text
stringlengths 0
1.67M
|
|---|
1. A method for increasing in vivo efficacy of an nucleic acid molecule that is administered to a mammal, comprising incorporating into said nucleic acid molecule at least one nucleotide substitute. 2-55. (CANCELED) 56. The method of claim 1, wherein said nucleotide substitute is selected from the group consisting of 2′6′-diaminopurine and analogs thereof. 57. The method of claim 56, wherein said analog of 2′6′-diaminopurine is selected from the group consisting of 2,6-diaminopurine hemisulfate, 2-amino-9-(B-D-2′-deoxyribofuranosyl) purine, 7-Deaza-2′-deoxyadenosine, N6-methyl-2′-deoxyadenosine, 2-aminoadenosine/2,6-diaminopurine riboside, salts thereof and functional derivatives thereof. 58. The method of claim 1, wherein the nucleotide substitute is incorporated into said nucleic acid molecule for substituting therein at least one adenosine base. 59. An isolated or purified nucleic acid molecule, comprising a nucleotide substitute selected from the group consisting of 2′6′-diaminopurine, analogs of 2′6′-diaminopurine and functional derivatives thereof, said nucleic acid molecule being selected from antisense oligonucleotides and nucleic acid molecules comprising a sequence coding for a therapeutic gene product. 60. The nucleic acid molecule of claim 59, wherein said analog of 2′6′-diaminopurine is selected from the group consisting of 2,6-diaminopurine hemisulfate, 2-amino-9-(B-D-2′-deoxyribofuranosyl) purine, 7-Deaza-2′-deoxyadenosine, N6-methyl-2′-deoxyadenosine, 2-aminoadenosine/2,6-diaminopurine riboside, salts thereof, and functional derivatives thereof. 61. The nucleic acid molecule of claim 59, wherein said nucleotide substitute is incorporated into said nucleic acid molecule for substituting therein an adenosine base. 62. The nucleic acid molecule of claim 59, comprising at least one mononucleotide linking residue selected from the group consisting of: methylphosphonate, phosphotriester, phosphorothioate, phosphodiester, phosphorodithioate, boranophosphate, formacetal, thioformacetal, thioether, carbonate, carbamate, sulfate, sulfonate, sulfamate, sulfonamide, sulfone, sulfite, sulfoxide, sulfide, hydroxylamine, methylene (methyimino), methyleneoxy (methylimino), and phosphoramidate residues. 63. The nucleic acid molecule of claim 59, wherein said nucleic acid molecule consists of DNA. 64. The nucleic acid molecule of claim 59, wherein said nucleic acid molecule consists of RNA. 65. The nucleic acid molecule of claim 59, wherein said antisense oligonucleotide has a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 18, 23 and 26. 66. A pharmaceutical composition comprising at least one nucleic acid molecule selected from the group consisting of the nucleic acid molecules as defined in claim 59, and a pharmaceutically acceptable carrier. 67. The composition of claim 66, for treating and/or preventing a disease selected from the group consisting of respiratory system diseases, neurological diseases, cardiovascular diseases, rheumatological diseases, digestive diseases, cutaneous diseases, ophtalmological diseases, urinary system diseases, cancers, pathogen infections, genetic diseases, hypereosinophilia, general inflammation, and cancers. 68. The composition of claim 66, wherein said nucleic acid molecule is present in an amount of about 1% to about 90% of the composition. 69. The composition of claim 66, further comprising an agent selected from the group consisting of drugs, antioxidants, surfactants, flavoring agents, volatile oils, buffering agents, dispersants, propellants, and preservatives. 70. A method of antisense therapy, comprising administering to a mammalian subject in need thereof, an effective therapeutic or prophylactic amount of at least one antisense oligonucleotide comprising a nucleotide substitute selected from the group consisting of 2′6′-diaminopurine, analogs of 2′6′-diaminopurine and functional derivatives thereof. 71. The method of claim 70, wherein said analog of 2′6′-diaminopurine is selected from the group consisting of 2,6-diaminopurine hemisuilfate, 2-amino-9-(B-D-2′-deoxyribofuranosyl) purine, 7-Deaza-2′-deoxyadenosine, N6-methyl-2′-deoxyadenosine, 2-aminoadenosine/2,6-diaminopurine riboside, salts thereof, and functional derivatives thereof. 72. The method of claim 71, for preventing or treating a disease selected from the group consisting of: respiratory system diseases, neurological diseases, cardiovascular diseases, rheumatological diseases, digestive diseases, cutaneous diseases, ophtalmological diseases, urinary system diseases, cancers, pathogen infections, genetic diseases, general inflammation and cancer. 73. The method of claim 72, wherein the respiratory system disease is a sickness associated with an inflammation of the lungs, the airways and/or the nose. 74. The method of claim 72, wherein the respiratory system disease is selected from the group consisting of pulmonary fibrosis, adult respiratory distress syndrome, cystic fibrosis, chronic obstructive lung disease, chronic bronchitis, eosinophilic bronchitis, asthma, allergy, allergic rhinitis, sinusitis and hypereosinophilia. 75. The method of claim 70, wherein the at least one antisense oligonucleotide has a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 18, 23 and 26. 76. The method of claim 70, comprising administering from about 2 μg to about 1 mg of the antisense oligonucleotide per kg of body weight of said mammal. 77. The method of claim 1, wherein said administration is made by way of a pressurized aerosol dispenser, a nasal sprayer, a nebulizer, a metered dose inhaler, a dry powder inhaler, or a capsule. |
<SOH> BACKGROUND OF THE INVENTION <EOH>(a) Field of the Invention The invention relates to the use of nucleotide substitutes for increasing the in vivo efficacy of nucleic acid molecules and also for inhibiting inflammation in mammals. More particularly, the present invention relates to the use of 2′6′diaminopurine (DAP) and analogs thereof per se in anti-inflammatory compositions, and also for preparing nucleic acid molecules having an increased in vivo physiological efficiency and a reduced toxicity. (a) Brief Description of the Prior Art Therapeutic approaches based on the use of nucleic acid molecules are becoming more and more popular. Gene-based therapies and antisense based-therapies will probably change radically medicine in a near future. The problems to date with nucleic acid molecules as therapeutics, and more particularly with antisense oligonucleotides, have been toxicity (both systemic and topical), stability, and non-specific binding to cell surface proteins. The toxicity of antisense oligonucleotides seems to vary between species, rats being the most sensitive, although the toxicity appears at doses higher than those that are therapeutically effective (see S T Crooke, Hematologic Pathology, 1995, 9:5972 for a review). In pulmonary/respiratory diseases, nucleic acid molecules toxicity associated with the administration of therapeutic antisenses/genes include: an increase in immune stimulation, a mononuclear cellular-inflammatory infiltrate into the lungs, and possibly hypersensitivity and bronchoconstriction of the airways. Several solutions that are less than optimum have been proposed up to date for circumventing the toxicity problem. Among the most popular there is the preparation of nucleic acid molecules containing various modified DNA bases, RNA bases, and/or a modified backbone structure. For instance, WO 99/67378 describes antisense oligonucleotides constructs based on modified sugars. Also, Nyce has postulated, although not demonstrated, in WO 00/09525 and WO 00/62736 that the adenosine base included in antisense oligonucleotides for treating respiratory diseases is a major cause of toxicity in lungs. Accordingly, Nyce proposes low adenosine oligonucleotides and oligonucleotides wherein the adenosine base has been replaced by an analog of adenosine. However, none of the low adenosine oligonucleotides and none of the adenosine analogs proposed by Nyce have ever been tested for their biological activity or their allegedly reduced toxicity. 2′,6′-diaminopurine nucleoside (2-amino-2′-deoxyadenosine; DAP) was found to be present in DNA in place of adenosine by the cyanophage S-2L (Cheng, X., Annu Rev Biophys Biomol Struct 24: 293-318, 1995); Khudyakov, I. Y., et al., Virology 88: 8-18, 1978). Since then, 2′,6′-diaminopurine nucleoside (DAP) has been widely used and studied, notably as a chemical starting point for the synthesis of antiviral compounds such as 2-amino-2′,3′-dideoxyadenosine (not DAP) which is capable of selectively inhibiting human immunodeficiency virus (HIV) replication in vitro (Balzarini, J. et al., Biochem. & Biophys. Res. Communications 145:269-76 (1987). The use of DAP in antisense oligonucleotides or in gene therapy methods has however never been suggested. Also, U.S. Pat. No. 5,925,624 and No. 5,889,178 describe derivatives of 2,6-diaminopurine-beta-D-ribofuranuronamide. Although these derivatives have an anti-inflammatory effect (mostly against neutrophil superoxide release) and that they could be used in the therapy of respiratory disease, they have a chemical formula which is different from the formula of DAP and analogs thereof. In summary, there has been up to date no suggestion nor any evidence that DAP per se could be used in anti-inflammatory compositions, nor any suggestion or example that DAP and analogs thereof could be incorporated in nucleic acid molecules (gene constructs and antisenses) for increasing the in vivo efficacy of these oligos. There is thus a need for more effective anti-inflammatory compositions comprising 2′6-diaminopurine and/or analogs thereof. There is also a long felt need for nucleic acid molecules that would remain stable in the body while exhibiting high effectiveness and low toxicity. There is more particularly a need for nucleic acid molecules incorporating a nucleotide substitute such as 2′6′diaminopurine (DAP) and analogs thereof, a need for composition comprising the same and a need for methods of using these nucleic acid molecules, particularly in gene and antisense therapies methods. No one has ever tested whether replacement of base(s) by a nucleotide substitute could affect the stability, binding, degradation efficacy and toxicity of antisense oligonucleotides, nor have they tested such modified antisense oligonucleotides for biological activity in cells, in culture or in animals. The present invention fulfils these needs and also other needs which will be apparent to those skilled in the art upon reading the following specification. |
<SOH> SUMMARY OF THE INVENTION <EOH>An object of the invention is to provide nucleic acid molecules such as gene constructs and antisense oligonucleotides that would remain stable in the body while exhibiting high effectiveness and low toxicity. According to an aspect of the invention, it is provided a method for increasing in vivo efficacy of an nucleic acid molecule that is administered to a mammal, comprising incorporating into the nucleic acid molecule at least one nucleotide substitute. Such an incorporation increases in vivo physiological effectiveness of the nucleic acid molecule and also reduces its toxicity when administered to a mammal, as compared to an nucleic acid molecule not incorporating the nucleotide substitute. According to a preferred embodiment, the nucleotide substitute is incorporated into the nucleic acid molecule for substituting therein an adenosine base. More preferably, the nucleotide substitute is selected from the group consisting of 2′6′-diaminopurine and analogs thereof. Preferred 2′6′-diaminopurine analogs include 2,6-diaminopurine hemisulfate, 2-amino-9-(B-D-2′-deoxyribofuranosyl) purine, 7-Deaza-2′-deoxyadenosine, N6-methyl-2′-deoxyadenosine, 2-aminoadenosine/2,6-diaminopurine riboside, salts thereof and functional derivatives thereof. The invention also relates to an improved method for the in vivo administration of at least one nucleic acid molecule to a mammal subject. The improvement consists of incorporating into the nucleic acid molecule at least one 2′6′-diaminopurine and/or an analog thereof. Preferably, 2′6′-diaminopurine or its analog is incorporated into the nucleic acid molecule for substituting therein an adenosine base. According to another aspect of the invention, it is provided an isolated or purified nucleic acid molecule selected from antisense oligonucleotides and nucleic acid molecules comprising a sequence coding for a therapeutic gene product, the nucleic acid molecule according to the present invention comprising a nucleotide substitute selected from the group consisting of 2′6′-diaminopurine and analogs thereof. According to another aspect of the invention, it is provided a pharmaceutical composition comprising at least one nucleic acid molecule as defined previously and a pharmaceutically acceptable carrier. The composition of the invention may be useful for treating and/or preventing a disease selected from respiratory system diseases, neurological diseases, cardiovascular diseases, rheumatological diseases, digestive diseases, cutaneous diseases, ophtalmological diseases, urinary system diseases, cancers, pathogen infections, and genetic diseases, hypereosinophilia, general inflammation, and cancers. According to a further aspect of the invention, it is provided a method of antisense therapy, comprising the step of administering, directly to the respiratory system of a mammal in need thereof, an effective therapeutic or prophylactic amount of at least one antisense oligonucleotide as defined previously. This method is useful for preventing and/or treating respiratory system diseases, cancers, pathogen infections, and genetic diseases, and more particularly respiratory system diseases associated with an inflammation of the lungs, the airways and/or the nose such as pulmonary fibrosis, adult respiratory distress syndrome, cystic fibrosis, chronic obstructive lung disease, chronic bronchitis, eosinophilic bronchitis, asthma, allergy, sinusitis, respiratory syncytial virus or other viral respiratory tract infection and hypereosinophilia. According to another aspect of the invention, it is provided a method for inhibiting inflammation in a mammal, comprising the use of a nucleotide substitute selected from the group consisting of 2′6′-diaminopurine and analogs thereof. Typically, 2′6′ diaminopurine or its analogue(s) are administered to the mammal. Preferably 2′6′-diaminopurine and its analogs are used as such in an anti-inflammatory composition, but they may be also incorporated into nucleic acid molecules. In a related aspect, the invention concerns an anti-inflammatory composition comprising: an adenosine antagonist compound selected from the group consisting of 2′6′-diaminopurine and analogs thereof; and a pharmaceutically acceptable carrier. Another related aspect concerns the use of 2′6′-diaminopurine and/or an analog thereof for the preparation of an anti-inflammatory composition. |
Nucleic acids encoding glucosinolate biosynthesis enzymes and methods of their use |
Provided are nucleic acid sequences from Brassica oleracea plants that encode enzymes involved in the synthesis of a glucosinolate molecule, including BoGSL-ALK, and BoGSL-ELONG, and methods of their use. The sequences find particular use in modifying the glucosinolate content of a plant. Also provided are primers for these two genes and a third key gene in the glucosinolate pathway, BoGSL-PRO, that can be used for developing molecular markers for assisted selection of plants with specific glucosinolate compositions. Additionally, compositions and methods for a simple, reliable and efficient PCR-based marker system, named sequence-related amplification polymorphism (SRAP), that finds use in the identification of coding sequences in the genome of a plant are provided. |
1. A nucleic acid comprising a DNA sequence at least 80% identical to SEQ ID NO:3 or SEQ ID NO:34, wherein said nucleic acid encodes an enzyme which modifies glucosinolate content in a plant. 2. The nucleic acid according to claim 1, wherein said enzyme comprises an ALK gene or an ELONG gene. 3. The nucleic acid according to claim 2, wherein the amino acid sequence for said enzyme is SEQ ID NO:4 or SEQ ID NO:35. 4. The nucleic acid according to claim 1, wherein said DNA sequence is SEQ ID NO:3 or SEQ ID NO:34. 5. A DNA construct comprising a nucleic acid according to claim 1. 6. The DNA construct according to claim 5, wherein said DNA sequence is in the antisense orientation in said construct. 7. An amino acid comprising a sequence as depicted by SEQ ID NO:4 or SEQ ID NO:35. 8. A seed comprising a recombinant expression cassette comprising at least one of an ALK nucleic acid sequence at least 80% identical to SEQ ID NO: 3 or an ELONG nucleic acid sequence at least 80% identical to SEQ ID NO: 34. 9. A plant comprising a recombinant expression cassette comprising at least one of an ALK nucleic acid sequence at least 80% identical to SEQ ID NO: 3 or an ELONG nucleic acid sequence at least 80% identical to SEQ ID NO: 34. 10. A method of modifying the glucosinolate content in a plant, said method comprising the steps of: introducing into a plant a construct comprising at least one of an ALK nucleic acid sequence at least 80% identical to SEQ ID NO: 3 or an ELONG nucleic acid sequence at least 80% identical to SEQ ID NO: 34, whereby said glucosinolate content is modified as compared to a non-transgenic plant. 11. The method of claim 10, wherein the ALK or ELONG nucleic acid is operably linked to a plant promoter in a sense orientation. 12. The method of claim 10, wherein the ALK or ELONG nucleic acid is operably linked to a plant promoter in the antisense orientation. 13. The method of claim 10, wherein said construct is introduced into a plant introduced using Agrobacterium. 14. The method of claim 10, wherein the ALK sequence is SEQ ID NO: 3 and the ELONG sequence is SEQ ID NO:34. 15. The method of claim 10, wherein modifying the glucosinolate content is increasing the amount of glucoraphanin. 16. The method according to claim 10, wherein modifying the glucosinolate content is increasing the amount of sinigrin. 17. A nucleic acid primer pair, comprised for a forward primer and a reverse primer, wherein said forward and reverse primer comprise a nucleic acid sequence as depicted in SEQ ID NOs:6-33. 18. A method for identifying a Brassica plant with increased sinigrin content, said method comprising the steps of: amplifying a sequence of genomic DNA from said Brassica plant using one or more nucleic acid primer pairs according to claim 17, wherein said one or more primer pairs amplify an allele of BoGSL-ALK, BoGSL-PRO, and BoGSL-ELONG; and determining whether said allele is a plus allele or a minus allele, wherein said Brassica plant with increased sinigrin content has a BoGSL-ALK plus allele, a BoGSL-PRO plus allele, and a BoGSL-ELONG minus allele, whereby said Brassica plant with increased sinigrin content is identified. 19. A method for identifying a Brassica plant with increased glucoraphanin content, said method comprising the steps of: amplifying a sequence of genomic DNA from said Brassica plant using one or more nucleic acid primer pairs according to claim 17, wherein said one or more primer pairs amplify an allele of BoGSL-ALK, BoGSL-PRO and BoGSL-ELONG; and determining whether said allele is a plus allele or a minus allele, wherein Brassica plant with increased glucoraphanin content has a minus allele for BoGSL-ALK and BoGSL-PRO, and a plus allele for BoGSL-ELONG, whereby said Brassica plant with increased glucoraphanin content is identified. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention The invention relates to compositions and methods of using nucleic acids and amino acids that encode enzymes involved in the synthesis of glucosinolates (GSL). The invention is exemplified by nucleic acids and amino acids encoding a BoGSL-ALK, an enzyme involved in glucosinolate side-chain desaturation, isolated from Brassica oleracea (Groups Botrytis (Cauliflower and Broccoli), Italica (Broccoli) and Viridis (Collard)), and methods of using these sequences to increase or decrease the levels of alkenyl glucosinolates in Brassica oleracea plant varieties. The invention also relates to methods and compositions for marker assisted gene selection, exemplified by primers and methods of using them for selecting BoGSL-ALK and two other key genes in GSL synthesis, BoGSL-PRO and BoGSL-ELONG. 2. Introduction GSL are a diverse class of thioglucosides that are synthesized by many species of the order Capparales, including Brassica and Arabidopsis Heynh. The GSL molecule consists of two parts; a common glycone moiety and a variable aglycone side chain (Fenwick et al., Crit. Rev. Food Sci. Nutr., 18:123-301 (1983); Rosa et al., Hort Rev, 19:99-215 (1997)). The aglycone part may contain aliphatic, indolyl, or aromatic side chains and is derived from a corresponding α-amino acid. In the general GSL biosynthetic pathway proposed by Underhill, Glucosinolates. Encyclopedia of Plant Physiology (New Series), Vol. 8, Springer Verlag, Berlin, pp. 493-511 (1980); Larsen, Glucosinolates. In: The Biochemistry of Plants (E E Conn, ed.), Vol. 7, Academic Press, New York, pp. 501-525 (1981); and Haughn et al., Plant Physiol, 97:217-226 (1991), aliphatic GSL are derived from methionine. Genetic studies in Arabidopsis thaliana (Mithen et al., Heredity, 74:210-215 (1995); Mithen and Campos, Entomol. Exp. Appl., 80:202-205 (1996)) and Brassica sp. (Magrath et al., Plant Breeding, 111:55-72 (1993); Magrath et al., Heredity, 72:290-299 (1994)) support the biochemical pathway proposed for biosynthesis of aliphatic GSL. The synthesis of these compounds is determined by a simple genetic system containing two distinct sets of genes, one determining side-chain elongation and the second one for chemical modification of the side-chains. Aliphatic GSL profiles vary considerably in A. thaliana ecotypes and in Brassica crops and species. These GSL are synthesized in the following sequence: methylsulfinylalkyl, alkenyl and hydroxy-types, which can be divided into three-carbon (3C) four-carbon (4C) and five-carbon (5C) groups based on their side-chain length. A number of studies suggest that consumption of vegetables, in particular, crops such as broccoli [ Brassica oleracea ( Italica Group)] and other crucifers, reduces the incidence of cancer in humans and other mammals (Block et al., Nutr. Cancer, 18:1-29 (1992); Fahey and Talalay (1998) pp. 16-22. In: T. Shibamoto, J. Terao and T. Osawa (eds.). Functional foods for disease prevention I. Fruits, vegetables and teas. , Amer. Chem. Soc. Symp. Ser., 701. Amer. Chem. Soc., Washington, D.C.; Prochaska et al., Proc. Natl. Acad. Sci. USA, 89:2394-2398 (1992)). This seems to be due to the presence of inducers of phase II enzymes, that detoxify carcinogens and mutagens in various mammalian organs (Prestera et al., Adv. Enzyme Regulat., 33:28 1-296 (1996); Prochaska et al., (1992) supra; Talalay et al., pp. 469-478 (1992). In: L. W. Wattenberg, M. Lipkin, C. W. Boone, and G. J. Kelloff, (eds.). Cancer chemoprevention, CRC Press, Boca Raton, Fla.). In broccoli, the isothiocyanate sulfurophane, derived from the GSL glucoraphanin by the action of the enzyme myrosinase, was identified as a potent inducer of these enzymes, conferring protection against mammary tumor growth in rats after treatment with dimethyl benzanthracene, a carcinogenic agent (Zhang et al., Proc. Natl. Acad. Sci. USA, 91:3147-3150 (1994)). Glucoraphanin is one of the major GSL present in some crops of B. oleracea such as broccoli (Farnham et al., J. Amer. Soc. Hort. Sci., 125:482-488 (2000)) cauliflower [ B. oleracea ( Botrytis Group)], cabbage [ B. oleracea ( Capitata Group)] and brussels sprouts [ B. oleracea ( Gemmifera Group)] (Rosa et al., Hort Rev, 19:99-215 (1997)). Unfortunately, the wide range of glucoraphanin in broccoli can lead to consumer confusion. At the present time the consumer that eats broccoli might assume that it has high sulfurophane content and that therefore this produce is conferring health benefits by carcinogen detoxification. However, this is not always true. For example, the heads of broccoli inbred plants have been found to contain from 0.28 to 4.0 mol/gram of fresh weight glucoraphanin content (Farnham, et al. (2000) J. Amer. Soc. Hort. Sci. 125(4):______). Because most of the existing broccoli varieties in the supermarket have not been selected for glucoraphanin content, the precursor of sulfurophane, certain produce could actually possess only small concentrations of this compound and in reality be ineffective for its assumed anticarcinogenic properties. Although certain GSL derivatives have a protective effect against cancer (Rosa et al., (1997) supra), there are some that may have detrimental effects such those derived from alkenyl GSL in rapeseed seed meal ( Brassica napus L. ). Such GSLs act as anti-nutrients affecting not only animal growth and development, but also lowering food intake. Additionally, modified isothiocyanates from the aliphatic GSL progoitrin may have goitrogenic effects in animals (Rosa et al., (1997) supra). There is therefore an interest in methods and compositions for lowering the amount of these antinutritional GSL and for providing crucifer varieties with consistently increased amounts of protective GSL in plants intended for human and animal consumption. The polymerase chain reaction (PCR) is widely used in genomic DNA analysis. One of its main applications has been on the development of DNA markers for map construction, which are useful in breeding, taxonomy, evolution and gene cloning. Several PCR marker systems are available varying in complexity, reliability and information generating capacity. These include random amplified polymorphic DNA (RAPD), simple sequence repeat polymorphism (SSR), amplified fragment length polymorphism (AFLP) and a few others (Lee, Adv. Agronomy, 55:265-344 (1995); Rafalski et al., in Non Mammalian genome analysis: A practical guide, Acad. Press, pp. 75-134 (1996)). Each system has its own advantages and disadvantages. For example, RAPD is a simple method to fingerprint genomic DNA, but poor consistency and low multiplexing output limit its use. SSR has the advantage that it produces mostly co-dominant markers, however the development of these is expensive and time-consuming. AFLPs are now widely used for a variety of applications due to their high multiplexing ratio (Vos et al., Nucleic Acids Res, 23:4407-4414 (1995)). The main disadvantage of this method is its complexity, it being necessary to perform multiple steps including DNA digestion, ligation and amplification, which makes it difficult to optimize the conditions for each step. Furthermore, methylation of genomic DNA can result in pseudo polymorphism when the restriction enzyme used is methylation-sensitive. Also the use of the MseI restriction enzyme, which recognizes AATT restriction sites, often results in uneven marker distribution in the genome of some species (Haanstra et al., Theor Appl Genet, 99:254-271 (1999)). Ability to isolate specific bands for sequencing is another concern when selecting a marker system, especially for the development of new markers for gene tagging. In most cases, both RAPD and AFLP markers need to be cloned into vectors, which adds to the labor. In addition, for AFLP bands it is notoriously difficult to isolate the correct fragment due to band overlapping. Therefore, there is a need for a PCR marker system that combines the desired attributes of simplicity, reliability, moderate throughput ratio, facile sequencing of selected band, with targeting of coding sequences in the genome and efficient identification of a moderate number of co-dominant markers. 3. Relevant Literature Brassica napus seeds, and plants producing them, obtained by genetic mutation and having a maximum total glucosinolate content of about 3.4 micromoles per gram of seed and a maximum 4-hydroxy-3-indolylmethyl glucosinolate content of 1.9 micromoles per gram of seed are disclosed in U.S. Pat. No. 6,225,533. In Arabidopsis thaliana , several genes involved in the glucosinolate pathway have been identified by genetic analysis (Mithen et al., Heredity, 74:210-215 (1995); Mithen and Campos, Entomol. Exp Appl., 80:202-205 (1996)). In rapeseed, genes regulating aglycon side-chain elongation and modification have been reported (Magrath et al., Plant Breeding, 111:55-72 (1993); Parkin, et al. (1994) Heredity 72:594-598 (1994)). Campos de Quiros et al., Theoretical and Applied Genetics, 101:429-437 (2000)) disclose the mapping and sequencing of a GSL-ELONG gene from A. thaliana . However, many steps in side-chain elongation, glycone formation, and aglycone modification remain to be characterized biochemically and genetically. Hall et al., Theoretical and Applied Genetics, 102:369-374 (2001)) disclose the fine mapping of the OHP locus in A. thaliana , which contains a gene cluster of three open reading frames with high homology to sequences encoding 2-oxoglutarate-dependent dioxygenases (2-ODDs). The 2-ODD translation products associate with glucosinolate hydroxylation activity, and Hall speculates that the ALK and OHP loci in A. thaliana may either represent two closely linked genes or different alleles of the same gene. Hall et al. do not provide either a nucleic acid or an amino acid sequence. Kliebenstein et al., Plant Cell, 13:681-693 (2001)) disclose the identification of genes encoding two 2-oxoglutarate-dependent dioxygenases from Arabidopsis that control the conversion of methylsulfinylalkyl glucosinolate to either the alkenyl or the hydroxyalkyl form. Kliebenstein et al. expressed these genes in E. coli to determine their catalytic activity. WO 99/27120 discloses cloning of GSL-ELONGASE gene alleles from Arabidopsis. |
<SOH> SUMMARY OF THE INVENTION <EOH>Compositions and methods are provided for modifying the glucosinolate content of a plant or plant cell using one or more enzyme involved in the modification or biosynthesis of a glucosinolate compound. The methods include the steps of transforming a plant or plant cell with a construct that comprises a nucleic acid encoding an enzyme required for the modification of a glucosinolate, and growing the plant or plant cell, whereby the nucleic acid sequence is transcribed in either the sense or antisense orientation to increase or decrease the activity of glucosinolate side-chain elongation, desaturation/alkenylation and/or hydroxylation as desired. The compositions include constructs and vectors that contain the nucleic acid, and cells, particularly plant cells, that contain such constructs or vectors. Particular nucleic acids provided include the DNA sequences for BoGSL-ALK from Brassica oleracea and the Brassica oleracea homologue BoGLS-ELONG from broccoli. The invention finds use in improving the nutritional value of a plant that produces glucosinolate compounds, such as those of the order Capparales, including Brassica and Arabidopsis , and for rationally controlling the glucosinolate content of a plant. Also provided is a simplified high throughput marker system, called Sequence-Related Amplified Polymorphism (SRAP), that can be used for map construction, gene tagging, genomic and cDNA fingerprinting and map based cloning and primer pairs designed to carry out this marker system. In using the SRAP marker system, a primer pair is used to preferentially amplify a coding sequence from the genomic DNA of a plant. The “amplicons” or sequences amplified by a particular primer pair are amplified in a polymerase reaction, separated, and sequenced. The SRAP marker identification system is applicable to any monocotyledonous or dicotyledonous plant, particularly vegetable, fruit, and grain plants such as wheat and corn. The molecular markers can be used for visual selection of plants with a specific genetic profile, such as a glucosinolate profile. |
Recording apparatus and method, and communication device and method |
The present invention relates to a recording apparatus and method and communication apparatus and method suitably for use in supplying the encoded data of accumulated music for example to a semiconductor memory or a portable device. In step S461, the content data enabled for check-in into an MS are identified. In step S462, a check-in process is executed. In step S463, it is determined whether or not the content data enabled for check-in have all been checked in. In step S464, an album to be checked out is determined. In step S465, one track is selected. In step S466, the selected track is determined whether or not it is enabled for check-out. In step S467, the capacity of the MS is confirmed. In step S468, a check-out operation is performed. In step S469, it is determined whether or not all tracks in the album to be checked out have been selected. The present invention is applicable to audio servers for example. |
1. A recording apparatus for generating duplicate content data in an information storage medium by copying content data, the recording apparatus comprising: first storage means for storing an album including a plurality of content data; check-in means for checking, among duplicate content data recorded to said information storage medium, said duplicate content data enabled for check-in into said first storage means; and check-out means for checking out, among said plurality of content data included in said album, said content data enabled for check-out into said information storage medium after said check-in means ends its process. 2. The recording apparatus according to claim 1, wherein said information storage medium is detachable from said recording apparatus. 3. The recording apparatus according to claim 1, wherein said information storage medium is loaded on an electronic device connected to said recording apparatus. 4. The recording apparatus according to claim 1, wherein said information storage medium is incorporated in an electronic device connected to said recording apparatus. 5. The recording apparatus according to claim 1, further having second storage means, wherein said check-in means comprises: identification means for identifying, among said duplicate content data recorded to said information storage medium, said duplicate content data checked out from said recording apparatus as said duplicate content data enabled for check-in; deletion means for deleting said duplicate content data identified by said identification means from said information storage medium; and incrementing means for incrementing, by one, a check-out permission count included in said attribute information stored in said second storage means in correspondence with said content data which is an original version of said duplicate content data deleted by said deletion means. 6. The recording apparatus according to claim 1, further having second storage means for storing attribute information corresponding to said content data, wherein said check-out means comprising: determination means for determining said content data enabled for check-out among said plurality of content data included in said album stored in said first storage means; confirmation means for making a confirmation of a free capacity of said information storage medium; generating means for generating said content data included in said album into said information storage medium by copying said content data included in said album determined by said determination means based on a result of the confirmation performed by said confirmation means; and decrementing means decrementing, by one, a check-out permission count included in said attribute information stored in said second storage means in correspondence with said content data which is an original version of said duplicate content data generated by said generating means. 7. A recording method for generating duplicate content data into an information storage medium by copying content data included in an album stored in storage means, the recording method comprising the steps of: checking, among duplicate content data recorded to said information storage medium, said duplicate content data enabled for check-in into said first storage means; and checking out, among said plurality of content data included in said album stored in said first storage means, said content data enabled for check-out into said information storage medium after said check-in step ends its process. 8. A storage medium for storing a computer-executable program which generates duplicate content data into an information storage medium by copying content data included in an album stored in first storage means, the computer-executable program comprising the steps of: checking, among duplicate content data recorded to said information storage medium, said duplicate content data enabled for check-in into said first storage means; and checking out, among said plurality of content data included in said album stored in said first storage means, said content data enabled for check-out into said information storage medium after said check-in step ends its process. 9. A computer-executable program for generating duplicate content data into an information storage medium by copying content data included in an album stored in first storage means, the computer-executable program comprising the steps of: checking, among duplicate content data recorded to said information storage medium, said duplicate content data enabled for check-in into said first storage means; and checking out, among said plurality of content data included in said album stored in said first storage means, said content data enabled for check-out into said information storage medium after said check-in step ends its process. 10. A recording apparatus for generating duplicate content data into an information storage medium by copying content data, the recording apparatus comprising: first storage means for storing an album including a plurality of content data; second storage means for storing attribute information corresponding to said content data; acceptance means for accepting a command operation executed by a user; identification means for identifying, among duplicate content data recorded to said information storage medium, said duplicate content data checked out from said recording apparatus as said content data enabled for check-in; deletion means for deleting said duplicate content data identified by said identification means from said information storage medium; incrementing means for incrementing, by one, a check-out permission count included in said attribute information stored in said second storage means in correspondence with said content data which is an original version of said duplicate content data deleted by said deletion means; determination means for determining said content data enabled for check-out among said plurality of content data included in said album stored in said first storage means; confirmation means for making a confirmation of free capacity of said information storage medium; generating means for generating said duplicate content data into said information storage medium by copying said content data included in said album determined by said determination means on the basis of a result of the confirmation performed by said confirmation means; decrementing means for decrementing, by one, a check-out permission count included in said attribute information stored in said second storage means in correspondence with said content data which is an original version of said duplicate content data generated by said generating means; and control means for controlling said identification means, said deletion means, said incrementing means, said determination means, said confirmation means, said generating means, and said decrementing means in response to said one command operation done by said user accepted by said acceptance means. 11. The recording apparatus according to claim 10, wherein said information storage medium is detachable from said recording apparatus. 12. The recording apparatus according to claim 10, wherein said information storage medium is loaded in an electronic device connected to said recording apparatus. 13. The recording apparatus according to claim 10, wherein said information storage medium is incorporated in an electronic device connected to said recording apparatus. 14. A recording apparatus in which only a dedicated application program for generating duplicate content data into an information storage medium by copying content data can be started and said dedicated application program is executed immediately after a power-on sequence, the recording apparatus comprising: first storage means for storing an album including a plurality of content data; acceptance means for accepting a command operation executed by a user; check-in means for checking, among duplicate content data recorded to said first information storage medium, said duplicate content data enabled for check-in into said storage means in response to said command operation accepted by said acceptance means; and check-out means for checking out, among said plurality of content data included in said album stored in said first storage means, said content data enabled for check-out into said information storage medium after said check-in means ends its process. 15. The recording apparatus according to claim 14, wherein said information storage medium is detachable from said recording apparatus. 16. The recording apparatus according to claim 14, wherein said information storage medium is loaded on an electronic device connected to said recording apparatus. 17. The recording apparatus according to claim 14, wherein said information storage medium is incorporated in an electronic device connected to said recording apparatus. 18. The recording apparatus according to claim 14, further having a second storage means for storing attribute information corresponding to said content data, wherein said check-in means comprises: identification means for identifying, among said duplicate content data recorded to said information storage medium, said duplicate content data checked out from said recording apparatus as said duplicate content data enabled for check-in; deletion means for deleting said duplicate content data identified by said identification means from said information storage medium; and incrementing means for incrementing, by one, a check-out permission count included in said attribute information stored in said second storage means in correspondence with said content data which is an original version of said duplicate content data deleted by said deletion means. 19. The recording apparatus according to claim 14, further having second storage means, wherein said check-out means comprising: determination means for determining said content data enabled for check-out among said plurality of content data included in said album stored in said first storage means; confirmation means for making a confirmation of free capacity of said information storage medium; generating means for generating said duplicate content data into said information storage medium by copying said content data included in said album determined by said determination means on the basis of a result of the confirmation performed by said confirmation means; reading means for reading from said second storage means said attribute information corresponding to said content data which is an original version of said duplicate content data generated by said generating means; and decrementing means decrementing, by one, a check-out permission count included in said attribute information read by said reading means. 20. A communication apparatus for communicating data with a storage apparatus having an information storage medium, the communication apparatus comprising: a data storage block for storing an album including a plurality of data; an attribute information storage block for storing attribute information associated with data to be stored in said data storage block; an instruction block for instructing automatic check-in and check-out; and a communication controller for, in response to an instruction from said instruction block, checking data enabled for check-in stored in said information storage medium into said data storage block, checking out data enabled for check-out, among said plurality of data included in said album from said data storage block into said information storage medium, and, if capacity of said information storage medium runs short, stopping said check-out operation. 21. The communication apparatus according to claim 20, wherein said communication controller: in response to said instruction, after changing a playback permission flag in attribute information of data stored in said information storage medium from valid to invalid, changes said playback permission flag in said attribute information of said data stored in said attribute information storage block from invalid to valid and increments a check-out permission count in said attribute information of said data stored in said information storage medium; if a check-out permission count in attribute information of other data stored in said storage block satisfies a condition, transfers said other data and said attribute information of said other data with a playback permission flag set to invalid to said information storage medium of said storage apparatus, sets said playback permission flag in said attribute information corresponding to said data stored in said information storage medium to valid, and decrements said check-out permission count in said attribute information of said data stored in said attribute information storage block; and if the capacity of said information storage medium runs short due to the transfer of said other data to said information storage medium, stops the transfer of said other data. 22. A communication method for a communication apparatus for communicating data with a storage apparatus having an information storage medium, the communication method comprising the steps of: accepting automatic check-in and check-out requests; checking, in response to said request acceptance, data enabled for check-in stored in said information storage medium into a storage block enabled for data storage; checking out data enabled for check-out among a plurality of content data included in an album stored in said storage block into said information storage medium; and stopping said check-out operation if capacity of said information storage medium runs short. 23. A storage medium storing a computer-executable program for controlling a communication apparatus for communicating data with a storage apparatus having an information storage medium, said computer-executable program comprising the steps of: accepting automatic check-in and check-out requests; checking, in response to said request acceptance, data enabled for check-in stored in said information storage medium into a storage block enabled for data storage; checking out data enabled for check-out among a plurality of content data included in an album stored in said storage block into said information storage medium; and stopping said check-out operation if capacity of said information storage medium runs short. 24. A computer-executable program for causing a computer for controlling a communication apparatus for communicating data with a storage apparatus having an information storage medium to execute the steps of: accepting automatic check-in and check-out requests; checking, in response to said request acceptance, data enabled for check-in stored in said information storage medium into a storage block enabled for data storage; checking out data enabled for check-out among a plurality of content data included in an album stored in said storage block into said information storage medium; and stopping said check-out operation if capacity of said information storage medium runs short. |
<SOH> BACKGROUND ART <EOH>Conventionally, it is practicable to record a music CD by use of a portable device (hereafter referred to as a PD) such as the Network Walkman (trademark) connected to a CD player. To be more specific, it is practicable to encode the PCM data recorded in a music CD on the basis of the ATRAC (Adaptive Transform Acoustic Coding) 3 technique and record the encoded data to a semiconductor memory such as the Memory Stick (trademark) (hereafter referred to as an MS) or a memory incorporated in a PD. However, the recording method in which a music CD is recorded by connecting a CD player with a PD makes it such an editing operation cumbersome as selecting only favorite music titles from two or more music CDs and recording the selected music titles. It should be noted that use of a personal computer allows the encoding of PCM data recorded in a music CD and storing the encoded data into its hard disk drive and, at the same time, and it is possible to create a copy of the stored encoded data temporarily on an MS or a PD connected to the personal computer. This processing is referred to as check-out processing. The deletion, by the check-out processing, of the copy of the stored encoded data created on an MS or a PD is referred to as check-in processing. The check-out and check-in processing will be detailed later. Meanwhile, if, in checking out the encoded data stored in a hard disk drive to an MS or a PD, its storage capacity is already full, the user must perform an operation for checking in a copy of the encoded data stored in the MS or the PD and then perform an operation for checking out the encoded data of desired music, thereby presenting a problem of increased operator load. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 is a schematic diagram illustrating an overview of an audio server 1 practiced as one embodiment of the invention. FIG. 2 is an external view of the audio server 1 . FIG. 3 is a top view of the audio server 1 . FIG. 4 is a rear view of the audio server 1 . FIG. 5 is an elevational view of the audio server 1 . FIG. 6 is a block diagram illustrating an exemplary hardware configuration of the audio server 1 . FIG. 7 is a diagram illustrating firmware which is executed by the audio server 1 . FIG. 8 is a diagram illustrating a FAT file system (data format) applied to a HDD 58 . FIG. 9 is a diagram illustrating a logical structure of a file recording area 121 . FIG. 10 is a diagram illustrating a configuration of a FAT 141 . FIG. 11 is a diagram illustrating one example of the FAT 141 . FIG. 12 is a diagram illustrating an exemplary record of a file recording area 121 . FIG. 13 is a diagram illustrating a structure of a size recording area 151 . FIG. 14 is a flowchart describing a file creating process. FIG. 15 is a flowchart describing a free cluster retrieving process. FIG. 16 is a flowchart describing FAT entry reading process. FIG. 17 is a flowchart describing a linking process. FIG. 18 is a flowchart describing a file X reading process. FIG. 19 is a flowchart describing a file X searching process. FIG. 20 is a flowchart describing a file X reverse reading process. FIG. 21 is a diagram illustrating a logical structure of an object recording area 122 . FIG. 22 is a diagram illustrating a structure of an object type recording area 163 . FIG. 23 is a diagram illustrating an area information recording area 164 . FIG. 24 is a diagram illustrating an object managing block 124 . FIG. 25 is a diagram illustrating a session managing information 181 . FIG. 26A is a diagram illustrating a basic object type 1 . FIG. 26B is a diagram illustrating a basic object type 2 . FIG. 27 is a diagram illustrating a structure an object identifier. FIG. 28 is a flowchart describing an object creating process. FIG. 29 is a flowchart describing a session opening process. FIG. 30 is a flowchart describing a free entry allocating process. FIG. 31 is a flowchart describing a write session establishing process. FIG. 32 is a flowchart describing a session discarding process. FIG. 33 is a flowchart describing an object searching process. FIG. 34 is a flowchart describing an entry retrieving process. FIG. 35 is a flowchart describing an object updating process. FIG. 36 is a flowchart describing a stream object creating process. FIG. 37 is a flowchart describing a stream object searching process. FIG. 38 is a diagram illustrating an object directory structure. FIG. 39 is a diagram illustrating a folder list object format. FIG. 40 is a diagram illustrating a folder object format. FIG. 41 is a diagram illustrating an album object format. FIG. 42 is a diagram illustrating a track object format. FIG. 43 is a diagram illustrating details of AC of a track object. FIG. 44 is a diagram illustrating a content data format. FIG. 45 is a diagram illustrating a CC object format. FIG. 46 is a diagram illustrating a CC data format. FIG. 47 is a diagram illustrating a data flow at a time when CD ripping is executed. FIG. 48 is a diagram illustrating a data flow at a time when CD recording is executed. FIG. 49 is a diagram illustrating a data flow at a time when HD recording for digital input is executed. FIG. 50 is a diagram illustrating a data flow at a time when HD recording for analog input is executed. FIG. 51 is a diagram illustrating a data flow at a time when HD play is executed. FIG. 52 is a diagram illustrating a data flow at a time when CD play is executed. FIG. 53A is a diagram illustrating a data flow at a time when MS play is executed. FIG. 53B is a diagram illustrating a data flow at a time when MS play is executed. FIG. 54 is a diagram illustrating a data flow at a time when MS check-out/move-out is executed. FIG. 55 is a diagram illustrating a data flow at a time when MS import/move-in is executed. FIG. 56 is a diagram illustrating a data flow at a time when a PD check-out is executed. FIG. 57 is a diagram illustrating CD ripping. FIG. 58 is a diagram illustrating CD recording. FIG. 59 is a diagram illustrating the partitioning of a buffer 56 in CD ripping or CD recording. FIG. 60 is a diagram illustrating buffer transition states. FIG. 61 is a diagram illustrating a ring buffer 241 arranged in a HDD 58 . FIG. 62 is a diagram illustrating a data flow between buffers at the time of CD ripping. FIG. 63 is a flowchart describing a recording speed setting process. FIG. 64 is a flowchart describing a CD recording process. FIG. 65 is a flowchart describing a ring buffer information initializing process. FIG. 66 is a flowchart describing a recording process for one piece of music. FIG. 67 is a flowchart describing a monitor sound outputting process. FIG. 68 is a flowchart describing a ring buffer writing process. FIG. 69 is a flowchart describing a ring buffer reading process. FIG. 70A is a diagram illustrating an exemplary display on a display 15 at a time when music to be recorded is set. FIG. 70B is a diagram illustrating an exemplary display on the display 15 when recording is on. FIG. 71 is a diagram illustrating the setting of a playback area. FIG. 72 is a diagram illustrating an exemplary play list. FIG. 73 is a diagram illustrating another exemplary play list. FIG. 74 is a diagram illustrating still another exemplary play list. FIG. 75 is a diagram illustrating yet another exemplary play list. FIG. 76 is a flowchart describing a play list creating process. FIG. 77 is a flowchart describing an all music repeat playback process. FIG. 78 is a flowchart describing a move-out process. FIG. 79 is a diagram illustrating a move-out processing state transition. FIG. 80 is a diagram illustrating an exemplary display on the display 15 at the time of a move-out process. FIG. 81 is a diagram illustrating an exemplary display on the display 15 at the time of a move-out process. FIG. 82 is a flowchart describing a move-in process. FIG. 83 is a diagram illustrating a move-in process state transition. FIG. 84 is a diagram illustrating an exemplary display on the display 15 at the time of a move-in process. FIG. 85 is a diagram illustrating another exemplary display on the display 15 at the time of a move-in process. FIG. 86 is a flowchart describing a restore process. FIG. 87 is a flowchart describing a move-out restore process. FIG. 88 is a flowchart describing a move-in restore process. FIG. 89 is a flowchart describing a check-out process. FIG. 90 is a diagram illustrating an exemplary display on the display 15 at the time of a check-out process. FIG. 91 is a diagram illustrating another exemplary display on the display 15 at the time of a check-out process. FIG. 92 is a flowchart describing a check-in process. FIG. 93 is a diagram illustrating an exemplary display on the display 15 at the time of a check-in process. FIG. 94 is a flowchart describing an exchanging process. FIG. 95 is a diagram illustrating an exemplary display on the display 15 at the time of an exchanging process. FIG. 96 is a diagram illustrating another exemplary display on the display 15 at the time of an exchanging process. FIG. 97 is a diagram illustrating still another exemplary display on the display 15 at the time of an exchanging process. FIG. 98 is a block diagram illustrating an exemplary hardware configuration of a PD 5 . FIG. 99 is a diagram illustrating the types of directories and files recorded on an MS 4 . FIG. 100 is a diagram illustrating archive file recording positions. FIG. 101 is a flowchart describing storing process. FIG. 102 is a diagram illustrating an exemplary display on the display 15 at the time of a storing process. FIG. 103 is a diagram illustrating another exemplary display on the display 15 at the time of a storing process. FIG. 104 is a diagram illustrating still another exemplary display on the display 15 at the time of a storing process. FIG. 105 is a flowchart describing a restoring process. FIG. 106 is a diagram illustrating an exemplary display on the display 15 at the time of restoring process. FIG. 107 is a diagram illustrating another exemplary display on the display 15 at the time of restore process. FIG. 108 is a diagram illustrating an area configuration of a flash ROM shown in FIG. 6 . FIG. 109 is a flowchart describing a program rewriting process. FIG. 110 is a flowchart describing a boot program process. detailed-description description="Detailed Description" end="lead"? |
Gfp fusion proteins and their use |
The present invention provides fusion proteins including a green fluorescent protein inserted into the internal amino acid sequence of a Gαs protein and further provides method of using the fusion protein construct to follow activation of a G-protein receptor by a candidate drug. |
1. A fusion protein comprising a green fluorescent protein inserted into the internal amino acid sequence of a Gαs protein. 2. The fusion protein of claim 1, wherein the insertion is at regions that are free of interactions with receptors or effectors. 3. The fusion protein of claim 1 modified for specific receptors by replacing amino acid residues at the C terminal end of Gαs. 4. A method for making a fusion protein, said method comprising: (a) obtaining a molecule having an amino acid sequence of a green fluorescent protein; and (b) inserting the molecule into the interior of a molecule having an amino acid sequence of a G-protein. 5. The method of claim 4 wherein the fusion protein has the amino acid sequence as in SEQ ID NO: 2. 6. The method of claim 4, wherein the G-protein is the Gαs protein. 7. A method to follow an activation of a G-protein receptor by a candidate drug said method comprising: (a) obtaining a G-protein green fluorescent fusion protein; (b) monitoring fluorescence of the fusion protein in response to the candidate drug; and (c) inferring from a change in fluorescence whether the drug is an agonist or antagonist. 8. Use of the fusion protein of claim 1 to follow the activation of a G-protein receptor. 9. Use of the fusion protein of claim 1 to track protein functions in living cells. |
<SOH> BACKGROUND OF THE INVENTION <EOH>A family of heterotrimeric nucleotide-binding proteins that bind to guanine (G proteins) transduces chemical and sensory signals across the plasma membrane by sequential interactions with receptor and second messenger-generating effectors. Because of the wide array of cellular processes that are mediated by G proteins, the study of G protein function and regulation is a significant area of research in the signal transduction field. There are reports containing suggestions of an important function for G protein at cellular locations other than the plasma membrane. Certain G proteins were detected at intracellular membranes, for example, the Golgi complex, whereas others associate with cytoskeletal structures, for example, microtubules and microfilaments. The mechanisms that govern the cellular destinations of G proteins and the relative proportions of G proteins that traffic to subcellular compartment are just beginning to be revealed. G proteins are reported to couple the receptors for hormones or neurotransmitters to intracellular effectors such as adenylyl cyclase or phospholipase C. Twenty forms of the α-subunit of G proteins were identified and each is involved in the conveyance of multiple hormonal neurotransmitter signals from the outside of the cell to the effects that those hormones and neurotransmitters have on the inside of the cell. G proteins may leave the membrane in response to neurotransmitter or hormone signals, but this has been very difficult to prove. GFP, an autofluorescent protein of 238 amino acids, is a reporter molecule useful to monitor gene and protein expression and to observe the dynamics of protein movements within the living cell. Fusing GFP to another protein of interest allows time-course studies to be performed on living samples in real time. Accounts of GFP fusion proteins include receptors, secretory proteins, cytoskeleton proteins and signaling molecules. Presently, GFP fusion proteins are constructed by generating an expression construct that contains GFP fused in frame to either the N-amino or C-carboxyl terminus of the protein of interest. However, this attachment may alter the function of the protein fused with GFP consequently may not give results reflective of the natural state. |
<SOH> SUMMARY OF THE INVENTION <EOH>Fusion of a GFP protein at either NH 2 or COOH ends of Gαs protein subunits is not acceptable because the NH 2 region is important for association with Gαs protein βγ subunits, and the COOH terminal is required for interaction with receptors. Consequently, a biologically active Gαs-GFP that incorporated GFP at some other positions of the molecule was developed. Suitable regions for insertion of a GFP sequence are those regions that are free of interactions with receptors or effectors. A fusion protein was constructed by inserting an amino acid sequence of a green fluorescent protein designated GFP, into the interior of an amino acid sequence of a G-protein, in particular the Gαs protein. Although, green fluorescent proteins have been inserted at either end of G-proteins, a method was needed to insert GFP into the internal amino acid sequence of a G-protein without altering the biological activity of the protein. Green fluorescent protein (GFP) was inserted within the internal amino acid sequence of Gαs to generate a Gαs-GFP fusion protein. The fusion protein maintained a bright green fluorescence and was also identified by antibodies against Gαs or GFP, respectively. The cellular distribution of Gαs-GFP was similar to that of endogenous Gαs. Gαs-GFP was tightly coupled to the β adrenergic receptor to activate the Gαs effector, adenylyl cyclase. Activation of Gαs-GFP by cholera toxin caused a gradual displacement of Gαs-GFP from the plasma membrane throughout the cytoplasm in living cells. Unlike the slow release of Gαs-GFP induced by cholera toxin, the β adrenergic agonist isoproterenol caused a rapid partial release of Gαs-GFP into the cytoplasm. At 1 min after treatment with isoproterenol, the extent of this Gαs-GFP release from plasma membrane was maximal. Translocation of Gαs-GFP induced by isoproterenol suggested that the internalization of Gαs might play a role in signal transduction by interacting with effector molecules and cytoskeletal elements at multiple cellular sites. Uses for the Gαs-GFP fusion construct of the present invention include: 1. G proteins from the intracellular plasma membrane move in response to activation by an antagonist. Following the activation of a G protein and discovering the time course for that activation. The occupancy of a receptor by an agonist is only the first step in a signaling cascade. The intracellular processes might be activated at different rates or, at specific areas within a cell. Gαs-GFP is useful because it can be followed in real time as events take place without disrupting natural progress of events. 2. Tracking protein functions in living cells. 3. As a non-radioactive marker for high throughput screening of G-proteins coupled receptor drug targets, following the course of activation of a putative receptor or a putative ligand. For example, if a drug company has a candidate that it believes activates G protein coupled receptors in a functional sense, the Gαs-GFP fusion construct is useful as a high throughput screen, because a change in fluorescence in response to the application of an agonist is detectable. Conversely, the activity of an antagonist is visualized by adding it in 96 well plates, and screening significant numbers of samples on a fluorimeter to determine which compounds block the expected fluorescence change. Gαs-GFP could be used in combination with a fluorescent receptor such as that developed by the Biosignal Corporation in Montreal. To do this, cells are transfected with fluorescent receptors and Gαs-GFP. A ligand which activated the receptor in such a way that the G protein was also activated should decrease the fluorescence of GFP induced by the emitted light from the receptor (fluorescence resonance energy transfer-FRET). Thus, a number of candidate compounds may be screened for receptor and G protein activation by conducting these assays in e.g. 96 well plates. 4. The use of green fluorescent protein (GFP) in the study of cellular signaling allows not only the observation of G protein trafficking, but the opportunity to study the dynamics of G proteins in real time as well as their function. Other molecules may be modified in the same way, for example the other of the 20 G protein α subunits. Insertion sites for GFP are determined by an analysis of the sequence. None of the Gαs can be modified by adding GFP to either the amino or carboxy terminus because their function would be destroyed. Putting the GFP in the internal regions does not harm the effects of the protein, but rather bestows on its new properties. Several other signaling molecules may be suitable candidates for the fusion proteins of the present invention. 5. Gαs-GFP is modified in such a way that it will couple to other receptors. Modification of amino acids near the carboxy terminal generates a fluorescent Γα that is capable of coupling to receptors which normally couple to Gαi, Gαo or Gαq (Conklin, et al., 1996). This will allow the same fluorescent G protein to assess potency and efficacy of putative agonists and agonists for a large number of G protein coupled receptors. The 5 C terminal residues of Gαs are QYELL (SEQ ID NO: 3). They are replaced with DCGLF (SEQ ID NO: 4) for Gi1 or Gi2, with ECGLY (SEQ ID NO: 5) for Gi3, with RCGLY (SEQ ID NO: 6) for Go, and with EYNLV (SEQ ID NO: 7) for Gq. COS1 or HEK293 cells are suitable because they are easy to transfect. These or comparable cells are co-transfected with GFP-Gαs (either in its native form or engineered to couple to a receptor which normally couples to Gi or Gq) and the desired receptor. Putative agonists are screened by monitoring loss of fluorescence from the membrane. High-throughput fluorescence monitoring instruments that are known to those of skill in the art are used for this purpose. Putative antagonists are screened by assessing their ability to block the effects of known receptor agonists to evoke this phenomenon. |
Data conversion device, data conversion method, learning device, learning method, program and recording medium |
The present invention relates to a data conversion device and a data conversion method, in which HD image data having an image quality higher than that of the original SD image data can be obtained, to a learning device therefor, to a learning method therefor, to a program therefor, and to a recording medium therefor. A data generation section 3 generates HD image data on the basis of the class of a class tap extracted from the SD image data. On the other hand, a correction level calculation section 4 detects features of the class tap based on the class tap and the class thereof, and determines the correction level for correcting the HD image data on the basis of the features. Then, a data correction section 5 corrects the HD image data output by the data generation section 3 on the basis of the correction level. The present invention can be applied to, for example, a television receiver for receiving television broadcasting signals and displaying images. |
1. A data conversion device for converting first data into second data having a quality higher than that of said first data, said data conversion device comprising: class tap extraction means for extracting, from said first data, a class tap used to cluster said first data; clustering means for clustering, on the basis of said class tap, the class tap into one of a plurality of classes; generation means for generating said second data on the basis of the class of said class tap; correction amount calculation means for detecting the features of said class tap on the basis of said class tap and the class thereof and for determining, based on the features, the correction amount for correcting said second data generated by said generation means; and correction means for correcting said second data generated by said generation means by using said correction amount determined by said correction amount calculation means. 2. A data conversion device according to claim 1, wherein said class tap extraction means uses the sample values of a plurality of pieces of said first data as said class tap, and said generation means generates sample values of a plurality of pieces of said second data. 3. A data conversion device according to claim 1, wherein said correction amount calculation means includes feature detection means for detecting, as the features of said class tap, a first error of first representative data with regard to said first data, the first representative data representing the class of said class tap, with respect to said first data forming said class tap, and determines said correction amount on the basis of said first error. 4. A data conversion device according to claim 3, further comprising error estimation means for estimating, based on said first error, as said correction amount, a second error with respect to the true value of said second data corresponding to said class tap, of second representative data with regard to said second data, the second representative data representing the class of said class tap, wherein said correction means corrects the second data by adding said second error to said second data generated by said generation means. 5. A data conversion device according to claim 4, further comprising storage means for storing, for each of said classes, error correspondence information in which said first and second errors correspond to each other, wherein said error estimation means estimates said second error on the basis of said first error and the error correspondence information. 6. A data conversion device according to claim 1, wherein said correction amount calculation means includes feature detection means for detecting, as the features of said class tap, a first error angle representing an error in the rate of change of first representative data with regard to said first data, which represents the class of said class tap, with respect to the rate of change of said first data forming said class tap, and determines said correction amount on the basis of said first error angle. 7. A data conversion device according to claim 6, wherein said correction amount calculation means further comprises error estimation means for estimating, based on said first error, as said correction amount, a second error representing an error in the rate of change of the second representative data with regard to said second data, which represents the class of said class tap, with respect to the true value of the rate of change of said second data corresponding to said class tap, wherein said correction means corrects the second data by rotating the angle representing the rate of change of said second data generated in said generation means by said second error angle. 8. A data conversion device according to claim 7, further comprising storage means for storing, for each of said classes, error correspondence information in which said first and second error angles correspond to each other, wherein said error estimation means estimates said second error on the basis of said first error angle and the error correspondence information. 9. A data conversion device according to claim 1, wherein said clustering means includes: storage means for storing, for each of said plurality of classes, assignment information in which a class code representing the corresponding class is assigned to the first representative data with regard to said first data, the first representative data representing each class; and distance computation means for determining, based on said assignment information, the distance between said class tap and each of the first representative data of said plurality of classes and for outputting a class code assigned to said first representative data that minimizes the distance. 10. A data conversion device according to claim 1, wherein said generation means generates said second data assigned to the class of said class tap on the basis of the assignment information such that said second data is assigned to each of said plurality of classes, which assignment information is determined by learning in advance. 11. A data conversion device according to claim 1, wherein said generation means includes: storage means for storing, for each of said plurality of classes, assignment information such that a class code representing the corresponding class is assigned to the second representative data with regard to said second data, the second representative data representing each class; and output means for determining, based on said assignment information, said second representative data assigned to the class of said class tap and for outputting said second representative data as said second data. 12. A data conversion device according to claim 1, wherein said first and second data are image data. 13. A data conversion method for converting first data into second data having a quality higher than that of said first data, said data conversion method comprising: a class tap extraction step of extracting, from said first data, a class tap used to cluster said first data; a clustering step of clustering, on the basis of said class tap, the class tap into one of a plurality of classes; a generation step of generating said second data on the basis of the class of said class tap; a correction amount calculation step of detecting the features of said class tap on the basis of said class tap and the class thereof and for determining, based on the features, the correction amount for correcting said second data generated in said generation step; and a correction step of correcting said second data generated in said generation step by using said correction amount determined in said correction amount calculation step. 14. A program for allowing a computer to perform a conversion process for converting first data into second data having a quality higher than that of said first data, said program comprising: a class tap extraction step of extracting, from said first data, a class tap used to cluster said first data; a clustering step of clustering, on the basis of said class tap, the class tap into one of a plurality of classes; a generation step of generating said second data on the basis of the class of said class tap; a correction amount calculation step of detecting the features of said class tap on the basis of said class tap and the class thereof and for determining, based on the features, the correction amount for correcting said second data generated in said generation step; and a correction step of correcting said second data generated in said generation step by using said correction amount determined in said correction amount calculation step. 15. A recording medium having recorded thereon a program for allowing a computer to perform a conversion process for converting first data into second data having a quality higher than that of said first data, said program comprising: a class tap extraction step of extracting, from said first data, a class tap used to cluster said first data; a clustering step of clustering, on the basis of said class tap, the class tap into one of a plurality of classes; a generation step of generating said second data on the basis of the class of said class tap; a correction amount calculation step of detecting the features of said class tap on the basis of said class tap and the class thereof and for determining, based on the features, the correction amount for correcting said second data generated in said generation step; and a correction step of correcting said second data generated in said generation step by using said correction amount determined in said correction amount calculation step. 16. A learning device for learning correction information for determining the correction amount for correcting second data obtained by converting first data into said second data, which has a quality higher than that of said first data, said learning device comprising: learning-pair data generation means for generating learning-pair data, which is a combination of teacher data corresponding to said second data, which serves as a teacher for learning, and student data corresponding to said first data, which serves as a student for learning; clustering means for clustering said student data into one of a plurality of classes; first relationship computation means for determining a first relationship between said student data and first representative data with regard to said first data, the first representative data representing the class of the student data; second relationship computation means for determining a second relationship between teacher data corresponding to said student data and second representative data with regard to said second data, the second representative data representing the class of the student data; and learning means for learning said correction information in which said first and second relationships correspond to each other. 17. A learning device according to claim 16, wherein said first relationship computation means determines, as said first relationship, a first error, with respect to said student data, of first representative data with regard to said first data, which represents the class of said student data, and said second relationship computation means determines, as said second relationship, a second error, with respect to said teacher data corresponding to said student data, of second representative data with regard to said second data, the second representative data representing the class of said student data. 18. A learning device according to claim 16, wherein said first relationship computation means determines, as said first relationship, an angle representing a first error in the rate of change of the first representative data with regard to said first data, the second representative data representing the class of said student data, with respect to the rate of change of said student data, and said second relationship computation means determines, as said second relationship, an angle representing a second error in the rate of change of second representative data with regard to said second data, the second representative data representing the class of said student data, with respect to the rate of change of said teacher data corresponding to said student data. 19. A learning device according to claim 16, wherein said clustering means includes: storage means for storing, for each of said plurality of classes, assignment information in which a class code representing the corresponding class is assigned to the first representative data with regard to said first data, the first representative data representing each class; and distance computation means for determining, based on said assignment information, the distance between said student data and each of the first representative data of said plurality of classes and for outputting a class code assigned to said first representative data that minimizes the distance. 20. A learning device according to claim 16, wherein said first and second data are image data. 21. A learning method for learning correction information for determining a correction amount for correcting second data obtained by converting first data into said second data having a quality higher than that of said first data, said learning method comprising: a learning-pair data generation step of generating learning-pair data, which is a combination of teacher data corresponding to said second data, which serves as a teacher for learning, and student data corresponding to said first data, which serves as a student for learning; a clustering step of clustering said student data into one of a plurality of classes; a first relationship computation step of determining a first relationship between said student data and first representative data with regard to said first data, the first representative data representing the class of the student data; a second relationship computation step of determining a second relationship between teacher data corresponding to said student data and second representative data with regard to said second data, the second representative data representing the class of the student data; and a learning step of learning said correction information in which said first and second relationships correspond to each other. 22. A program for allowing a computer to perform a learning process for learning correction information for determining a correction amount for correcting second data obtained by converting first data into said second data having a quality higher than that of said first data, said program comprising: a learning-pair data generation step of generating learning-pair data, which is a combination of teacher data corresponding to said second data, which serves as a teacher for learning, and student data corresponding to said first data, which serves as a student for learning; a clustering step of clustering said student data into one of a plurality of classes; a first relationship computation step of determining a first relationship between said student data and first representative data with regard to said first data, the first representative data representing the class of the student data; a second relationship computation step of determining a second relationship between teacher data corresponding to said student data and second representative data with regard to said second data, the second representative data representing the class of the student data; and a learning step of learning said correction information in which said first and second relationships correspond to each other. 23. A recording medium having recorded thereon a program for allowing a computer to perform a learning process for learning correction information for determining a correction amount for correcting second data obtained by converting first data into said second data having a quality higher than that of said first data, said program comprising: a learning-pair data generation step of generating learning-pair data, which is a combination of teacher data corresponding to said second data, which serves as a teacher for learning, and student data corresponding to said first data, which serves as a student for learning; a clustering step of clustering said student data into one of a plurality of classes; a first relationship computation step of determining a first relationship between said student data and first representative data with regard to said first data, the first representative data representing the class of the student data; a second relationship computation step of determining a second relationship between teacher data corresponding to said student data and second representative data with regard to said second data, the second representative data representing the class of the student data; and a learning step of learning said correction information in which said first and second relationships correspond to each other. |
<SOH> BACKGROUND ART <EOH>An image processing method is known in which, regarding, for example, image data, the image data is classified (clustered) into one of a plurality of classes and a process corresponding to the class is performed. According to such an image processing method, for example, when clustering is to be performed on the basis of the activity of image data, image data having high activity, such as image data with large changes, and image data having low activity, such as flat image data, can be clustered into different classes. As a result, image processing appropriate for image data having high activity and image data having low activity can be performed thereon. According to the above-described image processing, image processing suitable for image data of a class can be performed for each image data clustered for each class. Therefore, theoretically, the larger the number of classes, the more appropriate the processing that can be performed on image data clustered into each class. However, when the number of classes becomes huge, the number of patterns of image processing performed according to the class becomes huge, and the device becomes larger. That is, for example, in the manner described above, when clustering is performed on the basis of activity, by providing the same number of classes as the number of values that the activity can take, image processing appropriate for the activity can be performed on the image data of each activity. However, for example, when N difference values of the adjacent pixels of pixels arranged in the horizontal direction are used as the activity, if the difference value is of K bits, the total number of classes becomes huge, namely, (2 K ) N . For this reason, clustering is performed by using some kind of a compression process, such as ADRC (Adaptive Dynamic Range Coding). More specifically, in the clustering using ADRC, N difference values, such as those described above, as data used for clustering (hereinafter referred to as a “class tap”), are subjected to an ADRC process, and a class is determined according to the ADRC code obtained thereby. In K-bit ADRC, for example, the maximum value MAX and the minimum value MIN of the values of the data forming the class taps are detected, DR=MAX−MIN is assumed to be a local dynamic range of a set, and based on this dynamic range DR, the values of the data forming the class taps are requantized into K bits. That is, the minimum value MIN is subtracted from the value of the data forming the class taps, and the subtracted value is divided (quantized) by DR/2 K . A bit sequence such that the K-bit values of the data forming the class taps, obtained in the above-described way, are arranged in a predetermined order is output as an ADRC code. Therefore, when the class taps are subjected to, for example, a 1-bit ADRC process, after the minimum value MIN is subtracted from each piece of data forming the class taps, the data is divided by (maximum value MAX−minimum value MIN)/2, and as a result, each piece of data is formed as 1 bit (binarized). Then, a bit sequence such that the 1-bit data is arranged in a predetermined order is output as an ADRC code. Here, the clustering can also be performed using, for example, vector quantization, in addition to an ADRC process. As described above, when clustering is performed using a compression process, the number of classes can be decreased. However, on the contrary, when compared to performing clustering without performing a compression process, detailed clustering, so to speak, cannot be performed, and there are cases in which an appropriate process cannot be performed on image data. That is, for example, image processing in which the clustering of image data is performed using vector quantization and image data is generated for each class is considered. In this case, the image data is divided into blocks of a plurality of pixels, and a vector in which, for each block, a plurality of pixels (pixel values) forming the block are components (hereinafter referred to as a “block vector” where appropriate) is formed. Furthermore, the block vector is vector-quantized using a codebook which is determined in advance, and a code (symbol) as the vector quantization result is output as a class code representing the class of the block vector. Then, image data is generated for each class code. That is, the class code is inversely quantized using the codebook, and the code vector corresponding to the class code is determined. Then, a block in which the components of the code vector are pixels is determined, and the block is arranged at the corresponding position, thereby generating image data. Here, the inverse vector quantization can be performed using the same codebook as that used in the vector quantization, and also, for example, the inverse vector quantization can be performed using a codebook differing from that used in the vector quantization. That is, the inverse vector quantization can be performed using, for example, a codebook determined using image data having an image quality higher than that of the image data used to generate the codebook used in the vector quantization. In this case, as a result of the class code being inversely vector quantized, the image data of the image quality corresponding to the image data used to generate the codebook used for the inverse vector quantization, that is, high-quality image data, is determined. However, with respect to the high-quality image data obtained by inverse vector quantization, if image data for the object of vector quantization is assumed to be low-quality image data, in the above-described image processing, block vectors among the block vectors of the low-quality image data that are vector quantized into the same class code are all inversely vector quantized into the same class code, that is, the block vector of the same high-quality image data. In other words, the code vector determined in the inverse vector quantization has a so-called quantization error. Therefore, although the image data generated in the above-described image processing may be said to be of high quality, the image quality is deteriorated by an amount corresponding to the quantization error from the point of view of the image quality of the high-quality image data used for generating the codebook for the inverse vector quantization. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 is a block diagram showing an example of the configuration of an embodiment of a data conversion device to which the present invention is applied. FIG. 2 is a flowchart illustrating processing in the data conversion device. FIG. 3 shows the relationship between SD image data and HD image data. FIG. 4 is a block diagram showing an example of the configuration of a clustering section 2 and a data generation section 3 . FIG. 5A shows an example of a codebook for clustering. FIG. 5B shows an example of a data-generating codebook. FIG. 6 is a block diagram showing an example of the configuration of a codebook learning device that determines a codebook. FIG. 7 is a flowchart illustrating processing in the codebook learning device. FIG. 8A shows an example of learning pair data. FIG. 8B shows an example of code-pair teacher information. FIG. 9 illustrates a method for generating a clustering codebook. FIG. 10A shows an SD image space. FIG. 10B shows an HD image space. FIG. 11 is a block diagram showing a first example of the configuration of a correction level calculation section 4 and a data correction section 5 . FIG. 12 is a block diagram showing a second example of the configuration of a correction level calculation section 4 and a data correction section 5 . FIG. 13 is a block diagram showing an example of the configuration of an embodiment of a correction information learning device. FIG. 14 is a flowchart illustrating processing in the correction information learning device. FIG. 15 shows an example of an error table. FIG. 16A shows an SD image space. FIG. 16B shows an HD image space. FIG. 17 shows a function for approximating an HD error distance D q . FIG. 18 shows an example of a coefficient table. FIG. 19 is a block diagram showing a third example of the configuration of a correction level calculation section 4 and a data correction section 5 . FIG. 20A shows a codebook for clustering. FIG. 20B shows an SD angle table. FIG. 21A illustrates processing in a feature extraction section 82 , a correction angle estimation section 83 , and a rotation section 91 . FIG. 21B illustrates processing in the feature extraction section 82 , the correction angle estimation section 83 , and the rotation section 91 . FIG. 21C illustrates processing in the feature extraction section 82 , the correction angle estimation section 83 , and the rotation section 91 . FIG. 21D illustrates processing in the feature extraction section 82 , the correction angle estimation section 83 , and the rotation section 91 . FIG. 22A illustrates processing in the rotation section 91 . FIG. 22B illustrates processing in the rotation section 91 . FIG. 22C illustrates processing in the rotation section 91 . FIG. 23 is a block diagram showing a fourth example of the configuration of a correction level calculation section 4 and the data correction section 5 . FIG. 24 is a block diagram showing an example of the configuration of another embodiment of a correction information learning device. FIG. 25 is a flowchart illustrating processing in the correction information learning device. FIG. 26 shows an example of an error angle table. FIG. 27 shows an example of a coefficient table. FIG. 28 is a block diagram showing a fifth example of the configuration of a correction level calculation section 4 and a data correction section 5 . FIG. 29A illustrates processing in the correction level calculation section 4 and the data correction section 5 . FIG. 29B illustrates processing in the correction level calculation section 4 and the data correction section 5 . FIG. 29C illustrates processing in the correction level calculation section 4 and the data correction section 5 . FIG. 30 is a block diagram showing an example of the configuration of an embodiment of a computer to which the present invention is applied. detailed-description description="Detailed Description" end="lead"? |
Sun visor with conducting arm for vehicles |
The sun visor comprises a plate (1) for fastening to the bodywork of the vehicle and an arm (2) mounted in a hinged manner on the base (1), which in turn constitutes the means of assembly for the eyeshade of the sun visor. The arm (2) has a pair of conductive metallic elements (9) and (9′), located approximately parallel to each other and coated by means of an over-injected material, leaving the end (10) of such metallic elements (9-9′) uncovered to be able to establish contact with strips (7) foreseen in the hole (5) wherein the arm (2) is mounted in a hinged manner, whilst the other end of such elements (9-9′) in one case appears on the exterior in a terminal length (11) and in another of shorter length and defines a terminal end (12) which is uncovered on the arm (2), to be able to establish connection with a contact established on the actual eyeshade of the sun visor, for the enabling or disabling of the electrical device which can interact with said sun visor. |
1. Sun visor with conductive arm for vehicles which being of the type of those constituted by means of two pieces hinged to each other, one as base piece for fastening to the vehicle, and another as arm mounted in a hinged manner with respect to said base, and on which arm, arranged in the form of two lengths rigidly joined to each other (either directly or with another intermediate length), is mounted the corresponding eyeshade capable of acting on a device fed electrically through connectors or terminals coming from the vehicle, is characterised in that the fastening base has a hole or neck and housings for the conductor strips associated with the supply cables coming from the vehicle, in which hole or neck is mounted the corresponding end of said arm of the sun visor; with the particularity that said arm is constituted from two conductive metallic pieces arranged lengthwise along said arm and with a certain separation between them, with an insulating coating over-injected on the former, one of the ends of said metallic pieces having a diversion which produces ends in correspondence with the length of the arm which is coupled on the base of the sun visor, which ends are uncoated on order to be able to establish contact or not with the power supply connectors of the vehicle, in accordance with the position in rotation of the arm about the corresponding axis of rotation with respect to the aforementioned base for fastening the sun visor, whilst the other end of said metallic pieces is in correspondence with the other length of the arm, on which is mounted the eyeshade of the sun visor, with the particularity that the end of the conductive rigid piece is prolonged in a length which emerges on the exterior of the arm, whilst the conductive rigid piece of shorter length and its end, after a diversion, remains uncovered on said segment of the arm, corresponding to the sun visor eyeshade, to be able to establish connection or not with a contact foreseen in the actual eyeshade, when the latter is rotated about the arm, in order to establish or not the supply to an electrical device which the vehicle incorporates, be this incorporated or not in the actual eyeshade of the sun visor. 2. Sun visor with conductive arm for vehicles, according to claim 1, characterised in that the base of the sun visor has in the hole or neck individual expansions of said neck or hole for housing the end of the mobile arm. 3. Sun visor with conductive arm for vehicles, according to claim 1 characterised in that collaterally with said lateral expansions a pair of lateral guides has been foreseen for sliding contact appendages belonging to a terminal to which are fastened the power supply cables coming from the vehicle. 4. Sun visor with conductive arm for vehicles, according to claim 1, characterised in that collaterally with the lateral expansions of the neck or hole for housing the end of the mobile arm, individual lateral guides have been foreseen for holding and sliding respective lateral projections belonging to a protective socket of the conductor strips joined to the power supply conductors. 5. Sun visor with conductive arm for vehicles, according to claim 1, characterised in that the two terminals of the conductive rigid pieces of the arm of the sun visor corresponding to the length on which the eyeshade is mounted are both constituted in the same way, both being uncovered on the segment of the arm corresponding to the eyeshade of the sun visor after the appropriate diversion, to be able to establish connection or not with a contact foreseen in the actual eyeshade, when the latter rotates with respect to the arm, in order to establish or not the supply to an electrical device. 6. Sun visor with conductive arm for vehicles, according to claim 2, characterised in that collaterally with said lateral expansions a pair of lateral guides has been foreseen for sliding contact appendages belonging to a terminal to which are fastened the power supply cables coming from the vehicle. 7. Sun visor with conductive arm for vehicles, according to claim 2, characterised in that collaterally with the lateral expansions of the neck or hole for housing the end of the mobile arm, individual lateral guides have been foreseen for holding and sliding respective lateral projections belonging to a protective socket of the conductor strips joined to the power supply conductors. |
<SOH> BACKGROUND OF THE INVENTION <EOH>At the present time different systems are known of defining a hinged sun visor assembly with electrical device, systems which comprise different elements to fulfil all the functions which are required of the corresponding pieces. As is known, in a sun visor two fundamental parts or bodies intervene, one corresponding to the base for fastening to the bodywork of the vehicle and the other corresponding to a mobile subassembly formed by a supporting arm which is mounted in a hinged manner on the aforesaid base, and an eyeshade which in turn is also mounted in a hinged manner on said supporting arm. In the sun visors with electrical device, the mobile arm has a metallic, usually hollow core, to provide rigidity and a plastic coating for aesthetic purposes and for reducing friction, so that the electrical connection between the vehicle and the sun visor is implemented by means of cables and conductors which are hidden inside the actual mobile arm. In some advanced models the conductors are over-injected constituting part of the actual mobile arm. On the other hand, the electrical connection is implemented by means of electrical connectors, it being necessary to define a male-female unit for the connection between vehicle and sun visor. The mechanical union of the sun visor with the vehicle is implemented through the base of the hinged system. The different switching devices are implemented by means of mechanisms based on conductive boards with various designs, but in all cases having a common denominator which consists in that it only has a switch function. The functions of rigidity, electrical connection, switch and hinge, in the known models of sun visors, are provided by different pieces and of different nature, requiring multiple assembly operations during the production of the sun visor, with what this implies in time, cost, risk of poor quality and lack of reliability in use, as well as that the automation of the fabrication process of the end product is made more difficult, increasing the cost of the sun visor. In a word, the current sun visors with electrical device have a series of restrictions and drawbacks which can be summarized as follows: Lack of reliability and substantial complexity of the electrical connection between the bodywork or the panel of the vehicle roof and the actual sun visor. The current means implement the functions of conductor and switch in a complex way with a high number of pieces and of assembly operations for their construction. Switch functions not integrated in the mobile arm. |
Implant for use in aesthetic regions of the mouth |
The implantable portion of the implant body includes a bone engaging surface (40) which, is spaced from the upper side of the implant body by a smooth coronal surface (42). The edge (62) of the bone engaging surface follows the crestal outline of the supporting bone tissue. The bone engaging surface could include (a) an externally threaded portion, (b) an acid etched, physically abraded or other roughened or textured peripheral surface, (c) a porous coated surface which for example, could consist of titanium, metal or ceramic beads and/or (d) a chemically coated portion. Chemical coatings for use with the bone engaging surface could comprise bioreactive coatings, (including coatings formed from hydroxyapatile and other compounds suitable for stimulating bone tissue growth) which facilitate the anchoring of the implant body by bone tissues following its placement. |
1. A dental implant for use in replacing a missing tooth in a patient's jaw bone comprising, an implant body adapted to be at least partially recessed into a portion of said patient's jaw bone, said implant body extending longitudinally along an axis from a distalmost apex to a proximal end portion, a bone engaging surface provided about at least a portion of a peripheral surface of said implant body, said bone engaging surface selected to promote bone tissue ingrowth or attachment thereto and extending longitudinally along said periphery of said implant body to a proximal edge spaced towards said proximal end portion, wherein at least a portion of said proximal edge having a contour selected to generally follow a crestal surface contour of preselected bone tissues. 2. An implant as claimed in claim 1 further including an abutment for supporting a prosthesis thereon, said implant body including an attachment mechanism for securing said abutment to said proximal end portion. 3. An implant as claimed in claim 1 wherein said bone engaging surface is selected from the group consisting of a porous coated surface, a textured surface, an externally threaded surface and a biochemically coated surface. 4. An implant as claimed in claim 1 wherein said implant body is sized for insertion in an anterior region of said patient's mouth. 5. An implant as claimed in claim 1 wherein said implant body includes a generally cylindrical portion, said bone engaging surface extending about a periphery of at least part of said cylindrical portion. 6. An implant as claimed in claim 1 wherein said implant body is generally frustoconical in shape, said body tapering from said proximal end portion towards said apex at an angle of between 1 and 20 degrees. 7. An implant as claimed in claim 6 wherein said implant body tapers at an angle of about 5 degrees. 8. An implant as claimed in claim 1 wherein said implant body includes a tapered portion, said tapered portion narrowing in diameter towards said apex at an angle of between about 1 and 20 degrees. 9. An implant as claimed in claim 1 wherein said implant body further comprises orienting means to assist in orienting said implant body with the contour of the proximal edge substantially aligned with the contour of the crestal surface of said patient's jaw bone, said orienting means selected from the group consisting of visual indicia, grooves, stamped markings, and guide members. 10. A dental implant as claimed in claim 1 wherein said implant body includes a generally smooth peripheral portion intermediate said bone engaging surface and said proximal end portion. 11. A dental implant for use in replacing a missing tooth in a patient's jaw bone comprising, an implant body portion adapted to be recessed into a portion of said patient's jaw bone, said implant body extending longitudinally along an axis from a distalmost apex to a proximal end portion, a bone engaging surface providing a peripheral surface of said implant body, said bone engaging surface selected to promote bone tissue ingrowth or attachment thereto and extending longitudinally along said periphery of said implant body to a proximal edge spaced towards said proximal end portion, wherein the proximal edge of the bone engaging surface has a contour selected to generally follow a crestal surface contour of a pre-selected jaw bone adjacent said missing tooth. 12. An implant as claimed in claim 11 wherein said bone engaging surface extends longitudinally substantially from said apex a distance proximate to said proximal end portion. 13. An implant as claimed in claim 12 wherein said bone engaging surface comprises a porous surface. 14. An implant as claimed in claim 13 wherein said porous surface has a porosity selected at between about 20 and 800 microns. 15. An implant as claimed in claim 11 wherein said bone engaging surface comprises an externally threaded surface. 16. An implant as claimed in claim 11 wherein said bone engaging surface comprises a biochemically coated surface. 17. An implant as claimed in claim 16 wherein said biochemically coated surface comprises a coating selected from a hydroxyapatite coating and a calcium hydroxyapatite coating. 18. An implant as claimed in claim 11 wherein said implant body includes a generally smooth peripheral portion intermediate said bone engaging surface and said proximal end portion. 19. An implant as claimed in claim 18 wherein said bone engaging surface is selected from the group consisting of a porous surface, a textured surface, a threaded surface and a biochemically coated surface. 20. An implant as claimed in claim 11 wherein said pre-selected jaw bone comprises the jaw bone of a healthy human. 21. An implant as claimed in claim 11 wherein said pre-selected jaw bone comprises the jaw bone of said patient. 22. A dental implant for use in replacing a natural tooth in a patient's jaw bone comprising, an implant body extending longitudinally along an axis from a lowermost apex to an upper end portion and including, a bone engaging surface providing a peripheral surface of said implant body adapted to be recessed into said patient's jaw bone, said bone engaging surface selected to promote bone tissue ingrowth or attachment thereto and extending longitudinally along said periphery of said implant body substantially from said apex to an upper edge spaced towards said upper end portion, wherein the upper edge of the bone engaging surface has a contour selected to generally follow a crestal surface contour of healthy bone tissues at a site of implant placement, and a smooth peripheral portion intermediate said bone engaging surface and said upper end portion, and an abutment for supporting a prosthesis thereon. 23. The implant as claimed in claim 22 wherein said implant body is generally frustoconical in shape tapering inwardly towards said apex at an angle of between about 2 and 10 degrees, and said bone engaging surface comprises a porous coated surface. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Conventional implant constructions are generally of a two-part design and include a body portion which is adapted to be recessed into the patient's jaw, and a prosthesis in the form of a ceramic tooth which is adapted for coupling to a proximal end of the body. The implantable body which is made from stainless steel, titanium or other suitable metals or alloys is configured to be recessed into a suitable bore hole formed in the patient's jaw bone at the site of a lost tooth. Typically, the body has a threaded interior or is otherwise configured to mechanically receive thereto an attachment post which serves as a support for the ceramic tooth. U.S. Pat. No. 5,344,457 to Pilliar et al., entitled “Porous Surfaced Implant”, discloses a frustoconical shaped implant which is characterized by a porous coated bone engaging lower portion and a smooth non-porous upper bone attachment region or collar. The implant is press-fitted into a complementary sized bore formed in the patient's jaw bone at the site of placement and over time, bone tissues grow into and engage the porous coating on the lower portion of the implant to firmly anchor it in the place of a natural tooth. The implant which is the subject of U.S. Pat. No. 5,344,457 has achieved a significant degree of success in the market place, and is presently sold by Innova Corp. of Toronto, Canada, under the name Endopore®. Endopore® dental implants are used in the replacement of various teeth including, lost molars and bicuspid teeth in the anterior and posterior regions of the mouth. Other conventional implant constructions are characterized by the implantable body being cylindrical in shape and provided with a roughened lower exterior surface, texture, external thread configuration and/or coating, to facilitate the engagement of the implant body with the patient's surrounding bone tissues and its anchoring in place. A difficultly exists with conventional implants in that todate, they have achieved limited success in replacing incisors and teeth in the frontal-most regions of the mouth where high aesthetic demands exist. The abutment-implant interface, also termed “microgap”, is believed to harbor bacteria and bacterial products following exposure to the oral environment. This in turn results in the establishment of a “biological width” around the implant (i.e. the distance from the peri-implant bone crest to the microgap). The biological width is relatively constant and seems to be approximately 2 mm, similar to the biological width present around natural teeth. It has been found that following implantation, crestal bone remodeling occurs, whereby supporting bone tissues and the overlying bone tissues tend to recede to the uppermost peripheral edge of the textured or porous coated bone engaging portion of the implant body. A further variable that can play a role in crestal bone remodeling is lack of mechanical coupling around any smooth upper collar surface. For example, it has been demonstrated that the crestal bone resorption around Endopore® implants stops at the junction of the smooth collar and the porous surface. It has been suggested that the lack of mechanical coupling around the smooth collar surface results in “disuse atrophy” of the crestal bone to the level of the junction with the porous surface. This has been demonstrated also with other textured implant surfaces. The receding supporting tissues or crestal bone loss around dental implants has led to an aesthetic challenge when attempting dental restorations in that it may result in exposure of the metal implant body, greatly detracting from the natural appearance of the prosthesis. Conventional implants suffer the disadvantage in that the alveolar bone which encases the tooth root tends to gradually disappear along the portion of the implant where engagement of bone tissue with the implant body does not occur. This leads to a corresponding recession of the sulcus and overlying gum tissues which gradually results in the exposure of the stainless steel body of the implant. In the more aesthetically important regions of the mouth, the exposure of the stainless steel portion of the implant body greatly detracts from the natural look of the prosthesis. This problem is particularly pronounced in the anterior regions of the mouth and when using two implants positioned adjacent to each other. Loss of inter-implant bone height (as a result of the normal crestal bone remodeling that is associated with each of the implants) results in the absence of a papilla between the two implants due to lack of bone support. This creates an aesthetic deformity, often termed “black triangle”, between the two implant crowns. “Black triangles” are particularly visible when present in the maxillary anterior region and the patient has a high lip line. The patient's perception of a successful implant-supported prosthesis depends not only on restoring function, but also on restoring normal anatomy and aesthetics. The lack of a papilla and the presence of a “black triangle” can lead to patients' dissatisfaction with the whole implant treatment, even with patients having a low smile line. Heretofore, the dental profession has been forced to come up with techniques to deal with “black triangles”. Most commonly, pink acrylic or porcelain is added to the final restoration to replace the missing papilla. This solution is far from ideal since it is impossible to replicate the gingival tissue with acrylic or porcelain in terms of texture and colour. Several attempts have also been made in establishing surgical procedures that will regenerate the missing papilla; however, these procedures are very unpredictable and seldom result in 100% regeneration. Conventional implants are poorly suited to accommodate for the crestal bone remodeling which occurs with implants. With conventional implant designs, most often any bone engaging textured, porous or coated surface extends downwardly from an uppermost radial edge surface which is located a constant distance from the lower apex of the body. Conventional implant designs suffer the disadvantage that they fail to account for the fact that with natural incisor teeth, the surface contour of healthy supporting bone tissues tends to be higher along the distal and medial surfaces of the tooth than along the lingual and buccal regions. Heretofore, the bone engaging regions for conventional implants have either been limited by the lowermost extent of expected bone recovery, weakening the integrity of the dental implant attachment, or suffer the disadvantage that the lingual and buccal portions of the implantable portion of the implant body may be visible at the patient's gum line. |
<SOH> SUMMARY OF THE INVENTION <EOH>To at least partially overcome the disadvantages of the prior art, the present invention seeks to provide an implant which includes an implantable body portion adapted to be at least partially recessed within a patient's alveolar bone, and which has a peripheral surface portion which is configured to stimulate and/or facilitate the engagement of bone tissues with the implant. In a healthy jaw, the root of the tooth is supported by alveolar bone, with lamellated bone surrounding the root of the tooth where periodontal ligament fibres attach. The shape and crestal outline of interdental bone will to a large extent depend upon the shape and size of the tooth roots, with the distance from the crest of the alveolar bone to the cementoenamel junction of the tooth in a healthy periodontium being about 2 mm and a healthy sulcus extending about 0.5 mm. The present implant construction preferably seeks to stimulate osteoblasts, namely the bone forming cells, so as to promote bone ingrowth into and otherwise engage the implantable portion of the implant, with the crestal surface of the regrown bone tissues substantially mirroring that of a healthy tooth, to firmly anchor the implant in place. Another object of the invention is to provide an improved dental implant body for use in the anterior regions of the mouth, and which provides bone engaging regions along one or more of the distal and/or mesial implant surfaces which are elongated relative to bone engaging regions on the lingual and/or buccal surfaces of the implant body. Another object of the invention is to provide an implant body configuration which is configured to stimulate crestal bone tissue remodeling to a normal pre-implant height. Another object of the invention is to provide a dental implant body which has a bone engaging porous, textured, threaded and/or coated exterior surface, which is applied to the peripheral surface of the implant body in a configuration which reflects the actual or a preselected optimum contour of the crest of the alveolar bone and/or lamellated bone tissues at the site of implant placement. The implantable portion of the implant body could for example include about all or only part of its periphery, a bone engaging surface which, when the implant body is fully seated within the patient's jaw bone, extends from a distal portion of the implant body to a remote proximal-most edge. The proximal-most edge has a contour selected to generally follow a predetermined crestal outline of the supporting bone tissue. The bone engaging surface could take a number of possible forms including without restriction: an externally threaded portion, in which the proximal-most thread patterns are configured to generally follow the surface contour of alveolar and/or lamellated bone; an acid etched, physically abraded or other roughened or textured peripheral surface of the implant body; a porous coated surface which, for example, could consist of titanium, metal or ceramic beads and/or a chemically coated portion. Suitable chemical coatings for use with the bone engaging surface would typically comprise bioreactive coatings, including coatings formed from hydroxyapatite and other compounds suitable for stimulating bone tissue growth, and which facilitate the anchoring of the implant body by bone tissues following its placement. The predetermined crestal outline could by way of non-limiting example, be selected as a crestal outline of the patient's own alveolar and/or lamellated bone tissues at the site of implant placement or at the site of one or more of the patient's own teeth, or the crestal outline of alveolar and/or lamellated bone tissues of a typical healthy jaw, and more preferably the crestal outline at the site of or proximate to the intended site of implant placement. The bone engaging portion of the implant body could, for example, consist of a narrow band between the proximal exposed end of the implant body, and the distalmost end tip of the implant which is recessed into the patient's jaw. The bone engaging portion may further extend partially or completely about the circumference of the implant body. More preferably, however, the bone engaging region extends from approximately adjacent to the distalmost apex of the implant body to a proximal edge surface which, following placement of the implant body, approximately coincides with the crest of the alveolar bone of either the patient's missing tooth or a healthy tooth. In one aspect, the “aesthetic implant” design features of the present invention are therefore based on the principles governing peri-implant crestal bone loss, and aim at maintaining the interproximal bone at a level that is coronal to the buccal and lingual bone levels. In one simplified construction, the implant is designed to be inserted in a single stage surgery, thereby ensuring adequate biological width between the microgap and the crest of the bone. Although not essential, the implant body could be generally frustoconical in shape and, for example, be provided with a porous coated and/or textured bone engaging exterior surface which is designed to be “press-fit” in a specific buccal/lingual and mesial/distal orientation. In such an embodiment, the invention is directed to an improved dental implant which is suitable for use in aesthetic regions of the mouth, including as replacement for upper incisor teeth, and may be developed as a modification of the Endopore® implant disclosed in U.S. Pat. No. 5,344,457. The implantable portion of the implant may optionally be provided with a smooth upper collar portion which, for example, is provided to prevent or minimize the accumulation of oral bacteria. The smooth collar portion could, in a first embodiment, be provided as a smooth band which extends from the proximal edge of the bone engaging surface to a proximal end of the implant body which is provided with a substantially constant width, extending from the bone engaging surface to a contoured implant end surface which also follows the general contour of the crestal surface of the alveolar bone. In an alternate embodiment, the smooth collar of the implant body could extend from the proximal-most edge of the lower bone engaging portion to a generally flat proximal implant body surface. In another construction, the present invention seeks to provide an improved cylindrical implant body which is characterized by a bone engaging portion which, by way of non-limiting example, could comprised helical threads, ribs and/or a roughened implant surface formed by grit blasting and/or acid etching. The bone engaging portion most preferably extends from a lowermost distal end of the implant to a contoured upper edge which at least generally follows the contour of the patient's crestal bone or a pre-selected typical contour of healthy bone tissue at the site where the implant is to be used. A further construction of the invention provides an improved implant coating which is selected to provide enhanced engagement between the bone tissue and the implant body, and which for example could comprise a hydroxyapatite or other dentally active coating used to facilitate the anchoring of the implant in situ in a patient's jaw. The dentally active coating is applied about at least part of the circumference of the implant body, and depending upon the intended site of implant placement, extends from a distalmost end portion of the implant body to a proximal-most edge. The coating is applied so as to be elongated along one or more of the lingual, distal mesial and/or buccal sides of the implant body. More preferably, the coating is applied such that its proximal edge of the coating generally mirrors the typical crestal surface contour of either the patient's own or healthy bone tissues at the site at which the implant is to be used. It is envisioned that the dental implant could also be placed in the patient's alveolar bone in two stages. During the first stage surgery, the implant body is submerged into a complementary size bone formed in the bone to the level of a proximal end cap or platform used as a temporary cover over the proximal end of the implant. Following initial placement, a period of time is provided to allow bone tissue regrowth so as to grow into and engage the bone engaging surface and firmly anchor the implant body in place. As a next stage the proximal end platform is removed, and an abutment and suitable prosthesis are then coupled to the proximal end of the implant body in a mechanical and/or chemically bonded fit arrangement. Accordingly, in one aspect the present invention resides in a dental implant for use in replacing a missing tooth in a patient's jaw bone comprising, an implant body adapted to be at least partially recessed into a portion of said patient's jaw bone, said implant body extending longitudinally along an axis from a distalmost apex to a proximal end portion, a bone engaging surface provided about at least a portion of a peripheral surface of said implant body, said bone engaging surface selected to promote bone tissue ingrowth or attachment thereto and extending longitudinally along said periphery of said implant body to a proximal edge spaced towards said proximal end portion, wherein at least a portion of said proximal edge having a contour selected to generally follow a crestal surface contour of preselected bone tissues. In another aspect, the present invention resides in a dental implant for use in replacing a missing tooth in a patient's jaw bone comprising, an implant body portion adapted to be recessed into a portion of said patient's jaw bone, said implant body extending longitudinally along an axis from a distalmost apex to a proximal end portion, a bone engaging surface providing a peripheral surface of said implant body, said bone engaging surface selected to promote bone tissue ingrowth or attachment thereto and extending longitudinally along said periphery of said implant body to a proximal edge spaced towards said proximal end portion, wherein the proximal edge of the bone engaging surface has a contour selected to generally follow a crestal surface contour of a pre-selected jaw bone adjacent said missing tooth. In a further aspect, the present invention resides in a dental implant for use in replacing a natural tooth in a patient's jaw bone comprising, an implant body extending longitudinally along an axis from a lowermost apex to an upper end portion and including, a bone engaging surface providing a peripheral surface of said implant body adapted to be recessed into said patient's jaw bone, said bone engaging surface selected to promote bone tissue ingrowth or attachment thereto and extending longitudinally along said periphery of said implant body substantially from said apex to an upper edge spaced towards said upper end portion, wherein the upper edge of the bone engaging surface has a contour selected to generally follow a crestal surface contour of healthy bone tissues at a site of implant placement, and a smooth peripheral portion intermediate said bone engaging surface and said upper end portion, and an abutment for supporting a prosthesis thereon. |
Method for managing sessions between network parties, methods, network element and terminal for managing calls |
The invention relates to a management of sessions between parties being connectable with a network. Thereby a first party registers to the network and invites a second party to a session. It is determined from a session information whether said session is to be retained by the network. The retaining comprises storing at least part of the session information for a subsequent re-establishment or release of the session by the network on behalf of said first party, releasing said retained session by the network towards the second party on behalf of the first party, when the first party deregisters from the network or loses connection to the network, re-establishing the retained session by the network towards the second party on behalf of the first party, when the first party repeatedly registers to said network or re-establishes connection with said network. Furthermore, the invention relates to methods and a network element for managing multiple simultaneous sessions between parties participating in one or a plurality of calls and to a corresponding terminal. |
1. A method for managing sessions between parties being connectable to a network comprising the steps of: a first party registering to said network, said first party inviting a second party, to a session, determining from a session information relating to said session whether said session is to be retained by the said network, said retaining comprising storing of at least part of said session information for a subsequent re-establishment or release of the said session by said network on behalf of said first party, releasing said retained session by said network towards said second party on behalf of said first party, when said first party deregisters from said network or loses connection with said network, re-establishing said retained session by said network towards said second party on behalf of said first party, when said first party repeatedly registers to said network or re-establishes connection with said network. 2. A method according to claim 1, wherein said registering step triggers said re-establishing of all retained sessions on behalf of said first party by said network. 3. A method according to claim 1, wherein responses relating to said re-establishing of all said retained sessions are collected by said network into a single response to said first party. 4. A method according to claim 1, wherein at least said first party of said parties is a terminal, in particular a mobile terminal. 5. A method according to claim 1, wherein at least said second party, is a session initiation protocol (SIP) signalling entity. 6. A method according to claim 5, wherein said session initiation protocol (SIP) signalling entity is a group call server, or a session initiation protocol (SIP) terminal. 7. A method according to claim 1, wherein said determining from said session information relating to said session whether said session is to be retained is based on an indicator carried in a response message to an invitation message for inviting a party to a session. 8. A method according to claim 1, wherein said determining from said session information relating to said session whether said session is to be retained is based on an analysis of session information such as the identity of the said second party. 9. A method according to claim 1, wherein said stored at least part of said session information is deleted when said first party leaves said session. 10. A method according to claim 1, wherein said method is used for managing multiple simultaneous sessions between parties participating in one or a plurality of calls, and wherein each of said parties is destined for being in respective sessions with all of the other parties or at least some of the other parties, at least the sessions between a first party and further parties being respectively divided in a first subsession between said first party and a network element, and a second subsession between said network element and a call signaling entity serving a group call with at least one of said further parties, thereby combining first subsessions in a combined session between said first party and said network element in a combined session and/or second subsessions between said network element and said call-signalling entity in a combined session. 11. A method according to claim 10, wherein said combining step of combining second subsessions involves combining of media streams from second subsessions between said network element and at least one of said further parties into a single media stream relating to the first subsession between said first party and said network element. 12. A method according to claim 11, wherein said media stream combining is performed by a media proxy in association with said network element. 13. A method according to claim 10, wherein said call signaling entity is a group call server. 14. A method according to claim 10 wherein said call signaling entity is a session initiation protocol (SIP) proxy associated with one of said parties. 15. A method according to claims 1, wherein said method is used for managing multiple simultaneous session between parties participating in one or a plurality of group calls, and wherein each of said parties are destined for being in respective sessions with all of the other parties or at least some of the other parties, at least the sessions between a first party and further parties being respectively divided in sessions between a first party and further parties being respectively divided in a first subsession between said first party and a network element, and a second subsession between said network element and a group call server serving a group call with at least one of said further parties, thereby combining first subsessions in a combined session between said first party and said network element. 16. A method according to claim 15, wherein multiple sessions being initiated by said first party with a single combined message transmitted, from said first party to said network element, said combined message combining message content for said group call server thereby transmitting shared content in said combined message just once. 17. A method according to claim 16, wherein said network element splitting said combined message into multiple messages, whereby each of said multiple messages being respectively sent from said network element to one of a plurality of group call servers. 18. A method according to claim 17, wherein each of said multiple messages being a) either an individual message containing message content for one of the further parties only or b) a further combined message containing message content for a plurality of further parties. 19. A method according to claim 15, wherein said network element collecting response messages sent from said group call servers in response to a requests message from said party, combining content of said response messages, thereby eliminating repeated content and generating a still further combined message, and transmitting said still further combined message to said first party. 20. A method according to claim 15, wherein said network element storing information in a register; said information indicating remembered sessions for parties. 21. A method according to claim 20, wherein said network element determining in response to a message of a registering party whether there are remembered sessions for said party and if there are remembered sessions sending messages to each group call server of the parties of said remembered sessions. 22. A method to claim 15, wherein a party or a group call server inserting information into a message indicating whether a particular session should be remembered or not. 23. A method according to claim 22, wherein said information being inserted by means of an additional message header or an optional parameter to an existing message header. 24. A method to claim 15, wherein said sessions, subsessions and/or messages are session initiation protocol (SIP) sessions, subsessions and/or messages. 25. A network element for managing multiple simultaneous sessions between parties participating in one or a plurality of calls or group calls, wherein each of said parties are destined for being in respective sessions with all of the other parties or at least one or some of the other parties, said network element comprising separating means for separating respectively at least the sessions between a first party and further parties in a first subsession between said first party and said network element, and a second subsession between said network element and a call signaling entity or group call server serving a call or group call with at least one of said further parties, wherein first subsession between said first party and said network element are combined in a combined session and/or second subsessions between said network element and a call-signalling entity or group call server are combined in a combined session. 26. A network element according to claim 25, comprising a register storing information about existing group calls to which parties have joined. 27. A network element according to claim 25, comprising splitting means for splitting said combined message into multiple messages and for sending each of said multiple messages respectively to one of a plurality of group call servers. 28. A network element according to claim 25, comprising collecting means for collecting response messages sent from said group call servers in response to request message from said first party, said collecting means being designed for eliminating repeated content and generating a still further combined message to be sent to said first party. 29. A network element according to claim 25, comprising a group service. 30. A network element according to claim 25, comprising call state control function, in particular proxy call state control function. 31. (Cancelled) 32. A terminal for use in a method according to claim 1 comprising: combining means for combining messages to be sent from said first party via a network element; and one or more call-signalling entities or group call servers to further parties in a combined message for use in a combined session, and splitting means for splitting combined messages to be received from a network element being transmitted from one or more call-signalling entities or group call servers into a number of messages. 33. A terminal according to claim 31, wherein said combining means being designed for eliminating repeated message content. |
<SOH> BACKGROUND OF THE INVENTION <EOH>In 3GPP (3rd Generation Partnership Project) as UMTS (Universal Mobile Telecommunications Systems) SIP (Session Initiation Protocol) is used to establish multimedia sessions or calls e. g. VoIP (Voice over Internet Protocol) sessions. SIP is generally described e.g. in “SIP: Session Initiation Protocol” by Handley/Schulzrinne/Schooler/Rosenberg; Internet Engineering Task Force SIP WG; internet-draft: ietf-sip-rfc2543bis-02 dated Nov. 24, 2000. A multimedia session is defined as a set of a multimedia sender and a multimedia receiver whereby data streams flowing from the sender to the receiver. Multimedia sessions include internet multimedia conferences, internet telephone calls and multimedia distribution. SIP is a request-response control (signalling) protocol for initiating, maintaining and terminating sessions between terminals. SIP is an application level protocol which is used in packet switched environments, e. g. GPRS (General packet radio service) systems, UMTS or packet cable (USA cable modem standard) systems. SIP can be used in any reliable or unreliable protocol including UDP (User Datagram Protocol), SCTP (Stream Control Transmission Protocol) and TCP (Transmission Control Protocol). SIP uses SIP messages to negotiate between the participants of a SIP session, i.e. between parties or terminals. SIP, however, is not only used for sessions between two parties but also for group calls, such as conference calls. In a group call all parties can in turn talk or send videos and listen to each other. A group call is used in various activities in which several users participate, e.g. when a whole group must continuously be aware of the progress of events. Such group calls as well as automatic group call services can be implemented on top of SIP standards, such as the implementation of PMR (Private Mobile Radio) over SIP. When a terminal registers to a network it is determined whether there are existing or remembered group calls for that party or terminal. If there are such remembered group calls SIP INIVITE messages are sent to the other participants of such a group call in order to set up SIP sessions with each of the other terminals. However, SIP requires some amount of signalling for each SIP session set-up. For applications where the SIP user agent of a party or terminal is involved in many sessions and/or in many group calls that are typically long lasting, where the user terminal can be frequently powered on and off, and/or network capacity between the terminals' SIP user agents and the network is scarce or needs otherwise to be preserved, the amount of session related signalling as to the known SIP implementations may be too much. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is therefore an object of the present invention to optimize signalling between a between parties connectable with a network. This object is achieved by a method for managing sessions between parties being connectable to a network comprising the steps of: a first party registering to said network, said first party inviting a second party to a session, determining from a session information relating to said session whether said session is to be retained by the said network, said retaining comprising storing of at least part of said session information for a subsequent re-establishment or release of the said session by said network on behalf of said first party, releasing said retained session by said network towards said second party on behalf of said first party, when said first party deregisters from said network or loses connection with said network, re-establishing said retained session by said network towards said second party on behalf of said first party, when said first party repeatedly registers to said network or re-establishes connection with said network. This object is further achieved by a method for managing multiple simultaneous sessions between parties participating in one or a plurality of calls, in particular by using a method according to any one of the preceding claims, wherein each of said parties are destined for being in respective sessions with all of the other parties or at least one of the other parties, at least the sessions between a first party and further parties being respectively divided in a first subsession between said first party and a network element, and a second subsession between said network element and a call-signalling entity serving a call with at least one of said further parties, thereby combining first subsessions between said first party and said network element in a combined session and/or second subsessions between said network element and said call-signalling entity in a combined session. This object is further achieved by a method for managing multiple simultaneous sessions between parties participating in one or a plurality of group calls, wherein each of said parties are destined for being in respective sessions with all of the other parties or at least some of the other parties, at least the sessions between a first party and further parties being respectively divided in a first subsession between said first party and a network element, and a second subsession between said network element and a group call server serving a group call with at least one of said further parties, thereby combining first subsessions in a combined session between said first party and said network element. Furthermore, the above object is achieved by a network element for managing multiple simultaneous sessions between parties participating in one or a plurality of calls or group calls, wherein each of said parties are destined for being in respective sessions with all of the other parties or at least one or some of the other parties, said network element comprising separating means for separating respectively at least the sessions between a first party and further parties in a first subsession between said first party and said network element, and a second subsession between said network element and a call-signalling entity or group call server serving a call or group call with at least one of said further parties, wherein first subsessions between said first party and said network element are combined in a combined session and/or second subsessions between said network element and a call-signalling entity or group call server are combined in a combined session. Furthermore the above object is achieved by a party for use in such a method comprising: combining means for combining messages to be sent from said first party via a network element and one or more call-signalling entities or group call servers to further parties in a combined message for use in a combined session, and splitting means for splitting combined messages to be received from a network element being transmitted from one or more call-signalling entities or group call servers into a number of messages. The invention optimizes the signalling, in particular SIP signalling between a party or terminal participating or entering one or a plurality of group calls and a network. Furthermore, the invention enables to expedite call set-up procedures for parties or terminals, in particular mobile stations. The invention is particularly advantageous when there are multiple groups and only a narrow-band transmission resource is available for signalling such as in mobile networks, in particular in packet switched networks such as UMTS or GPRS (General Packet Radio Service) networks. Furthermore, User Agent set-up delay can be minimized, so that a party or terminal may start using sessions much faster compared to prior art solutions. Preferably, the above mentioned combining step of combining second subsessions involves combining of media streams from second subsessions between said network element and at least one of said further parties into a single media stream relating to the first subsession between said first party and said network element. In particular the media stream combining is performed by a media proxy in association with said network element. Preferably, the call signalling entity is a group call server and the call signalling entity is a session initiation protocol (SIP) proxy associated with one of the parties. The media proxy terminates from one end the media streams related to the second subsessions and the media stream related to the first subsession. Preferably, a media proxy moves packets between the media streams related to the second subsessions and media stream associated with the first subsession. Preferably, multiple sessions are initiated by the above mentioned first party with a single combined message that is transmitted from the first party to the network element, whereby that combined message combines message content for the group call server, thereby transmitting shared content in said combined SIP message just once. Thus signalling and session set-up time as well as network capacity and bandwidth in uplink is saved. Preferably, the network element is collecting response messages sent from other group call servers in response to a request message from the first registering party, thereby combining content of the response messages and eliminating repeated content and generating a further combined message that is transmitted from the network element to the registering party. Thus, this party sees only a single session towards the network element. When the set-up has been performed, the party is notified of the establishment of all the sessions with the other parties/participants via the network element. The call completion success of all calls is then reported to the registering party using a single message. A benefit thereof is that the network element can send a unified response message to the registering party indicating (re-)establishment of remembered sessions, thereby saving signalling and session set-up time as well as network capacity and bandwidth in downlink. Preferably, the network element comprises a register for storing information indicating remembered sessions for parties. Thus, information about existing group calls to which parties have joined is available from the network element for the parties. The register is meaningful and possible due to the home network control paradigm of 3GPP. The register assists the network element in remembering session set-up parameters for the sessions and thus the network element can act as a proxy for the parties. Furthermore, it is preferred that the network element determines in response to a message of a registering party whether there are remembered sessions for that party and if there are remembered sessions, sending messages to each group call server of the parties of said remembered sessions. Thus, the register effects registration and call set-up in the way that when a subscriber terminal registers to the network, it is automatically (re-)connected to the group calls it belongs to. This means that when e.g. a SIP REGISTER message is received from the network element, the network element starts immediately the set-up of a group call or group calls to the appropriate group call server(s) by sending multiple SIP INVITE messages. Further advantageous developments are defined in the dependent claims. |
Phosphorothioate antisense heparanase oligonucleotides |
The present invention provides antisense phosphorothioate oligonucleotides that specifically inhibit the translation of heparanase. The invention also provides various methods of reducing angiogenesis and metastasis of tumors in a subject using said antisense phosphorothioate oligonucleotides. Finally the invention provides pharmaceutical compositions comprising the said antisense phosphorothioate oligonucleotides as active ingredients. |
1. An oligonucleotide having a sequence complementary to a sequence of a ribonucleic acid encoding a heparanase, wherein: (a) the oligonucleotide hybridizes with the ribonucleic acid under conditions of high stringency and is between 10 and 40 nucleotides in length; (b) the internucleoside linkages of the oligonucleotide comprise at least one phosphorothioate linkage; and (c) hybridization of the oligonucleotide to the ribonucleic acid inhibits expression of the heparanase, wherein inhibition of heparanase expression means at least a 50% reduction in the quantity of heparanase as follows: (a) a T24 bladder carcinoma cell is exposed to a complex of the oligonucleotide and lipofectin at an oligonucleotide concentration of 1 μM and a lipofectin concentration of 10 μg/ml for 5 hours at 37° C., (b) the complex is completely removed after such exposure, (c) 19 hours later the cell is scraped, washed and extracted in lysis buffer, (d) the nucleus of the cell is removed by centrifugation, (e) the cytoplasmic proteins in the resulting supernatant are separated according to mass by sodium dodecyl sulphate polyacrylamide gel electrophoresis, (f) the protein is transferred to a polyvinylidene difluoride membrane that is incubated at room temperature for 1-2 hours in incubation solution (g) the membrane is exposed to 1 μg/ml of an antibody directed against heparanase at 4° C. for 12 hours, (h) the membrane is exposed to wash buffer and incubated for 1 hour at room temperature in blocking buffer comprising a 1:3,000 dilution of a peroxidase-conjugated secondary antibody directed against an epitope on the antibody directed against heparanase, (i) the membrane is exposed to a chemiluminescent cyclic diacylthydrazide and the oxidation of the cyclic diacylthydrazide by the peroxidase is detected as a chemiluminescent signal, and (j) the signal is quantitated by laser-scanning densitometry as a measure of the amount of heparanase expressed calculated as a percentage of heparanase expression in an untreated cell. 2. The oligonucleotide of claim 1, wherein the oligonucleotide comprises deoxyribonucleotides. 3. The oligonucleotide of claim 1, wherein the oligonucleotide comprises ribonucleotides. 4. The oligonucleotide of claim 1, wherein every internucleoside linkage is a phosphorothioate linkage. 5. The oligonucleotide of claim 1, wherein the oligonucleotide is between 15 and 25 nucleotides in length. 6. The oligonucleotide of claim 1, wherein the oligonucleotide is about 20 nucleotides in length. 7. The oligonucleotide of claim 1, wherein the sequence of the oligonucleotide is selected from the following: (a) CCCCAGGAGCAGCAGCAGCA; (SEQ ID NO:3) (b) GTCCAGGAGCAACTGAGCAT; (SEQ ID NO:4) and (c) AGGTGGACTTTCTTAGAAGT. (SEQ ID NO:5) 8. The oligonucleotide of claim 1, wherein the oligonucleotide further comprises a modified internucleoside linkage. 9. The oligonucleotide of claim 8, wherein the modified internucleoside linkage is a peptide-nucleic acid linkage, a morpholino linkage, a phosphodiester linkage or a stereo-regular phosphorothioate. 10. The oligonucleotide of claim 1, wherein the oligonucleotide further comprises a modified sugar moiety. 11. The oligonucleotide of claim 10, wherein the modified sugar moiety is 2′-O-alkyl oligoribonucleotide. 12. The oligonucleotide of claim 1, wherein the oligonucleotide further comprises a modified nucleobase. 13. The oligonucleotide of claim 12, wherein the modified nucleobase is a 5-methylpyrimidine or a 5-propynyl pyrimidine. 14. The oligonucleotide of claim 1, wherein the heparanase is a human heparanase. 15. A method of inhibiting expression of a heparanase in a cell comprising contacting the cell with the oligonucleotide of claim 1 under conditions such that the oligonucleotide hybridizes with mRNA encoding the heparanase so as to thereby inhibit the expression of the heparanase. 16. The method of claim 15, wherein the cell is a cancer cell. 17. A composition comprising the oligonucleotide of claim 1 in an amount effective to inhibit expression of a heparanase in a cell and a carrier. 18. The composition of claim 17, wherein the oligonucleotide and the carrier are capable of passing through a cell membrane. 19. The composition of claim 18, wherein the carrier comprises a membrane-permeable cationic reagent. 20. The composition of claim 19, wherein the cationic reagent is lipofectin. 21. A method of treating a tumor in a subject which comprises administering to the subject an amount of the oligonucleotide of claim 1 effective to inhibit expression of a heparanase in the subject and thereby treat the tumor. 22. A method of treating a subject which comprises administering to the subject an amount of the oligonucleotide of claim 1 effective to inhibit expression of a heparanase in the subject and thereby treat the subject. 23. The method of claim 21 or 22, wherein the subject is a human being. 24. The method of claim 21, wherein the treatment of the tumor is effected by reducing tumor growth. 25. The method of claim 21, wherein the treatment of the tumor is effected by reducing tumor metastasis. 26. The method of claim 21, wherein the treatment of the tumor is effected by reducing angiogenesis. 27. Use of the oligonucleotide of claim 1 for the preparation of a pharmaceutical composition for treating a tumor in a subject which comprises admixing the oligonucleotide in an amount effective to inhibit expression of a heparanase in the subject, with a pharmaceutical carrier. 28. An oligonucleotide having a sequence complementary to a sequence of a ribonucleic acid encoding a heparanase, wherein: (a) the oligonucleotide hybridizes with the ribonucleic acid under conditions of high stringency and is between 10 and 40 nucleotides in length; (b) the internucleoside linkages of the oligonucleotide comprise at least one phosphorothioate linkage; and (c) hybridization of the oligonucleotide to the ribonucleic acid inhibits expression of the heparanase. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Heparanase Cancer is the second leading cause of death in the United States. When cancer has metastasized, it can only be cured by systemic therapy, usually cytotoxic chemotherapy. Alternative methods to prevent tumor spread that would avoid cytotoxic chemotherapy are very desirable. One area of promise in alternative methods of therapy involves the study of heparanase. Heparanase breaks down heparan—a component of the cell surface and extracellular matrix. It has recently been shown that inhibition of heparanase reduces tumor spread (Kussie, et al. 1999 and Vlodasky, 1999), reducing both tumor neogenesis and angiogenesis. Antisense Phosphorothioate Oligonucleotides One way to achieve therapeutically useful targeted inhibition of protein expression is likely going to be through the use of antisense oligonucleotides. Antisense oligonucleotides are small fragments of DNA complementary to a defined sequence on a specified mRNA. The antisense oligonucleotide specifically binds to targets on the mRNA molecule and in doing so inhibits the translation of a specific mRNA into protein. Antisense oligonucleotide molecules synthesized with a phosphorothioate backbone have proven particularly resistant to exonuclease damage compared to standard deoxyribonucleic acids, and so they are used in preference. The present study discloses that instead of inhibiting heparanase itself, another method to reduce tumor spread may be to inhibit heparanase protein expression using antisense phosphorothioate oligonucleotides. |
<SOH> SUMMARY OF INVENTION <EOH>This invention provides an oligonucleotide having a sequence complementary to a sequence of a ribonucleic acid encoding a heparanase, wherein: (a) the oligonucleotide hybridizes with the ribonucleic acid under conditions of high stringency and is between 10 and 40 nucleotides in length; (b) the internucleoside linkages of the oligonucleotide comprise at least one phosphorothioate linkage; and (c) hybridization of the oligonucleotide to the ribonucleic acid inhibits expression of the heparanase, wherein inhibition of heparanase expression means at least a 50% reduction in the quantity of heparanase as follows: (a) a T24 bladder carcinoma cell is exposed to a complex of the oligonucleotide and lipofectin at an oligonucleotide concentration of 1 μM and a lipofectin concentration of 10 μg/ml for 5 hours at 37° C., (b) the complex is completely removed after such exposure, (c) 19 hours later the cell is scraped, washed and extracted in lysis buffer, (d) the nucleus of the cell is removed by centrifugation, (e) the cytoplasmic proteins in the resulting supernatant are separated according to mass by sodium dodecyl sulphate polyacrylamide gel electrophoresis, (f) the protein is transferred to a polyvinylidene difluoride membrane that is incubated at room temperature for 1-2 hours in incubation solution (g) the membrane is exposed to 1 μg/ml of an antibody directed against heparanase at 4° C. for 12 hours, (h) the membrane is exposed to wash buffer and incubated for 1 hour at room temperature in blocking buffer comprising a 1:3,000 dilution of a peroxidase-conjugated secondary antibody directed against an epitope on the antibody directed against heparanase, (i) the membrane is exposed to a chemiluminescent cyclic diacylthydrazide and the oxidation of the cyclic diacylthydrazide by the peroxidase is detected as a chemiluminescent signal, and (j) the signal is quantitated by laser-scanning densitometry as a measure of the amount of heparanase expressed calculated as a percentage of heparanase expression in an untreated cell. This invention further provides the instant oligonucleotide, wherein the oligonucleotide comprises deoxyribonucleotides. This invention further provides the instant oligonucleotide, wherein the oligonucleotide comprises ribonucleotides. This invention further provides the instant oligonucleotide, wherein every internucleoside linkage is a phosphorothioate linkage. This invention further provides the instant oligonucleotide, wherein the oligonucleotide is between 15 and 25 nucleotides in length. This invention further provides the instant oligonucleotide, wherein the oligonucleotide is about 20 nucleotides in length. This invention further provides the instant oligonucleotide, wherein the sequence of the oligonucleotide is selected from the following: (a) CCCCAGGAGCAGCAGCAGCA; (SEQ ID NO:3) (b) GTCCAGGAGCAACTGAGCAT; (SEQ ID NO:4) and (c) AGGTGGACTTTCTTAGAAGT. (SEQ ID NO:5) This invention further provides the instant oligonucleotide, wherein the oligonucleotide further comprises a modified internucleoside linkage. This invention further provides the instant oligonucleotide, wherein the modified internucleoside linkage is a peptide-nucleic acid linkage, a morpholino linkage, a phosphodiester linkage or a stereo-regular phosphorothioate. This invention further provides the instant oligonucleotide, wherein the oligonucleotide further comprises a modified sugar moiety. This invention further provides the instant oligonucleotide, wherein the modified sugar moiety is 2′-O-alkyl oligoribonucleotide. This invention further provides the instant oligonucleotide, wherein the oligonucleotide further comprises a modified nucleobase. This invention further provides the instant oligonucleotide, wherein the modified nucleobase is a 5-methylpyrimidine or a 5-propynyl pyrimidine. This invention further provides the instant oligonucleotide, wherein the heparanase is a human heparanase. This invention also provides a method of inhibiting expression of a heparanase in a cell comprising contacting the cell with the instant oligonucleotide under conditions such that the oligonucleotide hybridizes with mRNA encoding the heparanase so as to thereby inhibit the expression of the heparanase. This invention further provides the instant method, wherein the cell is a cancer cell. This invention also provides a composition comprising the instant oligonucleotide in an amount effective to inhibit expression of a heparanase in a cell and a carrier. This invention further provides the instant composition, wherein the oligonucleotide and the carrier are capable of passing through a cell membrane. This invention further provides the instant composition, wherein the carrier comprises a membrane-permeable cationic reagent. This invention further provides the instant composition, wherein the cationic reagent is lipofectin. This invention also provides a method of treating a tumor in a subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit expression of a heparanase in the subject and thereby treat the tumor. This invention further provides the instant method, wherein the subject is a human being. This invention further provides the instant method, wherein the treatment of the tumor is effected by reducing tumor growth. This invention further provides the instant method, wherein the treatment of the tumor is effected by reducing tumor metastasis. This invention further provides the instant method, wherein the treatment of the tumor is effected by reducing angiogenesis. This invention also provides a method of treating a subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit expression of a heparanase in the subject and thereby treat the subject. This invention further provides the instant method, wherein the subject is a human being. This invention also provides the use of the instant oligonucleotide for the preparation of a pharmaceutical composition for treating a tumor in a subject which comprises admixing the oligonucleotide in an amount effective to inhibit expression of a heparanase in the subject, with a pharmaceutical carrier. This invention also provides an oligonucleotide having a sequence complementary to a sequence of a ribonucleic acid encoding a heparanase, wherein: (a) the oligonucleotide hybridizes with the ribonucleic acid under conditions of high stringency and is between 10 and 40 nucleotides in length; (b) the internucleoside linkages of the oligonucleotide comprise at least one phosphorothioate linkage; and (c) hybridization of the oligonucleotide to the ribonucleic acid inhibits expression of the heparanase. |
Micromechanical cap structure and a corresponding production method |
A micromechanical cap structure and a corresponding manufacturing method are described. The micromechanical cap structure includes a first wafer with a micromechanical functional structure, and a second wafer to form a cap over the micromechanical functional structure. The first and second wafers have in their interior a support structure with a metal-semiconductor contact, and in their edge zone a bonding structure. The edge zone of the second wafer, when in the capped state, is arched in relation to the interior of the second wafer. |
1-7. (Canceled) 8. A micromechanical cap structure, comprising: a first wafer having a micromechanical functional structure; and a second wafer for forming a cap over the micromechanical functional structure, wherein the first wafer includes a first support structure in an interior thereof and the second wafer includes a second support structure in an interior thereof to form a metal-semiconductor contact with the first support structure; wherein the first wafer includes a first bonding structure in an edge zone thereof and the second wafer includes a second bonding structure in an edge zone thereof, when in a capped state, is arched in relation to the interior of the second wafer. 9. The micromechanical cap structure according to claim 8, wherein the second support structure includes a central support area and the first support structure includes a corresponding central countersupport area. 10. The micromechanical cap structure according to claim 9, wherein each of the first bonding structure and the second bonding structure has a circumferential edge zone, and the circumferential edge zone of the first bonding structure is anodically bonded to the circumferential edge zone of the second bonding structure. 11. The micromechanical cap structure according to claim 10, wherein the second wafer has a ring-shaped cavity around the second support structure. 12. The micromechanical cap structure according to claim 11, wherein the second wafer has a metallic inlay structure which at least partially lines the second support structure and the ring-shaped cavity and leaves the circumferential edge zone of the second bonding structure blank. 13. The micromechanical cap structure according to claim 11, wherein the ring-shaped cavity is provided in a base material of the second wafer, a layer of glass is disposed on the ring-shaped cavity, the circumferential edge zone of the second wafer, and the central support area. 14. A method for producing a micromechanical cap structure, comprising: stacking a first wafer having a support structure in its interior and a second wafer having a support structure in its interior in such a way that the support structures of the first and second wafers form a contact area and bonding structures of the first and second wafers are aligned; and applying an anodic bonding voltage between the first and second wafers in such a way that a first edge zone of a front side of the second wafer is drawn down onto a second edge zone on a front side of the first wafer, thereby forming a strong bonding structure. |
<SOH> BACKGROUND INFORMATION <EOH>German Published Patent Application Number 195 37 814 describes the structure of a layer system and a method for hermetically capping sensors, in particular surface-mounted micromechanical rotational speed sensors or acceleration sensors. The manufacture of the sensor structure using conventional technological methods is explained. The sensor is capped using a separate cap wafer made of silicon that is structured using complex structuring processes such as KOH etching. The cap wafer is placed on the sensor wafer at the wafer level, using a glass solder (seal glass). For this purpose a wide bond frame is needed around each sensor chip, in order to ensure adequate adhesion and sealing of the cap wafer. An anodic bond between a cap wafer and a sensor wafer is conceivable, where electrical contacts to the sensor wafer from the rear surface of a Si substrate are created by isolation trenches. One problem with such an anodic capping method is that the glass silicon composite wafer used (preferably Pyrex glass) is expensive to manufacture. The sequence of grinding, polishing and etching processes increases the process costs. Process reliability, in particular for adjusting the thickness of the glass wafer, is only attainable by specifying broad tolerance limits. Structuring the cap cavity in Pyrex using wet chemical methods such as BOE (buffered oxide etch) is expensive, and in the case of great etching depths of, for example, 5-10 μm, runs into problems in regard to varnish adhesion and surface roughness. A significant disadvantage of the technical design appears in regard to the anodic bonding with simultaneous formation of a metal-semiconductor contact. The incorporated metal inlay which is intended to keep the cavity space field-free during anodic bonding overlaps with the bond frame, introducing a rigid spacer which severely interferes with the bond and may result in leakage. |
<SOH> SUMMARY OF THE INVENTION <EOH>The micromechanical cap structure according to the present invention has the advantage compared to the conventional approach that the cap may be produced more economically and the bonding process may be carried out reliably. To this end, the metal-semiconductor contact may be placed outside the bond frame in the support area and is of elastic design to ensure a durable and robust electrical bonding. According to an exemplary embodiment, the support structure has a central support area on the second wafer and a corresponding central countersupport area on the first wafer. According to another exemplary embodiment, the connecting structure has a circumferential edge zone of the first wafer, and a circumferential edge zone of the second wafer anodically bonded thereto. According to another exemplary embodiment, the second wafer has a ring-shaped cavity running around the support area. According to another exemplary embodiment, the second wafer has a metallic inlay structure which at least partially lines the support area and the cavity and leaves the edge zone blank. The described method may also be used to produce a field-free space in the cavity. Another advantage results from the design of the metal layer, which prevents the metal layer from interfering with the bonding process in the area of the bond frame. According to the present invention, the metal inlay is instead structured in such a way that the metal contact is made elastic by the bonding process. To this end, the metal-silicon contact may be positioned in the center of the cap diaphragm. In this area the diaphragm may be deformed elastically. That compensates for the unevenness that may be introduced by the metal, and also achieves an elastic, reproducible connection between metal and silicon. According to another exemplary embodiment, the cavity is provided in the base material of the second wafer, a glass film being provided on the cavity, the edge zone, and the support area. It is expedient for the cap cavity to be structured with a depth of 5-10 μm not in an oxide but in the silicon substrate of the cap wafer. This makes use of the advantage that known Si deep structuring methods such as RIE (reactive ion etching) are not restricted by limitations, as the wet chemical deep structuring of Pyrex with BOE is. It is provided as a significant improvement that the cap composite wafer not be formed of a Pyrex wafer bonded on silicon. It is expedient for a thin layer of glass to be sputtered onto the cap substrate structured in silicon, as described for example in A. Drost et al., Anodic Bonding with Sputtered Pyrex Glass Layers, Proceedings of the Micro Materials Conference, Berlin, 1997, p. 933, or to be applied using a spin-on method. That results in the expectation of significantly lower processing costs and considerably smaller process fluctuations than in the case of composite manufacture through thinning a solid Pyrex wafer. Furthermore, the thin film process according to the present invention offers the advantage that it may be carried over into the process of capping a fully-integrated OMM sensor. The thin-film bonding process, with sputtered or vapor-deposited or spin-coated Pyrex glasses or Pyrex-like glasses, is regarded as a key process for capping integrated sensors. |
Method and apparatus with slips assembly for coupling tubulars without interruption of circulation |
A slips assembly which comprises a plurality of slip segments which, when positioned adjacent to each other, form a collar, which collar is larger than the diameter of the tubular body of the tubular at the top of the drill string and smaller than the diameter the upset shoulder of the said tubular, there being a segment moving means which can move the segments together to from a collar slidably located around the body of the said tubular, which slips assemblies can also be utilised in conjunction with, or as part of, the couplers referred to in prior patent applications, either to support, raise or lower the string below, or restraint, lower or raise the tubular, or stand of tubulars, above. |
1-32. Cancelled 33. A slips assembly for preventing axial movement of a tubular including a tool joint box having a shoulder comprising: (a) a plurality of slips segments arranged about said tubular and axially positioned to engage said shoulder; and (b) means for moving said slips segments to engage said shoulder as a continuous collar. 34. The slips assembly of claim 33 in combination with a coupler having a pressure hull, a pair of first and second grips and a valve partition wherein said slips assembly is positioned between said valve partition and one of said first and second grips. 35. A method of securing a tubular with a plurality of surrounding slips segments, such tubular including a joint box having a shoulder comprising: (a) moving said surrounding slips segments toward said tubular; (b) positioning said tubular and said slips segments so as to be in axial alignment with said shoulder; and (c) moving said slips segments toward said shoulder and engaging said shoulder to secure said tubular. 36. The method of claim 34 wherein said slips segments are moved such as to not engage non-shoulder portions of said tubular. 37. The method of claim 34 wherein said slips segments are moved toward said shoulder such as to form a continuous collar. 38. A slips assembly for use with a drill string comprising tubulars which slips assembly comprises a slips base and a slips body and in which there are a plurality of slip segments which, when positioned adjacent to each other, form a collar, which collar is larger than the diameter of the tubular body of the tubular body of the tubular at the top of the drill string and smaller than the diameter of the upset shoulder of the said tubular, there being a segment moving means which can move the segments together to form a collar which can be slidably located around the body of the said tubular. 39. A slips assembly as claimed in claim 38 in which the slip segments are located in a conical slips body so that downward force applied to the segments by the upset shoulder will hold the slip segments together. 40. A slips assembly as claimed in claim 38 in which the surface of the slips segments adjacent to the tubular is at angle to the axis of the said tubular which angle is less than the angle of the upset shoulder so that downward pressure on the segments due to the weight of the drill string is applied by the top end of the upset shoulder. 41. A slips assembly as claimed in claim 40, in which the said surface of the slips segments is at an angle to the tubular axis of less than 2 degrees less than the said angle of the shoulder to the tubular axis. 42. A slips assembly as claimed in claim 38 in which the segments are slidably mounted in key ways, which key ways constrain the segments to move in a controlled path to form the collar and align it around the said tubular. 43. A slips assembly as claimed in claim 42 in which the slips segments are connected to the slips base so that all the slips segments move in and out equally on the sliding keyway. 44. A slips assembly as claimed in claim 38 in which the slips segments are located in a slips body which is supported on a bearing mounted on the rig floor, rotary table or BOP (blow out preventer) stack. 45. A slips assembly as claimed in claim 38 in which there are three segments. 46. A slips assembly as claimed in claim 38 in which the slips base can be actuated up and down by mechanical, electrical or hydraulic means. 47. A slips assembly as claimed in claim 45 in which there is a spring positioned so that the slips base retracts under the force of a spring, such that mechanical, electrical or hydraulic pressure is only exerted to extend it. 48. A slips assembly as claimed in claim 38 in which the slips is able to rotate with the string. 49. A slips assembly as claimed in claim 48 in which the slips carrier is static in all directions. 50. A slips assembly as claimed in claim 38 in which, in use, the slips segments apply the force over the whole surface of the upset shoulder. 51. A slips assembly as claimed in claim 38 in which the slips are mounted in a slips carrier which slips carrier can be moved up and down in order to move the top of the string towards or away from the tubular, or stand of tubulars, to, or from, which it is to be connected or disconnected. 52. A slips assembly as claimed in claim 38 which operates outside and beneath a coupler for use in continuous drilling in which a drill string is rotated from a top drive rotating means and drilling fluid is circulated down the drill string which coupler comprises a means to grip the drill string and means to grip and seal a tubular lowered from substantially above, and the upper and lower sections of the coupler being inside a chamber separated into an upper half and a lower half by a blind preventer which, in its closed position prevents escape of drilling fluid from the drill stand, whereby when the blind preventer is opened the tubular and the drill stand can be brought into contact and joined together, so that mud circulation can continue uninterrupted. 53. A slips assembly as claimed in claim 38 which operates inside the lower chamber of a coupler for use in continuous drilling in which a drill string is rotated from a top drive rotating means and drilling fluid is circulated down the drill string which coupler comprises a means to grip the drill string and means to grip and seal a tubular lowered from substantially above, and the upper and lower sections of the coupler being inside a chamber separated into an upper half and a lower half by a blind preventer which, in its closed position prevents escape of drilling fluid from the drill stand, whereby when the blind preventer is opened the tubular and the drill stand can be brought into contact and joined together so that mud circulation can continue uninterrupted. 54. A slips assembly, as claimed in claim 38 which operates inside the upper chamber a coupler for use in continuous drilling in which a drill string is rotated from the top drive rotating means and drilling fluid is circulated down the drill string which coupler comprises a means to grip the drill string and means to grip and seal a tubular lowered from substantially above, and the upper and lower sections of the coupler being inside a chamber separated into an upper half and a lower half by a blind preventer which, in its closed position prevents escape of drilling fluid from the drill stand, whereby when the blind preventer is opened the tubular and the drill stand can be brought into contact and joined together, so that mud circulation can continue uninterrupted. 55. A slips assembly as claimed in claim 38 which is operated upside down to act upon the upset shoulder of a tubular, or the lowest tubular of a stand of tubulars, when forcing or snubbing a tubular, or stand of tubulars, in a downwards direction, into a high pressure space. 56. A slips assembly, as claimed in claim 55, in which the slips are mounted in a slips carrier which slips carrier is moved up or down, in order to move the tubular, or stand of tubulars, towards, and to connect with, the string, or away from, during a disconnection with the string. 57. A slips assembly as claimed in claim 55, in which the slips is inside the upper half of a coupler for use in continuous drilling in which a drill string is rotated from a top drive rotating means and drilling fluid is circulated down the drill string which coupler comprises a means to grip the drill string and means to grip and seal a tubular lowered from substantially above, and the upper and lower sections of the coupler being inside a chamber separated into an upper half and a lower half by a blind preventer which, in its closed position prevents escape of drilling fluid from the drill stand, whereby when the blind preventer is opened the tubular and the drill stand can be brought into contact and joined together. 58. A slips assembly as claimed in claim 55, in which the slips is inside the lower half of a coupler for use in continuous drilling in which a drill string is rotated from a top drive rotating means and drilling fluid is circulated down the drill string which coupler comprises a means to grip the drill string and means to grip and seal a tubular lowered from substantially above, and the upper and lower sections of the coupler being inside a chamber separated into an upper half and lower half by a blind preventer which, in its closed position prevents escape of drilling fluid from the drill stand, whereby when the blind preventer is opened the tubular and the drill stand can be brought into contact and joined together. 59. A slips assembly as claimed in claim 55 in which the slips is outside and above the coupler for use in continuous drilling in which a drill string is rotated from a top drive rotating means and drilling fluid is circulated down the drill string which coupler comprises a means to grip the drill string and means to grip and seal a tubular lowered from substantially above, and the upper and lower sections of the coupler being inside a chamber separated into an upper half and a lower half by a blind preventer which, in its closed position prevents escape of drilling fluid from the drill stand, whereby when the blind preventer is opened the tubular and the drill stand can be brought into contact and joined together. 60. A method for joining a tubular to a drill string using a coupler which incorporates slips which slips comprise a plurality of slip segments which, when positioned adjacent to each other, form a collar, which collar is larger than the diameter of the tubular body of the tubular at the top of the drill string and smaller than the diameter the upset shoulder of the said tubular, there being a segment moving means which can move the segments together to form a collar slidably located around the body of the said tubular method comprising lowering the string until the shoulder of the box contacts the slips segments, at which time the weight of the string is supported by the slips segments, which segments are on a slips base wedged within a slips body, which body comprises a continuous ring, supported on bearings, mounted on the rig floor, rotary table or the BOP (blow out preventer) stack, a tubular is then joined to the string, the slips base moved away from the slips body and the slips segments moved outwards from the axis of the string until they are clear of the passage of the relevant tool joints through the slips assembly and the relevant tool joints passed through the drill segments. 61. A method as claimed in claim 60 in which the surface of the slips segments adjacent the tubular is at angle to the axis of the said tubular which angle is less than the angle of the upset shoulder so that downward pressure on the segments due to the weight of the drill string is applied by the top end of the upset shoulder. 62. A method as claimed in claim 61 in which the difference between the said angles is less than 2 degrees. 63. A method as claimed in claim 60 in which the segments are slidably mounted in keyways and the segments are constrained by the keyways to move in and out equally on the sliding keyway in a controlled path to form the collar and align it around the said tubular. 64. A method as claimed in claim 60 in which the slips base is actuated up and down by mechanical, electrical or hydraulic means. 65. A method as claimed in claim 64 in which there is a spring positioned so that the slips base retracts under the force of a spring, and mechanical, electrical or hydraulic pressure is only exerted to extend it. 66. A method as claimed in claim 60 in which the slips assembly rotates with the string. 67. A method as claimed in claim 66 in which the slips carrier is static in all directions. 68. A method as claimed in claim 60 in which the slips segments apply the force over the whole surface of the upset shoulder. 69. A method as claimed in claim 60 in which if the axial force of the weight of the string or the pressure on the tubular is high enough to exceed the elastic deformation of the surface of the upset shoulder, the resulting plastic deformation takes place preferentially at the least stressed part of the tool joint. |
Method and system for co-joining computational spacecells in a networked environment |
A system, method and apparatus providing the creation, management and usage of a non-distributed computational and storage Space environment in the field of networked devices, specifically computational and storage devices. Mechanisms are provided to facilitate the merging of Space environments across dissimilar and security protected networks such that the merged Space environments act as a logically and operationally contiguous environment. Also disclosed is a system and method to use Space environments in the field of Transaction Servers with particular attention being made to Application Servers such as can be found on the Internet. |
1. A method to provide particular information from a first computational cell to a second computational cell on the internet, across a firewall, comprising: by the first computational cell, forming an HTTP message that encapsulates the particular information and sending the HTTP message to the second computational cell via port 80 of the firewall; by the second computational cell based upon receiving the HTTP message, issuing a MIME message to the first computational cell indicating receipt of the particular information; by the first computational cell based upon receiving the MIME message, issuing an activate command to the second computational cell; and by the second computational cell based upon receiving the activate command, utilizing the particular information. 2. A method to provide particular information from a first computational cell to a second computational cell connected to a network, across a firewall comprising: by the first computational cell, forming a message that encapsulates the particular information and sending the message to the second computational cell; by the second computational cell, based upon receiving the message, issuing a message to the first computational cell indicating the receipt of the particular information; by the first computational cell, based upon receiving the message indicating receipt, issuing a message encapsulating an activation command to the second computational cell: and by the second computational cell, based upon receiving the activate command, utilizing the particular information. 3. The method of claim 1 where the network includes a singular or plurality of firewall or security devices. 4. The method of claim 1, wherein the messages are sent across specific network ports. |
<SOH> BACKGROUND <EOH>The increasing power of desktop systems has given rise to the widespread situation where such desktop systems acting as Clients in the traditional Client/Server model are more powerful in terms of storage and computational ability than the server they are communicating with. Those skilled in the art will be familiar with the concepts of Client Server and Peer to Peer (P2P). Additionally, the increased availability of high-speed data networks such as Cable Modem Internet connections means that Client systems often have a better network bandwidth availability than the server or servers being connected to. These and other technological advances have given rise to a popular information sharing technology called Peer to Peer or P2P. In a P2P system, Client systems can communicate directly with each other after previously contacting a server to establish specific rules of access. P2P systems suffer from specific disadvantages: the inability to cope with increasing use, the use of centralized servers, lack of fault-tolerance the inability to share computational tasks between clients. forcing Clients to know where data is coming from and where it should be stored. Reliance on reliable network connections (i.e. those that do not suffer from frequent network disconnects such as wireless devices). Clearly, a system of inter-connected Client computers that share data, share computational power and other resources while allowing users to access data and perform computation tasks in a manner that did not require the users to actively specify where their data was stored has widespread application in fields such as: Information discovery and sharing Application server transactions in unreliable network environments (such as wireless). Computation resource pooling Applications where data needs to be stored for later asynchronous retrieval. The JavaSpaces technology from Sun Microsystems provides a broad framework for the interconnection of Client systems to a shared environment termed Space. Systems connected to Space share a common messaging area containing data and computational instructions in objects called templates. Connected Clients can send data into Space by first encapsulating the data into a template and then writing the template to Space. Such templates can then be accessed or modified by other connected clients at a future time. A limitation of the JavaSpaces framework relates to the inability of the Space environment to extend across firewalled devices as can be found in very extensive use in networks such as the Internet. As a result, the Space environment is restricted to local networks (also termed sub-nets) only. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 . A diagram showing the various components of a simple electronic computer which embodiments could use to facilitate operation of the invention. FIG. 2 A diagram showing a basic Space Cell Clerver Arrangement FIG. 3 A diagram showing Space Server Negotiation FIG. 4 A diagram showing the how a plurality of Space Cells are Co-joined into a one logically contiguous Space Cell FIG. 5 A diagram showing Inter-Space Communication FIG. 6 A diagram showing Simple template locking and access negotiations. FIG. 7 A diagram showing the Simple Transaction/Application Server Transaction FIG. 8 A diagram showing Simple Transaction/Application Server Transaction using Space Cells FIG. 9 A diagram showing Space Cells and Space Clusters.Detailed detailed-description description="Detailed Description" end="lead"? |
Patient information management apparatus and method |
A health care worker is able to manually input data by zooming a graphical representation of vital data, moving a cursor at a predetermined position using a mouse or the like, and clicking the mouse. If it is confirmed that the value can be correct, then a setting button is clicked. Alternatively, it may be canceled. For the cancellation, a click button is clicked. By the way, it can be also observed as an output on a monitor (Steps from S11 to S16). In this case, the fact of being confirmed is displayed over the screen on which the monitor output of the vital data is displayed. |
1. An apparatus for managing patient information comprising: at least one condition detecting means for detecting patient conditions; detected value displaying means for outputting a detected value obtained in said condition detecting means to display the detected value on a display screen; corrected value inputting means for inputting a corrected value of the detected value in the display screen displayed by said detected value displaying means corresponding to said condition detecting means; and corrected value displaying means for displaying said corrected value inputted by said corrected value inputting means on said display screen that said detected value is displayed. 2. The apparatus according to claim 1, further comprising display stopping means for stopping displaying the detected value with regard to a predetermined detected value. 3. The apparatus according to claim 1, wherein said condition detecting means includes at least two means selected from the group consisting of: heartbeat detecting means for detecting a heartbeat of said patient; arterial pressure detecting means for detecting an arterial pressure of said patient; saturated-oxygen-in-blood detecting means for detecting saturated-oxygen in blood of said patient; center venous pressure detecting means for detecting a center venous pressure of said patient; left atrium pressure detecting means for detecting a left atrium pressure of said patient; pulmonary artery pressure detecting means for detecting a pulmonary artery pressure of said patient; brain pressure detecting means for detecting a brain pressure of said patient; and respiratory rate measuring means for measuring a respiratory rate of said patient. 4. An apparatus for managing patient information comprising: provisional treatment displaying means for display the relationship between a content of a provisional treatment to a patient and the time; completed treatment displaying means for displaying a content of a completed treatment to said patient with the time; and decision result displaying means for deciding whether or not said content of provisional treatment matches with said content of completed treatment and for displaying a decision result. 5. The apparatus according to claim 4, wherein the apparatus has a first display screen displaying said provisional treatment, said completed treatment and said decision result and a second display screen displaying a relationship between a human body chart and a body part to be treated, and said first and second display screen can be seen at the same time. 6. The apparatus according to claim 5, further comprising link displaying means for displaying said provisional treatment, said completed treatment and said decision result in the first displaying screen, and said body part in the second displaying screen linked with each other. 7. The apparatus according to claim 4, wherein said provisional treatment displaying means displays a treatment content graphically. 8. The apparatus according to claim 4, wherein said completed treatment displaying means displays a treatment content graphically. 9. An apparatus for managing patient information comprising: at least one condition detecting means for detecting patient conditions; detected value displaying means for outputting a detected value obtained in said condition detecting means to display the detected value on a display screen; corrected value inputting means for inputting a corrected value of the detected value in the display screen displayed by said detected value displaying means corresponding to said condition detecting means; corrected value displaying means for displaying said corrected value inputted by said corrected value inputting means on said display screen that said detected value is displayed; provisional treatment displaying means for display the relationship between a content of a provisional treatment to a patient and the time; completed treatment displaying means for displaying a content of a completed treatment to said patient with the time; decision result displaying means for deciding whether or not said content of provisional treatment matches with said content of completed treatment and for displaying a decision result; and screen switching means for switching a display screen displaying said detected value and/or said corrected value, and a display screen displaying said provisional treatment, said completed treatment and said decision result. 10. A method for managing patient information comprising the steps of: detecting at least one patient condition by condition detecting means and a monitor connected to said condition detecting means in order to grasp a patient condition and outputting a detected result of said condition detecting means on a screen; correcting a monitor output on the basis of said monitor output displayed and displaying a corrected value on monitor screen with said monitor output; display the relationship between a content of a provisional treatment to a patient and the time on a display screen; displaying a content of a completed treatment to said patient with the time; deciding whether or not said content of provisional treatment matches with said content of completed treatment and for displaying a decision result; and switching a display screen displaying said detected value and/or said corrected value, and a display screen displaying said provisional treatment, said completed treatment and said decision result and display either display screen. 11. A program to execute a method according to claim 10. |
<SOH> BACKGROUND ART <EOH>The known system for managing patient information includes, for example, a system developed by Dr. Tait of Hospital for Sick Children, Toronto, Canada. This patient information management system was developed around 1980, and based on a client-server network constituted of Macintosh® computers actually used in the ICU of this pediatric hospital until around 1998. According to this information management system, a physician can instruct a nurse a method how to conduct the bolus or dripping injection of a medicine to a patient. However, although the instruction can convey sufficient information about the mode of injection such as single injection, repeated injection, etc., its information about the time schedule of injection is not always satisfactory. According to this system, a default display mode is predetermined for each clinical category. Therefore, the user cannot exchange the display mode of a patient classified to a certain category for the display mode of a different category. Moreover, according to this known system, a physician cannot inform a nurse of what precautions should be taken, for a given medicine, as regards the risk of its causing an adverse interaction when it is applied to a patient suffering from a particular disease or receiving a particular medicine. Furthermore, according to this system, a physician cannot inform a nurse of what precautions should be taken, for a given medicine, as regards the risk of its invoking an adverse response when it is applied to a patient through a certain route (a medicine may be safely applied to a patient, when injected through a central vein but may evoke an adverse response when injected through a peripheral vein, or vice versa, or a medicine may be safely applied to a patient when injected alone through a vein, but may cause an adverse interaction when injected through the same vein within a certain period after another medicine has been injected through the same vein, depending of the kind of the latter medicine). Still further, according to this system, the user cannot choose desired display modes from among various display modes available, to combine them. Another known patient information management system includes one provided by Fujitsu (EG-Main EX). This system spreads widely among university hospitals and big private hospitals having a capacity sufficiently large to accept 200 or more beds. According to this system, the user or physician can instruct nurses the bolus or dripping injection of medicines, and prescriptions. If a studied patient is so seriously sick that his/her condition changes from one moment to another, it is necessary for treating the patient properly to follow the pathological condition of the patient moment by moment. For this purpose, the physician must monitor at regular intervals the vital condition of the patient, and manage the thus obtained data in such a manner as to allow him/her to timely take a proper action for any pathological change. However, according to said patient information management system, the physician cannot always take proper action timely for a sudden pathological change particularly of a seriously sick patient. In addition, in a ward such as PICU where seriously sick patients are cared, even if such a patient information system as described above is introduced, the user or physician must deal with two different kinds of data, that is, data provided through a hospital information system (HIS) and data provided through a department information system (DIS), and the user must determine, for a given data, to which category it should be classified. This may disturb the concentration of the user or physician, which should be exclusively directed towards his/her patients. It is true that introduction of a computer system such as HIS and/or DIS in a hospital ensures efficient management of clinical works as well as clerical works of the hospital. However, it has the risk of causing adverse side-effects: an operator may feed an erroneous input, or miss an input, or a physician may give an erroneous instruction or miss an instruction, which may lead to a serious blunder. Even if the system is so configured that clinical data are automatically fed to the system, the system will cause another frustration: data fed from various sources become so voluminous and complicated that the physician might not be able to rightly grasp the pathological condition of his/her patients. Disclosure of Invention In view of the above problems encountered with the conventional systems, this invention had been proposed. The present inventors aimed at providing a patient information management system, which is “directly helpful for the promotion of the patient's safety and health.” They analyzed the procedures a medical professional will take when he/she must treat a patient in ICU, and developed, based on the analysis results, a system which can minimize the risk of making medical blunders as a result of erroneous input/instructions, missed input/instructions or duplicate input/instructions. One object of this invention is provided such a patient information system. Another object of this invention is to provide a “versatile system widely applicable to various medical departments”: in the pediatric department physicians must deliver a wide variety of instructions regarding injections and therapies, and orders of materials and facilities incessantly, and clerks and nurses must check those instructions and orders, and practice the instructions and dispatch the orders to external providers, and staff of ICU must command a number of widely different therapeutic courses. Yet another object of this invention is to provide an information system smoothening the entire works of a hospital capable of delivering security-insured, electronic medical records, safely storing the medical data, and providing a standard interface through which it can communicate with any external systems. This system will ensure not only the improved efficiency of clerical works of the hospital, but also the safe management of patients including pediatric patients. The above objects of this invention can be achieved by providing an apparatus for managing patient information comprising at least one condition detecting means for detecting patient conditions; detected value displaying means for outputting a detected value obtained in said condition detecting means to display the detected value on a display screen; corrected value inputting means for inputting a corrected value of the detected value in the display screen displayed by said detected value displaying means corresponding to said condition detecting means; and corrected value displaying means for displaying said corrected value inputted by said corrected value inputting means on said display screen that said detected value is displayed. The condition detecting means for detecting patient condition comprises applying, on various appropriately chosen spots on the body of a patient, detection means or sensors, e.g., of an electrocardiography meter or of manometer adapted for detecting specified signals peculiar to the spots, and delivering the received signals to a bedside monitor for inspection. This means enables the detection of blood pressures at specified spots or of the heartbeat, and the delivery of the detected signals as output. The monitor receives signals from those detection means, and delivers the signals to other external devices. It is empirically known that an output value displayed on the monitor does not always reflect rightly the condition of a patient. It is of course prohibited to artificially modify the output value on the monitor, because it constitutes a fake. If a medical practitioner determines that a given output value on the monitor does not reflect the condition of his/her patient, based on his/her own experience or on the results of other clinical tests, and has in mind a certain possibly right value, he/she will want to store his/her expected right value together with the actual value on the monitor for later reference. To meet such a demand, the system of the present invention allows the user to feed his/her expected right value in addition to the actual output on the monitor. The system of the present invention further allows the input fed by the user to be displayed on the monitor together with the actual output, which will be a great help for the user in constructing a therapeutic plan. The situation where the medical practitioner suspects an output on the monitor does not rightly reflect the true condition of his/her patient includes the following: the monitor itself is disordered, or the output on the monitor is at a transitional phase prior to recovery to a normal, constant phase. Besides the above situations, it is empirically known that the output on the monitor becomes unstable for a certain period after treatment. During that phase, the patient him/herself also becomes so unstable that it is often difficult to determine the true condition of the patient solely dependent on an output on the monitor. To meet such a situation, the physician asks the patient about his/her condition, or palpitates his/her pulses to check or determine the true condition of the patient. According to the system of the present invention, the user can feed his/her expected right condition of the patient obtained based on his/her own examination results. However, since this value is not the direct output on the monitor, the system of the present invention allows the input fed by the user to be displayed in parallel with the actual output on the monitor. The corrected value inputting means allows a corrected value fed by the user to be displayed in parallel with a detected value provided by the condition detecting means. Then, the user or medical practitioner can compare the corrected value fed by him/herself with the actually detected value on the monitor. If the difference between the two values is too large to be ignored, the user or medical practitioner has his/her attention aroused towards the cause underlying the difference. This urges the user or medical practitioner to be prudent in the treatment of the patient, which will insure the safe and proper treatment of the patient. If the user finds no discrepancy between an output on the monitor and his pathological image of the patient, this means that the user finds the system reliable, and the treatment based on the reliable system will be also reliable. A preferred embodiment may further comprise a display stopping means which can stop the display of detected values of chosen parameters. The operator may activate the display stopping means in the following situation. If a patient receives a medicine, his/her physical condition changes temporarily. Then, parameters representing the functional aspects of his/her body may also change. Then, the output on the monitor will not rightly reflect the true condition of the patient. If the user took this output as reflecting the true condition of the patient and constructed a therapy based on such data, that therapy would result in a failure. It is more right for the user to activate the display stopping means and to wait for a certain period until the physical condition of the patient returns to a normal, constant state, and parameters representing the functional aspects of the patient's body become stable. Indeed, activation of the display stopping means may prevent the occurrence of a blunder which might occur if the output on the monitor is relied on heedlessly. In addition, the system allows the user to activate the display stopping means for a certain predetermined period, and to freely alter the period. Once the user feeds the input specifying when and how long the display stopping means is activated, the system automatically activates the display stopping means at each specified time for a specified period. However, it is also possible for the user to manually activate and inactivate the display stopping means. The condition detecting means preferably includes at least two selected from the group consisting of heartbeat detecting means for detecting the heartbeat of a patient; arterial pressure determining means for determining the arterial pressure of a patient; oxygen-saturation-in-blood determining means for determining the oxygen saturation in blood of a patient; central venous pressure determining means for determining the central venous pressure of a patient; left atrium pressure determining means for determining the left atrium pressure of a patient; pulmonary artery pressure determining means for determining the pulmonary artery pressure of a patient; intracranial pressure determining means for determining the intracranial pressure of a patient; and respiratory rate measuring means for measuring the respiratory rate of a patient. These parameters serve as the vital sign of a patient, and represent the basic functions of the patient's body. If the sequential changes of those parameters are maintained on display, it will be possible for the user to closely follow the pathological changes of the patient and thus to timely apply proper treatment to the patient. As another feature, the present invention provides an apparatus for managing patient information comprising treatment schedule displaying means for displaying a treatment schedule as a function of time; performed treatment displaying means for displaying actually performed treatment as a function of time; and comparing means for comparing the actually performed treatment with the treatment schedule, checking whether the two are in agreement, and displaying the comparison result. The above apparatus has a first display screen for displaying the treatment schedule, actually performed treatment and comparison result, and a second display screen for displaying the spots on a human body to which treatment should be applied, and the first and second display screens are disposed side by side to be viewed simultaneously by an observer. With this display system, the observer can see mutually interrelated, but qualitatively different data presented on different screens at the same time, and thus rightly grasp what treatment has been performed on a patient, and can construct a proper therapeutic plan based on this right understanding, which may lead to the prevention of accidental medical blunders, and contribute to the establishment of highly reliable medicine. Preferably, the above apparatus further comprises a display linking means for linking the treatment schedule, actually performed treatment and comparison result on the first display screen with the spots on a human body on the second display screen. This apparatus makes it easier for the user to check the history of treatment hitherto performed on a patient. Preferably, with the above apparatus, the treatment schedule displaying means displays the scheduled treatments in a graphic form. Preferably, with the above apparatus, the performed treatment displaying means displays the actually performed treatments in a graphic form. This apparatus makes it easier for the user to check to what extent the scheduled treatments have been performed. As yet another feature, the present invention provides an apparatus for managing patient information comprising at least one condition detecting means for detecting patient conditions; detected value displaying means for outputting a detected value obtained in said condition detecting means to display the detected value on a display screen; corrected value inputting means for inputting a corrected value of the detected value in the display screen displayed by said detected value displaying means corresponding to said condition detecting means; corrected value displaying means for displaying said corrected value inputted by said corrected value inputting means on said display screen that said detected value is displayed; treatment schedule displaying means for displaying a treatment schedule as a function of time; performed treatment displaying means for displaying actually performed treatment as a function of time; and comparing means for comparing the actually performed treatment with the treatment schedule, checking whether the two are in agreement, and displaying the comparison result; and display screen switching means for arbitrarily choosing, by switching, one or two or more among the display screen for displaying detected and/or corrected values, display screen for displaying the treatment schedule, display screen for displaying actually performed treatment, and display screen for displaying the comparison result. With this apparatus, the user can freely choose, by switching, one or two or more among the display screens for displaying detected and/or corrected values, treatment schedule, actually performed treatment and comparison result. Thus, the user can rightly grasp what treatment has been performed on a patient in parallel with the sequential change of the patient's condition, and can construct a proper therapeutic plan based on this information and apply reliable treatment based on the plan. As yet another feature, the present invention provides a method for managing patient information comprising the steps of detecting at least one patient condition using condition detecting means and a monitor connected to said condition detecting means in order to grasp a patient condition and outputting a detected result of said condition detecting means on a screen; correcting a monitor output on the basis of said monitor output displayed and displaying a corrected value on the monitor screen with said monitor output; displaying a treatment schedule as a function of time; displaying actually performed treatment as a function of time; comparing the actually performed treatment with the treatment schedule, checking whether the two are in agreement, and displaying the comparison result; and arbitrarily choosing, by switching dependent on an instruction from the operator, one or two or more among the display screen for displaying detected and/or corrected values, display screen for displaying the treatment schedule, display screen for displaying actually performed treatment, and display screen for displaying the comparison result. This invention is generally achieved by a general-purpose computer system, and the above functions can be achieved by instructions from the computer, that is, programs properly provided by the computer. Thus, as yet another feature, this invention provides the programs necessary for achieving the above functions. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 is a sketchy diagram of a patient information management system of the present information. FIG. 2 is a diagram for outlining the constitutive elements of the patient information management system as shown in FIG. 1 . FIG. 3 shows the organization of display screens of the patient information management system of the present invention. FIG. 4 shows a basic display screen used in the patient information management system of the present invention. FIG. 5 is a flowchart of functions the user can effect through the basic display shown in FIG. 4 . FIG. 6 illustrates an example of display to be used in the patient information management system of this invention. FIG. 7 illustrates another example of display to be used in the patient information management system of this invention. FIG. 8 illustrates yet another example of display to be used in the patient information management system of this invention. FIG. 9 illustrates yet another example of display to be used in the patient information management system of this invention. FIG. 10 illustrates yet another example of display to be used in the patient information management system of this invention. FIG. 11 lists data elements required for constructing the display of FIG. 10 . FIG. 12 shows a table in a master file of FIG. 11 . FIG. 13 shows an example of a display used in the patient information management system of this invention. FIG. 14 is a flowchart of functions the user can effect through the display shown in FIG. 10 . FIG. 15 is an example of the flow of information through the patient information management system of this invention. detailed-description description="Detailed Description" end="lead"? |
Recyclable, multi-layer packaging material capable of water absorption and desorption |
A composite sheet material suitable for use as a wrapping material having a layer of non-woven material formed from thermoplastic fibers or spunbonded fabric and a single or a composite water impermeable layer, the layers being laminated together. The composite impermeable layer may include a polymeric woven scrim for increasing the tensile strength and tear strength of the sheet. |
1. A protective wrapping material which comprises a flexible composite sheet material comprising: (a) a layer of hydrophilic non-woven fabric made from thermoplastic polymer fibers; (b) a water-impermeable thermoplastic polymer film laminated to layer (a); and (c) a layer of woven thermoplastic polymer tapes laminated to the outside of said polymer film. 2. A wrapping material according to claim 1 further comprising a second water-impermeable thermoplastic film, said film being laminated to the outside of said woven layer. 3. A composite material according to claim 1 wherein said non-woven fabric is a spunbonded fabric. 4. A wrapping material according to claim 1, wherein said non-woven fabric contains one or more of the following: (a) anti-fungal composition; (b) anti-staining composition; (c) flame-retardant composition; and (d) corrosion-inhibiting composition. 5. A wrapping material according to claim 1 wherein said polymer film contains one or more of the following: (a) UV-resistant composition; (b) flame-retardant composition; (c) color pigment; and (d) corrosion-inhibiting composition. 6. A wrapping material according to claim 1 wherein said layer of woven thermoplastic polymer tapes contains one or more of the following: (a) UV-resistant composition; (b) flame-retardant composition; and (c) color pigment. 7. A wrapping material according to claim 1, wherein said non-woven fabric and said polymer film comprise polyolefins. 8. A wrapping material according to claim 1 wherein said woven polymer tapes comprise polyolefins. 9. A wrapping material according to claim 2 wherein said second thermoplastic film comprise polyolefins. 10. A wrapping material according to claim 1 wherein said non-woven fabric is polypropylene. 11. A wrapping material according to claim 2 wherein said second thermoplastic film comprises low density polyethylene. 12. A wrapping material according to claim 1 wherein said non-woven sheet is made hydrophilic by the application thereto of a surfactant. 13. A wrapping material according to claim 1 wherein said non-woven fabric has a weight in the range of 15-200 grams per square meter. 14. A wrapping material according to claim 1 wherein said polymer film has a thickness in the range of 0.2-4.0 mils. 15. A wrapping material according to claim 1 wherein said polymer film has a weight in the range of 5 to 100 grams per square meter. 16. A wrapping material according to claim 2 wherein said second thermoplastic film has a thickness in the range of 0.2-4.0 mils. 17. A wrapping material according to claim 2 wherein said second thermoplastic film has a weight in the range of 5 to 100 grams per square meter. 18. The use of the wrapping material of claim 1 for wrapping industrial products. 19. The use of the wrapping material according to claim 1 as a geomembrane. 20. The use of the wrapping material according claim 1 for covering temporary building structures. 21. The use of the wrapping material according to claim 1 as a landfill cover. 22. The use of a wrapping material according to claim 1 as a pond liner. 23. The use of a wrapping material according to claim 1 as a hay tarp. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Various composite sheet materials have been made for use in the packaging industry. For some applications, such as lumber wraps, water impermeable wraps may create sweating inside the package due to humidity. For this reason lumber wraps sometimes include a water-absorbing layer such as kraft paper on the inside. Kraft paper of weights of 65 to 200 grams per square meter are usual in the industry. They absorb a greater weight of water than their original weight and release moisture gradually under drier conditions without sweating. A paper layer can also be used to incorporate additives such as anti-fungal, anti-staining and anti-mildew compositions and, in case of metal wraps, additives such as liquid corrosion inhibitors. It is well known that plastic and paper can easily be recycled separately but not together. Disposing of wraps comprising both plastic and paper has become a major problem to the users. It would be desirable for such packaging material to be made from materials that can be recycled together. Other prior art products include laminates of a non-woven textile material and a water vapour permeable film, as in WO 94/19178, published Sep. 1, 1994, for use as wrapping material; and a laminate of polyvinyl acetate having ultraviolet shielding properties laminated to a non-woven fabric, egg. Japanese Patent Abstract JP 921565 97. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is an object of this invention to provide a composite is sheet material that absorbs moisture and is capable of Incorporating various additives while allowing those additives to exit gradually from the surface of the inside layer. It Is a further object of this invention to provide a composite sheet material that is resistive to water from the outside surface. This outer layer protects the packed goods from environmental hazards and can Include UV-resistive compounds and other additives. It is a further object of this invention to provide a composite sheet material that is recyclable. According to one embodiment, the Invention provides a flexible sheet material, suitable for use as a protective wrapping material and other uses, comprising a non-woven fabric layer and a water-impermeable polymer layer. The non-woven fabric is preferably made of the same general kind of polymer as the water-impermeable layer, eg. both polyolefins, The non-woven fabric layer used in the invention is a hydrophilic fabric made fromn polymeric fibers or is a spunbonded fabric. This layer is capable of absorbing and releasing moisture. The non-woven fabric layer is preferably capable of incorporating various additives such as liquid vapour corrosion inhibitors, anti-fungal compositions, anti-staining compositions, liquid flame-retardants, etc. According to a further embodiment, the sheet material may include a woven scrim for Increasing the tensile strength of the material and the tear strength. The woven scrim may optionally be coated on the outer side. The outer layer of the sheet material may carry additives such as UV-resistive compounds for increased protection of the wrapped goods, |
Process for the manufacture of homopolyamide-4,6 fibers |
The invention relates to a process for the manufacture of homopolyamide-4,6 fibers by melt spinning of homopolyamide-4,6, to fibers and multifilament yarns obtainable by the process and the use thereof for the reinforcement of rubber like in tire cords, V-belts etc. The invention further relates to a novel homopolyamide-4,6, a process for the manufacture thereof and the use of the new homopolyamide-4,6 for the manufacture of fibers, films and injection molded articles. The homopolyamide-4,6 fiber is manufactured by melt spinning of homopolyamide-4,6 having nascent morphology with a melting enthalpy of at least 140 J/g and a main melting temperature between 290 and 305° C. |
1. A process for the manufacture of homopolyamide-4,6 fibers by melt spinning of homopolyamide-4,6 having a nascent morphology with a melting enthalpy of at least 140 J/g and a main melting temperature between 290 and 305° C. 2. Process according to claim 1, wherein the homopolyamide-4,6 is spun from the melt at a temperature between 10 and 20° C. above the main melting temperature of the homopolyamide-4,6. 3. Process according to claim 1, wherein the polymer melt-temperature at the exit of the melt-spinning apparatus is between 305 and 320° C. 4. Process according to claim 1, wherein the homopolyamide-4,6 has a viscosity number in the range 160-250 ml/g. 5. Process according to claim 1, wherein the homopolyamide-4,6 has an average polymer residence time in the extruder of less than 6 minutes. 6. Process according to claim 1, wherein the difference in the viscosity number of the nascent homopolyamide-4,6 and of the fiber spun thereof is less than 25%. 7. A process according to claim 1, wherein the fiber is spun with a take-up speed between 400 and 2000 m/min. 8. A process according to claim 1, wherein the spun fiber is drawn in a drawing process comprising at least 2 drawing steps. 9. A process according to claim 8, wherein the drawing process involves a first drawing step with a draw ratio of less than 80% of the total draw ratio. 10. A process according to claim 8, wherein the drawing process is executed at a temperature below 240° C. 11. A homopolyamide-4,6 fiber obtainable by the process according to claim 1 wherein the homopolyamide-4,6 in the fiber has a viscosity number in the range 130-200. 12. A homopolyamide-4,6 fiber according to claim 11, having a T{square root}E being at least 24, wherein T is the tenacity in the cN/dtex and E is the elongation break in % measured according to ASTM-D885-98 at 500 mm sample length and 100%/min drawing speed. 13. A multifilament yarn comprising homopolyamide-4,6 fibers according to claim 11, wherein the yarn has a titer of at least 800. 14. Homopolyamide-4,6 having a nascent morphology with a melting enthalpy of at least 140 J/g, and a main melting temperature between 290 and 305° C. 15. Process for the manufacture of a homopolyamide-4,6 according to claim 14, comprising solid-state post condensation of homopolyamide-4,6 prepolymer at a temperature below 250° C. 16. Process according to claim 15, wherein the temperature is below 240° C. 17. Process according to claim 15, wherein the solid state post condensation is performed in a water containing gas atmosphere having a dew temperature at atmospheric pressure between 5 and 100° C. 18. Process according to claim 15, wherein the prepolymer has a viscosity number between 3 and 90 and is solid state post condensated to a viscosity number between 160-250 ml/g. 19. Process according to claim 15, wherein the homopolyamide-4,6 prepolymer is prepared at temperatures below 250. 20. Homopolyamide-4,6 obtainable by the process according to claim 15. 21. Homopolyamide-4,6 obtainable by the process according to claim 15, wherein the solid state polycondensation is performed at a temperature below 240° C. 22. Homopolyamide according to claim 21 wherein at least 80% of the area of the melting peak is below a temperature of 305 ° C. 23-25. (Cancelled) 26. Homopolyamide-4,6 according to claim 14, having a nascent morphology with a melting enthalpy of at least 150 J/g. 27. Process according to cliam 15, whereint he homopolyamide-4,6 prepolymer is prepared at a temperature below 240° C. 28. Fiber, film, extrusion for injection molded article comprising the homopolyamide-4,6 according to claim 14. 29. Fiber, film, extrusion for injection molded article comprising the homopolyamide-4,6 according to claim 20. 30. Fiber, film, extrusion for injection molded article comprising the homopolyamide-4,6 according to claim 21. 31. An article in the form of an air bag, a serving thread or abrasion resistant fabric, wherein said article comprises a homopolyamide-4,6 fiber according to claim 11. 32. An article in the form of an air bag, a serving thread or abrasion resistant fabric, wherein said article comprises a homopolyamide-4,6 fiber according to claim 12. 33. An article in the form of an air bag, a serving thread or abrasion resistant fabric, wherein said article comprises a multifilament yarn according to claim 13. 34. A rubber-reinforced article, such as V-belts, tire cap plies, airplane tire carcasses or air springs, wherein such article is reinforced with a homopolyamide-4,6 fiber according to claim 11. 35. A rubber-reinforced article, such as V-belts, tire cap plies, airplane tire carcasses or air springs, wherein such article is reinforced with a homopolyamide-4,6 fiber according to claim 12. 36. A rubber-reinforced article, such as V-belts, tire cap plies, airplane tire carcasses or air springs, wherein such article is reinforced with a multifilament yarn according to claim 13. |
Method and apparatus of detecting network activity |
Embodiments of the invention are concerned with a method of, and apparatus for, identifying types of network behaviour for use in identifying aberrant network behaviour. In particular, embodiments are concerned with identifying email viruses. The method comprises the steps of: collecting data representative of network traffic that has travelled over a network; training a classification means to recognise a plurality of network behaviour types from the collected data; and for unseen data travelling over the network, classifying the unseen data into one of the defined network behaviour types. |
1. A method of identifying behaviour patterns in respect of a system that operates over a communications network, the system comprising a plurality of server computers and client computers, wherein at least some of the server computers are arranged to deliver data to, and receive data from, one or more client computers over the communications network, the method comprising the steps of: (a) receiving data in respect of data which have been sent within the system, each of the received data items identifying the computer, within the system, to and/or from which the said data item has been sent; (b) organising the received data into a representation indicative of the distribution of data sent within the system, as a function of identified computer; and (c) using the representation to train a classification means to recognise a plurality of behaviour types. 2. A method according to claim 1, including transforming the representation into a format suitable for input into the classification means. 3. A method according to claim 1, in which step (b) comprises creating a topological representation of the server and client computers in the system, and the method includes, for each received data item, incrementing a counter representative of a level of activity associated with the identified computer; and adding an identifier, which is indicative of a level of activity, to whichever part of the topological representation corresponds to the identified computer, thereby creating a representation indicative of a distribution of data sent within the system. 4. A method according to claim 3, in which said topological representation comprises a plurality of regions, each of which is representative of an area of the network, a plurality of sub-regions, each of which is representative of a server computer within a corresponding area of the network, and a plurality of sub-sub regions, each of which is representative of a client computer acting as a client to a corresponding server computer; and in which the step of adding an identifier to whichever part of the topological representation corresponds to the identified computer involves adding an identifier to whichever sub region or sub-sub region corresponds thereto. 5. A method according to claim 3, in which the level of activity is normalised over the topological representation. 6. A method according to claim 5, wherein the transforming step comprises transforming the representation into a frequency representation of activity; and converting the frequency representation into a vector, which vector is suitable for input into a classification means. 7. A method according to claim 6, in which the step of transforming the representation into a frequency representation comprises applying a Fourier transform to the said representation. 8. A method according to claim 6, in which the step of converting the frequency representation into a vector comprises sampling the frequency representation in order to extract vector values corresponding thereto. 9. A method according to claim 1, in which the received data items additionally identify attributes of the data sent within the system, and in which step (b) comprises the steps of creating a plurality of lists, each of which corresponds to a link between server machines in the system; and for each received data item: identifying a link over which the corresponding sent data item has passed; identifying a list corresponding to the identified link; identifying attributes of the data item; and for each identified attribute, incrementing a counter corresponding thereto in the identified list. 10. A method according to claim 9 when dependent on claim 2, in which the received data items additionally identify attributes of the data sent within the system, and in which step (b) comprises the steps of creating a Plurality of lists, each of which corresponds to a link between server machines in the system; and for each received data item: identifying a link over which the corresponding sent data item has passed: identifying a list corresponding to the identified link; identifying attributes of the data item; and for each identified attribute, incrementing a counter corresponding thereto in the identified list; and the transforming step comprises creating a vector comprising at least some of the lists, which vector is suitable for input into a classification means. 11. A method according to claim 2, in which data is received in respect of a plurality of time periods, and the organising and transforming steps are performed for the said plurality of the said time periods, thereby generating a plurality of transformed representations for inputting to the classification means. 12. A method according to claim 11, in which the method is carried out for a plurality of different size time periods, so that there are a plurality of behaviour types for each size of time period. 13. A method according to claim 14, in which, for each size time period, a different respective classification means is used. 14. A method according to claim 1, wherein the data being received is email data, and the aberrant behaviour to be identified is email viruses propagating through the network. 15. A method according to claim 14, in which the receiving step (a) includes collecting data from any one of a log file being part of a firewall arrangement, or a log file accessible from an email server machine, or a plurality of log files accessible from a plurality of email server machines. 16. A method according to claim 1, including arranging the received data into groups of received data as a function of type of sent data. 17. A method of identifying aberrant behaviour in respect of unseen data items that have been sent within a system comprising a plurality of server computers and client computers, including the steps of receiving data in respect of the unseen data items; organising the received data into a representation according to claim 3; transforming the representation into a format suitable for input into the classification means in which the level of activity is normalized over the topological representation and wherein the transforming step comprises transforming the representation into a frequency representation of activity; and converting the frequency representation into a vector, which vector is suitable for input into a classification means; inputting the transformed representation to the trained classification means; and operating the classification means in order to classify the unseen data as a type of a behaviour. 18. Apparatus for identifying aberrant behaviour in respect of a system that operates within a communications network, the system comprising a plurality of server computers and client computers, wherein each server computer is arranged to deliver data to, and receive data from, one or more client computers over the communications network, the apparatus comprising receiving means arranged to receive data in respect of data which have been sent within the system, each of the received data items identifying the computer, within the system, from and/or to which the said data item has been sent during a time period; means operable to arrange the received data into groups of received data as a function of type of sent data, so that each group represents a type of behaviour; organising means arranged to organise data in each group into a representation indicative of a distribution of data sent within the system, as a function of identified computer during the period; and a classification means operable to receive the representation as input and operable to generate an output representative of a behaviour corresponding to the group. 19. Apparatus according to claim 18, including transforming means arranged to transform the representation into a format suitable for input into a classification means. 20. Apparatus according to claim 19, wherein the receiving means is in operative association with means operable to retrieve data from any one of a log file being part of a firewall arrangement, or a log file accessible from a server machine, or a plurality of log files accessible from a plurality of server machines. 21. Apparatus according to claim 19 or claim 20, wherein the organising means comprises means arranged to create a representation indicative of a level of activity of server and client computers of the system. 22. Apparatus according to claim 21, wherein the transforming means includes means operable transform the representation into a frequency representation. 23. Apparatus according to claim 22, wherein the transforming means includes means operable to apply a Fourier transform to the representation, thereby generating the frequency representation. 24. Apparatus according to claim 18, including means arranged to analyse data passing through at least some of the server computers and to identify attributes associated with the analysed data, wherein received data in respect of the analysed data identifies the said server computer and identified attributes. 25. Apparatus according to claim 18, wherein the classification means comprises any one of a neural network, a statistical classifier or a pattern recogniser. 26. Apparatus according to claim 25, wherein, when the classification means comprises a neural network, the said neural network comprising at least an input layer comprising a plurality of input nodes, a hidden layer comprising a plurality of hidden nodes, which hidden layer is in operative association with the input layer, and an output layer comprising a plurality of output nodes, which output layer is in operative association with the hidden layer, wherein each of the output nodes corresponds to a type of behaviour. 27. Apparatus according to claim 18, wherein the received data is email data, and the aberrant behaviour to be identified is email viruses propagating through the network. 28. Apparatus according to claim 27, wherein at least some of the output nodes correspond to rates of email virus propagation. 29. Apparatus according to claim 18, further including alerting means arranged in operative association with at least some of the output nodes and operable to generate one of a plurality of alert outputs in dependence on activation of output nodes. 30. An email activity device for use in identifying email viruses, the device being located in a network and operable to communicate with other devices in the network, comprising retrieving means operable to retrieve data representative of email traffic, during a time period, from any one of: a log file being part of a firewall arrangement, or a log file accessible from an email server machine, or a plurality of log files accessible from a plurality of email server machines; organising means arranged to organise the retrieved data into a representation indicative of a distribution of the said email traffic during the period; transforming means arranged to transform the representation into a format suitable for input into a classification means; and a classification means operable to receive the transformed representation as input and operable to generate an output representative of a type of email traffic. |
Monothilic refractory composition |
A subject for the invention is to provide an unshaped refractory composition having not only high thermal resistance but also improved corrosion resistance and improved unsusceptibility to slag infiltration. The invention is “an unshaped refractory composition comprising: (1) 20 to 70% by weight raw spinel material comprising an MgO—Al2O3 spinel phase and containing 2 to 20% by weight magnesia and/or raw spinel/corundum material comprising an MgO—Al2O3 spinel phase and a corundum phase and containing 2 to 20% by weight magnesia; (2) 3 to 12% by weight raw magnesia material having a particle diameter of 0.3 mm or smaller, containing particle sizes of 75 μm or smaller in an amount of 55 to 85% by weight, and having a magnesia purity of 90% by weight or higher; (3) 3 to 10% by weight alumina cement having a calcia content lower than 20% by weight; (4) 0.3 to 1.5% by weight ultrafine powder consisting mainly of silica; and (5) a raw alumina material as the remainder”. |
1. An unshaped refractory composition comprising: 20 to 70% by weight of raw spinel material comprising an MgO—Al2O3 spinel phase and containing from 2 to 20% by weight of magnesia and/or raw spinel/corundum material comprising an MgO—Al2O3 spinel phase and a corundum phase and containing from 2 to 20% by weight of magnesia; 3 to 12% by weight of raw magnesia material having a particle diameter of 0.3 mm or smaller, containing particle sizes of 75 I=or smaller in an amount of from 55 to 85% by weight, and having a magnesia purity of 90% by weight or higher; 3 to 10% by weight of alumina cement having a calcia content of lower than 20% by weight; 0.3 to 1.5% by weight of ultrafine powder consisting mainly of silica; and a raw alumina material as a remainder. 2. An unshaped refractory composition comprising: 20 to 70% by weight of raw spinel material comprising an MgO—Al2O3 spinel phase, containing from 2 to 20% by weight of magnesia, and having a particle size of 1.0 mm or larger and/or raw spinel/corundum material comprising an MgO—Al2O3 spinel phase and a corundum phase, containing from 2 to 20% by weight of magnesia, and having a particle size of 1.0 mm or larger; 3 to 12% by weight of raw magnesia material having a particle diameter of 0.3 mm or smaller, containing particle sizes of 75 μm or smaller in an amount of from 55 to 85% by weight, and having a magnesia purity of 90% by weight or higher; 3 to 10% by weight of alumina cement having a calcia content of lower than 20% by weight; 0.3 to 1.5% by weight ultrafine powder consisting mainly of silica; and a raw alumina material as a remainder. 3. The unshaped refractory composition according to claim 1 or 2, which is for use in application by casting or application by shotcreting after having been mixed together with water. |
<SOH> BACKGROUND ART <EOH>Recently, “an alumina/spinel castable” comprising a combination of a raw alumina material and a raw spinel material and “an alumina/magnesia castable” obtained by adding magnesia to an alumina castable were developed as “refractories for the lining of furnaces used at high temperatures” such as molten-steel ladles including VOD ladles, RH vacuum degassers, tundishes for hot operating, covers of smelting furnaces, ash melting furnaces, and cement preheaters, and are being used in such applications. Of these, the “alumina/magnesia castable” is attracting attention as a material especially for ladle lining because of reduced slag infiltration, and is coming to be applied to the bottom and side wall. Incidentally, “unshaped materials comprising a raw alumina material, raw magnesia material, alumina cement, and ultrafine silica powder” are described as “alumina/magnesia castables” in JP-A-63-218586, JP-A-2-208260, JP-A-5-185202, and JP-A-7-25669. Compared to the alumina castable and alumina/spinel castable heretofore in use, the unshaped materials described in those patent documents are superior in corrosion resistance and unsusceptibility to slag infiltration. However, with recent changes in circumstances surrounding the iron and steel industry, the treatment of molten steels in ladles is becoming severer so as to improve steel quality, and the improvement attainable with the unshaped materials described above has reached a limit. There also are limitations on measures for the steady “need of the iron and steel industry for a refractory cost reduction by life prolongation”. Under those circumstances, the present inventors proposed “a spinel/magnesia castable obtained by compounding spinel (MgO.Al 2 O 3 ) and magnesia as the main raw materials with a raw spinel material as an aggregate part and with small amounts of a raw alumina material and a raw magnesia material as fine powder parts” prior to the present application (see Taikabutsu , Vol. 54, No. 1 (published by the Technical Association of Refractory, Japan in January, 2002) pp. 23-24). This spinel/magnesia castable not only has high unsusceptibility to infiltration and hot-stress relaxation characteristics but also can improve corrosion resistance while inhibiting infiltration, like the alumina/spinel castable, due to the incorporation of spinel also as an aggregate part. The invention relates to an improvement of the “spinel/magnesia castable”. An object of the invention is to provide an unshaped refractory composition which, in particular, not only has high heat resistance but also has far higher corrosion resistance and unsusceptibility to slag infiltration than the alumina, alumina/spinel, or alumina/magnesia castable heretofore in use. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.