ( 4 patients , 6.5% ) , bradykinesia without pd ( 5 patients , 8.1% ) , tardive dyskinesia ( 4 patients , 6.5% ) , and tics ( 3 patients , 4.8% ) .
there were 12 patients with a history of seizures and the onset of seizures was in adulthood for 5 ( 8.1% ) patients ( 3 patients had seizures at over 40 years of age ) .
table 1the number and percentage of medical problems in patients with fxs 40 yearsproblemssexdna statustotal subjects ( n = 62)nmale ( n = 44)female ( n = 18)pnfull mutation (
n = 46)mosaic ( n = 14)pall neurological problems6221 ( 47.7%)3(16.7%)0.021 * 6019(41.3%)3(21.4%)0.15024(38.7%)movement disorder6217(38.6%)2(10.2%)0.029 * 6014(30.4%)3(21.4%)0.38619(30.6% ) tremor628(18.2%)1(5.6%)0.192607(15.2%)2(14.3%)0.6519(14.5% ) ataxia626(13.6%)1(5.6%)0.336604(8.7%)3(21.4%)0.1997(11.3% ) parkinsonism624(9.1%)00.243602(4.3%)2(14.3%)0.2304(6.5% ) tardive dyskinesia624(9.1%)00.243601(2.2%)1(7.1%)0.4154(6.5% ) bradykinesia without pd625(11.4%)00.168605(10.9%)00.2515(8.1% ) tics622(4.5%)1(5.6%)0.650603(6.5%)00.4443(4.8%)seizure6210(22.7%)2 ( 11.1%)0.2496010(21.7%)1(7.1%)0.20512(19.4%)multiple sclerosis621(2.3%)00.71060001(1.6%)gastrointestinal problem6214(31.8%)5(27.8%)0.5036013(28.3%)4(28.6%)0.61419(30.6%)obesity525(13.9%)10(62.5%)0.001 * 5112(30.0%)3(27.3%)0.58915(28.8%)hypertension629(20.5%)6(33.3%)0.2246012 ( 26.1%)2(14.3%)0.30015(24.2%)heart problem6213(29.5%)2(11.1%)0.1106012 ( 26.1%)2(14.3%)0.30015(24.2%)history of decline6210(22.7%)4(22.2%)0.437609(19.6%)3(21.4%)0.57414(22.6%)autonomic problem629(20.5%)2(11.1%)0.316607(15.2%)3(21.4%)0.42611(17.7%)memory problem629(20.5%)2(11.1%)0.316608(17.4%)3(21.4%)0.50211(17.7)dementia / cognitive decline624(9.1%)2(11.1%)0.567604(8.7%)1(7.1%)0.6696 ( 9.7%)kidney problem625(11.4%)2(11.1%)0.674606(13.0%)1(7.1%)0.4787(11.3%)respiratory problem624(9.1%)2(11.1%)0.567604(8.7%)1(7.1%)0.6696(9.7%)swallowing problem624(9.1%)00.243602 ( 4.3%)1(7.1%)0.5564(6.5%)diabetes623(6.8%)1(5.6%)0.671603(6.5%)1(7.1%)0.6654(6.5%)thyroid problems623(6.8%)1(5.6%)0.671603(6.5%)1(7.1)00.6654(6.5%)cancer622 ( 4.5%)00.5006001(7.15)0.2332(3.2%) percentage within sex and dna status # n = 52 ,
male = 36 , female = 16 ; $ n = 51 , full = 40 , mosaic = 11 the number and percentage of medical problems in patients with fxs 40 years percentage within sex and dna status # n = 52 , male = 36 , female = 16 ; $ n = 51 , full = 40 , mosaic = 11 overall , of 52 patients who had bmi measurements , 43(82.6% ) were in the obese ( 28.8% ) or overweight ( 53.8% ) category .
the mean bmi in females ( 32 5.4 ) was significantly higher ( p < 0.001 ) than that of males ( 26.9 3.9 ) .
however , more males ( 63.9% ) met criteria for being overweight than females ( 31.2% ) .
there were no significant differences in medical problems between those with a full mutation as compared to those with mosaicism .
almost half of the patients were taking psychopharmacologic medication including selective serotonin reuptake inhibitors ( ssris ) , serotonin and norepinephrine reuptake inhibitors ( snris ) , atypical neuroleptics , first generation neuroleptics ( thioridazine ) and other medication ( benzodiazepines , bupropion , buspirone ) .
table 2current medication documented in study patients ( n = 62)medical classnumber and percentageall medication47 ( 75.8%)psychopharmacologic medication29 ( 46.8% ) ssri/ snri20 ( 68.9% )
stimulant0 other including benzodiazepines , bupropion , buspirone , thioridazine12(41.4%)anticonvulsants / mood stabilizer8 ( 12.9%)hbp and other cv medications18 ( 29%)gastrointestinal medications9 ( 14.5%)percentage represents the % of those who took psychopharmacological medications;hbp high blood pressure ; cv cardiovascular current medication documented in study patients ( n = 62 ) percentage represents the % of those who took psychopharmacological medications;hbp high blood pressure ; cv cardiovascular
the mean age in males 50.2 8 y and females 48.5 7.8 y were not significantly different ( p = 0.451 ) .
there was no significant differences ( p = 0.752 ) between mean age of the patients with full mutation alleles ( 49.6 7.4 year ) compared with patients with mosaic alleles ( 50.4 10.3 year ) .
of 52 patients for whom measurement of body mass index ( bmi ) was available , the mean of the bmi was 28.5 5 ( 28.8% obese and 53.8% overweight ) .
the molecular studies of 60 patients showed that 46 patients ( 76.7% ) had a hypermethylated full mutation whereas 14 ( 23.3.% ) were mosaic patients ( either size or methylation mosaicism ) .
two ( 3.2% ) patients were dna positive for fragile x ( > 200 repeats ) but their exact cgg repeat number was unavailable .
five of 18 ( 27.8% ) females and 9 of 44 ( 20.5% ) males were mosaics .
there was no significant difference between males and females in the percentage with a full mutation or mosaicism ( p = 0.412 ) .
the full scale iq was assessed by the wechsler adult intelligence scale - third edition ( wais - iii ) , wechsler adult intelligence scale - revised ( wais - r ) , wechsler abbreviated scale of intelligence ( wasi ) , or stanford binet from 44 patients who completed this testing ranged from 36 to 122 with a mean of 58 19 .
the mean iq was significally higher in the group of female patients ( 77 17.4 ) than in the male patients ( 51.5 14.3 , p < 0.001 ) .
of 43 patients who have iq data and dna category available , the iq of those with mosaicism ( 69.2 18.6 ) was significantly higher than those with the full mutation only ( 55.4 18 ; p = 0.036 ) .
we found that the five most frequent medical problems in patients with fxs 40 years of age were neurological problems ( 38.7% ) , gastrointestinal problems ( 30.6% ) , obesity ( 28.8% ) , hypertension ( 24.2% ) and heart problems including mitral valve prolapse ( mvp ) , cardiac conduction abnormalities , heart attack , and heart rhythm disorder ( 24.2% ) ( see table 1 ) .
males had a significantly higher percentage of neurological problems compared with females ( 47.7% vs 16.7% , p = 0.021 ) . however , only movement disorders were significantly different between males ( 38.6% ) and females ( 10.2% , p = 0.029 ) .
the symptoms / diagnoses that were included in movement disorders are tremor ( 9 patients , 14.5% ) , parkinson s disease ( pd ) ( 4 patients , 6.5% ) , bradykinesia without pd ( 5 patients , 8.1% ) , tardive dyskinesia ( 4 patients , 6.5% ) , and tics ( 3 patients , 4.8% ) .
there were 12 patients with a history of seizures and the onset of seizures was in adulthood for 5 ( 8.1% ) patients ( 3 patients had seizures at over 40 years of age ) .
table 1the number and percentage of medical problems in patients with fxs 40 yearsproblemssexdna statustotal subjects ( n = 62)nmale ( n = 44)female ( n = 18)pnfull mutation ( n = 46)mosaic ( n = 14)pall neurological problems6221 ( 47.7%)3(16.7%)0.021 * 6019(41.3%)3(21.4%)0.15024(38.7%)movement disorder6217(38.6%)2(10.2%)0.029 * 6014(30.4%)3(21.4%)0.38619(30.6% ) tremor628(18.2%)1(5.6%)0.192607(15.2%)2(14.3%)0.6519(14.5% ) ataxia626(13.6%)1(5.6%)0.336604(8.7%)3(21.4%)0.1997(11.3% ) parkinsonism624(9.1%)00.243602(4.3%)2(14.3%)0.2304(6.5% ) tardive dyskinesia624(9.1%)00.243601(2.2%)1(7.1%)0.4154(6.5% ) bradykinesia without pd625(11.4%)00.168605(10.9%)00.2515(8.1% ) tics622(4.5%)1(5.6%)0.650603(6.5%)00.4443(4.8%)seizure6210(22.7%)2 ( 11.1%)0.2496010(21.7%)1(7.1%)0.20512(19.4%)multiple sclerosis621(2.3%)00.71060001(1.6%)gastrointestinal problem6214(31.8%)5(27.8%)0.5036013(28.3%)4(28.6%)0.61419(30.6%)obesity525(13.9%)10(62.5%)0.001 * 5112(30.0%)3(27.3%)0.58915(28.8%)hypertension629(20.5%)6(33.3%)0.2246012 ( 26.1%)2(14.3%)0.30015(24.2%)heart problem6213(29.5%)2(11.1%)0.1106012 ( 26.1%)2(14.3%)0.30015(24.2%)history of decline6210(22.7%)4(22.2%)0.437609(19.6%)3(21.4%)0.57414(22.6%)autonomic problem629(20.5%)2(11.1%)0.316607(15.2%)3(21.4%)0.42611(17.7%)memory problem629(20.5%)2(11.1%)0.316608(17.4%)3(21.4%)0.50211(17.7)dementia / cognitive decline624(9.1%)2(11.1%)0.567604(8.7%)1(7.1%)0.6696 ( 9.7%)kidney problem625(11.4%)2(11.1%)0.674606(13.0%)1(7.1%)0.4787(11.3%)respiratory problem624(9.1%)2(11.1%)0.567604(8.7%)1(7.1%)0.6696(9.7%)swallowing problem624(9.1%)00.243602 ( 4.3%)1(7.1%)0.5564(6.5%)diabetes623(6.8%)1(5.6%)0.671603(6.5%)1(7.1%)0.6654(6.5%)thyroid problems623(6.8%)1(5.6%)0.671603(6.5%)1(7.1)00.6654(6.5%)cancer622 ( 4.5%)00.5006001(7.15)0.2332(3.2%) percentage within sex and dna status # n = 52 , male = 36 , female = 16 ; $ n = 51 , full = 40 , mosaic = 11 the number and percentage of medical problems in patients with fxs 40 years percentage within sex and dna status # n = 52 , male = 36 , female = 16 ; $ n = 51 , full = 40 , mosaic = 11 overall , of 52 patients who had bmi measurements , 43(82.6% ) were in the obese ( 28.8% ) or overweight ( 53.8% ) category .
the mean bmi in females ( 32 5.4 ) was significantly higher ( p < 0.001 ) than that of males ( 26.9 3.9 ) .
however , more males ( 63.9% ) met criteria for being overweight than females ( 31.2% ) .
there were no significant differences in medical problems between those with a full mutation as compared to those with mosaicism .
table 2 shows the current medications of the subjects . almost half of the patients were taking psychopharmacologic medication including selective serotonin reuptake inhibitors ( ssris ) , serotonin and norepinephrine reuptake inhibitors ( snris ) , atypical neuroleptics , first generation neuroleptics ( thioridazine ) and other medication ( benzodiazepines , bupropion , buspirone ) .
table 2current medication documented in study patients ( n = 62)medical classnumber and percentageall medication47 ( 75.8%)psychopharmacologic medication29 ( 46.8% ) ssri/ snri20 ( 68.9% ) atypical neuroleptic13 ( 44.8% )
stimulant0 other including benzodiazepines , bupropion , buspirone , thioridazine12(41.4%)anticonvulsants / mood stabilizer8 ( 12.9%)hbp and other cv medications18 ( 29%)gastrointestinal medications9 ( 14.5%)percentage represents the % of those who took psychopharmacological medications;hbp high blood pressure ; cv cardiovascular current medication documented in study patients ( n = 62 ) percentage represents the % of those who took psychopharmacological medications;hbp high blood pressure ; cv cardiovascular
this is the only study to date to describe the medical problems in patients with fxs 40 years and older .
the neurodegeneration seen in aging premutation carriers with fxtas is thought to be secondary to the elevated level of fmr1 mrna which usually does not occur in those with fxs .
however , rarely elevated fmr1 mrna can be seen in those with the full mutation and a high level of mosaicism , although this has not been associated with neurodegeneration or autism ( harris et al .
however , we did find significant neurological problems with aging , more so in males than females , including pd and movement disorders . while overall the presence of neurological problems was not related to the molecular status ( mosaicism ) of the patient , we found pd in four of 44 males ( 9.1% ) , and the one with earliest onset at age 42 , had mosaicism with the highest mrna level ( 10.29 0.78 ) .
there were 3 of 12 males ( 20% ) over age 55 with pd compared to the expected rate of 1.2% of males with pd seen in the general population 55 years old and older ( de rijk et al .
1995 ) . a larger study of aging patients with fxs is needed to understand whether the rate of pd is higher in fxs compared to the general population as found in this study .
all of the patients with pd and fxs had been treated for many years with antipsychotics , although usually atypical antipsychotics have been used since they became available in the 1990s .
the atypical antipsychotics have a lower incidence of movement disorder sequelae , particularly tartive dyskinesias , than first generation antipsychotics , although even these newer drugs can be associated with symptoms of pd ( cortese et al .
it is possible that the high occurence of pd in the fxs cases reported here relates to this treatment .
these patients were taken off neuroleptics when pd symptoms started but their pd progressed . in one patient lowering the dose of the atypical antipsychotic seemed to decrease the symptoms of pd and in others the symptoms of motor dysfunction improved with lowering the dose of atypicals also . however , it is also possible that the pd - like symptoms such as tremor or balance problems seen in fxs are exacerbated by the loss of purkinje cells and resultant cerebellar compromise .
there is also cellular evidence for significant dysfunction of the dopamine system in fxs related to the lack of fmrp ( wang et al .
2008 ) , although the substantia nigra has not been directly studied in fxs . in those patients with pd and fxs
there was cognitive decline and this can occur in pd in general ( muslimovic et al .
the prevalence of obesity has increased in the us population over the last decade so it is not unexpected to see significant rates of obesity in those with fxs in the current study .
the obesity epidemic in the us is related to the lack of physical activity ( brock dw , 2009 ) and our diet composition ( murtaugh ma , 2007 ) .
additionally , in those with fxs the tendency for more reclusive behavior with age ( hatton et al .
2006 ) , the use of atypicals that increase the appetite and the presence of the prader - willi phenotype ( seen in less than 10% of patients with fxs ) leading to hyperphagia ( nowicki et al .
in this study , 82.6% of patients with fxs have either obesity ( 28.8% ) or they are overweight ( 53.8% ) .
the percentage of obesity in these patients is slightly lower than in the general population ( 34% ) but the overweight percentage is much higher than estimated in the general population ( 33% ) ( khan et al .
hypertension is common in men with fxs , but the prevalence has never been studied in detail ( hagerman 2002 ) .
recently , the prevalence rate of hypertension in the us general population was reported as 28.9% overall ( cutler et al . 2008 ) .
hypertension may be underrecognized by the physician because anxiety and tactile defensiveness in the clinical setting often leads to increased bp in patients with fxs .
thus , a high value is often interpreted with consideration of the stress and anxiety associated with the medical visit . in this study 24%
were diagnosed with hypertension , and although this is not significantly different from the general population it may be an underestimate of the true incidence of this problem in fxs .
hypertension may be more likely in individuals with fxs because of the sympathetic hyperarousal documented in this syndrome ( miller et al .
1999 ) and possibly because of elastin abnormalities in the vessel walls as was documented in one patient with fxs ( waldstein and hagerman 1988 )
. a recent neuropathology study of three older men with fxs who died ( they are included in this study ) showed significant evidence of hyaloid changes in the blood vessels presumed to be secondary to hypertensive disease .
these results emphasize the need to diagnose hypertension in those with fxs and treat it appropriately .
we found 7 ( 11.3% ) patients have kidney problems including acute renal failure ( 2 patients ) , urinary tract infection ( 2 patients ) , kidney stones ( 1 patient ) , small cysts ( 1 patient ) , and 1 patient with a kidney problem but unclear diagnosis .
connective tissue dysplasia , documented to be related to elastin abnormalities ( waldstein et al . 1986 ) in fxs may lead to reflux and ureteral dilation leading to renal failure and nephrectomy in one previous case ( hagerman 2002 ) . in this study ,
one patient had severe prostate enlargement which lead to obstruction and renal failure and this was relieved by surgery .
two male patients were diagnosed with cancer including one with an adenocarcinoma of the testicle and the other with a malignant liver cancer that did not have a pathological diagnosis .
some studies suggest a decreased risk of cancer in individuals with fxs ( schultz - pedersen et al .
however , there is also upregulation of the mtor pathway in fxs ( hoeffer et al .
2009 ) which can lead to an increased risk of cancer ( matsumoto et al .
typically seizures in fxs occur in childhood in about 1520% and they are usually well controlled with anticonvulsants ( berry - kravis 2002 ) .
however , our study found that 8.1% of the patients had seizures that began in adulthood with 3 patients developing seizures after age 40 .
further studies of seizures in aging are needed to assess whether seizures in fxs tend to be a complication of aging and whether a second peak of seizure onset ( in addition to that described in childhood ) occurs late in life in fxs ( hagerman and stafstorm 2009 ) .
clinicians should be alert to the possibility of seizures in adult and aging patients with fxs .
an additional notable finding in our study is the lack of significant atherosclerotic heart disease or late onset complications of mitral valve prolapse which is thought to be present in over 50% of adult males with fxs ( hagerman 2002 )
. the limitations of this study include lack of typical or intellectually impaired controls , intellectually impaired subjects , cohort effects due to the small sample size , retrospective chart review and referral bias to well - known fxs clinics . however , this study is a first step toward understanding the medical problems associated with aging in those with fxs . in summary , we have found a number of medical problems associated with aging in individuals with fxs that may be related to the neurobiological changes in this disorder .
since these may be related to long term use of atypical antipsychotics , the risks and benefits for continued use should be weighed in aging individuals with fxs .
all of the atypical antipsychotics can be associated with parkinsonism except quetiapine ( seroquel ) , which is frequently used for managing hallucinations in the pd population because of it s minimal motor side effects ( cortese et al . 2008 ) .
in addition , vigorous identification and treatment of hypertension is warranted because of the cns effects of untreated hypertension .
Output:
| many studies have focused on the behavior and cognitive problems in young patients with fragile x syndrome ( fxs ) , but there are no studies about the problems in aging for those with fxs .
the discovery of the fragile x - associated tremor ataxia syndrome ( fxtas ) , a neurodegenerative disorder related to elevated fmr1-mrna , in elderly men and some women with the premutation , intensified the need for aging studies in fxs .
approximately 40% of males with fxs have repeat size mosaicism and as a result , some of these individuals also have elevated levels of fmr1-mrna which theoretically puts them at risk for fxtas . here
, we have surveyed all of the aging patients with fxs that we have followed over the years to clarify the medical complications of aging seen in those with fxs .
data was collected from 62 individuals with the fxs full mutation ( 44 males ; 18 females ) who were at least 40 years old at their most recent clinical examination .
we found that the five most frequent medical problems in these patients were neurological problems ( 38.7% ) , gastrointestinal problems ( 30.6% ) , obesity ( 28.8% ) , hypertension ( 24.2% ) and heart problems ( 24.2% ) .
movement disorders were significantly different between males and females ( 38.6% vs.10.2% , p = 0.029 ) .
we did not find any differences in medical problems between those with a full mutation and those with mosaicism .
identification of medical problems associated with aging in fxs is important to establish appropriate recommendations for medical screening and treatment considerations . |
PubmedSumm118486 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the world health organization ( who ) defines participation restriction ( pr ) , a key feature of the revised international classification of functioning , disability and health ( icf ) , as problems an individual may experience in involvement in life situations , and it reflects the negative consequences of health conditions on important personal and societal domains .
community participation is an important type of participation because having and maintaining valued life roles and activities is associated with better psychological well - being and self - rated health [ 24 ] and may be especially important for older adults , who are often at risk for unwanted declines in participation [ 57 ] .
there is a growing interest in pr from public health , medical , and social perspectives , partly because even when poor health persists , participation may still be maintained .
pr from an icf perspective considers the influence of environment , in all its forms , on one 's ability to engage in life situations .
a recent independent validity study found that the icf model , including its conceptualization of participation , is useful for examining disability in aging research . despite some studies [ 1014 ] ,
gaps remain in research on the interaction between older adults and their environment . among limited findings
, arthritis has consistently been associated with high levels of pr and disability in both cross - sectional and longitudinal studies [ 2 , 1521 ] .
also , features of the built environment and poor walkability of neighborhoods have been identified as barriers for individuals with varying levels of physical impairment .
combining both health status and environmental perspectives provides an ideal context in which to examine how older adults with chronic health conditions participate in their communities .
the purpose of this study was to estimate the prevalence of community pr due to perceived environmental barriers among older adults ( 50 years ) and to compare the impact among those with selected chronic conditions .
previous reports in the literature suggest that community pr would be greatest among older adults with disabling conditions ( e.g. , arthritis , stroke ) and sensory deprivation ( e.g. , hearing or vision loss ) [ 5 , 8 , 19 , 2123 ] .
data sourcedata were obtained from the 2002 national health interview survey ( nhis ) , an ongoing , multistage probability survey conducted annually by a standardized in - person interview in english or spanish .
the nhis is designed to be representative of the us civilian , noninstitutionalized population . in 2002 , a supplement based on healthy people 2010 content , disability and secondary conditions questions : assistive technologies and environmental barriers , was added to the sample adult core questionnaire , from which our sample was drawn .
the sample adult core was administered to 31,044 individuals ages 18 years ; only respondents 50 years (
data were obtained from the 2002 national health interview survey ( nhis ) , an ongoing , multistage probability survey conducted annually by a standardized in - person interview in english or spanish .
the nhis is designed to be representative of the us civilian , noninstitutionalized population . in 2002 ,
a supplement based on healthy people 2010 content , disability and secondary conditions questions : assistive technologies and environmental barriers , was added to the sample adult core questionnaire , from which our sample was drawn .
the sample adult core was administered to 31,044 individuals ages 18 years ; only respondents 50 years
these were age , sex , race / ethnicity ( non - hispanic white , non - hispanic black , hispanic non - hispanic other ) , annual household income ( > $ 20,000 , < $ 20,000 , and unknown ) , and education ( high school , < high school , and unknown ) .
we examined the prevalence of three main outcomes : ( 1 ) community pr , ( 2 ) condition - associated absolute burden of community pr , and ( 3 ) community environmental barriers .
participants were shown a list of ten environmental barriers ( building design , lighting , sound , crowds , sidewalks and curbs , and transportation , household or workplace equipment hard to use , attitudes of other people , policies , and other ) and were asked : thinking of community activities such as getting together with friends or neighbors , going to church , temple , or another place of worship , movies , or shopping , do problems with any of these things on the list now limit or prevent your participation in community activities ?
respondents answering yes were next asked to identify which items on the list were barriers to them and to report how often they experienced these barriers ( collapsed to always / often or sometimes / rarely ) .
conceptually , the first three barriers ( building design , lighting , and sound ) fit together as accessibility barriers , while crowds , sidewalks / curbs , and transportation made up a category of mobility barriers .
household / workplace equipment hard to use was omitted because it pertained to noncommunity settings ; other was excluded because of high item nonresponse .
the policy category was excluded from the analysis because it had a low item response rate with estimates failing to meet minimum reliability criteria ( relative standard error < 30.0 ) for any condition examined . for each condition ( defined below ) , the associated burden of community pr was estimated as the absolute number of respondents with the condition reporting community pr .
condition - associated absolute burden was also examined for those with each chronic condition who also had arthritis as a comorbidity ( described below ) .
the presence of seven diagnosed chronic conditions or condition categories was based on a yes
response to have you ever been told by a doctor or other health professional that you have for each of arthritis , diabetes , hypertension , stroke , heart conditions ( i.e. , angina pectoris , coronary heart disease , heart attack , heart failure , or heart condition / disease ) , neurological conditions ( i.e. , multiple sclerosis , parkinson 's disease , neuropathy , or seizures ) , and respiratory conditions ( i.e. , asthma , emphysema , or chronic bronchitis ) .
hearing impairments were defined as a response of a lot of trouble hearing or deaf to which statement best describes your hearing without a hearing aid : good , a little trouble , a lot of trouble , deaf ?
vision impairments were defined as a response of yes to do you have any trouble seeing , even when wearing glasses or contact lenses ?
obesity was defined as a body mass index ( weight in kg / height in m ) of 30 .
depression / anxiety was determined by a yes response to during the past 12 months , have you been frequently depressed or anxious ? serious psychological distress ( spd ) was measured with the kessler 6 ( k6 ) , a psychological distress scale developed to screen for and monitor population prevalence and trends of nonspecific spd .
it comprises 6 questions on a 0 ( none of the time ) to 4 ( all of the time ) point scale asking how often in the past 30 days a person felt sad , worthless , nervous , restless , hopeless , or that everything was an effort .
responses are summed for a total score ( 026 ) ; we used a cutoff of 13 as recommended by the scale developer to identify spd among respondents .
respondents could have more than one chronic condition ; therefore , chronic conditions examined were not mutually exclusive . missing values for community pr and
individual barriers were assigned to the most conservative category , that is , if a respondent did not identify community pr with a yes
missing values for chronic conditions ranged from n = 8 ( 0.06% ) for respiratory conditions to n = 613 ( 5.0% ) for obesity . age , sex , and race / ethnicity variables were provided by nchs with no missing values . to examine the effects of comorbidities on community pr
, we created a count variable indicating how many of the 12 chronic conditions described above each respondent reported ( categorized as 0 , 1 , 2 , 3 , 4 , and 5 ) .
given its widespread prevalence and status as the most common cause of disability among us adults , arthritis was expected to be associated with high levels of community pr .
we examined community pr among those with each of the other chronic conditions plus arthritis as a comorbidity .
weighted frequencies , 95% confidence intervals ( 95% ci ) , and proportions were obtained using sas 9.2 and sudaan v10 statistical software , accounting for the complex sampling design .
estimates were considered unstable if they did not meet minimum reliability criteria ( i.e. , a relative standard error ( rse ) 30% ) and are not reported .
estimates were considered potentially unreliable if they had an rse between 20% and 30% and have been flagged as such in tables and footnotes .
the weighted median age of the participants was 61.5 ( mean = 64.0 ; standard deviation 13.4 ) ( table 1 ) ( the age of respondents 85 years are reported as 85 years in the nhis public release files : ftp://ftp.cdc.gov/pub/health_statistics/nchs/dataset_documentation/nhis/2002/samadult.pdf .
therefore , the mean , standard deviation , median , and range of ages may be underestimated . ) .
the majority of the participants were female ( 54.2% ) , non - hispanic whites ( 80.4% ) and those with an annual household income of $20,000 ( 70.7% ) and at least a high school education ( 77.8% ) ( table 1 ) .
chronic conditions were common among adults 50 years ; 23.7% reported one condition and 55.8% reported two or more conditions most condition groups examined ( 8 of 12 ) were reported by > 10% of the sample ( table 2 ) .
hypertension was the most frequently reported chronic condition ( 44.4% , 95% ci = 43.545.3 ) , followed by arthritis ( 39.8% , 95% ci = 38.740.8 ) . neurological conditions ( 4.3% ) and
spd ( 3.1% ) were the least reported conditions ( table 2 ) . among all adults
50 years , the prevalence of any community pr was 3.6% ( 3.23.9 ) . among adults with chronic conditions ,
the overall prevalence of any community pr ranged from 5.1% ( 4.36.0 ) for obesity to 20.4% ( 17.623.2 ) for spd ( table 2 ) .
respondents with the most prevalent conditions ( hypertension and arthritis ) reported among the lowest proportion of any community pr , 5.3% and 6.4% , respectively ( table 2 ) . the highest prevalence of community pr overall was among respondents with spd ( 20.4% ) , followed by neurological conditions , hearing or vision impairments , and depression / anxiety ( table 2 ) .
however , due to the relatively low prevalence of these conditions , only depression / anxiety and vision impairments were among the top five conditions with the greatest condition - associated absolute burden of community pr .
in absolute numbers , the greatest condition - associated burden was among people with arthritis , affecting 1.9 million adults 50 years ( table 2 ) .
the remaining top five conditions in terms of absolute numbers of condition - associated burden of community pr were , in order of magnitude , hypertension , depression / anxiety , heart conditions , and vision impairments . across all conditions ,
more than half of those with community pr reported being restricted always / often , ranging from 54.7% for neurological conditions to 75.8% for spd ( table 2 ) .
approximately two - thirds of respondents with community pr and stroke , obesity , or depression / anxiety reported restriction
always / often ( table 2 ) . similar to condition - associated absolute burden , despite the lower prevalence of being
always / often restricted , those with arthritis had the greatest disease burden in absolute numbers ( ~1.1 million ) , followed by hypertension ( 961,000 ) ( table 2 ) .
the presence of arthritis as a comorbidity resulted in significantly higher community pr for respondents with hypertension ( 7.8 versus 5.3 ) , heart conditions ( 9.4 versus 6.7 ) , and obesity ( 7.5 versus 5.1 ) ( table 2 ) . despite the lack of significance for arthritis comorbidity in the remaining conditions ,
there was pattern of higher community pr for every condition examined ; arthritis seemed to result in greater prevalence of community pr by 2 - 3% across conditions ( table 2 ) .
respondents with spd reported the highest prevalence of any accessibility ( 13.9% ) , any mobility ( 16.8% ) , and attitudes of others ( 8.5% ) barriers ( table 3 ) .
report of any accessibility barrier ranged from 3.4% for obesity ( 2.74.2 ) and hypertension ( 2.93.9 ) to 13.9% ( 11.616.2 ) for spd .
the prevalence of any mobility barrier ranged from 3.6% ( 2.94.3 ) for obesity to 16.8% ( 14.219.5 ) for spd .
attitudes of others barriers were less frequent , ranging from 1.1% ( 0.81.4 ) for hypertension to 8.5% ( 6.610.4 ) for spd ( table 3 ) .
although the frequency of accessibility barriers was the same as mobility barriers across conditions , the absolute number of people with mobility barriers was greater for all conditions except diabetes ( table 3 ; figure 2 ) . among those with accessibility barriers , building design ( 2.58.6% ) was reported significantly more often than either lighting ( 0.83.3% ) or sound ( 0.97.4% ) for all conditions , with the exceptions of hearing impairments , spd , and stroke ( table 3 ) . within mobility barriers
, there were no significant differences in the prevalence of any of the three components , with the exception that respondents with spd reported crowds as a barrier significantly more often than those with other conditions ( table 3 ) . among the top five chronic conditions with the greatest condition - associated absolute burden of community pr ( arthritis , hypertension , depression / anxiety , heart conditions , and vision impairments ) , the absolute numbers of those with mobility barriers were greater than accessibility barriers ( table 3 ) . within accessibility barrier components ,
building design was reported with the greatest frequency across all 5 conditions and was highest among those with arthritis ( figure 2 ) . within mobility barriers ,
the category sidewalks / curbs was reported by more people than either crowds or transportation among respondents with arthritis ( figure 2 ) . for the remaining top five conditions ,
overall , attitude barriers were cited more often than either lighting or sound and were highest among those with arthritis , hypertension , and depression / anxiety ( figure 2 ) . the prevalence of community pr rose with increasing number of chronic conditions , ranging from 0.6% ( 0.20.9 ) for zero chronic conditions to 13.0% ( 10.815.2 ) for 5 chronic conditions ( figure 3 ) .
this study is a novel examination of community pr in older adults with chronic conditions .
first , individuals with low - prevalence conditions ( e.g. , spd , neurological conditions , and stroke ) reported high community pr .
second , highly prevalent conditions ( e.g. , arthritis , and hypertension ) had relatively low community pr but resulted in the greatest absolute numbers of condition - associated burden .
third , the presence of comorbid conditions had a significant effect , resulting in greater community pr as the number of conditions increased .
finally , the most frequently reported barriers were building design , sidewalks / curbs , and crowds .
studies of participation in older adults demonstrate that pr is associated with several health , disability , demographic , and socioeconomic characteristics as well as suggesting discordance between physical limitations and pr [ 2 , 5 , 32 , 33 ] .
it is also well - established that functional limitations are associated with chronic conditions , older age , increased health care expenditures , and lower quality of life [ 34 , 35 ] .
this paper extends the literature through the examination of selected chronic conditions , as single and comorbid conditions , with associated community pr and specific environmental barriers .
stroke and vision and hearing impairments were associated with high levels of community pr as expected ; alternatively , respondents with arthritis reported among the lowest prevalence of community pr .
surprisingly , obesity was associated with low levels of community pr , despite cross - sectional and longitudinal studies consistently showing declining mobility in tandem with increasing adiposity in older adults .
large condition - associated absolute burden was expected and observed with arthritis . also , higher prevalence of community pr among respondents with arthritis comorbidity was consistent with a priori expectations .
arthritis has been shown to increase levels of physical inactivity among adults with heart disease and diabetes , as well as being linked to negative physical and mental health outcomes , including increased activity limitation [ 35 , 39 ] , work limitation , frequent mental distress , and serious psychological distress .
there is consistent evidence in the literature that absent or poorly maintained sidewalks , lack of access to transportation , and heavy motor vehicle traffic [ 4345 ] have negative impacts on mobility in older adults .
for example , clarke et al . found that adults with severe lower extremity physical impairments who lived in neighborhoods with fair / poor streets were 4.5 times more likely to report severe mobility disability than those living in neighborhoods with streets free from cracks , potholes , and broken curbs . also , a recent us study estimated that each year more than 9,000 older pedestrian fall - related injuries involve a curb .
attitudes of the public and other persons ' rudeness have also been identified as community barriers in other studies ; in these studies , as in ours , physical barriers were more frequently reported by respondents .
study also cited religious buildings , friends ' or relatives ' houses , restaurants , and other places for recreation or leisure as destinations participants , particularly those 50 , wanted to but were unable to reach , suggesting these may be important destinations related to community pr in that sample as well .
interestingly , there were insufficient responses from survey participants to create reliable estimates regarding policy barriers to community pr .
this may reflect that , while community dwelling older adults in the usa do not report encountering policies that explicitly limit their community participation , these same adults may not be aware of or recognize that policy changes could facilitate their ability to maintain community participation [ 11 , 13 , 44 , 45 , 4850 ] . as described in the disablement process and the icf , intervening factors of the physical environment , which can be influenced by policy , speed - up and slow - down disablement in the presence of functional limitations . a growing literature links environmental barriers to pr , particularly among older adults [ 5 , 10 , 11 , 13 , 4951 ] .
many of these studies simultaneously reinforce that for those adults at greatest risk for disability , the disablement process could be reversed or attenuated [ 11 , 48 ] through policy - supported efforts to improve community infrastructure , such as sidewalk repairs , creating greener street environments , removing obstacles , and adding or maintaining street lighting , which can assist individuals with impairments to remain engaged in their communities [ 10 , 11 , 13 , 50 ] . among the features consistently associated with greater community mobility are intact pavement
[ 11 , 45 ] , greater land use density [ 45 , 49 , 52 ] , greater land use diversity [ 13 , 45 , 49 ] , and shorter distance to nonresidential destinations [ 45 , 49 ] . in a study examining neighborhood design and walkability , frank et al . reported that walking levels could increase 2-fold if older adults had access to multiple destinations within short distances , and li and colleagues found a positive relationship between housing density , green and open spaces , number of nearby recreational facilities , and number of street intersections , among other features , and walking activity in older adults .
evidence on correlates appears sufficient to support policy changes and recommended efforts related to land use patterns and transportation systems .
regulatory and fiscal policies that affect zoning codes , land use development , street networks , housing density , intersection characteristics ( e.g. , cross walks , safety islands , and countdown timers ) , and city planning have also been recommended as important opportunities to reduce barriers in the built environment [ 43 , 45 , 46 , 49 , 53 ] .
based on a comparative study of the usa , the netherlands , and germany , pucher and dijkstra recommended that policies to improve urban design , support traffic calming , and provide better pedestrian facilities could be applied in the usa to increase walking safety .
the potential decrease in community barriers and community pr offered by policy change is important because even small environmental changes can postpone , reverse , and possibly prevent disability in vulnerable older adults ( e.g. , those with chronic conditions or functional limitations ) [ 1 , 8 , 10 , 11 , 13 , 44 , 4650 , 52 , 53 , 55 , 56 ] .
furthermore , changes to improve the built environment for older adults could benefit community members of all ages [ 10 , 45 , 46 , 54 ] .
first , data were from survey participants ' self - reports and may be subject to recall bias , although such self - reports are considered valid for surveillance purposes .
second , cross - sectional data can not be used to infer causation ; therefore , we can not determine the temporal sequencing of the chronic conditions and community pr .
third , there was limited statistical power to examine sex and race / ethnicity differences .
previous literature suggests that disability may be experienced or perceived differently by men and women [ 12 , 14 ] , and future studies with the ability to examine these possible differences are warranted .
finally , the list of potential barriers shown to respondents to identify community pr was not exhaustive . there could be additional environmental and other barriers that result in community pr ; therefore , our findings may underestimate community pr among older adults .
strengths of this study include a large sample with simultaneously available data on both community pr and a substantial number of chronic conditions that allowed us to generate nationally representative estimates for older adults . additionally ,
mobility , and attitude barriers are self - reported , individual - level rather than community - level variables , reflecting individuals ' perceptions and experiences of barriers in their environments .
finally , establishment of a condition - associated absolute burden measure that describes the impact of arthritis and other chronic conditions on community pr can be used to target and leverage resources and interventions for the greatest population effect .
millions of older adults experience community pr due to modifiable environmental characteristics , especially accessibility and mobility barriers . given the rapid growth of the older population and the high prevalence of arthritis in this population , the burden of arthritis will likely continue to be the largest among the conditions studied .
furthermore , arthritis prevalence is projected to increase by an estimated 19 million americans by 2030 and is already the most common cause of disability among older adults [ 28 , 58 ] .
assuming that the current prevalence of community pr due to modifiable environmental barriers remains constant , given the aging of the population and the projected increase in arthritis prevalence , our findings suggest that increasing numbers of adults 50 years with arthritis will experience pr due to modifiable environmental characteristics . moreover , many of these environmental features are barriers to older adults with other chronic conditions and are demonstrated to further limit people with comorbid conditions .
promising targets to reduce community pr among adults 50 years with chronic conditions , particularly arthritis , include building design , sidewalks / curbs , crowd control , and interventions that improve the built environment .
Output:
| community participation may be especially important for older adults , who are often at risk for unwanted declines in participation .
we estimated the prevalence of community participation restriction ( pr ) due to perceived environmental barriers among older adults ( 50 years ) and compared the impact among those with selected chronic conditions .
individuals with low - prevalence conditions reported high community pr ( 9.120.4% ) , while those with highly prevalent conditions ( e.g. , arthritis ) had relatively low community pr ( 5.110.0% ) but represented the greatest absolute numbers of condition - associated burden ( > 1 million ) . across all conditions ,
more than half of those with community pr reported being restricted always or often .
community pr most often resulted from modifiable environmental barriers .
promising targets to reduce community pr among adults 50 years with chronic conditions , particularly arthritis , include building design , sidewalks / curbs , crowd control , and interventions that improve the built environment . |
PubmedSumm118487 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in this research project i investigated if and how the biblical topos of the compassionate god was received in the spirituality , theologies , ideologies and theories of nursing during the 1 through the 4 century of the common era ( ce ) and in the 19 and 20 centuries .
the topos of the compassionate god is one of several motifs of the jewish and christian traditions which give comfort to the suffering believers . to think that god suffers with them can help patients bear their misery .
the scriptures of both religious communities contain many texts which give evidence for both , the need of suffering people for a compassionate god and for his continuing comfort ( 1 ) . in the old testament ( ot ) a psalmist
let god say : when they call to me , i will answer them ; i will be with them in trouble , i will rescue them and honor them . with long life
i will satisfy them , and show them my salvation ( 2 : ps 91:15 ) . in the beginning of the jewish and christian traditions
the topos of the compassionate god served as a model for people who cared for the sick .
those who adhered to it hoped to do justice to both the need of the suffering and to religious expectations .
the thesis for this research was that the biblical topos of the compassionate god provides the original model of compassionate nursing .
it represents the core of today s ethics of compassion and of caring in nursing .
the focus of this study lay on the history of compassion in nursing . in order to clarify the proposed thesis i investigated the following questions :
what substantive elements constitute the topos of the compassionate god in the old testament , in the christian new testament ( nt ) and in the jewish talmud?can the topos be identified in later generations of jewish and christian texts ( church fathers / midrashim)was the topos received in christian , jewish and secular nursing texts of the 19/20 century ?
what substantive elements constitute the topos of the compassionate god in the old testament , in the christian new testament ( nt ) and in the jewish talmud ? can the topos be identified in later generations of jewish and christian texts ( church fathers / midrashim ) was the topos received in christian , jewish and secular nursing texts of the 19/20 century ?
this research is based on the assumption of a typological utilization of the tops of the compassionate god in nursing .
typological means that an originally historical event in this case the compassionate god as a spiritual reality for jews and christians becomes a symbol or a paradigm which no longer is tied to the historical event . finally , the symbol is more important than the event which produced it
this process of transformation makes possible the transfer of past events ( in this case the experience of god s comfort to people in troubling situations ) into the present or into the future and the generalization of a paradigmatic event ( 3 ) .
to investigate the history of a particular topos means to investigate its interpretation during various historical periods and in different societal contexts ( 4 , 5 ) .
it includes aspects of historical research ( the analysis of the historical contexts of nursing ( 6 ) , of philology ( the clarification and interpretation of words and concepts such as compassion ) , of theology ( the analysis of traditions of suffering ) ( 7 ) , aspects of the science of religion ( the comparison of defined parts of christianity and judaism ) ( 8 , 9 ) , of nursing science ( the investigation of the consequences of compassion ) ( 10 ) and of social research .
compassion presupposes an experience of suffering , and any interpretation of compassion in a given text requires a qualitative and quantitative analysis of this underlying suffering and its context .
compassion is a comprehensive concept which includes the total of the experiences , expressions , activities of and interactions with the suffering .
the rabbinical texts are of semitic origin , the christian texts follow greek tradition . hence in the rabbinical texts stories , in
many new testament and talmudic texts do not describe extensively the qualities required of the carers but refer to an old testament text which has to be consulted for adequate interpretation .
the variety of expressions containing aspects of compassion presented a serious problem as the following examples show ( 11 , 12 , 13 ) :
hebrew : chamal , rachamim , chesed , zeddaka , ahavagreek : sympaschein , sympatheo , splanchnizomai , oiktireinenglish : compassion , empathy , sympathy , caringgerman : mitgefhl , empathie , mitleid , mitleidento discover the true meaning of these expressions in a given context a study of the texts in their original language was necessary .
hebrew : chamal , rachamim , chesed , zeddaka , ahava greek : sympaschein , sympatheo , splanchnizomai , oiktirein english : compassion , empathy , sympathy , caring german : mitgefhl , empathie , mitleid , mitleiden
the investigation of the research questions required the following research steps :
analysis of old and new testament and talmud texts to establish the topos of the compassionate godanalysis of texts of the rabbis and of the church fathers from the 1 through the 4 century ceanalysis of the christian , jewish and secular nursing literature of the 19/20 century ( usa , german speaking countries)comparative analysis of results according to the research questions analysis of old and new testament and talmud texts to establish the topos of the compassionate god analysis of texts of the rabbis and of the church fathers from the 1 through the 4 century ce analysis of the christian , jewish and secular nursing literature of the 19/20 century ( usa , german speaking countries ) comparative analysis of results according to the research questions
the research material for the investigation of the first and the second research questions originates mainly in the eastern mediterranean world .
the time of consolidation of rabbinic judaism and christianity were characterized by rich literary activity .
the 19 and the 20 centuries in the german speaking countries the protestant and catholic nursing orders as well as of jewish and secular schools of nursing started .
this also applies to the american nursing scene . at the same time in both places
i selected the research material according to two principles : a ) terminological selection involving texts which contain the word compassion , b ) subject related selection involving texts which imply compassion .
the research material included jewish and christian sources ( old testament , babylonian talmud , midrashim , new testament , church fathers ) in their original languages and in various translations ; secondary literature of scholars with expertise in the relevant substantive fields or language ; modern texts ( historical documents , reports , comments , diaries , biographical notes , rules of institutions , nursing literature ) .
the systematic hermeneutical analysis of the selected literature shows that the topos of the compassionate god forms the foundation of the ethics of compassion .
i will present some of the literary evidence answering the research questions and supporting this thesis .
the writings of the rabbinic and early christian texts are based on the old testament ( ot ) .
the following of these ot - reference texts illustrate god s closeness to and compassion with his people .
isaiah paraphrases god as follows : for this says the high and lofty one who inhabits eternity , whose name is holy : i dwell in the high and holy place and also with those who are contrite and humble in spirit , to revive the heart of the contrite ( 2 : isaiah 57:1519 ) . in another place
isaiah says : it was his presence that saved them ( the israelites ) ; in his love and in his pity he redeemed them ; he lifted them up and carried them all the days of old ( 2 : isaiah 63:9 ) . referring to the meaning of such texts , matthew ,
an evangelist of the christian new testament said : this was to fulfill what had been spoken through the prophet isaiah : he took our infirmities and bore our diseases ( 2 : mt 8:17 ) .
probably the clearest witness of the image of god , who gets involved actively in the fate and in the suffering of the ( prosecuted ) believers is hebrews ( 2 : 4:15 ) the author of which states : for we do not have a high priest ( christ ) who is unable to sympathize with our weaknesses , but we have one who in every respect has been tested as we are , yet without sin .
the most powerful nt - metaphor which teaches compassion to the christians is the parable of the good samaritan ( 2 : lk 10:2537 ) .
also the jewish talmud implies both god s compassion and man s obligation to imitate him . in the talmud rabbi
chama ben chanina referred to the first and second ot - books of genesis and deuteronomium , when he addressed the members of his community :
ye shall walk after the lord your god ( 2 : dtn 13:5 ) the meaning is , to walk after the attributes of the holy one , blessed be he he visited the sick , for it is written : and the lord appeared unto him ( abraham ) by the oaks of mamre ( 2 : gen 18:1 ) , so do thou also visit the sick ( 14 : bsota 14a / bned 40a ) . in another place
the talmud teaches : and he will have mercy upon you and show mercy to you . who has compassion with his fellow human beings will be shown mercy in heaven
rabbi akiba referred to the psalms when he wrote : not visiting a sick person equals shedding blood
( 14 : bned 40a ) . who visits a sick person will be saved from the punishment of purgatory , because it is written ( 2 : ps 41:2 ) : hail him who cares about the weak , in times of misfortune the lord will serve him and weak means a sick person .
the lord will protect him and keep him alive ( 14 : bned 39b ) .
many teachings about and descriptions of the compassionate god in the holy scriptures of both religions converge in a few elements that constitute the topos of the compassionate god :
he is existentially present near the suffering. he is available for them
. they can pray to him any time. he is their advocate. he is committed to their care. he is actively involved in their suffering. he is faithful and dependable. he suffers himself because he is compassionate .
therefore believers of both creeds applied them in everyday life and in the care of the sick .
the reception of the topos of the compassionate god , i.e. his presence with the suffering and his care could be identified in the writings ( sermons , letters ) of most church fathers who were active during the 1 through the 4 century ce in the region of the eastern mediterranean as the following examples show .
the christian writer tertullian who lived in the 2 century ce wrote to a group of christian martyrs ( 198 ce ) : above all , you blessed people , do not provide sorrow to the holy spirit who accompanied you to prison ( 15 : letter to the martyrs ,
the certainty of the presence of the holy spirit should enable them to transcend their pain .
cyprian , bishop of cartago , who lived in the 3 century ce wrote to the prosecuted and suffering christians in rome :
i am suffering , brothers , i am suffering with you , and my personal well - being is no comfort to me , because if the flock gets injured the shepherd is even more afflicted .
i am one with every single one of you . with every single one i share the burden of grief about the great loss .
i am complaining with those who complain , i am crying with those who cry , i am feeling crushed with those crushed in the shattered brothers compassion has also shattered myself
3 ) . from north africa cyprian paraphrases an nt - passage and uses the nt - metaphor of the shepherd and his flock to strengthen his bereaved companions in the distant community .
basil the great ( 329379 ce ) , bishop of caesarea in cappadocia , asked his colleagues for mercy : but now we ask you to get dressed with mercy and compassion
you heard of our misery . as disciples of the apostle who teaches that the love of your neighbor equals the fulfillment of the law , you probably are not untouched
( 17 : letter to the bishops of italy and gallia , 1f . )
basil the great was one of the most excellent proponents of the care of the needy in the 4 century ce . in this letter
he wrote : who would have a heart as hard as a diamond , who would be as rough and without sensitivity as not to be shattered by the complaints which reach our ear from anywhere and which sound like one choir of the grieving . who would not be bent to the ground and destroyed by such indescribable sorrow ? ( 18 : letter to the church of antiochia , 1 ) .
one of basils instructions which directly concerns nursing can be found in his sermon for the martyr julitta : how could we show compassion and deep love toward our neighbor ?
but we must not believe that the one who cries aloud and complains with the suffering fulfils the law .
i can not praise a physician who instead of helping the sick allows himself to be contaminated by them the same applies to the one who visits the mourning but who is not able to offer them anything reasonable or comfortable but instead meets them with inappropriate empathy .
it is quite alright to mourn with those who suffer trials and tribulations . in this way you will become the confident of the suffering but you are not allowed to be carried away by the suffering this would mean to increase the misfortune rather than to soften it .
do nt you see that the pain increases if fever is added to wounds and swelling ? but a soft touch with your hand could sooth the pain ? hence , do nt make worse the suffering by your own presence and do nt fall with those who fell . who wants to erect those lying on the ground has to stand higher than those who fell
. who has fallen equally deep , also needs somebody to erect him . on the other hand
it is right to have compassion with the events and to mourn silently about the misfortune of others and also to express the corresponding mood with one s face and dignified earnest .
it is not right when talking to the suffering to make reproaches as if one wanted to step on them with one s feet .
if you allow them to complain and lament this can not harm and in this way the pain will decrease soon and you find opportunity for tactful comforting
basil also borrows a metaphor of the nt - apostle paul when he asks his fellow bishops in a region where at that time the christians were less prosecuted to act on behalf of his own community in asia minor . with respect to his own community and
the sick in his hospital basil sketched a sort of theology of caring . in this text basil
explains the delicate balance between compassion and distancing with respect to the suffering of others in order for the compassionate carer to remain therapeutic . in one of his sermons also
gregor of nyssa expanded on the phenomenon of compassion in relation to the witnessing of suffering people : compassion is the opposite of toughness .
the compassionate in his heart enters into a relation with the needy ; through this he becomes like the broken minds of the suffering desire .
in fact , compassion if one conceptualises it is a sort of sadness which the human being bears voluntarily because of the suffering of others
1 ) . gregor of nyssa conceptualises compassion as a sort of identification of the observer with the suffering when he said : because in the face of accidents of others we are being touched painfully in the face of such events a certain painful state of participation develops in our soul ( 19 : 5th speech , chpt .
his fellow bishop , gregor of nazianz , referred to the most prominent nt - models when he taught his community : if we have to believe saint paul and jesus christ that love is the first and most important law , the major content of the law of the prophets , i declare the devotion to poverty , compassion with the suffering as the greatest love . because nothing is more specific to god than compassion
( 20 : 14th speech , about the love for the poor , 5 ) .
even if you give little to the needy it is not little for someone who has nothing if you have nothing to give to them , show your good intention .
compassion that comes from the heart is a great comfort for someone who is miserable .
true compassion is a great relieve in misery ... ( 20 : 14th speech , about the love for the poor ,
gregor of nazianz identified love as gods most prominent feature and the most important to be imitated by the believers . unlike him bishop chrysostomos focused on compassion as the deepest human trait : it is our nature to be moved by compassion and no other disposition is fixed as firmly as this . therefore one could ask why it roots as deeply as this in our nature so that we are moved to tears easily , and that we are inclined towards compassion .
all the texts quoted here show that the church fathers celebrated compassion with more or less direct reference to the compassionate god as a biblical virtue which can not be renounced in the care of suffering people .
similarly the jewish scriptures of the 1 through the 4 century ( the midrashim ) continue to refer to the topos of the compassionate god .
god said to moise : do nt you realize that i am in trouble if the israelites are in trouble ?
from this you can see that : in the place in which i am talking with you , from the thorn bush , i participate in their suffering ( 22 : shemr on ex 3:2 )
. in judaism nursing is part of those works of charity ( gemilut chasadim ) which ought to be practiced spontaneously towards everybody in need .
holy texts such as the following encourage such actions . the holy one , blessed be he , said : who acts in the way of my works resembles me ( 23 : tanchb bechuqqotai 56 on lev 27:1f . ) .
this text tells the believers that by imitating god they will increasingly resemble his image . in the jewish tradition bikkur cholim
, the visiting of the sick has special value among the prescribed works of charity .
visiting the sick means nursing them , because it is unconceivable that one visits a sick person without comforting him , nursing him physically , sharing his suffering and without wishing him well or praying with him .
the following examples from the rabbinical writings give an impression of the duties that go along with the visit of the sick : who visits a sick person does not sit either on his bed or on a bench or on a chair .
the almighty comforts him on his bed of pain ( 14 : bned 40a ) .
this picture implies god s presence with the sick rendering his bed in a holy place .
it commands other visitors to prove their humbleness by staying on the lowest possible level . in another place
a rabbi taught : who visits a sick person takes off him the 60 part of his illness
rabbi levi said : if you have nothing to give to the poor , comfort him with the words : my soul wants to emanate because of you , because i have nothing to give to you
this midrash teaches that compassion , the spiritual touch of a fellow human being , is equally powerful as material gifts .
also the mishna vividly illustrates how god expresses his compassion : what expression does the divinity use when a human being suffers agony ?
my head is gone , my arm is gone ! if god grieves so much over the bloodshed by the offenders , how much more over the blood of the pious
this is an illustration of god s forgiveness vis - - vis the sinners .
( 22 : shemr 2:5 ) rabbi jannai said : like those twins : when one of them suffers from a headache , then also the other !
so , ( if permitted ) the holy one , blessed be he , said :
i will be with him in trouble ( 2 : ps 91:15 ) and it is written : in their entire affliction he was afflicted. like one who took a stick and beat two people . both were hit and experienced his pain .
likewise misery and oppression of israel were obvious and known to the one who spoke and the earth became , as it is said : i know their sufferings ( 2 : ex 3:7 ) .
the old testament confirms that wherever they are and whatever happens to them god is with them and suffers the same adversities . in another text
rabban gamaliel said in the name of rabbi : always , when you show compassion with the creatures , you will be shown mercy in heaven ; if you do not show compassion with the creatures , you will not be shown mercy from heaven
( 26 : sifdev 13:18 96 ) . with this reference to god s power of retaliation
rabbi akiba , a scholar who was teaching at the beginning of the 2 century in palestine made this even more explicit when he said : everywhere , where the israelites were banned , the schekhina ( god s presence in the world ) was with them .
they were banned to egypt and the schekhina was with them , as it has been said :
i am being banned to the house of your father , as they were in egypt ( 2 : 1sam 2:27 ) .
they were banned to babylon , the schekhina was with them , as it is said : because of you i was sent to babylon ( 2 : jes 43:14). they were banned to edom ( rome ) , the schekhina was with them and if they will return , the schekhina will be with them .
as it is said : and the eternal , your god , will return with your prisoners ( 2 : dtn 30,3 )
the quoted literary works teach that the eternal was compassionate not only towards the just and the pious israelites but also towards the sinners .
the talmud thus states : every day god cries about three kinds of human beings : about him who can preoccupy himself with the tora and does not do it ; about him who can not preoccupy himself with the tora but does it nevertheless and about the president of the community who behaves himself arrogant vis - - vis his community ( 14 : bhag 5b ) . for both the suffering and the carers
this example is important because they can be certain that even if they cause their suffering themselves they will not be abandoned by god and they can expect his compassion like all the others .
the writings of the rabbinic and early christian texts are based on the old testament ( ot ) .
the following of these ot - reference texts illustrate god s closeness to and compassion with his people .
isaiah paraphrases god as follows : for this says the high and lofty one who inhabits eternity , whose name is holy : i dwell in the high and holy place and also with those who are contrite and humble in spirit , to revive the heart of the contrite ( 2 : isaiah 57:1519 ) . in another place
isaiah says : it was his presence that saved them ( the israelites ) ; in his love and in his pity he redeemed them ; he lifted them up and carried them all the days of old ( 2 : isaiah 63:9 ) . referring to the meaning of such texts , matthew ,
an evangelist of the christian new testament said : this was to fulfill what had been spoken through the prophet isaiah : he took our infirmities and bore our diseases ( 2 : mt 8:17 ) .
probably the clearest witness of the image of god , who gets involved actively in the fate and in the suffering of the ( prosecuted ) believers is hebrews ( 2 : 4:15 ) the author of which states : for we do not have a high priest ( christ ) who is unable to sympathize with our weaknesses , but we have one who in every respect has been tested as we are , yet without sin .
the most powerful nt - metaphor which teaches compassion to the christians is the parable of the good samaritan ( 2 : lk 10:2537 ) .
also the jewish talmud implies both god s compassion and man s obligation to imitate him . in the talmud rabbi
chama ben chanina referred to the first and second ot - books of genesis and deuteronomium , when he addressed the members of his community :
ye shall walk after the lord your god ( 2 : dtn 13:5 ) the meaning is , to walk after the attributes of the holy one , blessed be he he visited the sick , for it is written : and the lord appeared unto him ( abraham ) by the oaks of mamre ( 2 : gen 18:1 ) , so do thou also visit the sick ( 14 : bsota 14a / bned 40a ) . in another place
the talmud teaches : and he will have mercy upon you and show mercy to you . who has compassion with his fellow human beings will be shown mercy in heaven
rabbi akiba referred to the psalms when he wrote : not visiting a sick person equals shedding blood
( 14 : bned 40a ) . who visits a sick person will be saved from the punishment of purgatory , because it is written ( 2 : ps 41:2 ) : hail him who cares about the weak , in times of misfortune the lord will serve him and weak means a sick person . what is his reward in this world ?
the lord will protect him and keep him alive ( 14 : bned 39b ) .
many teachings about and descriptions of the compassionate god in the holy scriptures of both religions converge in a few elements that constitute the topos of the compassionate god :
he is existentially present near the suffering. he is available for them
. they can pray to him any time. he is their advocate. he is committed to their care. he is actively involved in their suffering. he is faithful and dependable. he suffers himself because he is compassionate .
. he suffers himself because he is compassionate . in their holy scriptures jews and christians
therefore believers of both creeds applied them in everyday life and in the care of the sick .
the reception of the topos of the compassionate god , i.e. his presence with the suffering and his care could be identified in the writings ( sermons , letters ) of most church fathers who were active during the 1 through the 4 century ce in the region of the eastern mediterranean as the following examples show .
the christian writer tertullian who lived in the 2 century ce wrote to a group of christian martyrs ( 198 ce ) : above all , you blessed people , do not provide sorrow to the holy spirit who accompanied you to prison ( 15 : letter to the martyrs ,
the certainty of the presence of the holy spirit should enable them to transcend their pain .
cyprian , bishop of cartago , who lived in the 3 century ce wrote to the prosecuted and suffering christians in rome :
i am suffering , brothers , i am suffering with you , and my personal well - being is no comfort to me , because if the flock gets injured the shepherd is even more afflicted .
i am one with every single one of you . with every single one i share the burden of grief about the great loss .
i am complaining with those who complain , i am crying with those who cry , i am feeling crushed with those crushed in the shattered brothers compassion has also shattered myself ( 16 : letter to the inhabitants of rome ,
3 ) . from north africa cyprian paraphrases an nt - passage and uses the nt - metaphor of the shepherd and his flock to strengthen his bereaved companions in the distant community .
basil the great ( 329379 ce ) , bishop of caesarea in cappadocia , asked his colleagues for mercy :
you heard of our misery . as disciples of the apostle who teaches that the love of your neighbor equals the fulfillment of the law , you probably are not untouched
( 17 : letter to the bishops of italy and gallia , 1f . )
basil the great was one of the most excellent proponents of the care of the needy in the 4 century ce . in this letter
he wrote : who would have a heart as hard as a diamond , who would be as rough and without sensitivity as not to be shattered by the complaints which reach our ear from anywhere and which sound like one choir of the grieving . who would not be bent to the ground and destroyed by such indescribable sorrow ? ( 18 : letter to the church of antiochia , 1 ) .
one of basils instructions which directly concerns nursing can be found in his sermon for the martyr julitta : how could we show compassion and deep love toward our neighbor ?
but we must not believe that the one who cries aloud and complains with the suffering fulfils the law .
i can not praise a physician who instead of helping the sick allows himself to be contaminated by them the same applies to the one who visits the mourning but who is not able to offer them anything reasonable or comfortable but instead meets them with inappropriate empathy .
it is quite alright to mourn with those who suffer trials and tribulations . in this way you will become the confident of the suffering but you are not allowed to be carried away by the suffering
do nt you see that the pain increases if fever is added to wounds and swelling ? but a soft touch with your hand could sooth the pain ?
hence , do nt make worse the suffering by your own presence and do nt fall with those who fell . who wants to erect those lying on the ground has to stand higher than those who fell
. who has fallen equally deep , also needs somebody to erect him . on the other hand
it is right to have compassion with the events and to mourn silently about the misfortune of others and also to express the corresponding mood with one s face and dignified earnest .
it is not right when talking to the suffering to make reproaches as if one wanted to step on them with one s feet .
if you allow them to complain and lament this can not harm and in this way the pain will decrease soon and you find opportunity for tactful comforting
basil also borrows a metaphor of the nt - apostle paul when he asks his fellow bishops in a region where at that time the christians were less prosecuted to act on behalf of his own community in asia minor . with respect to his own community and
the sick in his hospital basil sketched a sort of theology of caring . in this text basil
explains the delicate balance between compassion and distancing with respect to the suffering of others in order for the compassionate carer to remain therapeutic . in one of his sermons also
gregor of nyssa expanded on the phenomenon of compassion in relation to the witnessing of suffering people : compassion is the opposite of toughness .
the compassionate in his heart enters into a relation with the needy ; through this he becomes like the broken minds of the suffering desire .
in fact , compassion if one conceptualises it is a sort of sadness which the human being bears voluntarily because of the suffering of others ( 19 : 5th speech , chpt .
1 ) . gregor of nyssa conceptualises compassion as a sort of identification of the observer with the suffering when he said : because in the face of accidents of others we are being touched painfully in the face of such events a certain painful state of participation develops in our soul ( 19 : 5th speech , chpt .
his fellow bishop , gregor of nazianz , referred to the most prominent nt - models when he taught his community : if we have to believe saint paul and jesus christ that love is the first and most important law , the major content of the law of the prophets , i declare the devotion to poverty , compassion with the suffering as the greatest love . because nothing is more specific to god than compassion
( 20 : 14th speech , about the love for the poor , 5 ) . and
even if you give little to the needy it is not little for someone who has nothing
compassion that comes from the heart is a great comfort for someone who is miserable .
true compassion is a great relieve in misery ... ( 20 : 14th speech , about the love for the poor ,
gregor of nazianz identified love as gods most prominent feature and the most important to be imitated by the believers . unlike him bishop chrysostomos focused on compassion as the deepest human trait : it is our nature to be moved by compassion and no other disposition is fixed as firmly as this .
therefore one could ask why it roots as deeply as this in our nature so that we are moved to tears easily , and that we are inclined towards compassion .
all the texts quoted here show that the church fathers celebrated compassion with more or less direct reference to the compassionate god as a biblical virtue which can not be renounced in the care of suffering people .
similarly the jewish scriptures of the 1 through the 4 century ( the midrashim ) continue to refer to the topos of the compassionate god .
god said to moise : do nt you realize that i am in trouble if the israelites are in trouble ?
from this you can see that : in the place in which i am talking with you , from the thorn bush , i participate in their suffering ( 22 : shemr on ex 3:2 ) . in judaism nursing
is part of those works of charity ( gemilut chasadim ) which ought to be practiced spontaneously towards everybody in need .
holy texts such as the following encourage such actions . the holy one , blessed be he , said : who acts in the way of my works resembles me ( 23 : tanchb bechuqqotai 56 on lev 27:1f . ) .
this text tells the believers that by imitating god they will increasingly resemble his image . in the jewish tradition bikkur cholim
, the visiting of the sick has special value among the prescribed works of charity .
visiting the sick means nursing them , because it is unconceivable that one visits a sick person without comforting him , nursing him physically , sharing his suffering and without wishing him well or praying with him .
the following examples from the rabbinical writings give an impression of the duties that go along with the visit of the sick : who visits a sick person does not sit either on his bed or on a bench or on a chair .
the almighty comforts him on his bed of pain ( 14 : bned 40a ) .
this picture implies god s presence with the sick rendering his bed in a holy place .
it commands other visitors to prove their humbleness by staying on the lowest possible level . in another place
a rabbi taught : who visits a sick person takes off him the 60 part of his illness
rabbi levi said : if you have nothing to give to the poor , comfort him with the words : my soul wants to emanate because of you , because i have nothing to give to you
this midrash teaches that compassion , the spiritual touch of a fellow human being , is equally powerful as material gifts .
also the mishna vividly illustrates how god expresses his compassion : what expression does the divinity use when a human being suffers agony ?
my head is gone , my arm is gone ! if god grieves so much over the bloodshed by the offenders , how much more over the blood of the pious
at the same time this is an illustration of god s forgiveness vis - - vis the sinners .
( 22 : shemr 2:5 ) rabbi jannai said : like those twins : when one of them suffers from a headache , then also the other !
so , ( if permitted ) the holy one , blessed be he , said :
i will be with him in trouble ( 2 : ps 91:15 ) and it is written : in their entire affliction he was afflicted. like one who took a stick and beat two people . both were hit and experienced his pain .
likewise misery and oppression of israel were obvious and known to the one who spoke and the earth became , as it is said :
the old testament confirms that wherever they are and whatever happens to them god is with them and suffers the same adversities . in another text
rabban gamaliel said in the name of rabbi : always , when you show compassion with the creatures , you will be shown mercy in heaven ; if you do not show compassion with the creatures , you will not be shown mercy from heaven
( 26 : sifdev 13:18 96 ) . with this reference to god s power of retaliation
rabbi akiba , a scholar who was teaching at the beginning of the 2 century in palestine made this even more explicit when he said : everywhere , where the israelites were banned , the schekhina ( god s presence in the world ) was with them .
they were banned to egypt and the schekhina was with them , as it has been said :
i am being banned to the house of your father , as they were in egypt ( 2 : 1sam 2:27 ) .
they were banned to babylon , the schekhina was with them , as it is said : because of you i was sent to babylon ( 2 : jes 43:14). they were banned to edom ( rome ) , the schekhina was with them and if they will return , the schekhina will be with them . as it is said : and the eternal , your god , will return with your prisoners ( 2 : dtn 30,3 )
the quoted literary works teach that the eternal was compassionate not only towards the just and the pious israelites but also towards the sinners .
the talmud thus states : every day god cries about three kinds of human beings : about him who can preoccupy himself with the tora and does not do it ; about him who can not preoccupy himself with the tora but does it nevertheless and about the president of the community who behaves himself arrogant vis - - vis his community ( 14 : bhag 5b ) . for both the suffering and the carers
this example is important because they can be certain that even if they cause their suffering themselves they will not be abandoned by god and they can expect his compassion like all the others .
the analysis of the jewish and christian sources of the 1 through the 4 century ce show that their authors and editors picked up the topos of the compassionate god as presented in the ot .
however , none of them includes all aspects of it . rather depending on the purpose of a text ( teaching , comforting , and asking for help ) selected attributes appear .
all of them more or less explicitly refer to the compassionate presence of god , the schekhina , the holy spirit , a saint or the authors themselves as their representatives .
most of them ask the people addressed to imitate these characters through actively demonstrating their compassionate care towards their neighbors .
the texts imply that compassion is not only an emotional gesture but involves caring acts .
hence , it can be concluded that the scriptures of both religions start and consolidate a tradition of compassionate care in relation to the sick . in late antiquity
the imitation of god s mercy vis - - vis the suffering was the strongest motivation of jewish and christian believers to nurse their sick .
the topos presents itself as a religious motif of great variety , be it that the instructions for the carers simply refer to the requirements of the imitatio dei , be it that they describe in detail how to behave .
Output:
| backgroundthe topos of the compassionate god is a dominant motive of the jewish and christian traditions .
it is relevant for nursing because it asks the nurse to imitate god so as to become god - like .
also , to think that god suffers with the suffering believers is thought to give comfort to them . because in the western world the topos of the compassionate god represents the basis of the ethics of compassion / caring ,
this piece of basic research is important for clinical practice .
this study explores to what extent jewish and christian nursing adhered to the biblical topos of the compassionate god at different periods and in different cultural contexts.methoda mixed methods approach was used .
it included variations of hermeneutical text analysis as used in historical , philosophical , theological , science of religion , and nursing research.resultsthe analysis of the literary sources shows that the topos of the compassionate god was interpreted differently in different cultural contexts .
however , at all times it directed religious and secular nursing . since the beginning of the 21st century it builds the core of compassionate caring as propagated by north american nursing science.conclusionsthe topos of the compassionate god laid the foundation of the tradition of the ethics of compassion in nursing .
more research is required to learn whether it also plays a role in islamic nursing . |
PubmedSumm118488 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: systemic and local proinflammatory changes are in focus when investigating the pathophysiology of arteriosclerosis and acute coronary syndromes . in acute myocardial infarction ( ami ) ,
proinflammatory markers such as c - reactive protein ( crp ) , interleukins , or monocyte - chemoattractant protein ( mcp)-1 are elevated [ 13 ] and their increase is of prognostic relevance for future cardiovascular events [ 46 ] and mortality [ 79 ] . moreover , in healthy persons elevated proinflammatory markers are associated with an increase in cardiovascular risk [ 1012 ] .
patients with increased circulating proinflammatory markers in ami present with decreased myocardial salvage after coronary reperfusion therapy .
sources of inflammatory response are vascular cells such as activated endothelial cells , which release proinflammatory cytokines such as interleukin ( il)-8 .
il-8 is a cxc cytokine that acts as a chemoattractant and agonist for neutrophils , lymphocytes , and monocytes and is found in macrophage - rich atherosclerotic plaques . under flow conditions , il-8 facilitates the arrest of monocytes on endothelium , which is necessary for migration into the intima in evolution of arteriosclerosis . reperfusion injury after ami as well as systemic inflammatory response syndrome can be associated to increased levels of il-8 . in experimental setting , murine il-8 receptor knock - out mice display smaller arteriosclerotic lesions with less macrophages . apart from their contribution to arteriosclerosis , cxc cytokines are also produced by malignant cells and can promote tumor progression of a large variety of malignancies .
besides il-8 , many other cytokines such as il-6 take part in inflammatory responses by inducing b - cell differentiation , t - cell activation , and synthesis of acute phase proteins , but also contributing to proliferation of vascular smooth muscle cells ( smcs )
the pathogenesis of proinflammatory changes in acute coronary syndromes as well as the interplay between coagulation and inflammation is poorly understood and is subject to intense research .
the mechanisms by which the coagulation system is altered by inflammatory interactions comprise enhanced synthesis and activation of coagulant proteins , decreased synthesis of anticoagulants , and suppression of fibrinolysis .
accordingly , increased levels of prothrombin fragment f1 + 2 , fibrinopeptide a and d - dimer , reflecting activation of the coagulation cascade , are also associated with an unfavorable outcome in acute coronary syndromes [ 2527 ] . in this paper
we focus on possible mechanisms of the interplay between coagulation and inflammation in acute coronary syndromes .
a strict separation between the intrinsic and extrinsic coagulation cascade surely fails to reflect physiologic conditions .
nevertheless , in the setting of arteriosclerosis and acute coronary syndromes the extrinsic pathway of coagulation is of particular significance .
tissue factor ( tf ) is the most important initiator of the extrinsic coagulation cascade .
tf , a 47 kda transmembrane glycoprotein and member of the class ii cytokine receptor family , is the cofactor for the activated plasma clotting factor vii ( fviia ) .
the tf - fviia complex catalyzes the activation of factor x and ix , which leads to the generation of thrombin and thus finally of a fibrin clot . under physiologic conditions
tf is abundantly expressed only in the adventitia and is induced by several inflammatory mediators such as il-6 , il-8 , and mcp-1 [ 28 , 29 ] .
after vascular injury , tf is rapidly augmented in smc of the media and accumulates in the smc of the developing neointima .
consequently , tf is highly expressed within atherosclerotic lesions and displays high procoagulant activity suggesting a role in determining plaque thrombogenicity . in atherosclerotic carotid lesions disruption of plaques
exposes tf - positive cells within the plaque to plasma clotting factors and initiates local thrombosis with subsequent occlusion of the vessel .
furthermore , increased tf expression can be noticed on circulating monocytes and microparticles in acute coronary syndromes and may , thereby , contribute to activation of coagulation [ 3234 ] .
it has been shown that cytokines can induce expression of soluble tf , which on the other hand has been shown to accumulate in developing thrombi .
however , the clinical significance and individual contributions of microparticle - derived and soluble tf remain a matter of debate .
several studies have demonstrated increased levels of circulating tf in patients with unstable angina pectoris ( uap ) and acute myocardial infarction ( ami ) [ 32 , 3845 ] .
therefore , it has long been speculated that , in cases with no plaque rupture or only fractional superficial erosion , thrombus formation may mainly depend on circulating levels of tf .
consistent with this idea , several studies suggest that the levels of circulating tf and other haemostatic biomarkers may correlate to adverse cardiovascular events and mortality in patients with acute coronary syndrome [ 4648 ] .
stimulation of the tf - thrombin pathway does not only occur at the site of the plaque but also within the ischemic myocardium where activated coagulation factors may enhance inflammatory responses and increase infarct size .
furthermore , tf expression has been reported in a number of cancers , such as glioma , pancreatic cancer , non - small - cell lung cancer , colorectal cancer , ovarian cancer , prostate cancer , hepatocellular cancer , and breast cancer .
tf expression in tumors not only correlates with the incidence of thrombosis but also promotes metastasis , tumor progression , and tumor angiogenesis .
on one hand tf allows docking and activation of fvii and , therefore , promotes the generation of downstream coagulation factors and activation of protease - activated receptors ( pars ) which themselves possibly induce intracellular signal transduction . on the other hand
there is evidence for direct signalling through the cytoplasmic domain of tf following tf - fviia complex formation [ 55 , 56 ] .
the endogenous kunitz - type inhibitor tissue factor pathway inhibitor-1 ( tfpi ) inhibits initiation of tf - induced blood coagulation and is mainly expressed on vascular endothelial cells .
increased levels of the tfpi - fxa complex may reflect both increased fxa generation and increased tfpi concentrations .
in addition to the full length tfpi most of the plasma tfpi circulates in truncated forms that are bound to plasma lipoproteins .
these truncated forms lack their c - terminal domains and exhibit reduced affinity for vascular wall proteolysis .
additionally , it has been shown that endogenous proteases and elastase released by neutrophils degrade tfpi , resulting in enhanced local coagulation that contributes to prevent pathogen dissemination during infection .
conversely , infusion of a mutant tfpi protein resistant to proteolysis by elastase strongly impaired host defence against systemic infection .
important players in the interaction between coagulation and inflammation are protease - activated receptors ( pars ) .
pars are g - protein coupled receptors that mediate various cellular reactions as cytokine release , expression of adhesion molecules , cell migration , or proliferation . unlike other receptors , pars are not activated by a soluble , external ligand .
proteases , such as activated coagulation factors , detach a defined part of the nh2-terminal chain of the receptor , thereby inducing a conformational change of the receptor .
pars can also be activated by synthetic peptides consisting of the sequence of amino acids representing the tethered ligand .
in contrast to other receptors , the activation of pars by enzymatic cleavage is irreversible .
pars are mainly expressed in vascular cells , but also in many different other cell types such as gastrointestinal and bronchial epithelial cells .
four different pars are known : par-1 , -3 , and -4 show responsible for thrombin signaling whereas par-2 is activated by trypsin - like serine proteases , fviia , and matriptase but not by thrombin .
par-1 and par-2 are expressed on smooth muscle cells and endothelial cells , whereas mainly par-1 is expressed on monocytes .
par-1 agonists or thrombin induce il-8 and il-6 in smc , ec , and mononuclear cells ( mncs ) therefore emphasizing the role of par-1 in inflammatory processes in vascular cells and confirming data about par-1-mediated cytokine release in ec and monocytes . in smooth muscle cells par-1 and par-2 agonists induce cytokine release to a similar extent which underlines the relevance of both pars .
in addition to coagulation factors other serine proteases , for example , matriptase secreted by monocytes stimulate proinflammatory cytokine release in endothelial cells via par-2 activation . increased par-2 expression in atherosclerotic lesions suggests a role for this proinflammatory pathway ( figure 1 ) .
in addition , pars can also be cleaved downstream of the tethered ligand , resulting in receptor inactivation by preventing further proteolytic activation .
par-1 signalling not only induces inflammatory responses but also causes antiapoptotic and vasculoprotective reactions . since the anticoagulant protease - activated protein c can activate par1 when in complex with the endothelial cell protein c receptor ( epcr ) , which may account for much of the protective effects conferred by activated protein c ( apc ) in severe sepsis
first , apc acts via par-1 when attached to epcr , resulting in cellular responses distinct from thrombin signalling by a mechanism dependent in trans - activation of the sphingosine 1 phosphate receptor 1 . in mouse models with strongly reduced epcr expression or par-1 deficiency ,
the loss of epcr / apc signalling via par-1 resulted in increased endotoxemia - induced lethality .
concordantly , apc mutants have been shown to contribute to protective effects during sepsis by pathways independent from anticoagulant properties [ 67 , 68 ] .
the second pathway described is independent from epcr . in this case , the availability of the integrin cd11b
/ cd18 has been shown to be crucial for par-1 mediated apc signaling on macrophages , thereby exhibiting anti - inflammatory effects and reducing endotoxin - induced lethality .
thus the strength of par1 and par2 activation by thrombin , factor xa , and activated protein c can either promote or protect against changes in vascular permeability depending on the status of the endothelium .
platelet activation with subsequent thrombus generation plays a major role in the development of acute coronary syndromes . at low concentrations thrombin activates par-1 on platelets through a hirudin - like site and at high concentrations additional par-4 .
this induces shape change , p - selectin , and cd40l mobilization to the platelet membrane and promotes the release of platelet agonists adp , thromboxane a2 , chemokines , and growth factors and , thereby , enhances proinflammatory changes .
thus , inhibition of pars by thrombin of fxa inhibitors may prove beneficial in reducing not only thrombotic but also proinflammatory responses .
binding of the serine protease fvii to tf results in generation of the coagulation protease fxa ( fxa ) and subsequently thrombin both known to induce cell signaling .
fxa shows dose - dependent induction of intracellular calcium transients in endothelial cells that is active - site - dependent , and independent of thrombin .
potential pathophysiological responses to fxa include stimulation of proliferation , production of proinflammatory cytokines , and prothrombotic tf .
elevated tfpi - fxa and prothrombin fragments f1 + 2 plasma levels indicate activation of the coagulation cascade in acute coronary syndromes . under physiological conditions
an inverse relationship between tfpi - fxa and f1 + 2 suggests that tfpi - fxa regulates prothrombinase activity in vivo . under conditions associated with activation of the coagulation cascade , however , increased tfpi - xa plasma levels occur [ 57 , 74 ] .
activation of coagulation as measured by tfpi - fxa but not by f1 + 2 is associated with plasma concentrations of the proinflammatory cytokine il-8 in acute coronary syndromes .
furthermore , subsequent elevated il-6 levels in the course of acute coronary syndromes are associated with initial tfpi - fxa concentrations .
these results argue for a proinflammatory role of fxa in acute coronary syndromes that is independent of thrombin .
although thrombin provokes similar proinflammatory effects as fxa in vitro the effects of thrombin may be diminished after heparin treatment in vivo .
several trials of unfractionated heparin ( ufh ) , direct thrombin inhibitors , and enoxaparin have thus far failed to demonstrate mortality reductions in acute coronary syndromes . yet
, the oasis-6 trial suggests a reduction in reinfarction and mortality without excess bleeding in patients not undergoing pci .
therapeutic inhibition of the proinflammatory effects of factor xa may , therefore , prove additional benefits as compared to thrombin inhibition in the clinical course in acute coronary syndromes .
this is currently investigated in the atlas - acs 2 timi 51 trial that is testing the hypothesis that anticoagulation with the oral factor xa inhibitor rivaroxaban reduces cardiovascular death , mi , and stroke among patients with acs treated with guideline - based therapies for acs . in vitro experiments revealed that fxa stimulates il-8 and mcp-1 transcription in endothelial cells and mononuclear leukocytes .
genetic studies and receptor desensitization experiments indicate that signaling by fxa is mediated by par-1 and par-2 [ 80 , 81 ] . according to the expression of par-1 and par-2 , par-1 and par-2 agonists induce il-8 and mcp-1 release in endothelial cells , whereas , only par-1 agonists stimulated cytokine release in mononuclear cells .
several studies suggest a signaling mechanism of the tf - fviia complex via par-2 . in this model ,
tf - bound fviia proteolytically activates par-2 and , to a lesser extent , par-1 , and thereby evokes intracellular signaling cascades .
in contrast to fxa , fviia does not elicit a proinflammatory response in endothelial cells or mononuclear cells .
the tf - fviia - par-2 signalling was only observed in smc since they express both tf and par-2 and both of them seem to be a prerequisite for fviia action .
ec expressing par-2 but lacking tf will not permit fviia docking , whereas mnc displaying tf but only low par-2 expression , probably allow fviia binding but do not express sufficient par-2 molecules being subsequently activated .
however , par-2 and tf are induced by cytokine stimulation [ 28 , 84 ] .
thus , fviia may still have an important impact in atherosclerotic vessels and acute coronary syndromes . in recent studies
, it has been demonstrated that fvii is synthesized by different cancer cells ( liver , ovary , prostate , lung , gastric , thyroid , and breast ) . considering that these tumor cells also synthesize tf it is conceivable that supraphysiologic concentrations of fviia after binding of fvii to tf occur . on tumor cells , the tf - fviia binary complex mediates activation of par-2 .
therefore tf - fviia - par-2 interaction with subsequent cytokine release may be relevant within a tumor environment .
tf / fviia / par2 signalling has been shown to promote proliferation and metastasis of tumor cells [ 87 , 88 ] .
consistently , tf / fviia - specific upregulation of il-8 expression in breast cancer cells has been shown to be mediated by par-2 and to increase cell migration .
whether tf - fviia - par-2 interaction may also contribute to local thrombus formation and progression of atherosclerotic disease remains to be elucidated .
experimental evidence suggests that this interplay may contribute to the development of vascular remodeling or support plaque disruption of the artery .
however transfer of these data to the clinical settings remains controversial since additional optimized medical and interventional treatments interfere .
therefore , understanding the causes of inflammation facilitate the development of new therapeutic strategies . to analyse whether these new therapies translate to improved clinical outcome
needs to be studied in appropriate clinical trials . while inhibiting proinflammatory cytokines such as tumor - necrosis factor- ( tnf ) has been shown to effectively improve survival in several animal models of sepsis [ 8991 ] , anti - tnf therapy in septic humans failed to ameliorate or even worsened clinical outcome [ 9295 ] . in chronic inflammatory diseases however , anti - inflammatory treatment has become clinical routine .
for example , inhibition of il-6 by the first anti - il-6 antibody , tocilizumab , has been shown to completely block tf - dependent thrombin generation in experimental endotoxemia [ 23 , 96 ] , and tocilizumab will be of special future interest as it has been approved for rheumatoid arthritis .
experimental studies that have shown that anticoagulant treatment not only diminishes activation of coagulation but also inhibits inflammation , underline the cross - talk between activation of coagulation and cytokine release in vivo [ 49 , 97 , 98 ] . in acute inflammatory disorders such as severe sepsis , administration of recombinant apc
apc mutants that lack anticoagulant properties but still enable sphingosine 1 phosphate receptor 1 dependent activation of par-1 will be of special clinical interest as they have been shown to reduce sepsis - induced in mice but do not predispose to bleeding complications .
so far , anti - inflammatory treatments displayed no explicit benefit in patients with acute coronary syndromes .
however , there is evidence that fxa inhibitors prove to be superior to thrombin inhibitors .
particularly , treatment with low molecular weight heparins , that include additional anti - fxa activity as compared to unfractionated heparin , has been shown to decrease inflammatory changes in vitro and in vivo [ 101 , 102 ] .
yet the question remains if and what anticoagulant therapies will prove beneficial to alter systemic inflammatory responses .
Output:
| the intimate connection between coagulation and inflammation in the pathogenesis of vascular disease has moved more and more into focus of clinical research .
this paper focuses on the essential components of this interplay in the settings of cardiovascular disease and acute coronary syndrome .
tissue factor , the main initiator of the extrinsic coagulation pathway , plays a central role via causing a proinflammatory response through activation of coagulation factors and thereby initiating coagulation and downstream cellular signalling pathways .
regarding activated clotting factors ii , x , and vii , protease - activated receptors provide the molecular link between coagulation and inflammation .
hereby , par-1 displays deleterious as well as beneficial properties . unravelling these interrelations may help developing new strategies to ameliorate the detrimental reciprocal aggravation of inflammation and coagulation . |
PubmedSumm118489 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: medical management of gastroesophageal reflux disease ( gerd ) with h-2 blockers , antacids , and omeprazole is effective , but as many as 80% of patients managed medically relapse when omeprazole is stopped .
further , medical management is expensive , and many patients are now placed on lifetime maintenance doses of omeprazole to prevent the complications of reflux .
nissen fundoplication is an effective treatment for gerd , and multiple studies comparing open nissen fundoplication ( onf ) to laparoscopic nissen fundoplication ( lnf ) show equivalent short - term control of symptoms .
we conducted a retrospective chart review and survey of hospital stay , convalescence , control of symptoms , and length of medical management concurrent with a cost analysis of medical management , onf , and lnf for the treatment of gerd .
we then developed a treatment algorithm , which emphasizes early surgical management in patients who relapse after an initial successful two - month treatment with omeprazole .
the charts of all patients who underwent laparoscopic and open nissen fundoplication since 1990 were reviewed through 1995 .
patients were asked to report medications required before and after surgery , time to return to baseline activity , and if they would recommend the procedure to others .
. concurrent review of 46 charts was undertaken of patients with gerd managed with omeprazole .
the only data recorded was amount and duration of medication directed at controlling gerd symptoms .
cost analysis data was collected through the procurement offices of pharmacy and surgery as well as the department of treasury and third party collections .
an assumption was made that initial work - up and follow - up costs for both medical and surgical patients were equal .
the cost of medical management includes follow - up esophagogastroduodenostoscopy , office visits , and emergency department visits for non - cardiac chest pain .
average hospital stay was 7.38 days in the open group and 2.70 days in the laparoscopic group ( p<0.05 ) ( figure 1 ) .
the convalescence time , calculated as time from surgery until return to work , was 35.3 days in the open group and 17.90 days in the laparoscopic group ( p<0.05 ) ( figure 2 ) .
patients in both groups averaged 24.9 months of h-2 blocker treatment and 10.75 weeks of omeprazole treatment .
the annual cost of 40 mg of daily omeprazole at government rate is $ 1,500.71 .
the annual cost of 20 mg of daily omeprazole with 10 mg of cisapride three times daily is $ 1,154.67 .
one patient in the lnf group experienced return of symptoms at six weeks , which resolved with subsequent onf .
one patient in the lnf group experienced gas bloat syndrome , which was improving , but not resolved , at one year .
cost effectiveness was achieved at two years in patients treated with 40 mg of omeprazole daily .
mean number of days from surgery until return to work in the lnf ( 17.9 ) and onf ( 35.3 ) p<0.05 .
a large prospective randomized study has shown that onf is superior to medical management with h-2 receptor antagonists in healing esophagitis .
unfortunately , this study predated wide - spread use of omeprazole in this country , and , to date , no prospective randomized trial has compared proton pump antagonists to surgery for control of esophagitis .
several studies have shown that an appropriate maintenance therapy for prevention of recurrent esophagitis is 1020 mg omeprazole everyday .
this regimen requires a compliant patient , frequent follow - up , and substantial cost .
multiple studies have shown omeprazole in doses of 2040 mg daily results in complete resolution of esophagitis within 60 days ; however , cessation of omeprazole results in recurrent esophagitis in 80% of patients .
patients who do not resolve their esophagitis or symptoms on 2040 mg daily of omeprazole in 60 days warrant evaluation for other non - gerd causes for their symptoms .
the literature is clear that medical therapy will resolve most if not all symptoms from gerd .
expense with this approach includes follow - up visits for prescription refill , the medication itself and emergency department and cardiac care unit visits for atypical chest pain .
despite having these issues clearly defined in the literature , a 1995 new england journal of medicine article and editorial stated that preferred management for gerd was long - term ( > 4 years ) omeprazole and cisapride .
no gastric cancer has occurred in humans attributable to omeprazole to date , but the implications of hypergastrinemia , corpus gastritis , argyrophil cell hyperplasia , and atrophie gastritis remain unclear . in our institution ,
treatment with surgery became cost effective at 1.5 years in patients treated with 20 mg of omeprazole daily and 10 mg cisapride three times daily .
cost effectiveness was achieved at two years in patients treated with 40 mg omeprazole daily ( figure 3 ) .
no significant long - term complications were observed in the surgical groups , and complications were not noted in the medical group .
cost of civilian and military lnf compared to medical therapy with 40 mg omeprazole and 20 mg omeprazole with 10 mg cisapride three times a day over a 5 year period .
despite small numbers in our study , we feel that laparoscopic nissen fundoplication is the logical treatment for gerd in patients who fail a 2-month trial of omeprazole treatment and meet criteria for fundoplication ( figure 4 ) .
we suggest , based on patient satisfaction , cost analysis , acceptable complication rate , and efficient use of time and resources , that laparoscopic nissen fundoplication is the appropriate treatment in patients who develop recur - rent esophagitis after two months of treatment with omeprazole ( figure 5 ) . recommended preoperative work - up prior to lnf . recommended treatment algorithm for surgical treatment of gerd .
Output:
| background : eighty percent of patients treated medically for gastroesophageal reflux disease relapse after treatment .
many of these patients require indefinite treatment with omeprazole to prevent recurrence .
nissen fundoplication has been shown to be effective , safe and cost effective in the management of gastroesophageal reflux disease .
we suggest a treatment algorithm , which encourages early surgical intervention in cases of recurrent esophagitis after a previously successful two - month course of omeprazole.methods:we have offered laparoscopic nissen fundoplication since 1993 .
patients who received nissen fundoplication since 1990 were asked to report return to baseline activity , medications , and lifestyle changes . concurrent chart review of patients treated with omeprazole was conducted to analyze cost.results:patients receiving laparoscopic nissen fundoplication were discharged significantly sooner and spent significantly less time convalescing when compared to those who underwent open nissen fundoplication .
laparoscopic nissen fundoplication became cost effective at 1.5 to 2 years when compared to omeprazole.conclusion:based on cost analysis , patient satisfaction , acceptable complication rate , and efficient use of time and resources , we recommend laparoscopic nissen fundoplication as the appropriate treatment in patients who develop recurrent esophagitis after a two - month treatment with omeprazole . |
PubmedSumm118490 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: kounis syndrome ( ks ) is defined as the concurrence of acute coronary syndrome ( acs ) with conditions associated with mast cell activation relating to hypersensitivity .
the incidence of ks is not established due to lack of well - defined studies to record the events ; the available evidence is based on case series and case reports .
multiple agents have been described to trigger ks including drugs , contrast media , stent material , insect stings , food , environmental exposures and medical conditions like asthma . among drugs antibiotics
we report a case presented with features of anaphylactic reaction after cefotaxime injection and features of acs , which was considered rare compared to other cephalosporins .
a 36-year - old male with no conventional coronary risk factors was treated elsewhere for fever , cough with expectoration and diarrhea with antibiotic ( inj .
he experienced generalized itching 5 minutes after cefotaxime infusion along with sweating , headache , chest pain and facial swelling for which he was brought to our hospital .
his medical records revealed the administration of corticosteroid ( betamethasone ) injection along with analgesics after the onset of reaction .
five years ago he had hypersensitivity to an unknown tablet . on examination he was afebrile , mildly tachycardic and tachypneic with a blood pressure of 80/60 mmhg .
an electrocardiogram ( ecg ) taken immediately after the reaction and subsequent ecg taken at our hospital are similar and revealed sinus rhythm , st depression v3v5 and incomplete right bundle branch block , st elevation - i , avr [ figure 1 ] .
hemogram revealed relative neutrophilia ( 92.7% ) , normal esr and eosinophil count with normal red blood cells .
serum electrolytes , creatinine and random blood sugar were normal while potassium was low ( 3.24 meq / l ) .
arterial blood gases revealed mild hypocapnia [ pco2 - 31.9 mmhg , po2 - 111.9 mmhg ] .
troponin t was elevated ( 1027 pg / ml ) and liver enzymes were slightly increased .
the patient was immediately administered with intravenous antihistaminic , a h2 receptor blocker , and an anti - emetic .
he was started on a standard protocol for the management of acs including dual anti - platelets , statin , betablocker , low - molecular - weight heparin after which the patient improved symptomatically .
echocardiogram showed good left ventricular ( lv ) systolic function with no regional wall motion abnormality ( rwma ) . a coronary angiogram performed on the subsequent day revealed normal epicardial coronaries with no evidence of spasm or thrombus .
work up for young myocardial infarction was negative with an exception of serum homocysteine levels ( 49.3 mol / l ) .
the patient was diagnosed with ks and was treated suitably which lead to his discharge after 4 days with an anti - platelet , nitrate and a statin .
our case presented with acs and anaphylactic reaction ( caused by a previous antibiotic injection ) . though an acute coronary event unrelated to anaphylaxis can not be completely ruled out , totally asymptomatic state before the antibiotic administration , chronology of events and normal coronaries favor acs related to anaphylactic reaction possibly due to coronary vasospasm .
a majority of case reports showed ecg abnormality as st segment elevation , but in our case the ecg revealed st depression .
kounis and zavrae first described the simultaneous appearance of acute coronary events and anaphylactic reaction , called kounis syndrome or allergic angina which could be due to coronary vasospasm or rupture of pre - existing atheromatous plaque .
inflammatory mediators such as histamine , neutral proteases like chymase , tryptase , platelet - activating factor and variety of cytokines and chemokines constitute the pathophysiologic basis of ks .
histamine released during anaphylactic reaction acts on h1 receptors causing coronary vasoconstriction and its action on h2 and h3 receptors causes hemodynamic instability .
chymase converts angiotensin i into angiotensin ii , which acts synergically with histamine upon receptors in the cells of coronary arteries , aggravating coronary spasm .
anaphylactic cardiac damage may be dissociated into two sets of events : ( i ) initial primary cardiac reaction caused by the intracardiac release of histamine ( ii ) a subsequent cardiovascular reaction secondary to systemic release of mediators .
several antibiotics and few nonsteroidal anti - inflammatory drugs ( nsaids ) were reported as a cause of ks [ table 1 ] .
antibiotics and nsaids reported to cause kounis syndrome among third generation cephalosporins , cefotaxime rarely causes anaphylaxis yet in this case the patient was presented with severe anaphylaxis . majority of literatures identify three variants of kounis syndrome that has been established .
type i includes patients with normal coronary arteries without predisposing factors for coronary artery disease ( cad ) , where the acute release of inflammatory mediators can result in acs with or without raised cardiac enzymes and troponins .
type ii ks is a group with quiescent pre - existing atheromatous disease , in which the acute release of inflammatory mediators can result in acs .
type iii are patients with coronary artery thrombosis ( including stent thrombosis ) in whom aspirated thrombus specimens stained with hematoxylin - eosin and giemsa demonstrate the presence of eosinophils and mast cells . in this patient
elevated homocysteine level was reported as a risk factor for cad , but a large meta analysis including prospective studies concluded that while serum homocysteine is elevated in patients with cad , elevated homocysteine probably does not itself cause the disease .
similar to the earlier published case reports relative neutrophilia and elevated troponin levels were observed in this patient also .
there is no specific investigation to diagnose ks - associated acs and treatment of ks involves administration of antihistamines , corticosteroids and/or acs management protocol .
a recent review reported that majority of the cases have been treated with corticosteroids ( 76% ) , h1 blockers ( 70% ) , nitroglycerin ( 47% ) and h2 blockers ( 35% ) , while adrenalin was only used in 23% of the cases and aspirin in 18% .
kounis syndrome is a clinical feature difficult to diagnose , but is important that a possibility of ks as a cause of acute coronary syndrome be considered when patients present with features suggestive of anaphylactic reaction and acs .
although a few cases of cephalosporin - related ks was reported , to the best of our knowledge , evidence of ks pertaining to cefotaxime was not recorded in earlier reports .
Output:
| kounis syndrome is a clinical condition due to hypersensitivity that culminates into acute coronary syndrome ( acs ) which can be fatal . a 36-year - old male with no conventional coronary risk factors presented elsewhere with a history of fever for 4 days , cough with expectoration , diarrhea and was treated with cephalosporin ( inj .
cefotaxime as an infusion ) along with analgesics .
he experienced generalized itching 5 minutes after cefotaxime infusion followed by sweating , headache , chest pain with facial and periorbital swelling for which he was rushed to our hospital . on examination
he was afebrile with a low blood pressure .
electrocardiogram taken at an outside hospital revealed incomplete right bundle branch block and st depression v3v5 .
investigations showed increase in troponin t. he was managed with anti - histamines and standard protocol for treatment of acs .
coronary angiogram revealed normal coronaries .
the patient improved symptomatically with treatment and was discharged on an anti - platelet , nitrate and a statin . |
PubmedSumm118491 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: initially described by dutch anatomist and physician herman boerhaave in 1724 during post - mortem examination performed on baron jan gerrit van wassenaer , grand admiral of the dutch fleet , spontaneous esophageal perforation or boerhaave syndrome ( bs ) is a very rare surgical emergency , most usually diagnosed in men aged 50 - 70 years after heavy meal ingestion combined with abundant alcohol consumption . at our tertiary care hospital ,
this patient is the only occurrence during the last ten years.[13 ] typically , a vertical full - thickness rupture occurs on the left posterior aspect of the distal esophagus , 2 - 3 cm proximally to the gastroesophageal junction .
the pathogenesis involves sudden pressure increase caused by forceful vomiting against a closed glottis because of incomplete cricopharyngeal relaxation .
untreated cases may rapidly progress to infectious mediastinitis and septic shock within 24 - 48 hours .
a 69-year - old male with history of chronic gastro - duodenitis and colonic diverticulosis was admitted to emergency department because of postprandial epigastric pain radiating to his left hemiabdomen , associated with vomiting . at physical examination , he was found dyspneic and tachypneic , and severe pain was exacerbated during palpation on the upper abdomen without signs of peritonism .
technically limited plain radiographs of the thorax and abdomen , obtained with the patient supine , reported predominantly left - sided basal lung opacities consistent with pneumonia and probable associated effusion . shortly afterwards , because of worsening clinical condition and haemodynamic parameters , urgent contrast - enhanced multidetector ct was requested to rule out acute abnormalities of the thoraco - abdominal aorta .
initial ct acquisition [ figure 1a ] disclosed an abnormal posterior mediastinal air collection surrounding the collapsed distal esophagus , suggesting the clinically unsuspected presence of a perforation .
bilateral basal lung infiltrates , with extensive involvement of the left inferior lobe , were attributed to aspiration pneumonia . with the patient still on the ct scanner table , further investigation with ct - esophagography
was performed with administration of diluted iodinated contrast medium through the nasogastric tube [ figure 1b and c ] .
evidence of extraluminal contrast leakage confirmed the presence of a focal wall disruption on the left postero - lateral aspect of the distal esophagus .
both the esophageal perforation and the associated mediastinal contamination were depicted along three planes by means of multiplanar ct reformations .
contrast - enhanced ct acquisition excluded acute aortic diseases . on an axial image from initial ct acquisition ( a ) viewed at lung window settings ) an abnormal air collection
is detected in the posterior mediastinum , surrounding the collapsed distal esophagus with nasogastric tube .
basal lung infiltrates , with extensive involvement of the left inferior lobe , are consistent with aspiration pneumonia .
further investigation with ct esophagography ( axial image in ( b ) coronal reformation in ( c ) visualize increasing posterior pneumomediastinum and extraluminal water - soluble contrast leakage ( arrowheads ) indicating full - thickness esophageal perforation antibiotic treatment with intravenous piperacilline was started .
urgent surgery was performed , including thoracotomic access , posterior mediastinal debridement and irrigation . in agreement with ct findings , after a full - thickness distal esophageal perforation was identified and primarily repaired , without the need for resection .
supportive therapy and parenteral nutrition therapy were protracted during 32 days of intensive care unit stay .
the patient finally recovered and was discharged from the hospital nearly two months after initial admission .
the first aim of this paper is to remind clinicians of this uncommon disease , that should be promptly diagnosed and correctly treated in order to prevent its most severe consequences : despite diagnostic , surgical and critical care advancements , esophageal perforation remains a life - threatening condition associated with high morbidity and mortality ( 18 - 50% ) . according to the literature , due to its rarity
, unspecific clinical presentation and subtle or absent findings on plain radiographs , bs usually represents a diagnostic challenge .
the cardinal symptom is sudden lower thoracic pain , sometimes radiating to the back and aggravated by swallowing , associated with vomiting and variable signs of systemic inflammatory response , respiratory and hemodynamic compromission .
unless specifically considered in the differential diagnosis , spontaneous esophageal perforation is often unsuspected or misdiagnosed , since its manifestations closely mimic other more common intrathoracic diseases , including myocardial infarction and pericarditis , acute aortic disease or even abdominal emergencies such as perforated peptic ulcer or acute pancreatitis .
unfortunately , diagnostic work - up delays may hinder timely treatment with a negative effect on patients outcome .
although controversy exists about appropriate therapy , surgical management is currently considered the gold standard for ruptures diagnosed within 24 hours from onset and allows a 75% chance of recovery .
surgery should include pleural cavity drainage , perforation debridement and primary repair through an open thoracotomic or laparoscopic approach .
conservative management with resuscitation and broad - spectrum antibiotics should be reserved for patients with minimal sepsis and mediastinal abnormalities , and for those too unstable to undergo surgery .
after 24 hours , survival rates as low as 20% have been reported , therefore a high index of clinical suspicion and prompt diagnostic assessment are needed . in emergency departments , plain films of the thorax and abdomen
unfortunately , in severely ill , uncooperative patients who can not stand up and hold their breath plain radiographs often result technically inadequate with a limited diagnostic value .
the usual although unspecific radiographic features of bs include predominantly left - sided pleural effusion , lung infiltrates and atelectasis , whereas more specific signs such as pneumothorax , pneumomediastinum and pneumopericardium are rarely detected or very subtle . in the past
, fluoroscopic esophagography with ingestion of water - soluble contrast medium was used to confirm suspected esophageal perforation through the direct demonstration of extraluminal contrast extravasation .
cumbersome to perform in severely ill , bed - ridden patients , this technique is associated with a significant rate ( 10 - 38% ) of false - negative results and with the potential risk of pulmonary oedema precipitated by aspiration of orally administered contrast.[468 ] the second objective of this report is to present the useful role of multidetector ct - esophagography , a relatively new
one - stop - shop technique that provides fast , comprehensive diagnosis of bs .
currently , the vast majority of patients with acute chest and/or abdominal symptoms undergo multidetector ct as the initial emergency investigation .
as this case exemplifies , mediastinal findings suggestive of esophageal injury and associated mediastinitis ( such as periesophageal and mediastinal gas and/or mediastinal fluid collections , esophageal wall thickening , pleural effusion or hydrothorax ) are reliably identified on thoraco - abdominal emergency ct examinations performed under alternative clinical diagnoses.[368 ] clinical or ct features suggesting the diagnosis of bs should be further investigated by means of ct - esophagography with oral ingestion or administration through the nasogastric tube of 10% diluted iodinated
easily performed as a complement of initial ct acquisition , ct - esophagography allows to confirm and visually document the perforation through the direct identification of extraluminal contrast leakage .
the time spared without transferring the patient from the ct scanner table to the fluoroscopic suite may prove prognostically important .
Output:
| spontaneous esophageal perforation ( boerhaave syndrome ) is a very uncommon , life - threatening surgical emergency that should be suspected in all patients presenting with lower thoracic - epigastric pain and a combination of gastrointestinal and respiratory symptoms .
variable clinical manifestations and subtle or unspecific radiographic findings often result in critical diagnostic delays .
multidetector computed tomography complemented with ct - esophagography represents the ideal one - stop shop
investigation technique to allow a rapid , comprehensive diagnosis of bs , including identification of suggestive periesophageal abnormalities , direct visualization of esophageal perforation and quantification of mediastinitis . |
PubmedSumm118492 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: degenerative aortic stenosis ( as ) is the most frequent cause among aortic valve stenotic changes .
mini sternotomy aortic valve replacement is a replacement of aortic valve through upper partial sternotomy .
the aim of this approach is to improve postoperative convalescence by leaving pleural spaces closed and do not compromise respiratory function , to decrease bleeding , and reduce post op ventilation time and icu stay .
all these advantages decrease cost during hospital stay by reducing icu stay , respiration time , bleeding and using blood products , pain killers and shortening hospital stay .
this case report presents an initial experience with reversed l - type upper partial sternotomy in aortic valve replacement .
the goal is to demonstrate that minimally invasive advanced cardiac surgery procedures can be performed in our country .
degenerative aortic stenosis ( as ) is the most frequent cause among aortic valve stenotic changes .
when aortic valve area is critically stenosed down to 0.7 cm2 , or when patient become symptomatic , an aortic valve replacement ( avr ) is indicated .
it is save procedure , done by medial sternotomy and with main mortality rate 2 - 4% ( 1 , 2 ) .
mini sternotomy aortic valve replacement ( ms avr ) is a replacement of aortic valve through upper partial sternotomy , extending from jugular notch to the right 3rd or 4th intercostal space .
the aim of this approach is to , using partial sternotomy , improve postoperative convalescence by leaving pleural spaces closed and do not compromise respiratory function , to decrease bleeding , and reduce post op ventilation time and icu stay ( 3 ) .
all those advantages of ms avr decrease cost during hospital stay by reducing icu stay , respiration time , bleeding and using blood products , pain killers and shortening hospital stay ( 3 , 4 ) .
msavr has been performed since late 1990-es , and is not a new method in cardiac surgery but it is considered as advanced one ( 4 ) .
this case report presents an initial experience with reversed l - type upper partial stenotomy ms avr at our department and the goal of it is to demonstrate that even advanced cardiac surgery procedures can be successfully performed in our country .
we report a case of 64-years - old female patient scheduled for replacement of severely stenosed aortic valve ( as ) of degenerative etiology .
coronary angiogram was performed , in presurgery period , and revealed as follows : left main , lad , cx and rca showed no signs of coronary disease .
trans thoracic echocardiogram ( tte ) verified concentric hypertrophy of the left ventricle ( ivs 1.45 cm ) , normal dimension of heart chambers and good ejection fraction ( ef 55% ) , severe aortic stenosis ( ava less than 1 cm , vmax5.04m / sec .
, pgmean62.5mmhg , pgmax102mmhg ) . in previous medical history patient had verified copd and was suffering from chest pain and effort dyspnea .
laboratory findings at the day of surgery were as follows : glucosis 7.10 , urea 9.20 , sodium 140 , potassium 3.8 , wbc 6.54 , rbc 4.08 , htc 0.367 , plt 202 , preoperative ecg : regular sinus rithm , heart rate 103bpm , depressed descending st junction and r height 25 mm in precordial leads v4-v6(signs of lv hypertrophy ) .
after anesthesia introduction , short skin incision was done ( 7 cm long ) and partial stenotomy starting from jugular notch down to 4th intecostal space and horizontal sternotomy then extended from mid line to 4th intercostal space , forming upper partial reversed l - shape sternotomy .
if in sight the right internal thoracic artery ( rita ) was then ligated and divided at this space to prevent tearing due to stretching of divided parts of sternum .
fat tissue in the front of the pericardial sac was removed , and inverted t shaped pericardiotomy , in line with sternotomy , followed .
pericardiotomy was done in middle line , from brachiocephalic vein , down to 4 th intercostal space , and then redirected ortogonaly on both sides , forming inverted t shape .
four pericardial stay sutures ( two at each side ) were used to elevate the heart and improve access to the aortic root , ascending aorta and right atrium .
cannulation was performed by flexible medtronic eopa aortic cannula no 24 , and right atrium and superior vena cava with medtronic venous vire - reinforced cannulas no 22 .
carioplegic arrest was introduced via antegrade cardioplegia cannula set at the ascending aorta , and maintained by direct left and right coronary artery cannulation during avr .
left ventricle venting was obtained by vent cannula placed in lv through right superior pulmonary vein .
after cardioplegic cardiac arrest was accomplished , hockey stick aortotomy was done , and three commissural stay stitches placed to lift av up in the operating field for better exposure ( figure 1 ) .
opened ascending aorta , aortic valve elevated on commissural stitches end exposed for excision av excision and avr with ats 21 mm mechanical valve was implanted , and followed with blalock aortotomy two line - sewing in standard fashion with prolene 4.0 stitch .
while heart was in arrest , retrosternal drain was placed through subxyhpodin incision and retrosternal plain made by blunt digital dissection , pace maker wire was placed on anterior wall of the right ventricle during cardiac arrest .
the sternotomy was closed using 4 standard wires to the sternum and an absorbable suture to the soft tissues and skin ( figure 2 ) .
three were placed around in a horizontal manner , and one was set in vertical manner approximating intact and horizontally cut part of sternum , which is contracted first .
patient was transversed to intensive care unit ( icu ) for early convalescence and awaking by standard anesthesiology procedure .
one dose of blood ( 330ml ) , and two doses of cryoprecipitate ( 350ml ) were transfused to the patient .
only one episode of af was noticed on the second post - op day and converted into sinus rithm by amiodaron infusion .
patient was discharged in sinus rithm without any complains , and checked seven days after discharge when no complication was noticed and with no complains . closed chest and soft tissue of the wound with thoracic drain in retrosternal position it was the first successful mini sternotomy avr ( ms avr ) in bosnia and herzegovina performed completely by domestic staff .
this case report is to show advanced cardiac surgery can be safely performed in our country and it is small contribution to development and advancement of cardiac surgery in bosnia and herzegovina .
minimally invasive techniques for valve replacement have become increasingly popular over the past 15 years , with good early and long - term results having been achieved ( 3 - 6 ) .
the greatest experience with msavrs has been reported by cohn and colleagues ( 7 - 9 ) who described an initial learning curve ( 7 ) that improved with increasing experience ( 4 , 10 , 11 ) .
the aortic cross - clamp times were found to be very slightly greater with msavr ; likewise , the median cpb times were 17 min longer with msavr , due to the extra time spent on cpb for
deairing. a lower bleeding rate with msavr has been suggested in some studies ( 10 , 12 ) but not in others ( 3 , 4 ) .
previous reports have described shorter icu stays , a lower incidence of respiratory complications ( 10 , 12 ) , shorter hospital stays ( 4 , 8) and , therefore , a lower resource utilization ( 4 ) with msavr . in randomized trials alone , there was no difference between the groups for any of the above parameters , except for slightly longer cpb ( 8 min ) and overall operating ( 16 min ) times with msavr ; however , this was not clinically relevant ( 11 ) .
( 4 ) reported no difference in perioperative mortality , but did demonstrate a 4% three - year survival benefit with msavr .
other studies failed to demonstrate any differences in early or late mortality , or complications with msavr ( 3 ) .
however , given that msavr is a relatively new technique , and has been adopted by surgeons only over the past 10 - 15 years , long - term results of msavr should begin to emerge at the start of the next decade .
this initial experience has provided an insight into the safety of msavr performed by a single surgeon , providing a cosmetically acceptable result . given that the incidence of postoperative complications , the duration of the icu and hospital stays , and early survivals were similar for savr and msavr , it can be concluded that the latter procedure can be performed safely , by paying meticulous attention to the surgical techniques involved .
Output:
| introduction : degenerative aortic stenosis ( as ) is the most frequent cause among aortic valve stenotic changes .
mini sternotomy aortic valve replacement is a replacement of aortic valve through upper partial sternotomy.aim:the aim of this approach is to improve postoperative convalescence by leaving pleural spaces closed and do not compromise respiratory function , to decrease bleeding , and reduce post op ventilation time and icu stay .
all these advantages decrease cost during hospital stay by reducing icu stay , respiration time , bleeding and using blood products , pain killers and shortening hospital stay .
esthetic effect is also considerable result of this method.case report : this case report presents an initial experience with reversed l - type upper partial sternotomy in aortic valve replacement .
the goal is to demonstrate that minimally invasive advanced cardiac surgery procedures can be performed in our country . |
PubmedSumm118493 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: a hypertensive intracranial hemorrhage ( ich ) is generally solitary.15 ) ich occurrence accounts for 8 to 14% of all strokes in europe and the united states,3)5 ) but 20 to 35% of all strokes in asia.9)10)18 ) the occurrence of simultaneous multiple ichs is a rare clinical entity , with a prevalence rate of 1% to 4.7% of all spontaneous ich.2)14)15)17 ) spontaneous ich usually presents as right hemiplegia with increased severity in the foot , systemic arterial hypertension , vascular sensory deficits , and right homonymous hemianopsia upon malformation or aneurysmal rupture.8 ) simultaneous multiple ichs ( smichs ) are associated with cerebral aneurysms , vascular malformations , hemorrhagic infarction , coagulation defects , cerebral angiitis , neoplasms , sinus thrombosis , and/or amyloid angiopathy.13 ) here we describe a case involving multiple ichs that occurred simultaneously .
a 35-year - old patient was carried into the emergency room after sudden syncope or loss of consciousness .
several hours before this attack , the patient experienced a severe headache , nausea , and vomiting .
he reported drinking 1 - 2 bottles of alcohol daily and smoking cigarettes for 25 years ; he was also very obese .
his initial blood pressure was 200/114 mmhg , pulse was 100 and regular and respiration rate was 18 , body temperature was 36.6. no cardiac murmurs or neck bruits were present .
a computed tomography ( ct ) scan without brain contrast revealed multiple ichs in the right cerebellar dentate nucleus and left basal ganglia ( fig .
after more deterioration of consciousness six hours later , a brain ct showed acute hydrocephalus without new bleeding , but edema around the hemorrhages .
we diagnosed him with hydrocephalus and performed an emergency operation for extra - ventricular drainage ( evd ) catheter insertion .
2b , c , d ) revealed old infarctions in the pons and left thalamus , a subacute infarction in the left frontal and parietal lobes , and multiple old microbleeds in the pons and the thalamus on both sides .
two days later , the patient was moved from the intensive care unit to the general ward .
he was alert , followed commands well , and was able to walk voluntarily ; however , his mild dysarthria remained .
recurrent hemorrhages are not an unusual finding in patients with previous hypertensive ich,1)3)4 ) but the simultaneous occurrence of multiple intraparenchymal bleeding sites is rare and comprises only a small percentage of strokes.8)18 ) smich have been observed in only 2 to 3% of hemorrhagic stroke patients.11 ) kabuto et al .
reported that the most common location of multiple ichs was the bilateral putamen , while only two of 17 multiple ich patients in his case series had putaminal and cerebellar hemorrhages.7)13 ) some studies suggest that the mean age and sex distributions of groups of patients with multiple ichs are similar to those with solitary ich,18 ) but that these patients exhibited a longer duration of chronic hypertension and more often a history of a previous stroke.13)18 ) several risk factors , including blood pressure , blood sugar , cigarette smoking , alcohol drinking , and hypercholesterolemia have been examined as precipitating factors for hypertensive ich .
however , the blood pressure measurements that are taken after a stroke will most likely not reflect the patients ' blood pressure before the stroke , as high blood pressure could be a result of increased intracranial pressure .
additionally , the prevalence of hypercholesterolemia was significantly higher in the group with multiple ichs.13 ) smich is a rare clinical entity , and the mechanisms are not clear and only occasionally associated with cerebral aneurysms , vascular malformations , hemorrhagic infarctions , coagulation defects , cerebral angiitis , neoplasms , sinus thrombosis , or amyloid angiopathy.11)15 ) the simultaneous development of intracranial hemorrhages in two different arterial territories may occur in hypertensive patients and create smich.8 ) the current theory is that the initial hemorrhage causes resulting structural or hemodynamic changes that tend to result in a second hemorrhage.16)18 ) the rupture of bilateral intracerebral microaneurysms may occur simultaneously by chance .
the initial hemorrhage that results from a ruptured microaneurysm may cause the necessary conditions , such as hemodynamic changes and structural distortion , that rupture other microaneurysms , capillaries , and/or venules on the contralateral side , which are at risk , in a relatively short time,7 ) but our multivariate studies did not revealed these findings . in this patient ,
this type of smich is very rare.7 ) some studies suggest that simultaneous supraand infratentorial hemorrhages occur commonly,7)12 ) but that their mechanism and pathophysiology are not clear . in any case
, the high mortality and morbidity rates in these patients make the treatment of this devastating condition difficult .
thus , preventive measures must be taken.13 ) the management of ich remains heterogeneous across institutions due to the lack of information regarding medical and surgical effectiveness of these methods of management.18 ) the indications of surgery for multiple simultaneous hypertensive ichs are ambivalent.15 ) for patients with multiple ichs , surgery seems of minor use.18 ) treatment may be either medical or surgical , and the decision for treatment should be based on the gcs score of the patient , the locations and sizes of the hematomas , and the presence of additional medical problems .
patients with gcs scores over 5 or those with additional problems , as in our case , should be treated medically.6 ) adequate blood pressure control is an important part of management of smich .
the majority of patients with smich have poor outcomes because of their severely impaired consciousness.13 ) the mortality rate for patients with smich is much higher than that of patients with a single ich , even if the hematomas were small.7)8)16)18 ) in our case , the patient had hydrocephalus , and we performed an evd operation . because he had a cerebellar hematoma , the evd operation had the potential to expand the hematoma and aggravate his neurological symptoms .
however , it was a small hematoma , and , thus we were able to drain the cerebrospinal fluid very slowly with a catheter .
simultaneous multiple ich is rare , and the mechanism is not clear . with the increased availability of the use of ct scans for the diagnosis of ich ,
medical professionals should be alert and initiate treatment for excessive reflex hypertension to properly treat this dangerous condition .
Output:
| a 35-year - old man presented with simultaneous multiple intracranial hematomas in the right cerebellar dentate nucleus and left basal ganglia .
the hematomas were visible by computed tomography performed within two hours of the patient 's arrival .
the initial computed tomography showed acute hemorrhage in the left basal ganglia and dentate nucleus in cerebellum .
the patient then experienced a change of consciousness due to newly developed hydrocephalus , and emergent extra - ventricular drainage was performed . by discharge , fortunately , the patient was fully recovered . |
PubmedSumm118494 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: gefitinib ( zd1839 , iressa ) is an orally administered , reversible tyrosine kinase inhibitor ( tkis ) of epidermal growth factor receptor ( egfr ) , belonging to the smallmolecule class ( quinazoline - derivative molecule ) .
the egfr family includes four different tyrosine kinase receptors : egfr ( erbb-1 ) , erbb-2 , erbb-3 , and erbb-4 .
each of these proteins has an extracellular ligand - binding domain , a single hydrophobic transmembrane domain and a cytoplasmic tyrosine kinase - containing domain .
the receptors of the erbb family are activated following binding to peptide growth factors of the egf - family . upon ligand
binding , the erbb receptors form either homo- or heterodimers and , following dimerization , auto- and transphosphorylation in tyrosine residues of the erbb receptors occurs .
egfr signaling plays a key role in promoting the growth and survival of various types of solid tumors , including non small cell lung cancer ( nsclc ) [ 4 , 5 ] .
gefitinib has an inhibitory effect both on the autophosphorylation and downstream signaling , competing reversibly with the adenosine triphosphate ( atp ) for the catalytic domain of egfr . in vitro studies
indicated that gefitinib potently inhibited egfr tyrosine kinase activity at low concentrations that did not significantly affect other kinases tested . in vivo studies showed that gefitinib had a favourable tolerability profile and an antitumor activity in various xenograft models and enhanced the antitumor activity of a variety of cytotoxic drugs , including platinum compounds [ 7 , 8 ] .
gefitinib was well tolerated in healthy volunteers and showed a terminal half - life of 28 hours , supporting the once - daily oral administration .
this paper focuses on the clinical development of gefitinib in nsclc , discussing the causes of its failure in unselected nsclc patients and summarizing the available evidence coming from the randomized phase 3 trials that support the use of gefitinib as the standard first line treatment of patients with advanced nsclc harbouring egfr mutations .
gefitinib has been evaluated as single agent in four phase 1 clinical trials , including patients with advanced refractory solid tumors . in the first study , conducted in uk and
usa , gefitinib was administered once daily for 14 consecutive days , followed by 14 days off treatment .
dose escalation started at 50 mg and continued to 925 mg or until consistent dose - limiting toxicity ( dlt ) .
sixty - four patients were entered at eight dose levels . the most frequent dose - related grade 1 and 2 adverse events were acne - like rash , nausea , and diarrhea .
three of 9 patients treated at 700 mg / day developed dlt ( reversible grade 3 diarrhea ) .
four of 16 patients with nsclc had partial responses ( observed from 300 to 700 mg / day ) . in the second study ,
including 88 patients in europe and australia , gefitinib was administered at dose ranging from 150 to 1000 mg / day in 28-day cycles to patients with either advanced non small cell lung , ovarian , head and neck , prostate , or colorectal cancer . at 1000 mg
/ day , 5 of 12 patients experienced dlt ( grade 3 diarrhea in four patients and grade 3 somnolence in one patient ) .
the most frequent adverse events were acne - like rash ( 64% ) and diarrhea ( 47% ) , which were generally mild ( grade 1/2 ) and reversible on cessation of treatment .
nineteen patients had stable disease and received gefitinib for > 3 months . in the third study , conducted in usa , 71 patients
were enrolled at seven dose levels ( ranging from 150 to 1000 mg / day in 28-day cycles ) and most had nsclc ( n = 39 ) .
frequent treatment - related grade 1 - 2 adverse events were diarrhea ( 55% ) , asthenia ( 44% ) , and acne - like follicular rash ( 46% ) . at doses
the fourth phase 1 study investigated the tolerability and toxicity of gefitinib in japanese patients with solid tumors .
thirty - one patients were included and received oral gefitinib on 14 consecutive days , every 28 days .
dose escalation was from 50 mg / day to a maximum of 925 mg / day or dlt .
the most frequent adverse events were an acne - like rash and gastrointestinal side effects .
two of 6 patients at 700 mg / day had dlt ; no further dose escalation occurred .
a partial response was observed in 5 of the 23 patients with nsclc ( duration 35361 days ) over a range of doses ( 225700 mg / day ) , and 7 patients with various tumors had disease stabilization .
therefore , gefitinib showed a favourable tolerability profile and antitumor activity also in japanese patients .
moreover , pharmacokinetic analyses from all these studies confirmed the feasibility of the once daily schedule .
the preclinical evidence of synergism between gefitinib and chemotherapy provided the rationale for a feasibility study designed to assess the tolerability and antitumor activity of the combination of two doses of gefitinib ( 250 and 500 mg / day ) , gemcitabine and cisplatin ( at standard doses ) in chemotherapy - nave patients with advanced or metastatic solid tumors , and to assess whether there was a pharmacokinetic interaction between these drugs when administered concurrently .
two patients developed dlt : one grade 3 convulsion ( 250 mg / day dose group ) and one grade 3 rash ( 500 mg / day dose group ) .
the most common grade 3/4 adverse events were vomiting ( 7 patients ) , asthenia ( 6 patients ) , thrombocytopenia ( 6 patients ) , diarrhea ( 5 patients ) , and anorexia ( 5 patients ) .
pharmacokinetic analyses showed no apparent pharmacokinetic interaction between gefitinib and cisplatin or gemcitabine , with the exception of a possible small increase in the geometric mean exposure to gemcitabine seen on day 8 of therapy when given alone with the higher dose of gefitinib .
of 10 evaluable patients with nsclc , 5 had confirmed partial response , 4 had stable disease and 1 had progressive disease .
two randomized phase 2 clinical studies evaluated the safety and the activity of two doses of gefitinib ( 250 mg or 500 mg ) as second- or third - line therapy of nsclc patients ( ideal 1 and ideal 2 ) [ 15 , 16 ] .
the ideal-1 ( iressa dose evaluation in advanced lung cancer ) study recruited 210 patients who were pretreated with one or two chemotherapy regimens , at least one containing platinum . the ideal-2 study included 221 patients who were pretreated with two or more regimens containing platinum and docetaxel . in both studies ,
the two doses of gefitinib produced similar results in terms of objective responses ( approximately 20% in ideal-1 and 10% in ideal-2 ) , disease control rate ( about 50% in ideal 1 and 40% in ideal 2 ) , and overall survival ( about 8 months in ideal 1 and 7 months in ideal 2 ) .
overall , the incidence of toxic effects , including skin rash and diarrhea , was lower in patients treated with 250 mg / day as compared with patients treated with 500 mg / day .
these results led to choosing the lower dose for subsequent development of the drug in nsclc . in both trials
, an attempt has been made to identify predictive factors for objective response to gefitinib . in the ideal-1 study ,
a multivariate analysis showed that performance status , previous immuno / hormonal treatment , histology , and female gender were significantly associated with a higher response rate , while in the ideal-2 study only female gender was significantly predictive of response to gefitinib .
the promising results of these trials led , in 2003 , the food and drug administration ( fda ) to grant an accelerated approval for gefitinib as monotherapy treatment for patients with locally advanced or metastatic nsclc after failure of both platinum - based and docetaxel chemotherapies .
the results of other phase 2 studies conducted with gefitinib as single agent in unselected patients with advanced nsclc are summarized in table 1 [ 1523 ] .
the encouraging results obtained in early clinical trials and the preclinical evidence of synergism between gefitinib and chemotherapy prompted two large randomized phase 3 clinical trials examining the role of gefitinib in combination with standard chemotherapy ( cisplatin plus gemcitabine in intact-1 and carboplatin plus paclitaxel in intact-2 ) for the first line treatment of advanced nsclc [ 24 , 25 ] . both of these studies failed to demonstrate any advantage in overall survival for patients treated with chemotherapy in combination with gefitinib .
moreover , subgroups analyses of predictive factors of sensitivity to gefitinib did not demonstrate any survival advantage for specific subgroups when gefitinib was added to chemotherapy .
negative results were similarly observed with the combination of another tyrosine kinase inhibitor , erlotinib , with chemotherapy ( talent and tribute studies ) [ 26 , 27 ] .
several explanations regarding the lack of an additive effect between tyrosine kinase inhibitors and chemotherapy have been proposed : a mechanistic interaction between gefitinib or erlotinib and chemotherapy , for which the antiproliferative effects of anti - egfr agents may render tumor cells less sensitive to cytotoxic agents , as suggested by preclinical studies ; the possibility that patients who benefit from egfr - targeted treatments are the same who likely respond to chemotherapy : in this case , the effect of tyrosine kinase inhibitors can be masked by the effect of chemotherapy ; finally , the lack of patient selection based on the expression of egfr . because no additive effect was observed by administering gefitinib in combination with chemotherapy , a phase 3 trial was conducted to evaluate the efficacy of a sequential strategy , with gefitinib given after first line platinum - doublet chemotherapy for nsclc , which might have avoided problems of drug interference or antagonism .
unfortunately , sequential gefitinib therapy after three cycles of standard platinum doublet chemotherapy showed no survival benefit over platinum doublet chemotherapy up to six cycles ( hr 0.86 , 95%ci 0.721.03 , p = .11 ) , although sequential gefitinib was associated with significantly prolonged progression - free survival ( hr 0.68 , 95%ci 0.570.80 ; p < .001 ) .
an exploratory subset analysis demonstrated a possible survival prolongation for sequential therapy of gefitinib , for patients with adenocarcinoma ( hr 0.79 , 95%ci 0.650.98 , p = .03 ) .
table 2 summarizes the results of the randomized clinical trials with gefitinib in first- and second - line therapy , in locally advanced disease and adjuvant setting and in special populations [ 24 , 25 , 2938 ] . a multicenter phase 3 study compared gefitinib as monotherapy at the dose of 250 mg / day to placebo in 1692 pretreated patients with nsclc .
patients treated with gefitinib reported significantly higher response rate ( 8% versus 1.3% ) and longer time to treatment failure ( 3.0 versus 2.6 months ) .
however , treatment with gefitinib was not associated with significant improvement in survival in the overall population ( 5.6 versus 5.1 months in the gefitinib and placebo arms , resp . ) nor in the subgroup of patients with adenocarcinoma .
there was pronounced heterogeneity in survival outcomes between groups of patients , with some evidence of benefit among never - smokers ( median survival of 8.9 versus 6.1 months ; hr 0.67 ; 95% ci 0.490.92 , p = .012 ) and asian ethnicity ( 9.5 versus 5.5 months ; hr 0.66 ; 95% ci 0.480.91 , p = .01 ) . explanations of the negative results of this trial could be the large number of chemotherapy refractory patients ( 90% ) , a suboptimal dose of gefitinib and the lack of selection based on potential molecular markers , associated with clinical outcome .
in addition , exploratory biomarker analyses , including the assessment of egfr gene copy number by fish , egfr and p - akt protein expression by ihc , egfr , k - ras and d - raf mutational status , showed a trend towards a better survival outcome for gefitinib in patients with high egfr - gene - copy number ( hr 0.61 for high copy number and hr 1.16 for low copy number , p = .045 ) , while patients with egfr mutations obtained higher rr than wild - type patients ( 37.5% versus 2.6% ) . no relationship was observed between p - akt protein expression and survival outcome .
on the basis of the lack of survival benefit in the isel study , in 2005 the fda restricted the use of gefitinib to patients continuing to benefit from treatment already initiated or participating in clinical trials . four randomized trials compared gefitinib versus docetaxel as a second - line therapy of advanced nsclc patients .
an open - label randomized phase 2 study ( sign trial second line indication of gefitinib in nsclc ) compared gefitinib ( 250 mg / day ) with docetaxel ( 75 mg / mq every 3 weeks ) in 135 patients with advanced pretreated nsclc .
gefitinib and docetaxel showed similar activity ( symptom improvement rates of 36% and 26% , response rate of 13.2% and 13.7% , median progression - free survival of 3 and 3.4 months , median overall survival of 7.5 and 7.1 months , with quality of life improvement rates of 33.8% and 26% for gefitinib and docetaxel , resp . ) .
however , gefitinib had a more favorable tolerability profile than docetaxel ( adverse events of all grades : 51.5% versus 78.9% ; grade 3 - 4 : 8.8% versus 25.4% ) .
the interest trial was the largest study comparing gefitinib to docetaxel as second- or third - line therapy in 1466 patients with advanced nsclc treated with prior platinum - based chemotherapy .
the coprimary endpoints were the noninferiority of gefitinib in comparison with docetaxel in terms of overall survival in the total population and the superiority in patients expressing a high egfr gene copy number .
the study demonstrated the noninferiority of gefitinib ( os 7.6 versus 8.0 months , with a 1-year survival of 32% versus 34% , in the gefitinib and docetaxel arms , resp .
, hr 1.02 , 96% ci 0.9051.150 , meeting the pre - defined non inferiority criterion of 1.154 ) , while failed to demonstrate the superiority of gefitinib in the subgroup of 174 patients with high egfr gene copy number : in this setting , median survival was 8.4 months in the gefitinib group and 7.5 months in the docetaxel group , and 1-year survival was 32 and 35% , respectively ( hr 1.09 ; 95% ci 0.781.151 , p = .620 ) .
the most common adverse events in the gefitinib group were skin reactions ( 49% versus 10% ) and diarrhea ( 35% versus 25% ) , whereas in docetaxel group neutropenia ( 5% versus 74% ) , asthenia ( 25% versus 47% ) , and alopecia ( 3% versus 36% ) .
significantly more patients had sustained clinically relevant improvement in quality of life with gefitinib than with docetaxel , as assessed by fact - l total score ( or 1.99 , 95% ci 1.422.79 ; p < .0001 ) and the fact - l - toi ( or 1.82 , 95%ci 1.232.69 ; p
similar proportions of patients had improvements in lung cancer symptoms ( fact - l lcs ) with gefitinib and docetaxel ( or 1.29 , 95%ci 0.931.79 ; p = .013 ) . moreover , a biomarkers analysis was conducted in this trial on 453 patients ( 31% ) who had tissue samples evaluable for at least one biomarker ( egfr copy number by fluorescent in situ hybridization , egfr protein expression by immunohistochemistry , and egfr and kras mutations ) and showed no difference in overall survival between treatments for any biomarker .
however , notably , among patients with egfr mutation - positive tumors , pfs was longer ( hr 0.16 ; 95% ci 0.050.49 , p = .001 ) and objective response was higher ( 42.1% versus 9.8% ) for gefitinib as compared to docetaxel .
overall survival was longer in patients with egfr mutation - positive tumors in both gefitinib and docetaxel subgroups ( median survival 14.2 and 16.6 months , resp . )
than in the overall population ( 7.6 and 8.0 months , resp . ) and in the population with wild - type egfr ( 6.4 and 6.0 months , resp . ) , but there was no difference between treatments . finally , exploratory analyses showed no difference between patients with high and low egfr copy number within the gefitinib arm ( high versus low hr , 1.02 , 95% ci 0.741.41 , p = .914 ) and no significant differences in survival outcome between the study arms according to kras mutation status .
two further randomized phase 3 clinical trials ( conducted in japan and korea , resp . ) compared gefitinib versus docetaxel in patients with locally advanced or metastatic nsclc , pretreated with one or two chemotherapy regimens [ 35 , 36 ] .
the japanese trial did not meet the primary objective ( non inferiority of gefitinib versus docetaxel ) in terms of overall survival ( 11.5 months for gefitinib versus 14 months for docetaxel ) , although fewer severe adverse events ( 40.6% versus 81.6% ) and benefits in terms of quality of life improvement occurred with gefitinib compared with docetaxel . in the korean study ,
gefitinib improved significantly objective response rate ( 28.1 versus 7.6% ) and pfs ( hr 0.73 , 90% ci 0.530.98 , p = .0441 ) than docetaxel .
however , no differences were observed in terms of os ( 14.1 versus 12.2 months in the gefitinib and docetaxel arms , resp . ) and quality of life or symptom improvement rates .
a meta - analysis of the randomized clinical trials comparing gefitinib to docetaxel was presented at 2009 asco meeting and showed similar overall and progression - free survival between the two drugs and superior response rate with gefitinib .
therefore , given the similar efficacy demonstrated by gefitinib , its favorable tolerability profile , the quality of life benefits , and the oral administration , the authors concluded that gefitinib has a favorable benefit - risk profile compared with docetaxel in a broad pretreated advanced nsclc patient population .
a single phase 3 trial of adjuvant gefitinib has been conducted to date ( the br.19 trial ) , starting in the early 2000s , when a great enthusiasm existed for exploring the potential of this drug in nsclc treatment . in the br.19 trial ,
patients with completely resected stage ib to iiia nsclc were randomly assigned to receive daily gefitinib 250 mg or placebo , for two years .
the study planned to enrol 1160 patients , but it was stopped prematurely in 2005 , following the negative results of the isel study and the swog s0023 trials . at the time of study closure , 503 patients had been enrolled .
median age of patients was 67 ; 54% were male , 54% ps 0 and most of them were ever smoker ( 89% ) ; most of tumors were adenocarcinoma ( 59% ) ; only 17% of patients received chemotherapy .
differences were not significant for both overall survival ( hr 1.24 ; 95% ci 0.941.64 ; p = .14 ) and disease - free survival ( hr 1.22 , 95% ci 0.931.61 ; p = .15 ) , with a negative trend for gefitinib treatment .
the toxicity analysis excluded the possibility of attributing this disadvantage to a higher incidence of fatal toxicity in the gefitinib arm .
preplanned subgroup analyses according to egfr mutational status ( 357 evaluable patients , 76 of whom with mutation ) demonstrated no benefit for gefitinib treatment in both wild - type and mutant nsclc patients , with a more evident negative trend just in patients with egfr mutations ( hr 1.58 , 95% ci 0.833.00 ; p = .16 ) .
although all the comparisons have weak power due to the small number of the patients , these results are very striking and preclude the use of adjuvant gefitinib outside from clinical trials .
the above - mentioned swog s0023 trial compared maintenance gefitinib to placebo after concurrent chemoradiotherapy and docetaxel consolidation in inoperable stage iiia and iiib nsclc patients .
this study also closed prematurely , on the recommendation of an unplanned interim analysis that was prompted by the results of the isel trial .
of the 571 eligible patients registered at the time of the interim analysis ( against the 840 planned ) , 234 were randomized to receive gefitinib 500 mg or placebo , daily for five years .
the interim analysis of this study showed that the hypothesized alternative of a 33% improvement in survival with gefitinib over placebo was ruled out with a one - sided p = .0015 . updated results , after a median followup of 27 months , were successively published , showing that patients receiving gefitinib had a worse survival than patients on placebo , with a median survival of 23 compared with 35 months ( hr 0.63 , 95% ci 0.440.91 ; p = .013 ) .
as in the br.19 trial , the analysis of cancer - related and toxic death revealed that the inferior survival was due to tumor progression and not to gefitinib toxicity . unfortunately , molecular features of the tumors , including egfr mutations , were not recorded in this study .
the detrimental effect of maintenance gefitinib after optimal cytoreduction with chemoradiotherapy in stage iii nsclc reported by the s0023 trial excludes the use of the drug in this setting of disease .
the evidence coming from these two randomized trials do not support the use of gefitinib in the localized stages of nsclc patients , even with tumors carrying egfr mutations .
the intrathoracic disease could have a different biologic behavior that should be further explored . in consideration of its good toxicity profile
, gefitinib has been tested as an alternative to a single - agent chemotherapy in elderly and poor performance status ( ps ) ncslc patients .
( 250 mg daily ) versus vinorelbine in 196 untreated elderly ( 70 years ) nsclc patients .
the trial was designed to determine the superiority of gefitinib versus vinorelbine in terms of progression - free survival .
the results showed no statistical difference in progression - free survival ( 2.7 versus 2.9 months , hr 1.19 , 95% ci , 0.851.65 , p = .310 ) , overall survival ( 5.9 versus 8.0 months ; hr 0.98 , 95% ci , 0.661.47 ) , and response rate ( 3.1 versus 5.1% ) between gefitinib and vinorelbine , respectively .
most of the enrolled patients were male ( 77% ) , smokers ( 82% ) , and with squamous cell carcinoma , thus without clinical features conferring sensitivity to gefitinib , and this may explain the low percentage of responders in this study .
goss et al . compared gefitinib to bsc in 201 untreated ncslc patients with ps 2 , not eligible for chemotherapy , in a randomized phase ii trial .
primary endpoint was pfs and , nevertheless the results showed no statistical difference , there was a trend toward improved progression - free survival ( hr 0.82 , 95% ci , 0.601.12 , p = .217 ) , overall survival ( hr 0.84 , 95% ci , 0.621.15 , p = .272 ) and response rate ( 6% versus 1 % placebo ) in favor of gefitinib .
the recent discovery that some somatic mutations in the tyrosine kinase domain of the egfr gene are associated with a high response to egfr tyrosine kinase inhibitors in nsclc highlighted the need for patient selection through molecular screening [ 42 , 43 ] .
several phase 2 studies showed a high response rate ( 5590% ) and a prolonged progression - free survival ( of approximately 9 months ) with first - line gefitinib in asiatic patients selected on the basis of the presence of activating egfr gene mutations [ 4456 ] .
yang and colleagues observed in 43 patients with exon 19 deletions and l858r mutations a response rate of 95% and 73.9% and a progression - free survival of 8.9 and 9.1 months , respectively .
the itarget trial selected chemo - nave patients with nonsquamous histology who had one or more clinical characteristics associated with activating egfr mutations , such as low or never smoking history , adenocarcinoma histology , female gender , and east asian ethnicity . in this study , mutations were identified in 35% of patients and 31 patients received gefitinib : the response rate was 55% , the median progression - free survival was 9.2 months , and overall survival was 17.5 months .
actually , the response rate was 78% and 59% for patients carrying l858r mutation and exon 19 deletion , respectively , which are activating mutations , predictive for response to gefitinib , whereas it was 0% in patients with atypical mutations .
therefore , this study has demonstrated that genotype - directed egfr - tki therapy with gefitinib for patients with previously untreated nsclc is feasible also in a western population .
inoue et al . tested gefitinib in a phase ii trial in nsclc patients harbouring egfr mutations and with poor ps , not eligible for chemotherapy . to note , 22 of 30 patients had very poor ps ( 3 or 4 ) .
the median progression - free and overall survival were 6.5 and 17.8 months , respectively .
this is the first report indicating that egfr mutation - positive patients with poor ps can benefit from front line gefitinib treatment .
others phase ii trials have selected patients on the basis of clinical , pathological , or molecular features .
the oncobell trial enrolled 42 patients who were never smokers or who had evidence of a high egfr gene copy on fish and were p - akt positive .
the response rate was 47.6% , the median time to progression was 6.4% , and 1-year survival rate was 64.3% . in egfr - mutated patients ( 66.8% ) ,
the southwest oncology group performed a phase ii trial for pretreated ( n = 22 ) or untreated ( n = 69 ) patients with bronchioalveolar carcinoma .
the response rate in the pretreated and untreated patients was 9% and 17% , respectively .
finally , a phase ii trial investigated the activity of gefitinib 250 mg daily in 37 chemo - nave korean patients with adenocarcinoma and a never - smoking history .
the response rate was 69% with a disease stabilization rate of 81% ; median progression - free survival and 1-year survival rate were 33 weeks and 73% , respectively .
four randomized phase iii clinical trials evaluated the role of gefitinib as first line therapy of patients with advanced nsclc , selected on the basis of clinical or molecular features ( table 4 ) [ 5760 ] .
the first evidence of efficacy of a therapeutic strategy based on an egfr tyrosine kinase inhibitor as a first - line treatment of patients with advanced nsclc derived from a large , randomized phase 3 clinical trial conducted in asian patients , the ipass study .
the ipass ( iressa pan asia study ) trial randomized 1217 patients with advanced adenocarcinoma , non - smoker or former light smoker , to receive gefitinib , 250 mg daily until progression or unacceptable toxicity , or carboplatin ( auc 5 - 6 ) plus paclitaxel ( 200 mg / m ) for a maximum of 6 cycles .
the study met the primary objective ( non inferiority of gefitinib ) and also demonstrated the superiority of gefitinib compared to carboplatin and paclitaxel in terms of progression - free survival in intention - to - treat analysis ( hr 0.74 , 95% ci : 0.650.85 , p = .001 ) . because of the crossing of the curves , the median progression - free survival is similar with both treatments : however , the pattern of progression - free rates favors chemotherapy for the first 6 months and gefitinib for the remaining 16 months .
the initial superiority of chemotherapy was attributed to the benefit that the egfr - mutation - negative subgroup received from chemotherapy but not from gefitinib , whereas prolonged progression - free survival in the egfr - mutation - positive subgroup explained the subsequent improvement favoring gefitinib .
crossing of the curves did not occur in the mutation - positive subgroup or the mutation - negative subgroup .
another important finding of this study was the significant interaction between treatment efficacy and egfr mutational status . in the subgroup of patients with egfr mutation ( 261 of 437 available samples ) , progression - free survival was significantly longer ( hr 0.48 ; 95% ci 0.360.64 , p = .001 ) , and the response rate was significantly higher with gefitinib than with carboplatin - paclitaxel ( 71.2% versus 47.3% , p = .001 ) . on the contrary , in the mutation - negative subgroup , progression - free survival was significantly shorter ( hr 2.85 ; 95% ci 2.053.98 , p < .001 ) and response rate was significantly lower with gefitinib ( 23.5% versus 1.1% , p = .001 ) .
overall survival data were immature , based on only 37.0% of events , and showed a similar overall survival between the two groups : 18.6 months with gefitinib and 17.3 months with carboplatin - paclitaxel ( hr for death in the gefitinib group , 0.91 ; 95% ci , 0.76 to 1.10 ) .
final overall survival data confirmed no difference between gefitinib and chemotherapy , in the whole population ( 18.8 months with gefitinib versus 17.4 months with chemotherapy , hr 0.90 , 95% ci : 0.791.02 , p = .11 ) and in the mutation positive subgroup ( hr 1.00 , 95% ci : 0.761.33 ) .
patients in the gefitinib group had a clinically relevant improvement in quality of life , as assessed by fact - l questionnaire ( or 1.34 ; 95% ci 1.061.69 , p = .01 ) and by toi ( trial outcome index ) scores ( or 1.78 ; 95% ci 1.402.26 ; p < .001 ) .
moreover , gefitinib was associated with a lower rate of grade 3 or 4 adverse events compared to chemotherapy .
the incidences of rash or acne , diarrhea , and elevated aminotransferase levels were significantly higher with gefitinib , whereas neurotoxic effects , nausea and vomiting , and hematologic toxic effects were significantly higher with carboplatin - paclitaxel .
interstitial lung disease events ( i.e. , the acute respiratory distress syndrome , interstitial lung disease , pneumonitis , or radiation pneumonitis ) occurred in 16 patients treated with gefitinib ( 2.6% ) and in 8 patients treated with chemotherapy ( 1.4% ) . a second randomized phase 3 clinical trial compared gefitinib ( 250 mg daily ) with cisplatin - gemcitabine as a first - line treatment in 309 asian , never smokers patients , with advanced adenocarcinoma .
the study failed to reach its primary endpoint , overall survival , even if gefitinib allowed the achievement of a favorable response rate : 53.5% for gefitinib versus 45.3% for chemotherapy ( or 1.385 , 95% ci 0.8852.167 , p = .153 ) .
the overall mutation rate in this study was 43.8% : in mutation positive patients , the response rate was 84.6% for gefitinib versus 37.5% for chemotherapy ( p = .002 ) , while , in mutation negative subgroup , the response rate was 29.9% for gefitinib versus 51.9% for chemotherapy ( p = .051 ) .
there was some difference in progression - free survival favoring gefitinib in mutation positive patients ( 8.5 versus 6.7 months ; hr 0.613 , 95% ci 0.3081.221 , p = .0849 ) .
there was no difference in overall survival by mutation status , both in the overall and egfr - mutated populations : it could be due to the poststudy use of egfr tkis in 80.7% of chemotherapy arm .
two randomized phase 3 studies have been performed in japanese , egfr - mutated patients with advanced nsclc , to compare the efficacy of gefitinib versus chemotherapy in the first - line setting . in the open label phase iii wjtog3405 trial ,
172 egfr mutated patients were randomly assigned to receive gefitinib ( 250 mg daily ) or chemotherapy ( cisplatin 80 mg / m plus docetaxel 60 mg / m adminstered every 21 days for three to six cycles ) .
the study met its endpoint , showing a median progression - free survival of 9.2 months in the gefitinib group versus 6.3 months in the chemotherapy group ( hr 0.489 , 95% ci : 0.3360.710 , p = .0001 ) . in this
molecularly selected population , progression - free survival curves did not cross , unlike ipass trial , being the benefit of gefitinib over chemotherapy consistent at any time of treatment . response rate was 62.1% and 32.2% with gefitinib and chemotherapy , respectively ( p < .0001 ) .
myelosuppression , alopecia and fatigue were more frequent in the cisplatin - docetaxel group , while skin toxicity , liver dysfunction , and diarrhea in the gefitinib group .
another prospective phase iii study , the nej002 trial , compared gefitinib to chemotherapy with carboplatin and paclitaxel as a first - line treatment in advanced nsclc patients selected for egfr mutation .
the study was stopped by independent data and safety monitoring committee after the preplanned interim analysis , conducted 4 months after the 200th patient enrolled , because it showed a significant difference in progression - free survival between the two treatment groups .
the median progression - free survival was 10.4 months versus 5.5 months for gefitinib and chemotherapy , respectively ( hr 0.36 , 95% ci : 0.250.51 , p < .001 ) , and the final analysis confirmed these results , showing a median pfs of 10.8 versus 5.4 months for gefitinib and chemotherapy , respectively ( hr 0.30 , 95% ci 0.220.41 , p < .001 ) .
the response rate was significantly higher in the gefitinib than chemotherapy arm ( 73.7% versus 30.7% , p < .001 ) .
the median progression - free survival and overall survival did not differ significantly between patients with exon 19 deletion and those with l858r point mutation ( 11.5 months versus 10.8 months , resp . ) .
the overall survival did not differ significantly between the two treatment groups ( median survival time and the 2-year survival rate were 30.5 months and 61.4% for gefitinib group as compared with 23.6 months and 46.7% for the chemotherapy , resp .
importantly , among 112 patients who had completed first - line carboplatin - paclitaxel , 106 ( 94.6% ) received second - line gefitinib and 58.5% of these patients had a response .
the most common adverse events in the gefitinib group were rash and elevated levels of aspartate aminotransferase or alanine aminotransferase and , in the chemotherapy arm , appetite loss , neutropenia , anemia , and sensory neuropathy .
interstitial lung disease was reported in 6 patients ( 5.3% ) in the gefitinib arm , with one of these fatal . in general , the incidence of severe toxic effects ( nci - ctc 3 ) was significantly higher in the chemotherapy group than in the gefitinib group ( 71.7% versus 41.2% , p < .001 ) . therefore , these both studies confirmed gefitinib to be superior to chemotherapy in terms of response rate and progression - free survival in patients with egfr mutations .
several phase iii / iv studies are currently ongoing with gefitinib in nsclc in different clinical settings ( table 5 ) . a double - blind , multicenter , randomized
, placebo - controlled phase iii study is evaluating the efficacy , safety , and tolerability of gefitinib as a maintenance therapy in 296 patients with locally advanced or metastatic nsclc ( inform trial , clinicaltrials.gov i d : nct00770588 ) .
patients must have completed 4 cycles of platinum - based first - line doublet chemotherapy without experiencing disease progression or unacceptable toxicity and are randomized to gefitinib or placebo at 1 : 1 ratio .
the primary endpoint is progression - free survival ; secondary endpoints are overall survival , objective tumor response , quality of life , and safety profile in terms of adverse events .
another randomized phase iii trial is evaluating the efficacy of a maintenance therapy with gefitinib compared with placebo in 600 japanese patients treated with first - line chemotherapy for stage iiib or iv nsclc ( clinicaltrials.gov i d : nct00144066 ) .
the primary aim of the study is to determine if gefitinib improves overall survival of the patients that did not progress on prior first line induction chemotherapy .
a phase iv study is investigating the activity and safety of gefitinib as first - line therapy for 100 caucasian patients with egfr - positive mutations ( clinicaltrials.gov i d : nct01203917 ) .
the primary endpoint is the objective response rate ; secondary endpoints are disease control rate , safety data , and overall survival .
a randomized phase iii clinical study will compare gefitinib versus pemetrexed in never - smoker patients with adenocarcinoma histotype , previously treated with platinum - based chemotherapy ( clinicaltrials.gov i d : nct01066195 ) .
the estimated enrollment is of 129 patients , and the main endpoints are progression - free survival , overall survival , objective response rate , and toxicity .
a randomized , open label , phase iii study is enrolling 226 east asian never or light ex - smoker patients with locally advanced or metastatic nonsquamous nsclc , with the aim to compare first line cisplatin + pemetrexed for 6 cycles followed by gefitinib for 6 courses ( each of 21 days ) versus gefitinib alone for 6 courses ( each of 21 days ) ( clinicaltrials.gov i d : nct01017874 ) .
primary endpoint is progression - free survival ; secondary endpoints are overall survival , tumor response rate , disease control rate , time to progression , duration of response , and time to worsening of health - related quality of life . the trial should be completed in 2013 .
a multicenter randomized phase iii study is investigating the efficacy of whole brain radiation therapy compared with observation in preventing brain metastases in 242 patients with advanced nsclc responding to first- or second - line gefitinib ( 250 mg / day ) or erlotinib ( 150 mg / day ) administered continuatively until disease progression or unacceptable toxicity ( clinicaltrials.gov i d : nct00955695 ) .
patients must be never smoker , with a diagnosis of adenocarcinoma with the egfr - positive mutations on exon 19 or 21 .
secondary endpoints are overall survival , progression - free survival , safety , psycho - neurological effects , and quality of life
. a phase iv pharmacoeconomics study will have the objective to analyze the cost - effectiveness and the cost - utility of gefitinib as a first - line treatment for 200 patients affected by stage iiib or iv nsclc , compared with the conventional first - line platinum - based chemotherapy ( clinicaltrials.gov i d : nct00173524 ) .
the development of gefitinib in nsclc is a clear example of the difficulties in designing and conducting of clinical trials with new molecular - targeted agents and of the uncertainty about predictive factors and selection criteria .
crucial points , regarding the methodology of clinical research with target - based agents , especially for phase 3 trials , are how should patients be selected and which patients are expected to benefit from a targeted agent .
the proper characterization of a molecular target that allows the identification of responding versus nonresponding patients to a molecular - targeted agent could have important implications for the design of randomized trials evaluating the efficacy of the drug .
in fact , the presence of unrecognized molecular heterogeneity can result in a falsely negative study that could be underpowered and may fail to detect a truly effective new therapy , leading to the rejection of a potentially useful drug .
gefitinib was the first targeted drug that entered into clinical practice for the treatment of lung cancer : however , the positive results obtained in early clinical trials were not confirmed in large phase 3 trials , testing the efficacy of gefitinib in unselected patients with advanced nsclc and , therefore , the use of gefitinib in clinical practice was stopped for several years .
it has been then shown that the presence of somatic mutations in the kinase domain of egfr strongly correlates with increased responsiveness to egfr tyrosine kinase inhibitors in patients with advanced nsclc and that a substantial percentage of tumors with objective response to gefitinib or erlotinib harbours somatic mutations in the egfr gene [ 42 , 43 , 65 ] . moreover , clinical and demographic factors , including female sex , nonsmoking status , adenocarcinoma histotype , and asian race have been identified as potentially predictive of the efficacy of egfr tyrosine kinase inhibitors .
currently , 4 randomized clinical trials have demonstrated the efficacy of gefitinib as a first - line treatment of nsclc patients harbouring egfr mutations : the ipass and the first - signal studies , conducted in asian patients selected for clinical factors ; the wjtog 3405 and the nej002 studies , conducted in patients selected for the presence of egfr - activating mutations [ 5760 ] .
all these trials have demonstrated a statistically significant increase in progression - free survival with gefitinib compared to platinum - based chemotherapy in patients with egfr - mutated advanced nsclc . moreover ,
treatment with gefitinib was associated with evidence of high objective response rate , better quality of life and more favourable toxicity profile . on these bases , in july 2009 gefitinib received from emea the authorization for the treatment of locally advanced or metastatic nsclc with activating mutations of egfr , across all lines of therapy and , currently , it can be considered the standard first - line treatment of patients with advanced nsclc harbouring egfr mutations .
similar results have been recently obtained with erlotinib in a phase 3 clinical trial conducted in china ( the optimal trial ) , comparing erlotinib to gemcitabine plus carboplatin , in egfr - mutation - positive tumors in terms of progression - free survival .
the optimal study showed that erlotinib was significantly superior to chemotherapy in terms of progression - free survival ( 13.1 versus 4.6 months , hr 0.16 , 95% ci : 0.100.26 , p < .0001 ) and also in terms of objective response rate ( 83% versus 36% ) . on the contrary , a treatment strategy based on a tyrosine kinase inhibitor ( erlotinib ) as
a first - line therapy , followed at progression by chemotherapy in unselected patients with advanced nsclc , is inferior to standard treatment with a first - line platinum - based doublet , followed at progression by erlotinib and can not be recommended in clinical practice .
several questions need to be addressed , regarding the reproducibility of these results in western patients with nsclc and egfr mutations , the proper tyrosine kinase selection ( gefitinib versus erlotinib ) , the lack of a survival benefit with first - line gefitinib in all these studies , the most appropriate clinical use of tkis in mutated patients ( first versus second line ) , the efficacy of gefitinib as neoadjuvant therapy or in combination with radiotherapy in patients with locally advanced nsclc and egfr mutations , and overcoming resistance to tyrosine kinase inhibitors . a large randomized phase 3 trial ( the eurtac trial , clinicaltrial.gov i d nct00446225 ) testing erlotinib in western patients harbouring egfr mutation is addressing the first question .
conversely , there are no ongoing phase 3 trials that directly compare gefitinib with erlotinib : therefore , the choice of the tyrosine kinase inhibitor to use in clinical practice should be based on evidence coming from these randomized trials .
whether progression - free survival prolongation translates into survival gain is not yet clear : mature data from the ipass trial showed no survival difference between first - line gefitinib and chemotherapy , probably due to treatment cross - over of patients with tumor harbouring egfr mutation .
the lack of a survival benefit with first - line gefitinib raises the question regarding its use as first- or second - line therapy , in patients selected by the presence of egfr mutation .
data from western and asian patients suggest that there was no statistically significant difference in overall survival between patients receiving egfr inhibitors as a first - line therapy or after failure of previous chemotherapy [ 68 , 69 ] .
however , these analyses were not based on a prospective comparison between the two strategies ( first- versus the second - line therapy with egfr inhibitors ) .
moreover , it should be considered that , for patients who do not receive first - line tyrosine kinase inhibitors , there is the risk of never receiving an egfr inhibitor at the time of disease progression , due to a rapid worsening of clinical conditions .
finally , the better quality of life and more favourable toxicity profile with first line gefitinib , in addition to the prolonged progression - free survival , compared to chemotherapy , strongly support the use of gefitinib as a first - line therapy in patients with activating egfr mutations .
the final results of ongoing clinical trials should define the efficacy of gefitinib also as neoadjuvant therapy or in combination with radiotherapy in patients with locally advanced nsclc and egfr mutations , while the development of irreversible inhibitors of egfr tyrosine kinases may have the potential to overcome the resistance to tyrosine kinase inhibitors .
Output:
| gefitinib is an oral , reversible , tyrosine kinase inhibitor of epidermal growth factor receptor ( egfr ) that plays a key role in the biology of non small cell lung cancer ( nsclc ) .
phase i studies indicated that the recommended dose of gefitinib was 250 mg / day .
rash , diarrhea , and nausea were the most common adverse events .
the positive results obtained in early phase 2 clinical trials with gefitinib were not confirmed in large phase 3 trials in unselected patients with advanced nsclc . the subsequent discovery that the presence of somatic mutations in the kinase domain of egfr strongly correlates with increased responsiveness to egfr tyrosine kinase inhibitors prompted phase 2 and 3 trials with gefitinib in the first line - treatment of egfr - mutated nsclc .
the results of these trials have demonstrated the efficacy of gefitinib that can be now considered as the standard first - line treatment of patients with advanced nsclc harbouring activating egfr mutations . |
PubmedSumm118495 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: the klotho gene , named from a greek goddess who spins the thread of life , was identified in 1997 as a gene mutated in the klotho mouse , which exhibited multiple disorders resembling human premature - aging syndrome .
it is expressed in a limited numbers of tissues , most notably in distal convoluted tubules of kidney and choroid plexus of brain .
a previous study showed that overexpression of klotho in a mouse model of glomerulonephritis restored mitochondrial function and suppressed mitochondrial dna damage in kidney .
it also suppressed the accelerated cellular senescence and apoptosis induced by glomerulonephritis , resulting in preservation of renal function and improvement of survival .
research shows that early blood glucose control can reduce the incidence of diabetic nephropathy .
hyperglycemic damage to mesangial cells is implicated in the development of diabetic nephropathy [ 5 , 6 ] .
one possibility is that high glucose levels induce excessive production of reactive oxygen species ( ros ) in mesangial cells , causing damage to these cells .
improvements in diabetes - induced renal dysfunction and/or diabetic nephropathy using antioxidants lend evidence to the role of ros in kidney damage .
but the effect of ros on changes of klotho expression in diabetic nephropathy is unknown . in present study we investigated changes in klotho expression in diabetic nephropathy using type 1-like diabetic rats showing diabetic nephropathy .
we examined the effect of insulin and floridzin on hyperglycemia in diabetic rats and we tested the effect of a famous antioxidant , referred to as tiron on renal , function , and expression of klotho in these kidneys .
the role of oxidative stress in change of klotho expression was further characterized in cultured madin - darby canine kidney ( mdck ) epithelial cells .
male wistar rats , aged 6 weeks , were obtained from the animal center of national cheng kung university medical college .
diabetic rats were induced by intravenously ( i.v . ) injecting streptozotocin ( 65 mg / kg ) ( sigma - aldrich inc .
animals were considered to be diabetic if they had elevated plasma glucose concentrations of 350 mg / dl .
then , these type 1-like diabetic rats , rerffered to as stz rats , were considered to show diabetic nephropathy if their blood urea nitrogen ( bun ) and creatinine values were elevated .
all animal procedures were performed according to the guide for the care and use of laboratory animals of the national institutes of health . for correction of hyperglycemia
, stz rats were injected intraperitoneally ( i.p . ) with long - lasting human insulin ( monotard hm . , denmark ; 1 iu / kg ) or phloridzin ( 1 mg / kg ; fluka chemie ag , switzerland ) , three times a day for 7 days as described previously [ 8 , 10 ] .
the age - matched rats were divided into four groups ( n = 6 ) : vehicle - treated normal rats , vehicle - treated stz rats , insulin - treated stz rats , and phloridzin - treated stz rats . in another experiment ,
rats prepared as the above were randomly divided into three groups ( n = 6 ) : vehicle - treated normal rats ; vehicle - treated stz rats , and tiron - treated ( i.p . at 300 mg / kg ; 3 times / day ) stz rats .
the levels of plasma glucose , bun , and creatinine , were measured in blood samples collected from the femoral vein of anesthetized rats ( pentobarbital , 30 mg / kg , i.p . ) one hour before treatment .
animals were sacrificed and kidneys were dissected , washed with saline , weighed for analysis , and frozen in liquid nitrogen to store at 80c for future analysis .
samples were then analyzed using glucose , bun , and creatinine kit reagents ( appliedbio assay kits ; hercules , ca , usa ) .
the levels of plasma glucose , bun , and serum creatinine were then estimated by an autoanalyzer ( quik - lab , usa ) run in duplicate .
protein expression levels of klotho in rat kidneys or mdck cells were determined by western blot analysis .
ripa buffer ( 25 mm trishcl ph 7.6 , 150 mm nacl , 1% np-40 , 1% sodium deoxycholate , 0.1% sds ) was used to extract total protein .
protein extracts were separated by sds - page , electrotransfered , and immobilized on a nitrocellulose membrane . the membrane was blocked with 5% nonfat milk in phosphate - buffered saline containing 0.1% tween 20 ( pbs - t ) and incubated for 2 hours .
the membrane was then washed in pbs - t and hybridized with primary antibodies , which were diluted to a suitable concentration in pbs - t for 16 hours .
specific antibodies purchased from abgent ( san diego , ca , usa ) for klotho ( 1 : 1000 ) were used .
incubation with secondary antibodies and detection of the antigen - antibody complex were performed using an ecl kit ( amersham biosciences , uk ) .
the kidney was removed from each rat , fixed in pbs containing 10% formaldehyde , and embedded in paraffin .
each sample was then cut into 5-m sections , the sections were mounted on glass slides and depleted of paraffin with xylene . then sections are subjected to standard hematoxylin / eosin staining .
the resultant pellet was then resuspended in 900 l of krebs buffer , containing 130 mm nacl , 5 mm kcl , 1 mm mgcl2 , 1.5 mm cacl2 , 1 mm k2hpo4 , and 20 mm hepes , ph 7.4 , with 1 mg / ml bovine serum albumin . to measure ros production ,
the suspension were transferred into a measuring chamber and assessed in a chemiluminescence analyzer ( tohoku electronic industrial co. , ltd .
measurement was induced by an injection of 100 l lucigenin ( final concentration , 4 10
60004 ) were obtained from the culture collection and research center of the food industry institute ( hsin - chiu city , taiwan ) , maintained in minimum essential medium ( gibco - brl , usa ) , and supplemented with 10% fetal bovine serum and antibiotics .
after cells reached approximately 60% confluence , they were incubated in serum - free medium with varying final concentrations of d - glucose ( 5.5 , 10 , 20 , 30 or 40 mm ) for 24 hours .
mdck cells exposed to 5.5 mm d - glucose was used as the comparison condition . to rule out an effect of osmolarity
we also treated mdck cells with tiron ( 10 mmol / l , 4,5-dihydroxyl-1,3-benzene disulfonic acid ; sigma - aldrich inc . , saint louis , mo , usa ) .
hydrogen peroxide ( h2o2 ) was diluted and added into the culture medium at final concentrations of 50 , 100 , and 150 mol / l . after 1 hour of h2o2 exposure , the culture medium was replaced with serum - free medium for another 23-hour culture period . for intracellular ros detection
after 24 hr of growth , cultures were placed in either control or high glucose ( hg ) medium , treated as described above for 24 hr and then harvested .
after fixation , cells were washed three times with pbs , and 5 mol / l of dihydroethidium ( dhe ; invitrogen ) was added as a fluorescent indicator of ros .
images were collected with an olympus ix70 fluorescence microscope fitted with an olympus america camera and magnafire 2.1 software .
statistical analysis was carried out using anova analysis and newman - keuls post - hoc analysis .
statistical significance was achieved if the p < .05 . results were expressed as mean se .
after 9 weeks of diabetes induction , the serum levels of glucose , bun , and creatinine in stz rats were markedly higher than in age - matched normal rats ( table 1 ) ; marked difference in bun and creatinine levels between the two groups were observed ( p < .05 ) .
he ( hematoxylin and eosin stain ) staining also showed structural defects of glomerosclerosis and tubular thickness in stz rats ( figure 1(b ) , black arrows ) .
after treatment with insulin or phloridzin for 7 days , the serum glucose was significantly reduced in stz rats ( table 1 ) .
bun and creatinine levels in insulin- or phloridzin - treated stz rats were also decreased ( table 1 ) .
these treatments ameliorated glomerosclerosis and improved tubular thickness , as observed by he staining ( figures 1(c)1(d ) , black arrows ) . after a 7-day treatment with the antioxidant tiron , the blood glucose level was not changed in stz rats , similar to that in stz rats receiving vehicle ( table 2 ) .
the lucigenin assay showed that superoxide levels in diabetic kidneys were markedly higher than normal kidneys ( control ) and these levels were significantly reduced by tiron ( figure 2(a ) ) .
the blood levels of bun and creatinine in tiron - treated stz rats were also improved ( table 2 ) .
additionally , expression levels of klotho were decreased in stz rats , and these levels could be restored in kidneys of diabetic rats treated with tiron ( figure 2(b ) ) . from he staining ,
rehabilitation of structural change was also observed in kidney receiving tiron treatment ( figure 1(e ) , black arrows ) .
changes in klotho expression in kidneys from stz rats were characterized using western blot analysis .
klotho expression in kidney of stz rats was markedly reduced as compared to control group ( figure 2(b ) ) .
insulin or phloridzin treatment reversed klotho expression in kidney of stz rats ( figure 2(b ) ) .
similar results were also observed in tiron - treated kidney ( figure 2(b ) ) .
effect of hyperglycemia on klotho expression levels was further characterized in cultured mdck cells exposed to various concentrations of glucose in vitro .
the klotho expression in mdck cells was reduced by high glucose in a concentration - dependent manner after 24-hr incubation ( figure 3 ) .
but the klotho expression levels were not changed in mannitol - treated mdck cells , indicating that the mediation of hyperosmolarity does not reduced klotho levels .
actually , decrease of klotho expression by high glucose in mdck cells is similar to that observed in diabetic kidneys ( figure 2(b ) ) . from the detection of dhe staining
, we also demonstrated that high glucose caused an increase in superoxide levels in mdck cells and that tiron reduced ros in glucose - treated mdck cells ( figure 4 ) .
ros are excessively produced in the pathogenesis of acute and chronic renal diseases . to understand the effect of ros on klotho expression , we treated mdck cells with hydrogen peroxide ( h2o2 ) directly and then we examined the changes of klotho expression using western blot analysis .
high glucose - induced ros is believed to be one of the main factors in the pathogenesis of diabetic nephropathy .
thus , we treated mdck cells in high glucose ( 40 mmol / l ; hg ) medium with and without 10 mmol of tiron , a superoxide anion scavenger .
the dhe fluorescence staining was applied to confirm the increase of ros in hg - treated mdck cells ( figure 2(b ) ) and mamnitol was used to exclude the role of hyperosmolarity . as shown in figure 5(b ) , the lowering of klotho protein in mdck cells by high glucose concentrations was markedly reversed by tiron treatment .
in the present study , we found that hyperglycemia caused poor renal function and lower expression of klotho protein in diabetic kidney , and these defects could be reversed by correction of blood glucose levels using insulin or phloridzin treatment in diabetic rats .
we used stz to induce type-1 like diabetes in rats according to previous report .
after 9 weeks , diabetic rats developed diabetic nephropathy showing typical features of this disorder , such as higher creatinine and bun levels in blood .
insulin and phloridzin have the ability to lower blood glucose levels in diabetic animals through different mechanisms ; insulin decreases blood glucose via receptor - coupled signaling and phloridzin acts as an inhibitor of renal tubular reabsorption of glucose . a 7-day correction of hyperglycemia with insulin or phloridzin - improved renal function in stz - induced diabetic rats .
these results support the view that blood glucose control can reduce the incidence of diabetic nephropathy .
it has been demonsted that klotho - overexpressed mice showed increased sod2 expression in muscles and low levels of phosphorylated forkhead box o proteins ( foxos ) , in addition to the reduced oxidative stress as evidenced by lower levels of urinary 8-ohdg , a marker of oxidative damages to dna . also , they survived normally lethal quantities of injected paraquat , a herbicide that generates reactive oxygen species ( ros ) , indicating that klotho overexpression induces resistance to oxidative stress .
klotho could activate foxos , induce sod2 expression , and confer resistance to oxidative damages and apoptosis induced by paraquat or hydrogen peroxide .
oxidative stress is involved in the pathogenesis of various diseases , including ischemia and inflammation .
renal klotho expression was significantly suppressed in the kidney subjected to experimental injury by h2o2 .
also , higher expression of klotho prevented ischemic renal damages and the development of acute renal failure [ 2 , 18 ] .
these observations suggest that klotho seems related to the induction of resistance to oxidative stress .
this view was consistent with our results both in kidney of stz rats and cultured renal tubular cells . in the present study ,
stz rats treated with tiron at doses sufficient to scavenge free radicals continuously for 7 days showed a recovery of renal function without the correction of blood glucose .
the decrease of klotho expression in kidney of stz rats was also reversed by tiron treatment with a marked reversion of structural defeats .
the important role of oxidative stress in damage of diabetic kidney can be considered . moreover ,
the reduced expression of klotho in cultured renal tubular cells caused by high glucose was also reversed by the antioxidant tiron .
thus , antioxidants could provide effective protection against the oxidative stress through klotho expression in diabetic nephropathy .
klotho plays a major role in the protection of kidney due to antioxidation [ 2 , 18 ] relating with ppar - gamma .
improvements in diabetes - induced renal dysfunction and diabetic nephropathy by antioxidants is evidence for an important role of ros in kidney damage .
it can be considered that decrease of klotho expression is related to the process of diabetic nephropathy .
otherwise , klotho has been introduced as a cofactor of fibroblast growth factor 23 ( fgf23)-induced phosphate excretion in kidney . according to our results ,
phosphate excretion was actually decreased in stz rats with a marked lower of klotho expression ( data not shown ) .
however , the role of fgf-23 in this change shall be studied in the future .
in the present study , klotho expression is decreased in the kidney of stz rats showed diabetic nephropathy .
this decreased klotho expression can be reversed by antioxidant without the correction of blood glucose .
thus , we suggest that antioxidants and/or agents can increase klotho expression may have the merit in the prevention of renal damage from oxidative stress produced in diabetic disorders .
Output:
| the klotho gene is expressed in a limited number of tissues , most notably in distal convoluted tubules in the kidney and choroid plexus in the brain .
a previous study suggested that klotho increases resistance to oxidative stress .
however , changes of klotho expression in high glucose - induced oxidative stress remain unclear . in the present study , we used streptozotocin - induced diabetic rats ( stz rats ) to examine the effects of insulin , phloridzin or antioxidant , tiron on diabetic nephropathy .
both insulin and phloridzin reversed the lower klotho expression levels in kidneys of stz rats by the correction of hyperglycemia .
also , renal functions were improved by these treatments .
in addition to the improvement of renal functions , the decrease of klotho expression in kidney of stz rats was also reversed by tiron without changing blood glucose levels .
the reduction of oxidative stress induced by high glucose can be considered for this action of tiron .
this view was further confirmed in vitro using high glucose - exposed madin - darby canine kidney ( mdck ) epithelial cells .
thus , we suggest that decrease of oxidative stress is not only responsible for the improvement of renal function but also for the recovery of klotho expression in kidney of stz rats . |
PubmedSumm118496 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: ranitidine , cimetidine , and famotidine are h2-antihistamines which are used quite often for the treatment of anaphylactic reactions . in the national study of us
emergency department visits for acute allergic reactions , h2-antihistamine prescriptions increased from 7% to 18% of visits from 1993 to 2004 .
h2-antihistamines , like h1-antihistamines , are inverse agonists , not competitive antagonists or blockers as originally thought .
they have a preferential affinity for the inactive state of h2-receptors , stabilize the receptors in this conformation , and consequently shift the equilibrium toward the inactive state .
when they administered concurrently , they decrease urticaria , flushing , headache , hypotension , and rhinorrhea . in patients with chronic urticaria , antihistamines suppress wheal and flare by 10 - 15% , but they do not relieve itching . in patients with mild acute allergic reactions , they enhance relief of urticaria and tachycardia but have no significant effect on itching or other symptoms . despite the above beneficial effects on anaphylactic symptomatology , cimetidine , famotidine , and ranitidine can themselves induce severe anaphylactic reactions and shock . in the very important report published in this journal ,
a 25-year - old primigravida with no past history of allergy was posted for the emergency cesarean section for oligohydramnios .
she was given , correctly , for anesthesia , lactated ringer solution , hyperbaric bupivacaine , oxytocin , midazolam , pethidine , methylergometrine and after 5 min 50 mg ranitidine hydrochloride intravenously .
however , she immediately developed an allergic reaction and she started complaining of itching , became restless , became flushed , and was coughing . despite administration of h1-antihistamine pheniramine maleate , hydrocortisone and deriphyllin ( etofylline and theophylline ) she developed anaphylactic shock .
the initiation of allergic inflammation takes place when allergens cross - bridge their corresponding , receptor - bound , immunoglobulin ( ig ) e antibodies on the mast cell or basophil cell surface .
these cells degranulate and release their mediators when the critical number of bridged ige antibodies reaches the order of 2000 out of maximal number of some 500 000 - 1000 000 ige antibodies on the cell surface .
however , recent findings indicate that mast cells can be activated by nonallergic triggers often without degranulation , but with selective release of potent and vasoactive compounds .
clinical studies indicate that allergic patients simultaneously exposed to several allergens have more symptoms than monosensitized individuals . on the contrary , ige antibodies with different specificities
can have additive effects and small , even subthreshold numbers of them can join forces and trigger the cells to release their mediators .
this data suggest that a possible sensitization should not be clinically evaluated as a consequence of exposure to a single drug but rather viewed in the context of potential sensitization to multiple drugs .
the described patient had received a total 10 different drugs in an effort to induce anesthesia and to treat the allergic reaction to ranitidine .
all these substances have been incriminated as inducing mild or severe allergic reactions , namely bupivacaine , hydrocortisone , methylergometrine , midazolam , oxytocin , pethidine , pheniramine , ranitidine , lactated ringer , and theophylline .
every anesthetized patient is under the risk of multiple drugs and substances that can induce anaphylactic reaction and kounis syndrome .
antibiotics , apronitin , blood transfusion , chlorhexidine , contrast media , colloids , dyes , h1-and h2-antihistamines , hypnotic agents , latex exposure , local anesthetics , neuromuscular blocking drugs , opioids , protamine , and several other specific agents depending on the kind and area of intervention are some of the offenders . while anaphylaxis can occur shortly after induction of anesthesia
the clinical features are involving mainly the cardiovascular system and especially the coronary arteries manifesting as kounis syndrome .
anaphylactic symptoms and signs are grated as grade i involving cutaneous - mucus signs , grade ii involving mild cutaneous - mucus signs that may be combined with cardiorespiratory signs , grade iii involving cutaneous - mucus signs and/or bronchospasm with cardiovascular collapse , and grade iv denoting cardiac arrest .
diagnosis of anaphylaxis during anesthesia can be achieved by measuring of histamine which has very short ( 8 - 10 min ) plasma half - life , tryptase which has intermediate half - plasma time ( 90 min ) , specific iges for thiopental , propofol , antibiotics , suxamethnium , quaternary ( choline analog ) , ammonium ( is thought to be the allergenic determinant in neuromuscular blocking drugs ) and for other given agents .
additionally , prick tests followed by intradermal tests can corroborate the diagnosis and identify the culprit cause of anaphylaxis and/or of kounis syndrome during anesthesia .
therefore , most cases of ranitidine - induced anaphylaxis are encountered during anesthesia . in the described case 50 mg of ranitidine
was given intravenously 5 min following lactated ringer solution , hyperbaric bupivacaine , oxytocin , midazolam , and pethidine .
did all these substances join forces and directly or via ige - induced mast cells degranulation ?
this syndrome was described 20 years ago as allergic angina and allergic myocardial syndrome , and is defined today as the concurrence of acute coronary syndromes with conditions associated with mast cell degranulation , involving interrelated and interacting inflammatory cells , and including allergic or hypersensitivity and anaphylactic or anaphylactoid insults .
it is caused by inflammatory mediators such as histamine , neutral proteases , arachidonic acid products , platelet activating factor , and a variety of cytokines and chemokines released during the activation process .
a subset of platelets bearing fcri , fcrii , fcri , and fcrii receptors are also involving in the activation cascade . today kounis syndrome is ubiquitous disease affecting patients of any age , involving numerous and continuously increasing causes , with broadening clinical manifestations and covering a wide spectrum of mast cell activation disorders . indeed ,
kounis - like syndromes have been described that affect the cerebral and mesenteric arteries and constitutes a manifestation of mast cell activation syndromes .
the most recent offenders are the scombroid syndrome which is called also histamine fish poisoning , the anisakis simplex which is a common parasite of fish which is able to sensitize humans via the alimentary tract , the gelofusine substance , latex exposure , the drug losartan and fish flesh contains the amino acid histidine and when fish is infected by gram negative bacteria that contain the enzyme histidine decarboxylase , then this enzyme converts histidine to histamine which induces kounis syndrome .
gelofusin is component of various vaccines for children and constitutes the main cause of sensitization to children .
it should be always remembered that exposure to such substances can occur through the kiss of death and the dog licking .
the kiss of death occurs when a person after consumption of shellfish or peanuts kisses passionately his or her friend who happens to be allergic to these substances .
furthermore a dog , who receives antibiotic such as penicillin for any infection , can be very dangerous when he licks his penicillin allergic master .
three variants of kounis syndrome have been described : type i variant which includes patients with normal or nearly normal coronary arteries without predisposing factors for coronary artery disease in whom the acute release of inflammatory mediators can induce either coronary artery spasm without increase of cardiac enzymes and troponins or coronary artery spasm progressing to acute myocardial infarction with raised cardiac enzymes and troponins .
type ii variant which includes patients with culprit but quiescent preexisting atheromatous disease in whom the acute release of inflammatory mediators can induce either coronary artery spasm with normal cardiac enzymes and troponins or coronary artery spasm together with plaque erosion or rupture manifesting as acute myocardial infarction .
type iii variant which includes patients with coronary artery stent thrombosis in whom aspirated thrombus specimens stained with hematoxylin - eosin and giemsa demonstrate the presence of eosinophils and mast cells , respectively .
the described patient developed anaphylactic shock with feeble peripheral pulses , tachycardia , and cardiovascular collapse .
although electrocardiogram was not given and troponins and cardiac enzymes were not described , a type i variant of kounis syndrome can not be excluded .
so far , it is generally believed that anaphylactic shock is the result of systemic vasodilation , reduced venous return , leakage of plasma , and volume loss due to increased vascular permeability ensuing to depression of cardiac output that contributes to coronary hypoperfusion with subsequent myocardial damage .
however , experimental and clinical studies indicate that the human heart can be the primary site and the target of anaphylaxis resulting in the development of kounis syndrome . in experimental anaphylaxis with ovalvumin sensitized guinea pigs
, it was shown that soon after antigen administration the left ventricular end , diastolic pressure rose significantly indicating pump failure and the arterial blood pressure rose also significantly , while the cardiac output decreased by 90% , the blood pressure started declining steadily after 4 min .
it was concluded that the rapid increase in left ventricular end diastolic pressure suggests that decreased venous return and volume loss due to an increase of vascular permeability are unlikely to be the primary causes of the documented depression of cardiac output and the view that the registered anaphylactic damage might be due to peripheral vasodilation can be definitely excluded . in the clinical setting , there are current reports according to which patients with anaphylactic cardiac shock do not respond to fluid replacement but recover with current acute myocardial infarction protocol and antiallergic treatment thus denoting that the heart is primarily affected .
furthermore , other recent experiments have shown that anaphylactic shock decreases cerebral blood flow more than what would be expected from severe arterial hypotension .
this was attributed to the early and direct action of anaphylactic mediators on cerebral vessels . indeed
, mast cell mediators such as histamine , chymase , and leukotrienes released locally and in the systemic circulation can induce cerebral artery spasm and platelet - activating factor can reduce cerebral blood flow leading to postischemic hypoperfusion .
therefore , cerebral ischemia and brain injury following anaphylactic shock could be due to direct action of anaphylactic mediators on the cerebral arterial system and not solely due to arterial hypotension .
apart from their adrenergic action , commercially available preparations of adrenaline usually contain as a preservative , sodium metabisulfite .
there are reports of hypersensitivity , anaphylaxis , and even death from kounis syndrome from sulfite administration .
anaphylactoid shock has been reported during epidural anesthesia for cesarean section , in which the responsible agent was metabisulfite , as additive agent of adrenaline - containing local anesthetic .
this situation poses a therapeutic dilemma in the sulfite - sensitized patients who suffer from anaphylactic shock .
although adrenaline is still the primary drug for anaphylaxis , avoidance of medications that contain metabisulfites as preservatives , including adrenaline , is suggested for patients with definite sensitization to sulfites . in this situation ,
a possible alternative is glucagon which has been used successfully for treatment of anaphylaxis in patients taking -blockers . today
, sulfite - free adrenaline is available ( american regent inc , usa ) for patients sensitive to sulfites .
fortunately , the described patient received repeated doses of adrenaline and had an excellent and quick recovery with uneventful course .
mother nature has given to us , on several occasions , natural paradigms of how to treat but also several paradoxes of how not to treat .
every physician should bring in mind that commonly used , generally safe drugs , may occasionally cause serious anaphylactic effects . such drugs may also join forces in order to do their adverse effect .
thus , careful patient history and consideration for drug side effects and allergy should be taken into account before use . the decision to prescribe a drug where
there is a history of previous adverse reactions requires careful assessment of the risks and potential benefits .
we all as physicians should always have in mind the aristotle 's ( 384 - 322 b.c . ) dictum : not many is the good , but in the good , the many ( ouk en t pollo to eu , but en to eu to poly= ) .
Output:
| kounis syndrome is a condition that combines allergic , hypersensitivity , anaphylactic or anaphylactoid reactions with acute coronary syndromes including vasospastic angina , acute myocardial infarction and stent thrombosis .
this syndrome is a ubiquitous disease affecting patients of any age , involving numerous and continuously increasing causes , with broadening clinical manifestations and covering a wide spectrum of mast cell activation disorders .
drugs , environmental exposures and various conditions are the main offenders .
clinical and therapeutic paradoxes concerning kounis syndrome therapy , pathophysiology , clinical course and causality have been encountered during its clinical course .
drugs that counteract allergy , such as h2-antihistamines , can induce allergy and kounis syndrome . the more drugs an atopic patient is exposed to , the easier and quicker anaphylaxis and kounis syndrome can occur .
every anesthetized patient is under the risk of multiple drugs and substances that can induce anaphylactic reaction and kounis syndrome .
the heart and the coronary arteries seem to be the primary target in severe anaphylaxis manifesting as kounis syndrome .
commercially available adrenaline saves lives in anaphylaxis but it contains as preservative sodium metabisulfite and should be avoided in the sulfite allergic patients .
thus , careful patient past history and consideration for drug side effects and allergy should be taken into account before use . the decision to prescribe a drug where
there is a history of previous adverse reactions requires careful assessment of the risks and potential benefits . |
PubmedSumm118497 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: staphylococcus aureus and streptococcus pneumoniae are two common colonizers of the upper respiratory tract that may cause severe invasive disease , .
s. aureus is the leading cause of skin and soft tissue infections affecting individuals in the community and hospitals and also a leading cause of neonatal sepsis and childhood pneumonia , .
s. pneumoniae is a frequent cause of pneumonia , meningitis and septicaemia . for both bacteria , asymptomatic colonization ( or carriage ) of the nasopharynx
s. aureus is found most frequently in the anterior nares but is also commonly found in the oropharynx and nasopharynx , on the skin and to a lesser extent in the gastrointestinal tract , perineum and axilla .
carriage of s. pneumoniae is most prevalent in children and older adults , while s. aureus shows a different age colonization pattern being highest among neonates , and then relatively constant in older age groups .
worldwide , approximately 20% to 30% of adults are nasal carriers of s. aureus
but there is wide variation in reports of s. aureus carriage rates among paediatric and surgical patient populations in sub - saharan africa , ranging from 14% in ghana to 47% in south africa .
the prevalence of s. aureus was highest among white men in one study which looked at healthy volunteer donors of different ethnic origins .
the introduction of pneumococcal conjugate vaccines ( pcvs ) alters the microbial flora in the nasopharynx of vaccinated individuals and their contacts .
although the overall prevalence of pneumococcal carriage has remained constant in most settings , there has been a substantial decrease of pneumococcal serotypes included in the vaccine , vaccine serotypes ( vt ) and an increase in other serotypes not included in the vaccine , nonvaccine serotypes ( nvt ) , .
one study found that s. aureus also increased after the introduction of pcvs , and several studies have reported an inverse association between asymptomatic carriage of s. pneumoniae and s. aureus
, , . in some instances
there are increasing concerns about a potential increase in s. aureus carriage and disease after the introduction of pcvs into africa . in the gambia
, the epidemiology of pneumococcal carriage , before and after pcv introduction , has been well described , . however
therefore , we used available data to study the epidemiology and risk factors for s. aureus nasopharyngeal carriage in a cohort of gambian infants before the introduction of pcv and evaluated the association with s. pneumoniae carriage .
infants were recruited as part of a large longitudinal carriage survey that was conducted in a rural area of western gambia between 17 december 2003 and 16 june 2005 .
we used samples and data from infants who were part of an ancillary study that assessed the association between routine vaccination and bacterial carriage .
all infants were vaccinated according to the gambia expanded program of immunization 's schedule which then offered bacillus calmette - gurin , oral polio , pentavalent ( diphtheria , pertussis , tetanus hepatitis b and haemophilus influenzae type b ) , measles and yellow fever vaccines .
nasopharyngeal swab samples were taken from infants as soon as possible after birth , every 2 weeks for the first 6 months and then every other month until their first birthday .
swabs were collected from the posterior wall of the nasopharynx using a calcium alginate swab and immediately placed in vials containing skim milk
vials were then transported within 8 hours of collection to the medical research council ( mrc ) unit the gambia , fajara , laboratories and stored at 70c .
samples were tested in batches for s. pneumoniae as part of the initial study . to isolate s. pneumoniae ,
10 l of a stgg sample were streaked onto a gentamicin blood agar plate and incubated for 18 to 24 hours at 35c in 5% co2 .
pneumococci were identified on the basis of colony morphology , optochin susceptibility and/or bile solubility .
serotyping was done with capsular and factor typing sera ( statens serum institute , copenhagen ) using the latex agglutination technique .
, the stgg samples were plated again onto agar plates for the isolation of s. aureus for the ancillary study . to isolate s. aureus , 50 l of thawed stgg sample were plated onto mannitol salt agar plates and incubated for 48 hours at 37c in ambient temperature .
the plates were examined for yellow or white colonies typical of staphylococci and subcultured onto blood agar plates to obtain pure growth .
all suspected colonies were tested with a catalase test , followed by coagulase testing when this was positive , using the remel staphaurex plus kit ( oxr30950201 ; oxoid ) to confirm the identity of s. aureus .
we analysed trends in the prevalence of s. aureus and s. pneumoniae carriage by splitting the sample into 10 groups of equal size , with the first group containing 10% of the samples taken at the youngest ages , the second group containing those taken at the next youngest 10% and so on .
we used logistic regression to model the association between s. aureus and s. pneumoniae carriage ( all serotypes , 13-valent pcv ( pcv13 ) vt and pcv13-nvt ) adjusted for season and age .
season was included in the model as a binary factor ( dry season from june to october and rainy season from november to may ) , and age was included as a restricted cubic spline .
other risk factors including sex , breast - feeding , upper respiratory tract infection ( urti ) and ear discharge at the time of swabbing , antibiotic use and travel out of the study area in the previous 2 weeks were also examined .
confidence intervals ( cis ) were adjusted for clustering at the village level using robust standard errors .
we conducted a secondary analysis using conditional logistic regression to estimate the association between s. aureus and s. pneumoniae carriage within individuals , thereby eliminating any confounding attributable to variation between individuals .
the cohort study was approved by the joint mrc gambia government ( gg ) ethics committee and by the ethics committee of the london school of hygiene and tropical medicine ; the subsequent study that collected additional vaccination data was also approved by the mrc gg ethics committee .
written consent was obtained from the parents or guardians of each infant recruited into the study .
a total of 237 infants were recruited into the original study . here , we included all infants from the previous ancillary study that had data on carriage of s. aureus and s. pneumoniae ( i.e. 57.6% of the original cohort ) ; an additional 11 infants were excluded from that study because their vaccination record was incomplete .
altogether , 147 infants were included in our analysis , providing a total of 1873 samples with median of 14 samples per infant ( range , 217 ) .
the median ages at which routine vaccines were given was 1.9 weeks ( interquartile range ( iqr ) 1.42.4 ) for bacillus calmette - gurin , 26.3 weeks ( iqr 22.733.3 ) for the third dose of the pentavalent vaccine , 43.1 weeks ( iqr 40.648.1 ) for measles vaccine and 44.0 weeks ( iqr 40.948.9 ) for yellow fever vaccine .
the majority of infants were breast - fed ; only on 7/1753 occasions was the infant not breast - feeding at the time of swabbing . of the 1873 samples ,
30.9% were positive for s. aureus , 82.0% positive for s. pneumoniae and 23.2% positive for both bacteria .
the 1535 s. pneumoniae positive samples yielded 1673 isolates with a total of 65 serotypes / groups . among all samples collected ,
51.2% were positive for pcv13-vt and 34.1% were positive for pcv13-nvt ( including 2.9% , n = 49 , nontypeable pneumococci ) .
prevalence of s. aureus was highest immediately after birth at 74.5% in the seven samples taken within the first 24 hours of life and decreased to 21.4% by 20 weeks of age .
prevalence of s. pneumoniae carriage , on the other hand , was low at birth , increased rapidly with age and reached a plateau after 10 weeks of age ( approximately 90% ) .
in infants older than 20 weeks , the prevalence of carriage of both bacteria remained constant until the end of the follow - up at 1 year of age ( fig . 1 ) .
the age pattern of pcv13-vt carriage was similar to that for overall pneumococcal carriage , but the peak was observed in older infants at approximately 40 weeks of age .
for pcv13-nvt , the peak of 51% carriage occurred very early ( 89 weeks of age ) , and carriage subsequently decreased to about 25% after 34 weeks ( fig . 1 ) .
a crude analysis showed an inverse association between carriage of s. aureus and s. pneumoniae ( inverse association with any pneumococcal carriage and pcv13-vt carriage ) and also with age ( table 1 ) .
after adjusting for age and season , s. aureus was positively associated with carriage of any s. pneumoniae ( odds ratio ( or ) 1.32 ; 95% ci 1.071.64 ; p 0.009 ) but was no longer associated with carriage of pcv13-vt ( or 0.99 ; 95% ci 0.701.41 ; p 0.973 ) . in an analysis using conditional regression , the statistical significance of the increased risk of any s. pneumoniae colonization among s. aureus carriers after adjusting for age and season was borderline ( adjusted or 1.41 ; 95% ci 0.992.03 ; p 0.059 ) . apart from urti , which was negatively associated with carriage
, none of the other risk factors tested in the adjusted analysis was associated with carriage of s. aureus ( table 1 ) .
in this study , we demonstrated that the inverse association between s. aureus and s. pneumoniae nasopharyngeal carriage among gambian infants before the introduction of pcv is explained by the difference in age pattern of carriage during the first year of life , and we found that the confounding effect of age masked a potential positive association between s. aureus and s. pneumoniae .
several studies have shown an inverse association between s. aureus and s. pneumoniae in africa and other regions , including studies by bogaert et al . in dutch children aged 1 to 19 years , and madhi et al .
one of them did adjust for age . in a randomized controlled trial in the netherlands which recruited children aged 1 to 7 years with recurrent otitis media ,
s. aureus carriage was higher in children who received pneumococcal vaccines compared to placebo .
. found an inverse association that persisted after adjustment for age among children younger than 40 months old ( median , 1.3 years ) in israel .
there are differences between the latter study and ours in that 80% of the children in the regev - yochay et al .
we also swabbed the children more frequently and included age as a continuous variable in our analysis . in another gambian study ,
an inverse association between overall pneumococcal carriage and s. aureus carriage also disappeared in the adjusted analysis .
a positive association between s. aureus and s. pneumoniae has not previously been reported , although shiri et al . noted increased s. pneumoniae colonization among individuals with dual carriage of h. influenzae and s. aureus .
a possible explanation for this association is that susceptibility to carriage varies within individuals over time , and this variation affects the risk of acquiring both s. aureus and s. pneumoniae .
the positive association is not attributable to variation between individuals in susceptibility to carriage because the association was also observed in the within - individual analysis .
our study showed a very high prevalence of s. aureus nasopharyngeal carriage among gambian infants , as previously reported in another setting in the country .
approximately 70% of newborns carried s. aureus ; the prevalence decreased to 20% between 10 and 20 weeks of life . a rapid drop in prevalence during this first year of life has been reported previously , although possibly later in infancy , as shown among pcv - unvaccinated infants .
carriage trend for vt pneumococci , but not nvt pneumococci , was similar to the trend for any pneumococcal carriage .
found an inverse association between s. aureus and vt pneumococci was stronger than that between s. aureus and nvt pneumococci .
besides being positively associated with s. pneumoniae , we found that carriage of s. aureus was negatively associated with urti .
the reason for this association is unclear , but it might be due to competitive interaction with other bacteria and possibly viruses which we did not explore .
carriage of s. aureus was not associated with breast - feeding , season or antibiotic use .
the absence of an association with breast - feeding is consistent with the findings of a large cohort study . on the other hand ,
the absence of an association with antibiotic use is not consistent with previous studies which have shown that recent antibiotic use lowers s. aureus carriage , but it is unsurprising because antibiotics were rarely used among infants in our study .
seasonality of s. aureus carriage has not been documented , although the prevalence of s. pneumoniae carriage in children increases during the dry season .
other factors including crowding and socioeconomic status may also be important predictors of bacterial carriage , but these data were not collected in the original study . s. aureus is primarily carried in the anterior nares ; therefore , carriage of s. aureus might have been more frequently detected if nasal or oral swabs had been used in addition to nasopharyngeal swabs . in a recent study of gambian infants ,
s. aureus was isolated from 65% of oropharyngeal swabs , but only 36% of nasopharyngeal swabs .
however , we would not expect this to alter the direction of the association between s. aureus and s. pneumoniae .
have shown that other respiratory pathogens remain viable when cultured from original swabs stored in stgg at 70c for up to 12 years .
s. aureus , though not one of the bacteria in their study , is a very robust organism and there is no reason to believe it would behave differently . in assessing the relationship between s. aureus and s. pneumoniae , age should be considered as an important confounder , at least among infants . after controlling for the effect of age ,
our study found a positive association between these two pathogens in the nasopharynx of infants , which suggests that s. aureus will not increase in prevalence after the introduction of pcv .
however , further surveys of bacterial carriage after introduction of pcvs in the gambia are required to confirm this prediction .
Output:
| staphylococcus aureus and streptococcus pneumoniae commonly colonize the upper respiratory tract and can cause invasive disease .
several studies suggest an inverse relationship between these two bacteria in the nasopharynx .
this association is of particular concern as the introduction of pneumococcal conjugate vaccines ( pcvs ) that affect pneumococcal nasopharyngeal carriage become widespread .
a cohort of children in rural gambia were recruited at birth and followed for 1 year , before the introduction of pcv into the routine immunization program .
nasopharyngeal swabs were taken immediately after birth , every 2 weeks for the first 6 months and then every other month .
the presence of s. aureus and s. pneumoniae was determined using conventional microbiologic methods .
prevalence of s. aureus carriage was 71.6% at birth , decreasing with age to reach a plateau at approximately 20% between 10 to 20 weeks of age .
carriage with any s. pneumoniae increased during the first 10 weeks of life to peak at approximately 90% , mostly of pcv13 serotypes .
although in the crude analysis s. aureus carriage was inversely associated with carriage of any s. pneumoniae and pcv13 serotypes , after adjusting by age and season , there was a positive association with any carriage ( odds ratio 1.32 ; 95% confidence interval 1.071.64 ; p 0.009 ) and no association with carriage of pcv13 serotypes ( odds ratio 0.99 ; 95% confidence interval 0.701.41 ; p 0.973 ) . among gambian infants , s. aureus and s. pneumoniae
are not inversely associated in nasopharyngeal carriage after adjustment for age .
further carriage studies following the introduction of pcv are needed to better understand the relationship between the two bacteria . |
PubmedSumm118498 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: twenty years ago ( 1992 ) , a landmark institute of medicine ( iom ) report entitled emerging infections : microbial threats to health in the united states underscored the important but often underappreciated concept of emerging infectious diseases ( eids ) ( 1 ) .
although the iom report was influential in thrusting the issue of eids squarely into scientific and public discourse , the awareness that diseases periodically emerge and reemerge actually goes back millennia ( 2 , 3 ) .
for example , ancient greek , roman , and persian writers documented the emergence of many new epidemics . during and after the 14th - century black death
pandemic of bubonic / pneumonic plague , european city officials quarantined arriving ships to prevent its importation and set up quarantine stations to isolate and care for patients . in 1685
, the scientist robert boyle presciently observed that there are ever new forms of epidemic diseases appearing among [ them ] the emergent variety of exotick and hurtful ( 4 , 5 ) . by the mid-19th century , the discovery of microbes as causative agents of infectious diseases led to the development of preventive countermeasures such as passive immunotherapy , vaccines , and drugs against infective agents ( 6 ) .
these advances spurred optimistic predictions that infections would soon be conquered ( 7 ) , and physicians and public health workers began to lose sight of the possibility of the emergence of new and previously unrecognized infectious diseases .
to a large extent , it was the shock of the recognition of hiv / aids in the early 1980s , followed by the iom report of 1992 , that rekindled awareness of , and interest in , eids .
two decades after the iom report , it is appropriate to ask what has been learned about eids , where have we succeeded or failed in our efforts to fight them , and what challenges remain .
as predicted in 1992 ( 1 ) , previously unrecognized infectious diseases have continued to emerge , including variable creutzfeldt - jakob disease / bovine spongiform encephalopathy ( vcjd / bse ) , severe acute respiratory syndrome ( sars ) , and 2009 pandemic h1n1 influenza , and others have reemerged , e.g. , disease caused by multiple - drug - resistant staphylococcus aureus ( mrsa ) , multiple - drug - resistant and extensively drug - resistant ( mdr and xdr ) tuberculosis , cholera , and dengue .
the recent eid with the greatest global impact has been hiv / aids . over the past 3 decades , humankind has witnessed the unexpected emergence of , and then the relentless devastation resulting from , one of history s deadliest pandemics ( 8) . at the same time
, modern research tools have helped us to understand how , where , and when hiv emerged ; to understand its pathogenesis and natural history ; and to develop life - saving treatment and prevention modalities that have put the control of the hiv / aids pandemic within reach .
surely , future generations will look back on the era of hiv / aids as one of the most remarkable periods in the history of human disease , in which civilization was challenged by a devastating pandemic eid and aggressively addressed it from a scientific and global health standpoint , leading to the real possibility of effective control in a relatively timely manner .
the term eid and the concepts of newly emerging and reemerging infectious diseases have recently become much more widely appreciated .
the 1992 iom report led to rapid and heightened awareness of this issue in the scientific , public health , medical , and lay communities .
for example , both the united states centers for disease control and prevention ( cdc ) and the national institute of allergy and infectious diseases of the national institutes of health released eid research and response plans ( 9 , 10 ) . in 1995 , the cdc established an eid - oriented scientific journal , emerging infectious diseases . now in its 18th year , the journal has published nearly 10,000 articles and has become standard reading for many in the disciplines of microbiology , clinical infectious diseases , public health , and allied medical fields .
other microbiology and general medical journals emphasizing eids have been established , e.g. , plos pathogens , or expanded their coverage of eids , e.g. , the journal of infectious diseases and vaccine , while mbio and other journals published by the american society for microbiology ( asm ) have remained leaders in publishing important eid - related research .
for example , promed was launched in 1994 as a grass roots effort by the federation of american scientists and has been continued by the international society for infectious diseases . today
, promed s 60,000-plus subscribers from 185 countries can read openly , online , and in real time about virtually all important eids occurring anywhere in the world .
this creates immediate awareness of epidemics not only for scientists but also for the public and the media .
promed has made it extremely difficult for cautious governments to suppress outbreak information and has greatly enhanced the capacity of public health systems to control infectious disease outbreaks ( 11 ) .
cdc has expanded the mmwr ( morbidity and mortality weekly report ) , which is now abstracted in medical journals such as the journal of the american medical association , so that every week practitioners around the world can get the latest information about eids .
it has become clear that the five or six eids emerging annually ( on average ) over the past 8 decades have disproportionately emerged from perturbed ecological niches , especially those in tropical areas with vector - borne enzootic diseases ( 12 , 13 ) .
since 1992 , high - throughput genetics techniques have led to the sequencing of thousands of microorganisms , their vectors , and many of their hosts .
genomics and proteomics have helped in the discovery of new infectious diseases and in acquiring a better understanding of the pathogenesis of existing ones ; have substantially improved surveillance , diagnosis , and drug and vaccine design ; and promise to help elucidate host susceptibility factors and host responses to treatment of infections . for example , by 2003 , the genomes of the human species , the mosquito anopheles gambiae , and the malaria parasite plasmodium falciparum all had been sequenced , representing the first time that all the major actors in the drama of an important emerging / reemerging infectious disease had been characterized at the molecular genetic level ( 12 , 14 ) .
these breakthroughs are important additions to our continuing efforts to control malaria , which have had recent successes but still require new countermeasures .
these genomic data are contributing to vaccine and drug development and are elucidating the pathogenesis of and human resistance and susceptibility to malaria ( 14 ) .
genomics techniques , like pcr and high - throughput deep and whole - genome sequencing , that now greatly facilitate the discovery of eids ( e.g. , the etiologic agents of hantavirus pulmonary syndrome and kaposi sarcoma ) also reveal previously unimagined genomic diversity among microbes .
this diversity includes complex and evolving viral quasispecies and microbes that have undergone considerable interbacterial horizontal gene transfer , creating new phenotypic properties of virulence and drug resistance .
given these and other advances in science and technology , it is now possible to perceive , as dawkins argued decades ago ( 15 ) , that the evolution and natural selection of human diseases are not simply a struggle between microbes and hosts .
rather , it is fought out at a more basic level of gene - to - gene competition , pitting the genomes of microbes against those of their hosts ( many of whose genomes contain genetic evidence of past microbial encounters ) .
dawkins contended that the visible evidence of genomic survival is an organism s expressed phenotype , its survival machine , which is akin to a simple virus being protected by its external protein coat ; however , dawkins proposed that we should think of natural selection as operating at the level of the gene , not the organism it encodes .
specifically , our gut flora represents a complex external organ system comprising at least three different enterotypes that have coevolved with us over millennia and appear to affect our health , including by preventing and modifying infection ( 16 , 17 ) . indeed , fecal transplantation is now a novel treatment for clostridium difficile colitis ( a potentially fatal eid ) ( 18 ) .
infants who start life with or develop reduced flora ( e.g. , via pre- or postnatal antibiotics ) may be at increased risk of ids and eids .
variations in the microbiome may also affect the occurrence of certain chronic diseases , allergies , and malnutrition ( 19 ) . in this newer view
, humans are not just static victims of virulent microbes but hubs of gene flow in which pathogens not only seek to survive environmental barriers and natural and acquired immunity but also compete with other microbes on the playing field that we think of as us .
additional conceptual advances in eids include the realization that many chronic diseases have a direct or indirect infectious basis , e.g. , cervical , hepatic , and gastric cancers ; gastroduodenal ulcers ; hemolytic - uremic syndrome ; and possibly some types of tics and obsessive - compulsive disorders ( 6 , 12 ) .
we also have become aware of the critical role of microbial coinfections in the pathogenesis of certain infectious diseases ( e.g. , hiv and numerous opportunistic infections ; influenza and measles in association with secondary bacterial pneumonias ) and of nutrition , e.g. , the link between vitamin a and measles ( 20 , 21 ) .
the one - health concept , which emphasizes understanding and studying the unity of human and animal infectious diseases ( 22 ) , reflects growing awareness that the majority of human eids , probably more than 60 per cent ( 11 ) , are of animal origin ( zoonotic ) , a realization that has implications not only for disease surveillance but also for understanding pathogenesis and controlling disease .
for example , hiv / aids , influenza , lyme disease , tuberculosis , measles , plague , smallpox , and possibly even leprosy are directly or primarily of animal origin .
viral host switching , in some cases associated with rapid and complicated microbial comutations ( 23 ) , has become an important research topic ( 23 , 24 ) for both newer eids , such as sars , and reemerging ones , such as influenza .
the processes by which animal - adapted microorganisms leave their hosts and adapt to new species , such as humans , are largely unknown and represent an important challenge in the study of eids . moreover , host - switching is not just a one - way street from other animals to humans .
for example , ebola virus , a devastating disease for humans , has decimated african gorilla populations ; in the united states , suburban expansion associated with deforestation has driven raccoons into the suburbs , increasing rabies transmission to and from them ; and a human strain of staphylococcus aureus has adapted to chickens , spread globally , and developed new mutations enhancing avian virulence ( 25 , 26 ) .
these examples remind us that ecosystem dynamism in which humans play a critical role is a key variable in eid occurrence and prevention ( 6 , 12 ) .
since 1992 , enormous strides have also been made in understanding the history of eids , most notably by genetic sequencing of historically preserved microbial dna and rna .
perhaps the most significant example is the 1918 pandemic influenza virus , which caused the deadliest single disease event in recorded human history ( 27 ) . although that pandemic occurred 15 years before influenza viruses were first identified , recent sequencing efforts from rna in preserved tissues allowed full reconstruction of the 1918 pandemic viral genome , leading to a remarkable body of ongoing research and a greater understanding of how influenza viruses continue to emerge among humans and other animal species ( 27 , 28 ) . of the several thousand microorganisms already
sequenced , those of historical importance include smallpox virus strains , the plague bacillus ( yersinia pestis ) ( 29 ) , and ancient tuberculosis organisms .
strikingly , paleovirus oncogenes have even been resurrected and studied in infectivity assays to find the original cellular receptors to which they had become adapted millions of years ago ( 30 ) .
both traditional historical research and study of phylogenetic trees derived from gene sequencing of modern organisms have added significantly to these efforts , leading , for example , to the discovery that the initial jump of what became known as hiv from nonhuman primates to humans probably occurred nearly a century ago with multiple independent host - switching events that ultimately led to the pandemic that was first recognized in 1981 ( 31 ) .
understanding the history and evolution of emerging microbes allows us to predict more accurately what their potential pandemic impact will be , and to understand how we can best prevent and control them .
it is now becoming accepted that disease eradication has a legitimate place in the armamentarium of responses to eids ( 6 ) .
smallpox , a devastating reemerging disease for millennia , was eradicated in 1980 , and the epizootic morbillivirus ( measles - related ) disease rinderpest was eradicated in 2011 ( 32 , 33 ) . with dracunculiasis and polio disease close to eradication , with measles on the path to eradication , and with significant strides in controlling such diseases as hepatitis b and even malaria and
hiv infection being made , it is now possible to realistically consider eradication as an ultimate means of controlling certain eids . even though antibiotic resistance has accelerated alarmingly , new generations of antibiotics have kept pace ( albeit , barely ) , and vaccines against some of the most important diseases have been developed or improved , such as those against haemophilus influenzae type b , pneumococci , and cancer - causing human papillomavirus strains .
the development of antivirals and antiviral combination therapies has led to a historic breakthrough in helping to control hiv / aids ( 12 ) and major strides in curing chronic hepatitis c virus infection .
future directions in research and drug development likely will include better antibacterial and antiviral combination therapies as well as the development and use of more narrow - spectrum drugs against infective agents , which are less likely to cause polymicrobial resistance . in the 20 years since the iom report on eids ,
hiv infection was considered a death sentence for most patients . in 2012 , after the tragedy of more than 35 million aids deaths , persons treated early with combination antiretroviral therapy , although not cured of their viral infection , can expect to live normal life spans with only a low risk of transmitting infection to others . in 1992 , at least a million children died annually of measles . in 2012 ,
fewer than 100,000 are expected to die , and measles eradication based upon an already - available effective vaccine is a realistic near - term goal . in 1992 , it was possible to enter villages in many developing countries to monitor poliovirus circulation by conducting childhood lameness surveys . in 2012 , most lame individuals are adults whose children are largely free of the threat of polio and probably will live to see it eradicated ( poliovirus type 2 has already been extinguished ) . despite extraordinary progress during the past 2 decades , infectious diseases still kill 15 million people each year ( 6 ) , and new and deadly diseases continue to emerge and reemerge .
the perpetual nature of the emergence of infectious diseases poses a continuing challenge , which is volatile and ever - changing .
this challenge includes a need for constant surveillance and prompt , efficient diagnosis ; a need to develop and deploy new vaccines and drugs to combat new diseases ; and a need for ongoing research not only in developing countermeasures but also in understanding the basic biology of new organisms and our susceptibilities to them .
the future is ever uncertain , because unimagined new diseases surely lie in wait , ready to emerge unexpectedly ; however , our ability to detect and identify them , our armamentarium of treatment and prevention options , our capacity to undertake and maintain basic and applied research , and our commitment to eradicating certain eids have never been greater .
we have made far - reaching advances in the past 20 years since the original iom report , and scientists are guardedly optimistic that further breakthroughs lie ahead .
Output:
| abstracttwenty years ago ( 1992 ) , a landmark institute of medicine report entitled emerging infections : microbial threats to health in the united states underscored the important but often underappreciated concept of emerging infectious diseases ( eids ) .
a review of the progress made and setbacks experienced over the past 2 decades suggests that even though many new diseases have emerged , such as sars ( severe acute respiratory syndrome ) and the 2009 pandemic influenza , significant advances have occurred in eid control , prevention , and treatment . among many elements of the increase in the capacity to control eids
are genomics - associated advances in microbial detection and treatment , improved disease surveillance , and greater awareness of eids and the complicated variables that underlie emergence . in looking back over the past 20 years ,
it is apparent that we are in a time of great change in which both the challenge of eids and our responses to them are being transformed .
recent advances support guarded optimism that further breakthroughs lie ahead . |
PubmedSumm118499 | ***TASK***
the task is to summarize an input biomedical literature in six sentences
***INPUT***
the input is a biomedical literature
***OUTPUT***
the output is the summary of an input biomedical literature in six sentences
***DOCUMENTATION***
***EXAMPLES***
Input: in this commentary , i present information and encourage further inquiry and dialogue regarding the separate but related concepts of sociocultural roles and sociocultural authority of chiropractic .
perhaps most importantly , i suggest that our fundamental underlying assumptions about the notion of sociocultural authority may warrant careful studied consideration . rather than conceive superficially
that sociocultural authority is solely a macro - level collective characteristic attributed to an entire profession , it may be more helpful and accurate to consider the concept of sociocultural authority as being multidimensional and multilevel .
sociocultural authority and sociocultural roles are neither predetermined nor static , but include dynamic micro - level processes of malleable factors such as shifting perceptions and evolving relationships between individuals , as well as macro - level interactions between collective entities .
recent scholarly attention focuses laudably on better understanding and appreciating the full diversity of chiropractic patients and their biological , psychological , and sociocultural needs and circumstances .
we need to stay mindful that successful development of a comprehensive biopsychosocial approach toward actualizing the full potential for chiropractic health care provision and integrative health care delivery should explicitly recognize the priority and value of individual preferences and choice in matters of health and health care .
i borrow loosely from the academic traditions of sociology and anthropology to provide a general orienting framework for the following discussion . from the general perspective of structural functionalism in sociology
, the chiropractor - patient relationship can be viewed as an interaction between autonomous individuals while explicitly recognizing the importance of contextual factors such as physical or social constraints that may also influence the actions of the individuals and the interactions between them .
roles for each of the participants in such interactions , as their respective expectations become more entrenched or institutionalized over time .
roles are malleable , that is , autonomous individuals in new interactions with changing situations may adapt through processes such as role bargaining , thereby establishing new roles and new norms that may , in turn , initiate or guide further action .
roles and collectivities of roles ( ie , roles that complement each other in fulfilling functions for society ) can be considered
structural in the sense that they may manifest as institutions or social structures , such as social arrangements with proscribed economic or legal parameters .
that is , individuals and collective entities may develop new values that legitimate a greater range of activities as a new social order , thereby creating new functional alternatives to the institutions and structures currently fulfilling the functions of society .
sociocultural anthropology , drawing from the combined historical traditions of cultural anthropology 's focus on symbols and values and social anthropology 's focus on social groups and institutions , generally promotes the idea of cultural relativism
( ie , the view that one can only understand another person 's beliefs and behaviors in the context of the culture in which he or she lived or lives ) . emerging anthropological methods such as multisited ethnography introduce interdisciplinary approaches to fieldwork by incorporating methods from cultural studies , media studies , science and technology studies , and others .
tracking subjects across spatial and temporal boundaries , such research combines a focus on the local with an effort to grasp larger political , economic , and cultural frameworks that impact local lived realities in order to gain greater insights by examining the impact of higher - order
systems on local communities , specific populations , or individuals . such qualitative , encompassing , exploratory approaches have obvious potential utility for illuminating complex , multidimensional , multilevel notions such as dynamic sociocultural roles of chiropractors or the evolving sociocultural authority of the chiropractic profession .
sociocultural roles are multidimensional , even within a presumably narrow context such as health care provision . for instance
, the disciplinary roles of most health care professionals are typically developed in disciplinary isolation during their pregraduate education and training , such that nurses in nursing school are educated separately from medical physicians in medical school . without adequate preparation , new clinical practitioners
may transition to the workplace unprepared for collaboration at a time when chronic illnesses require the concerted effort of coordinated , fully cooperative health care teams .
innovations such as interdisciplinary clinical training programs encourage clinical trainees to explore the terrain of adapting their singular disciplinary roles to fit the actual exigencies of clinical practice ; for example , their clinical roles .
in other words , disciplinary roles and clinical roles are 2 distinct , though related , concepts .
the necessary transition and negotiation between singular disciplinary role and interdisciplinary clinical role may require a substantial commitment , willingness , and ability to explore issues of role if potential clinical collaborations are to be effective , mutually satisfying , and actualized .
disciplinary roles may be considered structural in the sense that they are largely shaped during standardized credentialing processes , such as disciplinary - specific education in accredited health professions institutions that prepare and qualify the individual to meet proscribed legal requirements to obtain professional licensure and relicensure ( initial clinical competency testing , and continuing education ) .
clinical roles , however , are functional , and as form follows function , so too may new clinical roles both shape , and be shaped by , the specific environment in which the clinician practices .
that is , mutual acculturation , or role bargaining , of all parties can occur , be they clinicians from different disciplines , clinical staff or administrators , or patients . the social ecology or context in which contemporary chiropractors practice varies greatly , and that variation is growing ever greater over time . the historical norm of solo practice for chiropractors becomes ever less typical , as newly graduating chiropractors increasingly seek out group or multidisciplinary practices , and as the increasing integration of chiropractic into new clinical domains opens new opportunities for chiropractors to practice in interdisciplinary clinical practice environments , such as in veterans administration ( va ) or other health delivery systems .
it is reasonable to posit that singular factors such as patient attributes ( eg , values , preferences ) , provider attributes ( eg , additional clinical expertise beyond their basic disciplinary training ) , and higher - order relational factors such as those that may manifest within a patient - provider relationship ( eg , trust ) may also vary as the social ecology or context surrounding that relationship varies .
for example , the nature of patient - provider relationships within a context of enclosed health care systems such as va or closed - panel managed care arrangements may differ markedly from those that occur within differing contexts such as open insurance plans or self - pay arrangements .
such a broad range of unknown potential factors are perhaps most appropriately and comprehensively explored using both qualitative and quantitative approaches , at varying levels of analyses from macro - level to micro - level .
quantitatively , units of analysis operationalized as variables describing ecological context as well as both collective and individual attributes might be best measured along a continuum to better capture and measure the distribution of variation and to better ascertain potential sources of that variation .
useful conceptual frameworks for theoretically grounding such inquiry may be found in multilevel , multidimensional sociological study of the behavior of collectivities .
for instance , it is useful to examine collectivities with multidimensional aspects , such as health care delivery organizations , as rational , natural , and open systems . as rational systems
, collectivities are oriented to the pursuit of specific goals and exhibit highly formalized social structures .
as natural systems , the participants share a common interest in the survival of the collective system and thereby engage in informally structured collective activities to secure that end .
as open systems , coalitions of shifting interest groups develop goals by negotiation , and the structure , activities , and outcomes of the coalition are strongly influenced by factors external to the coalition ( ie , its environment ) .
the nature of any interpersonal relationship may be characterized along a number of dimensions , such as the level of familiarity , trust , or mutual respect , reflected within that relationship .
the characteristics of a relationship , in turn , may also be contingent on certain specific attributes of the individuals in that relationship , in this case attributes of the individual patient and the individual health care provider .
important dimensions of sociocultural roles , then , may also vary along a dynamic and complex set of singular factors such as patient attributes ( eg , individual patient expectations about their health or patient preferences about their health care options ) , provider attributes ( eg , the health care expertise or cultural competence of a particular chiropractor ) , and higher - order relational factors such as those that may manifest within a patient - provider relationship ( eg , trust , respect ) . far from being static and constant , doctor of chiropractic and patient factors are more likely to be malleable and dynamic , with significant potential for change , particularly over the course of a sustained long - term chiropractor - patient relationship .
for instance , a companion report in this journal describes evidence of noteworthy variation in how individual chiropractors perceive their professional identity as being akin to that of a specialist or as a generalist in their chiropractic clinical practice ; with some indication as well that the perceptions of chiropractors or their chiropractic patients may change over time .
chiropractors believed that their established patients , more so than their new patients , were likely to view the chiropractor as both specialist and generalist , suggesting that the nature of certain chiropractor - patient relationships may evolve profoundly over time , as patients transition from new to established patients within the chiropractic practice . the sociocultural authority embedded within sociocultural roles , then
, may also evolve profoundly over time , perhaps as a function of shifting patient expectations or preferences . or , patient - specific factors , provider - specific factors , or higher - order relational factors may change or evolve over time , for other reasons altogether . as mentioned in an earlier study
, local health care system conditions may differ by locale and therefore introduce variation in the nature of the sociocultural authority experienced by doctors of chiropractic ( dcs ) practicing in different areas .
for instance , chiropractic patients in medically underserved areas may be more likely to use the chiropractor as a first point of contact with the health care system or chiropractic patients in rural areas may be more likely to seek care for nonmusculoskeletal health problems from their chiropractor .
similarly , the nature of the cultural / social congruence between dcs and their respective patient or market populations may also differ somewhat by locale , for instance rural versus urban , introducing another potential source of variation in the range of sociocultural roles and sociocultural authority experienced by individual chiropractors .
the notion of trust is closely intertwined with notions of sociocultural authority and professional legitimacy on a number of levels , ranging from the immediate intimacy of the individual patient - provider relationship to that of macro - level interactions between collective entities .
interestingly , these multiple perspectives do not always fully align , nor do they necessarily need to align .
for instance , an extensive review of point - in - time data from multiple cross - sectional public opinion surveys found that even though many americans may not trust the medical profession as a whole , they do trust their own medical doctor .
similarly , a separate analysis of time - series survey data from gallup , harris , and national opinion research corporation ( norc ) polls documented a waning of public confidence in many american social institutions over the past 30 years , and a particularly noteworthy decline wherein . .
american medicine went from being perhaps the most trusted to being one of the least trusted social institutions . . .
. both the american general public ( fig 1 ) and policymakers , or policy elites
( fig 2 ) , evidenced this loss of faith and now question the presumed authority of the medical profession to advise on matters of health policy , but for different reasons .
historically , the authority of the professions has been legitimized by a sociocultural presumption that professionals are motivated by an altruistic orientation and value neutrality and therefore will subordinate their own self - interest and normative judgments to act as trusted agents on behalf of their clients . though both the general public and policymakers now explicitly question this historic implicit presumption that physicians can always and fully be entrusted to serve as reliable agents , they apparently do so on different grounds .
policymakers express concerns that physicians who exhibit an unwillingness to care for the poor are failing in their roles as societal agents , that health policy should be less influenced by medical doctors ( mds ) , and that matters of health care are primarily a societal and individual responsibility .
chief concerns expressed by the general public are that the needs of patients are being subordinated to cost - containment , and that mds have become too monetarily motivated or too self - interested in the health care system .
compared with policymakers , the general public also expresses a much higher level of support for the importance of individual choice in health care decisions .
the focus of policymakers , then , is on aspects of social trust such as the presumptive responsibilities of health professions to society ( ie , the collectivities of sociocultural roles and authority ) .
the typical individual of the general public , however , opines the importance of personal trust in the more immediate patient - physician relationships and in legitimizing the individual sociocultural role and authority of physicians ( ie , the presumption that the physician should , first and foremost , serve to protect the interests of their patients and to also promote the role of the patient to share in the responsibility for both clinical and fiscal decisions in their health care ) . at this early stage of socioanthropological inquiry
, it would be premature conjecture , and an inaccurate oversimplification , to presume that any profession in entirety may be labeled as either possessing , or not possessing , cultural authority along a given dimension .
rather , as illustrated by the few examples above , the multilevel multidimensional complexity of sociocultural roles , sociocultural authority , and professional legitimacy is evident .
equally complex is the conceptualization and measurement of patient trust of health care providers , health care professions , health insurers , and health care systems .
it is important to appreciate the centrality of patient trust to this line of scientific inquiry and to the continuing open dialogue on this topic within the chiropractic profession .
we know from empirical data that patients who have their choice of physician and who have a longer relationship with the physician are more likely to trust their physician .
the trust of patients in their physicians is one of the strongest predictors of patient satisfaction with their care , and patients who trust their physicians are more likely to adhere to recommendations for their treatment . further inquiry examining the nature of sustained long - term chiropractor - patient relationships may also inform , and be informed by , the increasingly important scientific evidence base on patient trust .
this commentary offers the speculative premise that sociocultural roles and sociocultural authority of chiropractic health care providers are more truly conceived not solely as a static , dichotomous , macro - level , collective attribute of an entire profession , but rather as malleable and dynamic , multidimensional , and multilevel . also requisite to gaining
a better understanding of sociocultural roles and sociocultural authority of the chiropractic profession is a fuller appreciation for the duality of impulses toward heterogeneity and homogeneity .
the impulse toward homogeneity can be witnessed in collective actions such as standardization of disciplinary structures and processes , such as the rational pursuit of specific goals for the profession ( top - down , inside - out ) .
the history of evolution also teaches us the inherent advantages of heterogeneity , recognizing that a profession also exists as a
natural and open collectivity , hopefully capable of flexible and nimble response to environmental challenges as they arise ( bottom - up , outside - in ) .
Output:
| objectivethis commentary discusses the evolving sociocultural roles and sociocultural authority of chiropractic.discussionthe complex interconnectivity of the biological , psychological , and social aspects of our individual and collective well - being has occupied centuries of nature versus nurture philosophical debate , creative art , and scientific work .
what has emerged is a better understanding of how our human development is affected by the circumstances of what we are born with ( ie , nature ) and how we are shaped by the circumstances that we are born into ( ie , nurture).conclusionin the new millennium , a cumulative challenge to the emerging integrative biopsychosocial health care disciplines is one of reconciling circumstance versus choice ; that is , advancing individually and collectively the fullest actualization of human potential through the philosophy , art , and science of autonomy and empowerment . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.