text
stringlengths 0
1.67M
|
|---|
1. A method of determining the risk of developing obesity in an individual, comprising determining a paternal insulin variable number of tandem repeats (VNTR) allele in the individual by determining the identity of a polymorphic base of at least one marker in linkage disequilibrium with the insulin VNTR of the individual, wherein the presence of a paternal insulin VNTR class I allele indicates that the individual has an approximately two-fold increase in risk of developing obesity compared to an individual carrying a paternal insulin VNTR class III allele. 2. A method of treating obesity in an individual, comprising administering a weight loss or a weight control regimen in an individual identified by a method according to claim 1 as being at risk of developing obesity, thereby treating obesity in the individual. 3. A method of reducing the risk that an individual will develop an obesity-related disorder, comprising administering a weight loss or a weight control regimen in an individual identified by a method according to claim 1 as being at risk of developing obesity, thereby reducing the risk that the individual will develop an obesity-related disorder. 4. The method of claim 1, wherein the marker is −23 HphI. 5. The method of claim 2, wherein the marker is −23 HphI. 6. The method of claim 3, wherein the marker is −23 HphI. |
<SOH> BACKGROUND OF THE INVENTION <EOH>For reasons that remain largely obscure, obesity is rapidly increasing in preschool children (1). Accumulation of excess fat in the first years of life is due to metabolic and hormonal events affecting the differentiation, proliferation and storage of lipids by adipocytes. Insulin is a potent regulator of fat accretion and neutral glyceride synthesis from glucose in early postnatal life (2). Sequence variations within the regulatory regions of the insulin gene (INS) have recently been shown to influence insulin secretion in children (3). Specifically, a polymorphic minisatellite located in the 5′ region of INS influences the expression of both INS and the nearby insulin like growth factor 2 (IGF2) genes (4,5). During fetal life, genomic imprinting affects these two genes in humans, with restricted expression to the paternal allele. Paternal and maternal variable number of tandem repeats (VNTR)-INS-IGF2 haplotypes, therefore, do not have comparable roles during this period of life (6). Caucasian INS VNTR alleles can be subdivided into two main length groups: class I (26-63 repeats) and class III (141-209 repeats). Class I alleles are associated with increased expression of INS in the fetal pancreas (7,8) and of IGF2 gene in the placenta (9). Several studies, in different control and diabetic populations, have shown departures from Mendelian parent-child transmission probabilities at this locus. In several Caucasian populations, Eaves et al found evidence for slight, but significant excess transmission of the class I allele from I/III heterozygous parents to healthy children (10). This transmission distortion was not specific to a particular parental gender, showing no evidence for parent-of-origin effects on excess transmission. However, two studies have shown parent-of-origin-dependent transmission distortion of VNTR alleles to children with Type 1 (T1D) or Type 2 diabetes (T2D). Bennett et al found an excess transmission of class I alleles from fathers to patients with autoimmune T1D (11). In contrast, Huxtable et al recently reported an excess transmission of class III alleles from fathers to T2D patients (12). This is a particularly interesting observation given that homozygous III/III individuals are known to have an increased risk of developing T2D (11). Obesity and diabetes are among the most common human health problems in industrialized societies. In industrialized countries a third of the population is at least 20% overweight. In the United States, the percentage of obese people has increased from 25% at the end of the 70s, to 33% at the beginning of the 90's. Obesity is one of the most important risk factors for NIDDM. Definitions of obesity differ, but in general, a subject weighing at least 20% more than the recommended weight for his or her height and build is considered obese. The risk of developing NIDDM is tripled in subjects 30% overweight, and three-quarters of people with NIDDM are overweight. Obesity, which is the result of an imbalance between caloric intake and energy expenditure, is highly correlated with insulin resistance and diabetes in experimental animals and humans. However, the molecular mechanisms that are involved in obesity-diabetes syndromes are not clear. During early development of obesity, increased insulin secretion balances insulin resistance and protects patients from hyperglycemia (Le Stunff, et al., Diabetes. 43, 696-702 (1994)). However, after several decades, β cell function deteriorates and non-insulin-dependent diabetes develops in about 20% of the obese population (Pedersen, P. Diab. Metab. Rev. 5, 505-509 (1989)) and (Brancati, F. L., et al., Arch Intern Med. 159, 957-963 (1999)). Given its high prevalence in modern societies, obesity has thus become the leading risk factor for NIDDM (Hill, J. O., et al., Science. 280, 1371-1374 (1998)). However, the factors which predispose a fraction of patients to alterations of insulin secretion in response to fat accumulation remain unknown. Obesity considerably increases the risk of developing cardiovascular diseases as well. Coronary insufficiency, atheromatous disease, and cardiac insufficiency are at the forefront of the cardiovascular complications induced by obesity. It is estimated that if the entire population had an ideal weight, the risk of coronary insufficiency would decrease by 25%, and the risk of cardiac insufficiency and of cerebral vascular accidents by 35%. The incidence of coronary diseases is doubled in subjects under 50 years who are 30% overweight. The diabetic patient faces a 30% reduced lifespan. After age 45, people with diabetes are about three times more likely than people without diabetes to have significant heart disease and up to five times more likely to have a stroke. These findings emphasize the inter-relations between risks factors for NIDDM and coronary heart disease and the potential value of an integrated approach to the prevention of these conditions based on the prevention of obesity (Perry, I. J. et al. BMJ. 310, 560-564 (1995)). Despite advances in detecting mutations and genes associated with obesity, obesity continues to exert adverse effects on human health. Literature Bundred et al. (2001) Brit Med. J. 322, 313-314; Taniguchi et al. (1986) J. Lip. Res. 27, 925-929; Le Stunff et al. (2000) Nat Genet. 26, 444-446; Kennedy et al. (1995) Nat Genet. 9,293-298; Paquette et al. (1998) J. Biol. Chem. 273, 14158-64; Reik et al. (2001) Nat. Rev. 2, 21-32; Vafiadis et al. (1996) J. Autoimmun. 9,397-403; Bennett et al. (1996) J. Autoimmun. 9, 415-421; Paquette et al. (1998) J. Biol. Chem. 273:14158-14164; Eaves et al. (1999) Nat. Genet. 22,324-5; Bennett and Todd (1996) Annu. Rev. Genet. 30, 343-370; Huxtable et al. (2000) Diabetes 49, 126-130. |
<SOH> SUMMARY OF THE INVENTION <EOH>The invention features methods for determining the risk of development of obesity by determining the insulin VNTR allele of the individual, particularly the paternal insulin VNTR allele. In related aspects, the invention features methods to facilitate rational therapy and maintenance of individuals predisposed to become obese. Features of the Invention The invention features a method of determining the risk of developing obesity in an individual. The method generally involves determining a paternal insulin VNTR allele in the individual. The presence of a paternal insulin VNTR class I allele indicates that the individual has an approximately two-fold increase in risk of developing obesity compared to an individual carrying a paternal insulin VNTR class III allele. Any method can be used to genotype the insulin VNTR in the individual, and thereby to determine the paternal insulin VNTR allele. In some embodiments, the determination is made by determining the identity of a polymorphic base of at least one marker in linkage disequilibrium with the insulin VNTR of the individual. In particular embodiments, the marker is −23 HphI. The invention further features a method of treating obesity and related disorders in an individual. The method generally involves administering a weight loss or a weight control regimen in an individual identified by a method according to the invention as being at risk of developing obesity, thereby treating obesity in the individual. In some embodiments, a weight control regimen is selected from the group consisting of food restriction, increased calorie use, gastrointestinal surgery, medicinal approaches and reduced absorption of dietary lipids. The invention further features a method of reducing the risk that an individual will develop an obesity-related disorder. The method generally involves administering a weight loss or a weight control regimen in an individual identified by a method according to the invention as being at risk of developing obesity, thereby reducing the risk that the individual will develop an obesity-related disorder. |
Fluid collecting device |
An adjustable fluid collecting device with two shells pivotally movable relative to each other wherein the fluid collecting device is movable between an open position in which the shells are distanced from each other and a closed position in which the shells touch, an actuator and a lever assembly wherein the operation of the actuator results in equal but opposite movement of the shells and the mechanical advantage increases as the shells move toward the closed position. A rigid frame which substantially surrounds the two shells, actuator and lever assembly is provided. Optionally, the apparatus can be equipped with an integral pipe spinner. |
1. An apparatus for collecting fluid from a drill string comprising, first (1) and second (2) shells pivotably coupled to each other and designed and arranged to move from an open position around the circumference of a pipe (11) of a predetermined diameter to a closed position where said first shell (1) is sealingly mated with said second shell, and an actuator (6), pivotably coupled to said first (1) and second (2) shells and designed and arranged to move said first and second shells to said closed position such that a force measured at said actuator required to move said first and second shells to said closed position decreases as said first and second shells move toward said closed position. 2. The apparatus of claim 1 wherein, a bellcrank (12) is coupled between said actuator (6) and said first shell (1). 3. The apparatus of claim 2 wherein, said bellcrank (12) has a fulcrum pivotably coupled to said first shell (1) with a first end of the bellcrank (12) coupled to said second shell (2) and a second end of the bellcrank (12) coupled to said actuator (6). 4. The apparatus of claim 3 further comprising, a linkage (13) having a first end pivotably coupled to said first end of said bellcrank (12) and a second end pivotably coupled to said second shell (2). 5. The apparatus of claim 4 further comprising, a frame (20) with said first and second shells (101, 102) pivotably mounted to said frame. 6. The apparatus of claim 5 wherein, said actuator (106) has a first end pivotably coupled to said frame (20) and a second end, and said bellcrank (112) has a fulcrum pivotably coupled to said frame (20), with a first end of the bellcrank (112) coupled to said first shell and second shells (101, 102) and a second end of said bellcrank (112) is coupled to said second end of said actuator (106). 7. The apparatus of claim 6 further comprising, a tie rod (25) having a first tie rod end pivotably coupled to said first shell (101) and a second tie rod end coupled to said second shell (102), said first end of said tie rod (25) coupled to said first end of said bell crank (112). 8. The apparatus of claim 7 further comprising, a first lever (24) having first and second ends, said first end of said first lever (24) pivotably coupled to said first shell (101), said second end of said first lever (24) pivotably coupled to said first end of said tie rod (25) and said first end of said bellcrank (112), a second lever (29) having first and second ends, said first end of said second lever (29) pivotably coupled to said second shell (102), said second end of said second lever (29) pivotably coupled to said second end of said tie rod (25), and a third lever (28) having first and second ends, said first end of said third lever (28) pivotably coupled to said frame (20), said second end of said third lever (28) pivotably coupled to said second end of said tie rod (25) and said second end of said second lever (29). 9. The apparatus of claim 5 further comprising, a pipe spinner moveably coupled to said frame (20). 10. The apparatus of claim 1 wherein, bottom half members (9, 10) are attached to said first and second shells. 11. An apparatus for collecting fluid from a drill string comprising, first and second shells, said first shell designed and arranged to be moved from an open position to a closed position with the first and second shells sealingly mating with each other around the circumference of a pipe of a predetermined diameter, an actuator assembly coupled to said first shell and said second shell and designed and arranged to move said first shell and said second shell from said open position to said closed position, said actuator assembly characterized by a mechanical advantage which increases as said first shell and said second shell approach said closed position. 12. An apparatus for collecting fluid from a drill string comprising, first and second shells (101, 102) pivotably coupled to each other and designed and arranged to move from an open position around the circumference of a pipe (111) of a predetermined diameter to a closed position where said first shell is sealingly mated with said second shell, and an actuator (106), with a bellcrank (11) coupled between said actuator (106) and said first shell (101) and pivotal coupling to said second shell and designed and arranged to move said first and second shells from said open position to said closed position and vice versa. 13. The apparatus of claim 12 further comprising, a frame (20), with said first and second shells (101, 102) being pivotably mounted to said frame. 14. The apparatus of claim 13 wherein, said actuator (106) includes a cylinder and an actuator rod with said cylinder pivotably coupled to said frame (20), and said bellcrank (112) has a fulcrum pivotably coupled to said frame (20) with a first end of the bellcrank (112) coupled to said first shell and second shell (101, 102) and a second end of said bellcrank (112) coupled to said actuator rod. 15. The apparatus of claim 14 further comprising, a tie rod (25) having a first tie rod end (25) pivotably coupled to said first shell (101) and a second tie rod end (25) coupled to said second shell (102), said first tie rod end (25) coupled to said first end of said bell crank (112). 16. The apparatus of claim 15 further comprising, a first lever (24) having first and second ends, said first end of said first lever (24) pivotably coupled to said first shell (101), said second end of said first lever (24) pivotably coupled to said first end of said tie rod (25) and said first end of said bellcrank (112), a second lever (29) having first and second ends, said first end of said second lever (29) pivotably coupled to said second shell (102), said second end of said second lever (29) pivotably coupled to said second end of said tie rod (25), and a third lever (28) having first and second ends, said first end of said third lever (28) pivotably coupled to said frame (20), said second end of said third lever (28) pivotably coupled to said second end of said tie rod (25) and said second end of said second lever (29). 17. The apparatus of claim 12 wherein, bottom half members (109, 110) are respectively attached to said first and second shells (101, 102), and compliant gaskets are coupled to said first and second shells (101, 102) such that in said closed position, said compliant gaskets are sealingly disposed between said first and second shells (101, 102). 18. The apparatus of claim 12 wherein, said first and second shells (101, 102) are semi-cylindrically shaped and have longitudinal axes disposed parallel to a longitudinal axis of said pipe (111). 19. An apparatus for collecting fluid from and disconnecting a drill string comprising, a frame (120), first and second shells (201, 202) with respective bottom half members, with the first and second shells pivotably coupled to each other and designed and arranged to move from an open position around a joint (42, 43) coupling an upper pipe (40) of a predetermined diameter to a lower pipe (41) of said predetermined diameter to a closed position where said first shell (201) is mated with said second shell (202) and said first and second shells (201, 202) to substantially form a bucket around said joint (42, 43), said first and second shells coupled to said frame (120), and a spinner (47) coupled to said frame (120) and disposed longitudinally above said first and second shells, said spinner (47) designed and arranged for rotating said upper pipe (40) with respect to said lower pipe (41). 20. The apparatus of claim 19 further comprising, at least one actuator assembly designed and arranged for moving said first and second shells from said open position to said closed position and vice versa. 21. The apparatus of claim 19 further comprising, a connection (46) fluidly coupled to said first shell (201) and designed and arranged for attachment to a hose. 22. The apparatus of claim 19 further comprising, a compliant gasket (45) coupled to said first and second shells (201, 202) designed and arranged to seal said first and second shells (201, 202) with respect to each other when said first and second shells (201, 202) are in said closed position. 23. The apparatus of claim 19 wherein said spinner (47) comprises, first and second rollers (48, 49) moveably and rotatably coupled to said frame (120) and designed and arranged to rotatively engage said upper pipe (40). |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention The invention relates generally to a fluid collecting device for use when disconnecting pipes and in particular to a mud bucket for use in the oil production industry. As is well known, borehole drilling is generally carried out by means of a drill bit at the end of a string of hollow sections of pipe which are joined by tapered threaded connections. The connections are sufficiently strong to transmit the linear, torsional and bending forces involved in drilling and also provide a mechanical seal to prevent leakage of the drilling mud which is pumped down the drill string to lubricate the bit, balance hydrostatic pressure in the rock formation, and carry the cuttings back to the surface. Drilling mud can contain a variety of chemicals, and for cost, environmental and safety reasons it is desirable that spillage of mud in the drilling rig should be kept to a minimum. Drill pipes are generally connected together in approximately 27-meter long “stands” consisting of three 9-meter lengths. Depending on its internal diameter, each stand can contain a considerable amount of mud. For example, the internal volume of 27 meters of pipe with a mean internal diameter of 63.5 mm is 85.5 liters. When withdrawing the drill string from a hole, a large proportion of the mud can remain in the drill pipes and would escape when each stand was disconnected unless measures where taken to prevent this from happening. A device commonly used to contain leakage is referred to as a mud bucket and basically consists of shells which are clamped around the drill pipe connection when it has been sufficiently loosened that further rotation requires relatively little torque, but significant leakage has not occurred. A hose is led from the mud bucket to a holding tank to enable the mud collected in the mud bucket to be returned to the holding tank. A mud bucket can be deployed either by suspension from a wire connected to a hoist, or can be automatically moved into position by mechanical arms and other robotic devices. The shells of a mud bucket are fitted with elastomeric seals to provide a leakage-free fit at the joints with each other and the drill pipe. The shells of the mud bucket may be clamped or closed around the drill pipe manually or by hydraulic or pneumatic actuators. Regardless of the clamping method employed, the shell closing mechanism must be capable of resisting the large force resulting from the pressure exerted by the mud column on the shells. Each meter of mud in the column equates to a pressure of about 0.1 bar when the specific gravity is 1.0. The force on each half of the shell is equal to the projected area multiplied by the total pressure. For example, if the internal diameter of the shells is 300 mm, the height 1.5 meters and the mud column 10 meters, the force on the shells is about 44,000 newtons or 4.4 metric tons. 2. Description of the Prior Art GB 2300659 describes a mud bucket comprising a can which is longitudinally split into two sections. Each section is provided with a seal along the split, and the two sections are hinged together at a common pivot point. Each section is further connected to an actuator which moves the mud bucket between an open and closed position. However, in the mud bucket described in GB 23003659, the perpendicular distance between the actuator and the common pivot point between the two sections decreases as the device closes, so that the leverage available to the actuator to close the mud bucket is decreased in the very time at which it is desirable for it to be increased. This means that larger actuators have to be used, or some subsidiary mechanical or hydraulic locking mechanism employed to prevent leakage caused by the internal mud pressure. All drill pipes are joined together using male and female threads cut into larger diameter sections (or tool joints) at each end. The threads are then tightened up to a very high torque to withstand the linear, torsional and bending forces involved in drilling. When drill pipe is removed from the bore hole, it is customary to loosen the high torque of the tool joints with two tongs, which can be either manually or hydraulically operated, so that further rotation requires relatively little torque. At this stage little or no mud is leaking from the tool joints, and the mud bucket is clamped around the drill pipe tool joints. Once the mud bucket is installed, a separate hydraulic or pneumatic pipe spinner (or spinning wrench) is used to revolve the upper pipe stand for a number of full turns, and therefore complete the loosening of threads of the tool joints. The spinner rotates the upper drill pipe stand by means of motor driven rollers or chains, while the lower drill pipe is prevented from rotating by the tapered slips used to hold it in position. The upper stand in than lifted up a few centimeters to allow the drilling mud to drain into the mud bucket and through the drain hose to a holding tank. On manual drilling rigs the pipe spinner is swung into location on the pipe above the mud bucket on a hanging wire attached to a winch by personnel who often have to climb onto the mud bucket to complete the operation. This can be dangerous for personnel if the mud bucket is positioned at an awkward height above the drill floor. On automatic and semi-automatic drilling rigs it is customary to use a hydraulically powered and positioned device called an iron roughneck that employs a pair of tongs and a pipe spinner, one of whose functions is to provide the loosening and spinning functions described above. Newer models of this device are fitted with an integral mud bucket that can be clamped around the tool joints prior to the final loosening of the tool joints with the device's integral pipe spinner. Older models of this device are not fitted with a mud bucket, and it is not possible for a separate mud bucket to be deployed during the spinning function. This results in significant mud loss onto the drill floor before the separate mud bucket can be deployed. U.S. Pat. No. 4,643,259 describes a hydraulic drill string breakdown and bleed-off unit which includes a hydraulic drill string disassembly apparatus in combination with a pressure chamber for bleeding off trapped pressure in the drill pipes and a further apparatus for collecting drilling mud from the drill pipes. The unit described in U.S. Pat. No. 4,643,259 employs two tongs for loosening the torque of the tool joints of the drill pipes and is large, heavy, slow, cumbersome and expensive to manufacture. 3. Identification of Objects of the Invention An object of the invention is to overcome the problems of the prior art by providing a fluid collecting device designed and arranged such that the mechanical advantage of the closing actuator increases as the bucket moves from an open to a closed position. Another object of the invention is to provide a fluid collection device having an actuator attached to a rigid frame. Another object of the invention is to provide a fluid collection device housed within a supporting framework to provide operator safety. Another object of the invention is to provide a fluid collection device in combination with a pipe spinner, housed within a common framework. |
<SOH> SUMMARY OF THE INVENTION <EOH>According to the invention there is provided an adjustable fluid collecting device comprising two shells pivotally movable relative to each other wherein the fluid collecting device is movable between an open position in which the shells are distanced from each other and a closed position in which the shells touch and the angle between the lever member and the link member is reduced relative to the angle between the same members when the adjustable fluid collecting device is in its open position. Preferably, the adjustable fluid collecting device includes two shells pivotally movable relative to each other and a lever member operated by an actuator. The lever member is pivotally connected to a link member which is pivotally connected to at least one of the shells. The lever member is pivotally movable relative to at least one of the shells. In a second aspect of the invention, an adjustable fluid collecting device includes two shells pivotally movable relative to each other and a lever member operated by an actuator. The lever member is pivotally connected to first and second linking members. The first linking member is pivotally connected to one of the shells. The second linking member is pivotally connected to the other shell so that operation of the actuator results in equal but opposite movement of the shells. Preferably, the actuator is attached to a rigid frame which substantially surrounds the two shells, actuator and lever assembly. The rigid frame includes bracketing members to which the two shells are pivotally mounted. Desirably, the second linking member is pivotally connected to the second shell by way of a third linking member, and the second linking member is further pivotally connected to the bracketing member by way of a fourth linking member. Preferably, the lever member is also pivotably connectable to the bracketing member. Desirably, the lever member is a bellcrank. Preferably, the adjustable fluid collecting device is used for collecting mud during the disconnection of pipes. In a third aspect of the invention, a fluid collecting device includes a mud bucket housed within a supporting framework. In a fourth aspect of the invention, a pipe disconnecting assembly arranged and designed to engage with a plurality of connected pipes includes a rotating means and a fluid collecting device, housed within a single framework, wherein the fluid collecting device is clampable to the connected pipes so that it surrounds the junction therebetween and the rotating means is movable to engage with at least one of the connected pipes so that rotation of the rotating means causes the disconnection of at least one connected pipes, and the fluid collecting device collects any fluid which leaks out of the opened junction between the pipes. |
Mixed electrolyte battery |
A battery (100B) comprises an electrolyte in which a first element forms a redox pair with a second element, wherein the battery (100B) is charged at a voltage sufficient to plate the first element at the anode (122B) and wherein the voltage is insufficient to plate the second element on the anode (122B). Preferred batteries include secondary batteries comprising a mixed electrolyte that includes a redox pair formed by a first element and a second element. |
1. A battery comprising an electrolyte that contacts an anode and includes a redox pair formed by a first element and a second element, wherein the battery is charged at a voltage sufficient to plate the first element at the anode, wherein the voltage is insufficient to plate the second element on the anode, and wherein reduction of the second element and oxidation of the first element provides a current of the battery. 2. The battery of claim 1 wherein the electrolyte is an acid electrolyte. 3. The battery of claim 2 wherein the acid electrolyte comprises an organic acid 4. The battery of claim 3 wherein the organic acid is selected from the group consisting of methane sulfonic acid and trifluoromethane sulfonic acid. 5. The battery of claim 1 wherein the first element is zinc or titanium 6. The battery of claim 1 wherein the second element is a lanthanide 7. The battery of claim 6 the lanthanide is selected from the group consisting of cerium, praseodymium, neodymium, terbium, and dysprosium. 8. The battery of claim 1 wherein the first element is zinc and the second element is cerium. 9. The battery of claim 1 further comprising a cell with a separator that separates the cell into an anode compartment and a cathode compartment, wherein the anode compartment comprises an anolyte that includes the first element, and wherein the cathode compartment that comprises a catholyte that includes the second element. 10. The battery of claim 9 wherein the anode compartment comprises at least 5 vol % catholyte. 11. The battery of claim 9 wherein the anode compartment comprises at least 10 vol % catholyte. 12. The battery of claim 9 wherein the electrolyte further comprises indium. 13. The battery of claim 1 wherein the redox pair provides an open circuit voltage of at least 2 3 Volt per cell. 14. The battery of claim 1 wherein the electrolyte is a gelled electrolyte 15. A secondary battery comprising a mixed electrolyte that includes a redox pair formed by a first element and a second element, and wherein reduction of the second element and oxidation of the first element provides a current of the battery. 16. The battery of claim 15 wherein the mixed electrolyte comprises an organic acid 17. The battery of claim 16 wherein the first element comprises zinc 18. The battery of claim 16 wherein the second element comprises a lanthanide 19. The battery of claim 18 wherein the lanthanide comprises cerium 20. The battery of claim 16 wherein the mixed electrolyte comprises a zinc ion and a cerium ion, and wherein the zinc and cerium ions are complexed by methane sulfonic acid anions, respectively. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Many types of batteries and other power cells are known, based upon a relatively wide range of electrical couples, and among the most popular electrical couples are those containing zinc. For example, zinc is frequently employed in primary batteries. Such batteries are typically found in many simple flashlight batteries to provide a relatively inexpensive and reliable power source. Although manufacture of Zn/C batteries is typically simple and poses only relatively little environmental impact, various disadvantages of Zn/C batteries exist. Among other things, the ratio of power to weight in commonly used Zn/C batteries is relatively poor. To improve the power to weight ratio, alternative coupling partners for zinc may be utilized. Among other metal oxides, mercury oxide or silver oxide have been employed to manufacture primary batteries with significantly improved power to weight ratio. However, the toxicity of mercury oxide is frequently problematic in manufacture, and tends to become even more problematic when such batteries are discarded. On the other hand, silver oxide as a coupling partner for zinc is environmentally substantially neutral. However, silver oxide is in many instances economically prohibitive, especially where such batteries are used in everyday devices (e.g., portable CD player or radio). Alternatively, zinc air battery systems may be employed in applications where a favorable ratio of weight to capacity is particularly important. In such zinc air batteries, atmospheric oxygen is used as a gaseous coupling partner for zinc, which is typically provided in form of gelled zinc powder anodes. Among the various advantages in such batteries, using air (i.e., oxygen) as coupling partner for zinc significantly reduces weight. However, reasonable shelf life of such batteries can often only be achieved by using an airtight seal. Furthermore, to provide continuous operation, air must have an unobstructed path through the battery to the cathode so that the oxygen in the air is available to discharge the cathode. Moreover, commercial applications of zinc-air batteries have previously been limited to primary or non-rechargeable types. Thus, while zinc may be combined with various redox partner to provide at least a somewhat advantageous power to weight ratio, many of those redox couples limit use of such batteries to primary, non-rechargeable batteries. Consequently, considerable effort has been made to form a redox pair in which zinc can be used in a secondary, rechargeable battery. For example, zinc may form a redox pair with nickel to provide a rechargeable redox system. While many rechargeable zinc/nickel batteries frequently exhibit a relatively good power to weight ratio, several problems of the zinc/nickel redox pair persist. Among other difficulties, such batteries tend to have a comparably poor cycle life of the zinc electrode. Moreover, nickel is known to be a carcinogen in water-soluble form, and is thus problematic in production and disposal. To circumvent at least some of the problems with toxicity, zinc may be combined with silver oxide to form a secondary battery. Rechargeable zinc/silver batteries often have a relatively high energy and power density. Moreover, such batteries typically operate efficiently at extremely high discharge rates and generally have a relatively long dry shelf life. However, the comparably high cost of the silver electrode generally limits the use of zinc/silver batteries to applications where high energy density is a prime requisite. In a further, relatively common secondary battery, zinc is replaced by cadmium and forms a redox couple with nickel. Such nickel/cadmium batteries are typically inexpensive to manufacture, exhibit a relatively good power to weight ratio, and require no further maintenance other than recharging. However, cadmium is a known toxic element, and thereby further increases the problems associated with health and environmental hazards. Thus, despite the relatively widespread use of secondary batteries, numerous problems persist. Among other things, all or almost all of the known secondary batteries can only be continuously operated under conditions in which the cathode compartment is separated from the anode compartment by a separator. Loss of the separation (e.g., due to puncture of the membrane by dendrites forming during recharge) will typically result in undesired plating of one or more components of the electrolyte on the battery electrode and thereby dramatically decrease the performance of such batteries. Although numerous secondary batteries are known in the art, all or almost all of them suffer from one or more disadvantages. Particularly, the performance of known secondary batteries will significantly decrease when anolyte and catholyte of such batteries will inadvertently mix. Therefore, there is still a need to provide improved batteries. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention is directed to a battery comprising an electrolyte that contacts the anode and includes a redox pair formed by a first element and a second element, wherein the battery is charged at a voltage sufficient to plate the first element at the anode, and wherein the voltage is insufficient to plate the second element on the anode when the second element is present at the anode. Especially contemplated batteries are secondary batteries that comprise a mixed electrolyte. Especially preferred redox pairs provide an open circuit voltage of at least 2.3 Volt per cell. In one aspect of the inventive subject matter, contemplated electrolytes are acid electrolytes, and it is particularly preferred that such electrolytes comprise an organic acid (e.g., methane sulfonic acid, trifluoromethane sulfonic acid) or inorganic acid (e.g., perchloric acid, nitric acid, hydrochloric acid, or sulfuric acid), wherein the anion of the acid forms a complex (e.g., salt) with at least one of the first and second element. In further contemplated aspects, suitable electrolytes may also be gelled. In another aspect of the inventive subject matter, contemplated first elements particularly include zinc and/or titanium, while preferred second elements include lanthanides (e.g., cerium, praseodymium, neodymium, terbium, or dysprosium). In a further aspect of the inventive subject matter, contemplated batteries may include a separator that separates a battery cell into an anode compartment and a cathode compartment, wherein the anode compartment comprises an anolyte that includes the first element, wherein the cathode compartment that comprises a catholyte that includes the second element, and wherein the anode compartment comprises at least 5 vol % catholyte, more preferably at least 10 vol % catholyte, and most preferably least 25 vol % catholyte. Various objects, features, aspects, and advantages of the present invention will become more apparent from the following detailed description of preferred embodiments of the invention, along with the accompanying drawing. |
Method for quatitative determination of dicarbonyl compounds |
The present invention relates to a method for quantitative detrtmintaion of dicarbonyl compounds in gaseous and/or liquid samples and also aerosols. The method can hereby be used also for determination of the accumulation of reactive carbonyl compounds in the case of so-called carbonyl stress in diabetics. |
1-20. (canceled). 21. A method for quantitative determination of dicarbonyl compounds in gaseous and/or liquid samples with the following steps: a) enrichment of the dicarbonyl compounds contained in the sample on a solid phase and/or on a water-soluble polymer, which are derivatised with carbonyl-reactive groups, via a coupling reaction between at least one carbonyl function of the dicarbonyl compound and the carbonyl-reactive group, b) coupling reaction of the dicarbonyl compound and/or of the immobilised compound, which is formed during the enrichment, with a specific analytical reagent, and c) quantitative determination of the dicarbonyl compounds by means of the detection of the quantity of the bonded analytical reagent. 22. The method according to claim 21, wherein the method is implemented by means of microtitration plates. 23. The method according to claim 21, wherein the method is implemented in a flow injection system. 24. The method according to claim 21, wherein the method is implemented in a miniaturised through-flow system. 25. The method according to claim 23, wherein, in step a), the sample is conducted through a cartridge which contains the solid phase. 26. The method according to claim 25, wherein, in step a), the coupling reaction between a first carbonyl function and the carbonyl-reactive group is implemented, and subsequently in step b), a coupling reaction between the analytical reagent and the second carbonyl function of the dicarbonyl compound is implemented. 27. The method according to claim 26, wherein, in step b), a fluorophoric hydrazide is used as analytical reagent and this hydrazide is detected fluorometrically in step c). 28. The method according to claim 26, wherein, in step b), an avidin-enzyme complex is used as analytical reagent, which is bonded to the second carbonyl function of the dicarbonyl compound via a biotin hydrazide. 29. The method according to claim 26, wherein, in step b), nano- or microparticles are used, which are modified on the surface with carbonyl-reactive groups, and which are subsequently detected photometrically, fluorometrically, nephelometrically, turbidimetrically or visually. 30. The method according to claim 26, wherein, in step b), a compound which contains hydrazide groups is used, which compound is subsequently coupled with an antibody which is specific for this compound. 31. The method according to claim 30, wherein the antibody is marked with an analytical reagent, for example with a fluorophore, gold particles or latex particles. 32. The method according to claim 30, wherein the antibody is marked with an enzyme as analytical molecule. 33. The method according to claim 28, wherein, in step c), detection is implemented photometrically, fluorometrically, electrochemically, luminometrically, direct-optically and/or with a quartz microbalance. 34. The method according to claim 21, wherein the carbonyl-reactive group in step a) is selected from the group of aminopyrazines, aminopyridines, aminopyrimidines and aminoguanidines. 35. The method according to claim 34, wherein a marked antibody is used as analytical reagent which is specific for the immobilised compound. 36. The method according to claim 35, wherein the antibody is marked with a fluorophore, an enzyme, gold particles, a marked anti-antibody or an avidin-biotin system. 37. The method according to claim 21, wherein, in step b), the solid phase and/or the watersoluble polymer, which are derivatised with carbonyl-reactive groups, function as specific analytical reagent, an aromatic component being produced by a ring closure reaction, which component is detected in step c) photometrically or fluorometrically. 38. The method according to claim 21, wherein α-oxoaldehydes are determined as dicarbonyl compound. 39. The method according to claim 38, wherein methylglyoxal, glyoxal and/or 3-deoxyglucuron is determined as dicarbonyl compound. 40. Utilization of the method according to claim 21 for determination of dicarbonyl compounds in respiratory air, respiratory condensate, body fluids and/or bronchioalveolar lavage. |
Recombinant vector derived from adeno-associated virus for gene therapy |
The present invention is related to a recombinant adeno-associated viral construct comprising at least: a first terminal repeat of an Adeno Associated Virus a strong heterologous promoter an heterologous DNA with at least 90% homology to the gene encoding for a constitutively activated TGF-b1 peptide, said gene being under the control of said promoter a polyadenylation signal a second terminal repeat of an Adeno Associated Virus |
1. A recombinant adeno-associated viral construct comprising at least: a first terminal repeat of an Adeno Associated Virus a strong heterologous promoter an heterologous DNA with at least 90% homology to the gene encoding for a constitutively activated TGF-b1 peptide, said gene being under the control of said promoter a polyadenylation signal a second terminal repeat of an Adeno Associated Virus. 2. The recombinant adeno-associated viral construct of claim 1 wherein said adeno-viral construct is comprised in a plasmid and/or a recombinant viral particle. 3. The recombinant adeno-associated viral construct of claim 1, wherein the TGF-b1 peptide is the TGF-b1 peptide present in LMBP 4281. 4. The recombinant adeno-associated viral construct of claim 1 further comprising nucleotidic sequences encoding suitable regulatory elements so as to effect expression of the constitutively activated TGF-b1 peptide in a suitable host cell. 5. A host cell genetically transformed by the construct according to claim 1. 6. A host cell according to claim 5, characterized in that said host cell is a human tumor cell. 7. A pharmaceutical composition comprising the recombinant adeno-associated viral construct of claim 1 or the cell according to a host cell genetically transformed by the construct and a pharmaceutically acceptable carrier. 8. The pharmaceutical composition of claim 7 wherein the recombinant adeno-associated viral construct is comprised in a recombinant viral particle. 9. A method for inhibiting the proliferation of cells, comprising at least the step of transferring a sufficient amount of the recombinant adeno-associated viral construct according to claim 1 into said cells. 10. The method according to claim 9, characterized in that said cells are cancer cells. 11. The method according to claim 10, characterized in that said cancer cells are selected from the group consisting of human melanoma cells, human mammary tumor cells, human ovarian tumor cells, lung tumor cells, human sarcoma cells and carcinoma cells. 12. Use of a sufficient amount of the pharmaceutical composition according to claim 7 for the preparation of a medicament in the treatment and/or the prevention of cancers. 13. Non-human animal, genetically modified by the recombinant adeno-associated viral construct according to claim 1. |
<SOH> BACKGROUND OF THE INVENTION AND STATE OF THE ART <EOH>Cancer is one of the most frequent causes of death of both males and females. Many cancers are difficult to cure with current treatment methods. One such examples is ovarian cancer. In over eighty percent of cases, ovarian tumors are of the epithelial type and originate from the cellular surface epithelium overlying the ovaries. In many cases these tumors are extremely difficult to treat, especially in advanced cancer with metastases. Currently available therapies include surgery, radiation therapy, chemotherapy, radioimmunotherapy, cytokine treatment and hyperthermia. All these treatment modalities have important limitations and disadvantages. For example, surgery can only be performed on localised accessible tumors, radiation and chemotherapy are associated with both acute and latent toxicity; radioimmunotherapy and hyperthermia have limited application and effectivity. Moreover, most of these techniques are not discriminating techniques and destroy not only tumor cells but also normal cells, with various side-effects on patients. However, in general, the efficiency of said therapies and their combinations is still unsatisfactory. More recently, gene therapy has been proposed as a novel approach to treat malignancies. Gene therapy consists of correcting a deficiency or an abnormality or of ensuring the expression of a protein of therapeutic interest, by introducing genetic information into the cell or organ concerned. This genetic information can be introduced either in vitro into a cell extracted from the organ, with the modified cell then being introduced into the organism, or directly in vivo in the appropriate tissue. The introduction of a molecule carrying genetic information can be achieved by various methods known in the art. Preferred methods use gene delivery vehicles derived from viruses, including adenoviruses, retroviruses, vaccina viruses and adeno associated viruses. Among these viruses, adeno-associated viruses (AAV) offer certain attractive properties for gene therapy. The wild type AAVs are DNA viruses of relatively small size which integrate, in a stable and site-specific manner, into the genome of the cells they infect. They are able to infect a wide spectrum of cell species and tissue types, without having any significant effect on cell growth, on cell morphology or on cell differentiation. In particular, they can express a transgene to high levels in epithelial cells. Moreover, so far no human disease has been found to be asssociated with AAV infection. Examples of the use of vectors derived from AAVs for transferring genes in vitro and in vivo have been described in the literature: see in particular, documents WO 91/18088, WO 93/09239, U.S. Pat. No 4,797,368, U.S. Pat. No. 5,139,941 and EP 488 528. However, the genetics of cancer and the molecular mechanisms operating in cells for maintaining the integrity of tissues are so complicated, that the potential ways for treating cancer are numerous and it is impossible to predict a priori the efficacy of a potential way of treatment. Different treatment strategies are currently under investigation. For example, one treatment strategy involves the enhancement of immunogenicity of tumor cells in vivo by the introduction of cytokine genes. Another treatment involves the introduction of genes that encode enzymes capable of conferring to the tumor cells sensitivity to chemotherapeutic agents. Another strategy involves the delivery of normal tumor suppressor genes and/or inhibitors of activated oncogenes into tumor cells. Considering the importance of the challenge for obtaining an efficient gene transfer system, efforts to build up new constructs to be tested in vivo are always appreciated. Transforming Growth Factor beta (TGF-β) represents a large family of secreted polypeptides called TGF-b superfamily, including TGF-β1, TGF-β2, TGF-β3, TGF-β4, TGF-β5, inhibins, activins, Mullarian Inhibiting Substance (MIS), Bone Morphogenic Protein (BMP) and Decapentaglegic Product (DPP). TGF-β1 has a wide range of biological activities in different cell types and different organisms and acts as an inhibitor of cell proliferation, an inducer of differentiation and an immunosuppressor. In particular, TGF-β1 induces an autocrine growth suppression in many epithelial cells. The loss of the autocrine growth suppressive circuit of TGF-β1 may be an important step in cancer formation since many cancer cells lose their sensitivity to TGF-β1 growth inhibition and many others retain the responsiveness but do not produce enough active peptide to sustain the autocrine growth suppressive loop (Zeinoun et al., Anticancer Research 19, 413-420 (1999)). For the latter kind of cancer cell types, it would be interesting to introduce a vector comprising the gene encoding the bioactive peptide. Hence, such a vector has never been proposed. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention is related to a recombinant adeno-associated viral construct comprising at least: a first terminal repeat of an Adeno Associated Virus a strong heterologous promoter donor-acceptor splicing signals of SV40 16S/19S protein an heterologous DNA corresponding to the gene encoding for a constitutively activated TGF-β1 peptide, said gene being under the control of said promoter the polydenylation signal of the bovine growth hormone gene a second terminal repeat of an Adeno Associated Virus. With construct is meant a genetic construct, which can be comprised in a plasmid and/or in a recombinant viral particle. The recombinant adeno-associated viral construct may further comprise nucleotidic sequences encoding suitable regulatory elements so as to effect expression of the constitutively activated TGF-β1 peptide in a suitable host cell. The present invention is also related to a pharmaceutical composition comprising said recombinant adeno-associated viral construct alone or with a pharmaceutically acceptable carrier. Preferably, the recombinant adeno associated viral construct is comprised in a recombinant viral particle. The present invention is also related to a method for inhibiting the proliferation of cells, comprising at least the step of transferring a sufficient amount of the recombinant adeno-associated viral construct according to the invention into said cells. Preferably, said cells are epithelial cells. Preferably, said epithelial cells are mammary epithelial cells, ovarian epithelial cells or lung epithelial cells. Preferably, said cells are cancer cells. Preferably, said cancer cells are selected from the group consisting of human melanoma cells, human mammary tumor cells, human ovarian tumor cells, human lung tumor cells, human sarcoma cells and carcinoma cells. The present invention is also related to the use of a sufficient amount of the pharmaceutical composition according to the invention for the preparation of a medicament in the treatment and/or the prevention of cancers. The present invention is related to a non-human animal, genetically modified by the recombinant adeno-associated viral construct according to the invention. |
Process for the hydrolysis of milk proteins |
The present invention provides a composition comprising hydrolysed milk casein and, preferably non-hydrolysed whey protein in a ratio from 9:1 to 1:1 (on dry weight), which is a clear liquid at pH 4 when dissolved or present in water in an amount of 40 g/litre at 10° C. |
1. A composition comprising hydrolysed casein protein and whey protein in a ratio of from 9:1 to 1:1 dry weight, which is a clear liquid at pH 4 when dissolved or present in water in an amount of 40 g/litre at 10° C. 2. The composition of claim 1 wherein the whey protein fraction is non-hydrolysed. 3. The composition of claim 1 having a reduced allergenicity compared to the protein composition before hydrolysis. 4. The composition of claim 1, wherein the fraction of the hydrolysed protein that has a molecular weight below 5000 Dalton is more than 90% by wt of the protein present in the hydrolysed protein. 5. The composition of claim 1, wherein the fraction of the hydrolysed protein that has a molecular weight below 1500 Dalton is more than 80% by wt of the protein present in the hydrolysed protein. 6. The composition of claim 1, wherein skim milk is used as source of the casein and whey proteins. 7. The composition of claim 1, which contains from 10 to 150 of total protein dry weight per 1000 g of the composition. 8. The composition of claim 1, which contains less than 10% w/w of water. 9. A foodstuff comprising a composition according to claim 1. 10. The beverage of claim 20 which is a sports drink or a soft drink or a health drink. 11. A method to produce the composition of claim 1 which method comprises hydrolysing at least casein protein. 12. The method of claim 11 which further comprises hydrolysing the whey protein. 13. The method of claim 11 wherein the casein protein is hydrolysed by an endoprotease. 14. The method of claim 13 wherein said endoprotease is a proline specific endoprotease. 15. The method of claim 13, whereby exoprotease is added simultaneously or subsequently to the endoprotease. 16. (canceled) 17. (canceled) 18. The composition of claim 4 wherein the fraction of hydrolysed protein that has molecular weight below 5,000 Daltons is more than 95% by weight of the protein present in the hydrolysed protein. 19. The composition of claim 5 wherein the fraction of hydrolysed protein that has molecular weight below 1,500 Daltons is more than 85% by weight of the protein present in the hydrolysed protein. 20. The foodstuff of claim 9 which is a beverage. 21. The method of claim 14 wherein the hydrolysis with a proline-specific endoprotease is performed subsequently to or simultaneously with hydrolysis by an additional endoprotease. 22. A method to reduce allergenicity in a food or feed which method comprises providing the protein content of said food or feed as the composition of claim 1. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The protein fraction of bovine milk is associated with health. The health promoting properties reside not only in the nutritional aspects of this protein fraction but also in the various health promoting factors present. Milk proteins consists of approximately 80% caseins. The remaining protein is accounted for by a variety of whey proteins. The casein fraction is the main source of amino acids, calcium and phosphate all of which are required for growth of the young animal. The whey protein fraction is also a source of amino acids and in addition it contains several bioactive and putative health promoting proteins such as immunoglobulins, folate binding protein, lactoferrin, lactoperoxidase and lysozyme. It is also known that upon metabolisation of the casein and whey protein fractions a number of new bioactive peptides are formed. Examples of such newly formed bioactive peptides include casomorphins, casokinins, immunoglobulins, immunopeptides, caseinephosphopeptides, lactiphins and lactoferricin. Therefore, the use of casein and whey proteins in the combination in which they occur in milk offers significant nutritional and health benefits. More recently industrially prepared hydrolysates of milk proteins were also found to contain newly formed bioactive peptides and notably ACE-inhibitors to fight hypertension. The white appearance of milk is caused by the scattering of light by fat globules and casein micelles. Skimmed milk, i.e. milk from which all fat has been removed, is still white because of these casein micelles. The whey protein fraction of the milk, i.e. milk after removal of both the fat and casein fraction, is a yellowish but clear protein solution which is rich in various proteins, peptides, lactose, minerals and vitamins. All of these constituents are completely soluble even under acidic conditions. Nevertheless the dissolution of whey proteins may yield turbid solutions as the result of partial denaturation during spray drying. Partial enzymatic hydrolysis can improve the dissolution characteristics of these somewhat denatured spray dried whey proteins. More exhaustive enzymatic hydrolysis of whey proteins further improves their solubility but also leads to modest increases in bitterness and levels of free amino acids present. The usual aim of more exhaustive enzymatic hydrolysis of whey proteins is to achieve a reduction in allergenicity and an improved intestinal uptake. Especially the reduced allergenicity aspect is commercially important. For example in different countries of Northern Europe cow's milk intolerance has been diagnosed in almost 3% of general populations of infants in the first two years of life. Beta-lactoglobulin belongs, together with the caseins to the major allergens in bovine milk. Adults rarely exhibit bovine milk allergies and specialised products for this group must be tailored to be easily assimilable, provide a good taste and exhibit good shelf stabilities, especially under acid conditions. It is therefore not surprising that there exists considerable literature regarding the exhaustive enzymatic digestion of whey hydrolysates aimed at clinical, dietetic and sports applications as well as infant nutrition. In contrast with whey, casein is rich in hydrophobic amino acids so that its hydrolysates are notoriously bitter and tend to have rancid and brothy off-tastes. Due to their extreme bitterness enzymatically hydrolysed caseins find limited application only. Moreover their high content of hydrophobic amino acids make casein derived peptides difficult to dissolve, especially under acid conditions. Processes for the preparation of partial casein hydrolysates described in the literature generally involve multi-step hydrolyses with a few endoproteases followed by incubation with one or more exoproteases. Combinations of various endoproteases are commonly used to obtain the high Degree of Hydrolysis (high DH) required to minimise possible allergenic reactions and to improve the solubility. Subsequent incubation with exoproteases releases amino- or carboxyterminal amino acid residues to minimise bitter off-tastes. However, the release of free amino acids implies losses in yield and a diminished nutritional value. Because high levels of free amino acids may also result in brothy off-tastes and increased osmotic values of the final hydrolysate, additional processing steps to remove free amino acids, and strongly hydrophobic peptides which account for the bitter off-tastes, are common practice. Patent application EP 0 610 411 describes completely soluble casein hydrolysates of good organoleptic quality with low molecular weight peptides and a DH value in the order of magnitude of 15 to 35%. Patent application WO 96/131744 describes a method for production of a milk protein hydrolysate characterised by a hydrolysis reaction involving any neutral or alkaline protease from Bacillus in combination with an Aspergillus enzyme complex comprising both endo- and exopeptidases and a degree of hydrolysis between 35% and 55%. Patent application EP 384 303 describes a method for production of a protein hydrolysate exhibiting low bitterness and a low DH value using an aminopeptidase. Patent application EP 223 560 describes a method for production of milk proteins by means of a sequential enzyme hydrolysis. Patent application EP 0 631 731 describes a partial hydrolysate of a protein mixture comprising whey protein and casein wherein the hydrolysate has a degree of hydrolysis between 4 and 10% and a low bitter hydrolysate is obtained using a combination of trypsin and chymotrypsin. Patent U.S. Pat. No. 4,600,588 describes a milk protein hydrolysate consisting of acid precipitated casein that has been treated with a.o. an acid fungal protease. Patent application JP11243866 describes a casein hydrolysate useful for drinks and food which is tasteless and odorless and has a degree of hydrolysis of 17 to 30%. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention provides a protein composition comprising hydrolysed casein protein and whey protein in a ratio of 9:1 to 1:1 dry weight. Preferably the whey protein is non-hydrolysed. The protein composition is a clear liquid at pH 4 when the hydrolysed casein protein and whey protein are dissolved or present in water in an amount of 40 g of protein (dry weight)/litre at 10° C. In case the protein composition comprises less than 40 g of protein (dry weight)/litre, this composition is still a clear liquid at 10 degrees C. when concentrated to a liquid of 40 g of protein (dry weight)/litre. The present invention also provides a method of production of a composition comprising casein protein and whey protein, wherein at least the casein fraction is hydrolysed. The present invention also provides a product comprising a composition of the invention, for example a beverage such as a sports drink or a soft drink or a health drink or a dietetic food such as a product for elderly or for slimming people or an infant formula such as a term or follow-on product. Moreover it can be a a fermented product or it can be incorporated into various personal care products. detailed-description description="Detailed Description" end="lead"? |
LASER BEAM MACHINING APPARATUS |
A laser beam machining apparatus includes a laser oscillator, a machining head which that machines a workpiece using the laser beam. An optical duct has an optical system to guide the laser beam form the laser oscillator to the machining head. Purge gas is supplied into the optical duct from a purge gas supply port, and the purge gas is output from a purge gas exhaust port. A detector detects presence of undesired gas in the optical duct. |
1. A laser beam machining apparatus, comprising: a laser oscillator which oscillates a laser beam, the laser oscillator having a laser beam outgoing port to output the laser beam; a machining head which machines a workpiece with the laser beam; an optical duct with an optical system to guide the laser beam from the laser beam outgoing port to the machining head; a purge gas supply port that opens into the optical duct and situated near any one of the laser beam outgoing port and the machining head, wherein a purge gas supply unit supplies purge gas into the optical duct from the purge gas supply port; a purge gas exhaust port that opens into the optical duct and situated near any one of the laser beam outgoing port and the machining head, wherein the purge gas in the optical duct is output from the purge gas exhaust port; and an odor sensor that detects undesired gas in a portion of the optical duct from the laser beam outgoing port to the machining head, wherein the undesired gas is a gas that makes the laser beam anomalous. 2. The laser beam machining apparatus according to claim 1, further comprising a control notification unit that, upon the odor sensor detecting the undesired gas, identifies a cause of the undesired gas entering the optical duct and notifies the cause. 3. The laser beam machining apparatus according to claim 2, wherein the control notification unit includes a counter that counts number of times the odor sensor detects the undesired gas from the time the laser beam machining apparatus is booted, and if the count of the counter indicates that the odor sensor has detected the undesired gas for a first time, the control notification identifies a faulty in the purge gas supply unit and peripheral atmosphere of the purge gas supply unit as the cause. 4. The laser beam machining apparatus according to claim 2, wherein the control notification on unit includes a counter that counts number of times the odor sensor detects the undesired gas from the time the laser beam machining apparatus is booted, and if the count of the counter indicates that the odor sensor has detected the undesired gas for a second time, the control notification unit identifies a fault in the optical duct as the cause. 5. The laser beam machining apparatus according to claim 2, wherein the control notification unit includes a counter that counts number of times the odor sensor detects the undesired gas from the time the laser beam machining apparatus is booted, and if the count of the counter indicates that the odor sensor has detected the undesired gas for third or more times, the control notification unit identifies a fault in the entire laser beam machining apparatus as the cause and controls an operating state of the laser oscillator 6. The laser beam machining apparatus according to claim 1, wherein the odor sensor is situated adjacent to the purge gas exhaust port. 7. The laser beam machining apparatus according to claim 6, further comprising a control notification unit that, upon the odor sensor detecting the undesired gas, identifies a cause of the undesired gas entering the optical duct and performs any one of notifying the cause and notifying the cause and controlling an operating state of the laser oscillator based on number of times the odor sensor detects the undesired gas from the time the laser beam machining apparatus is booted. 8-23. Cancelled 24. The laser beam machining apparatus according to claim 1, wherein the odor sensor is situated adjacent to the purge gas supply port. 25. The laser beam machining apparatus according to claim 24, further comprising a control notification unit that, upon the odor sensor detecting the undesired gas, identifies a cause of the undesired gas entering the optical duct and performs any one of notifying the cause and notifying the cause and controlling an operating state of the laser oscillator based on number of times the odor sensor detects the undesired gas from the time the laser beam machining apparatus is booted. 26. The laser beam machining apparatus according to claim 1, wherein the odor sensor includes a first odor sensor situated adjacent to the purge gas exhaust port, and a second odor sensor situated adjacent to the purge gas supply port. 27. The laser beam machining apparatus according to claim 26, further comprising a control notification unit that, upon any one of the first odor sensor and the second odor sensor detecting the undesired gas, identifies a cause of the undesired gas entering the optical duct and performs any one of notifying the cause and notifying the cause and controlling an operating state of the laser oscillator based on number of times the first odor sensor and the second odor sensor detect the undesired gas from the time the laser beam machining apparatus is booted, and based on which one of the first odor sensor and the second odor sensor has detected the undesired gas. 28. The laser beam machining apparatus according to claim 27, wherein the purge gas supply unit has an inlet port to suck air, a filter to filter dust from the air and obtain dust-free air, and a compressor to compress the dust-free air and supply the compressed dust-free air to the optical duct, and when the second odor sensor detects the undesired gas for a first time after the laser beam machining apparatus is booted, the control notification identifies a faulty in the purge gas supply unit and peripheral atmosphere of the purge gas supply unit as the cause. 29. The laser beam machining apparatus according to claim 28, further comprising: a second purge gas supply unit that is situated in a flow channel connecting the compressor and the purge gas supply port via a valve which selectively switches the purge gas between the purge gas supply unit and the compressor, the control notification unit switches the valve so that, when daily one of the first odor sensor and the second odor sensor detects the undesired gas when the purge gas is supplied from the compressor to the optical duct, the purge gas is supplied from the second purge gas supply unit to the optical duct. 30. The laser beam machining apparatus according to claim 1, wherein the purge gas supply unit has an inlet port to suck air, a filter to filter dust from the air and obtain dust-free air, and a compressor to compress the dust-free air and supply the compressed dust-free air to the optical duct, and The odor sensor includes a first odor sensor situated adjacent to the purge gas exhaust port, a second odor sensor situated adjacent to the purge gas supply port, and a third odor sensor situated adjacent to the inlet port of the purge gas supply unit. 31. The laser beam machining apparatus according to claim 30, further comprising a control notification unit that, upon any one of the first odor sensor, the second odor sensor, and the third odor sensor detecting the undesired gas, identifies a cause of the undesired gas entering the optical duct and performs any one of notifying the cause and notifying the cause and controlling an operating state of the laser oscillator based on number of times the first odor sensor, the second odor sensor, and the third odor sensor detect the undesired gas from the time the laser beam machining apparatus is booted, and based on which one of the first odor sensor, the second odor sensor, and the third odor sensor has detected the undesired gas. 32. The laser beam machining apparatus according to claim 1, wherein the optical duct includes a concave portion to fit the odor sensor. 33. The laser beam machining apparatus according to claim 32, further comprising a calibration gas supply unit gas supply unit situated near the odor sensor, wherein the calibration gas supply unit ejects calibration gas towards the odor sensor for calibrating the odor sensor. 34. The laser beam machining apparatus according to claim 33, further comprising a driving unit which moves the odor sensor sufficiently inside the concave portion when the odor sensor is being calibrated, and moves the odor sensor inside the conducting arrangement until the odor sensor does not disturb the path of the laser beam in the conducting arrangement when the workpiece is to be machined with the laser beam. 35. The laser beam machining apparatus according to claim 33, further comprising two gate valves in positions on the optical duct sandwiching the concave portion, wherein the gate valves are closed when the odor sensor is being calibrated. |
<SOH> BACKGROUND ART <EOH>Various types of laser machining apparatuses are known. For example, Japanese Patent Application Laid-Open Publication No. 5-8079 (see page 2 , FIGS. 1 and 2 ) discloses a conventional laser beam machining apparatus that transmits a laser beam stably for long time and can weld and cut a subject to be machined with high accuracy. This laser beam machining apparatus includes a laser oscillator, a laser robot, an optical duct, and a machining gas supply unit. The laser oscillator has a beam transmission line including a laser outgoing port of an airtight mechanism. The laser robot has an articulated configuration which can emit a laser beam to an arbitrary position of the subject to be machined. The optical duct guides the laser beam so that an optical axis of the laser beam between the laser oscillator and the laser robot does not shift. The machining gas supply unit detects pressure in the optical duct and supplies a predetermined machining gas into the optical duct so that the pressure in the optical duct becomes higher than external pressure. Such a configuration prevents fume and dust generated at the time of the laser beam machining from entering the optical duct through a tip of the laser robot. Japanese Patent Application Laid-Open Publication No. 6-17120 (see pages 2 to 3, FIG. 1 ) discloses a laser annealing apparatus capable of controlling intensity of a laser beam accurately according to a condition where a subject to be machined undergoes a laser annealing process. The laser annealing apparatus has such a configuration that the laser oscillator and a chamber in which the subject to be machined and to undergo the laser annealing process is arranged are connected by the optical duct. The laser annealing apparatus adjusts the intensity of the laser beam emitted to the subject to be machined in the chamber based on purge gas which does not absorb the laser beam transmitting through the optical duct, and concentration of control gas having predetermined absorbance with respect to the laser beam. The optical duct, therefore, has a detecting sensor which detects the concentration of the control gas in the optical duct, and a quantity of the control gas to be supplied into the optical duct is controlled based on a signal obtained in such a manner that the detecting sensor detects the concentration of the control gas. In the conventional laser beam machining apparatus disclosed in Japanese Patent Application Laid-Open Publication No. 5-8079, however, air might enter the optical duct. One of causes that the air enters the optical duct is a configuration of the optical duct. As shown in FIG. 1 of this publication, for example, the optical duct which connects the laser oscillator and the laser robot does not have a linear form, and the optical path is bent at a plurality of portions. Such an optical duct is normally constituted so that bellows or the like connects a plurality of pipes. The laser beam machining apparatus of the first prior art has the laser robot in which a position to which the laser beam is emitted can be moved so that the laser beam can be emitted to an arbitrary position of a subject to be machined. In the laser beam machining apparatus having such a configuration, for example, a bellows section composing a part of the optical duct occasionally moves according to a changing operation of the emitting position of the laser robot which is performed in order to change the laser beam emitting position, or when the laser beam machining is stopped, pressure in the optical duct temporarily drops. As a result, for example, outside air enters the optical duct through joints of the pipes composing the optical duct or joints between the pipes and the bellows. Another cause that the air might enter the optical duct is machining gas to be supplied into the optical duct, and this is caused by using air sucked from a compressor into the optical duct as the machining gas. If the air enters the optical duct, when thinner, paint, or the like is used in a vicinity of the optical duct, impure gas such as laser beam absorbing gas (thinner, trichloroethylene, acrylic combustion gas, fluorocarbon gas, SF 6 , organic compound, and the like) enters the optical duct. The impure gas causes power distribution of the laser beam and increase in attenuation of the laser beam, and as a result, characteristics of the laser beam are deteriorated, and thus machining ability of the laser beam machining apparatus is deteriorated. When anomalous output of the laser beam occurs, a defect in the laser oscillator is firstly regarded as a cause of the fault. After various factors which cause the fault in the output of the laser beam are eliminated, it is frequently found that the intrusion of the impure gas into the optical duct is the cause of the anomalous output of the laser beam. That is to say, the impure gas in the optical duct cannot be specified as the cause of the anomalous output of the laser beam in the early stage of the checkup of the causes. During the checkup of the causes, therefore, the machining cannot be carried out by the laser beam machining apparatus, and thus the impure gas is also a cause for deteriorating working efficiency. In the laser annealing apparatus disclosed in Japanese Patent Application Laid-Open Publication No. 6-17120, the detecting sensor which detects the control gas is provided in the optical duct, but the detecting sensor detects the concentration of the control gas which controls the output of the laser beam and does not detect the impure gas. That is to say, even if the impure gas such as the laser absorbing gas enters the optical duct, the detecting sensor cannot detect the intrusion of the impure gas. The present invention has been achieved in order to solve the above problems, and its object is to obtain the laser beam machining apparatus which is capable of detecting impure gas intruded into the optical duct. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 is a schematic diagram of a laser beam machining apparatus according to a first embodiment of the present invention; FIG. 2 illustrates how a gas detector is attached to an optical duct; FIG. 3 is a flowchart of a process to detect anomaly in the laser beam machining apparatus according to the first embodiment; FIG. 4 is a flowchart of a process of calibration executed using the gas detector; FIG. 5 is a schematic diagram of a laser beam machining apparatus according to a second embodiment of the present invention; FIG. 6 is a flowchart of a process to detect an anomaly in the laser beam machining apparatus; FIG. 7 is a schematic diagram of a laser beam machining apparatus according to a third embodiment of the present invention; FIG. 8 is to explain how the odor sensor detects anomalous portions; FIG. 9 is a flowchart of a process to detect an anomaly in the laser beam machining apparatus according to the third embodiment; FIG. 10 is a schematic diagram of a laser beam machining apparatus according to a fourth embodiment of the present invention; FIG. 11 is a flowchart of a process to detect an anomaly in the laser beam machining apparatus according to the fourth embodiment; FIG. 12 is a schematic diagram of a laser beam machining apparatus according to a fifth embodiment of the present invention; FIG. 13 is to explain how the odor sensor detects anomalous portions in the laser beam machining apparatus according to the fifth embodiment; FIG. 14 is a flowchart of a process to detect an anomaly in the laser beam machining apparatus according to the fifth embodiment; FIG. 15 illustrates an example in which the gas detector is attached to the optical duct; FIG. 16 is a flowchart of a process of calibration executed using the gas detector; FIG. 17 illustrates an example in which the gas detector is mounted to the optical duct; and FIG. 18 is a flowchart of a process of calibration executed using the gas detector. detailed-description description="Detailed Description" end="lead"? |
Diamine derivatives, process for producing the same, and bactericide containing the same as active ingredient |
A fungicide can be provided by using, as an active ingredient, a diamine derivative of the following general formula (1): wherein R1 to R7 represent a specific substituent such as an alkyl group with 1 to 6 carbon atoms, and R8 represents an aryl group, which may be substituted or a heteroaryl group, which may be substituted. |
1. A diamine derivative, represented by the following general formula (1): wherein R1 represents an alkyl group with 1 to 6 carbon atoms provided that the case is excluded where R1 is a tert-butyl, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, a cycloalkenyl group with 3 to 6 carbon atoms, an alkynyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, a heteroarylalkyl group which may be substituted, an aryl group which may be substituted, or a heteroaryl group which may be substituted; R2 and R7 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, a cycloalkenyl group with 3 to 6 carbon atoms, an alkynyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, an aryl group which may be substituted, or an acyl group; R3 and R4 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, a cycloalkenyl group with 3 to 6 carbon atoms, an alkynyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, a heteroarylalkyl group which may be substituted, an aryl group which may be substituted or a heteroaryl group which may be substituted, or a cycloalkyl group with 3 to 6 carbon atoms including an attached carbon atom; R5 and R6 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, a cycloalkenyl group with 3 to 6 carbon atoms, an alkynyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, or an aryl group which may be substituted; provided that the case is excluded where R3, R4, R5 and R6 all represent a hydrogen atom or where any one of R3, R4, R5 and R6 represents a methyl group which may be substituted and the others represent a hydrogen atom, and R8 represents an aryl group which may be substituted or a heteroaryl group which may be substituted. 2. The diamine derivative according to claim 1, wherein R1 represents an alkyl group with 1 to 6 carbon atoms provided that the case is excluded where R1 is a tert-butyl, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, a heteroarylalkyl group which may be substituted, an aryl group which may be substituted, or a heteroaryl group which may be substituted; R2 and R7 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an arylalkyl group which may be substituted, an aryl group which may be substituted, or an acyl group; R3 and R4 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, a heteroarylalkyl group which may be substituted, an aryl group which may be substituted or a heteroaryl group which may be substituted, or a cycloalkyl group with 3 to 6 carbon atoms including an attached carbon atom; and R5 and R6 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an arylalkyl group which may be substituted, or an aryl group which may be substituted; provided that the case is excluded where R3, R4, R5 and R6 all represent a hydrogen atom or where any one of R3, R4, R5 and R6 represents a methyl group which may be substituted and the others represent a hydrogen atom. 3. The diamine derivative according to claim 2, wherein R2 and R7 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, or an acyl group; R3 and R4 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an arylalkyl group which may be substituted, an aryl group which may be substituted, or a cycloalkyl group with 3 to 6 carbon atoms including an attached carbon atom; and R5 and R6 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, an arylalkyl group which may be substituted, or an aryl group which may be substituted; provided that the case is excluded where R3, R4, R5 and R6 all represent a hydrogen atom or where any one of R3, R4, R5 and R6 represents a methyl group which may be substituted and the others represent a hydrogen atom. 4. The diamine derivative according to claim 3, wherein R2 and R7 represent a hydrogen atom. 5. A diamine derivative, represented by the following general formula (9): wherein R9 represents an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, a cycloalkenyl group with 3 to 6 carbon atoms, an alkynyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, a heteroarylalkyl group which may be substituted, a phenyl group, a phenyl group which is substituted at the fourth position, or a heteroaryl group which may be substituted; R10 and R15 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, a cycloalkenyl group with 3 to 6 carbon atoms, an alkynyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, an aryl group which may be substituted, or an acyl group; One of R11 and R12 represents a methyl group, and the other represents a hydrogen atom; R13 and R14 represent a hydrogen atom, respectively; and R16 represents a phenyl group, a phenyl group which is substituted at the fourth position, or a heteroaryl group which may be substituted. 6. The diamine derivative according to claim 5, wherein R9 represents an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an alkenyl group with 2 to 6 carbon atoms, an arylalkyl group which may be substituted, a heteroarylalkyl group which may be substituted, a phenyl group, a phenyl group which is substituted at the fourth position, or a heteroaryl group which may be substituted; and R10 and R15 represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, a cycloalkyl group with 3 to 6 carbon atoms, an arylalkyl group which may be substituted, an aryl group which may be substituted, or an acyl group, independently. 7. The diamine derivative according to claim 6, wherein R10 and R15 independently represent a hydrogen atom, an alkyl group with 1 to 6 carbon atoms, or an acyl group. 8. The diamine derivative according to claim 7, wherein at R10 and R15 represent a hydrogen atom, respectively. 9. A fungicide, wherein it contains the diamine derivative according to claim 8 as an active ingredient. 10. A process for producing the diamine derivative according to claim 1, wherein a compound having the following general formula (2): wherein R1, R2, R3, R4, R5, R6 and R7 represent the same groups as those of the compounds according to claim 1, is reacted with a compound having the following general formula (3): wherein R8 represents the same group as that of the compound according to claim 1, and X represents a leaving group. 11. A process for producing the diamine derivative according to claim 1, wherein a compound of the general formula (2) is condensed with a compound having the following general formula (4): wherein R8 represents the same group as that of the compounds according to claim 1. 12. A process for producing the diamine derivative according to claim 1, wherein a compound having the following general formula (5): wherein R2, R3, R4, R5, R6, R7 and R8 represent the same groups as those of the compound according to claim 1, is reacted with a compound having the following general formula (6): wherein R1 represents the same group as that of the compound according to claim 1, and X represents a leaving group. 13. A process for producing the diamine derivative according to claim 5, wherein a compound having the following general formula (10): wherein R9, R10, R11, R12, R13, R14 and R15 represent the same groups as those of the compounds according to claim 5, is reacted with a compound having the following general formula (11): wherein R16 represents the same group as that of the compound according to claim 5, and X represents a leaving group. 14. A process for producing the diamine derivative according to claim 5, wherein a compound of the general formula (10) is condensed with a compound having the following general formula (12): wherein R16 represents the same group as that of the compounds according to claim 5. 15. A process for producing the diamine derivative according to claim 5, wherein a compound having the following general formula (13): wherein R10, R11, R12, R13, R14, R15 and R16represent the same groups as those of the compound according to claim 5, is reacted with a compound having the following general formula (14): wherein R9 represents the same group as that of the compound according to claim 5, and X represents a leaving group. 16. A fungicide, wherein it contains the diamine derivative according to claim 1 as an active ingredient. 17. A fungicide, wherein it contains the diamine derivative according to claim 5 as an active ingredient. |
<SOH> BACKGROUND ART <EOH>Pest Control plays a significant role in cultivation of paddy rice, and, in particular, various fungicides have been developed and used against rice blast, which is considered to be an important disease injury. These fungicides, however, are not always satisfactory in terms of the desired fungicidal activity and control of the undesirable harmful effects on useful crops. In addition, in recent years, fungi having drug-resistant have emerged due to the frequent use of agricultural and horticultural fungicides, and the existing fungicides do not always exhibit satisfactory fungicidal activity. Furthermore, from the environmental viewpoint, there have been demands for novel fungicides which are safe and capable of controlling harmful fungi at lower concentrations. |
System for producing clonal or complex populations of recombinant adenoviruses, and the application of the same |
The invention relates to a novel system for producing recombinant adenoviruses (rAd). The areas of application of said system are medicine, veterinary medicine, biotechnology, genetic engineering, and functional genomic analysis. The inventive system for producing rAds preferably consists of a donor virus, the packaging signal of which is (i) partially deleted and (ii) is surrounded by parallel recognition cites for a site-specific recombinase; a packaging cell line which expresses the site-specific recombinase; and donor plasmids containing (i) at least one recognition site for the site-specific recombinase, (ii) the full viral packaging signal, (iii) optionally two recognition sites for a rarely cutting restriction endonuclease, and (iv) insertion sites for foreign DNA or inserted foreign DNA. |
1. System for the generation of recombinant adenoviruses, comprising (a) a donor virus with a partially deleted viral packaging signal, which is framed by two recognition sites for a site-specific recombinase, (b) a packaging cell line, which expresses the site-specific recombinase and (c) a donor plasmid, which contains one or two recognition sites for the site-specific recombinase, the complete viral packaging signal and insertion sites for foreign DNA and/or inserted foreign DNA. 2. System according to claim 1, wherein it is suitable for the generation of a clonal population of recombinant adenoviruses, by employment of a clonal population of the donor plasmid. 3. System according to claim 1, wherein it is suitable for the generation of a complex population of recombinant adenoviruses, by employment of a complex population of the donor plasmid. 4. System according to claim 1, wherein a donor virus is used, which is derived from human adenoviruses. 5. System according to claim 1, wherein a donor virus is used, which is derived from non-human adenoviruses. 6. System according to claim 1, wherein in the donor virus at least one non-essential viral gene is deleted. 7. System according to claim 1, wherein in the donor virus, at least one essential viral gene is deleted. 8. System according to claim 1, wherein the rescue and propagation of the donor virus is done in a producer cell line, which makes available the deleted essential viral gene(s). 9. System according to claim 1, wherein a donor virus is used, which is derived from the human adenovirus serotype 5 and contains a deletion of the essential E1-Region. 10. System according to claim 1, wherein donor viruses derived from the human adenovirus serotype 5 with a deletion of the non-essential E3-region are used. 11. System according to claim 1, wherein in the donor virus, there are two recognition sites for a site-specific recombinase of the Int family. 12. System according to claim 1, wherein in the donor virus, there are two recognition sites for the Cre-recombinase. 13. A recombinant virus derived from the human adenovirus serotype 5, where it contains (a) a deletion of the E1-Region, (b) a deletion of the E3 region and (c) a partially deleted viral packaging signal that (d) is framed by parallel-oriented recognition sites for the Cre-recombinase. 14. A recombinant virus according to claim 13, wherein the partially deleted viral packaging signal contains the A repeats I-V. 15. A recombinant virus according to claim 13, wherein the partially deleted viral packaging signal contains the A repeats I, II, VI and VII. 16. System according to claim 1, wherein a donor plasmid is used, which contains (a) a bacterial replication origin, (b) a bacterial resistance gene, (c) a recognition site for the site-specific recombinase, (d) a complete viral packaging signal, as well as (e) an insertion site for foreign DNA and/or foreign DNA 17. System according to claim 1, wherein a donor plasmid is used, which contains (a) a bacterial replication origin, (b) a bacterial resistance gene, (c) an recognition site for the site-specific recombinase, (d) a viral ITR, (e) a complete viral packaging signal, (f) an insertion site for foreign DNA and/or foreign DNA and (g) two recognition sites for a rare cutting restriction endonuclease. 18. System according to claim 1, wherein a donor plasmid is used, which contains (a) a bacterial replication origin, (b) a bacterial resistance gene, (c) two recognition sites for the site-specific recombinase, (d) a complete viral packaging signal, as well as (e) an insertion site for foreign DNA and/or foreign DNA. 19. System according to claim 1, wherein in the donor plasmid there is present the complete packaging signal of adenovirus for serotype 5. 20. System according to claim 1, wherein in the donor plasmid there are present one or two recognition sites for a site-specific recombinase of the Int Family. 21. System according to claim 20, wherein in the donor plasmid there are present one or two recognition sites for the Cre-recombinase. 22. System according to claim 1, wherein in the donor plasmid, recognition sites are present for a rare cutting restriction endonuclease, with a recognition sequence more than 8 bp long. 23. System according to claim 22, wherein in the donor plasmid there are present recognition sites for the rare cutting restriction endonuclease I-SceI. 24. System according to claim 1, wherein in the donor plasmid there is present the 5′ITR of adenovirus serotype 5. 25. Donor plasmids for employment in a system according to claim 1. 26. System according to claim 1, wherein the packaging cell line expresses a site-specific recombinase of the Int Family. 27. System according to claim 1, wherein the packaging cell line, besides the site-specific recombinase, makes available essential viral gene(s) deleted, where appropriate, in the donor virus. 28. System according to claim 1, wherein the packaging cell line expresses the Cre-recombinase and makes available the E1 gene products of adenovirus serotype 5. 29. System according to claim 1, wherein the cell line CIN 1004 is used as a packaging cell line. 30. Use of the cell line CIN1004 for the generation of clonal or complex populations of recombinant adenoviruses. 31. System according to claim 1, wherein a clonal population of the donor plasmid is used, with which an expression cassette is present as foreign DNA, which contains (a) a promoter, (b) the open reading frame of a gene, (c) a polyadenylation signal, (d) where appropriate, at least one insulator, (e) where appropriate, at least one intron and (f) where appropriate, at least one enhancer. 32. System according to claim 1, wherein a complex population of the donor plasmid is used, with which there is present a mixture of different DNA sequences as foreign DNA. 33. System according to claim 32, wherein there is present a mixture of non-coding DNA sequences as foreign DNA. 34. System according to claim 32, wherein there is present a mixture of coding DNA sequences as foreign DNA. 35. System according to claim 32, wherein there is present a mixture of expression units as foreign DNA, with which there are differently coding DNA sequences under the control of the same promoter and polyadenylation signal. 36. System according to claim 32, wherein there is a cDNA library present as a mixture of coding sequences. 37. System according to claim 32, wherein as a mixture of coding sequences, there is present a mixture of variants of an individual gene, which are distinguished in individual base pair positions at least, and/or contain insertions or deletions of at least one base pair. 38. System according to claim 32, wherein there is present a mixture of expression units as foreign DNA, with which different promoters, which are distinguished in one bp position at least, and/or contain insertions or deletions of at least one base pair, which control the expression of the same coding DNA sequence. 39. Process for the generation of recombinant adenoviruses, comprising the steps (a) Provision of a donor virus with an at least partially deleted viral packaging signal, which is framed by two recognition sites for a site-specific recombinase, (b) Infection of a packaging cell line, which expresses the site-specific recombinase with the donor virus, (c) Formation of a donor virus acceptor substrate through action of the site-specific recombinase on the donor virus, (d) Transfection of donor plasmids, which contain one or two recognition sites for the site-specific recombinase, the complete viral packaging signal and insertion sites for foreign DNA and/or inserted foreign DNA into the donor virus infected packaging cell line and (e) Formation of recombinant adenoviruses through action of the site-specific recombinase. 40. Process according to claim 39 for the generation of a clonal population of recombinant adenoviruses. 41. Process according to claim 39 for the generation of a complex population of recombinant adenoviruses. 42. Process according to claim 39, further comprising the step (f) amplification of the recombinant adenoviruses. 43. Process according to claim 42, wherein the amplification is done on cells which express the site-specific recombinase. 44. Process according to claim 42, wherein the amplification is done on cells which express the site-specific recombinase. 45. Process according to claim 39, further comprising the step (g) Purification of the recombinant adenoviruses through density gradient centrifugation or affinity chromatography. 46. Recombinant adenoviruses population produced using a process according to claim 39. 47. Recombinant adenovirus population according to claim 46, wherein the recombinant population is a clonal population. 48. Recombinant adenovirus population according to claim 46, wherein the recombinant population is a complex population. 49. Clonal adenovirus population according to claim 47, wherein there is present an expression cassette as foreign DNA, which contains (a) a promoter, (b) an open reading frame of a gene, (c) a polyadenylation signal, (d) where appropriate, at least one insulator, (e) where appropriate, at least one intron and, (f) where appropriate, at least one enhancer. 50. Complex adenovirus population according to claim 48, wherein there is present a mixture of different DNA sequences as foreign DNA. 51. Complex adenovirus population according to claim 48, wherein there is present a mixture of non-coding DNA sequences as foreign DNA. 52. Complex adenovirus population according to claim 48, wherein there is present a mixture of coding DNA sequences as foreign DNA. 53. Complex adenovirus population according to claim 48, wherein there is present a mixture of expression units as foreign DNA, with which there are different coding DNA sequences under the control of the same promoter and polyadenylation signal. 54. Complex adenovirus population according to claim 48, wherein there is present a cDNA library as a mixture of coding sequences. 55. Complex adenovirus population according to claim 48, wherein there is present a mixture of variants of an individual gene as a mixture of coding sequences, which are distinguished at least in individual base pair positions, and/or insertions or deletions of at least one base pair. 56. Complex adenovirus population according to claim 48, wherein there is present a mixture of expression units as foreign DNA, with which different promoters, which differ in one bp position at least, and/or contain insertions or deletions of at least one base pair, control the expression of the same coding DNA sequence. 57. Utilization of a recombinant adenovirus population, according to claim 46, for the transfer of genetic material in cells or/and animals, in particular into human cells or/and humans. 58. Utilization according to claim 57 for the gene transfer and the expression of genes in cells. 59. Utilization according to claim 57 for the transfer of genetic material into animals or/and humans for gene therapy or/and vaccination. 60. Utilization according to claim 57 for the gene transfer into cells or cell complexes, which exhibit changed, in particular, sick appearances. 61. Utilization according to claim 60 for the therapy of inherited, acquired or malignant disease. 62. Utilization according to claim 57 for the DNA vaccination, in particular for vaccination against pathogens, such as viruses, bacteria, as well as single-cell or multiple-cell eukaryotes, or for the vaccination against malignant or non-malignant cells and/or cell populations. 63. Utilization of a complex population of recombinant adenoviruses according to claim 53, for the isolation, where appropriate, of new genes which cause a certain phenotype in a cell-based test system. 64. Utilization of a complex population of recombinant adenoviruses according to claim 55, for the isolation of variants of a gene with changed properties. 65. Utilization of a complex population of recombinant adenoviruses according to claim 56, for the isolation of variants of a promoter with changed properties. 66. Utilization of a complex population of recombinant adenoviruses according to claim 51, for the isolation of sequences with certain binding sites for proteins. 67. Process for the generation of masterplates with clonal or low complexity sub-populations, from a complex population of adenoviruses, comprising (a) the titration of the complex population of recombinant adenoviruses, (b) the infection of producer cells cultivated in multititer plates, with only one or few infectious particles of the recombinant adenovirus population per multititer plate well, (c) the lysis of the producer cells in the multititer plate after occurrence of the cytopathic effect and (d) the storage of the masterplates in frozen status. 68. Masterplates available with a process according to claim 67. 69. Process for the identification of clonal or low complexity sub-populations from a complex population of adenoviruses, which cause a certain verifiable phenotype in a cell-based test system, comprising (a) the utilization of the virus-containing supernatants of the lysed cells in masterplates, which are available in accordance with a process according to claim 67, for the infection of the cells of the functional test system, (b) the implementation of the functional test with the infected cells of the test system and (c) the identification of the well(s) of the masterplates, which contains/contain the viruses with the required functional properties. 70. Process according to claim 69, further comprising (d) the clonal separation of the recombinant adenoviruses through plaque assay on a producer cell line, (e) the cultivation of the thus obtained clonal recombinant adenovirus population and the characterization of the foreign DNA contained in it. 71-74. (canceled) 75. A method for isolating new genes which result in a certain phenotype in a cell-based test system comprising (a) producing masterplates according to claim 67 for the infection of cells of a functional test system, (b) implementing the functional test with the infected cells of the test system, (c) identifying the well(s) of the masterplates, which contains/contain the viruses with the required functional properties, (d) clonal separation of any recombinant adenoviruses through plaque assay on a producer cell line, and (e) cultivating the thus obtained clonal recombinant adenovirus population and characterizing any foreign DNA contained in it in order to isolate new genes. 76. A method for isolating variants of a gene with changed properties, isolating variants of a promoter with changed properties or isolating sequences with certain binding sites for proteins, comprising (a) producing masterplates according to claim 67 for the infection of cells of a functional test system, (b) implementing the functional test with the infected cells of the test system, (c) identifying the well(s) of the masterplates, which contains/contain the viruses with the required functional properties, (d) clonally separating any recombinant adenoviruses through plaque assay on a producer cell line, and (e) cultivating the thus obtained clonal recombinant adenovirus population and characterizing any foreign DNA contained in it in order to identify variants of a gene with changed properties, isolate variants of a promoter with changed properties and/or isolate sequences with certain binding sites for proteins. |
Method for phosporous quantitation |
A method of detecting and measuring phosphorus in samples is disclosed. The measurement of phosphorylation is made with an inductively coupled plasma mass spectrometer (ICP-MS), coupled to a reactive collision cell. The reactive collision cell is employed to ensure in inteference-free detection of phosphorus ions, by the: formation of product ions, with a different mass to charge ratio. Accurate Measurement of phosphorylation in samples is important in proteomics. |
1. A method for detecting and measuring the degree of phosphorylation in a sample, comprising: (i) introducing the sample containing an analyte into an inductively coupled plasma mass spectrometer having a reactive collision cell, and producing analyte ions; (ii) reacting the analyte ions with a reactive gas, producing product ions with a different mass to charge ratio than the analyte ions which provides interference-free detection; (iii) detecting and measuring a signal or combination of signals from a product phosphorus-containing ion and a signal or combination of signals from a second ion, wherein the second ion is specific to the sample and is one of an ion and a plurality of ions; and (iv) computing one of the ratio and plurality of ratios, of the signal or combination of signals from the product phosphorus-containing ions to the signal or combination of signals from the second ions, to determine the degree of phosphorylation in the sample. 2. The method of claim 1 wherein the reactive collision cell is a Dynanic Reaction Cell™. 3. The method of claim 2 wherein the second ion or plurality of second ions are specific to the sample and are selected from the group consisting of non-phosphorus-containing analyte ions, non-phosphorus-containing product ions, and combinations thereof. 4. The method of claim 3 further comprising detecting and measuring a plurality of isotopes of the product phospborus-containing ion and the second ions and computing a plurality of ratios of product phosphorus-containing ions to second ions. 5. The method of claim 3 wherein the second ion is selected from the group consisting of sulfur-containing ions and sodium. 6. The method of claim 3 wherein the sample is selected from the group consisting of proteins, polypeptides, cells, cell lines, cell lysates nucleic acids, sugars, and mixtures thereof. 7. The method of claim 3 wherein the product ions are ions that have been oxidized. 8. The method of claim 7 wherein the reactive gas is selected from the group consisting of O2, N2O and CO2. 9. The method of claim 3 wherein the product ions are ions that have been fluorinated. 10. The method of claim 9 wherein the reactive gas is CH3F. 11. The method of claim 3 wherein the product ions contain an allyl group. 12. The method of claim 11 wherein the reactive gas is selected from the group consisting of CH4, C2H4 and C2H6. 13. The method of claim 3 further comprising controlling the pressure and potentials on the field defining elements of the reactive collision cell. 14. The method of claim 3 further comprising controlling the axial field in the reactive collision cell such that it is accelerating. 15. The method of claim 3 further comprising controlling the axial field in the reactive collision cell such that it is decelerating. 16. The method of claim 3 wherein the step of sample introduction comprises laser ablation. 17. The method of claim 16 wherein the sample contains SDS denatured proteins and the second ion is Na+. 18. A system that detects and measures the degree of phosphorylation in a sample, comprising: (i) means for introducing the sample containing an analyte into an inductively coupled plasma mass spectrometer having a reactive collision cell, and producing analyte ions; (ii) means for reacting the analyte ions with a reactive gas, producing product ions with a different mass to charge ratio than the analyte ions which provides interference-free detection; (iii) means for detecting and measuring a signal or combination of signals from a product phosphorus-containing ion and a signal or combination of signals from a second ion, wherein the second ion is specific to the sample and is one of an ion and a plurality of ions; and (iv) means for computing one of the ratio and plurality of ratios, of the signal or combination of signals from the product phosphorus-containing ions to the signal or, combination of signals from the second ions, to determine the degree of phosphorylation in the sample. 19. Use of an inductively coupled mass spectrometer having a reactive collision cell for the detection and measurement of the degree of phosphorylation in a sample. 20. The method of claim 3 further comprising the step of tagging a biologically active material with an element, such that the biologically active material binds with the analyte in the sample. 21. The method of claim 3 further comprising the step of tagging the analyte with an element. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Organisms have evolved mechanisms to control cellular processes by the addition and removal of phosphate groups to and from molecules. Organisms use phosphorylation and dephosphorylation to transmit and integrate signals from their environment. For example, a pollen grain landing on a stigma leads to a series of protein phosphorylation events that ultimately triggers the onset of fertilization. In addition, phosphorylation is a mechanism for cellular regulation of processes such as cell division, cell growth and cell differentiation. In proteins, a phosphate group can modify serine, threonine, tyrosine, histidine, arginine, lysine, cysteine, glutamic acid and aspartic acid residues. The emerging field of proteomics deals with the characterization and regulation of proteins in organisms. Since phosphorylation plays such a major role in protein regulation, there is a need for an accurate, fast, simple and inexpensive method to measure the degree of phosphorylation in samples. Currently, the methods used to detect phosphorylation in a sample include fluorescent assays, radioimmunoassays, immobilized metal affinity chromatography (IMAC), two-dimensional electrophoretic gel separation (2-D PAGE) coupled with mass spectrometry detection, and liquid chromatography separation coupled with mass spectrometry detection. Normally detection of the mass spectrometer requires electrospray ionization (ESI) or matrix-assisted laser desorption ionization (MALDI). Methods for quantitation of phosphate include 31 P nuclear magnetic resonance spectroscopy (NMR) and radioisotope (γ- 32 P) labelling with scintillation counting or multiphoton (MPD) detection (Godovac-Zimmerman and Brown, 2001). However, the above methods are either laborious or hindered by the need to use radioisotopes, and are not considered quantitative in that they do not precisely determine the number of phosphate groups in the sample. These methods require a two-step process, whereby a portion of the sample is used to determine the phosphorous concentration, and another portion of the sample is used to determine the concentration of the sample. Thus, there is variability in the degree of sample utilization. For example, if one is assaying a protein sample, quantitation of the protein is required to accurately assess the number of phosphorylation sites per protein molecule. This measurement requires a completely different assay done independently of phosphate detection. The only truly accurate method for determining protein concentration is to acid hydrolyse a portion of the sample and then perform amino acid analysis on the hydrolysate (Wilson and Walker, 2000). Other approximate methods rely on the presence of particular amino acid residues in the proteins. For example, tyrosine and typtophan are measured in ultraviolet absorption, and arginine and lysine are measured in the Bradford colorimetric assay. The Kjeldahl analysis measures total nitrogen, and the far ultraviolet absorption method is based on the number of peptide bonds. However, these assays are relative as the concentration of particular amino acid residues and even nitrogen in proteins varies significantly (Wilson and Walker, 2000). Recently, Wind et al. (2001) disclosed a method for determining ale degree of protein phosphorylation by the simultaneous detection of phosphorus and sulfur ions using inductively coupled plasma mass spectrometry (ICP-MS). However, this method required ‘adjustments’ to avoid or minimize isobaric interference. For example, a very slow flow rate was required (4 microlitre/minute) to minimize isobaric interferences from solvent molecules. The method required the use of ‘high resolution’ ICP-MS, which is a very expensive instrument and generally is not used for routine measurements. These restrictions make the method laborious and expensive. Thus, the current methods to determine the degree of phosphorylation of a sample either (i) lack accurate quantitation, (ii) require a two-step process, or (iii) they require a very expensive machine. The use of ICP-MS to detect phosphorus and quantify the degree of phosphorylation in samples is hindered by the low degree of ionization of phosphorus (33%) and the elements that can characterize a biological sample namely O, N, H (0.1%), C (5%), S (14%). The degrees of ionization given here in the brackets are taken from Houk, R. S., 1986. Another limitation is the presence of high background of these ions that originate from the plasma ion source, sample matrix or the vacuum system of the instrument, and also the presence of spectral interferences of other atomic or polyatomic ions at the same mass of the ions of interest. For example, 31 P + is interfered by the presence of 15 N 16 O + , 14 N 17 O + , 14 N 16 OH + and others. The latter limitation is referred to as isobaric interference. U.S. Pat. No. 6,140,638 to Tanner and Baranov, discloses a reactive collision cell used in conjunction with an inductively coupled plasma mass spectrometer (ICP-MS), to reduce isobaric interference, by reactive removal of the interference, in which a dynamic bandpass is employed to reject intermediate ions which would otherwise react to form new isobaric interferences. Recently, this reactive collision cell has also been used to produce secondary ions or product ions with a different mass to charge ratio than the interfering ions, to minimize isobaric interference (Baranov and Tanner, 1998; Tanner and Baranov, 1998; Baranov and Tanner, 1999;Tanner and Baranov, 1999; Bollinger and Schleisman, 1999). WO 01/01446 to Todd et al., 2000 discloses a similar approach to minimize isobaric interference using a different apparatus. Similarly, Eiden et al., 1997, discloses the use of an Ion Trap Mass Spectrometer coupled to an octopole ion guide/collision cell to avoid isobaric interference, by using reactions to remove interferences to a different mass. Both these references use different instruments and do not deal with the detection and measurement of the degree of phosphorylation in samples. With the great potential offered by the emerging field of proteomics, there is a need for the detection and measurement of the degree of phosphorylation in biological samples. There is a need for rapid method for quantitation, employing simultaneous measurement of the concentration of phosphorus and the concentration of the sample. Further, there is a need for a rapid and accurate confirmation of the results. Further still, there is a need for a simple and cheap method, requiring a small and relatively inexpensive machine. |
<SOH> SUMMARY OF THE INVENTION <EOH>The last two decades have seen the improvement of elemental analysis due to the development of the inductively coupled plasma (ICP) source using mass or optical spectrometry. This has resulted in ultra sensitive spectrometers with high matrix tolerance and means of resolving isotopic and spectral interferences. The present invention has coupled the developments in this field with the continuing need to provide rapid and precise detection and measurement in biological assays. The invention discloses a method to determine the degree of phosphorylation in a sample using a mass spectrometer. According to one aspect of the present invention, there is provided a method for detecting and measuring the degree of phosphorylation in a sample, comprising: (i) introducing the sample containing an analyte into an inductively coupled plasma mass spectrometer having a reactive collision cell, and producing analyte ions, (ii) reacting the analyte ions with a reactive gas, producing product ions with a different mass to charge ratio than the analyte ions which provides interference-free detection, (iii) detecting and measuring a signal or combination of signals from a product phosphorus-containing ion and a signal or combination of signals from a second ion, wherein the second ion is specific to the sample and is one of an ion and a plurality of ions, and (iv) computing one of the ratio and plurality of ratios, of the signal or combination of signals from the product phosphorus-containing ions to the signal or combination of signals from the second ions, to determine the degree of phosphorylation in the sample. According to another aspect of the present invention, there is provided a system that detects and measures the degree of phosphorylation in a sample, comprising: (i) means for introducing the sample containing an analyte into an inductively coupled plasma mass spectrometer having a reactive collision cell, and producing analyte ions, (ii) means for reacting the analyte ions with a reactive gas, producing product ions with a different mass to charge ratio than the analyte ions which provides interference-free detection, (iii) means for detecting and measuring a signal or combination of signals from a product phosphorus-containing ion and a signal or combination of signals from a second ion, wherein the second ion is specific to the sample and is one of an ion and a plurality of ions, and (iv) means for computing one of the ratio and plurality of ratios, of the signal or combination of signals from the product phosphorus-containing ions to the signal or combination of signals from the second ions, to determine the degree of phosphorylation in the sample. According to another aspect of the present invention, there is provided the use of an inductively coupled mass spectrometer having a reactive collision cell for the detection and measurement of the degree of phosphorylation in a sample. Other features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. |
Rollover determination system and method |
A rollover determination system 20 includes a first roll rate sensor 22, a lateral G-sensor 26, and a main rollover determination unit 30. The first roll rate sensor 22 detects roll rate of a vehicle. The lateral G-sensor 26 detects acceleration in the lateral direction of the vehicle. The main rollover determination unit 30 determines a possibility of rollover of the vehicle based on roll rate RR and lateral acceleration Gy. A safing determination unit 70 for confirming an occurrence of rollover is additionally incorporated in the main rollover determination unit 30. |
1. A rollover determination system comprising: a first roll rate sensor that detects a first roll rate of a vehicle; a second roll rate sensor that detects a second roll rate of the vehicle; a lateral acceleration sensor that detects a lateral acceleration of the vehicle in a lateral direction of the vehicle; and a controller that makes a determination whether there is a possibility of rollover of the vehicle on the basis of at least one of the first roll rate detected by the first roll rate sensor and the second roll rate detected by the second roll rate sensor together with the lateral acceleration detected by the lateral acceleration sensor, wherein the first roll rate sensor and the second roll rate sensor are arranged to detect a rotational angular velocity about a longitudinal axis of the vehicle. 2. A rollover determination system according to claim 1, wherein the controller makes a determination whether there is a possibility of rollover of the vehicle on the basis of the first roll rate, second roll rate, and the lateral acceleration. 3. A rollover determination system according to claim 1, wherein the controller makes the determination whether there is a possibility of rollover of the vehicle in accordance with at least one map indicating a relationship between two parameters selected from the roll rate, a roll angle obtained by integrating the roll rate with respect to time, and the lateral acceleration. 4. A rollover determination system according to claim 3, wherein the controller makes the determination whether there is a possibility of rollover of the vehicle by determining whether the roll rate exceeds a predetermined threshold value within a predetermined time period measured from detection of the roll rate. 5. A rollover determination system according to claim 5, wherein the controller makes, in parallel to the first determination, a second determination whether there is a possibility of rollover of the vehicle on the basis of the first roll rate and the second roll rate. 6. A rollover determination system according to claim 5, wherein the controller makes the first determination and the second determination whether there is a possibility of rollover of the vehicle in parallel in accordance with at least one map indicating a relationship between two parameters selected from the roll rate, a roll angle obtained by integrating the roll rate with respect to time, and the lateral acceleration. 7. A method of determining a rollover comprising the steps of: detecting a first roll rate of a vehicle, detecting a second roll rate of the vehicle; detecting a lateral acceleration of the vehicle in a lateral direction of the vehicle, and determining whether there is a possibility of rollover of the vehicle on the basis of at least one of the first roll rate and the second roll rate together with the lateral acceleration, wherein the first and second roll rates are detected by measuring a rotational angular velocity about a longitudinal axis of the vehicle. 8. A method of determining a rollover according to claim 7, wherein it is determined whether there is a possibility of rollover of the vehicle on the basis of the first roll rate, second roll rate, and the lateral acceleration. 9. A method of determining a rollover according to claim 7, wherein the determination whether there is a possibility of rollover of the vehicle is made in accordance with at least one map indicating a relationship between two parameters selected from the roll rate, a roll angle obtained by integrating the roll rate with respect to time, and the lateral acceleration. 10. A method of determining a rollover according to claim 9, wherein the determination is made whether there is a possibility of rollover of the vehicle is made by determining whether the roll rate exceeds a predetermined threshold value within a predetermined time period measured from detection of the roll rate. 11. A method of determining a rollover according to claim 8, wherein the determination is a first determination and the method further comprises the step of making, in parallel to the first determination, a second determination whether there is a possibility of rollover of the vehicle on the basis of the first roll rate and the second roll rate. 12. A method of determining a rollover according to claim 11, wherein the first determination and the second determination whether there is a possibility of rollover of the vehicle are made in parallel in accordance with at least one map indicating a relationship between two parameters selected from the roll rate, a roll angle obtained by integrating the roll rate with respect to time, and the lateral acceleration. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of Invention The invention relates to a rollover determination system for determining a possibility of a rollover of a vehicle. The rollover determination system is mounted on a vehicle as a preprocessing system of an occupant protection device such as a side airbag and is adapted to activate the occupant protection device immediately and appropriately in the event of the vehicle rollover. 2. Description of Related Art A rollover determination system for determining a rollover of a vehicle is disclosed in Japanese Laid-open Patent Publication No. 2000-9599. In this system, it is determined whether the vehicle is in a rollover state at an earlier stage on the basis of not only a rotational angular velocity in the longitudinal direction of the vehicle, but also a roll rate that represents a lateral acceleration of the vehicle. The aforementioned rollover determination system uses the lateral acceleration as well as the rotational angular velocity for the detection of a rollover of the vehicle. This makes it possible to activate an occupant protection device so as to protect the occupant of the vehicle in the event of the rollover. Upon collision of the vehicle at its front portion (front-end collision), an air bag for the front-end collision is deployed based on a detected value of an acceleration sensor (a G-sensor) disposed in the vehicle. The acceleration sensor detects longitudinal acceleration of the vehicle. Recently, a safing function has been added to the determination system for the deployment of the airbag for the front-end collision so as to prevent the airbag or the like from being activated by mistake. Assuming that deployment of the airbag is determined on the basis of a signal sent from a single G sensor, the airbag may be deployed in accordance with a wrong determination made on the basis of the error signal of the G sensor owing to noise, or failure of the G sensor. The safing function is added to the collision determination system in order to prevent undesired activation of the occupant protecting device in accordance with the wrong determination. For achieving the above-described safing function, for example, regarding front-end collisions, a mechanical safing sensor is provided at a central portion of a vehicle in addition to the G sensor provided in a front portion of the vehicle so that the front-end collision is detected using values sent from a plurality of sensors. The aforementioned safing function is applicable to a side collision of the vehicle. Detected values of a plurality of lateral acceleration sensors (G sensors) mounted in different portions of the vehicle are combined, based on which the side collision of the vehicle can be accurately detected. In the event the vehicle is rolled over, the occupant is hit against the side of a passenger compartment. Accordingly the occupant protection device, for example, the side airbag, curtain shield airbag, seat belt pretensioning device and the like is activated. Like the front-collision, it is undesirable that the occupant protection device for the rollover is activated faultily. It is preferable that the safing function be operated during determination of the vehicle rollover as in the case of the front-end collision. Any satisfactory proposal, however, has not been made yet with respect to the aforementioned function. There has been proposed to prevent faulty activation of the occupant protection device for the front-collision or the side-collision by operating the safing function. The technology for operating the safing function for preventing faulty activation of the occupant protection device has not been considered to a satisfactory level. Furthermore it is preferable that determination of the vehicle rollover be made 20 on the basis of the lateral acceleration as well as the roll rate. However, any proposal with respect to the safing sensor used for determining the vehicle rollover has not been made yet. The mechanical sensor may be used as the safing sensor used for detecting the rollover as in the case of the front-collision. The mechanical sensor that is capable of accurately determining the vehicle rollover has not been introduced yet. Use of the safing sensor with a response lag may delay the determination of the vehicle rollover. Meanwhile, the safing sensor with excessively high sensitivity may be brought into ON state frequently even when the vehicle is in a normal running state, failing to perform the intended safing operation. . |
<SOH> SUMMARY OF THE INVENTION <EOH>It is therefore an object of the invention to provide a rollover determination system which incorporates a safing function and is capable of accurately determining a possibility of the vehicle rollover. A rollover determination system includes a first roll rate sensor that detects a first roll rate of a vehicle, a lateral acceleration sensor that detects a lateral acceleration of the vehicle in a lateral direction of the vehicle, and a controller that determines whether there is a possibility of rollover of the vehicle on the basis of the first roll rate detected by the first roll rate sensor and the lateral acceleration detected by the lateral acceleration sensor, wherein the controller makes a determination that confirms the possibility of rollover of the vehicle. According to the embodiment of the invention, the safing function is added to the rollover determination system which allows determination of the vehicle rollover by eliminating faulty determination. The rollover determination system further includes a second roll rate sensor that detects a second roll rate of the vehicle such that a determination is made whether there is a possibility of rollover of the vehicle on the basis of the first roll rate, second roll rate, and the lateral acceleration. According to another embodiment of the invention, the rollover determination system is provided by changing the structure of the system, that is, adding another roll rate sensor. The controller may be designed to perform both the vehicle rollover determination and the safing determination. The determination is made whether there is a possibility of rollover of the vehicle in accordance with at least one map indicating a relationship between two parameters selected from the roll rate, a roll angle obtained by integrating the roll rate with respect to time, and the lateral acceleration. According to the embodiment of the invention, the safing determination is made in the same way as in the determination of the vehicle rollover. The resultant rollover determination system, thus, can be simplified. The safing determination does not necessarily require the map for performing the safing determination. For example, the safing determination may be performed by determining whether the roll rate exceeds a predetermined threshold value within a predetermined time period elapsing from detection of the roll rate. The rollover determination system may incorporate the safing function rather than adding the safing function to the rollover determination system. A rollover determination system includes a first roll rate sensor that detects a first roll rate of a vehicle, a second roll rate sensor that detects a second roll rate of the vehicle, a lateral acceleration detector that detects a lateral acceleration in a lateral direction of the vehicle. In the rollover determination system, a first determination is made whether there is a possibility of rollover of the vehicle on the basis of the first roll rate detected by the first roll rate sensor and the second roll rate detected by the second roll rate sensor. In the rollover determination system, a second determination is made whether there is a possibility of rollover of the vehicle on the basis of the lateral acceleration detected by the lateral acceleration detector and the first and second roll rate detected by the first and the second roll rate sensors, respectively. The first and the second determinations are made in parallel. According to another embodiment of the invention, a first rollover determination is performed for determining the rollover on the basis of the roll rate in parallel with a second rollover determination for determining the rollover of the vehicle on the basis of the lateral acceleration and the roll rate. This structure corresponds to the rollover determination system that incorporates the safing function. This makes it possible to perform the rollover determination while suppressing faulty determination. |
Use of a class of antiviral compounds for production of an agent for the treatment or prevention of a viral infection in the respiratory tract |
The invention discloses a use of dithiocarbamate compounds having the structural formula R1R2NCS2H, in which R1 and R2, independently of each other, represent a straight or branched C1-C4 alkyl, or, with the nitrogen atom, form an aliphatic ring with 4 to 6 C atoms, in which R1, R2, or the aliphatic ring is optionally substituted with one or more substituents selected from OH, NO2, NH2, COOH, SH, F, Cl, Br, I, methyl or ethyl, and oxidized forms of these compounds, in particular dimers thereof, as well as pharmaceutically acceptable salts thereof, to prepare an agent for treating or preventing an infection by RNA viruses which attack the respiratory tract and cause disease there. |
1-15. (canceled) 16. A method of treating or preventing an infection by an RNA virus which attacks the respiratory tract and causes disease therein, comprising: obtaining an agent comprising a dithiocarbamate compound having the structural formula R1R2NCS2H, in which R1 and R2, independently of each other, represent a straight or branched C1-C4 alkyl, or, with the nitrogen atom, form an aliphatic ring with 4 to 6 C atoms or a pharmaceutically acceptable salt thereof; and administering the agent to a subject. 17. The method of claim 16, where in R1, R2, or the aliphatic ring is further defined as substituted with one or more of OH, NO2, NH2, COOH, SH, F, Cl, Br, I, or methyl, ethyl, or oxidized forms thereof. 18. The method of claim 16, wherein R1, R2, or the aliphatic ring is further defined as substituted with dimers of one or more of OH, NO2, NH2, COOH, SH, F, Cl, Br, I, or methyl, ethyl, or oxidized forms thereof. 19. The method of claim 16, wherein R1 and R2, independently of each other, represent a C1-C3 alkyl, or, with the nitrogen atom, form an aliphatic ring with 4 to 6 C atoms. 20. The method of claim 16, wherein the dithiocarbamate compound is pyrrolidine dithiocarbamate or N,N-diethyl dithiocarbamate. 21. The method of claim 16, wherein the infection is an infection with picomavirus, ortho-myxovirus, rhinovirus, enterovirus, Coxsackie virus, aphthovirus, or paramyxovirus. 22. The method of claim 21, wherein the infection is an infection with influenza A virus, influenza B virus, influenza C virus, parainfluenza virus, pneumovirus, human rhinovirus, equine rhinovirus, enterovirus 70, enterovirus 71, foot and mouth disease virus, or equine rhinitis virus A. 23. The method of claim 21, wherein the infection is an infection with influenza A virus. 24. The method of claim 16, wherein the dithiocarbamate compound is comprised in the agent at a concentration of from 0.01 to 5000 mM. 25. The method of claim 24, wherein the dithiocarbamate compound is comprised in the agent at a concentration of from 1 to 300 mM. 26. The method of claim 25, wherein the dithiocarbamate compound is comprised in the agent at a concentration of from 10 to 100 mM. 27. The method of claim 16, wherein the dithiocarbamate compound is comprised in the agent at a concentration of 10 mM to 1 M. 28. The method of claim 16, wherein the agent further comprises a pharmaceutically acceptable carrier. 29. The method of claim 16, wherein the agent is adapted for oral, intranasal, intravenous, rectal, parenteral, eye drop, ear drop, gargle, or aerosol administration. 30. The method of claim 16, wherein the agent comprises further antiviral substances. 31. The method of claim 16, wherein the agent comprises a combination of at least two different dithiocarbamate compounds. 32. The method of claim 16, wherein the agent comprises an antibiotic, vaccine, immune suppressant, stabilizer, immune-stimulating substance, blood product, or mixture thereof. 33. The method of claim 16, further defined as a method of inhibiting virus propagation. 34. A method of preparing a pharmaceutical composition adapted for treating or preventing an infection by an RNA virus which attacks the respiratory tract and causes disease therein, comprising: obtaining a dithiocarbamate compound having the structural formula R1R2NCS2H, in which R1 and R2, independently of each other, represent a straight or branched C1-C4 alkyl, or, with the nitrogen atom, form an aliphatic ring with 4 to 6 C atoms or a pharmaceutically acceptable salt thereof; and admixing the agent in a pharmaceutically acceptable carrier adapted for administration to a subject in a manner effective to treat or prevent an infection by an RNA virus which attacks the respiratory tract and causes disease therein. |
Device for detecting force acting on a tire |
A device for detecting force acting on a tire includes a detector (10) provided with respect to vehicle wheels for detecting force acting on a tire and a determining portion (14) for determining a detection abnormality of force acting on the tire by the detector based on at least either the detected value or a temporal changing tendency of the detected value. |
1-56. (cancelled). 57. A device for detecting force acting on a tire, which is mounted in a vehicle with plural vehicle wheels in which each vehicle wheel is configured by mounting the tire on the periphery of a disc wheel, comprising: at least one detector for detecting the force acting on a tire, which is provided on at least one of the plural vehicle wheels; and at least either a detecting portion determining a detection abnormality of force acting on the tire by the detector with the use of a detected value of the detector or a zero-point correcting portion correcting a zero point of the detector with the use of the detected value of the detector. 58. The device for detecting force acting on a tire according to claim 57, wherein: the determining portion performs the determination based on at least either the detected value or a temporal changing tendency of the detected value. 59. The device for detecting force acting on a tire according to claim 58, wherein: the determining portion includes a first abnormality determining portion determining that detection of the force acting on a tire is abnormal if the detected value has deviated from a limit value of the detected value that can be detectable under normal detection of the force acting on a tire. 60. The device for detecting force acting on a tire according to claim 59, wherein: the detector is provided with respect to all or some of the plural vehicle wheels, and the first abnormality determining portion includes a portion determining that detection of force acting on a tire by at least one of the plural detectors is abnormal if a total value of the plural detected values has deviated from a limit value of the total value that can be detectable under normal detection of force acting on a tire by all the plural detectors. 61. The device for detecting force acting on a tire according to claim 58, wherein: the determining portion includes a second abnormality determining portion determining that detection of the force acting on a tire is abnormal if the temporal changing tendency disconforms to generated load movement in a load movement generation state where the load movement is being generated in the vehicle based on movement of the vehicle. 62. The device for detecting force acting on a tire according to claim 61, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the second abnormality determining portion includes a portion determining that detection of vertical force by at least one of the plural detectors is abnormal if a total value of plural vertical forces detected by the plural detectors temporally changes in the load movement generation state. 63. The device for detecting force acting on a tire according to claim 61, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the determining portion includes a portion determining the load movement generation state based on relation among the plural detected values of the plural detectors. 64. The device for detecting force acting on a tire according to claim 58, wherein: the determining portion includes an abnormality mode identifying portion identifying the mode of detection abnormality of the force acting on a tire by determining a zero point to be abnormal if the detected value has deviated from the limit value that can be detectable under normal detection of the force acting on a tire by the detector and if the temporal changing tendency conforms to generated load movement in the load movement generation state where the load movement is being generated in the vehicle based on movement of the vehicle, and by determining a graph gradient indicating input/output characteristics of the detector to be abnormal if the detected value has deviated from the limit value and if the temporal changing tendency disconforms to the generated load movement in the load movement generation state. 65. The device for detecting force acting on a tire according to claim 64, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the determining portion includes a portion determining the load movement generation state based on relation among the plural detected values of the plural detectors. 66. The device for detecting force acting on a tire according to claim 58, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, plural forces acting on a tire to be detected by the plural detectors are affected by load movement in the opposite direction to each other in the load movement generation state where the load movement is being generated in the vehicle based on movement of the vehicle, and the determining portion includes an abnormal detector identifying portion identifying a particular detector with abnormal vertical force detection out of the plural detectors based on a direction of load movement and the temporal changing tendency of the total value of plural vertical forces detected by the plural detectors if the total value has deviated from a limit value that can be detectable under normal detection of the force acting on a tire and if the temporal changing tendency of the total value disconforms to the generated load movement in the load movement generation state. 67. The device for detecting force acting on a tire according to claim 65, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the determining portion includes a portion determining the load movement generation state based on relation among the plural detected values of the plural detectors. 68. The device for detecting force acting on a tire according to claim 58, wherein: the detector has a function of detecting horizontal force acting on the tire in the horizontal direction as the force acting on a tire, and the determining portion includes a third abnormality determining portion determining whether detection of the horizontal force is abnormal with the use of the quotient of the horizontal force, detected by the detector, divided by vertical force acting on the tire in the vertical direction. 69. The device for detecting force acting on a tire according to claim 68, wherein: the detector is provided with respect to all or some of the plural vehicle wheels, and the third abnormality determining portion includes a portion determining whether horizontal force detection of the detector with respect to at least one vehicle wheel is abnormal based on an individual value equivalent to road friction coefficient μ with respect to each of the vehicle wheels which is the quotient of horizontal force, detected by each of the detector of each of the vehicle wheels, divided by individual vertical force with respect to each of the vehicle wheels, and based on a general value equivalent to road friction coefficient μ with respect to the entire vehicle which is the quotient of a total value of the plural horizontal forces, detected by the plural detectors, divided by general vertical force with respect to the entire vehicle. 70. The device for detecting force acting on a tire according to claim 69, wherein: the portion includes a portion determining that horizontal force detection by the detector with respect to at least one of the vehicle wheels is abnormal if a graph gradient indicating corresponding relation between the individual value equivalent to road friction coefficient μ with respect to each of the vehicle wheels and the general value equivalent to road friction coefficient μ with respect to the entire vehicle has deviated from a normal gradient with respect to at least that one of the vehicle wheels. 71. The device for detecting force acting on a tire according to claim 68, wherein: the vehicle includes an acceleration sensor detecting acceleration acting on the vehicle in the same direction as the horizontal force, the detector is provided with respect to all or some of the plural vehicle wheels, and the third abnormality determining portion includes a portion determining that detection of the horizontal force is abnormal if the general value equivalent to road friction coefficient μ with respect to the entire vehicle, which is the quotient of a total value of the plural horizontal forces detected by the plural detectors divided by the general vertical force with respect to the entire vehicle, and the acceleration detected by the acceleration sensor disconform to each other. 72. The device for detecting force acting on a tire according to claim 71, wherein: the determining portion further includes an acceleration sensor abnormality determining portion determining that detection of the acceleration sensor is abnormal if the general value equivalent to road friction coefficient μ and the acceleration detected by the acceleration sensor disconform to each other and if a graph gradient indicating corresponding relation between the individual value equivalent to road friction coefficient μ with respect to each of the vehicle wheels, which is the quotient of horizontal force detected by each of the detectors of each of the vehicle wheels divided by the individual vertical force with respect to each of the vehicle wheels, and the acceleration detected by the acceleration sensor has deviated from a normal gradient in the same direction with respect to all the vehicle wheels. 73. The device for detecting force acting on a tire according to claim 71, wherein: the determining portion further includes a tire abnormality determining portion determining that a particular tire, which is a part of a particular vehicle wheel out of the plural vehicle wheels, is abnormal if a graph gradient indicating corresponding relation between the individual value equivalent to road friction coefficient μ, which is the quotient of horizontal force detected by each of the detectors of each of the vehicle wheels divided by the individual vertical force with respect that particular vehicle wheel, and the general value equivalent to road friction coefficient μ, has deviated from a normal gradient and if the general value equivalent to road friction coefficient μ and the acceleration detected by the acceleration sensor conform to each other. 74. The device for detecting force acting on a tire according to claim 57, wherein: the detector is provided with respect to all or some of the plural vehicle wheels, and based on at least either plural detected values of the plural detectors or temporal changing tendencies of the plural detected values, the determining portion performs at least one of the following steps: 1) a determination of whether detection of force acting on a tire by at least one of plural detectors is abnormal, 2) identification of a mode of the abnormality if the detection is determined to be abnormal, and 3) identification of a particular detector with a detection abnormality of force acting on a tire out of the plural detectors if the detection is determined to be abnormal. 75. The device for detecting force acting on a tire according to claim 74, wherein: the determining portion includes a first abnormality determining portion determining that detection of the force acting on a tire is abnormal if the detected value has deviated from a limit value of the detected value that can be detectable under normal detection of the force acting on a tire. 76. The device for detecting force acting on a tire according to claim 75, wherein: the detector is provided with respect to all or some of the plural vehicle wheels, and the first abnormality determining portion includes a portion determining that detection of force acting on a tire by at least one of the plural detectors is abnormal if a total value of the plural detected values has deviated from a limit value of the total value that can be detectable under normal detection of force acting on a tire by all the plural detectors. 77. The device for detecting force acting on a tire according to claim 74, wherein: the determining portion includes a second abnormality determining portion determining that detection of the force acting on a tire is abnormal if the temporal changing tendency disconforms to generated load movement in a load movement generation state where the load movement is being generated in the vehicle based on movement of the vehicle. 78. The device for detecting force acting on a tire according to claim 77, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the second abnormality determining portion includes a portion determining that detection of vertical force by at least one of the plural detectors is abnormal if a total value of plural vertical forces detected by the plural detectors temporally changes in the load movement generation state. 79. The device for detecting force acting on a tire according to claim 77, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the determining portion includes a portion determining the load movement generation state based on relation among the plural detected values of the plural detectors. 80. The device for detecting force acting on a tire according to claim 74, wherein: the determining portion includes an abnormality mode identifying portion identifying the mode of detection abnormality of the force acting on a tire by determining a zero point to be abnormal if the detected value has deviated from the limit value that can be detectable under normal detection of the force acting on a tire by the detector and if the temporal changing tendency conforms to generated load movement in the load movement generation state where the load movement is being generated in the vehicle based on movement of the vehicle, and by determining a graph gradient indicating input/output characteristics of the detector to be abnormal if the detected value has deviated from the limit value and if the temporal changing tendency disconforms to the generated load movement in the load movement generation state. 81. The device for detecting force acting on a tire according to claim 80, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the determining portion includes a portion determining the load movement generation state based on relation among the plural detected values of the plural detectors. 82. The device for detecting force acting on a tire according to claim 74, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, plural forces acting on a tire to be detected by the plural detectors are affected by load movement in the opposite direction to each other in the load movement generation state where the load movement is being generated in the vehicle based on movement of the vehicle, and the determining portion includes an abnormal detector identifying portion identifying a particular detector with abnormal vertical force detection out of the plural detectors based on a direction of load movement and the temporal changing tendency of the total value of plural vertical forces detected by the plural detectors if the total value has deviated from a limit value that can be detectable under normal detection of the force acting on a tire and if the temporal changing tendency of the total value disconforms to the generated load movement in the load movement generation state. 83. The device for detecting force acting on a tire according to claim 82, wherein: the detector is provided with respect to all or some of the plural vehicle wheels and has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the determining portion includes a portion determining the load movement generation state based on relation among the plural detected values of the plural detectors. 84. The device for detecting force acting on a tire according to claim 74, wherein: the detector has a function of detecting horizontal force acting on the tire in the horizontal direction as the force acting on a tire, and the determining portion includes a third abnormality determining portion determining whether detection of the horizontal force is abnormal with the use of the quotient of the horizontal force, detected by the detector, divided by vertical force acting on the tire in the vertical direction. 85. The device for detecting force acting on a tire according to claim 84, wherein: the detector is provided with respect to all or some of the plural vehicle wheels, and the third abnormality determining portion includes a portion determining whether horizontal force detection of the detector with respect to at least one vehicle wheel is abnormal based on an individual value equivalent to road friction coefficient μ with respect to each of the vehicle wheels which is the quotient of horizontal force, detected by each of the detector of each of the vehicle wheels, divided by individual vertical force with respect to each of the vehicle wheels, and based on a general value equivalent to road friction coefficient μ with respect to the entire vehicle which is the quotient of a total value of the plural horizontal forces, detected by the plural detectors, divided by general vertical force with respect to the entire vehicle. 86. The device for detecting force acting on a tire according to claim 85, wherein: the portion includes a portion determining that horizontal force detection by the detector with respect to at least one of the vehicle wheels is abnormal if a graph gradient indicating corresponding relation between the individual value equivalent to road friction coefficient μ with respect to each of the vehicle wheels and the general value equivalent to road friction coefficient μ with respect to the entire vehicle has deviated from a normal gradient with respect to at least that one of the vehicle wheels. 87. The device for detecting force acting on a tire according to claim 84, wherein: the vehicle includes an acceleration sensor detecting acceleration acting on the vehicle in the same direction as the horizontal force, the detector is provided with respect to all or some of the plural vehicle wheels, and the third abnormality determining portion includes a portion determining that detection of the horizontal force is abnormal if the general value equivalent to road friction coefficient μ with respect to the entire vehicle, which is the quotient of a total value of the plural horizontal forces detected by the plural detectors divided by the general vertical force with respect to the entire vehicle, and the acceleration detected by the acceleration sensor disconform to each other. 88. The device for detecting force acting on a tire according to claim 87, wherein: the determining portion further includes an acceleration sensor abnormality determining portion determining that detection of the acceleration sensor is abnormal if the general value equivalent to road friction coefficient μ and the acceleration detected by the acceleration sensor disconform to each other and if a graph gradient indicating corresponding relation between the individual value equivalent to road friction coefficient μ with respect to each of the vehicle wheels, which is the quotient of horizontal force detected by each of the detectors of each of the vehicle wheels divided by the individual vertical force with respect to each of the vehicle wheels, and the acceleration detected by the acceleration sensor has deviated from a normal gradient in the same direction with respect to all the vehicle wheels. 89. The device for detecting force acting on a tire according to claim 87, wherein: the determining portion further includes a tire abnormality determining portion determining that a particular tire, which is a part of a particular vehicle wheel out of the plural vehicle wheels, is abnormal if a graph gradient indicating corresponding relation between the individual value equivalent to road friction coefficient μ, which is the quotient of horizontal force detected by each of the detectors of each of the vehicle wheels divided by the individual vertical force with respect that particular vehicle wheel, and the general value equivalent to road friction coefficient μ has deviated from a normal gradient and if the general value equivalent to road friction coefficient μ and the acceleration detected by the acceleration sensor conform to each other. 90. The device for detecting force acting on a tire according to claim 57, wherein: the vehicle includes a vehicular state variable sensor detecting a state variable of the vehicle besides the device for detecting force acting on a tire, and the determining portion includes a fourth abnormality determining portion determining whether detection of the detector is abnormal based on a detected value of the vehicular state variable sensor and that of the detector. 91. The device for detecting force acting on a tire according to claim 90, wherein: the fourth abnormality determining portion includes a portion determining whether detection of the detector is abnormal based on relation between the detected value of the vehicular state variable sensor and that of the detector. 92. The device for detecting force acting on a tire according to claim 90, wherein: the fourth abnormality determining portion includes a portion determining that the detector is abnormal if the detected value of the vehicular state variable sensor and that of the detector disconform to each other. 93. The device for detecting force acting on a tire according to claim 90, wherein: the vehicular state variable sensor includes a manipulation state variable sensor detecting a state variable of manipulation carried out by a driver for changing the vehicular state, and the fourth abnormality determining portion includes a portion determining whether detection of the detector is abnormal based on the detected value of the vehicular state variable sensor and that of the detector. 94. The device for detecting force acting on a tire according to claim 90, wherein: the vehicle includes a brake actuated for inhibiting rotation of at least one of the plural vehicle wheels, the manipulation state variable sensor includes a brake action-related quantity obtaining device obtaining a quantity relating to action of the brake, the detector includes a braking torque detecting device detecting a braking torque generated in a vehicle wheel corresponding to the actuated brake as a physical quantity relating to the force acting on a tire, and the fourth abnormality determining portion includes a braking torque detecting device abnormality determining portion determining whether detection of the braking torque detecting device is abnormal based on the brake action-related quantity obtained by the brake action-related quantity obtaining device and the braking torque detected by the braking torque detecting device. 95. The device for detecting force acting on a tire according to claim 94, wherein: the braking torque detecting device abnormality determining portion includes a portion determining whether detection of the braking torque detecting device is abnormal based on relation between the brake action-related quantity obtained by the brake action-related quantity obtaining device and the braking torque detected by the braking torque detecting device. 96. The device for detecting force acting on a tire according to claim 94, wherein: the brake includes a friction brake inhibiting rotation of a corresponding vehicle wheel by pushing a friction engaging member against a brake rotating body rotating with the corresponding vehicle wheel, the brake action-related quantity obtaining device includes a pushing force-related quantity obtaining device obtaining a pushing force-related quantity relating to pushing force of the friction engaging member against the brake rotating body, and the braking torque detecting device abnormality determining portion includes a portion determining whether detection of the braking torque detecting device is abnormal with the use of the pushing force-related quantity obtained by the pushing force-related quantity obtaining device as the brake action-related quantity. 97. The device for detecting force acting on a tire according to claim 94, wherein: the brake includes a pushing device pushing the friction engaging member against the brake rotating body through actuation of the brake based on manipulation of a brake manipulating member by the driver, the brake action-related quantity obtaining device includes a manipulation state variable detecting device detecting a manipulation state variable indicating a manipulation state of the brake manipulating member by the driver, and the braking torque detecting device abnormality determining portion includes a portion determining whether detection of the braking torque detecting device is abnormal with the use of the manipulation state variable detected by the manipulation state variable detecting device as the brake action-related quantity. 98. The device for detecting force acting on a tire according to claim 94, wherein: the vehicle includes a pushing force control device controlling the pushing force of the friction engaging member against the brake rotating body, the brake includes a pushing device pushing the friction engaging member against the brake rotating body through actuation of the brake based on controls of the pushing force control device regardless of manipulation of the brake manipulating member by the driver, and the braking torque detecting device abnormality determining portion includes a portion determining whether detection of the braking torque detecting device is abnormal with the use of a control-related quantity relating to the controls of the pushing force control device as the brake action-related quantity. 99. The device for detecting force acting on a tire according to claim 94, wherein: the brake action-related quantity obtaining device includes an acceleration state detecting device detecting an acceleration state of the vehicle, and the braking torque detecting device abnormality determining portion includes a portion determining whether detection of the braking torque detecting device is abnormal with the use of an acceleration state variable indicating the acceleration state detected by the acceleration state detecting device as the brake action-related quantity. 100. The device for detecting force acting on a tire according to claim 94, wherein: the vehicle includes a driving torque-related quantity obtaining device obtaining a driving torque-related quantity relating to a driving torque applied to at least one of the plural vehicle wheels, and the braking torque detecting device abnormality determining portion includes a portion determining whether detection of the braking torque detecting device is abnormal in consideration of the driving torque-related quantity detected by the driving torque-related quantity obtaining device. 101. The device for detecting force acting on a tire according to claim 94, wherein: the vehicle includes a braking environmental variable detecting device detecting a braking environmental variable indicating an environment under which a particular vehicle wheel out of the plural vehicle wheels are being braked, and the braking torque detecting device abnormality determining portion includes a portion determining whether detection of the braking torque detecting device is abnormal based on relation between an obtained value of the brake action-related quantity and the detected value of the braking torque and the braking environmental variable detected by the braking environmental variable detecting device. 102. The device for detecting force acting on a tire according to claim 94, wherein: the braking torque detecting device abnormality determining portion includes a portion determining whether detection of the braking torque detecting device is abnormal if the brake is acting while the vehicle is traveling straight. 103. The device for detecting force acting on a tire according to claim 57, wherein: the detector is provided with respect to all or some of the plural vehicle wheels, and the determining portion includes a portion determining whether detection of at least one of the plural detectors is abnormal based on relation among detected values of the force acting on a tire with respect to the plural detectors. 104. The device for detecting force acting on a tire according to claim 57, wherein: the determining portion includes a portion determining whether detection of the detector is abnormal provided that a set condition, which has been so set as to be met in order to change the vehicular state, is met. 105. The device for detecting force acting on a tire according to claim 104, wherein: the set condition is a condition which is so set as to be met if the driver has changed the manipulation state of at least one of the following members: 1) an accelerator manipulating member, 2) the brake manipulating member, 3) a steering manipulating member, 4) a changing gear member manipulated by the driver in order to change gears of a driving force transmitting device of the vehicle, and 5) a direction switching member manipulated by the driver in order to change a traveling direction of the vehicle from forward to backward and vice versa. 106. The device for detecting force acting on a tire according to claim 57, wherein: the detector is provided in a position close to a corresponding vehicle wheel where the force acting on a tire to be detected is dynamically transmitted. 107. The device for detecting force acting on a tire according to claim 57, wherein: the force acting on a tire includes tire ground force acting on a tire at a contact point where the tire is in contact with a road surface. 108. The device for detecting force acting on a tire according to claim 57, wherein: the detector has a function of detecting plural types of forces acting on a corresponding tire as the force acting on a tire, and the determining portion includes a portion determining whether detection of the force acting on a tire by the detector is abnormal based on relation among the plural types of forces detected by the detector. 109. The device for detecting force acting on a tire according to claim 57, wherein: the determining portion is actuated at least either while the vehicle is moving or while the vehicle is at a stop. 110. The device for detecting force acting on a tire according to claim 109, wherein: the determining portion includes a portion determining whether detection of the force acting on a tire by the detector is abnormal based on the detected value of the detector and according to different rules depending on whether the vehicle is moving or it is at a stop. 111. The device for detecting force acting on a tire according to claim 109, wherein: the determining portion includes a portion determining whether detection of the force acting on a tire by the detector is abnormal provided that an abnormality determination permitting condition, preset with respect to a traveling state of the vehicle when at least the vehicle is moving, is met. 112. The device for detecting force acting on a tire according to claim 57, wherein: the detector has a function of detecting at least either one of the following forces: 1) at least one of the following forces; longitudinal force acting on the tire in the longitudinal direction, lateral force acting on the tire in the lateral direction, and vertical force acting on the tire in the vertical direction, 2) at least one of resultant forces of any two of the above-mentioned three forces: longitudinal force, lateral force, and vertical force. 113. The device for detecting force acting on a tire according to claim 112, wherein: the detector has a function of detecting the longitudinal force, the lateral force, and the vertical force as the force acting on a tire respectively. 114. The device for detecting force acting on a tire according to claim 113, wherein: the determining portion includes a portion determining whether detection of the detector is abnormal based on dynamic relation among the longitudinal force, the lateral force, and the vertical force which have been detected by the detector virtually at the same time. 115. The device for detecting force acting on a tire according to claim 114, wherein: the portion includes a portion determining that detection of the detector is abnormal if set relation, which is so preset as to be met if horizontal force as resultant force of the longitudinal force and the lateral force and the vertical force with respect to a tire corresponding to the detector share the same circle of friction, and the dynamic relation virtually unmatch each other. 116. The device for detecting force acting on a tire according to claim 57, wherein: the vehicle includes the vehicular state variable sensor detecting the state variable of the vehicle besides the device for detecting force acting on a tire, and the determining portion includes a fifth abnormality determining portion obtaining the same physical quantity as a physical quantity detected by the detector as a comparison physical quantity and determining that detection of the detector is abnormal if the obtained comparison physical quantity and the detected value of the detector disconform to each other. 117. The device for detecting force acting on a tire according to claim 57, wherein: the zero-point correcting portion includes a setting portion setting the zero point of the detector to a position indicating that the force acting on a tire is 0 in a reference vehicular state where an actual value of the force acting on a tire is expected to be 0. 118. The device for detecting force acting on a tire according to claim 117, wherein: the detector has a function of detecting horizontal force acting on the tire in the horizontal direction as the force acting on a tire, and the setting portion includes a reference vehicular state determining portion determining that the vehicle is in the reference vehicular state if the vehicle is at a stop with horizontal posture. 119. The device for detecting force acting on a tire according to claim 118, wherein: the detector is provided with respect to a front wheel and a rear wheel of the plural vehicle wheels, each detector has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the reference vehicular state determining portion includes a portion determining whether the vehicle is in the reference vehicular state where posture of the vehicle is horizontal with respect to the longitudinal direction thereof based on relative relation between the vertical forces detected with respect to the front and rear vehicle wheels. 120. The device for detecting force acting on a tire according to claim 118, wherein: the detector is provided with respect to a right wheel and a left wheel of the plural vehicle wheels, each detector has a function of detecting vertical force acting on the tire in the vertical direction as the force acting on a tire, and the reference vehicular state determining portion includes a portion determining whether the vehicle is in the reference vehicular state where posture of the vehicle is horizontal with respect to the lateral direction thereof based on relative relation between the vertical forces detected with respect to the right and left vehicle wheels. 121. The device for detecting force acting on a tire according to claim 117, wherein: the vehicle includes plural brakes provided to the plural vehicle wheels respectively and actuated for inhibiting rotation of the plural vehicle wheels individually, each of the detectors is provided to each of the plural vehicle wheels and has a function of detecting braking force acting on the tire as the force acting on a tire, and the setting portion includes a portion setting the zero points of some of the plural detectors in order when the vehicle is at a stop and causing a state where braking force is absent on a vehicle wheel provided with a particular detector subject to zero-point correction as the reference vehicular state by keeping the brake at a rest on the vehicle wheel provided with the particular detector subject to zero-point correction and by actuating the brake on at least one of the other vehicle wheels except the vehicle wheel provided with the particular detector at each zero-point correction. 122. The device for detecting force acting on a tire according to claim 117, wherein: the detector has a function of detecting lateral force acting on the tire in the lateral direction as the force acting on a tire, and the setting portion includes a portion setting the zero point when the vehicle is traveling straight. 123. The device for detecting force acting on a tire according to claim 117, wherein: the detector has a first portion detecting driving force rather than braking force and a second portion detecting braking force rather than driving force, the two portions are provided independently to each other to detect driving force and braking force acting on the tire as the force acting on a tire, and the setting portion includes portion setting the zero point with respect to the first portion when the vehicle is traveling and braking force is being generated in a vehicle wheel provided with the detector. 124. A device for detecting force acting on a tire, which is mounted in a vehicle with plural vehicle wheels in which each vehicle wheel is configured by mounting the tire on the periphery of a disc wheel, comprising: at least one detector for detecting the force acting on a tire, which is provided on at least one of the plural vehicle wheels; and a first abnormality determining portion determining whether detection of vertical force by the detector is abnormal based on vertical force rather than horizontal force detected by the detector. 125. The device for detecting force acting on a tire according to claim 124, wherein: the device includes a second abnormality determining portion determining whether detection of horizontal force by the detector is abnormal based on vertical force and horizontal force detected by the detector if detection of vertical force by the detector has been determined to be normal by the first abnormality determining portion. 126. A device for detecting force acting on a tire, which is mounted in a vehicle with plural vehicle wheels in which a vehicular state variable sensor detecting a state variable of the vehicle is provided and each vehicle wheel is configured by mounting the tire on the periphery of a disc wheel, comprising: at least one detector for detecting force acting on the tire, which is provided on at least one of the plural vehicle wheels, and at least either a sensor determining portion determining a detection abnormality of the vehicular state variable sensor with the use of a detected value of the detector or a sensor zero-point correcting portion correcting a zero point of the vehicular state variable sensor with the use of the detected value of the detector. 127. The device for detecting force acting on a tire according to claim 126, wherein: the vehicular state variable sensor has a function of detecting a physical quantity relating to the force acting on a tire as the vehicular state variable, and the sensor zero-point correcting portion includes a setting portion setting the zero point of the vehicular state variable sensor in a position indicating that the vehicular state variable is 0 if the force acting on a tire detected by the detector is 0. 128. The device for detecting force acting on a tire according to claim 126, wherein: the vehicular state variable sensor has a function of detecting a physical quantity relating to the force acting on a tire as the vehicular state variable, and the sensor zero-point correcting portion includes a setting portion setting the zero point of the vehicular state variable sensor based on an error between an ideal value of the physical quantity detected by the vehicular state variable sensor and the force acting on a tire detected by the detector if the force acting on a tire is equal to a reference value which is unequal to 0. |
<SOH> BACKGROUND OF THE INVENTION <EOH>One example of a conventional device for detecting force acting on a tire in a vehicle has been disclosed in Japanese Patent Application Laid-Open Publication No. 9-2240. In the conventional device, a stress sensor is inserted into a hole formed on a vehicle axis of the tire to detect the force acting on the tire. The stress sensor mainly comprises a strain gauge. The device in the publication is mounted on a vehicle including a vehicle wheel in which the tire is mounted on the periphery of a disc wheel, and a vehicle body having a retaining body integrally retaining the vehicle wheel with the disc wheel for enabling rotation of the vehicle wheel by mounting the disc wheel on the same axis as that of the vehicle wheel. The retaining body in this case may be referred to as a hub, a hub carrier, a carrier, a spindle, a disc wheel support, or the like. Abnormalities in detection of the device for detecting force acting on a tire may occur for some reason. Therefore, it is preferable that measures for avoiding the use of an abnormal detected value as a normal detected value be devised. However, the publication does not include a configuration for detecting abnormalities in the device for detecting force acting on a tire. On the other hand, a vehicular state variable sensor for detecting a state variable of a vehicle may be mounted on the vehicle in which the device for detecting force acting on a tire is mounted on. In this case, if the device for detecting force acting on a tire can be utilized to normalize detection of the vehicular state variable sensor, functions of the device for detecting force acting on a tire in the vehicle improve. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>The invention will be described with reference to the accompanying drawings, wherein: FIG. 1 is a front view showing an internal structure of a detector in a device for detecting force acting on a tire according to a first preferred embodiment of the invention; FIG. 2 is a sectional view taken along line 2 - 2 in FIG. 1 ; FIG. 3 is a perspective view showing relative positional relation between the detector, a disc wheel of a vehicle wheel and a hub on the vehicle body side in FIG. 1 ; FIG. 4 is a front view conceptually showing a longitudinal force detecting portion, which is for detecting longitudinal force of a tire, of the detector in FIG. 1 . FIG. 5 is a side sectional view conceptually showing the longitudinal force detecting portion in FIG. 4 ; FIG. 6 is a front view for conceptually explaining a principle of leverage employed by the longitudinal force detecting portion in FIG. 4 ; FIG. 7 is a front view for conceptually explaining another principle of leverage, which can be employed by the longitudinal force detecting portion in FIG. 4 ; FIG. 8 is a side sectional view conceptually showing a lateral force detecting portion, which is for detecting portion detecting lateral force on the tire, of the detector in FIG. 1 ; FIG. 9 is a front view conceptually showing a vertical force detecting portion, which is for detecting portion detecting vertical force on the tire of the detector in FIG. 1 ; FIG. 10 is a side sectional view conceptually showing the vertical force detecting portion in FIG. 9 ; FIG. 11 is a graph showing relation between loads F 1 and F 2 input to each detecting portion in FIG. 1 and strain of a strain gauge in each detecting portion; FIG. 12 is a block diagram showing an electrical configuration of the device for detecting force acting on a tire according to the first preferred embodiment of the invention; FIG. 13 is a graph showing how an output signal from the strain gauge of each detecting portion in FIG. 1 changes as a rotation angle of the detector in the same figure changes; FIG. 14 is a front view for explaining the types of force acting on the strain gauge of the vertical force detecting portion in FIG. 9 ; FIG. 15 is a flow chart conceptually showing a part of a vertical force detection abnormality determining program performed by a determining portion in FIG. 12 ; FIG. 16 is a flow chart conceptually showing the rest of the vertical force detection abnormality determining program; FIG. 17 is a flow chart conceptually showing a lateral force detection abnormality determining program performed by the determining portion in FIG. 12 ; FIG. 18 is flow chart conceptually showing a longitudinal force detection abnormality determining program performed by the determining portion in FIG. 12 ; FIG. 19 is a flow chart conceptually showing a vertical force detection zero-point correction program performed by a zero-point correcting portion in FIG. 12 ; FIG. 20 is a flow chart conceptually showing a lateral force detection zero-point correction program performed by the zero-point correcting portion in FIG. 12 ; FIG. 21 is a flow chart conceptually showing a longitudinal force detection zero-point correction program performed by the zero-point correcting portion in FIG. 12 ; FIG. 22 is a perspective view for explaining step S 101 in FIG. 15 ; FIG. 23 is a table showing the contents of a vertical force detection abnormality determining program in FIGS. 15 and 16 ; FIG. 24 is a perspective view for explaining step S 152 in FIG. 17 ; FIG. 25 is a graph for explaining step S 156 or step S 158 in FIG. 17 ; FIG. 26 is a perspective view for explaining step S 172 in FIG. 18 ; FIG. 27 is a graph for explaining step S 176 or step S 178 in FIG. 18 ; FIG. 28 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a second preferred embodiment of the invention; FIG. 29 is a flow chart conceptually showing a lateral force detection abnormality determining program performed by a determining portion in FIG. 28 ; FIG. 30 is a flow chart conceptually showing a longitudinal force detection abnormality determining program performed by the determining portion in FIG. 28 ; FIG. 31 is a graph for explaining step S 311 or step 313 in FIG. 29 ; FIG. 32 is a graph for explaining step S 361 or step 363 in FIG. 30 ; FIG. 33 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a third preferred embodiment of the invention; FIG. 34 is a flow chart conceptually showing a vertical force detection abnormality determining program performed by a determining portion in FIG. 33 ; FIG. 35 is a flow chart conceptually showing a lateral force detection abnormality determining program performed by the determining portion in FIG. 33 ; FIG. 36 is a flow chart conceptually showing a longitudinal force detection abnormality determining program performed by the determining portion in FIG. 33 ; FIG. 37 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a fourth preferred embodiment of the invention; FIG. 38 is a flow chart conceptually showing a lateral force detection abnormality determining program performed by a determining portion in FIG. 37 ; FIG. 39 is a graph for explaining step S 442 in FIG. 38 ; FIG. 40 is a graph for explaining step S 444 in FIG. 38 ; FIG. 41 is a graph for explaining the graph in FIG. 40 ; FIG. 42 is a graph for explaining step S 446 in FIG. 38 ; FIG. 43 is a graph for explaining the graph in FIG. 42 ; FIG. 44 is a front view showing an internal structure of a detector in a device for detecting force acting on a tire according to a fifth preferred embodiment of the invention; FIG. 45 is a sectional view taken from line 45 - 45 in FIG. 44 . FIG. 46 is a table showing the conditions by which each detecting portion in FIG. 44 detects longitudinal force, lateral force, and vertical force, respectively, on the tire; FIG. 47 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to the fifth preferred embodiment of the invention; FIG. 48 is a flow chart conceptually showing a driving force detection zero-point correction program performed by a zero-point correcting portion in FIG. 47 . FIG. 49 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a sixth preferred embodiment of the invention; FIG. 50 is a flow chart conceptually showing a sensor zero-point correction program performed by a sensor zero-point correcting portion in FIG. 49 ; FIG. 51 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a seventh preferred embodiment of the invention; FIG. 52 is a flow chart conceptually showing a lateral force detection abnormity determining program performed by a determining portion in FIG. 51 ; FIG. 53 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a eighth preferred embodiment of the invention; FIG. 54 is a flow chart conceptually showing a vertical force detection abnormity determining program performed by a determining portion in FIG. 53 ; FIG. 55 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a ninth preferred embodiment of the invention; FIG. 56 is a flow chart conceptually showing a general abnormality determining program performed by a determining portion in FIG. 55 ; FIG. 57 is a system diagram showing a hydraulic brake device including a brake controlling device which has a braking torque detecting device abnormality detecting device according to a tenth preferred embodiment of the invention; FIG. 58 is a front sectional view showing a brake in the hydraulic brake device in FIG. 57 ; FIG. 59 is a front sectional view and a hydraulic pressure circuit diagram for explaining a braking torque detecting device in the hydraulic brake device in FIG. 57 ; FIG. 60 is a block diagram showing an electrical configuration of the brake controlling device and each element connected thereto; FIG. 61 is a flow chart conceptually showing the contents of an abnormality detecting program stored in the ROM in FIG. 60 ; FIG. 62 is a flow chart conceptually showing the contents of an abnormality detecting program stored in a ROM of a brake controlling device including a braking torque detecting device abnormality detecting device according to an eleventh preferred embodiment of the invention; FIG. 63 is a flow chart conceptually showing the contents an abnormality detecting program stored in a ROM of a brake controlling device including a braking torque detecting device abnormality detecting device according to a twelfth preferred embodiment of the invention; FIG. 64 is a flow chart conceptually showing the contents an abnormality detecting program stored in a ROM of a brake controlling device including a braking torque detecting device abnormality detecting device according to a thirteenth preferred embodiment of the invention; FIG. 65 is a graph for explaining relation between the pushing force toward the disk rotor from the friction engaging member and the braking torque generated on the vehicle wheel corresponding to the disk rotor; FIG. 66 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a fourteenth preferred embodiment of the invention; FIG. 67 is a flow chart conceptually showing a lateral force detection abnormality determining program performed by a determining portion in FIG. 66 . FIG. 68 is a block diagram showing an electrical configuration of a device for detecting force acting on a tire according to a fifteenth preferred embodiment of the invention; FIG. 69 is a flow chart conceptually showing a vertical force detection abnormality determining program performed by a determining portion in FIG. 68 . detailed-description description="Detailed Description" end="lead"? |
Methods |
This invention relates to disgnostic methods for the detection of one or more cytochrome b mutations in fungi at the position corresponding to Saccharomyces cerevisiae cytochrome b residue 129 that leads to resistance to strobilurin analogues or compounds in the same cross resistance group using any (or a) single nucleotide polymorphism detection technique, preferably using either an allele specific amplilication technique such as the amplification refractory mutation system (ARMS) or preferably using an allele selective hybridisation probe technique such as Molecular Beacons or TaqMan. The invention also relates to mutation specific oligonucleotides for use in the method and to diagnostic kits containing these (oligonucleotides. |
1. A method for the detection of one or more mutations in a fungal cytochrome b gene resulting in an amino acid replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation(s) in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique. 2. The method according to claim 1 for the detection of one or more mutations in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation(s) in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique. 3. The method according to claim 1 wherein said method comprises detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation(s) in said nucleic acid. 4. The method according to claim 1 wherein said method uses an allele selective hybridisation probe technique. 5. A method for the diagnosis of one or more nucleotide polymorphisms in a fungal cytochrome b gene which method comprises determining the sequence of a fungal nucleic acid that encodes a fungal cytochrome b protein at a position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the fungal cytochrome b protein and determining the resistance status of the said fungi to a strobilurin analogue or a compound in the same cross resistance group by reference to one or more polymorphisms in the cytochrome b gene. 6. A method for detecting fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of one or more mutation(s) in a fungal nucleic acid encoding a fungal cytochrome b gene wherein the presence of said mutation(s) gives rise to resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of a single nucleotide polymorphism occurring at a position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the fungal cytochrome b protein. 7. The method according to claim 1 wherein a single nucleotide polymorphism mutation occurs at the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 8. The method according to claim 1 wherein a single nucleotide polymorphism mutation occurs at the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 9. The method according to claim 1 wherein the single nucleotide polymorphism mutation occurs at the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 10. The method according to claim 1 wherein the single nucleotide polymorphism mutation occurs at the first base in the triplet coding for the amino acid at position corresponding to S. cerevisiae cytochrome b residue 129. 11. A fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymorphism mutation at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein which results in the replacement of the normal phenylalanine residue with an alternative amino acid. 12. The fungal DNA sequence according to claim 11 wherein said alternative amino acid is a leucine residue. 13. The fungal DNA sequence according to claim 11 obtained or obtainable from a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici, Erysiphe graminis f.sp. hordei, Rhynchosporium secails, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Peronospora tabacina, Puccinia recondita and Puccinia horiana. 14. The fungal DNA sequence according to claim 13 obtained or obtainable from a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici, Erysiphe graminis f.sp. hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerelia fjiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola. 15. A method for the detection of the presence of absence of one or more mutation(s) in a fungal cytochrome b gene, said mutation(s) resulting in replacement in the encoded protein of a phenyalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129 said method comprising identifying the presence or absence of said mutation(s) in a sample of fungal nucleic acid wherein any (or a) single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. 16. The method according to claim 15 wherein said detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. 17. The method according to claim 16 wherein said detection method is based on the sequence infornation from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. 18. The method according to claim 16 wherein said detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. 19. An allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a wild type cytochrome b protein wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129. 20. An allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a wild type cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. triticii, Erysiphe graminis f.sp. hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella rjiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Peronospora tabacina, Puccinia recondita and Puccinia horiana wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129. 21. An allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a mutant cytochrome b protein wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding an amino acid selected from the group isoleucine, leucine, serine, cysteine, valine, tyrosine, and most preferably leucine at the position corresponding to S. cerevisiae cytochrome b residue 129. 22. The allele specific oligonucleotide according to claim 21 capable of binding to a fungal nucleic acid sequence encoding a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici, Erysiphe graminis f.sp. hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella filiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicol, Cercospora arachidola, Colletotrichum acutatum, wilsonomyces carpophillum, Didymella bryoniae, Peronospora tabacina, Puccinia recondita and Puccinia horiana wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding an amino acid selected from the group isoleucine, leucine, serine, cysteine, valine, tyrosine, and most preferably leucine at the position corresponding to S. cerevisiae cytochrome b residue 129. 23. An allele specific oligonucleotide probe capable of detecting a wild type cytochrome b gene sequence at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. 24. An allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymorphism at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. 25. The allele specific oligonucleotide probe according to claim 24 capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 26. The allele specific oligonucleotide probe according to claim 24 capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 27. The allele specific oligonucleotide probe according to claim 24 capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 28. The allele specific oligonucleotide probe according to claim 24, capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 29. An allele specific primer capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. 30. The allele specific primer according to claim 29 capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 31. The allele specific primer according to claim 29 capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 32. The allele specific primer according to claim 29 capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochromewsidue 129. 33. The allele specific primer according to claim 29 capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. 34. A diagnostic primer capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence at a position corresponding to first and/or the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group. 35. A diagnostic primer capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence at a position corresponding to first or the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group. 36. A kit for use in the method of any of claim 1. 37. The diagnostic kit according to claim 36 comprising one or more of the following: diagnostic, wild type, control and common oligonucleotide primers: appropriate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase and a buffer solution. 38. The kit according to claim 36 comprising an allele selective hybridisation probe and one or more of the following: oligonucleotide primers which allow the selective amplification of a segment of DNA comprising the region of the target pathogen cytochrome b gene including codon 129 from both wild type and isolates resistant to strobilurin analogue or any other compound in the same cross resistance group diagnostic wild type (F129) and resistant (A129) selective hybridisation probes, appropriate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase as previously described, and a buffer solution. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The widespread use of fungicides in agriculture is a relatively recent phenomenon, and most of the major developments have taken place during the last 40 years. Previously, farmers often ignored or did not recognise the effect that fungal pathogens had on the yield and quality of their crops. Nowadays, however these losses are unacceptable, and farmers rely on the use of fungicidal chemicals to control fungal diseases. As a consequence, commercial fungicides have become an important component of the total agrochemical business, with world-wide sales in 1996 of about $5.9 billion, equivalent to 18.9% of the total agrochemical market (Wood Mackenzie, 1997a ‘Agchem products—The key agrochemical product groups’, in Agrochemical Service, Update of the Products Section, May 1997, 1-74). A large number of fungicides are already available to the farmer; a recent edition of The Pesticide Manual (Tomlin, 1994 10 th Edition, British Crop Protection Council, Farnham, UK, and the Royal Society of Chemistry, Cambridge, UK) contains 158 different fungicidal active ingredients in current use. Nevertheless, further industrial research aimed at the discovery and development of new compounds is extremely intensive and product management procedures are extremely important in securing the best and longest lasting performance from fungicides with a particular mode of action and/or belonging to a particular compound series. In particular it is vital to develop effective resistance management strategies when fungicides with new modes of action are introduced (Fungicide Resistance Management: Into The Next Millenium (Russell) 1999, in Pesticide Outlook, October 1999 (213-215). The strobilurin analogues constitute a major new series of agricultural fungicides, which are considered the most exciting development on the agricultural fungicide scene since the discovery of the 1,2,4-triazoles in the 1970s. The fungicidal activity of the strobilurin analogues is a result of their ability to inhibit mitochondrial respiration in fungi. More specifically, it has been established that these compounds have a novel single site mode of action, exerting their effect on fungi by blocking the ubiquinol:cytochrome c oxidoreductase complex (cytochrome bc1) thus reducing the generation of energy rich ATP in the fungal cell (Becker et al 1981 FEBS Letts. 132: 329-33). This family of inhibitors prevents electron transfer at the ubiquinone redox site Q o on the multimeric cytochrome b protein (Esposti et al 1993 Biochim. et Biophys Acta 1143(3): 243-271). Unlike many mitochondrial proteins, the cytochrome b protein is mitochondrially encoded. Reports in the literature show that specific amino acid changes at the cytochrome b target site can affect the activity of strobilurin analogues. In depth mutagenesis studies in Saccharomyces cerevisiae (hereinafter referred to as S. cerevisiae ) (JP Rago et al 1989 J. Biol. Chem. 264:14543-14548), mouse (Howell et al 1988 J. Mol. Biol. 203:607-618), Chlamydomonas reinhardtii (Bennoun et al 1991 Genetics 127:335-343) and Rhodobacter spp (Daldal et al 1989 EMBO J. 8(13):3951-3961) have been carried out. Relevant information was also gathered from studying the natural basis for resistance to strobilurin analogues in the sea urchin Paracentrotus lividus (Esposti et al 1990 FEBS 263:245-247) and the Basidiomycete fungi Mycena galopoda and Strobilurus tenacellus (Kraiczy et al 1996 Eur. J. Biochem. 235:54-63), both of which produce natural variants of the strobilurin analogues. There are two distinct regions of the cytochrome b gene where amino acid changes have a dramatic effect on strobilurin analogue activity. These areas cover amino acid residues 125-148 and 250-295 (based on S. cerevisiae residue numbering system). More precisely amino acid changes at residues 126, 129, 132, 133, 137, 142, 143, 147, 148, 256, 275 and 295 have been shown to give rise to resistance to strobilurin analogues (Brasseur et al 1996 Biochim. Biophys. Acta 1275:61-69 and Esposti et al (1993) Biochimica et Biophysica Acta, 1143:243-271). Published International Patent Application Number WO 00/66773 describes the identification of a mutation in a fungal cytochrome b gene resulting in a glycine to alanine replacement at the position corresponding to S. cerevisiae cytochrome b residue 143 (G 143 A) in the encoded protein. The present invention identifies for the first time the key importance of a further mutation(s) in cytochrome b gene of field isolates of important plant pathogenic fungi showing resistance to a strobilurin analogue or a compound in the same cross resistance group. |
<SOH> SUMMARY OF THE INVENTION <EOH>According to a first aspect of the invention we now provide a method for the detection of the presence or absence of one or more mutations in a fungal cytochrome b gene resulting in an amino acid replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation(s) in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique. According to a preferred embodiment of the first aspect of the invention we now provide a method for the detection of the presence or absence of one or more mutations in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation(s) in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique. In the present invention we have now devised diagnostic methods for the detection of one or more point mutations in a fungal cytochrome b gene based on single nucleotide polymorphism detection methods including allele specific amplification. It will be apparent to the person skilled in the art that there are a large number of analytical procedures which may be used to detect the presence or absence of variant nucleotides at one or more polymorphic positions according to the invention. In general, the detection of allelic variation requires a mutation discrimination technique, optionally an amplification reaction and optionally a signal generation system. Many current methods for the detection of allelic variation are reviewed by Nollau et al, Clin. Chem. 43:1114-1120, 1997 and in standard textbooks, for example ‘Laboratory Protocols for Mutation Detection’, Ed, by U. Landegren, Oxford University Press, 1996 and ‘PCR’ 2 nd Edition by Newton and Graham, BIOS Scientific Publishers limited, 1997. Allele specific amplification reactions include primer based methods such as PCR based methods and more specifically, allele specific polymerase chain reaction (PCR) extension (ASPCR). One such ASPCR based method is ARMS (Amplification Refractory Mutagenesis System). The technique of ASPCR is described in U.S. Pat. No. 5,639,611 and the ARMS technique is described fully in European Patent No. EP 332435. All such PCR based methods are suitable for use in methods of the current invention, and the use of ARMS based methods are particularly preferred. The methods of the invention also include the use of indiscriminate PCR followed by specific probing of the amplicon generated. All of these methods are suitable for the detection of the specific alleles which can confer resistance to any of the strobilurin analogues or any other compound in the same cross resistance group and Robust tests have been developed for the detection of point mutations conferring such resistance iii a range of fungal plant pathogens Compounds may be considered to be in the same cross resistance group when the resistance mechanism to one compound also confers resistance to another, even-when the modes of action are not the same. Other single nucleotide polymorphism (SNP) detection techniques which may be used in any aspect of the invention described herein to detect one or more mutation include, for example, restriction fragment length polymorphism (RFLP), single strand conformation polymorphism, multiple clonal analysis, allele-specific oligonucleotide hybridisation, single nucleotide primer extension (Juvonen et al, (1994) Hum Genet 93 16-20; Huoponen et al, (1994) Hum Mutat 3 29-36; Mashima et al (1995), Invest Opthelmol. Vision. Sci 36,1714-20; Howell et al (1994) Am J Hum Genet. 55 203-206; Koyabashi et al; (1994) Am. J. Hum. Genet. 55 206-209; Johns and Neufeld (1993) Am J Hum Genet 53 916-920; Chomyn et al, (1992) Proc. Natl. Acad. Sci USA 89 4221-4225) and Invader™ technology (available from Third Wave Technologies Inc. 502 South Rosa Road, Madison, Wis. 53719 USA). The use of PCR based detection systems is preferred for use in all aspects and embodiments of the invention described herein. The use of allele selective hybridisation probe techniques, often in combination with PCR based target DNA fragment amplification, is also preferred for all aspects and embodiments of the invention described herein. In a preferred embodiment of the first aspect of the invention we now provide a diagnostic method for the detection of the presence of absence of one or more mutation(s) in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation(s) in said nucleic acid. The detection of the amplicon generated during the PCR reaction may be directly dependent on the extension of a primer specific for the presence of the mutation i.e. where primer extension is dependent on the presence of the mutation and hence an amplicon is generated only when the primer binds and/or is extended when the mutation is present (as is the case with ARMS technology), similarly it may be directly dependent on the extension of a primer specific for the absence of the mutation e.g. wild type sequence or may be directly linked to the PCR extension product containing the mutant DNA sequence i.e. where the detection is of an amplicon comprising the mutant DNA sequence. The first alternative is particularly preferred. In the above method of the invention where allele selective amplification is used the said diagnostic method comprises detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the generation of said amplicon is directly related to presence or absence of said mutation(s) in said nucleic acid. The amplicon can be from any PCR cycle and this includes a first allele specific primer extension product. In an alternative preferred example the method of the invention uses an allele selective hybridisation probe technique such as Molecular Beacons or TaqMan (as described herein, see Example 18). In a particularly preferred embodiment of the first aspect of the invention we now provide a diagnostic method for the detection of the presence or absence of one or more mutation(s) in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising contacting a test sample, comprising a fungal nucleic acid, with a diagnostic primer appropriate for the mutation(s) resulting in a F129L replacement in the encoded protein, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the mutation(s) is (are) present in the sample that results in an F129L replacement in the encoded protein or when wild type sequence is present; and detecting the presence orabsence of the said mutation(s) by reference to the presence or absence of the diagnostic primer extension product. In a further preferred embodiment the invention provides a method for detecting the presence or absence one or more mutation(s) in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising a fungal nucleic acid with a diagnostic primer for the specific mutation(s) in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation(s) is (are) present in the sample; and detecting the presence or absence of the mutation(s) by reference to the presence or absence of a diagnostic primer extension product. According to a particularly preferred embodiment of the first aspect of the invention we provide a method for detecting the presence or absence of one or more mutation(s) in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising a fungal nucleic acid with a diagnostic primer for the specific mutation(s) in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the mutation(s) is (are) present in the sample; and detecting the presence or absence of the mutation(s) by reference to the presence or absence of a diagnostic primer extension product. As used herein the term diagnostic primer is used to indicate a primer which is used specifically to identify the presence or absence of a mutation or wild type sequence and the term common primer is used to denote a primer binding to the opposite strand of DNA to that to which the diagnostic primer and 3′ to the region recognised by that diagnostic primer and which, by acting in concert with said diagnostic primer allows amplification of the intervening tract of DNA during the PCR. Where the diagnostic primer is an ARMS primer it can have a 3′ mismatch when compared to the mutant or wild type sequence. In this and in further aspects and embodiments of the invention it is preferred that the extension of the primer extension product is detected using a detection system which is an integral part of either the diagnostic primer or the common primer on the opposite strand. Alternatively where a Taqman® or Taqman®MGB probe is used in conjunction with a diagnostic primer and a common primer, the Taqman® or Taqman®MGB probe will comprise the detection means. This is described more fully herein. Compounds may be considered to be in the same cross resistance group when the resistance mechanism to one compound also confers resistance to another, even when the modes of action are not the same. The strobilurin analogues and compounds in the same cross resistance group include for example, azoxystrobin, picoxystrobin, kresoxim-methyl, trifloxystrobin, pyraclostrobin, famoxadone and fenamidone. (Details of pyraclostrobin were presented at the BCPC Conference in Brighton in November 2000—see Abstract 5A-2). It should also be noted that strobilurin analogues or compounds in the same cross resistance group are now frequently referred to as Qo site inhibitors (QoIs) because of their action on the complex III Qo site. We have found that the position in fungal nucleic acids encoding cytochrome b that corresponds to the 129 th codon/amino acid in the cytochrome b of S. cerevisiae sequence is a key determinant of fungal resistance to strobilurin analogues or any other compound in the same cross resistance group in field isolates of strobilurin analogue resistant plant pathogenic fungi. The methods of the invention described herein are particularly suitable for the detection of a mutation at the position corresponding to that endcoding Saccharomyces cerevisiae cytochrome b residue 129 where the encoded phenylalanine residue is replaced by another amino acid which prevents the activity of strobilurin analogues or any other compound in the same cross resistance group and results in a resistant phenotype in the fungus carrying the mutant cytochrome b gene thereby giving rise to fungal resistance to strobilurin analogues or any other compound in the same cross resistance group. The method is preferably used for the detection of a mutation resulting in the replacement of said phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129 with an amino acid selected from the group isoleucine, leucine, serine, cysteine, valine, tyrosine. It is most preferable that the mutation(s) to be detected results in the phenylalanine residue being replaced by leucine. The mutation in the fungal cytochrome b gene resulting in a F129L replacement in the encoded protein is usually a thymine to cytosine base change at the first position (base) of the codon or a thymine or cytosine to adenine or guanine base change at the third position (base) of the codon and the detection of these single nucleotide polymorphisms is preferred for all aspects and embodiments of the invention described herein. It is further possible that a rare combination of a change from thymine to cytosine at the first position and a thymine or cytosine to adenine or guanine base change at the third position (base) of the codon may also occur and this is covered in all aspects and embodiments of the invention. It should be noted that in this patent application frequent reference is made to both mutations and allelic variants (alleles) of the cytochrome b gene which confer resistance to strobilurin analogues or compounds in the same cross resistance group. Such references are essentially synonymous although the term mutation tends to imply a new or recent genetic change whereas allelic variant implies that an alternate, and in this case resistance conferring, form of the gene may have been present for some time in the population under analysis. These alternatives are indistinguishable during analysis of natural populations. It should also be noted that the nature in the difference in properties of the wild type and mutant/allelic variant form of the cytochrome b protein, encoded by the gene conferring resistance to strobilurin analogues or compounds in the same cross resistance group, requires an amino acid substitution within the so-called Qo site of the respective respiration complex m species which are, in part, comprised of the cytochrome b protein. Such amino acid substitutions are caused by changes in the codon for the altered amino acid. Typically, and in the specific examples considered herein, the amino acid substitution of interest is caused by a change in only one of the three nucleotide residues in that codon. Such changes may therefore be described as single nucleotide polymorphisms (SNPs). Occasionally because of the degeneracy of the genetic code amino acid substitutions that can be caused by a single nucleotide polymorphism may also be caused by two, closely linked (within 3 nucleotides) substitutions. Such situations are referred to herein as.“simple nucleotide polymorphisms”. By their nature it would be anticipated that such polymorphisms would be much rarer than SNPs since the sequence change required to bring it about requires at least two separate base changes, within the same codon, rather than just one. As used herein the term F129L is used to denote the substitution of a phenylalanine residue by a leucine residue in a fungal cytochrome b sequence at the equivalent of the position of the 129 th codon/amino acid of the S. cerevisiae cytochrome b sequence. This nomenclature is used for all other residue changes quoted herein i.e. all positions are quoted relative to the S. cerevisiae cytochrome b protein sequence. The S. cerevisiae cytochrome b gene and protein sequences are available on the EMBL and SWISSPROT databases (See EMBL ACCESSION NO. X84042 and SWISSPROT ACCESSION NO. P00163). The skilled man will appreciate that the precise length and register of equivalent proteins from different species may vary as a result of amino or carboxy terminal and/or one or more internal deletions or insertions. However, since the amino acid tract containing the residue corresponding to F 129 in S. cerevisiae is well conserved (Widger et al. Proc.Nat.Acad.Sci., U.S.A. 81 (1984) 674-678) it is straightforward and easily within the capability of the skilled man to identify the precisely corresponding residue in a newly obtained fungal cytochrome b sequence either by visual inspection or use of one of several sequence alignment programmes including Megalign or Macaw. Though designated F 129 in this application (because of positional and functional equivalence) the precise position of this phenylalanine in the new cytochrome b may not be the 129w residue from its amino terminal end. The S. cerevisiae cytochrome b consensus sequence is provided in SWISSPROT ACCESSION NO. P00163. In all aspects and embodiments of the invention described herein the positions in the cytochrome b sequence are preferably as defined relative to the S. cerevisiae cytochrome b sequence provided in EMBL ACCESSION NO. X84042. Alternatively, in all aspects and embodiments of the invention described herein the positions in the cytochrome b sequence are preferably as defined relative to the S. cerevisiae cytochrome b consensus sequence as provided in SWISSPROT ACCESSION NO. P00163. According to one aspect of the invention there is provided a method for the diagnosis of one or more nucleotide polymorphisms in a fungal cytochrome b gene which method comprises determining the sequence of the fungal nucleic acid at a position corresponding to one or more of the bases in the triplet coding for the amino acid at the position that corresponds to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein and determining the resistance status of the fungus to a strobilurin analogue or a compound in the same cross resistance group by reference to one or more polymorphisms in the cytochrome b gene. In all aspects and embodiments of the invention described herein it is preferred that only one base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein shows a mutation i.e. there is a single nucleotide polymorphism occurring at one position only and it is further preferred that it is at the first or third base of the triplet. According to a preferred embodiment of this aspect of the invention there is provided a method for the diagnosis of a single nucleotide polymorphism in a fungal cytochrome b gene which method comprises determining the sequence of fungal nucleic acid at a position corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein and determining the resistance status of the said fungi to a strobilurin analogue or a compound in the same cross resistance group by reference to a polymorphism in the cytochrome b gene. In an embodiment of the above aspect of the invention the method for diagnosis described herein is one in which the single nucleotide polymorphism at positions in the DNA corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein is presence of T or C at the first base in the codon and T, C, A or G at the third base in the codon. TABLE 1 Codon sequences encoding phenylalanine and leucine. First Second Third position position position T T Phe T Phe C Leu A Leu G C Leu T Leu C Leu A Leu G In wild type cytochrome b, if the phenylalanine residue at position 129 is encoded by either a TTT or TTC codon, then a single base mutation at the first position of the codon to a C (cytosine) would result in substitution of the phenylalanine residue in the Q o site of the strobilurin resistant mutant. Likewise if in wild type cytochrome b the phenylalanine at position 129 is encoded by either a TTT or TTC codon, then a single base position at the third position of the codon to an A (adenine) or a G (guanine) would result in substitution of the phenylalanine residue in the Q o site of the strobilurin resistant mutant. A double substitution at the first position (from a T to a C) together with a substitution at the third position (from either a T or a C to either an A or a G) could also cause such a phenylalanine to leucine amino acid substitution (see Table 1). In order to define whether a given plant pathogen or population of a plant pathogen is resistant to Q o site inhibitor fungicides or contains significant levels of a resistant allele as a result of the presence of a leucine residue at position 129, it is simply necessary to establish and/or measure whether that pathogen or population has a C residue at the first position of its cognate codon and/or an A or G residue at the third position. One method of achieving such an assessment is to use technology based on diagnostic primers such as ARMS primers. (The concept of ARMS primers is described fully in Newton et al, Nucleic Acid Research 17 (7) 2503-2516 1989). As a consequence of the above features of phenylalanine and leucine codons (see Table 1), when ARMS technology is used to detect and/or measure the status of residue 129, it is possible to design appropriate PCR primers that are capable of defining the identity and/or amounts of particular residues at either the first or third positions of the cognate codon in the pathogen cytochrome b gene. Such design requires the knowledge of only wild type sequence. There is no need to have access to a resistant isolate in a new fungus of interest where resistance results from a F129L mutation. Some examples of relevant plant pathogenic fungi are listed in Table 2. This list is not meant to be in any way to be exclusive. The skilled plant pathologist will be able to readily identify those fungi to which the methods of this invention are relevant. TABLE 2 Example of species where F129L can be assayed. Examples of species in which F129L can be assayed: 1 Plasmopara viticola 2 Erysiphe graminis f. sp. trilici/hordei 3 Rhynchosporium secalis 4 Pyrenophora teres 5 Mycosphaerella graminicola 6 Mycosphaerella fijiensis var. difformis 7 Sphaerotheca fuliginea 8 Uncinula necator 9 Colletotrichum graminicola 10 Pythium aphanidermatum 11 Colletotrichum gloeosporioides 12 Oidium lycopersicum 13 Leveillula taurica 14 Pseudoperonospora cubensis 15 Alternaria solani 16 Cercospora arachidola 17 Rhizoctonia solani 18 Venturia inaequalis 19 Phytophthora infestans 20 Mycosphaerella musicola 21 Colletotrichum acutatum 22 Wilsonomyces carpophillum 23 Didymella bryoniae 24 Didymella lycopersici 25 Peronospora tabacina 26 Puccinia recondita 27 Puccinia horiana The methods of the invention described herein are particularly useful in connection with plant pathogenic fungi and especially with any of the following fungal species: Plasmopara viticola, Erysiphe graminis f.sp. tritic/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Collectotrichum gloeosporioides, Oidium lycopersicurm, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana, and most especially with any of the following fungal species: Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola. In a further aspect the invention provides a method for detecting fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of one or more mutation(s) in a fungal nucleic acid that encodes a fungal cytochrome b protein wherein the presence of said mutation(s) gives rise to resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of a single nucleotide polymorphism occurring at positions corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the fungal cytochrome b protein. In a further preferred embodiment of this aspect the invention provides a method for detecting fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of a mutation in a fungal nucleic acid that encodes a fungal cytochrome b protein wherein the presence of said mutation gives rise to resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of a single nucleotide polymorphism occurring at a position corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the fungal cytochrome b protein. In a preferred embodiment of this aspect of the invention the presence or absence of a single nucleotide polymorphism at a position corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b gene in fungal nucleic acid are identified using any (or a) single nucleotide polymorphism detection technique. The invention further provides a fungal DNA sequence encoding all or part of a wild type cytochrome b protein wherein said DNA sequence encodes a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129 in the wild type protein wherein said sequence is obtainable or obtained from a fungus selected from the group consisting of: Plasmopara viticola, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctania solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana, preferably from the group consisting of: Plasmopara viticola, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctania solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola. A fungal DNA sequence according to the above aspects of the invention preferably comprises around 30 nucleotides on either or both sides of the position in the DNA that corresponds to one or more of the bases in the triplet (preferably the third base) coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein since this extent of nucleic acid provides the skilled man with all information necessary to design species- and mutation-specific reagents and/or methods for use in/with all single nucleotide polymorphism detection techniques as described herein. As used herein the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides, for example around 50 nucleotides i.e. up to 35, 40, 45 or 50 or more nucleotides. As used herein in connection with all DNA and protein sequences the term ‘all or part of’ is used to denote a DNA sequence or protein sequence or a fragment thereof. A fragment of DNA or protein may for example be 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the length of the whole sequence. The invention extends also to novel protein sequences encoded by the DNA sequences of the present invention. It will be evident to the man skilled in the art that both samples containing genomic (mitochondrial) DNA and cDNA may be analysed according to the invention. Where the sample contains genomic DNA, intron organisation needs to be taken into account when using the sequence information. Examnples of wild type fungal DNA sequences comprising part of the wild type cytochrome b gene sequence according to the above aspect of the invention are provided in Table 3 below and said sequences form a further aspect of the invention. TABLE 3 Tracts of wild type cytochrome b genomic and/or cDNA sequence flanking the codon corresponding to codon 129 in the S. cerevisiae cytochrome b sequence (first and last residues shown in bold and underlined) for a series of important plant pathogens. Species Sequence Plasmopara viticola 5′TTATGGTGTTCAGGGGTAAT (cDNA & genomic) TATTTTTATTTTAATGATGGCG ACTGCA T T T ATGGGTTATG 3′ Rhynchosporium secalis 5′GTATGAACAATAGGTACATT (cDNA & genomic, TATATTCATATTAATGATCGTT ACAGCA T T C TTGGGTTATG 3′ Pyrenophora teres 5′GTATGAACTATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCC T T C CTGGGTTACG 3′ Pyrenophora teres 5′CGCTATACAGATAAATTTAG (genomic) GTTGTAGTTAGCCGGAACTTAG ACAGCC T T C CTGGGTTACCAAC ATAGCCCAAAATGGTTTAATAT AAGTAATAAAAAAAG 3′ Mycosphaerella graminicola 5′ACATGAACAATCGGTACTAT (cDNA & genomic) AATACTAGTTCTGATGATGGCA ACCGCA T T C TTAGGGTATG 3′ Sphaerotheca fuliginea 5′CATTAGGTGTAGTTATATTC (cDNA) ATATTAATGATCGTTACTGCA T T C CTGGGTTATG 3′ Uncinula necator 5′CAATTGGTACAGTAATATTC (cDNA) ATTTTAATGATGGCTACAGCA T T C TTGGGTTATG 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTGCTAT Cgr1 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGT T T C TTAGGGTATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTTGTAT Cgr2 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGT T T C TTAGGATATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (cDNA) AATACTTGTAGCTATGATGGGT ATAGGT T T C CTGGGTTATGTTT TACCTTACGGACAAATGTCACT ATGAGGTGCAACTGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (genomic) AATACTTGTAGCTATGATGGGT ATAGGT T T C CTGGGTTACTTCA ACATAGCCCAAAATGATATGCA ATTATTAGGATTTCA 3′ Pythium aphanidermatum 5′TTATGGTGTTCAGGTGTTGT (genomic & cDNA) TATTTTTATTTTAATGATGGCA ACAGCT T T C ATGGGTTATG 3′ Colletotrichum 5′GTTTGAGTTATAGGTGCTAT gloeosporioides —chilli AATACTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGT T T C CTGGGTTATG 3′ Colletotrichum 5′GTTTGAGTAATAGGTGCTAT gloeosporioides —mango AATTCTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGT T T C TTGGGTTATGTTT TACCTTACGGGCAAATGTCATT ATGAGGTGCAACAGT 3′ Oidium lycopersicum 5′ACATGAACTATAGGTACAGT (cDNA) TATATTCATATTAATGATGGCT ACAGCA T T C CTGGGTTATG 3′ Leveillula taurica —Lt1 5′ACATGAACAATAGGTGTGGT (cDNA) AATATTTATATTAATGATGGCT ACAGCT T T C TTGGGTTATGTTT TACCGTACGGTCAAATGAGTTT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt4 5′ACATGAACAATAGGTGTTGT (cDNA) AATATTTATATTAATGATGCTA CAGCT T T C CTAGGTTACGTTTT ACCATACGGGACAAATGTCATT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt2 5′ACATGAACTATTGGTGTTGT (cDNA) TATCTTTATATTAATGATGGCT ACTGCC T T T TTAGGATATGTTT TACCATATGGTCAAATGAGTTT ATGAGGTGCTACAGT 3′ Leveillula taurica —Lt3 5′ATGAACAATTGGTACAGTAA (cDNA) TATTCATATTAATGATGGCTAC TGCA T T C CTGGGTTATGTTCTA CCTTTCGGACAGATGTCGCTCT GGGGTGCAACCGT 3′ Pseudoperonospora cubensis 5′TTATGGTGTTCAGGTGTTAT (cDNA & genomic) TATTTTTATTTTAATGATGGCA ACAGCT T T T ATGGGTTATG 3′ Alternaria solani 5′GTATGAACTATTGGTACTGT (cDNA & genomic) TATCTTTATCTTAATGATGGCT ACAGCT T T C CTGGGTTATG 3′ Cercospora arachidola 5′TTATGATCTATTGGAGTTAT (cDNA & genomic) AATTTTAGTTCTTATGATGGCA ATAGCC T T C TTAGGATATG 3′ Rhizoctonia solani 5′CTATCGGAGTTGTTATGCTT (cDNA) CTTGTTATGATGATGGGGATCG CA T T T TTAGGTTATG 3′ Mycosphaerella musicola 5′GTATGAGTTATAGGTACTAT (genomic & cDNA) TATATTAGTTCTAATGATGGCT ACCGCC T T T TTAGGATATG 3′ Didymella bryoniae —Db1 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCT T T C CTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCAACTGT 3′ Didymella bryoniae —Db2 5′GTGTGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCT T T C CTGGGTTATGTGC TGCCCTACGGGCAGATGTCATT ATGAGGTGCTACAGT 3′ Didymella lycopersici 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCT T T C CTGGGTTATGTTC TTCCTTATGCGCAAATGTCATT ATGAGGTGCTACAGT 3′ In the above table the first and third bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 which, when appropriately substituted, result in the replacement of the normal phenylalanine residue with an alternative amino acid wherein said replacement confers resistance to strobilurin analogues or a compound within the same cross resistance group are in bold and underlined. The invention also extends to a fungal DNA sequence showing homology or sequence identity to said DNA sequences in Table 3 and covers for example, variations in DNA sequences found in different samples or isolates of the same species. These variations may, for example, be due to the use of alternative codon usage, varying intron/exon mitochondrial organisation and amino acid replacement. In a further aspect the invention provides a fungal DNA sequence, which encodes all or part of a fungal cytochrome b protein wherein, when said fungal DNA sequence is lined up against the corresponding wild type DNA sequence that encodes a cytochrome b protein, it is seen that the fungal DNA sequence contains a single nucleotide polymorphism mutation at a position in the DNA that corresponds to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein which results in the replacement of the normal phenylalanine residue with an alternative amino acid. In a further preferred embodiment of this aspect the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymorphism mutation at a position in the DNA corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein which results in the replacement of the normal phenylalanine residue with an alternative amino acid. The fungal DNA sequence according to the above aspect of the invention preferably comprises around 30 nucleotides on either or both sides of the position in the DNA corresponding to one or more of the bases in the triplet, preferably corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein since this extent of nucleic acid provides the skilled man with all information necessary to design species and mutation specific reagents and/or methods for use in all single nucleotide polymorphism techniques. As used herein the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides. The invention further provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of one or more mutation(s) in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, said mutation(s) occurring at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. In a preferred embodiment of this aspect the invention further provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, said mutation occurring at a position in the DNA corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. In the above aspects of the invention the mutation occurring at positions in the DNA corresponding to the first and third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein are preferably a thymine to a cytosine and a thymine or cytosine to adenine or guanine respectively. The fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of one or more mutation(s) in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, according to the above aspects of the invention is preferably obtainable or obtained from a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana, preferably from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola. The invention extends also to DNA sequences comprising all or part of the sequences provided in Table 4 wherein the residue at a position in the DNA corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein is a cytosine residue. Such sequences, including those comprising the sequences described in Table 4 form a further aspect of the invention. TABLE 4 Tracts of plant pathogen cytochrome b gene sequence where the residue (shown in bold) corresponding to the first base in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein is a cytosine residue and, as a result, encodes leucine. Species Sequence Plasmopara viticola 5′TTATGGTGTTCAGGGGTAAT (cDNA & genomic) TATTTTTATTTTAATGATGGCG ACTGCACTTATGGGTTATG 3′ Rhynchosporium secalis 5′GTATGAACAATAGGTACATT (cDNA & genomic) TATATTCATATTAATGATCGTT ACAGCACTCTTGGGTTATG 3′ Pyrenophora teres 5′GTATGAACTATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCCCTCCTGGGTTACG 3′ Pyrenophora teres 5′CGCTATACAGATAAATTTAG (genomic) GTTGTAGTTAGCCGGAACTTAG ACAGCCCTCCTGGGTTACCAAC ATAGCCCAAAATGGTTTAATAT AAGTAATAAAAAAAG 3′ Mycosphaerella graminicola 5′ACATGAACAATCGGTACTAT (cDNA & genomic) AATACTAGTTCTGATGATGGCA ACCGCACTCTTAGGGTATG 3′ Mycosphaerella fijiensis 5′GTATGAGTTATAGGTACTAT var. difformis TATATTAGTTCTAATGATGGCA (cDNA & genomic) ACTGCCCTTTTAGGGTATG 3′ Sphaerotheca fuliginea 5′CATTAGGTGTAGTTATATTC (cDNA) ATATTAATGATCGTTACTGCAC TCCTGGGTTATG 3′ Uncinula necator 5′CAATTGGTACAGTAATATTC (cDNA) ATTTTAATGATGGCTACAGCAC TCTTGGGTTATG 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTGCTAT Cgr1 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGTCTCTTAGGGTATGTTT ACCTTACGGACAAATGTCATTA TGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTTGTAT Cgr2 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGTCTCTTAGGATATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (cDNA) AATACTTGTAGCTATGATGGGT ATAGGTCTCCTGGGTTATGTTT TACCTTACGGACAAATGTCACT ATGAGGTGCAACTGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (genomic) AATACTTGTAGCTATGATGGGT ATAGGTCTCCTGGGTTACTTCA ACATAGCCCAAAATGATATGCA ATTATTAGGATTTCA 3′ Pythium aphanidermatum 5′TTATGGTGTTCAGGTGTTGT (genomic & cDNA) TATTTTTATTTTAATGATGGCA ACAGCTCTCATGGGTTATG 3′ Colletotrichum 5′GTTTGAGTTATAGGTGCTAT gloeosporioides —chilli AATACTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGTCTCCTGGGTTATG 3′ Colletotrichum 5′GTTTGAGTAATAGGTGCTAT gloeosporioides —mango AATTCTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGTCTCTTGGGTTATGTTT TACCTTACGGGCAAATGTCATT ATGAGGTGCAACAGT 3′ Oidium lycopersicum 5′ACATGAACTATAGGTACAGT (cDNA) TATATTCATATTAATGATGGCT ACAGCACTCCTGGGTTATG 3′ Leveillula taurica —Lt1 5′ACATGAACAATAGGTGTGGT (cDNA) AATATTTATATTAATGATGGCT ACAGCTCTCTTGGGTTATGTTT TACCGTACGGTCAAATGAGTTT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt4 5′ACATGAACAATAGGTGTTGT (cDNA) AATATTTATATTAATGATGGCT ACAGCTCTCCTAGGTTACGTTT TACCATACGGACAAATGTCATT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt2 5′ACATGAACTATTGGTGTTGT (cDNA) TATCTTTATATTAATGATGGCT ACTGCCCTTTTAGGATATGTTT ACCATATGGTCAAATGAGTTTA TGAGGTGCTACAGT 3′ Leveillula taurica —Lt3 5′ATGAACAATTGGTACAGTAA (cDNA) TATTCATATTAATGATGGCTAC TGCACTCCTGGGTTATGTTCTA CCTTTGGACAGATGTCGCTCTG CGGTGCAACCGT 3′ Pseudoperonospora cubensis 5′TTATGGTGTTCAGGTGTTAT (cDNA & genomic) TATTTTTATTTTAATGATGGCA ACAGCTCTTATGGGTTATG 3′ Alternaria solani 5′GTATGAACTATTGGTACTGT (cDNA & genomic) TATCTTTATCTTAATGATGGCT ACAGCTCTCCTGGGTTATG 3′ Cercospora arachidola 5′TTATGATCTATTGGAGTTAT (cDNA & genomic) AATTTTATTCTTATGATGGCAA TAGCCCTCTTAGGATATG 3′ Rhizoctonia solani 5′CTATCGGAGTTGTTATGCTT (cDNA) GTTATGATGATGGGGATCGCAC TTTTAGGTTATG 3′ Mycosphaerella musicola 5′GTATGAGTTATAGGTACTAT (genomic & cDNA) TATATTAGTTCTAATGATGGCT ACCGCCCTTTTAGGATATG 3′ Didymella bryoniae —Db1 5′GTATGAACAATGGTACTGTT (cDNA) ATCTTTATCTTAATGATGGCTA CAGCTCTCCTGGGTATGTTCTT CCTTATGGGCAAATGTCATTAT GAGGTGCAACTGT 3′ Didymella bryoniae —Db2 5′GTGTGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCTCTCCTGGGTTATGTGC TGCCCTACGGGCAGATGTCATT ATGAGGTGCTACAGT3′ Didymella lycopersici 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCTCTCCTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCTACAGT 3′ The invention extends also to DNA sequences comprising all or part of the sequences provided in Table 5 wherein the residue at a position in the DNA corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein is an adenine residue. Such sequences form a further aspect of the invention: TABLE 5 Tracts of plant pathogen cytochrome b gene sequence where the residue (shown in bold) corresponding to the third base in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein is an adenine residue and, as a result, encodes leucine. Species Sequence Plasmopara viticola 5′TTATGGTGTTCAGGGGTAAT (cDNA & genomic) TATTTTTATTTTAATGATGGCG ACTGCATT A ATGGGTTATG 3′ Rhynchosporium secalis 5′GTATGAACAATAGGTACATT (cDNA & genomic) TATATTCATATTAATGATCGTT ACAGCATT A TTGGGTTATG 3′ Pyrenophora teres 5′GTATGAACTATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCCTT A CTGGGTTACG 3′ Pyrenophora teres 5′CGCTATACAGATAAATTTAG (genomic) GTTGTAGTTAGCCGGAACTTAG ACAGCCTT A CTGGGTTACCAAC ATAGCCCAAAATGGTTTAATAT AAGTAATAAAAAAAG 3′ Mycosphaerella graminicola 5′ACATGAACAATCGGTACTAT (cDNA & genomic) AATACTAGTTCTGATGATGGCA ACCGCATT A TTAGGGTATG 3′ Mycosphaerella fijiensis 5′GTATGAGTTATAGGTACTAT var. difformis TATATTAGTTCTAATGATGGCA (cDNA & genomic) ACTGCCTT A TTAGGGTATG 3′ Sphaerotheca fuliginea 5′CATTAGGTGTAGTTATATTC (cDNA) ATATTAATGATCGTTACTGCAT T A CTGGGTTATG 3′ Uncinula necator 5′CAATTGGTACAGTAATATTC (cDNA) ATTTTAATGATGGCTACAGCAT T A TTGGGTTATG 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTGCTAT Cgr1 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGTTT A TTAGGGTATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTTGTAT Cgr2 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGTTT A TTAGGATATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (cDNA) AATACTTGTAGCTATGATGGGT ATAGGTTT A CTGGGTTATGTTT TACCTTACGGACAAATGTCACT ATGAGGTGCAACTGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (genomic) AATACTTGTAGCTATGATGGGT ATAGGTTT A CTGGGTTACTTCA ACATAGCCCAAAATGATATGCA ATTATTAGGATTTCA 3′ Pythium aphanidermatum 5′TTATGGTGTTCAGGTGTTGT (genomic & cDNA) TATTTTTATTTTAATGATGGCA ACAGCTTT A ATGGGTTATG 3′ Colletotrichum 5′GTTTGAGTTATAGGTGCTAT gloeosporioides —chilli AATACTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGTTT A CTGGGTTATG 3′ Colletotrichum 5′GTTTGAGTAATAGGTGCTAT gloeosporioides —mango AATTCTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGTTT A TTGGGTTATGTTT TACCTTACGGGCAAATGTCATT ATGAGGTGCAACAGT 3′ Oidium lycopersicum 5′ACATGAACTATAGGTACAGT (cDNA) TATATTCATATTAATGATGGCT ACAGCATT A CTGGGTTATG 3′ Leveillula taurica —Lt1 5′ACATGAACAATAGGTGTGGT (cDNA) AATATTTATATTAATGATGGCT ACAGCTTT A TTGGGTTATGTTT TACCGTACGGTCAAATGAGTTT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt4 5′ACATGAACAATAGGTGTTGT (cDNA) AATATTTATATTAATGATGGCT ACAGCTTT A CTAGGTTACGTTT TACCATACGGACAAATGTCATT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt2 5′ACATGAACTATTGGTGTTGT (cDNA) TATCTTTATATTAATGATGGCT ACTGCCTT A TTAGGATATGTTT TACCATATGGTCAAATGAGTTT ATGAGGTGCTACAGT 3′ Leveillula taurica —Lt3 5′ATGAACAATTGGTACAGTAA (cDNA) TATTCATATTAATGATGGCTAC TGCATT A CTGGGTTATGTTCTA CCTTTCGGACAGATGTCGCTCT GGGGTGCAACCGT 3′ Pseudoperonospora cubensis 5′TTATGGTGTTCAGGTGTTAT (cDNA & genomic) TATTTTTATTTTAATGATGGCA ACAGCTTT A ATGGGTTATG 3′ Alternaria solani 5′GTATGAACTATTGGTACTGT (cDNA & genomic) TATCTTTATCTTAATGATGGCT ACAGCTTT A CTGGGTTATG 3′ Cercospora arachidola 5′TTATGATCTATTGGAGTTAT (cDNA & genomic) AATTTTAGTTCTTATGATGGCA ATAGCCTT A TTAGGATATG 3′ Rhizoctonia solani 5′CTATCGGAGTTGTTATGCTT (cDNA) GTTATGATGATGGGGATCGCAT T A TTAGGTTATG 3′ Mycosphaerella musicola 5′GTATGAGTTATAGGTACTAT (genomic & cDNA) TATATTAGTTCTAATGATGGCT ACCGCCTT A TTAGGATATG 3′ Didymella bryoniae —Db1 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCTTT A CTGGGTTATGTTC TTCCTTATGCGCAAATGTCATT ATGAGGTGCAACTGT 3′ Didymella bryoniae —Db2 5′GTGTGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCTTT A CTGGGTTATGTGC TGCCCTACGGGCAGATGTCATT ATGAGGTGCTACAGT 3′ Didymella lycopersici 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCTTT A CTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCTACAGT 3′ The invention extends also to DNA sequences comprising all or part of the sequences provided in Table 6 wherein the residue at a position in the DNA corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein is a guanine residue. Such sequences form a further aspect of the invention. TABLE 6 Tracts of plant pathogen cytochrome b gene sequence where the residue (shown in bold) corresponding to the third base in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein is a guanine residue and, as a result, encodes leucine. Species Sequence Plasmopara viticola 5′TTATGGTGTTCAGGGGTAAT (cDNA & genomic) TATTTTTATTTTAATGATGGCg ACTGCATT G ATGGGTTATG 3′ Rhynchosporium secalis 5′GTATGAACAATAGGTACATT (cDNA & genomic) TATATTCATATTAATGATCGTT ACAGCATT G TTGGGTTATG 3′ Pyrenophora teres 5′GTATGAACTATTGGTACTGT (cDNA) TATCTTTATCTTTATCTTAATG ATGGCTACAGCCTT G CTGGGTT ACG 3′ Pyrenophora teres 5′CGCTATACAGATAAATTTAG (genomic) GTTGTAGTTAGCCGGAACTTAG ACAGCCTT G CTGGGTTACCAAC ATAGCCCAAAATGGTTTAATAT AAGTAATAAAAAAAG 3′ Mycosphaerella graminicola 5′ACATGAACAATCGGTACTAT (cDNA & genomic) AATACTAGTTCTGATGATGGCA ACCGCATT G TTAGGGTATG 3′ Mycosphaerella fijiensis 5′GTATGAGTTATAGGTACTAT var. difformis TATATTAGTTCTAATGATGGCA (cDNA & genomic) ACTGCCTT G TTAGGGTATG 3′ Sphaerotheca fuliginea 5′CATTAGGTGTAGTTATATTC (cDNA) ATATTAATGATCGTTACTGCAT T G CTGGGTTATG 3′ Uncinula necator 5′CAATTGTACAGTAATATTCA (cDNA) TTTTAATGATGGCTACAGCATT G TTGGGTTATG 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTGCTAT Cgr1 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGTTT G TTAGGGTATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTTGTAT Cgr2 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGTTT G TTAGGATATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (cDNA) AATACTTGTAGCTATGATGGGT ATAGGTTT G CTGGGTTATGTTT TACCTTACGGACAAATGTCACT ATGAGGTGCAACTGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (genomic) AATACTTGTAGCTATGATGGGT ATAGGTTT G CTGGGTTACTTCA ACATAGCCCAAAATGATATGCA ATTATTAGGATTTC A 3′ Pythium aphanidermatum 5′TTATGGTGTTCAGGTGTTGT (genomic & cDNA) TATTTTTATTTTAATGATGGCA ACAGCTTT G ATGGGTTATG 3′ Colletotrichum 5′GTTTGAGTTATAGGTGCTAT gloeosporioides —chilli AATACTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGTTT G CTGGGTTATG 3′ Colletotrichum 5′GTTTGAGTAATAGGTGCTAT gloeosporioides —mango AATTCTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGTTT G TTGGGTTATGTTT TACCTTACGGGCAAATGTCATT ATGAGGTGCAACAGT 3′ Oidium lycopersicum 5′ACATGAACTATAGGTACAGT (cDNA) TATATTCATATTAATGATGGCT ACAGCATT G CTGGGTTATG 3′ Leveillula taurica —Lt1 5′ACATGAACAATAGGTGTGGT (cDNA) AATATTTATATTAATGATGGCT ACAGCTTT G TTGGGTTATGTTT TACCGTACGGTCAAATGAGTTT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt4 5′ACATGAACAATAGGTGTTGT (cDNA) AATATTTATATTAATGATGGCT ACAGCTTT G CTAGGTTACGTTT TACCATACGGACAAATGTCATT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt2 5′ACATGAACTATTGGTGTTGT (cDNA) TATCTTTATATTAATGATGGCT ACTGCCTT G TTAGGATATGTTT TACCATATGGTCAAATGAGTTT ATGAGGTGCTACAGT 3′ Leveillula taurica —Lt3 5′ATGAACAATTGGTACAGTAA (cDNA) TATTCATATTAATGATGGCTAC TGCATT G CTGGGTTATGTTCTA CCTTTCGGACAGATGTCGCTCT GGGGTGCAACCGT 3′ Pseudoperonospora cubensis 5′TTATGGTGTTCAGGTGTTAT (cDNA & genomic) TATTTTTATTTTAATGATGGCA ACAGCTTT G ATCGGGTTATG3′ Alternaria solani 5′GTATGAACTATTGGTACTGT (cDNA & genomic) TATCTTTATCTTAATGATGGCT ACAGCTTT G CTGGGTTATG 3′ Cercospora arachidola 5′TTATGATCTATTGGAGTTAT (cDNA & genomic) AATTTTAGTTCTTATGATGGCA ATACCCTT G TTAGGATATG 3′ Rhizoctonia solani 5′CTATCGGAGTTGTTATGCTT (cDNA) GTTATGATGATGGGGATCGCAT T G TTAGGTTATG 3′ Mycosphaerella musicola 5′GTATGAGTTATAGGTACTAT (genomic & cDNA) TATATTAGTTCTAATGATGGCT ACCGCCTT G TTAGGATATG 3′ Didymella bryoniae —Db1 5′GTATGAACAATTGGTACTGT (cDNA) GTATCTTTATCTTAATGATGCT ACAGCTTT G CTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCAACTGT 3′ Didymella bryoniae —Db2 5′GTGTGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCTTT G CTGGGTTATGTGC TGCCCTACGGGCAGATGTCATT ATGAGGTGCTACAGT 3′ Didymella lycopersici 5′GTATGAACAATTGGTACTGT TATCTTTATCTTAATGATGGCT ACAGCTTT G CTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCTACAGT 3′ The invention extends also to DNA sequences comprising all or part of the sequences provided in Table 7 wherein the residue at a position in the DNA corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 is a cytosine and the residue at the third base in the corresponding codon is an adenine. Such sequences form a further aspect of the invention. TABLE 7 Tracts of plant pathogen cytochrome b gene sequence where the residue (shown underlined) corresponding to the first base in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein is a cytosine and the residue shown in bold at the third base of the corresponding codon is an adenine and, as a result, encodes leucine. Species Sequence Plasmopara viticola 5′TTATGGTGTTCAGGGGTAAT (cDNA & genomic) TATTTTTATTTTAATGATGGCG ACTGCA C T A ATGGGTTATG 3′ Rhynchosporium secalis 5′GTATGAACAATAGGTACATT (cDNA & genomic) TATATTCATATTAATGATCGTT ACAGCA C T A TTGGGTTATG 3′ Pyrenophora teres 5′GTATGAACTATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCC C T A CTGGGTTACG 3′ Pyrenophora teres 5′CGCTATACAGATAAATTTAG (genomic) GTTGTAGTTAGCCGGAACTTAG ACAGCC C T A CTGGCTTACCAAC ATAGCCCAAAATGGTTTAATAT AAGTAATAAAAAAAG 3′ Mycosphaerella graminicola 5′ACATGAACAATCGGTACTAT (cDNA & genomic) AATACTAGTTCTGATGATGGCA ACCGCA C T A TTAGGGTATG 3′ Mycosphaerella fijiensis 5′GTATGAGTTATAGGTACTAT var. difformis TATATTAGTTCTAATGATGGCA (cDNA & genomic) ACTGCC C T A TTAGGGTATG 3′ Sphaerotheca fuliginea 5′CATTAGGTGTAGTTATATTC (cDNA) ATATTAATGATCGTTACTGCA C T A CTGGGTTATG 3′ Uncinula necator 5′CAATTGGTACAGTAATATTC (cDNA) ATTTTAATGATGGCTACAGCA C T A TTGGGTTATG 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTGCTAT Cgr1 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGT C T A TTAGGGTATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTTGTAT Cgr2 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGT C T A TTAGGATATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCAACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (cDNA) AATACTTGTAGCTATGATGGGT ATAGGT C T A CTGGGTTATGTTT TACCTTACGGACAAATGTCACT ATGAGGTGCAACTGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (genomic) AATACTTGTAGCTATGATGGGT ATAGGT C T A CTGGGTTACTTCA ACATAGCCCAAAATGATATGCA ATTATTAGGATTTCA 3′ Pythium aphanidermatum 5′TTATGGTGTTCAGGTGTTGT (genomic & cDNA) TATTTTTATTTTAATGATGGCA ACAGCT C T A ATGGGTTATG 3′ Colletotrichum 5′GTTTGAGTTATAGGTGCTAT gloeosporioides —chilli AATACTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGT C T A CTGGGTTATG 3′ Colletotrichum 5′GTTTGAGTAATAGGTGCTAT gloeosporioides —mango AATTCTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGT C T A TTGGGTTATGTTT TACCTTACGGGCAAATGTCATT ATGAGCTGCAACAGT 3′ Oidium lycopersicum 5′ACATGAACTATAGGTACAGT (cDNA) TATATTCATATTAATGATGGCT ACAGCA C T A CTGGGTTATG 3′ Leveillula taurica —Lt1 5′ACATGAACAATAGGTGTGGT (cDNA) AATATTTATATTAATGATGGCT ACAGCT C T A TTGGGTTATGTTT TACCGTACGGTCAAATGAGTTT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt4 5′ACATGAACAATAGGTGTTGT (cDNA) AATATTTATATTAATGATGGCT ACAGCT C T A CTAGGTTACGTTT TACCATACGGACAAATGTCATT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt2 5′ACATGAACTATTGGTGTTGG (cDNA) TTATCTTTATATTAATGATGGC TACTGCC C T A TTAGGATATGTT TTACCATATGGTCAAATGAGTT TATGAGGTGCTACAGT 3′ Leveillula taurica —Lt3 5′ATGAACAATTGGTACAGTAA (cDNA) TATTCATATTAATGATGGCTAC TGCA C T A CTGGGTTATGTTCTA CCTTTCGGACAGATGTCGCTCT GGGGTGCAACCGT 3′ Pseudoperonospora cubensis 5′TTATGGTGTTCAGGTGTTAT (cDNA & genomic) TATTTTTATTTTAATGATGGCA ACAGC C TT A ATGGGTTATG 3′ Alternaria solani 5′GTATGAACTATTGGTACTGT (cDNA & genomic) TATCTTTATCTTAATGATGGCT ACAGCT C T A CTGGGTTATG 3′ Cercospora arachidola 5′TTATGATCTATTGGAGTTAT (cDNA & genomic) AATTTTAGTTCTTATGATGGCA ATAGCC C T A TTAGGATATG 3′ Rhizoctonia solani 5′CTATCGGAGTTGTTATGCTT (cDNA) GTTATGATGATGGGGATCGCA C T A TTAGGTTATG 3′ Mycosphaerella musicola 5′GTATGAGTTATAGGTACTAT (genomic & cDNA) TATATTAGTTCTAATGATGGCT ACCGCC C T A TTAGGATATG 3′ Didymella bryoniae —Db1 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCT C T A CTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCAACTGT 3′ Didymella bryoniae —Db2 5′GTGTGAACAATTGGTACTGT (cDNA) TATCTTTATCTTTATGATGGCT ACAGCT C T A CTGGGTTATGTGC TGCCCTACGGGCAGATGTCATT ATGAGGTGCTACAGT 3′ Didymella lycopersici 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCT C T A CTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCTACAGT 3′ The invention extends also to DNA sequences comprising all or part of the sequence provided in Table 8 wherein the residue at a position in the DNA corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 is a cytosine and the residue at the third base in the corresponding codon is a guanine. Such sequences form a further aspect of the invention. TABLE 8 Tracts of plant pathogen cytochrome b gene sequence where the residue (shown underlined) corresponding to the first base in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein is a cytosine and the residue shown in bold at the third base of the corresponding codon is an guanine and, as a result, encodes leucine. Species Sequence Plasmopara viticola 5′TTATGGTGTTCAGGGGTAAT (cDNA & genomic) TATTTTTATTTTAATGATGGCG ACTGCA C T G ATGGGTTATG 3′ Rhynchosporium secalis 5′GTATGAACAATAGGTACATT (cDNA & genomic) TATATTCATATTAATGATCGTT ACAGCA C T G TTGGGTTATG 3′ Pyrenophora teres 5′GTATGAACTATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCC C T G CTGGGTTACG 3′ Pyrenophora teres 5′CGCTATACAGATAAATTTAG (genomic) GTTGTAGTTAGCCGGAACTTAG ACAGCC C T G CTGGGTTACCAAC ATAGCCCAAAATGGTTTAATAT AAGTAATAAAAAAAG 3′ Mycosphaerella graminicola 5′ACATGAACAATCGGTACTAT (cDNA & genomic) AATACTAGTTCTGATGATGGCA ACCGCA C T G TTAGGGTATG 3′ Mycosphaerella fijiensis 5′GTATGAGTTATAGGTACTAT var. difformis TATATTAGTTCTAATGATGGCA (cDNA & genomic) ACTGCC C T G TTAGGGTATG 3′ Sphaerotheca fuliginea 5′CATTAGGTGTAGTTATATTC (cDNA) ATATTAATGATCGTTACTGCA C T G CTGGGTTATG 3′ Uncinula necator 5′CAATTGGTACAGTAATATTC (cDNA) ATTTTAATGATGGCTACAGCA C T G TTGGGTTATG 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTGCTAT Cgr1 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGT C T G TTAGGGTATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTTGTAT Cgr2 (genomic & cDNA) AATACTTGTAGCTATGATGGGT ATAGGT C T G TTAGGATATGTTT TACCTTACGGACAAATGTCATT ATGAGGTGCTACAGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (cDNA) AATACTTGTAGCTATGATGGGT ATAGGT C T G CTGGGTTATGTTT TACCTTACGGACAAATGTCACT ATGAGGTGCAACTGT 3′ Colletotrichum graminicola — 5′GTTTGAGTTATAGGTACTAT Cgr3 (genomic) AATACTTGTAGCTATGATGGGT ATAGGT C T G CTGGGTTACTTCA ACATAGCCCAAAATGATATGCA ATTATTAGGATTTCA 3′ Pythium aphanidermatum 5′TTATGGTGTTCAGGTGTTGT (genomic & cDNA) TATTTTTATTTTAATGATGGCA ACAGCT C T G ATGGGTTATG 3′ Colletotrichum 5′GTTTGAGTTATAGGTGCTAT gloeosporioides —chilli AATACTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGT C T G CTGGGTTATG 3′ Colletotrichum 5′GTTTGAGTAATAGGTGCTAT gloeosporioides —mango AATTCTTGTAGCTATGATGGGT (genomic & cDNA) ATAGGT C T G TTGGGTTATGTTT TACCTTACGGGCAAATGTCATT ATGAGGTGCAACAGT 3′ Oidium lycopersicum 5′ACATGAACTATAGGTACAGT (cDNA) TATATTCATATTAATGATGGCT ACAGCA C T G CTGGGTTATG 3′ Leveillula taurica —Lt1 5′ACATGAACAATAGGTGTGGT (cDNA) AATATTTATATTAATGATGGCT ACAGCT C T G TTGGGTTATGTTT TACCGTACGGTCAAATGAGTTT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt4 5′ACATGAACAATAGGTGTTGT (cDNA) AATATTTATATTAATGATGGCT ACAGCT C T G CTAGGTTACGTTT TACCATACGGACAAATGTCATT ATGAGGTGCAACAGT 3′ Leveillula taurica —Lt2 5′ACATGAACTATTGGTGTTGT (cDNA) TATCTTTATATTAATGATGGCT ACTGCC C T G TTAGGATATGTTT TACCATATGGTCAAATGAGTTT ATGAGGTGCTACAGT 3′ Leveillula taurica —Lt3 5′ATGAACAATTGGTACAGTAA (cDNA) TATTCATATTAATGATGGCTAC TGCA C T G CTGGGTTATGTTCTA CCTTTCGGACAGATGTCGCTCT GGGGTGCAACCGT 3′ Pseudoperonospora cubensis 5′TTATGGTGTTCAGGTGTTAT (cDNA & genomic) TATTTTTATTTTAATGATGGCA ACAGCT C T G ATGGGTTATG 3′ Alternaria solani 5′GTATGAACTATTGGTACTGT (cDNA & genomic) TATCTTTATCTTAATGATGGCT ACAGCT C T G CTGGGTTATG 3′ Cercospora arachidola 5′TTATGATCTATTGGAGTTAT (cDNA & genomic) AATTTTAGTTCTTATGATGGCA ATAGCC C T G TTAGGATATG 3′ Rhizoctonia solani 5′CTATCGGAGTTGTTATGCTT (cDNA) GTTATGATGATGGGGATCGCA C T G TTAGGTTATG 3′ Mycosphaerella musicola 5′GTATGAGTTATAGGTACTAT (genomic & cDNA) TATATTAGTTCTAATGATGGCT ACCGCC C T G TTAGGATATG 3′ Didymella bryoniae —Db1 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCT C T G CTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCAACTGT 3′ Didymella bryoniae —Db2 5′GTGTGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCT C T G CTGGGTTATGTGC TGCCCTACGGGCAGATGTCATT ATGAGGTGCTACAGT 3′ Didymella lycopersici 5′GTATGAACAATTGGTACTGT (cDNA) TATCTTTATCTTAATGATGGCT ACAGCT C T G CTGGGTTATGTTC TTCCTTATGGGCAAATGTCATT ATGAGGTGCTACAGT 3′ The invention also extends to a fungal DNA sequence showing homology or sequence identity to said DNA sequences containing said polymorphisms and covers for example, variations in DNA sequences found in different samples of the same species. These variations may, for example, be due to the use of alternative codon usage, varying intron/exon organisation and amino acid replacement. The DNA sequences encoding all or part of a wild type or mutant cytochrome b protein as described herein are preferably in isolated form. For example through being partially purified from any substance with which it occurs naturally. The DNA sequence is isolatable (obtainable) or isolated (obtained) from the fungi disclosed herein. Further sequence information downstream of the 3′ end of the wild type sequences provided herein may be found in Published International Patent Application Number WO 00/66773 the teachings of which are incorporated herein by reference. The sequence information provided and teachings provided herein may be used in conjunction with that in Published International Patent Application Number WO 00/66773 to design a method of identifying the presence and absence of a mutation(s) at positions corresponding to S. cerevisiae cytochrome b residues 129 and/or 143 and the invention extends to any such method. The invention further provides a computer readable medium having stored thereon any of the sequences described and claimed herein and including all or part of a DNA sequence encoding a mutant cytochrome b protein as herein described preferably a cytochrome b protein sequence wherein the amino acid residue at the position equivalent to residue 129 of the amino acid residue at the position equivalent to residue 129 of S. cerevisiae is a leucine and the presence of one or more mutations gives rise to fungal resistance to a strobilurin analogue or any compound in the same cross resistance group said mutation(s) occurring at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein; all or part of a DNA encoding, or amino acid sequence of, a mutant cytochrome b protein said mutation(s) occurring at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein wherein said protein confers fungal resistance to a strobilurin analogue or a compound in the same cross resistance group from a fungus selected from the group Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana, preferably from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola; all or part of a DNA encoding, or amino acid sequence of a wild type cytochrome b sequence from a fungus selected from the group Plasmopara viticola, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana, preferably from the group consisting of gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group Plasmopara viticola, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola; or any allele specific oligonucleotide; allele specific oligonucleotide probe, allele specific primer, common or diagnostic primer disclosed herein. The computer readable medium may be used, for example, in homology searching, mapping, haplotyping, genotyping or any other bioinformatic analysis. Any computer readable medium may be used, for example, compact disk, tape, floppy disk, hard drive or computer chips. The polynucleotide sequences of the invention, or parts thereof, particularly those relating to and identifying the single nucleotide polymorphisms identified herein, especially the T to C (first base) and/or T to A or G and C to A or G (third base) changes in fungal cytochrome b causing the F129L change in the encoded protein, represent a valuable information source. The use of this information source is most easily facilitated by storing the sequence information in a computer readable medium and then using the information in standard bioinformatics programs. The polynucleotide sequences of the invention are particularly useful as components in databases for sequence identity and other search analyses. As used herein, storage of the sequence information in a computer readable medium and use in sequence databases in relation to polynucleotide or polynucleotide sequence of the invention covers any detectable chemical or physical characteristic of a polynucleotide of the invention that may be reduced to, converted into or stored in a tangible medium, such as a computer disk, preferably in a computer readable form. For example, chromatographic scan data or peak data, photographic scan or peak data, mass spectrographic data, sequence gel (or other) data. A computer based method is also provided for performing sequence identification, said method comprising the steps of providing a polynucleotide sequence comprising a polymorphism of the invention in a computer readable medium and comparing said polymorphism containing polynucleotide sequence to at least one other polynucleotide or polypeptide sequence to identify identity (homology) i.e. screen for the presence of the polymorphism. The invention further provides a fungal cytochrome b protein which confers fungal resistance to a strobilurin analogue or a compound within the same cross resistance group wherein in said protein a normal phenylalanine residue is altered due to the presence of one or more mutation(s) in the DNA coding for said protein said mutation(s) occurring at a position in the DNA corresponding to the first and/or third bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. In a preferred embodiment of this aspect the invention further provides a fungal cytochrome b protein which confers fungal resistance to a strobilurin analogue or a compound within the same cross resistance group wherein in said protein a normal phenylalanine residue is altered due to the presence of a mutation in the DNA coding for said protein said mutation occurring at a position in the DNA corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. The phenylalanine residue in the protein according to the above aspect of the invention is preferably replaced by an alternative amino acid and said replacement results in the fungus showing resistance to a strobilurin analogue or any other compound in the same cross resistance group. The mutation according to the above aspect of the invention preferably results in the replacement of said phenylalanine residue with an amino acid selected from the group isoleucine, leucine, cysteine, serine, valine, tyrosine and most preferably leucine. In a further aspect the invention provides an antibody capable of recognising said mutant cytochrome b protein. In a further aspect the invention provides a method for the detection of the presence or absence of one or more mutation(s) in a fungal cytochrome b gene resulting in replacement in the encoded protein of a phenyalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129 said method comprising identifying the presence or absence of said mutation(s) in a sample of fungal nucleic acid using any or a single nucleotide polymorphism detection method wherein said single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. in either the wild type or mutant protein. In a further preferred embodiment of this aspect the invention provides a method for the detection of the presence or absence of one or more mutation(s) in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein said method comprising identifying the presence or absence of said mutation(s) in a sample of fungal nucleic acid using any (or a) single nucleotide polmorphism detection method wherein said single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. In a further preferred embodiment of this aspect the invention provides a method for the detection of a first base thymine to a cytosine mutation and/or a third base thymine to adenine or guanine mutation or a cytosine to a adenine or guanine mutation in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein said method comprising identifying the presence or absence of said mutation(s) in a sample of fungal nucleic acid using any (or a) single nucleotide polymorphism detection method wherein said single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. In a further particularly preferred embodiment of this aspect the invention provides a method for the detection of a first base thymine to cytosine mutation or a third base thymine to adenine or guanine mutation or a cytosine to a adenine or guanine mutation in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein said method comprising identifying the presence or absence of said mutation(s) in a sample of fungal nucleic acid using any (or a) single nucleotide polymorphism detection method wherein said single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. In a further particularly preferred embodiment of this aspect the invention provides a:method for the detection of a third base cytosine to adenine mutation in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein said method comprising identifying the presence or absence of said mutation(s) in a sample of fungal nucleic acid using any (or a) single nucleotide polymorphism detection method wherein said single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. In the above aspects of the invention the single nucleotide polymorphism detection method is preferably based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. As used herein the term “upstream” is used to denote sequences “5′to” and the term “downstream” to denote sequences “3′ to”. The sequence information according to the above aspect of the invention is preferably derived from a fungus selected from the group comprising: Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana, preferably from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici; Mycosphaerella musicola and Cercospora arachidola and more preferably from the group Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctania solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola. As used herein the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides. In the above aspects of the invention it is preferred that the sequence information used is around 30, preferably 30 nucleotides upstream and/or downstream of the position corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in either the wild type or mutant protein. The nucleic acid according to the invention is preferably DNA. The test sample of nucleic acid is conveniently a total DNA preparation from fungal material, a cDNA preparation from fungal material or the fungal material itself or plant or seed extracts containing fungal nucleic acid. In this specification, we describe the detection of the F129L mutation by using total genomic DNA or cDNA preparations. However, it will be appreciated that the test sample may equally be a nucleic acid, the sequence of which corresponds to the sequence in the test sample. That is to say that all or a part of the region in the sample nucleic acid may firstly be isolated or amplified using any convenient technique such as PCR before use in a method of the invention. The present invention provides a means of analysing mutations in the DNA of agricultural field samples which by their very origin are normally considerably less well defined compared with analogous situations involving human samples with which the diagnostic methods described herein are more commonly used. Agricultural field samples are considerably more difficult to work with and it is more technically demanding to detect a mutation event occurring at a low frequency amongst a very large amount of wild type DNA and/or extraneous DNA from other organisms that is/are present in a field isolate when compared with a human sample that frequently contains DNA from only one individual. Any convenient enzyme for polymerisation may be used provided that it has no intrinsic ability to discriminate between normal and mutant template sequences to any significant extent. Examples of convenient enzymes include thermostable enzymes which have no significant 3′-5′ exonuclease activity, for example Taq DNA polymerase, particularly ‘Ampli Taq Gold’™ DNA polymerase (Applied Biosystems), Stoffel fragment, or other appropriately N-terminal deleted modifications of Taq ( Thermus aquaticus ) or Tth ( Thermus thermophilus ) DNA polymerases. In a further aspect the current invention provides an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a wild type cytochrome b protein wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129. In a preferred embodiment the said fungal nucleic acid sequence is selected from a fungus from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana. In a preferred embodiment of this aspect of the invention the said fungal nucleic acid sequence is selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola, and Cercospora arachidola and in a particularly preferred embodiment the fungal nucleic acid is selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola. The fungal nucleic acid according to the above aspects of the invention is preferably DNA. In a further aspect of the invention we provide an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a mutant cytochrome b protein wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding an amino acid selected from the group isoleucine, leucine, serine, cysteine, valine, tyrosine, and most preferably leucine at the position corresponding to S. cerevisiae cytochrome b residue 129. In a preferred embodiment of this aspect of the invention we provide an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding an amino acid selected from the group isoleucine, leucine; serine, cysteine, valine, tyrosine, and most preferably leucine at the position corresponding to S. cerevisiae cytochrome b residue 129. In a further preferred embodiment of this aspect of the invention we provide an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola. The fungal nucleic acid according to the above aspects of the invention is preferably DNA. In a further aspect the invention provides an allele specific oligonucleotide probe capable of detecting a wild type cytochrome b gene sequence at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. In a further aspect the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymorphism at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. In a further preferred embodiment of this aspect the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. In a further preferred embodiment of this aspect the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. In a further preferred embodiment of this aspect the invention provides an allele specific oligonucleotide probe capable of detecting,a fungal cytochrome b gene polymorphism at positions in the DNA corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. In further preferred embodiments of the above aspect of the invention said polymorphism is a thymine to cytosine base change at the first base a thymine or cytosine to adenine or guanine change at the third base of the codon, the mutation is in a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana. In further preferred embodiments of the above aspect of the invention said polymorphism is a thymine to cytosine base change at the first base a thymine or cytosine to adenine or guanine change at the third base of the codon, the mutation is in a fungus selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola. The allele-specific oligonucleotide probe is preferably 12 to 50 nucleotides long, more preferable about 12-35 nucleotides long and most preferably about 12-30 nucleotides long. The design of such probes will be apparent to the molecular biologist of ordinary skill and may be based on DNA or RNA sequence information. Such probes are of any convenient length such as up to 50 bases, up to 40 bases, more conveniently up to 30 bases in length, such as for example 8-25 or 8-15 bases in length. In general such probes will comprise base sequences entirely complementary to the corresponding wild type or variant locus in the gene. However, if required one or more mismatches may be introduced, provided that the discriminatory power of the oligonucleotide probe is not unduly affected. The probes of the invention may carry one or more labels to facilitate detection (e.g. fluorescent labels including for example FAM and VIC). The invention further provides nucleotide primers which can detect the nucleotide polymorphisms according to the invention. According to another aspect of the invention there is provided an allele specific primer capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. According to a preferred embodiment of this aspect of the invention there is provided an allele specific primer capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. According to a further preferred embodiment of this aspect of the invention there is provided an allele specific primer capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. According to a further preferred embodiment of this aspect of the invention there is provided an allele specific primer capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. In the above aspects the said mutation in the DNA sequence is preferably a thymine to cytosine base change at the first base of the triplet and a thymine or cytosine to adenine or guanine change at the third base of the triplet, most preferably a cytosine to adenine change at the third position. In a further aspect the invention provides an allele specific primer capable of detecting a fungal DNA sequence encoding a wild type cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musical, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana wherein said primer is capable of detecting a DNA sequence encoding a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129. In a preferred embodiment of this aspect the invention provides an allele specific primer capable of detecting a fungal DNA sequence encoding a wild type cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicol, and Cercospora arachidola horiana wherein said primer is capable of detecting a DNA sequence encoding a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129. In a preferred embodiment of this aspect of the invention the said fungal DNA sequence is selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola. In a further aspect of the invention we provide an allele specific primer capable of detecting a fungal DNA sequence encoding part of a mutant cytochrome b protein wherein said allele specific primer is capable of detecting a DNA sequence encoding an amino acid selected from the group isoleucine, leucine, serine, cysteine, valine, tyrosine, and most preferably leucine at the position corresponding to S. cerevisiae cytochrome b residue 129. In a further embodiment of this aspect of the invention we provide an allele specific primer capable of detecting a fungal DNA sequence encoding part of a mutant cytochrome b protein wherein said allele specific primer is capable of detecting a DNA sequence encoding an amino acid selected from the group isoleucine, leucine, serine, cysteine, valine, tyrosine, and most preferably leucine at the position corresponding to S. cerevisiae cytochrome b residue 129. In a preferred embodiment of this aspect of the invention we provide an allele specific primer capable of detecting a fungal DNA sequence encoding part of a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola, Cercospora arachidola, Colletotrichum acutatum, Wilsonomyces carpophillum, Didymella bryoniae, Didymella lycopersici, Peronospora tabacina, Puccinia recondita and Puccinia horiana wherein said primer is capable of detecting a DNA sequence encoding an amino acid selected from the group isoleucine, leucine, serine, cysteine, valine, tyrosine, and most preferably leucine at the position corresponding to S. cerevisiae cytochrome b residue 129. In a further preferred embodiment of this aspect of the invention we provide an allele specific primer capable of detecting a fungal DNA sequence encoding part of a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Didymella bryoniae, Didymella lycopersici, Mycosphaerella musicola and Cercospora arachidola wherein said primer is capable of detecting a DNA sequence encoding an amino acid selected from the group isoleucine, leucine, serine, cysteine, valine, tyrosine, and most preferably leucine at the position corresponding to S. cerevisiae cytochrome b residue 129. An allele specific primer is used generally with a common primer in an amplification reaction such as a PCR reaction which provides the discrimination between alleles through selective amplification of one allele at a particular sequence position e.g as used in the ARMS assay. We are now able to devise primers for the F129L mutation in the above-listed fungal species which have been shown to detect the specific mutations reliably and robustly. The primers detect either the thymine to cytosine base change at a position in the DNA corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein and/or the thymine or cytosine to adenine or guanine base changes at a position in the DNA corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the protein. The allele specific primers are herein referred to as diagnostic primers. In a further aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence at a position corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group. In a further embodiment of this aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence at a position corresponding to first or the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group. In a further embodiment of this aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence at a position corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group. In a further preferred embodiment of this aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence at a position corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group. In a further aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence at a position corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group. In a further aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence at a position corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group. The diagnostic primer of the invention is preferably at least 20 nucleotides in length, and most preferably about 26 nucleotides in length. However, diagnostic primers of the invention may also be between 15 and 20 nucleotides in length. It will be appreciated by th eskilled man that diagnostic primers of the invention may be such thtat they hybridise to either the sense or the antisense strand of nucleic acid encoding the fungal cytochrome b protein. In a preferred embodiment of the above aspect of the invention the penultimate nucleotide (−2) of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence. In a further preferred embodiment it is the −3 nucleotide of the primer which is not the same as that present in the corresponding position in the wild type cytochrome b sequence. Other destabilising components may be incorporated along with the −2 or −3 nucleotide. In a further particularly preferred embodiment of the above aspect of the invention we provide diagnostic primers capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129. in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer. In a further particularly preferred embodiment of the above aspect of the invention we provide diagnostic primers capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer. In a further particularly preferred embodiment of the above aspect of the invention we provide diagnostic primers capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer. In a further particularly preferred embodiment of the above aspect of the invention we provide diagnostic primers capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence corresponding to the first base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer. In a further particularly preferred embodiment of the above aspect of the invention we provide diagnostic primers comprising the sequences given below and derivatives thereof wherein the final nucleotide at the 3′ end is identical to the sequences given below and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied without significantly affecting the properties of the diagnostic primer. Diagnostic (e.g. ARMS) primers will have a high Tm as will be appreciated by the man skilled in the art, and it is preferred that the ARMS primers in all aspects of the invention are about 26 nucleotides in length. Conveniently, the sequence of the diagnostic primer may be exactly as provided below (see Tbales 9 to 13). In all the primers listed below int Table 9 to 13, the penultimate nucleotide has been altered from wild type cyt b sequence to destabilise the template/primer hybrid thereby making it more selective for the desired template and these primers are particularly preferred according to the invention. It will be apparent to the man skilled in the art of primer design that bases alternative to or in addition to those discussed above may also be varied without adversely affecting the ability of the primer to bind to the template. TABLE 9 ARMS primer design for the detection of the F129L mutation where the first base in the triplet coding for the leucine residue is a cytosine. primer sequence for the detection of F129L (thymine to cytosine change at first Primer # species: base of triplet 5′ to 3′) 1 Plasmopara viticola (reverse) CCCAAGGCAAAACATAACCCAT C AG 2 Erysiphe graminis f. sp. tritici/hordei ATTCATATTAATGATCGTTACTGC C C 3 Rhynchosporium secalis ATTCATATTAATGATCGTTACAGC G C 4 Pyrenophora teres (cDNA) CTTTATCTTAATGATGGCTACAGC G C 5 Pyrenophora teres (genomic) GTAGTTAGCCGGAACTTAGACAGC G C 6 Mycosphaerella graminicola ACTAGTTCTGATGATGGCAACCGC G C 7 Mycosphaerella fijiensis var. difformis ATTAGTTCTAATGATGGCAACTGC G C 8 Sphaerotheca fuliginea ATTCATATTAATGATCGTTACTGC G C 9 Uncinula necator ATTCATTTTAATGATGGCTACAGC G C 10 Colletotrichum graminicola —Cgr1 ACTTGTAGCTATGATGGGTATAGG C C 11 Colletotrichum graminicola —Cgr2 ACTTGTAGCTATGATGGGTATAGG C C 12 Colletotrichum graminicola —Cgr3 ACTTGTAGCTATGATGGGTATAGG A C 13 Pythium aphanidermatum (forward) TTTTATTTTAATGATGGCAACAGC G C 14 Colletotrichum gloeosporioides —chilli ACTTGTAGCTATGATGGGTATAGG A C 15 Colletotrichum gloeosporioides —mango TCTTGTAGCTATGATGGGTATAGG A C 16 Oidium lycopersicum ATTCATATTAATGATGGCTACAGC G C 17 Leveillula taurica —Lt1 ATTTATATTAATGATGGCTACAGC G C 18 Leveillula taurica —Lt4 ATTTATATTAATGATGGCTACAGC G C 19 Leveillula taurica —Lt2 CTTTATATTAATGATGGCTACTGC G C 20 Leveillula taurica —Lt3 ATTCATATTAATGATGGCTACTGC G C 21 Pseudoperonospora cubensis TTTTATTTTAATGATGGCAACAGC G C 22 Alternaria solani CTTTATCTTAATGATGGCTACAGC G C 23 Cercospora arachidola TTTAGTTCTTATGATGGCAATAGC G C 24 Rhizoctonia solani GCTTGTTATGATGATGGGGATCGC G C 25 Venturia inaequalis CTTTATATTAATGATAGTTACAGC G C 26 Phytophthora infestans TTTTATTTTAATGATGGCTACTGC G C 27 Mycosphaerella musicola ATTAGTTCTAATGATGGCTACCGC G C 28 Didymella bryoniae —Db1 CTTTATCTTAATGATGGCTACAGC G C 29 Didymella bryoniae —Db2 CTTTATCTTAATGATGGCTACAGC G C 30 Didymella lycopersici CTTTATCTTAATGATGGCTACAGC G C TABLE 10 ARMS primer design for the detection of the F129L mutation where the third base in the triplet coding for the leucine residue is an adenine residue. primer sequence for the detection of F129L (thymine to cytosine change at third Primer # species: base of triplet 5′ to 3′) 1 Plasmopara viticola (reverse) TCCCCAAGCCAAAACATAACCCA G T 2 Erysiphe graminis f. sp. tritici/hordei TCATATTAATGATCGTTACTGCAT G A 3 Rhynchosporium secalis TCATATTAATGATCGTTACAGCAT G A 4 Pyrenophora teres (cDNA) TTATCTTAATGATGGCTACAGCCT G A 5 Pyrenophora teres (genomic) AGTTAGCCGGAACTTAGACAGCCT G A 6 Mycosphaerella graminicola TAGTTCTGATGATGGCAACCGCAT G A 7 Mycosphaerella fijiensis var. difformis TAGTTCTAATGATGGCAACTGCCT G A 8 Sphaerotheca fuliginea TCATATTAATGATCGTTACTGCAT G A 9 Uncinula necator TCATTTTAATGATGGCTACAGCAT G A 10 Colletotrichum graminicola —Cgr1 TTGTAGCTATGATGGGTATAGGTT G A 11 Colletotrichum graminicola —Cgr2 TTGTAGCTATGATGGGTATAGGTT G A 12 Colletotrichum graminicola —Cgr3 TTGTAGCTATGATGGGTATAGGTT G A 13 Pythium aphanidermatum (reverse) ACCCCAAGGTAATACATAACACGTT 14 Colletotrichum gloeosporioides —chilli TTGTAGCTATGATGGGTATAGGTT G A and mango 15 Oidium lycopersicum TCATATTAATGATGGCTACAGCAT G A 16 Leveillula taurica Lt1 TTATATTAATGATGGCTACAGCTT G A 17 Leveillula taurica Lt4 TTATATTAATGATGGCTACAGCTT G A 18 Leveillula taurica Lt2 TTATATTAATGATGGCTACTGCCT G A 19 Leveillula taurica Lt3 TCATATTAATGATGGCTACTGCAT G A 20 Pseudoperonospora cubensis TTATTTTAATGATGGCAACAGCTT G A 21 Alternaria solani TTATCTTAATGATGGCTACAGCTT G A 22 Cercospora arachidola TAGTTCTTATGATGGCAATAGCCT G A 23 Rhizoctonia solani TTGTTATGATGATGGGGATCGCAT G A 24 Venturia inaequalis TTATATTAATGATAGTTACAGCCT G A 25 Phytophthora infestans TTATTTTAATGATGGCTACTGCTT G A 26 Mycosphaerella musicola TAGTTCTAATGATGGCTACCGCCT G A 27 Didymella bryoniae —Db1 TTATCTTAATGATGGCTACAGCTT G A 28 Didymella bryoniae —Db2 TTATCTTAATGATGGCTACAGCTT G A 29 Didymella lycopersici TTATCTTAATGATGGCTACAGCTT G A TABLE 11 ARMS primer design for the detection of the F129L mutation where the third base in the triplet coding for the leucine residue is guanine. primer sequence for the detection of F129L (thymine to cytosine to guanine change at third Primer # species: base of triplet 5′ to 3′) 1 Plasmopara viticola (reverse) TCCCCAAGGCAAAACATAACCCA G C 2 Erysiphe graminis f. sp. tritici/hordei TCATATTAATGATCGTTACTGCAT C G 3 Rhynchosporium secalis TCATATTAATGATCGTTACAGCAT C G 4 Pyrenophora teres (cDNA) TTATCTTAATGATGGCTACAGCCT C G 5 Pyrenophora teres (genomic) AGTTAGCCGGAACTTAGACAGCCT C G 6 Mycosphaerella graminicola TAGTTCTGATGATGGCAACCGCAT C G 7 Mycosphaerella fijiensis var. difformis TAGTTCTAATGATGGCAACTGCCT C G 8 Sphaerotheca fuliginea TCATATTAATGATCGTTACTGCAT C G 9 Uncinula necator TCATTTTAATGATGGCTACAGCAT C G 10 Colletotrichum graminicola —Cgr1 TTGTAGCTATGATGGGTATAGGTT C G 11 Colletotrichum graminicola —Cgr2 TTGTAGCTATGATGGGTATAGGTT C G 12 Colletotrichum graminicola —Cgr3 TTGTAGCTATGATGGGTATAGGTT C G 13 Pythium aphanidermatum (forward) TTATTTTAATGATGGCAACAGCTT C G 14 Colletotrichum gloeosporioides —chilli TTGTAGCTATGATGGGTATAGGTT C G and mango 15 Oidium lycopersicum TCATATTAATGATGGCTACAGCAT C G 16 Leveillula taurica Lt1 TTATATTAATGATGGCTACAGCTT C G 17 Leveillula taurica Lt4 TTATATTAATGATGGCTACAGCTT C G 18 Leveillula taurica Lt2 TTATATTAATGATGGCTACTGCCT C G 19 Leveillula taurica Lt3 TCATATTAATGATGGCTACTGCAT C G 20 Pseudoperonospora cubensis TTATTTTAATGATGGCAACAGCTT C G 21 Alternaria solani TTATCTTAATGATGGCTACAGCTT C G 22 Cercospora arachidola TAGTTCTTATGATGGCAATAGCCT C G 23 Rhizoctonia solani TTGTTATGATGATGGGGATCGCAT C G 24 Venturia inaequalis TTATATTAATGATAGTTACAGCCT C G 25 Phytophthora infestans TTATTTTAATGATGGCTACTGCTT C G 26 Mycosphaerella musicola TAGTTCTAATGATGGCTACCGCCT C G 27 Didymella bryoniae —Db1 TTATCTTAATGATGGCTACAGCTT C G 28 Didymella bryoniae —Db2 TTATCTTAATGATGGCTACAGCTT C G 29 Didymella lycopersici TTATCTTAATGATGGCTACAGCTT C G Table 12 ARMS primer design for the detection of the F129L mutation where the first base on the triplet coding for residue 129 is a cytosine and the third base is an adenine residue such that leucine is encoded. primer sequence for the detection of F129L (thymine to cytosine change at the first base and a thymine or cytosine to adenine change at third Primer # species: base of triplet 5′ to 3′) 1 Plasmopara viticola (reverse) TTATTTTAATGATGGCGACTGCAC G A 2 Erysiphe graminis f. sp. tritici/hordei TCATATTAATGATCGTTACTGCAC G A 3 Rhynchosporium secalis TCATATTAATGATCGTTACAGCAC G A 4 Pyrenophora teres (cDNA) TTATCTTAATGATGGCTACAGCCC G A 5 Pyrenophora teres (genomic) AGTTAGCCGGAACTTAGACAGCCC G A 6 Mycosphaerella graminicola TAGTTCTGATGATGGCAACCGCAC G A 7 Mycosphaerella fijiensis var. difformis TAGTTCTAATGATGGCAACTGCCC G A 8 Sphaerotheca fuliginea TCATATTAATGATCGTTACTGCAC G A 9 Uncinula necator TCATTTTAATGATGGCTACAGCAC G A 10 Colletotrichum graminicola —Cgr1 TTGTAGCTATGATGGGTATAGGTC G A 11 Colletotrichum graminicola —Cgr2 TTGTAGCTATGATGGGTATAGGTC G A 12 Colletotrichum graminicola —Cgr3 TTGTAGCTATGATGGGTATAGGTC G A 13 Pythium aphanidermatum (forward) TTATTTTAATGATGGCAACAGCTC G A 14 Colletotrichum gloeosporioides —chilli TTGTAGCTATGATGTATATAGGTC G A and mango 15 Oidium lycopersicum TCATATTAATGATGGCTACAGCAC G A 16 Leveillula taurica Lt1 TTATATTAATGATGGCTACAGCTC G A 17 Leveillula taurica Lt4 TTATATTAATGATGGCTACAGCTC G A 18 Leveillula taurica Lt2 TTATATTAATGATGGCTACTGCCC C A 19 Leveillula taurica Lt3 TCATATTAATGATGGCTACTGCAC G A 20 Pseudoperonospora cubensis TTATTTTAATGATGCCAACAGCTC G A 21 Alternaria solani TTATCTTAATGATGGCTACAGCTC G A 22 Cercospora arachidola TAGTTCTTATGATGGCAATAGCCC G A 23 Rhizoctonia solani TTGTTATGATGATGGGGATCGCAC G A 24 Venturia inaequalis TTATATTAATGATAGTTACAGCCC G A 25 Phytophthora infestans TTATTTTAATGATGGCTACTGCTC G A 26 Mycosphaerella musicola TAGTTCTAATGATGGCTACCGCCC G A 27 Didymella bryoniae —Db1 TTATCTTAATGATGGCTACAGCTC G A 28 Didymella bryoniae —Db2 TTATCTTAATGATGGCTACAGCTC G A 29 Didymella lycopersici TTATCTTAATGATGGCTACAGCTC G A TABLE 13 ARMS primer design for the detection of the F129L mutation where the first base on the triplet coding for residue 129 is a cytosine and the third base in the triplet coding is guanine such that leucine is encoded. primer sequence for the detection of F129L Primer (thymine or cytosine to guanine change at # species: third base of triplet 5′ to 3′) 1 Plasmopara viticola TTATTTTAATGATGGCGACTGCAC C G 2 Erysiphe graminis f.sp. tritici/hordei TCATATTAATGATCGTTACTGCAC G G 3 Rhynchosporium secalis TCATATTAATGATCGTTACAGCAC C G 4 Pyrenophora teres (cDNA) TTATCTTAATGATGGCTACAGCCC C G 5 Pyrenophora teres (genomic) AGTTAGCCGGAACTTAGACAGCCC C G 6 Mycosphaerella graminicola TAGTTCTGATGATGGCAACCGCAC C G 7 Mycosphaerella fijiensis var. difformis TAGTTCTAATGATGGCAACTGCCC C G 8 Sphaerotheca fuliginea TCATATTAATGATCGTTACTGCAC C G 9 Uncinula necator TCATTTTAATGATGGCTACAGCAC C G 10 Colletotrichum graminicola Cgr1 TTGTAGCTATGATGGGTATAGGTC C G 110 Colletotrichum graminicola Cgr2 TTGTAGCTATGATGGGTATAGGTC C G 12 Colletotrichum graminicola Cgr3 TTGTAGCTATGATGGGTATAGGTC C G 13 Pythium aphanidermatum (forward) TTATTTTAATGATGGCAACAGCTC C G 14 Colletotrichum gloeosporioides - chilli TTGTAGCTATGATGGGTATAGGTC C G and mango 15 Oidium lycopersicum TCATATTAATGATGGCTACAGCAC C G 16 Leveillula taurica Lt1 TTATATTAATGATGGCTACAGCTC C G 17 Leveillula taurica Lt4 TTATATTAATGATGGCTACAGCTC C G 18 Leveillula taurica Lt2 TTATATTAATGATGGCTACTGCCC C G 19 Leveillula taurica Lt3 TCATATTAATGATGGCTACTGCAC C G 20 Pseudoperonospora cubensis TTATTTTAATGATGGCAACAGCTC C G 21 Alternaria solani TTATCTTAATGATGGCTACAGCTC C G 22 Cercospora arachidola TAGTTCTTATGATGGCAATAGCCC C G 23 Rhizoctonia solani TTGTTATGATGATGGGGATCGCAC C G 24 Venturia inaequalis TTATATTAATGATAGTTACAGCCC C G 25 Phytophthora infestans TTATTTTAATGATGGCTACTGCTC C G 26 Mycosphaerella musicola TAGTTCTAATGATGGCTACCGCCC C G 27 Didymella bryoniae - Db1 TTATCTTAATGATGGCTACAGCTC C G 28 Didymella bryoniae - Db2 TTATCTTAATGATGGCTACAGCTC C G 29 Didymella lycopersici TTATCTTAATGATGGCTACAGCTC C G For the purposes of exemplification the primers included in Tables 9 to 13 include: ARMS primers for P.teres, C. graminicola —Cgr3 and V. ineaqualis which can be used effectively either on genomic DNA preparations or biological samples including fungal isolates, fungal cultures, fungal spores or infected plant material. ARMS primers for S. fulginea, O.lycopersicon, L. taurica Lt1, Lt2, Lt3 and Lt4, U. necator, Phytopthora infestans, R.solani, D. bryoniae Db1 and Db2, and D. lycopersici which may only be effective on cDNA ARMS primers for P.viticola, R. secalis, M. graminicola, M. fijiensis var. difformis, C. graminicola Cgr1 and Cgr2, P. aphanidermatum, C. gloesporoides —chilli and mango, P. cubensis, C, arachidola, Mycosphaerella musicola and A. solani which may be used effectively with either genomic DNA preparations, cDNA preparations, cDNA preparations or biological samples including fungal isolates, fungal cultures, fungal spores or infected plant material. cDNA material is recommended for those species in which the intron/exon organisation is not currently characterised around the nucleotide polymorphisms of interest. The ARMS primers described in Tables 9-13 above provide specific examples of diagnostic primers according to the invention. To adapt the primers shown in the above Tables for use in a standard ASPCR reaction the last base at the 3′ end should correspond to the point mutation without a destabilising base introduced. Such primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example “Protocols For Oligonucleotides And Analogues: Synthesis And Properties;” Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; 1 st Edition. It will be appreciated that diagnostic primers can be designed to indicate the absence of one or more mutation(s) resulting in a F129L replacement in the encoded protein (i.e. to detect wild type sequence encoding phenylalanine or confirm the presence of sequence encoding leucine at the position corresponding to codon 129 in S. cerevisisiae cytochrome b. The use of ARMS primers for the detection of the absence of the mutation(s) resulting in a F129L replacement in the encoded protein is preferred. Primers designed for that purpose are described herein. The detection of the wild type sequence is useful as a control in relation to the detection of the mutation and also is necessary where quantitation of wild type and mutant alleles present in a sample is desired. In a further aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising wild type fungal cytochrome b nucleotide sequence corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in a wild type fungal cytochrome b gene said wild type fungus showing sensitivity to a strobilurin analogue or any other compound in the same cross resistance group. In a further embodiment of this aspect the invention therefore provides diagnostic primers capable of binding to a template comprising wild type fungal cytochrome b nucleotide sequence corresponding to the first or the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in a wild type fungal cytochrome b gene said wild type fungus showing sensitivity to a strobilurin analogue or any other compound in the same cross resistance group In a further aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising wild type fungal cytochrome b nucleotide sequence corresponding to the third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in a wild type fungal cytochrome b gene said wild type fungus showing sensitivity to a strobilurin analogue or any other compound in the same cross resistance group. In a preferred embodiment of this aspect of the invention the penultimate nucleotide (−2) of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence. In a further preferred embodiment the -3 nucleotide of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence. Other destabilising components may be incorporated along with the −2 or −3 nucleotide. The diagnostic primer of the invention is preferably at least 20 nucleotides in length, most preferably 26 nucleotides in length but may be between 15 and 20 nucleotides in length. In a further particularly preferred embodiment of the above aspect of the invention we provide diagnostic primers capable of binding to a template comprising wild type fungal cytochrome b nucleotide sequence corresponding to the first and/or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochromeb residue 129 in the cytochrome b protein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in a wild type fungal cytochrome b and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer. In a further particularly preferred embodiment of the above aspect of the invention we provide diagnostic primers capable of binding to a template comprising wild type fungal cytochrome b nucleotide sequence corresponding to the first or third base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 129 in the cytochrome bprotein wherein the final 3′ nucleotide of the primer corresponds to a nucleotide present in a wild type fungal cytochrome b and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer. In a further particularly preferred embodiment of this aspect of the invention we provide diagnostic primers comprising the sequences given below and derivatives thereof wherein the final nucleotide at the 3′ end is identical to the sequences given below and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied without significantly affecting the properties of the diagnostic primer. Conveniently, the sequence of the diagnostic primer may be exactly as provided below (Tables 14 and 15). In the majority of the primers listed below the penultimate nucleotide has been altered from wild type cytochrome b sequence to destabilise the template/primer hybrid thereby making it more selective for the desired template. It will be apparent to the man skilled in the art of primer design that bases alternative to or in addition to those discussed above may also be varied without adversely affecting the ability of the primer to bind to the template. TABLE 14 ARMS primer designs for the detection of wild type sequence at position 1 of codon 129 of plant pathogen cytochrome b genes. primer sequence for the detection of WT sequence (focused on the thymine at the Primer Species first base of the triplet 5′ to 3′ 1 Plasmopara viticola CCCAAGGCAAAACATAACCCAT G AA (reverse complement) 2 Erysiphe graminis f.sp. tritici/hordei ATTCATATTAATGATCGTTACTGC G T 3 Rhynchosporium secalis ATTCATATTAATGATCGTTACAGC G T 4 Pyrenophora teres (cDNA) CTTTATCTTAATGATGGCTACAGC G T 5 Pyrenophora teres (genomic) GTAGTTAGCCGGAACTTAGACAGC G T 6 Mycosphaerella graminicola ACTAGTTCTGATGATGGCAACCGC G T 7 Mycosphaerella fijiensis var. difformis ATTAGTTCTAATGATGGCAACTGC G T 8 Sphaerotheca fuliginea ATTCATATTAATGATCGTTACTGC G T 9 Uncinula necator ATTCATTTTAATGATGGCTACAGC G T 10 Colletotrichum graminicola - Cgr1 ACTTGTAGCTATGATGGGTATAGG A T 11 Colletotrichum graminicola - Cgr2 ACTTGTAGCTATGATGGGTATAGG A T 12 Colletotrichum graminicola - Cgr3 ACTTGTAGCTATGATGGGTATAGG A T 13 Pythium aphanidermatum (forward) TTTTATTTTAATGATGGCAACAGC G T 14 Colletotrichum gloeosporioides - chilli ACTTGTAGCTATGATGGGTATAGG A T 15 Colletotrichum gloeosporioides - mango TCTTGTAGCTATGATGGGTATAGG A T 16 Oidium lycopersicum ATTCATATTAATGATGGCTACAGC G T 17 Leveillula taurica Lt1 ATTTATATTAATGATGGCTACAGC A T 18 Leveillula taurica Lt4 ATTTATATTAATGATGGCTACAGC A T 19 Leveillula taurica Lt2 CTTTATATTAATGATGGCTACTGC A T 20 Leveillula taurica Lt3 ATTCATATTAATGATGGCTACTGC A T 21 Pseudoperonospora cubensis TTTTATTTTAATGATGGCAACAGC G T 22 Alternaria solani CTTTATCTTAATGATGGCTACAGC G T 23 Cercospora arachidola TTTAGTTCTTATGATGGCAATAGC G T 24 Rhizoctonia solani GCTTGTTATGATGATGGGGATCGC G T 25 Venturia inaequalis CTTTATATTAATGATAGTTACAGC G T 26 Phytophthora infestans TTTTATTTTAATGATGGCTACTGC G T 27 Mycosphaerella musicola ATTAGTTCTAATGATGGCTACCGC G T 28 Didymella bryoniae - Db1 CTTTATCTTAATGATGGCTACAGC G T 29 Didymella bryoniae - Db2 CTTTATCTTAATGATGGCTACAGC G T 30 Didymella lycopersici CTTTATCTTAATGATGGCTACAGC G T TABLE 15 ARMS primer designs for the detection of wild type sequence at position 3 of codon 129 of plant pathogen cytochrome b genes. primer sequence for the detection of WT sequence. (focused on the thymine or cytosine at the third base of the Primer Species triplet 5′ to 3′) 1 Plasmopara viticola (reverse) TCCCCAAGGCAAAACATAACCCA G A 2 Erysiphe graminis f.sp. tritici/hordei TCATATTAATGATCGTTACTGCAT G C 3 Rhynchosporium secalis TCATATTAATGATCGTTACAGCAT C C 4 Pyrenophora teres (cDNA) TTATCTTAATGATGGCTACAGCCT G C 5 Pyrenophora teres (genomic) AGTTAGCCGGAACTTAGACAGCCT G C 6 Mycosphaerella graminicola TAGTTCTGATGATGGCAACCGCAT C C 7 Mycosphaerella fijiensis var. difformis TAGTTCTAATGATGGCAACTGCCT G T 8 Sphaerotheca fuliginea TCATATTAATGATCGTTACTGCAT G C 9 Uncinula necator TCATTTTAATGATGGCTACAGCAT C C 10 Colletotrichum graminicola - Cgr1 TTGTAGCTATGATGGGTATAGGTT G C 11 Colletotrichum graminicola - Cgr2 TTGTAGCTATGATGGGTATAGGTT G C 12 Colletotrichum graminicola - Cgr3 TTGTAGCTATGATGGGTATAGGTT G C 13 Pythium aphanidermatum (reverse) ACCCCAAGGTAATACATAACCC T TG 14 Colletotrichum gloeosporioides - TTGTAGCTATGATGGGTATAGGTT G C chilli and mango 15 Oidium lycopersicum TCATATTAATGATGGCTACAGCAT A C 16 Leveillula taurica Lt1 TTATATTAATGATGGCTACAGCTT A C 17 Leveillula taurica Lt4 TTATATTAATGATGGCTACAGCTT A C 18 Leveillula taurica Lt2 TTATATTAATGATGGCTACTGCCT G T 19 Leveillula taurica Lt3 TCATATTAATGATGGCTACTGCAT A C 20 Pseudoperonospora cubensis TTATTTTAATGATGGCAACAGCTT G T 21 Alternaria solani TTATCTTAATGATGGCTACAGCTT A C 22 Cercospora arachidola TAGTTCTTATGATGGCAATAGCCT A C 23 Rhizoctonia solani TTGTTATGATGATGGGGATCGCAT C T 24 Venturia inaequalis TTATATTAATGATAGTTACAGCCT A C 25 Phytophthora infestans TTATTTTAATGATGGCTACTGCTT G T 26 Mycosphaerella musicola TAGTTCTAATGATGGCTACCGCCT G T 27 Didymella bryoniae - Db1 TTATCTTAATGATGGCTACAGCTT A C 28 Didymella bryoniae - Db2 TTATCTTAATGATGGCTACAGCTT A C 29 Didymella lycopersici TTATCTTAATGATGGCTACAGCTT A C To adapt the primers shown in the above Tables for use in a standard ASPCR reaction the last base at the 3′ end should correspond to the wild type sequence without introduction of a destabilising base. The examples described above relate to ARMS primers based on the forward strand of DNA. The use of ARMS primers based on the forward strand of DNA is particularly preferred. However ARMS primers based on the reverse (antisense) strand may also be used. ARMS primers may also be based on the reverse strand of DNA if so desired. Such reverse strand primers are designed following the same principles above for forward strand primers namely, that the primers may be at least 20 nucleotides in length most preferably 26 nucleotides in length, but may be between 15 and 20 nucleotides in length and the final nucleotide at the 3′ end of the primer matches the relevant template i.e. mutant or wild type and preferably the penultimate residue is optimally changed such that it does not match the relevant template. Additionally up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides in the primer may be varied without significantly affecting the properties of the diagnostic primer. In many situations, it will be convenient to use a diagnostic primer of the invention with a further amplification primer referred to herein as the common primer, in one or more cycles of PCR amplification. A convenient example of this aspect is set out in European patent number EP-B1-0332435. The further amplification primer is either a forward or a reverse common primer. Examples of such common primers, which may be used with particular plant pathogens., are given in Table 16 below. TABLE 16 Examples of common forward and reverse primers for use with ARMS primers. Species primer sequence (5′ to 3′) 1 Plasmopara viticola (forward) CATATTTTTAGGGGTTTGTATTACGG 2 Erysiphe graminis f.sp. tritici/hordei AACACCTAAAGGATTACCAGATCCTGCAC 3 Rhynchosporium secalis TACACCTAAAGGATTACCTGACCCTGCAC 4 Pyrenophora teres (cDNA) TTACAGAGAAACCACCTCAAATGAACTCAACTATG TCCAC 5 Pyrenophora teres (genomic) TTTTTATTATACTTTTGTTAAACAGTCTTTTATTGT TTAA 6 Mycosphaerella graminicola AAATCCACCTCATACGAATTCAACTATGT 7 Mycosphaerella fijiensis var. difformis AAACCTCCTCAAATAAACTCAACTATATC 8 Sphaerotheca fuliginea (cDNA) TAACTGAGAAACCCCCTCAGAGAAACTCCACAATA TCTTG 9 Uncinula necator (cDNA) TTACAGAAAAACCACCTCAAAGAAACTCCACGATA TCTTG 10 Colletotrichum graminicola - Cgr1 TAACTGAGAAACCTCCTCAAACGAATTCAACAATA TCTTG 11 Colletotrichum graminicola - Cgr2 TAACAGAGAAACCTCCTCAAACGAATTCAACAATA TCTTG 12 Colletotrichum graminicola - Cgr3 TAACAGAGAAACCTCCTCAAACGAACTCAACAATA (cDNA) TCTTG 13 Colletotrichum graminicola - Cgr3 TATTTTTAATTGTAGTCTTGCCTTTCCTCGGAGAGG (genomic) ACAA 14 Pythium aphanidermatum (forward) TATATTATGGTTCATATATTACTCCAAG (reverse) TATTTAAAGTTGGATTATCTACAGC 15 Colletotrichum gloeosporioides - chilli TAACAGAGAAACCTCCTCAAACGAATTCAACTATA TCTTG 16 Colletotrichum gloeosporioides - mango TAACAGAGAAACCTCCTCAAACGAACTCAACGATA TCTTG 17 Oidium lycopersicum TTACAGAAAAACCTCCTCAAAGAAACTCCACGATA TCTTG 18 Leveillula taurica Lt1 TTACAGAGAAACCACCTCAAATAAATTCAACTATA TCTTG 19 Leveillula taurica Lt4 TTACAGAGAAACCTCCTCAAATAAATTCAACTATA TCTTG 20 Leveillula taurica Lt2 TAACACTGAAACCTCCTCAAATAAATTCAACTACA TCTTG 21 Leveillula taurica Lt3 TTACAGAAAAACCTCCTCAAATAAACTCGACGATA TCTTG 22 Psuedoperonospora cubensis CTACAGCAAAACCGCCCCACAACCAATCAACAATA TCTTT 23 Alternaria solani TAACACTGAAACCTCCTCAAATGAACTCAACAATA TCTTG 24 Cercospora arachidola AAACAGAGAAACCTCCTCATATAAATTCAACTAAA TCTTG 25 Rhizoctonia solani ACACGGAAAAGCCACCCCAGATTAACTCTACAAAA TCTTG 26 Venturia inaequalis (cDNA) TCACTGAAAAGCCTCCCCACAGAAATTCGACTATA TCTTG 27 Venturia inaequalis (genomic) TTGGTCCACTAATAGCCTTTCAACTACAGCTTGGT ATAAG 28 Phytophthora infestans CAACAGCAAAACCTCCCCATAACCAATCAACAATA TCTTT 29 Mycosphaerella musicola TAACAGAAAACCCACCTCAAATAAATTCAACTATA TCTTG 30 Didymella bryoniae - Db1 TAACGCTGAAACCTCCTCATATGAACTCAACAATA TCTTG 31 Didymella bryoniae - Db2 TAACTGAGAAACCACCTCAAATGAACTCAACGATA TCTTG 32 Didymella lycopersici TAACAGAAAAACCTCCTCATATGAACTCAACAATA TCTTG The common primers in Table 16 for Rhynchosporium secalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fulginea (cDNA), Uncinula necator (cDNA), Colletotrichum graminicola Cgr1, Colletotrichum gloeosporioides—chilli, Oidium lycipersicum, Leveillula taurica Lt4, Pseudoperonospora cubensis, Alternaria solani, Cercospora arachidola, Rhizoctonia solani, Phytopthora infestans and Mycospharella musicola have previously been described in in Published International Patent Application Number WO 00/66773. In the case of the longer sequences provided in Tables 3-8 and in Published International Patent Application Number WO 00/66773 the skilled man will be able to use this information to design appropriate primers. It will be evident to the man skilled in the art that the common primer can be any convenient pathogen specific sequence which recognises the complementary strand of the cytochrome b gene (or other gene of interest) lying 3′ of the mutation selective primer. The PCR amplicon size is preferentially 50 to 400 bp long but can be from 30 to 2500 bp long, or potentially from 30 to 10,000 bp long. A convenient control primer may be used which is designed upstream from the F129L position. It will be evident to the man skilled in the art that the control primer may be any primer which is not specific for the amplification of the mutation or wild type sequences. When using these primers along with the corresponding reverse (‘common’) primer described above, amplification will occur regardless whether the F129L point mutation is present or not. TABLE 17 Examples of control primers suitable for use in the invention Primer Species Control primer sequence (5′ to 3′) 1 Plasmopara viticola (reverse) GTCCCCAAGGCAAAACATAACCCAT 2 Erysiphe graminis f.sp. tritici/hordei ATTCATATTAATGATCGTTACTGC 3 Rhynchosporium secalis ATATTCATATTAATGATCGTTACAGC 4 Pyrenophora teres (cDNA) ATCTTTATCTTAATGATGGCTACAGC 5 Pyrenophora teres (genomic) TTGTAGTTAGCCGGAACTTAGACAGC 6 Mycosphaerella graminicola ATACTAGTTCTGATGATGGCAACCGC 7 Mycosphaerella fijiensis var. difformis ATATTAGTTCTAATGATGGCAACTGC 8 Sphaerotheca fuliginea ATATTCATATTAATGATCGTTACTGC 9 Uncinula necator ATATTCATTTTAATGATGGCTACAGC 10 Colletotrichum graminicola - Cgr1 ATACTTGTAGCTATGATGGGTATAGG 11 Colletotrichum graminicola - Cgr2 ATACTTGTAGCTATGATGGGTATAGG 12 Colletotrichum graminicola - Cgr3 ATACTTGTAGCTATGATGGGTATAGG 13 Pythium aphanidermatum (reverse) TTGACCCCAAGGTAATACATAACCC 14 Colletotrichum gloeosporioides - chilli ATACTTGTAGCTATGATGGGTATAGG 15 Colletotrichum gloeosporioides - ATTCTTGTAGCTATGATGGGTATAGG mango 16 Oidium lycopersicum ATATTCATATTAATGATGGCTACAGC 17 Leveillula taurica Lt1 ATATTTATATTAATGATGGCTACAGC 18 Leveillula taurica Lt4 ATATTTATATTAATGATGGCTACAGC 19 Leveillula taurica Lt2 ATCTTTATATTAATGATGGCTACTGC 20 Leveillula taurica Lt3 ATATTCATATTAATGATGGCTACTGC 21 Pseudoperonospora cubensis ATTTTTATTTTAATGATGGCAACAGC 22 Alternaria solani ATCTTTATCTTAATGATGGCTACAGC 23 Cercospora arachidola ATTTTAGTTCTTATGATGGCAATAGC 24 Rhizoctonia solani ATGCTTGTTATGATGATGGGGATCGC 25 Venturia inaequalis ATCTTTATATTAATGATAGTTACAGC 26 Phytophthora infestans ATTTTTATTTTAATGATGGCTACTGC 27 Mycosphaerella musicola ATATTAGTTCTAATGATGGCTACCGC 28 Didymella bryoniae - Db1 ATCTTTATCTTAATGATGGCTACAGC 29 Didymella bryoniae - Db2 ATCTTTATCTTAATGATGGCTACAGC 30 Didymella lycopersici ATCTTTATCTTAATGATGGCTACAGC It is intended that the invention extends to all novel oligonucleotides (which may be used as primers) that are disclosed in the above tables. A variety of methods may be used to detect the presence or absence of diagnostic primer extension products and/or amplification products. These will be apparent to the person skilled in the art of nucleic acid detection procedures. Preferred methods avoid the need for radiolabelled reagents. Particularly preferred detection methods are those based on fluorescence detection of the presence and/or absence of diagnostic primer extension products. Particular detection methods include gel electrophoresis analysis, “Scorpions”™ product detection as described in PCT application number PCT/GB98/03521 filed in the name of Zeneca Limited on 25 Nov. 1998 the teachings of which are incorporated herein by reference. Further preferred detection methods include ARMS linear extension (ALEX) and PCR with ALEX as described in published PCT application number WO 99/04037. Conveniently, real-time detection is employed. The use of “Scorpions”™ product detection as described in PCT application number PCT/GB98/03521 and published UK patent application No. GB2338301 is particularly preferred for use in all aspects of the invention described herein. The combination of the ARMS and the Scorpion technology as described herein is particularly preferred for use in all aspects of the invention described herein and the preferred detection method is a fluorescence based detection method. Many of these detection methods are appropriate for quantitative work using all of the above primers. These different PCRs can be carried out in different tubes or multiplexed in one tube. Using such methods, estimates can be made on the frequency of point mutation molecules present in a background of wild type molecules. It will be obvious to the man skilled in the art that ARMS primer based technology provides the capacity to selectively prime for the copying of the adjoining sequence following hybridisation of an allele selective hybridisation probe in which the 3′ residue matches precisely one or other of the SNP alternatives. It is possible that an ARMS primer capable, for example, of giving highly selective amplification where for example there is a C residue at the first position of codon 129 would bind well to the cyt b gene of the alternative, wild type, T residue containing gene since, apart from the 3′ and penultimate residues there would be a perfect match. The key property of ARMS is that there is no copying of the adjoining region because of the mismatch at the key 3′ residue.’ The skilled person will also appreciate that other single nucleotide polynucleotide (SNP) or simple nucleotide polymorphism detection techniques may also be employed to detect the F129L mutations given the plant pathogenic fungal cytochrome b sequence data included in this patent application. Such methods include allele selective hybridisation techniques such as: “TaqMan”™ product detection, for example as described in patent numbers U.S. Pat. No. 5,487,972 & U.S. Pat. No. 5,210,015; “TaqMan®MGB” and “turbo TaqMan®” probes described, for example in the Applied Biosystems User Bulletin: Primer Express Version 1.5 and TaqMan MGB Probes for Allelic Discrimination” (May 2000) available via: Applied Biosystems (850 Lincoln Centre Drive, Foster City, Calif. 94404, USA) and as described herein (see also Examples). Further SNP or simple nucleotide polymorphism detection techniques, which may also be used to detect the F129L mutation(s), include “Molecular Beacons”® product detection, as outlined in patent number WO-95/13399 and surface enhanced Raman resonance spectroscopy (SERRS), as outlined in patent application WO 97/05280 both of which are incorporated herein by reference. Other SNP and/or simple polynucleotide detection techniques which may be used to define the alleles present at codon 129 include, but are not limited, to: “Pyrosequencing™” (Pyrosequencing AB, Uppsala, Sweden), Locked Nucleic Acid (LNA) technology (Exiqon A/S, Bygstubben 9, 2950 Vedbæk, Denmark), Dynamic Allele Specific Hybridisation (DASH) (Hybaid US, 8 East Forge Parkway, Franklin. Mass. 02038, USA) and Denaturing High-Performance Liquid Chromatography (dHPLC) (Giordano M. et al. Genomics 56 (1999) 247-253, Oefner P. J. J.Chromatogr., B: Biomed. Sci. Appl. 739 (2000) 345-355), which are again incorporated herein by reference. The skilled user will also appreciate that some of the SNP and/or simple nucleotide recognition sequence techniques may readily be adapted to detect alleles encoding leucine at codon 129 which differ from the wild type phenylalanine codon by 2 changes (e.g. TTT CTA) for example by design of a TaqMan MGB probe capable of recognising the variant sequence including both substitutions or because the technique directly determines the sequence at several, closely linked, positions as is the case with Pyrosequencing technology. In other cases, particularly those dependent upon allele specific amplification methods (e.g. ARMS etc.) it may be desirable to develop several detection methods, including perhaps primers acting on sense and antisense sequences to differentiate single and double nucleotide polymorphisms. It may also be possible to combine different SNP detection techniques (e.g. ARMS with Pyrosequencing) to allow for the most sensitive and specific detection and discrimination between single and double nucleotide polymorphisms. The invention extends to the combination of different SNP detection techniques for use in the appropriate aspects and embodiments of the invention described herein. For example, Taqman® (or Taqman®MGB) probes may be used in combination with an ARMS primer and a common primer. Where this is the situation, it is preferred that the ARM-S primer provides the specificity for the detection of a SNP mutation and that the Taqman(® (or Taqman®MGB) probe provides the detection mease (e.g. the fluorophore to be detected). As exemplified herein we have used ARMS primers based on the forward strand of DNA in combination with Scorpion detection based on the reverse strand of DNA as the detection method. We have also exemplified herein ARMS primers based on the reverse strand of DNA in combination with Scorpion detection based on the forward strand of DNA as the detection method. It will be readily apparent to the man skilled in the art that alternative combinations of ARMS primers and Scorpion detection elements could also be used. For example the primer based on the forward strand of the DNA could be a combination of an ARMS primer with a Scorpion detection system and this could be used with a common primer based on the reverse strand of DNA or the primer based on the reverse strand of DNA could be a combination of an ARMS primer with a Scorpion detection system and this could be used with a common primer based on the forward strand of DNA. In the examples described herein, the Scorpion detection element is on the common primer. The ARMS primer specific to the mutation and the wild type sequence are used in combination with the common fluorescence labelled primer. These two reactions are carried out in different PCR tubes and the fluorescence is emitted when the probe binds to the amplicon generated. The Scorpion element may alternatively be incorporated on the ARMS primers. In this case, the two ARMS primers can be labelled with different fluorophore's and used along with the common primer (this time unlabelled). These three primers may be included in the same reaction as the resulting mutant and wild type amplicons will lead to different fluorescence being emitted. Such assays are commonly referred to as multiplex assays. As described in published UK patent application No. GB2338301 the Scorpion technology may be used in a number of different ways such as the intercalation embodiment where the tail of the Scorpion primer carries an intercalating dye which is capable of being incorporated between the bases of a double stranded nucleic acid molecule, upon which it becomes highly fluorescent; the FRET embodiment where the dyes involved in the primer form an energy transfer pair; the No-Quencher embodiment where a fluorophore is attached to the tail of the Scorpion primer; the Bimolecular embodiment where the fluorophore and quencher may be introduced on two separate but complementary molecules; the Capture Probe embodiment where amplicons may be specifically captured and probed using the same non-amplifiable tail and the Stem embodiment where the primer tail comprises self complementary stems. These embodiments are described fully in published UK patent application No. GB2338301, the teaching of which is incorporated herein by reference. As referred to above, TaqMan® probes or TaqMan® MGB probes may be used as allele specific hybridisation probes for the detection of the presence and/ or absence of a mutation. Under these circumstances such probes are used in combination with common forward and reverse primers that are specific for DNA sequences upstream of and downstream from the mutation respectively. Specifically a first TaqMan® probe (or a first TaqMan®MGB) probe that is labelled with a first fluorescent reporter dye (e.g. VIC™) is designed to hybridise to the wild type sequence. A second TaqMan® (or TaqMan® MGB) probe that is labelled with a second, different fluorescent reporter dye (e.g. FAM) is designed to hybridise to the mutation. Both the first and the second probes are also labelled with a quencher molecule. Each probe anneals specifically to its complementary sequence between the forward and reverse primer sites, and when a probes is annealed the fluorescence of the fluorescent reporter dye is quenched as a result of the close proximity of the quencher molecule. During PCR the Taq DNA polymerase, which has 5′ to 3′ exonuclease activity, cleaves the reporter dye only from probes that hybridise to their specific target sequence. This results in the physical separation of the reporter dye from the quencher molecule thus resulting in an increase of fluorescence of the reporter dye. As the probes are labelled with different fluorescent reporter dyes they can either be used in separate reactions to detect either wild type or mutant sequence as appropriate, or alternatively they may be used simulataneously in the same reaction tube. When used in the same reaction, such assays may be referred to as multiplex assays. TaqMan MGB probes are described in Applied Biosystems User Bulletin: Primer Express Version 1.5 and TaqMan® MGB Probes for Allelic Discrimination” (May 2000) available from Applied Biosystems (850 Lincoln Centre Drive, Foster City, Calif. 94404, USA). TaqMan® based assays are particularly useful for providing a relatively rapid “yes/no” answer as to the presence or not of a mutation in a test sample. The methods of the invention described herein reliably detect one or more single nucleotide polymorphism mutation(s) in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group at a detection level in the range of 1 mutated allele per 1,000,000 wild type alleles to 1 mutated allele per 10,000 wild type alleles, and preferably in the range of 1 mutated allele per 100,000 wild type alleles to 1 mutated allele per 10,000 wild type alleles. The method of the invention can also detect mutations occurring at higher frequency, for example, 1 mutated allele per 100 wild type alleles, 1 mutated allele per 10 wild type alleles or where only mutated alleles are present. Similarly the methods of the invention may be used to detect the frequency of the wild type allele in a background of mutated alleles. The combination of allele specific primer extension made more sensitive with use of the ARMS technology and quantitative detection methods that are used in the present invention make this an extremely valuable technique for the detection of fungal single and/or simple polynucleotide polymorphism mutations occurring at low frequency. The detection of those alleles responsible for giving rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group present in given isolates enables the results of phenotypic bioassays to be related to the DNA profile of the target gene. The discovery of single point mutations as the resistance mechanism explains the qualitative nature of the resistance, and the confirmation of single spore isolate sequences validates the accuracy of the screens in determining frequencies of resistant and sensitive isolates in the samples tested. The development of a method combining allele specific primer extension, the specificity of ARMS and real time fluorescent detection, as exemplified herein with the Scorpion system, enables a greater number of samples to be analysed for the presence of the resistance mutation than would be feasible in a bioassay programme. Larger sample numbers enable the identification of the resistance mutation at frequencies of a lower percentage than might be easily detected through bioassay. This enables resistance to be identified in the population before it might be apparent from field data. The high throughput nature of the method enables wider areas and more geographically distinct sites to be sampled and tested than might be possible using a bioassay. Allele specific primer extension such as ARMS linked with real time fluorescent detection allows the detection of the presence of the resistance gene in a population before the effects of the gene can be assessed phenotypically by bioassay in heteroplasmic and/or heterokaryotic cells, thus reducing the error of classifying samples as sensitive when they carry a low frequency of the resistance genotype. Results are obtained much faster through simultaneous read-out real time technology compared to waiting for disease development in planta, enabling fast responses to field situations and advice on resistance management to be given more quickly. One or more of the diagnostic primers of the invention may be conveniently packaged with instructions for use in the methods of the invention and appropriate packaging and sold as a kit. The kits will conveniently include one or more of the following: diagnostic, wild type, control and common oligonucleotide primers: appropriate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase as previously described, and a buffer solution. One or more of the allele selective hybridisation probes of the invention may also be conveniently packaged with instructions for use in the methods of the invention and appropriate packaging and sold as a kit. The kits will conveniently include one or more of the following: oligonucleotide primers which allow the selective amplification of a segment of DNA comprising the region of the target pathogen cytochrome b gene including codon 129 from both wild type and isolates resistant to strobilurin analogue or any other compound in the same cross resistance group diagnostic wild type (F 129 ) and resistant (A 129 ) selective hybridisation probes, appropriate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase as previously described, and a buffer solution. In a further aspect the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide, said method comprising detecting one or more mutations in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation(s) in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique. In a further embodiment of this aspect the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide, said method comprising detecting the hybridisation of an allele specific hybridisation probe wherein the detection of the hybridisation of said probe is directly related to presence or absence of a mutation(s) in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene. In a further embodiment of this aspect the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide, said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of a mutation(s) in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene. In a preferred embodiment of this aspect the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a cytochrome b gene comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for one or more specific mutation(s) in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation(s) is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product. In a further preferred embodiment of this aspect the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide: whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for one or more specific mutation(s) in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product. The methods of the invention described in the above aspect and embodiments are especially suitable for use with plant pathogenic fungal strains where the presence of one or more mutation(s) in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group where the mutation in the fungal DNA gives rise to a replacement of a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129, more especially to a F129L replacement in the encoded protein, and especially where the mutation is a T to C base change at the first position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 or if the mutation is a T or C to A or G base change at the third position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129. In a further aspect the invention provides a method of detecting and quantifying the frequency of one or more mutations in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue, said method comprising detecting the presence or absence of a mutation(s) in a fungal gene wherein the presence of said mutation(s) gives rise to fungal resistance to said fungicide, said method comprising identifying and quantifying the presence or absence of said mutation(s) in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique. In a further preferred embodiment of this aspect the invention provides a method of detecting and quantifying the frequency of one or more mutations in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene, said method comprising detecting the presence or absence of a mutation(s) in a fungal gene wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group, said method comprising identifying and quantifying the presence or absence of said mutation(s) in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique. In a further embodiment of this aspect the invention provides a method of detecting and quantifying the frequency of one or more mutations in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene, said method comprising detecting the hybridisation of an allele selective probe by contacting a test sample comprising fungal nucleic acid with appropriate diagnostic wild type (F 129 ) and resistant (A 129 ) selective hybridisation probes wherein the detection of hybridisation of said allele specific hybridisation probes is directly related to both the presence and absence of said mutation in said nucleic acid wherein the presence of said mutation(s) gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene, and detecting and quantifying the relative presence and absence of the said mutation(s) by reference to the presence or absence of an amplicon generated during the PCR reaction. In a further embodiment of this aspect the invention provides a method of detecting and quantifying the frequency of one or more mutations in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene, said-method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with appropriate primers in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to both the presence and absence of a mutation in said nucleic acid wherein the presence of said mutation(s) gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene, and detecting and quantifying the relative presence and absence of the said mutation(s) by reference to the presence or absence of an amplicon generated during the PCR reaction. In a further preferred embodiment of this aspect the invention provides a method of detecting and quantifying the frequency of one or more mutations in a fungal cytochrome b gene resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein wherein the presence of said mutation(s) gives rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene, comprising contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation(s) are extended only when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation(s) by reference to the presence or absence of diagnostic primer extension products. The methods of the invention described in the above aspect and embodiments are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129, due to a mutation to a T to C base change at the first position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 and/or to a mutation to a T or C to A or G base change at the third position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129, preferably due to a mutation to a T to C base change at the first position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 or preferably to a mutation to a T or C to A or G base change at the third position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129, most preferably to a C to A base change at the third position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129. In a yet further aspect the invention provides a method of selecting an active fungicide and optimal application levels thereof for application to a crop comprising analysing a sample of a fungus capable of infecting said crop and detecting and/or quantifying the presence and/or absence of one or more mutation(s) in a cytochrome b gene from said fungus resulting in a phenyalanine to leucine replacement at the position corresponding to S. cerevisiae cytochrome b residue 129 (F129L) in the encoded protein, wherein the presence of said mutation(s) may give rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene and then selecting an active fungicide and optimal application levels thereof. This may be achieved for example by initially testing for the frequency of occurrence of the F129L mutation in a plant pathogenic fungus of interest, using the methods of the invention. Once an initial assessment of the naturally occurring frequency of occurrence of the F129L mutation has been made, different fungal control strategies may be tested. For example a fungicide (preferably as strobilurin fungicide) may be applied to a further test sample of the fungus at a range of different rates and/or number and/or frequency of applications (preferably taking care to maintain a constant disease selection pressure), and for each strategy the frequency of occurrence of the F129L mutation may be assessed using the method of the invention. A correlation may then be drawn between the fungal control strategy employed and the frequency of occurrence of resistance mediated by the F129L mutation. The skilled man will easily be able to assess from this correlation, which is the best fungal control strategy to maintain fungal control and low levels of resistance to the fungicidal agent employed. In a particularly preferred embodiment of this aspect of the invention the detection method comprises any (or a) single nucleotide polymorphism detection technique and more preferably comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation(s) in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation(s) is present in the sample; and detecting the presence or absence of the said mutation(s) by reference to the presence or absence of a diagnostic primer extension product and the quantification is achieved by contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation(s) in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation(s) are extended when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation(s) by reference to the presence or absence of diagnostic primer extension products. In a further particularly preferred embodiment of this aspect of the invention the detection method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation(s) in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation(s) is present in the sample; and detecting the presence or absence of the said mutation(s) by reference to the presence or absence of a diagnostic primer extension product and the quantification is achieved by contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation(s) in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation(s) are extended only when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation(s) by reference to the presence or absence of diagnostic primer extension products. In a particularly preferred embodiment of this aspect of the invention the detection method comprises any (or a) single nucleotide polymorphism detection technique and more preferably comprises contacting a test sample comprising fungal nucleic acid with an allele specific hybridisation probe for the specific mutation(s), such that the hybridisation probe hybridises when the said mutation(s) is present in the sample; and detecting the presence or absence of the said mutation(s) by detection and quantitation of the amount of wild type (F 129 ) plant pathogen cytochrome b gene in the test sample quantification being achieved by contacting a test sample comprising fungal nucleic acid with allele specific hybridisation probes to detect both the presence and absence of a specific mutation(s) in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the hybridisation probes relating to the absence and the presence of the specific mutation(s) hybridise when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation(s) by reference to the presence or absence of hybridisation products. The methods of the invention described herein are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and where the mutation in the fungal DNA gives rise to a replacement of a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129, more especially to a F129L replacement in the encoded protein, and especially where the mutation is a T to C base change at the first position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129 or where the mutation is a T or C to A or G base change preferably a C to A base change at the third position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129. In a still further aspect the invention provides a method of controlling fungal infection of a crop comprising applying a fungicide to the crop wherein said fungicide is selected according to any of the selection methods of the invention described above. The method of the invention described above is especially suitable for use with plant pathogenic fungal strains where the presence of one or more mutation(s) in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein wherein the presence of said mutation(s) gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group. In a yet further aspect the invention provides an assay for the detection of fungicidally active compounds comprising screening the compounds against strains of fungi which have been tested for the presence or absence of one or more mutation(s) in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein giving rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene according to the methods of the invention described herein and then determining fungicidal activity against said strains of fungi. The methods of the invention described herein are especially suitable for use with plant pathogenic fungal strains where the presence of one or more mutation(s) in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group where the mutation in the fungal DNA gives rise to a replacement of a phenylalanine residue at the position corresponding to S. cerevisiae cytochrome b residue 129, more especially to a F129L replacement in the encoded protein, and especially where the mutation is a T to C base change at the first position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 143 or where the mutation is a T or C to A or G base change, preferably a C to A base change at the third position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 129. By applying the methods of the invention described herein the appropriate rate of application of fungicides and/or the appropriate combination of fungicides to be applied to the crop may be determined. The methods of the invention described herein are particularly suitable for monitoring fungal resistance to a strobilurin analogue or a compound in the same cross resistance group in crops such as cereals, fruit and vegetables such as canola, sunflower, tobacco, sugarbeet, cotton, soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrot, lettuce, cabbage, onion, vines and turf. The methods of the invention described herein are particularly sensitive for detecting low frequencies of one or more mutation(s) in a fungal cytochrome b gene resulting in a F129L replacement in the encoded protein wherein the presence of said mutation(s) gives rise to fungal resistance to a strobilurin analogue, or making this an especially useful and commercially important way of screening plant pathogenic fungi for the onset of fungicidal resistance wherein the resistance is due to the above-identified mutation. A key difference between ARMS, and other allele selective amplification based quantitative PCR detection systems, and technologies such as Taqman and Molecular Beacons is that the latter methods rely on the capacity of allele discriminatory hybridisation probes to provide a fluorescent signal proportionately related to the amount of target PCR product present at that time. This means that a single, non-selective and conventional primer pair can be used to amplify both wild type/parental and variant/mutant alleles of the target gene. The amount of the PCR product derived from each allele and, in each PCR cycle, an amount directly related to the amount present in the starting sample is then read from the fluorescent signal derived from the allele discriminatory hydridisation probe. This signal being “released” in the case of Taqman assays through DNA polymerase associated 5′exonuclease mediated release of the fluorophore from hybridised allele selective probe and in the case of Molecular Beacons by separation of 5′ and 3′ coupled fluorophore and quencher species on hyridisation of the Beacon to the target allele. In the case of allele selective amplification technologies, such as ARMS, differential PCR reactions based on the specificity of the primers determines the amount of the specific PCR product present at any time in the reaction and this in turn is directly related to the amount of the allele present in the starting sample. Quantitative measurement of the amount of the PCR product present is then achieved via either non-specific technologies, such intercalating double-stranded DNA specific dyes like SYBR® Green I (Molecular Probes Inc., 4849 Pitchford Ave., Eugene, Ore., USA) or target gene specific, but allele unselective, probes such as Scorpions. As the skilled person will appreciate these differences and their associated features provide distinctive advantages and potential disadvantages, including: The necessity to design and validate only a single pair of SNP discriminatory Taqman or Molecular Beacon probes once conventional target gene selective PCR primers are available. The requirement to design and validate both allele selective primer pairs (ARMS) and target gene specific hybridisation probes (Scorpions) for each allele discrimination ARMS/Scorpion based assays. The high signal strength and reaction speed when Scorpion probes are used because of the intramolecular nature of their hybridisation to the target gene product (Whitcombe D., Theaker J., Guy S. P., Brown T. & Little S. (1999) Nature Biotechnology 17 (1999), 804- 807 Thelwell N., Millington S., Solinas A., Booth J., & Brown T. (2000) Nucleic Acids Research 28 (2000) 3752-3761). The complications which can occur with non-sequence selective double stranded DNA detection technologies in the event of any non-specific amplification, arising perhaps as a result of contaminating DNAs in field samples and/or primer dimer formation. Under many conditions each of these methods is however quite suitable to, for example, detect and measure the relative amounts of F 129 and/or L 129 alleles of cytochrome b genes as described in this application. This is especially true when the genotypes of relatively homogeneous isolates of particular plant pathogens are being assessed e.g. individual complaint samples where strobilurin/QoI fungicide failure is suspected. The expert will however appreciate that there are however important circumstances in which allele selective amplification based technologies, and in particular the highly sensitive and selective capacity provided by ARMS/Scorpions based technologies, have real advantages. A particular case of direct relevance to this application being in the analysis of nucleic acid preparations derived from populations comprising mixtures of alternative SNPs such as the F 129 and L 129 alleles described herein. More specifically this is the case when the relative frequencies of the alternative SNPs vary over a wide range. It will be appreciated that field samples of plant pathogens will normally comprise such populations and indeed that analysing representative populations from a particular geographical region, plantation, vineyard, farm, field, orchard or plot will frequently be the most significant indicator of the performance of an agrochemical affected by the presence of SNPs, such as those encoding F 129 and L 129 alleles in cytochrome b genes, in the target pest. It will also be appreciated by the person skilled in the art that mitochondrially encoded genes such as cytochrome b genes also constitute a context where the suitability of technology to analyse populations is of particular importance. Whilst organisms such as plant pathogens, which are almost invariably haploid or diploid in their vegetative growth phase, will possess 0, 1, 1+1 or 0+2 copies of alternative nuclearly encoded alleles of a gene of interest, the situation can be much more complicated with mitochondrially encoded genes. Individual plant pathogens can have tens, sometime hundreds, of mitochondria per nucleus and individual mitochondria can also themselves possess multiple mitochondrial genomes. Intrinsically therefore mitochondrial genes are members of populations which are much larger, more complex and diverse, even when taken from samples which are nominally individual, microbiologically purified, isolates, when compared with nuclear genes from the same sample. The greater suitability of allele selective amplification based quantitative PCR technologies for analysing populations, especially ones where important alleles are present at relatively low levels, stems from the intrinsic nature of the PCR process: it is an exponential amplification based technology (see for example: Saiki et al. Science 230 (1985) 1350, PCR (Newton & Graham) pp 3-5 (1994) BIOS Scientific Publishers ISBN 1 872748 82 1 and The Encyclopedia of Molecular Biology (ed. Kendrew & Lawrence) pp 864-866 (1994) Blackwel] Science Ltd. ISBN 0 632 02182 9). This means firstly that if two allelic forms of a gene, capable of amplification with a common primer pair, are present in a sample at significantly different concentrations (e.g. 100 fold, 1,000 fold or 10,000 fold) that their relative abundance will be maintained throughout the PCR. The relative strength of the hybridisation signal achieved by annealing of allele specific probes such as Taqman or Molecular Beacons will therefore always reflect this difference. Fluorescence signals of 100 fold, 1,000 fold or 10,000 lower intensity are extremely difficult to detect above background levels. Secondly however PCR reactions are normally limited by complete utilisation of the nucleotides required to synthesise the PCR product. Exponential amplification of a very abundant species can therefore severely deplete or even exhaust the supply of nucleotides before significant amplification of a lower abundance species can start. Additionally hybridisation is a kinetic process and in bimolecular reactions such as Taqman and Molecular Beacons has a rate which is a function of the concentration of the reacting species. The higher concentration of the more abundant PCR product will therefore result in annealing to its cognate probe proceeding at a higher rate. As a consequence of such factors we have found that the effective range of Molecular Beacons and Taqman assays covers only about a 10-50 fold and, more specially, a less than 10 fold difference in mixed populations. By contrast allele selective amplification technologies are not affected by such competition effects arising from varying concentrations of alleles/SNPs. The PCR cycle at which a signal reflecting the presence of a given allele/SNP in a sample becomes apparent is a simple function of the starting concentration of that allele. Since there is no competing amplification product present there is no competition for substrate and the fluorescence signal can always approach the maximum. As a consequence when DNA populations comprising mixtures of different alleles/SNPs are analysed in parallel reactions with appropriate allele selective amplification reagents an accurate estimate of the relative concentrations of the alleles/SNPs in the initial sample can be obtained over a very wide range. Typically we find that ranges of 0.01-99.99% (10 4 ) are easily achieved with ARMS/Scorpions based assays, often ranges of 0.001-99.999% (10 5 ) can be obtained and sometimes ranges of 0.0001-99.9999% (10 6 ) may be achievable. The invention is further illustrated with reference to the examples and figures in which FIG. 1 : table describing the origin and sensitivity to Azoxystrobin of isolates of Pythium aphanidermatum. FIG. 2 : table describing development of disease on azoxystrobin treated turf. FIG. 3 : Summary of the molecular characterisation of the P. aphanidermatum cyt b region corresponding to amino acids 73 to 283. FIG. 4 : Base pair alignment of two consensus K3758 sequences with a partial wild type P. aphanidermatum cyt b gene sequence. FIG. 5 : amino acid alignment of two consensus K3758 sequences with a partial wild type P. aphanidermatum cyt b gene sequence FIG. 6 : Stem loop secondary structure of an antisense Scorpion primer for use in P. aphanidermatum F129L assays in combination with sense allele selective ARMS primers. FIG. 7 : A graph showing the amplification of wild type plasmid (wells A3 and A4) and amplification of mutant plasmid (wells A1 and A2) with primer Pt129-1. FIG. 8 : A graph showing the amplification of mutant plasmid (wells A1 and A2) and amplification of wild type plasmid (wells A3 and A4) with primer Pt129-4. FIG. 9 : Stem loop secondary structure of a sense Scorpion primer for use in P. aphanidermatum F129L assays in combination with antisense allele selective ARMS primers. FIG. 10 : A Plot of the Ct value on the appropriate template for the ARMS primers Pt129-A14 and Pt129-C4. FIG. 11 : A Plot of the ΔCt between ARMS primer Pt129-A14 and Pt 129-A14 vs template concentration. FIG. 12 : A plot showing the amplification of the L129 allele with ARMS primer Pt129-A14 when 10-fold dilutions of the resistant (L129) allele are spiked into a constsant background of the wild type (F129) allele. FIG. 13 : A plot of log 10 DNA concentration vs ΔCt for the P aphanidermatum F129L assay. FIG. 14 : A flow diagram showing preparation of P. viticola samples I112 and I116b for the in planta dose reponse assay. FIG. 15 : show the DNA alignment for the isolates I112 and I116b. FIG. 16 : shows the amino acid alignment for the isolates I112 and I116b. FIG. 17 : shows a sense Scorpion primer for P.viticola. FIG. 18 : A plot of log 10 DNA concentration vs ΔCt for the P. viticola F129L assay. FIG. 19 : shows an antisense Scorpion primer for P. viticola. FIG. 20 : shows the nucleotide alignment for the two isolates of A. solani FIG. 21 : shows the amino acid alignment for the two isolates of A. solani detailed-description description="Detailed Description" end="lead"? |
Process for the preparation of l-amino acids using strains of the enterobacteriaceae family which contain an attenuated aceb gene |
The invention relates to a process for the preparation of L-amino acids, in particular L-threonine, in which the following steps are carried out: a) fermentation of microorganisms of the Enterobacteriaceae family which produce the desired L-amino acid and in which the aceB gene, or the nucleotide sequence which codes for this, is attenuated, in particular eliminated, b) concentration of the L-amino acid in the medium or in the cells of the bacteria, and c) isolation of the L-amino acid. |
1. A process for the preparation of L-amino acids, in particular L-threonine, which comprises carrying out the following steps: a) fermentation of microorganisms of the Enterobacteriaceae family which produce the desired L-amino acid and in which the aceB gene, or the nucleotide sequence which codes for this, is attenuated, in particular eliminated, b) concentration of the desired L-amino acid in the medium or in the cells of the microorganisms, and c) isolation of the desired L-amino acid, constituents of the fermentation broth and/or the biomass in its entirety or portions (>0 to 100%) thereof optionally remaining in the product. 2. A process as claimed in claim 1, wherein microorganisms in which further genes of the biosynthesis pathway of the desired L-amino acid are additionally enhanced are employed. 3. A process as claimed in claim 1, wherein microorganisms in which the metabolic pathways which reduce the formation of the desired L-amino acid are at least partly eliminated are employed. 4. A process as claimed in claim 1, wherein the expression of the polynucleotide which codes for the aceB gene is attenuated, in particular eliminated. 5. A process as claimed in claim 1, wherein the regulatory and/or catalytic properties of the polypeptide (enzyme protein) for which the polynucleotide aceB codes are reduced. 6. A process as claimed in claim 1, wherein, for the preparation of L-amino acids, microorganisms of the Enterobacteriaceae family in which in addition at the same time one or more of the genes chosen from the group consisting of: 6.1 the thrABC operon which codes for aspartate kinase, homoserine dehydrogenase, homoserine kinase and threonine synthase, 6.2 the pyc gene which codes for pyruvate carboxylase, 6.3 the pps gene which codes for phosphoenol pyruvate synthase, 6.4 the ppc gene which codes for phosphoenol pyruvate carboxylase, 6.5 the pntA and pntB genes which code for transhydrogenase, 6.6 the rhtB gene which imparts homoserine resistance, 6.7 the mqo gene which codes for malate:guinone oxidoreductase, 6.8 the rhtC gene which imparts threonine resistance, 6.9 the thrE gene which codes for the threonine export protein, 6.10 the gdhA gene which codes for glutamate dehydrogenase, 6.11 the hns gene which codes for the DNA-binding protein HLP-II, 6.12 the pgm gene which codes for phosphoglucomutase, 6.13 the fba gene which codes for fructose biphosphate aldolase, 6.14 the ptsH gene which codes for the phosphohistidine protein hexose phosphotransferase, 6.15 the ptsI gene which codes for enzyme I of the phosphotransferase system, 6.16 the crr gene which codes for the glucose-specific IIA component, 6.17 the ptsG gene which codes for the glucose-specific IIBC component, 6.18 the lrp gene which codes for the regulator of the leucine regulon, 6.19 the mopB gene which codes for 10 Kd chaperone, 6.20 the ahpC gene which codes for the small sub-unit of alkyl hydroperoxide reductase, 6.21 the ahpF gene which codes for the large sub-unit of alkyl hydroperoxide reductase, 6.22 the cysK gene which codes for cysteine synthase A, 6.23 the cysB gene which codes for the regulator of the cys regulon, 6.24 the cysJ gene which codes for the flavoprotein of NADPH sulfite reductase, 6.25 the cysI gene which codes for the haemoprotein of NADPH sulfite reductase and 6.26 the cysH gene which codes for adenylyl sulfate reductase, is or are enhanced, in particular over-expressed, are fermented. 7. A process as claimed in claim 1, wherein, for the preparation of L-amino acids, microorganisms of the Enterobacteriaceae family in which in addition at the same time one or more of the genes chosen from the group consisting of: 7.1 the tdh gene which codes for threonine dehydrogenase, 7.2 the mdh gene which codes for malate dehydrogenase, 7.3 the gene product of the open reading frame (orf) yjfA, 7.4 the gene product of the open reading frame (orf) ytfP, 7.5 the pcka gene which codes for phosphoenol pyruvate carboxykinase 7.6 the poxB gene which codes for pyruvate oxidase 7.7 the aceA gene which codes for isocitrate lyase, 7.8 the dgsA gene which codes for the DgsA regulator of the phosphotransferase system, 7.9 the fruR gene which codes for the fructose repressor, 7.10 the rpoS gene which codes for the sigma38 factor, 7.11 the aspA gene which codes for aspartate ammonium lyase, 7.12 the aceK gene which codes for isocitrate dehydrogenase kinase/phosphatase and 7.13 the ugpB gene which codes for the periplasmic binding protein of the sn-glycerol 3-phosphate transport system is or are attenuated, in particular eliminated or reduced in expression, are fermented. |
<SOH> FIELD OF THE INVENTION <EOH>This invention relates to a process for the preparation of L-amino acids, in particular L-threonine, using strains of the Enterobacteriaceae family in which the aceB gene is attenuated. |
<SOH> SUMMARY OF THE INVENTION <EOH>The invention provides a process for the fermentative preparation of L-amino acids, in particular L-threonine, using microorganisms of the Enterobacteriaceae family which in particular already produce L-amino acids and in which the nucleotide sequence which codes for the aceB gene is attenuated. detailed-description description="Detailed Description" end="lead"? |
Wireless access system, method, signal, and computer program product |
A system, method, signal, and computer program product for providing secure wireless access to private databases and applications without requiring a separate wireless client-server internetworking security protocol infrastructure. The wireless device (201) communicates with the wireless access service provider (205) via hypertext transfer protocol (HTTP) messages, and the wireless access service provider (205) and the secure network (204) perform a RADIUS authentification for the wireless device (201). |
1. A method for providing a wireless device access to a secure application via a client-server internetworking security protocol configured to at least one of control authentication, perform accounting, and provide access-control in a networked, multi-user environment, comprising steps of: accessing a wireless network from said wireless device; transmitting user identification and authentication information from said wireless device to a wireless access service mechanism configured to process said user identification and authentication information; producing, by the wireless access service mechanism, a client-server internetworking security protocol authentication request message based on said user identification and authentication information; and transmitting said client-server internetworking security protocol authentication request message from said wireless access service mechanism to a client-server internetworking security protocol authentication device configured to perform client-server internetworking security protocol authentication. 2. The method of claim 1, wherein: said client-server internetworking security protocol comprises RADIUS. 3. The method of claim 2, wherein: said step of transmitting said client-server internetworking security protocol authentication request message includes transmitting via one of a direct connection and a local network. 4. The method of claim 3, further comprising: processing said client-server internetworking security protocol authentication request message by said client-server internetworking security protocol authentication device; and transmitting at least one of a client-server internetworking security protocol authentication accept message and a client-server internetworking security protocol authentication reject message from said client-server internetworking security protocol authentication device to said wireless access service mechanism via one of a direct connection and a local network. 5. The method of claim 4, further comprising: processing a client-server internetworking security protocol authentication accept message at said wireless access service mechanism; transmitting a client-server internetworking security protocol access Accounting-Start Message from said wireless access service mechanism to said client-server internetworking security protocol authentication device via one of a direct connection and a local network; transmitting a session start message from said wireless access service mechanism to a wireless gateway device via one of a direct connection and a local network; and transmitting a wireless authentication acceptance message from said wireless access service mechanism to said wireless device. 6. The method of claim 5, further comprising: timing a connection time between said wireless device and said wireless gateway device so as to produce a wireless timing parameter at said wireless access service mechanism; and transmitting a session end notification from said wireless access service mechanism to at least one of said wireless gateway device and said wireless device when said wireless timing parameter exceeds a predetermined timing value. 7. The method of claim 5, further comprising: transmitting a client-server internetworking security protocol access authentication Accounting-End Message from said wireless access service mechanism to said client-server internetworking security protocol authentication device via one of a direct connection and a local network. 8. The method of claim 6, further comprising: transmitting a client-server internetworking security protocol access authentication Accounting-End Message from said wireless access service mechanism to said client-server internetworking security protocol authentication device via one of a direct connection and a local network. 9. The method of claim 4, further comprising: processing a client-server internetworking security protocol authentication reject message at said wireless access service mechanism; and transmitting a wireless authentication rejection message from said wireless access service mechanism to said wireless device. 10. The method of claim 2, wherein: said step of transmitting said client-server internetworking security protocol authentication request message includes transmitting via a global network. 11. The method of claim 10, further comprising: processing a client-server internetworking security protocol authentication accept message at said wireless access service mechanism; transmitting a session start message from said wireless access service mechanism to a wireless gateway device via a global network; transmitting a wireless authentication acceptance message from said wireless access service mechanism to said wireless device; and transmitting a client-server internetworking security protocol access authentication Accounting-Start Message from said wireless access service mechanism to said client-server internetworking security protocol authentication device via a global network. 12. The method of claim 11, further comprising: timing a connection time between said wireless device and said wireless gateway device so as to produce a wireless timing parameter at said wireless access service mechanism; and transmitting a session end notification from said wireless access service mechanism to at least one of said wireless gateway device and said wireless device via a global network when said wireless timing parameter exceeds a predetermined timing value. 13. The method of claim 11, further comprising: transmitting a client-server internetworking security protocol access authentication Accounting-End Message from said wireless access service mechanism to said client-server internetworking security protocol authentication device via a global network. 14. The method of claim 12, further comprising: transmitting a client-server internetworking security protocol access authentication Accounting-End Message from said wireless access service mechanism to said client-server internetworking security protocol authentication device via a global network. 15. The method of claim 10, further comprising: processing a client-server internetworking security protocol authentication reject message at said wireless access service mechanism; and transmitting a wireless authentication rejection message from said wireless access service mechanism to said wireless device. 16. A system configured to interface a wireless device to a secure application via a client-server internetworking security protocol configured to at least one of control authentication, perform accounting, and provide access-control in a networked, multi-user environment authentication, comprising: said wireless device connected to a wireless service provider via a wireless connection medium; a wireless access service mechanism connected to said wireless service provider via a global telecommunications network, said wireless access service mechanism configured to convert between a wireless authentication protocol and a client-server internetworking security protocol; and a client-server internetworking security protocol authentication device connected to said wireless access service mechanism. 17. The system of claim 16, wherein: said client-server internetworking security protocol comprises RADIUS. 18. The system of claim 17, further comprising: a wireless gateway device connected to said wireless access service mechanism; and a secure application connected to said wireless gateway device. 19. The system of claim 17, wherein: said wireless access service mechanism and said client-server internetworking security protocol authentication device are connected by one of a direct connection and a local network. 20. The system of claim 17, wherein: said wireless access service mechanism and said client-server internetworking security protocol authentication device are connected by a global network. 21. The system of claim 18, wherein: said wireless access service mechanism and said wireless gateway device are connected by one of a direct connection and a local network. 22. The system of claim 18, wherein: said wireless access service mechanism and said wireless gateway device are connected by a global network. 23. An apparatus configured to interface at least one wireless client application to at least one secure application via a client-server internetworking security protocol configured to at least one control authentication, perform accounting, and provide access-control in a networked, multi-user environment authentication, comprising: a wireless access service mechanism configured to convert a wireless authentication protocol to a client-server internetworking security protocol and to exchange client-server internetworking security protocol authentication messages with a client-server internetworking security protocol authentication device. 24. The apparatus of claim 23, wherein: said client-server internetworking security protocol comprises RADIUS. 25. The apparatus of claim 24, wherein: said wireless access service mechanism is further configured to transmit a session start message to at least one of a wireless gateway device and said wireless device. 26. The apparatus of claim 24, wherein: said wireless access service mechanism is further configured to transmit at least one of a client-server internetworking security protocol authentication account-start and a client-server internetworking security protocol authentication account-end message to said client-server internetworking security protocol authentication device. 27. The apparatus of claim 24, wherein: said wireless access service mechanism is further configured to time a wireless application session and to send a session time-expired message to at least one of a wireless gateway device and a wireless device. 28. A system configured to interface at least one wireless client application to at least one secure application, comprising: means for connecting a wireless client device to a secure private network so as to produce a secure wireless connection, said wireless client device configured to produce wireless authentication information and said secure private network configured to manage access based on client-server internetworking security protocol information configured to at least one of control authentication, perform accounting, and provide access-control in a networked, multi-user environment; means for converting said wireless authentication information to said client-server internetworking security protocol authentication information; and means for initiating, managing, and terminating said secure wireless connection. 29. The system of claim 28, wherein: said client-server internetworking security protocol comprises RADIUS. 30. A computer program product, comprising: at least one of unit of software and a unit of firmware configured to convert a wireless authentication message to a client-server internetworking security protocol message and to exchange a client-server internetworking security protocol message with a client-server internetworking security protocol device. 31. The computer program product of claim 30, wherein: said client-server internetworking security protocol comprises RADIUS. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention The present invention relates to a system, method, signal, and computer program product for providing secure wireless access to private databases and applications. More particularly, the present invention relates to providing secure access to private networks for wireless devices without requiring a separate wireless security/authentication infrastructure for the private network. 2. Discussion of the Background Art Whenever an external computing device is connected to a corporate network, that network is subject to becoming more vulnerable to security breaches. Network Administrators are left with few tools to guard against break-ins. State of the art security systems generally require special hardware or are only compatible with a small number of products. This problem is exacerbated in large networks that have many points of access. To address this problem, Lucent Technologies InterNetworking Systems has developed a distributed security solution called Remote Authentication Dial-In User Service, or RADIUS. RADIUS is an example of a client-server internetworking security protocol configured to control authentication, accounting, and access-control in a networked, multi-user environment. RADIUS provides a software protocol based approach to security that does not require special hardware. Distributed security separates user authentication and authorization from the communications process and creates a single, central location for user authentication data. The RADIUS protocols are defined in Internet Engineering Task Force (IETF) Request for Comments (RFC) 2138 dated April 1997 and 2139 dated April 1997, the entire contents of both being incorporated herein by reference. RADIUS is a TCP/IP application layer protocol as defined in TCP/IP Illustrated: The Protocols by W. Richard Stevens (1994) and TCP/IP Clearly Explained, Third Edition, by Pete Loshin (1999), the contents of both being incorporated herein by reference. Based on a model of distributed security previously defined by the IETF, RADIUS provides an open and scaleable client/server security system. The RADIUS server can be easily adapted to work with third-party security products or proprietary security systems. To date, many types of communications servers or network hardware support the RADIUS client protocols and can communicate with a RADIUS server. RADIUS has become a widely accepted remote authentication protocol. RADIUS supports a system of distributed security that secures systems against unauthorized access. A system based on RADIUS authentication includes a RADIUS authentication server and a RADIUS client. In conventional RADIUS systems, user authentication and network service access information is located on the RADIUS authentication server. RADIUS supports this information being in a variety of formats based on the customer's requirements. RADIUS, in its generic form, will authenticate users against, for example, a UNIX password file, Network Information Service (NIS), as well as a separately maintained RADIUS database. RADIUS-compliant communications servers operate to connect RADIUS clients with RADIUS servers. The RADIUS client sends RADIUS authentication requests to the RADIUS server and acts on responses sent back by the RADIUS server. RADIUS is used to authenticate users through a protocol including a series of specially formatted messages between the client and the server. Once a RADIUS user is authenticated, the RADIUS client provides that RADIUS user with access to the appropriate network services. FIG. 1 is an interaction diagram of an exemplary conventional RADIUS system for providing authentication over the Internet. The order of events in the diagram flows from top to bottom as indicated by the time progression identified by figure element 107 . As shown in FIG. 1 , an end user 101 initiates a session by dialing 108 into an Internet Service Provider's (ISP) 102 Point of Presence (POP) 103 on the Internet. The ISP POP 103 then requests 109 that the end user 101 identify himself. In response, the end user 101 provides, for example, a user ID, password, and access server identification 110 . The ISP POP 103 then sends a RADIUS Access Request Message 111 containing the user identification information to its own ISP authentication server 104 , which is a RADIUS server and awaits a response 117 . Based on the user identification information provided in the RADIUS Access Request Message 111 , the ISP Authentication Server 104 recognizes that the end user 101 is an access service provider 105 user. The access service provider 105 is, in this example, a third party that manages the access of remote end users 101 to a company's internal secure network (e.g., Company XYZ 106 ). FIBERLINK COMMUNICATIONS CORPORATION is an example of a company that provides this type of service. The ISP Authentication Server 104 therefore sends a RADIUS Access Request Message 113 containing the user identification information to the Access Service Provider 105 and awaits a response 116 . Based on the user identification information provided in the RADIUS Access Request Message 113 , the Access Service Provider 105 recognizes that the end user 101 is a COMPANY XYZ 106 user. The Access Service Provider 105 therefore sends a RADIUS Access Request Message 114 containing the user identification information to COMPANY XYZ 106 and awaits a response 115 . Company XYZ 106 will then perform a RADIUS authentication for this particular end-user 101 and send either a RADIUS Access Granted or RADIUS Access Denied message 115 back to the Access Service Provider 105 , which will then forward the RADIUS Access Granted or RADIUS Access Denied message 116 to the ISP authentication server 104 , which in turn, forwards the RADIUS Access Granted or RADIUS Access Denied message 117 to the ISP POP 103 , which finally generates and transmits a corresponding access granted/access denied status message 118 to the end user 101 . A limitation associated with the above-described capability is that it does not readily accommodate wireless users and their applications. Wireless devices (e.g., Personal Digital Assistants (PDA) and wireless laptops) have become popular productivity tools, and given their portability, have become a desired tool for accessing applications and databases on secure networks from remote locations. Typically, access is via the Internet as accessed through a wireless network provider. Because wireless network providers do not provide the services that an ISP provides, the ability to have RADIUS-authenticated connections from remote wireless devices is limited. Therefore, a tension has been created between providing the convenience of wireless remote access and maintaining a secure network. One proposed solution to this problem is to provide a parallel authentication capability tailored to the needs of wireless users, wireless data services and communication technologies used in wireless networks. However, maintaining more than one authentication database in an organization is an administrative burden for information security personnel who must update multiple databases when employees or other authorized users arrive, depart, or otherwise change their access posture. Furthermore, maintaining more than one authentication database is an operational annoyance to users who may be required to maintain different passwords and be trained in different information security techniques for wireless and non-wireless access. Even further, as more access paths are provided for a network, more opportunities for a security breach or failure are created. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present inventors have recognized that there exists a need to provide secure access for wireless devices without compromising the level of security required by the accessed network. The present inventors have further recognized that since many wireless devices have limited processing power, providing a RADIUS capability on a wireless device is not an acceptable solution. The inventors of the present invention have recognized that by providing an ability to translate non-RADIUS authentication messages from a wireless device into RADIUS authentication messages that the existing RADIUS authentication infrastructure can be used to authenticate wireless devices. Accordingly, one object of the present invention is to provide systems, devices, communications protocols, and methods for providing RADIUS authentication for wireless devices that do not themselves have a RADIUS capability. A further object of the present invention is to provide methods and communications protocols for maintaining an integrated wireless/non-wireless security infrastructure. The above-described and other objects are addressed by the present invention, which includes a novel system, method, signal, and computer program product for authenticating, accounting, and controlling access to a secure network from a wireless device. The wireless device desiring remote access to a secure network sends a request for authentication to a wireless access service provider. The wireless access service provider receives the request and creates a formal authentication request or relays the request for authentication originating from the wireless device in compliance with the authentication system of the secure network and forwards the authentication request to the secure network. Since the ultimate authentication request is a formal request, the secure network handles the wireless user in the same way using the same security infrastructure as it does for non-wireless remote users. The result of the authentication request is sent from the secure network to the wireless access service provider via the formal authentication protocol. The wireless access service provider then translates this result into a wireless device compatible format and finally generates and transmits a corresponding access granted/access denied status message to the wireless device over a wireless transmission link. In one embodiment of the present invention, the wireless device communicates with the wireless access service provider via hypertext transfer protocol (HTTP) messages, and the wireless access service provider and the secure network perform a RADIUS authentication for the wireless user. In one embodiment of the present invention, the wireless access service provider is a third party that provides a service of managing remote access to secure networks for wireless devices. In another embodiment of the present invention, the wireless access service provider is housed within the security environment of an organization that has remote wireless users. |
Bushing arrangement for seal cavity protection in rotating fluid equipment |
An arrangement (120) of members for a throat bushing for rotary fluid equipment includes a first member (122) that is useful for seal cavities that contain conventional packing, and a second bushing member (132) that will be used in conjunction with the first bushing member if the seal cavity utilize a mechanical seal at the remote end of the cavity. Both bushing members (122, 132) are provided with spiral grooves (140) in a central bore thereof for the removal of contaminants from the seal cavity. The distal end face (124) of the first bushing member is contoured to receive a mating proximal end face (144) of the second bushing member or to also receive the abutting face of a packing ring or a lantern ring. The arrangement of the invention allows an operator to switch between the use of a mechanical seal or conventional packing without having to discard his primary seal cavity protector. |
1. A bushing arrangement for protecting a seal cavity of rotary fluid equipment which cavity is defined in part by a rotatable shaft having an outer cylindrical surface, a surrounding housing having an inner cylindrical surface spaced radially outwardly of said shaft, an entrance zone, and an end remote from said entrance zone, said cavity being adapted to receive conventional packing material therein or to have a mechanical seal positioned at said remote end, said arrangement comprising: a) first and second generally cylindrical bushing members for positioning in said cavity, each such bushing member having an outer cylindrical surface for slidably engaging said housing inner surface, and an inner cylindrical bore of a diameter greater than the diameter of said shaft so as to define an annular gap between such bore and said shaft outer surface; b) said first bushing member having proximal and distal annular end faces; c) the inner bore of said first bushing member including first and second end sections of generally uniform diameter opening to said proximal and distal end faces respectively, a third section of increasing diameter adjacent said first section, and a fourth section of decreasing diameter between said third and second sections, at least said third section of said first bushing member bore defining a spiral groove opening towards said fourth bore section and having a hand in the same direction of rotation as said shaft; d) said second bushing member having a proximal end face for mating abutment against said distal end face of said first bushing member; and e) said inner bore of said second bushing member including a first section of generally uniform diameter opening to said second bushing member proximal end face, and a second section of increasing diameter leading from said first section to a distal end of said second bushing member, at least said second bushing member second bore section defining a spiral groove opening towards said second bushing member distal end and having a hand in the same direction of rotation as said shaft; f) whereby if said cavity contains packing only, a first bushing member will be positioned at said entrance zone with such packing abutting said first bushing member distal end face, and if said cavity contains a mechanical seal a first bushing member will be positioned at said entrance zone and a second bushing member will be positioned within said cavity with the proximal end face of said second bushing member abutting and mating with the distal end face of said first bushing member and said second bushing member second bore section facing towards the mechanical seal. 2. The arrangement of claim 1 wherein each of said first and second bore sections of said first bushing member and said first bore section of said second bushing member is provided with a spiral groove of the same hand as the direction of shaft rotation. 3. The arrangement of claim 1 or claim 2 wherein said distal end face of said first bushing member includes a radially outer annular planar portion, an annular radially inwardly frustoconically extending portion and a radially inner annular planar portion, and said proximal end face of said second bushing member includes a radially outer annular planar portion and a frustoconical radially inwardly extending portion, said outer planar and frustoconical portions of said second bushing member proximal end face being adapted to abut and mate with the outer planar portion and the frustoconical portion of said first bushing member distal end face. 4. The arrangement of claim 1 wherein an annular shoulder is formed in the proximal end of said first bushing member adjacent the outer cylindrical surface thereof. 5. The arrangement of claim 1 including a key extending radially from the outer cylindrical surface of said first bushing member adjacent the proximal end thereof. 6. The arrangement of claim 1 including a third bushing member for abutment with the distal end of said first bushing member, said third bushing member having an outer cylindrical surface for slidably engaging said housing inner surface, and an inner cylindrical bore of a diameter greater than the diameter of said shaft so as to define an annular gap between such bore and said shaft outer surface; said inner bore of said third bushing member including a first section of generally uniform diameter opening to said third bushing member proximal end face, a second section of increasing diameter leading from said third bushing member bore first section to a third section of reducing diameter which extends to a planar distal end face of said third bushing member, at least said third bushing member second bore section defining a spiral groove opening towards said third bushing member distal end and having a hand in the same direction of rotation as said shaft. 7. A bushing arrangement for protecting a seal cavity of rotary fluid equipment which cavity is defined in part by a rotatable shaft having an outer cylindrical surface, a surrounding housing having an inner cylindrical surface spaced radially outwardly of said shaft, an entrance zone, and an end remote from said entrance zone, said cavity being adapted to receive conventional packing material therein, said arrangement comprising: a) first and second generally cylindrical bushing members for positioning in said cavity, each such bushing member having an outer cylindrical surface for slidably engaging said housing inner surface, and an inner cylindrical bore of a diameter greater than the diameter of said shaft so as to define an annular gap between such bore and said shaft outer surface; b) said first bushing member having proximal and distal annular end faces; c) the inner bore of said first bushing member including a first section of generally uniform diameter opening to said proximal end face, a second section of increasing diameter adjacent said first section, and leading to a third section of decreasing diameter which extends to said distal end face, said second section of said first bushing member bore defining a spiral groove opening towards said third bore section and having a hand in the same direction of rotation as said shaft; and d) said second bushing member being a lantern ring and having a proximal end face for mating abutment against said distal end face of said first bushing member; e) whereby said first bushing member will be positioned at said cavity entrance zone with and said lantern ring will be positioned in said cavity with said proximal end face thereof abutting said distal end face of said first bushing member. 8. The arrangement of claim 7 wherein said lantern ring has a spiral groove in an inner surface thereof, having a hand in the same direction as shaft rotation, said lantern ring spiral groove serving to direct contaminants to the first bushing member. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Pumps are used at the industrial level in many different industries for a variety of purposes. In the petroleum industry for example a large number of pumps of different sizes is used to perform a large number of pumping functions. In heavy industry it is not uncommon for pumps to fail because of contaminants contained within the pumpage or within the pump itself. Pumps are provided with a myriad of seals, bushings and packing arrangements to protect the components thereof from contamination and subsequent wear or damage. Attempts have been made in the past to devise pump accessories that will reduce the damage due to such contaminants, one successful accessory being the SpiralTrac™ seal protector manufactured by EnviroSeal Engineering Products Ltd. of Nova Scotia, Canada. This device may be considered to be an annular bushing that is placed at the entrance to a seal cavity of a pump, the cavity being defined by a portion of the pump housing, a shaft that extends through the cavity, and means for sealing the cavity itself. The sealing means may take the form of a mechanical seal positioned at one (the distal) end of the cavity) or it may take the form of packing material that fills the cavity. In either case the SpiralTrac™ bushing is positioned at the proximal end of the cavity. The bushing includes a tapered central bore which has a spiral groove formed in its wall and that leads from adjacent the outer surface of the bushing towards the cavity entrance. The spiral groove decreases, generally, in diameter down to the innermost diameter of the bushing which defines a small annular gap around the shaft. As the shaft rotates any particulate material that enters the seal cavity during operation of the pump will be centrifugally forced into the spiral groove and will flow therealong towards the gap by the shaft. The particulate material will be forced outwardly through the gap to the exterior of the seal cavity. This bushing is disclosed and claimed in U.S. Pat. No. 5,553,868 of Sep. 10, 1996 and in Australian Patent No. 688,977 of Oct. 18, 1995 as well as in Canadian and European applications. The bushing as taught in the aforementioned US patent is particularly advantageous with seal cavities that include a mechanical seal at the distal end thereof. The applicant herein also produces seal bushings which are especially adapted for use with packing material that in essence fills the seal cavity, which bushings operate on the same principle but require physical modifications to the design in order to accommodate the packing material. For example, a bushing for a packing environment requires a generally flat annular distal end face against which the packing material can abut, while such a flat face is not required or desired for a non-packing environment. In some instances pump manufacturers or operators may wish to convert their pumps which use mechanical seals at the distal end of a seal cavity to pumps which use packing material within the seal cavity, or vice versa. If the pump is already using a SpiralTrac™ seal bushing for a mechanical seal cavity it would be necessary to discard that bushing and to replace it with one that is adapted for use with packing material. This would entail a not insubstantial expense, especially since the SpiralTrac™ bushing is considered to have a considerably longer life than conventional seal cavity bushings. There is therefore a need for a bushing arrangement that can be used with either a mechanical seal cavity or with a packing material cavity without considerable additional expense or effort on the part of the manufacturer or the operator. |
<SOH> SUMMARY OF THE INVENTION <EOH>As used herein with respect to bushings the word “proximal” Is intended to refer to ends or faces that will be directed towards the seal cavity entrance while the word “distal” is intended to refer to ends or faces that will be directed towards the remote end of the seal cavity. The present invention is intended to satisfy the need for a bushing arrangement that can be used in either of the conventional seal cavity environments as described above. In essence the present invention provides an arrangement which utilizes a minimum of two bushing members. The first or main member is designed for use with a packing material contained within the seal cavity, this bushing member including an annular distal end face against which the packing material can abut when it is positioned within the seal cavity. This bushing member includes as well the spiral groove as disclosed in the aforementioned US patent for the removal of contaminants from the seal cavity. It can also be provided with other features, as found in the existing SpiralTrac™ bushing, including tangential openings therethrough for flushing fluid, and axial grooves in the outer surface for drainage purposes. The second bushing member includes distal and proximal end faces and a spiral groove therein. The proximal end face of the second member is shaped to mate with the distal annular end face of the first bushing member and the distal end face of the second member is very narrow in width, such that the spiral groove thereof starts very close to the outer wall of the seal cavity. The spiral groove of the second member leads smoothly into the spiral groove of the first member to ensure a smooth flow of contaminants from the distal end of the second member to the proximal end of the first member. With the arrangement of the present invention one would combine the two bushing members together if one is trying to protect a seal cavity which includes a mechanical seal at one end and generally free space between the mechanical seal and the bushing arrangement. One would use only a first bushing member if the seal cavity is to be filled with packing material. If one wishes to convert from one type of seal cavity to the other then one need only either remove the second member from the combination of the first and second bushing members or add the second member to the first member, as required. Typically, the second bushing member will be smaller than the first member and the cost advantage to this arrangement will outweigh the additional cost of the second member relative to the first member or relative to two separate full-size bushings which would be otherwise required to effect a conversion from one style of seal cavity to the other. In summary of the foregoing the present invention may be considered to provide a bushing arrangement for protecting a seal cavity of rotary fluid equipment, which cavity is defined in part by a rotatable shaft having an outer cylindrical surface, a surrounding housing having an inner cylindrical surface spaced radially outwardly of the shaft, an entrance zone, and an end remote from the entrance zone, the cavity being adapted to receive conventional packing material therein or to have a mechanical seal positioned at the remote end, the arrangement comprising: a) first and second generally cylindrical bushing members for positioning in the cavity, each such bushing member having an outer cylindrical surface for slidably engaging the housing inner surface, and an inner cylindrical bore of a diameter greater than the diameter of the shaft so as to define an annular gap between such bore and the shaft outer surface; b) the first bushing member having proximal and distal annular end faces; c) the inner bore of the first bushing member including first and second end sections of generally uniform diameter opening to the proximal and distal end faces respectively, a third section of increasing diameter adjacent the first section, and a fourth section of decreasing diameter between the third and second sections, at least the third section of the first bushing member bore defining a spiral groove opening towards the fourth bore section and having a hand in the same direction of rotation as the shaft; d) the second bushing member having a proximal end face for mating abutment against the distal end face of the first bushing member; and e) the inner bore of the second bushing member including a first section of generally uniform diameter opening to the second bushing member proximal end face, and a second section of increasing diameter leading from the first section to a distal end of the second bushing member, at least the second bushing member second bore section defining a spiral groove opening towards the second bushing member distal end and having a hand in the same direction of rotation as the shaft; f) whereby if the cavity contains packing only, a first bushing member will be positioned at the entrance zone with such packing abutting the first bushing member distal end face, and if the cavity contains a mechanical seal a first bushing member will be positioned at the entrance zone and a second bushing member will be positioned within the cavity with the proximal end face of the second bushing member abutting and mating with the distal end face of the first bushing member and the second bushing member second bore section facing towards the mechanical seal. It is possible to effect several forms of the bushing arrangement of this invention and some of those forms will be described hereinbelow in a non-limiting manner and with reference to the accompanying drawings. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.