text
stringlengths 0
1.67M
|
|---|
1. A nasal delivery device for delivering substance to a nasal airway of a subject, comprising: a nosepiece for fitting to a nostril of a subject, the nosepiece including a nozzle through which substance is in use delivered to the nasal airway, and at least one inflatable cuff member which is configured to be inflated subsequent to exhalation by the subject; and a delivery unit for delivering substance through the nozzle of the nosepiece. 2. The delivery device of claim 1, wherein the at least one inflatable cuff member is configured to be inflated in response to exhalation by the subject. 3. The delivery device of claim 1 or 2, further comprising: a mouthpiece unit through which the subject in use exhales to cause closure of the oropharyngeal velum of the subject. 4. The delivery device of claim 3, further comprising: a flow channel fluidly connecting the nosepiece and the mouthpiece unit, whereby exhaled air from an exhalation breath is delivered through the nosepiece. 5. The delivery device of claim 3, further comprising: a flow channel fluidly connected to the nosepiece through which a gas flow, separate to an exhaled air flow from an exhalation breath of the subject, is in use delivered to the nosepiece; and a gas supply unit for supplying a gas flow to the flow channel. 6. The delivery device of claim 1, wherein the delivery unit includes a dosing unit for supplying at least one substance. 7. The delivery device of claim 6, wherein the dosing unit comprises a nebulizer for supplying an aerosol. 8. The delivery device of claim 6, wherein the dosing unit comprises an aerosol canister for supplying an aerosol. 9. The delivery device of claim 6, wherein the dosing unit comprises a delivery pump unit for supplying one of an aerosol or a jet. 10. The delivery device of claim 9, wherein the delivery pump unit comprises a liquid pump unit for supplying a liquid aerosol. 11. The delivery device of claim 9, wherein the delivery pump unit comprises a powder pump unit for supplying a powder aerosol. 12. The delivery device of claim 6, wherein the dosing unit comprises a powder delivery unit for delivering a powder aerosol. 13. The delivery device of claim 1, further comprising: an actuation mechanism for actuating the delivery unit in response to exhalation by the subject. 14. The delivery device of claim 1, wherein at least one of the at least one inflatable cuff member is inflatable to engage an inner wall of a nasal cavity of the subject. 15. The delivery device of claim 14, wherein the at least one inflatable cuff member is configured such as, when inflated, to provide a fluid-tight seal between the nosepiece and the inner wall of the nasal cavity of the subject. 16. The delivery device of claim 1, wherein the at least one cuff member is configured such as, when inflated, to direct at least a distal end of the nozzle towards a site in the nasal airway of the subject. 17. The delivery device of claim 16, wherein the at least one cuff member is one or both of shaped and sized such as, when inflated, to direct at least a distal end of the nozzle to a site in the nasal airway of the subject. 18. The delivery device of claim 16, wherein the site includes at least a part of the inferior meatus. 19. The delivery device of claim 16, wherein the site includes at least a part of the middle meatus. 20. The delivery device of claim 19, wherein the site includes an inferior part of the middle meatus. 21. The delivery device of claim 16, wherein the site includes at least a part of the superior meatus. 22. The delivery device of claim 16, wherein the site includes at least a part of the inferior nasal concha. 23. The delivery device of claim 16, wherein the site includes at least a part of the middle nasal concha. 24. The delivery device of claim 16, wherein the site includes at least a part of the superior nasal concha. 25. The delivery device of claim 16, wherein the site includes at least a part of the olfactory region. 26. The delivery device of claim 16, wherein the site includes at least sinus ostia. 27. The delivery device of claim 16, wherein the site includes at least sinus infundibulum. 28. The delivery device of claim 16, wherein the site includes at least a part of the epipharynx. 29. The delivery device of claim 16, wherein the site includes at least adenoids. 30. The delivery device of claim 16, wherein the site includes at least tubal ostia. 31. The delivery device of claim 1, wherein at least one of the at least one cuff member includes at least one lobe which, when the at least one of the at least one cuff member is inflated, extends into a region of the nasal cavity of the subject such as to at least partially obstruct the same and prevent flow thereinto. 32. The delivery device of claim 31, wherein the nasal cavity region is a lower region of the nasal cavity of the subject. 33. The delivery device of claim 31, wherein the nasal cavity region is a middle region of the nasal cavity of the subject. 34. The delivery device of claim 31, wherein the nasal cavity region is an upper region of the nasal cavity of the subject. 35. The delivery device of claim 31, wherein at least one of the at least one cuff member includes a plurality of lobes which, when the at least one of the at least one cuff member is inflated, extend into regions of the nasal cavity of the subject such as to at least partially obstruct the same and prevent flow thereinto. 36. The delivery device of claim 35, wherein the nasal cavity regions are lower and middle regions of the nasal cavity of the subject. 37. The delivery device of claim 35, wherein the nasal cavity regions are lower and upper regions of the nasal cavity of the subject. 38. The delivery device of claim 35, wherein the nasal cavity regions are middle and upper regions of the nasal cavity of the subject. 39. The delivery device of claim 1, wherein the at least one cuff member is configured to be inflated by air from exhalation breath of the subject. 40. The delivery device of claim 1, wherein the at least one cuff member is configured to be inflated by a gas source separate to the exhalation breath of the subject. 41. The delivery device of claim 1, wherein the nosepiece includes a single inflatable cuff member. 42. The delivery device of claim 41, wherein the at least one cuff member is a substantially annular member disposed about the delivery channel. 43. The delivery device of claim 1, wherein the nosepiece includes a plurality of inflatable cuff members. 44. The delivery device of claim 43, wherein the nosepiece includes a plurality of cuff members disposed about the periphery thereof. 45. The delivery device of claim 44, wherein the cuff members are disposed at one position along a length of the nozzle. 46. The delivery device of claim 44, wherein the nosepiece includes first and second cuff members in spaced positions along the length of the nozzle. 47. The delivery device of claim 46, wherein one of the cuff members is disposed at a distal end of the nozzle. 48. A nasal delivery device for delivering substance to a nasal cavity of a subject, comprising: a nosepiece including a nozzle through which substance is in use delivered to the nasal cavity, and at least one inflatable cuff member which is configured such as, when inflated, to provide a fluid-tight seal between the nosepiece and an inner wall of the nasal cavity of the subject; and a delivery unit for delivering substance through the nozzle of the nosepiece. 49-93. (canceled) 94. A nasal delivery device for delivering substance to a nasal airway of a subject, comprising: a nosepiece for fitting to a nostril of a subject, the nosepiece including a nozzle through which substance is in use delivered to the nasal airway, and at least one cuff member which is configured such as, when fitted in a nasal cavity of the subject, to engage an inner wall of the nasal cavity of the subject and direct at least a distal end of the nozzle towards a site in the nasal airway of the subject; and a delivery unit for delivering substance through the nozzle of the nosepiece. 95-153. (canceled) 154. A nasal delivery device for delivering substance to a nasal airway of a subject, comprising: a nosepiece for fitting to a nostril of a subject, the nosepiece including a nozzle through which substance is in use delivered to the nasal airway, and at least one cuff member, at least one of the at least one cuff member including at least one lobe which, when the at least one of the at least one cuff member is fitted in the nasal cavity of the subject, extends into a region of the nasal cavity of the subject such as to at least partially obstruct the same and prevent flow thereinto; and a delivery unit for delivering substance through the nozzle of the nosepiece. 155-213. (canceled) 214. A nasal delivery device for delivering substance to a nasal airway of a subject, comprising: a nosepiece for fitting to a nasal cavity of a subject, the nosepiece including a first delivery outlet through which substance is in use delivered to the nasal airway of the subject, and at least one second delivery outlet through which at least one gas flow, separate to an exhalation breath of the subject, is in use delivered to the nasal airway of the subject; a delivery unit for delivering substance through the first delivery outlet of the nosepiece; and a gas supply unit for supplying a flow of gas through the at least one second delivery outlet of the nosepiece. 215-251. (canceled) 252. A method of delivering substance to a nasal airway of a subject, comprising: fitting a nosepiece to a nasal cavity of a subject, the nosepiece including a nozzle through which substance is delivered to the nasal airway, and at least one inflatable cuff member; inflating the at least one cuff member subsequent to exhalation by the subject; and delivering substance through the nozzle of the nosepiece. 253. The method of claim 252, wherein the at least one inflatable cuff member is configured to be inflated in response to exhalation by the subject. 254. The method of claim 252 or 253, further comprising the steps of: providing a mouthpiece unit; and exhaling through the mouthpiece unit to cause closure of the oropharyngeal velum of the subject. 255. The method of claim 254, further comprising the step of: providing a flow channel fluidly connecting the nosepiece and the mouthpiece unit, whereby exhaled air from an exhalation breath is delivered through the nosepiece. 256. The method of claim 254, further comprising the steps of: providing a flow channel fluidly connected to the nosepiece through which a gas flow, separate to an exhaled air flow from an exhalation breath of the subject, is delivered to the nosepiece; and supplying a gas flow to the flow channel. 257. The method of claim 252, further comprising the step of: delivering the substance in response to exhalation by the subject. 258. The method of claim 252, wherein the at least one cuff member is configured such as, when inflated, to direct at least a distal end of the nozzle towards a site in the nasal airway of the subject. 259. The method of claim 258, wherein the at least one cuff member is one or both of shaped and sized such as, when inflated, to direct at least a distal end of the nozzle to a site in the nasal airway of the subject. 260. The method of claim 258, wherein the site includes at least a part of the inferior meatus. 261. The method of claim 258, wherein the site includes at least a part of the middle meatus. 262. The method of claim 261, wherein the site includes an inferior part of the middle meatus. 263. The method of claim 258, wherein the site includes at least a part of the superior meatus. 264. The method of claim 258, wherein the site includes at least a part of the inferior nasal concha. 265. The method of claim 258, wherein the site includes at least a part of the middle nasal concha. 266. The method of claim 258, wherein the site includes at least a part of the superior nasal concha. 267. The method of claim 258, wherein the site includes at least a part of the olfactory region. 268. The method of claim 258, wherein the site includes at least sinus ostia. 269. The method of claim 258, wherein the site includes at least sinus infundibulum. 270. The method of claim 258, wherein the site includes at least a part of the epipharynx. 271. The method of claim 258, wherein the site includes at least adenoids. 272. The method of claim 258, wherein the site includes at least tubal ostia. 273. The method of claim 252, wherein at least one of the at least one cuff member includes at least one lobe which, when the at least one of the at least one cuff member is inflated, extends into a region of the nasal cavity of the subject such as to at least partially obstruct the same and prevent flow thereinto. 274. The method of claim 273, wherein the nasal cavity region is a lower region of the nasal cavity of the subject. 275. The method of claim 273, wherein the nasal cavity region is a middle region of the nasal cavity of the subject. 276. The method of claim 273, wherein the nasal cavity region is an upper region of the nasal cavity of the subject. 277. The method of claim 252, wherein at least one of the at least one cuff member includes a plurality of lobes which, when the at least one of the at least one cuff member is inflated, extend into regions of the nasal cavity of the subject such as to at least partially obstruct the same and prevent flow thereinto. 278. The method of claim 277, wherein the nasal cavity regions are lower and middle regions of the nasal cavity of the subject. 279. The method of claim 277, wherein the nasal cavity regions are lower and upper regions of the nasal cavity of the subject. 280. The method of claim 277, wherein the nasal cavity regions are middle and upper regions of the nasal cavity of the subject. 281. A method of delivering substance to a nasal cavity of a subject, comprising the steps of: fitting a nosepiece to a nasal cavity of a subject, the nosepiece including a nozzle through which substance is delivered to the nasal cavity, and at least one inflatable cuff member which is configured such as, when inflated, to provide a fluid-tight seal between the nosepiece and an inner wall of the nasal cavity of the subject; and delivering substance through the nozzle of the nosepiece. 282-310. (canceled) 311. A method of delivering substance to a nasal airway of a subject, comprising the steps of: fitting a nosepiece to a nasal cavity of a subject, the nosepiece including a nozzle through which substance is delivered to the nasal airway, and at least one cuff member which is configured such as, when fitted in the nasal cavity of the subject, to engage an inner wall of the nasal cavity of the subject and direct at least a distal end of the nozzle towards a site in the nasal airway of the subject; and delivering substance through the nozzle of the nosepiece. 312-349. (canceled) 350. A method of delivering substance to a nasal airway of a subject, comprising the steps of: fitting a nosepiece to a nasal cavity of a subject, the nosepiece including a nozzle through which substance is delivered to the nasal airway, and at least one cuff member, at least one of the at least one cuff member including at least one lobe which, when the at least one of the at least one cuff member is fitted in the nasal cavity of the subject, extends into a region of the nasal cavity of the subject such as to at least partially obstruct the same and prevent flow thereinto; and delivering substance through the nozzle of the nosepiece. 351-388. (canceled) 389. A method of delivering substance to a nasal airway of a subject, comprising the step of: delivering substance through a first delivery outlet and at least one gas flow, separate to an exhalation breath of a subject, through at least one second delivery outlet into the nasal airway of the subject. 390-403. (canceled) |
Method for detecting and identifying the presence of biological materials derived from fish and oligonucleotides therefor |
A subject of the present invention is a method for detecting the presence of biological materials originating from gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, in a sample of organic material, characterized in that the presence of mitochondrial DNA originating from gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae in said organic material is determined by amplification of at least one sequence or fragment of mitochondrial DNA specific to the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, and contained in the mitochondrial DNA extracted from said sample, namely at least one sequence or fragment present in the genomes of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, but absent from the genomes of the other animal genera, and in particular of the other animal species. |
1. Method for detecting the presence of biological materials originating from gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, in a sample of organic material, characterized in that the presence of mitochondrial DNA originating from gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae in said organic material is determined by amplification of at least one sequence or fragment of mitochondrial DNA specific to the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, and contained in the mitochondrial DNA extracted from said sample, namely at least one sequence or fragment present in the genomes of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, but absent from the genomes of the other animal genera, and in particular of the other animal species. 2. Method for detecting the presence of biological materials originating from gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, in a sample of organic material, and for identifying the genus, in particular of at least one species of gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, present in said sample, characterized in that the presence of mitochondrial DNA originating from gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae in said organic material is determined by amplification of at least one sequence or fragment of mitochondrial DNA specific to the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, and contained in the mitochondrial DNA extracted from said sample, namely at least one sequence or fragment present in the genomes of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, but absent from the genomes of the other animal genera, in particular of the other animal species, and in that at least one sequence or fragment of mitochondrial DNA specific to the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, thus amplified, is compared with other mitochondrial DNA sequences of the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, said sequence of mitochondrial DNA or said fragment of mitochondrial DNA specific to the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, thus amplified, displaying at least approximately 50% identity, in particular approximately 60% identity with the other aforementioned sequences of mitochondrial DNA of the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae. 3. Method according to claim 1, characterized in that it allows the detection and optionally the identification of the presence of gadidae, in particular chosen from the group constituted by Gadus morhua (common cod), Melanogrammus aeglefinus (haddock), Merlangius merlangus (whiting), Micromesistius poutassou (blue whiting), Pollachius virens (pollock), Pollachius pollachius (pollack), Trisopterus luscus (common pout), Trisopterus minutus capelanus (poor cod), Theragra chalcogramma (Alaskan pollock), Brome brome (tusk), Molva molva (ling) or Molva dypterygia dypterigia (blue ling). 4. Method according to claim 1, characterized in that it allows the detection and optionally the identification of the presence of merluccidae, in particular chosen from the group constituted by Merluccius albidus (offshore hake), Merluccius australis (Southern hake), Merluccius bilinearis (silver hake), Merluccius capensis (shallow-water Cape hake), Merluccius gayi (Chilean hake), Merluccius hubbsi (Argentine hake), Merluccius merluccius (common hake), Merluccius paradoxus (deep-water Cape hake), Merluccius productus (North Pacific hake), Merluccius senegalensis (Senegalese hake), Steindachneria argentea (silver hake). 5. Method according to claim 1, characterized in that the amplified sequence or fragment of the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, is situated in the central part of the gene coding for the cytochrome c oxidase of the mitochondrial DNA, delimited by the nucleotides situated in the vicinity of positions 6100 and 6601, and in particular in the vicinity of positions 6120 and 6590, and preferably in the vicinity of positions 6131 and 6580 of the gene coding for the cytochrome c oxidase of the mitochondrial DNA. 6. Oligonucleotides characterized in that that they are chosen from those: (1)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No1 (positions 6131 to 6154 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TRT AYC ARC AYY TRT TYT GRT TCT K in which R is A or G, Y is C or T, K is G or T, on condition that the following sequences are excluded: CGG GAT CCT GTT CTG ATT CTT GAT TTC C (SEQ ID NO: 69) and CGA CGG GAT CCC AAC ACC TGT TTC GAT CAT CGC GGC AAC (SEQ ID NO: 70) or comprising the following sequence SEQ ID No2 (positions 6134 to 6154 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): AYC ARC AYY TRT TYT GRT TCT in which Y is C or T, R is A or G, or constituted by the following sequence SEQ ID No3 (positions 6139 to 6153 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): AYY TRT TYT GRT TCT in which Y is C or T, R is A or G, or those (2)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No4 (positions 6244 to 6269 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TTY GGN YAY ATR GGN ATR GTN TGA GC in which Y is C or T, N is A, C, G or T, R is A or G, or comprising the following sequence SEQ ID No5 (positions 6247 to 6269 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GGN YAY ATR GGN ATR GTN TGA GC in which N is A, C, G or T, Y is C or T, R is A or G, or constituted by the following sequence SEQ ID No6 (positions 6253 to 6269 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): RGG NAT RGT NTG AGC in which R is A or G, N is A, C, G or T, or those (3)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No7 (positions 6556 to 6580 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TAY GTW GTN GCN CAY TTY CAC TAC G in which Y is C or T, W is A or T, N is A, C, G or T, or comprising the following sequence SEQ ID No8 (positions 6556 to 6575 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TAY GTW GTN GCN CAY TTY CA in which Y is C or T, W is A or T, N is A, C, G or T, or constituted by the following sequence SEQ ID No9 (positions 6556 to 6570 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TAY GTW GTN GCN CAY in which Y is C or T, W is A or T, N is A, C, G or T, or those (4)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No10 (positions 6131 to 6154 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TRT AYC ARC AYY TRT TYT GRT TCT K in which R is A or G, Y is C or T, K is G or T, or comprising the following sequence SEQ ID No11 (positions 6134 to 6154 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): ACC AAC ACT TAT TCT GAT TCT or constituted by the following sequence SEQ ID No12 (positions 6139 to 6154 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): AYY AAC ACT TAT TCT in which Y is C or T, or those (5)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No13 (positions 6277 to 6303 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): CYA TYG GMC TYT YGG YTT TAT YGT V in which Y is C or T, M is A or C, V is A, C or G, or comprising the following sequence SEQ ID No14 (positions 6283 to 6303 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GGC CTC CTT GGC TTT ATT GTA or constituted by the following sequence SEQ ID No15 (positions 6288 to 6303 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): YTY GGY TTT ATT GTV in which Y is C or T, V is A, C or G, or those (6)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No16 (positions 6496 to 6522 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GGM YTW ACA GGN ATY RTH YTR GCY AA in which M is A or C, W is A or T, Y is C or T, N is A, C, G or T, R is A or G, H is A, C or T, or comprising the following sequence SEQ ID No17 (positions 6496 to 6519 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GGC TTA ACA GGA ATT GTA CTA GCT or constituted by the following sequence SEQ ID No18 (positions 6496 to 6510 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GGC TTA ACA GGA ATT or those (7)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No19 (positions 6195 to 6219 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): CGG RAT AAT YTC YCA YAT YGT AGC C in which R is A or G, Y is C or T, or comprising the following sequence SEQ ID No20 (positions 6200 to 6219 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TAA TYT CYC AYA TYG TAG CC in which Y is C or T, or constituted by the following sequence SEQ ID No21 (positions 6205 to 6219 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TCY CAY ATY GTA GCC in which Y is C or T, or those (8)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No22 (positions 6324 to 6348 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): AGT BGG RAT RGA YGT DGA YAC MCG T in which B is C, G or T, R is A or G, Y is C or T, D is A, G or T, M is A or C, or comprising the following sequence SEQ ID No23 (positions 6329 to 6348 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GRA TRG AYG TDG AYA CMC GT in which R is A or G, Y is C or T, D is A, G or T, M is A or C, or constituted by the following sequence SEQ ID No24 (positions 6334 to 6348 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GAY GTD GAY ACM CGT in which Y is C or T, D is A, G or T, M is A or C, or those (9)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No25 (positions 6498 to 6523 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): ACT TAC AGG NAT YRT HCT RGC YAA YT in which N is A, C, G or T, Y is C or T, R is A or G, H is A, C or T, or comprising the following sequence SEQ ID No26 (positions 6498 to 6517 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): ACT TAC AGG NAT YRT HCT RG in which N is A, C, G or T, Y is C or T, R is A or G, H is A, C or T, or constituted by the following sequence SEQ ID No27 (positions 6498 to 6512 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): ACT TAC AGG NAT YRT in which N is A, C, G or T, Y is C or T, R is A or G, or those (10)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No28 (positions 6399 to 6423 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): AGT YTT YAG YTG AYT AGC AAC YYT V in which Y is C or T, V is A, C or G, or comprising the following sequence SEQ ID No29 (positions 6404 to 6423 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TTA GCT GAT TAG CAA CTT TA or constituted by the following sequence SEQ ID No30 (positions 6409 to 6423 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TGA YTA GCA ACY YTV in which Y is C or T, V is A, C or G, or those (11)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No31 (positions 6552 to 6577 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): RTA YTA YGT AGT MGC YCA YTT YCA CT in which R is A or G, Y is C or T, M is A or C, or comprising the following sequence SEQ ID No32 (positions 6552 to 6572 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GTA TTA CGT AGT AGC CCA TT or constituted by the following sequence SEQ ID No33 (positions 6552 to 6566 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): RTA YTA YGT AGT MGC in which R is A or G, Y is C or T, M is A or C, or those (12)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No34 (positions 6237 to 6261 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): AGA RCC NTT YGG RYA YAT RGG HAT R in which R is A or G, N is A, C, G or T, Y is C or T, H is A, C or T, or comprising the following sequence SEQ ID No35 (positions 6242 to 6261 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): CCT TTG GAT ATA TAG GCA TG or constituted by the following sequence SEQ ID No36 (positions 6248 to 6261 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GGR YAY ATR GGH ATR in which R is A or G, Y is C or T, H is A, C or T, or those (13)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No37 (positions 6381 to 6406 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): YAT YCC RAC AGG YGT WAA AGT YTT YA in which Y is C or T, R is A or G, W is A or T, or comprising the following sequence SEQ ID No38 (positions 6381 to 6400 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TAT CCC AAC AGG TGT AAA AG or constituted by the following sequence SEQ ID No39 (positions 6381 to 6395 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TAT YCC RAC AGG YGT in which Y is C or T, R is A or G, or those (14)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No40 (positions 6267 to 6291 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): AGC YAT RAT RGC YAT YGG MCT YCT Y in which Y is C or T, R is A or G, M is A or C, or comprising the following sequence SEQ ID No41 (positions 6272 to 6291 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TGA TGG CTA TTG GCC TCC TC or constituted by the following sequence SEQ ID No42 (positions 6277 to 6291 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GCY ATY GGM CTY CTY in which Y is C or T, M is A or C, or those (15)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No43 (positions 6451 to 6475 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): HCC BMT MCT BTG RGC CCT V GG YTT YA in which H is A, C or T, B is C, G or T, M is A or C, R is A or G, V is A, C or G, Y is C or T, or comprising the following sequence SEQ ID No44 (positions 6451 to 6469 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): CCC TCT ACT CTG AGC CCT AG or constituted by the following sequence SEQ ID No45 (positions 6451 to 6464 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): HCC BMT MCT BTG RGC in which H is A, C or T, B is C, G or T, M is A or C, R is A or G, or those (16)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No46 (positions 6194 to 6219 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TSG RAT AAT YTC YCA YAT YGT AGC V in which S is C or G, R is A or G, Y is C or T, V is A, C or G, or comprising the following sequence SEQ ID No47 (positions 6200 to 6219 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TAA TTT CTC ACA TCG TAG CG or constituted by the following sequence SEQ ID No48 (positions 6205 to 6219 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TCY CAY ATY GTA GCV in which Y is C or T, V is A, C or G, or those (17)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No49 (positions 6342 to 6366 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): YAC MCG WGC HTA CTT YAC ATC YGC A in which Y is C or T, M is A or C, W is A or T, H is A, C or T or comprising the following sequence SEQ ID No50 (positions 6342 to 6361 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TAC ACG TGC CTA CTT TAC AT or constituted by the following sequence SEQ ID No51 (positions 6342 to 6356 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): YAC MCG WGC HTA CTT in which Y is C or T, M is A or C, W is A or T, H is A, C or T, or those (18)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No52 (positions 6152 to 6177 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): TCT KCG GNC AYC CYG AAG THT AYA TH in which K is G or T, N is A, C, G or T, Y is C or T, H is A, C or T, or comprising the following sequence SEQ ID No53 (position 6158 to 6177 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GAC ACC CCG AAG TAT ACA TA or constituted by the following sequence SEQ ID No54 (positions 6163 to 6177 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): CCY GAA GTH TAY ATH in which Y is C or T, H is A, C or T, or those (19)—displaying a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, comprised in the following sequence SEQ ID No55 (positions 6303 to 6328 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): VTG RGC YCA YCA CAT RTT YAC AGT BG in which V is A, C or G, R is A or G, Y is C or T, B is C, G or T, or comprising the following sequence SEQ ID No56 (positions 6303 to 6322 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): GTG AGC CCA TCA CAT GTT TA or constituted by the following sequence SEQ ID No57 (positions 6303 to 6317 according to Johansen and Bakke, 1996, Molecular Marine Biology and Biotechnology, 5(3) 203-214): VTG RGC YCA YCA CAT, in which V is A, C or G, R is A or G, Y is C or T. 7. Pairs of primers characterized in that that they are constituted: by any one of the oligonucleotides SEQ ID No1, SEQ ID No2, SEQ ID No3, SEQ ID No4, SEQ ID No5, SEQ ID No6, and any one of the oligonucleotides SEQ ID No7, SEQ ID No8, SEQ ID No9 according to claim 6 or, by any one of the oligonucleotides SEQ ID No10, SEQ ID No11, SEQ ID No12, SEQ ID No13, SEQ ID No14, SEQ ID No15, and any one of the oligonucleotides SEQ ID No16, SEQ ID No17, SEQ ID No18 according to claim 6 or, by any one of the oligonucleotides SEQ ID No19, SEQ ID No20, SEQ ID No21, SEQ ID No22, SEQ ID No23, SEQ ID No24, and any one of the oligonucleotides SEQ ID No25, SEQ ID No26, SEQ ID No27 according to claim 6 or, by any one of the oligonucleotides SEQ ID No28, SEQ ID No29, SEQ ID No30, and any one of the oligonucleotides SEQ ID No31, SEQ ID No32, SEQ ID No33 according to claim 6 or, by any one of the oligonucleotides SEQ ID No34, SEQ ID No35, SEQ ID No36, and any one of the oligonucleotides SEQ ID No37, SEQ ID No38, SEQ ID No39 according to claim 6 or, by any one of the oligonucleotides SEQ ID No40, SEQ ID No41, SEQ ID No42, and any one of the oligonucleotides SEQ ID No43, SEQ ID No44, SEQ ID No45 according to claim 6 or, by any one of the oligonucleotides SEQ ID No46, SEQ ID No47, SEQ ID No48, and any one of the oligonucleotides SEQ ID No49, SEQ ID No50, SEQ ID No51 according to claim 6 or, by any one of the oligonucleotides SEQ ID No52, SEQ ID No53, SEQ ID No54, and any one of the oligonucleotides SEQ ID No55, SEQ ID No56, SEQ ID No57 according to claim 6, and advantageously constituted by the pair of oligonucleotides chosen from the following pairs: (SEQ ID No2 and SEQ ID No8), (SEQ ID No5 and SEQ ID No8), (SEQ ID No11 and SEQ ID No17), (SEQ ID No14 and SEQ ID No17), (SEQ ID No20 and SEQ ID No26), (SEQ ID No23 and SEQ ID No26), (SEQ ID No29 and SEQ ID No32), (SEQ ID No35 and SEQ ID No38), (SEQ ID No41 and SEQ ID No44), (SEQ ID No47 and SEQ ID No50), (SEQ ID No53 and SEQ ID No56). 8. Method according to claim 1, characterized in that the amplification of at least one sequence or fragment of mitochondrial DNA specific to the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, is carried out by the polymerase chain amplification method (PCR), comprising a repetition of the cycle of the following stages: heating of the DNA extracted from the sample of organic material, so as to separate the DNA into two single-chain strands, hybridization of oligonucleotide primers according to claims 6 and 7 or sequences CGG GAT CCT GTT CTG ATT CTT GAT TTC C (SEQ ID NO: 69) and CGA CGG GAT CCC AAC ACC TGT TTC GAT CAT CGC GGC AAC (SEQ ID NO: 70), to the monocatenary DNA strands at an adequate temperature, and elongation of the oligonucleotide primers by a polymerase at an adequate temperature, in order to obtain at least one amplified DNA sequence or fragment specific to the genome of the gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae. 9. Method according to claim 1, characterized in that the obtained amplified mitochondrial DNA fragment(s) contained in the amplification product is (are) identified: by sequencing of at least one amplified DNA fragment, and in particular of one amplified DNA fragment or, directly, by visualization of the presence of the amplification product by gel electrophoresis. 10. Method according to claim 9, characterized in that the sequencing of each of the amplified DNA fragments is preceded by a cloning method when the sample of organic material comprises a mixture of different DNA fragments originating from different species of gadiformes chosen from the group constituted by the gadidae, the merluccidae, the macrouridae and/or the moridae, said cloning method permitting the separation from said mixture of the different DNA fragments originating from the different species of gadiformes. 11. Method according to claim 1, characterized in that the DNA extracted from the sample of organic material is: non-degraded DNA originating in particular from a fresh sample or, degraded DNA, originating in particular from a sample that has been transformed, in particular cooked, lyophilized, dried, pickled, appertized, pasteurized etc. 12. DNA fragment as amplified at the end of the method according to claim 1, characterized in that it comprises approximately 100 to approximately 500 base pairs. 13. DNA fragment according to claim 12, characterized in that it displays a sequence identity of at least 80%, preferably 90% and advantageously 95% with at least one of the sequences contained in: the following SEQ ID No58: AYCARCAYYT RTTCTGATTC TKCGGNCAYC CYGAAGTHTA YATHCTNATY YTMCCHGGMT TCGGRATAAT YTCYCAYATY GTAGCVTAYT AYTCAGGNAA RMAAGARCCN TTYGGRYAYA TRGGHATRGT NTGAGCYATR ATRGCYATYG GMCTYCTYGG YTTTATYGTV TGRGCYCAYC ACATRTTYAC AGTBGGRATR GAYGTDGAYA CMCGWGCHTA CTTYACATCY GCAACBATAA TYATYGCYAT YCCRACAGGY GTWAAAGTYT TYAGYTGAYT AGCAACYYTV CAYGGRGGCT CARTTAARTG RGAVACHCCB MTMCTBTGRG CCCTDGGYTT YATYTTYCTM TTYACMGTHG GVGGMYTWAC AGGNATYRTH YTRGCYAAYT CYTCYCTAGA YATYGTDCTY CAYGAYACRT AYTAMGTAGT MGCYCAYTTY CA in which Y is C or T, R is A or G, K is G or T, N is A, C, G or T, H is A, C or T, M is A or C, V is A, C or G, B is C, G or T, D is A, G or T, W is A or T, said sequence SEQ ID No 58 comprising 442 base pairs, or the following SEQ ID No59: GGRYAYATRG GHATRGTNTG AGCYATRATR GCYATYGGMC TYCTYGGYTT TATYGTVTGR GCYCAYCACA TRTTYACAGT BGGRATRGAY GTDGAYACMC GWGCHTACTT YACATCYGCA ACBATAATYA TYGCYATYCC RACAGGYGTW AAAGTYTTYA GYTGAYTAGC ACYYTVCAYG GRGGCTCART TAARTGRGAV ACHCCBMTMC TBTGRGCCCT DGGYTTYATY TTYCTMTTYA CMGTHGGVGG MYTWACAGGN ATYRTHYTRG CYAAYTCYTC YCTAGAYATY GTDCTYCAYG AYACRTAYTA MGTAGTMGCY CAYTTYCA in which R is A or G, Y is C or T, K is G or T, N is A, C, G or T, H is A, C or T, M is A or C, V is A, C or G, B is C, G or T, D is A, G or T, W is A or T, said sequence SEQ ID No 59 comprising 328 base pairs, or the following SEQ ID No60: AYCARCAYYT RTTCTGATTC TKCGGNCAYC CYGAAGTHTA YATHCTNATY YTMCCHGGMT TCGGRATAAT YTCYCAYATY GTAGCVTAYT AYTCAGGNAA RMAAGARCCN TTYGGRYAYA TRGGHATRGT NTGAGCYATR ATRGCYATYG GMCTYCTYGG YTTTATYGTV TGRGCYCAYC ACATRTTYAC AGTBGGRATR GAYGTDGAYA CMCGWGCHTA CTTYACATCY GCAACBATAA TYATYGCYAT YCCRACAGGY GTWAAAGTYT TYAGYTGAYT AGCAACYYTV CAYGGRGGCT CARTTAARTG RGAVACHCCB MTMCTBTGRG CCCTDGGYTT YATYTTYCTM TTYACMGTHG GVGGMYTWAC AGGNATYRTH YTRGCY in which Y is C or T, R is A or G, K is G or T, N is A, C, G or T, H is A, C or T, M is A or C, V is A, C or G, B is C, G or T, D is A, G or T, W is A or T, said sequence SEQ ID No60 comprising 386 base pairs, or the following SEQ ID No61: GGMCTYCTYG GYTTTATYGT VTGRGCYCAY CACATRTTYA CAGTBGGRAT RGAYGTDGAY ACMCGWGCHT ACTTYACATC YGCAACBATA ATYATYGCYA TYCCRACAGG YGTWAAAGTY TTYAGYTGAY TAGCAACYYT VCAYGGRGGC TCARTTAART GRGAVACHCC BMTMCTBTGR GCCCTDGGYT TYATYTTYCT MTTYACMGTH GGVGGMYTWA CAGGNATYRT HYTRGCY in which Y is C or T, R is A or G, K is G or T, N is A, C, G or T, H is A, C or T, M is A or C, V is A, C or G, B is C, G or T, D is A, G or T, W is A or T, said sequence SEQ ID No 61 comprising 237 base pairs, or the following SEQ ID No62: TAATYTCYCA YATYGTAGCV TAYTAYTCAG GNAARMAAGA RCCNTTYGGR YAYATRGGHA TRGTNTGAGC YATRATRGCY ATYGGMCTYC TYGGYTTTAT YGTVTGRGCY CAYCACATRT TYACAGTBGG RATRGAYGTD GAYACMCGWG CHTACTTYAC ATCYGCAACB ATAATYATYG CYATYCCRAC AGGYGTWAAA GTYTTYAGYT GAYTAGCAAC YYTVCAYGGR GGCTCARTTA ARTGRGAVAC HCCBMTMCTB TGRGCCCTDG GYTTYATYTT YCTMTTYACM GTHGGVGGMY TWACAGGNAT YRTHYTRG in which Y is C or T, R is A or G, K is G or T, N is A, C, G or T, H is A, C or T, M is A or C, V is A, C or G, B is C, G or T, D is A, G or T, W is A or T, said sequence SEQ ID No 62 comprising 318 base pairs, or the following SEQ ID No63: GRATRGAYGT DGAYACMCGW GCHTACTTYA CATCYGCAAC BATAATYATY GCYATYCCRA CAGGYGTWAA AGTYTTYAGY TGAYTAGCAA CYYTVCAYGG RGGCTCARTT AARTGRGAVA CHCCBMTMCT BTGRGCCCTD GGYTTYATYT TYCTMTTYAC MGTHGGVGGM YTWACAGGNA TYRTHYTRG in which R is A or G, Y is C or T, D is A, G or T, M is A or C, W is A or T, B is C, G or T, V is A, C or G, H is A, C or T, N is A, C, G or T, said sequence SEQ ID No63 comprising 189 base pairs, or the following SEQ ID No64: TYAGYTGAYT AGCAACYYTV CAYGGRGGCT CARTTAARTG RGAVACHCCB MTMCTBTGRG CCCTDGGYTT YATYTTYCTM TTYACMGTHG GVGGMYTWAC AGGNATYRTH YTRGCYAAYT CYTCYCTAGA YATYGTDCTY CAYGAYACRT AYTAMGTAGT MGCYCAYT in which Y is C or T, V is A, C or G, R is A or G, B is C, G or T, H is A, C or T, M is A or C, D is A, G or T, N is A, C, G or T, said sequence SEQ ID No64 comprising 168 base pairs, or the following SEQ ID No65: CNTTYGGRYA YATRGGHATR GTNTGAGCYA TRATRGCYAT YGGMCTYCTY GGYTTTATYG TVTGRGCYCA YCACATRTTY ACAGTBGGRA TRGAYGTDGA YACMCGWGCH TACTTYACAT CYGCAACBAT AATYATYGCY ATYCCRACAG GYGTWAAAG in which N is A, C, G or T, R is A or G, Y is C or T, H is A, C or T, M is A or C, V is A, C or G, B is C, G or T, D is A, G or T, W is A or T, said sequence comprising 159 base pairs, or the following sequence SEQ ID No66: TRATRGCYAT YGGMCTYCTY GGYTTTATYG TVTGRGCYCA YCACATRTTY ACAGTBGGRA TRGAYGTDGA YACMCGWGCH TACTTYACAT CYGCAACBAT AATYATYGCY ATYCCRACAG GYGTWAAAGT YTTYAGYTGA YTAGCAACYY TVCAYGGRGG CTCARTTAAR TGRGAVACHC CBMTMCTBTG RGCCCTDG in which R is A or G, Y is C or T, M is A or C, V is A, C or G, B is C, G or T, D is A, G or T, W is A or T, H is A, C or T. said SEQ ID No66 comprising 198 base pairs, the following SEQ ID No67: TAATYTCYCA YATYGTAGCV TAYTAYTCAG GNAARMAAGA RCCNTTYGGR YAYATRGGHA TRGTNTGAGC YATRATRGCY ATYGGMCTYC TYGGYTTTAT YGTVTGRGCY CAYCACATRT TYACAGTBGG RATRGAYGTD GAYACMCGWG CHTACTTYAC AT in which Y is C or T, V is A, C or G, N is A, C, G or T, R is A or G, M is A or C, H is A, C or T, B is C, G or T, D is A, G or T, W is A or T, said sequence SEQ ID No67 comprising 162 base pairs, or the following SEQ ID No68: GNCAYCCYGA AGTHTAYATH CTNATYYTMC CHGGMTTCGG RATAATYTCY CAYATYGTAG CVTAYTAYTC AGGNAARMAA GARCCNTTYG GRYAYATRGG HATRGTNTGA GCYATRATRG CYATYGGMCT YCTYGGYTTT ATYGTVTGRG CYCAYCACAT RTTYA in which N is A, C, G or T, Y is C or T, H is A, C or T, M is A or C, R is A or G, V is A, C or G, said sequence SEQ ID NO 68 comprising 165 base pairs. 14. Method according to claim 1, characterized in that the presence of mitochondrial DNA originating from gadiformes in a sample of organic material is detected by amplification of at least one sequence of mitochondrial DNA specific to the genome of the gadiformes using any one of the oligonucleotides SEQ ID No1, SEQ ID No2, SEQ ID No3, SEQ ID No4, SEQ ID No5, SEQ ID No6, and any one of the oligonucleotides SEQ ID No7, SEQ ID No8, SEQ ID No9 as defined in claim 6, and advantageously using the pair of oligonucleotides (SEQ ID No2 and SEQ ID No8) or the pair of oligonucleotides (SEQ ID No5 and SEQ ID No8), in order to obtain respectively at least one of the DNA sequences contained in SEQ ID No58 or in SEQ ID No59 as defined in claim 13, said sequences being specific to the genome of the gadiformes, and in that at least one species of gadiforme present in said sample of organic material is identified by sequencing of at least one of the DNA sequences contained in SEQ ID No58 or in SEQ ID No59. 15. Method according to any claim 1, characterized in that the presence of mitochondrial DNA originating from gadidae in a sample of organic material is detected by amplification of at least one sequence of mitochondrial DNA specific to the genome of the gadidae using any one of the oligonucleotides SEQ ID No10, SEQ ID No11, SEQ ID No12, SEQ ID No13, SEQ ID No14, SEQ ID No15, and any one of the oligonucleotides SEQ ID No16, SEQ ID No17, SEQ ID No18 as defined in claim 6, and advantageously using the pair of oligonucleotides (SEQ ID No11 and SEQ ID No17) or the pair of oligonucleotides (SEQ ID No14 and SEQ ID No17), in order to obtain respectively at least one of the DNA sequences contained in SEQ ID No60 or in SEQ ID No61 as defined in claim 13, said sequences being specific to the genome of the gadidae, and in that at least one species of gadidae present in said sample of organic material is identified by sequencing of at least one of the DNA sequences contained in SEQ ID No60 or in SEQ ID No61. 16. Method according to claim 1, characterized in that the presence of DNA originating from merluccidae in a sample of organic material is detected by amplification of at least one sequence of mitochondrial DNA specific to the genome of the merluccidae using any one of the oligonucleotides SEQ ID No19, SEQ ID No20, SEQ ID No21, SEQ ID No22, SEQ ID No23, SEQ ID No24, and any one of the oligonucleotides SEQ ID No25, SEQ ID No26, SEQ ID No27 as defined in claim 6, and advantageously using the pair of oligonucleotides (SEQ ID No20 and SEQ ID No26) or the pair of oligonucleotides (SEQ ID No23 and SEQ ID No26), in order to obtain respectively at least one of the DNA sequences contained in SEQ ID No62 or in SEQ ID No63 as defined in claim 13, said sequences being specific to the genome of the merluccidae, and in that at least one species of merluccidae present in said sample of organic material is identified by sequencing of at least one of the DNA sequences contained in SEQ ID No62 or in SEQ ID No63. 17. Method according to claim 1, characterized in that the presence of mitochondrial DNA originating from gadiformes is identified in a sample of organic material, and in particular of gadidae chosen from the group constituted by the species Gadus morhua (common cod), Pollachius virens (pollock), Theragra chalcogramma (Alaskan pollock), Melanogrammus aeglefinus (haddock) and Merlangius merlangus (whiting), and in that each of the aforementioned species is identified by amplification of at least one DNA sequence specific to the genome of each of the aforementioned species of gadidae, with the help respectively: of any one of the oligonucleotides SEQ ID No28, SEQ ID No29, SEQ ID No30, and any one of the oligonucleotides SEQ ID No31, SEQ ID No32, SEQ ID No33 as defined in claim 6 or, of any one of the oligonucleotides SEQ ID No34, SEQ ID No35, SEQ ID No36, and any one of the oligonucleotides SEQ ID No37, SEQ ID No38, SEQ ID No39 as defined in claim 6 or, of any one of the oligonucleotides SEQ ID No40, SEQ ID No41, SEQ ID No42, and any one of the oligonucleotides SEQ ID No43, SEQ ID No44, SEQ ID No45 as defined in claim 6 or, of any one of the oligonucleotides SEQ ID No46, SEQ ID No47, SEQ ID No48, and any one of the oligonucleotides SEQ ID No49, SEQ ID No50, SEQ ID No51 as defined in claim 6 or, of any one of the oligonucleotides SEQ ID No52, SEQ ID No53, SEQ ID No54, and any one of the oligonucleotides SEQ ID No55, SEQ ID No56, SEQ ID No57 as defined in claim 6, and advantageously using respectively: the pair of oligonucleotides (SEQ ID No29 and SEQ ID No32) or, the pair of oligonucleotides (SEQ ID No35 and SEQ ID No38) or, the pair of oligonucleotides (SEQ ID No41 and SEQ ID No44) or, the pair of oligonucleotides (SEQ ID No47 and SEQ ID No50) or, the pair of oligonucleotides (SEQ ID No53 and SEQ ID No56), in order to obtain respectively at least one of the DNA sequences contained in: SEQ ID No64 specific to the genome of Gadus morhua (common cod), SEQ ID No65 specific to the genome of Pollachius virens (pollock), SEQ ID No66 specific to the genome of Theragra chalcogramma (Alaskan pollock), SEQ ID No67 specific to the genome of Melanogrammus aeglefinus (haddock), SEQ ID No68 specific to the genome of Merlangius merlangus (whiting), said SEQ ID No64, SEQ ID No65, SEQ ID No66, SEQ ID No67 and SEQ ID No68. 18. A method for detecting the presence of biological materials originating from gadiformes, comprising screening for nucleotide sequences chosen from the oligonucleotide primers according to claim 6 or from sequences CGG GAT CCT GTT CTG ATT CTT GAT TTC C (SEQ ID NO: 69) and CGA CGG GAT CCC AAC ACC TGT TTC GAT CAT CGC GGC AAC (SEQ ID NO: 70). |
Method for determining the existence of animal or vegetable mixtures in organic substrates |
The invention relates to the use of a cloning method for determining the existence and the identification of a mixture of organic origin containing DNA from different animal species and/or different vegetable species and/or different human individuals. |
1. A cloning method for determining the existence of a mixture of organic origin containing mitochondrial or chloroplast DNA of different animal species, populations or races and/or different vegetable species, populations or races and/or different human individuals, comprising: amplifying each DNA sequence present, cloning the amplification product to separate different DNA sequences present in the mixture, and sequencing each DNA sequence. 2. The method according to claim 1, characterized in that the mitochondrial or chloroplast DNA is degraded. 3. The method according to claim 1 to detect and/or identify the DNA of each of the different animal species, populations or races and/or each of the different vegetable species, populations or races and/or each of the different human individuals present in a mixture of organic origin containing DNA from animal species, populations or races and/or from vegetable species, populations or races and/or from human individuals. 4. The method according to claim 1, in which each animal species, population or race and/or each vegetable species, population or race and/or each human individual is represented by at least one DNA sequence or at least one DNA fragment, and in particular by a unique DNA sequence or a unique DNA fragment, each of said DNA sequences or each of said DNA fragments being taken from DNA extracted from the mixture of organic origin. 5. The method according to claim 1 to detect and/or identify the DNA of each of the different animal species present in a mixture of animal species and in particular the DNA of each of the sub-species, lineages, races, varieties and/or strains and/or populations present in said mixture. 6. The method according to claim 1 for detecting and/or identifying the DNA of each of the different vegetable species present in a mixture of vegetable species and in particular the DNA of each of the sub-species, lineages, races, varieties and/or strains, cepage and/or populations present in said mixture, each of said vegetable species, and in particular each of said sub-species, races, varieties and/or strains, being represented by at least one DNA sequence or at least one DNA fragment, and in particular by a unique DNA sequence or a unique DNA fragment. 7. The method according to claim 1 for detecting and/or identifying the DNA of each of the different human individuals present in a mixture of DNA from different human individuals, each of said human individuals being represented by at least one DNA sequence or at least one DNA fragment, and in particular by a unique DNA sequence or a unique DNA fragment. 8. The method according to claim 1, in which the DNA extracted from the mixture of organic origin is old (or fossil) DNA, degraded DNA or modern DNA. 9. The method according to claim 1, in which the DNA extracted from the mixture of organic origin is: non-degraded DNA, in particular taken from a fresh organic sample or, degraded DNA, in particular taken from a processed sample, in particular one which has been cooked, freeze-dried, dried, preserved in brine, canned or pasteurized. 10. The method according to claim 1 for detecting and possibly identifying the DNA of each of the different animal species, populations or races and/or each of the different vegetable species, populations or races and/or each of the different human individuals present in the mixture of organic origin, in which at least one of said species, populations or races and/or at least one of said individuals is represented by an old DNA sequence or an old DNA fragment. 11. The method according to claim 1, in which the cloning method is preceded by a stage during which each of the DNA sequences or each of the DNA fragments characteristic of each of the animal species, populations or races and/or each of the vegetable species, populations or races and/or each of the human individuals to be detected and/or identified is amplified, the amplified DNA sequences or the amplified DNA fragments obtained from the amplification process being contained in a unique amplification product. 12. The method according to claim 11, in which each amplified DNA sequence or each amplified DNA fragment is of nuclear or mitochondrial origin if seeking to detect and/or identify a mixture containing DNA from different animal species and/or different human individuals and is of nuclear, mitochondrial or chloroplastal origin if seeking to detect and/or identify a mixture containing DNA from different vegetable species. 13. Method for detecting and/or identifying the DNA of each of the different animal species, populations or races and/or each of the different vegetable species, populations or races and/or of each of the different human individuals present in a mixture of organic origin, each of said animal species, population or race and/or each of said vegetable species, population or race and/or each of said human individuals being represented by at least one DNA sequence or at least one DNA fragment, in particular a unique DNA sequence or a unique DNA fragment, each of said DNA sequences or each of said DNA fragments being taken from the DNA extracted from said mixture, said method being characterized in that it comprises the following stages: amplification of each of the DNA sequences or each of the DNA fragments characteristic of the animal species, population or race, of the vegetable species, population or race, or of the human individual to be detected and/or identified, in particular by the polymerase chain amplification method (PCR), in order to obtain a unique amplification product containing the different amplified DNA fragments or the different amplified DNA sequences, cloning the amplification product obtained from the preceding amplification stage, in order to separate the different DNA sequences or the different DNA fragments present in the mixture of organic origin, sequencing each of the DNA sequences or each of the DNA fragments thus separated from said mixture. 14. Method of detection and/or identification according to claim 13, in which: the polymer chain amplification method (PCR) includes repeating the cycle of the following stages: heating of the DNA extracted from the mixture of organic origin in order to separate the DNA into two single-chain strands, hybridization of the single-chain DNA strands at an appropriate temperature with the appropriate oligonucleotide primers in order to amplify the DNA of the animal or vegetable species, populations or races or the human individuals to be detected and/or identified, elongation of said appropriate oligonucleotide primers with a polymerase at an adequate temperature in order to obtain a unique amplification product containing each of said DNA sequences or each of said DNA fragments characteristic of a given animal or vegetable species or a human individual, cloning the amplification product obtained from the preceding amplification stage, comprising the following stages: with a DNA ligase enzyme, inserting said unique amplification product containing the different amplified DNA sequences or the different amplified DNA fragments characteristic of the DNA of the animal species, population or race, the vegetable species, population or race or the human individual to be detected and/or identified, in a previously linearized plasmid, in order to obtain several plasmids, each containing a unique amplified DNA sequence or a unique amplified DNA fragment, incorporating each plasmid obtained from the preceding stage respectively in a bacterium, in particular Escherichia coli (E. coli), multiplying each of the bacteria obtained in the preceding stage by cultivating said bacteria in an appropriate medium, in the presence of an antibiotic, in particular ampicillin, in order to select the bacteria which have incorporated a plasmid in which a DNA fragment or a DNA sequence has been inserted, separating each of the plasmids containing a unique DNA sequence or a unique DNA fragment from each of the bacteria containing said plasmids in order to recover all the plasmids or “plasmid DNA” thus multiplied, each of said plasmids containing a unique DNA sequence or a unique DNA fragment, taking a sufficient number of plasmids samples (or “plasmid DNA”) from all the plasmids (or “plasmid DNA”) obtained from the preceding stage in order to detect and/or identify at least two different DNA fragments or DNA sequences, each of said DNA sequences or DNA fragments being characteristic of a given animal or vegetable species, population or race, or of a human individual. 15. Method of detection and/or identification according to claim 14, in which each of the plasmid DNA samples obtained after the cloning stage is identified by sequencing, which enables the DNA characteristic of each of the animal species, populations or races and/or each of the vegetable species, populations or races and/or each of the human individuals present in the mixture of organic origin to be identified. 16. Oligonucleotides characterized in that they are selected from those: 1) presenting a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, contained in the following sequence SEQ ID No21 (position 16123 to 16144 of the mitochondrial DNA of salmon—replication control region according to Hurst, et al., 1999. Gene 239: 237-242): GCC GAA TGT AAA GCA TCT GG 2) or those presenting a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, contained in the following sequence SEQ ID No22 (position 16341 to 16361 of the mitochondrial DNA of the salmon—replication control region—according to Hurst, et al., 1999. Gene 239: 237-242): ACC TTA TGC ACT TGA TAT CC 3) or those presenting a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, contained in the following sequence SEQ ID No24 (position 14985 to 14996 of the mitochondrial of the salmon—cytochrome b—according to Hurst, et al., 1999. Gene 239: 237-242): ACC GGG TCT AAT AAC CCA GC 4) or those presenting a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, contained in the following sequence SEQ ID No25 (position 15409 to 15430 of the mitochondrial DNA of the salmon—cytochrome b—according to Hurst, et al., 1999. Gene 239: 237-242): ATG ATA ATG AAT GGG TGT TC 5) or those presenting a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, contained in the following sequence SEQ ID No28 (position 356 to 375 of the mitochondrial DNA of the salmon—replication control region—according to Albert et al., 1992, Science 257 (5076), 1491-1495): AAA GCT CTG CGC GCT CTA CG 6) or those presenting a sequence identity of at least 80%, preferably 90% and advantageously 95% with an oligonucleotide constituted by a sequence of approximately 15 to 25 nucleotides, in particular 20 to 25 nucleotides, contained in the following sequence SEQ ID No29 (position 539 to 558 of the mitochondrial DNA of the salmon—replication control region—according to Albert et al., 1992, Science 257 (5076), 1491-1495): CCG CGG AGA CAT TCA TAA AC 17. Primer pairs characterized in that they are constituted by: the oligonucleotides SEQ ID No21 and SEQ ID No22 the oligonucleotides SEQ ID No24 and SEQ ID No25 the oligonucleotides SEQ ID No28 and SEQ ID No29 18. DNA fragment as amplified using a primer pair according to claim 17 and containing approximately 100 to approximately 500 base pairs. 19. DNA fragment according to claim 18, characterized in that it presents a sequence identity of at least 80%, preferably 90% and advantageously 95% with at least one of the sequences contained in: SEQ ID No23 below: GCCBWWHDWR VVRCAYSTKB BBMWTRVWKH MRATCWYRWT GCSCGTTRMT CRCVRMRVCK DBCRBYYTHTTRWVYRCHYM BGGKWSYYYT YHWTKYWTYY TTWYCKYHYR GSKKGYMYDY MCMRRTRSMABYDMRRRRSK CYVRMRMBSK MRVMCYVKAY STYGMATTCC AGAGARYMYM TGYVTYWKVKYSMWRYSHYA THCTMTHADK DATYRCWYMH TKRGAYRKYH RARYATAHRG KBRAT in which B is C, G or T, W is A or T, H is A, C or T, D is A, G or T, R is A or G, V is A, C or G, Y is C or T, S is C or G, K is G or T, M is A or C, or SEQ ID No26 below: WCVGGVTCHAAYAACCCMVY AGGHATYWMM TCMSAYKYHG AYAAAATYHC MTTYCACCCH TACTWYWCMWWYAARGACVY YYTNGGMTTN VYHSYYWTMC THMYYKBHMT RAYAYYMYTA RYHCTRTTCKCMCCMRACCT CCTMGGVGAC CCRGAHAAYT WYACVCYWGC MAAYCCMYTM RWHACHCCHCCHCAWATCAA RCCHGARTGA TAYTTYYTAT TYGCMTAYRC MATYYTHCGM TCMRTYCYAAYAAACTWGGM GGHGTMCTHG CCCTMKYMBY MTCNRTCCTV RTYCTHDYHV TMRTYCCYHTMCTMCAYAHM TCYAARCAAC RMRSMMTRAY MTTYCGMCCM CTMWSCCAAW BMYTWTWYTGRVYYCTRGYM GCVRACMTHC TNAYHCTHAC MTGAATYGGR RGVMWACCHG TVRRMYACCCHTWYAYYAYC ATYGG in which W is A or T, V is A, C or G, H is A, C or T, Y is C or T, M is A or C, S is C or G, K is G or T, R is A or G, N is A, C, G or T, D is A, G or T, B is C, G or T, or SEQ ID No30 below: AAAGCTCTGCGCGCTCTACG TCTARAGGAT CTGCGAATCC CCCTGCTTAT ACTAAAACTT TCCAAGGCCCGCCTCATGGC ATCCAAGTTG AGAGAGATAA ATTGAACAAG TATGGTCGTC CCCTATTGGGATGTACTATT AAACCTAAAT TGGGGTTATC CGCTAAGAAC TATGGTAGAG CWGTTTATGAATGTCTCCGC GG in which R is A or G, W is A or T. |
Substituted aminoalcohols useful in treatment of alzheimer's disease |
The invention provides compounds of formula (I): useful in treating Alzheimer's disease and other similar diseases. These compounds include inhibitors of the beta-secretase enzyme that are useful in the treatment of Alzheimer's disease and other diseases characterized by deposition of A beta peptide in a mammal. The compounds of the invention are useful in pharmaceutical compositions and methods of treatment to reduce A beta peptide formation. |
1. A substituted aminoalcohol of formula (I): or pharmaceutically acceptable salt or ester thereof, wherein B is H, C1-C10 straight or branched chain alkyl; wherein R20 is H or C1-6 alkyl or alkenyl wherein n is 0 or 1; wherein R1 is: (I) C1-C6 alkyl, optionally substituted with one, two or three substit uents selected from the group consisting of C1-C3 alkyl, C1-C7 alkyl (optionally substituted with C1-C3 alkyl and C1-C3 alkoxy), —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, —OC═O NR1-aR1-b where R1-a and R1-b are as defined above, (II) —CH2—S(O)0-2—(C1-C6 alkyl), (Ill) —CH2—CH2—S(O)0-2—(C1-C6 alkyl), (IV) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (V) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (VI) —(CH2)n1—(R1-aryl) where n1 is zero or one and where R1-aryl is phenyl, 1-naphthyl, 2-naphthyl and indanyl, indenyl, dihydronaphthalyl, tetralinyl optionally substituted with one, two, three or four of the following substituents on the aryl ring: (A) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH , —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (B) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (C) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (D) —F, Cl, —Br and —I, (F) —C1-C6 alkoxy optionally substituted with one, two or three —F, (G) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (H) —OH, (I) —C≡N, (J) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (K) —CO—(C1-C4 alkyl), (L) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (M) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, or (N) —SO2—(C1-C4 alkyl), (VII) —(CH2)n1—(R1-heteroaryl) where n1 is as defined above and where R1-heteroaryl is selected from the group consisting of: (A) pyridinyl, (B) pyrimidinyl, (C) quinolinyl, (F) benzothienyl, (G) indolyl, (H) indolinyl, (I) pryidazinyl, (J) pyrazinyl, (K) isoindolyl, (L) isoquinolyl, (M) quinazolinyl, (N) quinoxalinyl, (O) phthalazinyl, (P) imidazolyl, (Q) isoxazolyl, (R) pyrazolyl, (S) oxazolyl, (T) thiazolyl, (U) indolizinyl, (V) indazolyl, (W) benzothiazolyl, (X) benzimidazolyl, (Y) benzofuranyl, (Z) furanyl, (AA) thienyl, (BB) pyrrolyl, (CC) oxadiazolyl, (DD) thiadiazolyl, (EE) triazolyl, (FF) tetrazolyl, (II) oxazolopyridinyl, (JJ) imidazopyridinyl, (KK) isothiazolyl, (LL) naphthyridinyl, (MM) cinnolinyl, (NN) carbazolyl, (OO) beta-carbolinyl, (PP) isochromanyl, (QQ) chromanyl, (SS) tetrahydroisoquinolinyl, (TT) isoindolinyl, (UU) isobenzotetrahydrofuranyl, (VV) isobenzotetrahydrothienyl, (WW) isobenzothienyl, (XX) benzoxazolyl, (YY) pyridopyridinyl, (ZZ) benzotetrahydrofuranyl, (AAA) benzotetrahydrothienyl, (BBB) purinyl, (CCC) benzodioxolyl, (DDD) triazinyl, (FEE) phenoxazinyl, (FFF) phenothiazinyl, (GGG) pteridinyl, (HHH) benzothiazolyl, (III) imidazopyridinyl, (JJJ) imidazothiazolyl, (KKK) dihydrobenzisoxazinyl, (LLL) benzisoxazinyl, (MMM) benzoxazinyl, (NNN) dihydrobenzisothiazinyl, (OOO)benzopyranyl, (PPP) benzothiopyranyl, (QQQ) coumarinyl, (RRR) isocoumarinyl, (SSS) chromonyl, (TTT) chromanonyl, and (UUU) pyridinyl-N-oxide, where the R1-heteroaryl group is bonded to —(CH2)n1- by any ring atom of the parent RN-heteroaryl group substituted by hydrogen such that the new bond to the R1-heteroaryl group replaces the hydrogen atom and its bond, where heteroaryl is optionally substituted with one, two, three or four of: (1) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH , —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy (2) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (3) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H C1-C6 alkyl, (4) —F, Cl, —Br and —I, (6) —C1-C6 alkoxy optionally substituted with one, two, or three —F, (7) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (8) —OH , (9) —C≡N, (10) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (11) —CO—(C1-C4 alkyl), (12) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (13) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, or (14) —SO2—(C1-C4 alkyl), with the proviso that when n1 is zero R1-heteroaryl is not bonded to the carbon chain by nitrogen, (VIII) —(CH2)n1—(R1 heterocycle) where n1 is as defined above and R1-heterocycle is selected from the group consisting of: (A) morpholinyl (B) thiomorpholinyl, (C) thiomorpholinyl S-oxide, (D) thiomorpholinyl S,S-dioxide, (E) piperazinyl, (F) homopiperazinyl, (G) pyrrolidinyl, (H) pyrrolinyl, (I) tetrahydropyranyl, (J) piperidinyl, (K) tetrahydrofuranyl, (L) tetrahydrothienyl, (M) homopiperidinyl, (N) homomorpholinyl, (O) homothiomorpholinyl, (P) homomorpholinyl S-oxide, (Q) homothiomorpholinyl S,S-dioxide, and (R) oxazolidinonyl, where the R1-heterocycle group is bonded by any atom of the parent R1-heterocycle group substituted by hydrogen such that the new bond to the R1-heterocycle group replaces the hydrogen atom and its bond, where heterocycle is optionally substituted with one, two, three or four of: (1) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH , —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (2) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH , —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-aand R1-b are —H or C1-C6 alkyl, (3) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH , —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (4) —F, Cl, —Br and —I, (5) C1-C6 alkoxy, (6) —C1-C6 alkoxy optionally substituted with one, two, or three —F, (7) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (8) —OH , (9) —C≡N, (10) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (11) —CO—(C1-C4 alkyl), (12) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (13) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, (14) —SO2-(C1-C4 alkyl), or (15) ═O, with the proviso that when n1 is zero R1-heterocycle is not bonded to the carbon chain by nitrogen; or (IX) G-L-A-W- where A is: (I) phenyl, 1-naphthyl, 2-naphthyl, indanyl, indenyl, dihydronaphthalyl, tetralinyl, cyclopentyl, cyclohexyl, and cycloheptyl optionally substituted with one or two of the following substituents on the ring: (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′) R, R′ defined below (D) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (E) —NH—CO—O—RN-5 where RN-5 is as defined above, (F) —O—(C2-C6 alkyl)—COOH, (G) —NRR′ where R, R′ are H, C1-C6 alkyl, —(CH2)0-2—(R1-a) where R1-aryl is as defined above, (H) —SR where R is H, C1-C6 alkyl, —(CH2)0-2—(R,1-aryl) where R1-aryl is as defined above, (I) —CH2OH, (J) —CO—(C1-C6) alkyl, (K) —CONRR′ where R, R′ are H, C1-C6 alkyl —(CH2)0-2-(R1-aryl) where R1-aryl is as defined above, (L) —SO2NRR′ where R, R′ are H, C1-C6 alkyl, (M) —COOH, (N) —C1-C6 alkyl, (O) —C2-C6 alkenyl with one or two double bonds, or (P) —C2-C6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three of —CF3, —F, —Cl, —Br, —I, C1-C3 alkyoxy, —OCF3, —NH2, —OH, and —CN, and provided that G, L and W may not all be absent; (II) R1-heteroaryl as defined above, where the R1-heteroaryl group bonds to the subsistent W by a ring carbon atom, and where R1-heteroaryl is optionally substituted with one, two, three, or four substituents independently chosen from the group consisting of: (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′) where R, R′ are defined below, (D) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (E) —NH—CO—O—RN-5 where RN-5 is as defined above, (F) —O—(C2-C6 alkyl)—COOH, (G) —NRR′ where R, R′ are independently H, C1-C6 alkyl, and —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (H) —SR where R and R1-aryl are as defined above, (I) —CH2OH, (J) —CO—(C1-C6) alkyl, (K) —CONRR′ where R, R′ and R1-aryl are as defined above, (L) —SO2NRR′ where R, R′ are H, C1-C6 alkyl, (M) —COOH, (N) —C1-C6 alkyl, (O) —C2-C6 alkenyl with one or two double bonds, and (P) —C2-C6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three substituent independently chosen from the group consisting of —CF3, —F, —Cl, —Br, —I, C1-C3 alkyoxy, —OCF3, —OH2, —OH, and —CN, and provided that G, L and W may not all be absent, or (III) R1-heterocycle as defined above: where the R1-heterocycle group bonds to the subsistent W by a ring carbon atom, and where R1-heteroaryl is optionally substituted with one to two substituents independently chosen from the group consisting of (1) ═O, (2) C1-C3 alkyl, (3) —CF3, (4) —F, Cl, —Br or —L (5) C1-C3 alkoxy, (6) —O—CF3, (7) —NH2, (8) —OH, and (9) —C≡N, and provided that G, L and W may not all be absent, where W is —S(O)0-2—, —O—, —N—, or absent, and N is optionally substituted with C1-C4 alkyl; where L is —CO—, —S(O)1-2—, —O—, —C(Ra)(Rb)O—, —OC(Ra)(Rb)—, —N(Ra)—, —CON(Ra)—, —N(Ra)CO—, —(Ra)(Rb)—, —C(OH)Ra—, —SO2NRa—, —N(Ra)SO2—, —N(Ra)CON(Rb)—, N(Ra)CSN(Rb)—, —OCOO—, —NCOO—, OCON(Ra)—, a bond, or L is absent when G is absent, and where Ra and Rb are independently H, C1-C4 alkyl which are optionally substituted. with OH, C1-C4 alkoxy, and up to five —F; where G is: (I) —C1-C10 alkyl optionally substituted with one substituent selected from the group consisting of: (A) —COOH, (B) —CO—O—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NCH2, (F) —C1-C6 alkyl optionally substituted with one to five —F (G) —(C1-C10 alkyl)—O—(C1-C3 alkyl), (H) —C2-C10 alkenyl with one or two double bonds, (I) —C2-C10 alkynyl with one or two triple bonds, (J) —C4-C10 hydrocarbyl chain with one double bond and one triple bond, (K) —R1-aryl where R1-aryl is as defined above, (L) —R1-heteroaryl where R1-heteroaryl is as defined above, (II) —(CH2)0-3—(C3-C7) cycloalkyl where cycloalkyl can be optionally substituted with one, two or three substituents selected from the group consisting of: (A) —COOH, (B) —CO—O—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 alkyl optionally substituted with one to five —F (G) —(C1-C10 alkyl)—O—(C1-C3 alkyl), (H) —C2-C10 alkenyl with one or two double bonds, (I) —C2-C10 alkynyl with one or two triple bonds, (J) —C4-C10 hydrocarbyl chain with one double bond and one triple bond, (K) —R1-aryl where R1-aryl is as defined above, (L) —R1-heteroaryl where R1-heteroaryl is as defined above, (III) —(CR′R″)0-4—R1-aryl where R′, R″ and R1-aryl are as defined above, (IV) —(CH2)0-4—R1-heteroaryl where R1-heteroaryl is as defined above, (V) —(CH2)0-4—R1-heterocycle where R1-heterocycle is as defined above, (VI) —C(RC-1)(RC-2)—CO—NH—RC-3 where RC-1 and RC-2 are independently selected from the group consisting of: (A) —H, (B) —C1-C6 alkyl, (C) —(C0-C4 alkyl)—R1-aryl, wherein R1-aryl is as defined above, (D) —(C0-C4 alkyl)—R1-heteroaryl, wherein R1-heteroaryl is as defined above, (E) —(C0-C4 allyl)—R1-heterocycles, wherein R1-heterocycles is as defined above, (F) —(CH2)1-4—OH, (G) —(CH2)1-4—RC-4—(CH2)1-4—R′C-aryl where RC-4 is —O—, —S—or (H) —NRC-5—where RC-5 is — or C1-C6 alkyl, and where RC′-aryl is defined above, and (I) —(CH2)1-4—RC-4—(CH2)1-4—RC-heteroaryl where RC-4 and RC-heteroaryl are as defined above, wherein in (C), (D) and (E) C0 is merely a bond, and where RC-3 is: (a) —H, (b) —C1-C6 alkyl, (c) —(C0-C4 alkyl)—R1-aryl where R1-aryl, is as defined above, (d) —(C0-C4 alkyl)—R1-heteroaryl where R1-heteroaryl is as defined above, (e) —(C0-C4 alkyl)—R1-heterocycle where R1-heterocycle is as defined above, (VII) -cyclopentyl or -cyclohexyl ring fused to a phenyl or heteroaryl ring where heteroaryl is as defined above and phenyl and heteroaryl are optionally substituted with one, two or three of: (E) C1-C6 alkyl, (B) —CF3, (C) —F, Cl, —Br and —I, (D) C1-C3 alkoxy, (E) —OCF3, (F) —NH2, (G) —OH, (H) —C≡N, (I) —NO2 (J) —CO—OH, (K) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(C0-C2 alkyl)-(R1-aryl) where R1-aryl is as defined above, (L) —NH—CO—O—RN-5 where RN-5 is as defined above, (M) —O—(C2-C5 alkyl)—COOH, or (N) —OR where R is as defined above, (O) —NR—R′ where R and R′ are as defined above, (P) —SR where R is as defined above, (Q) —CF3, (R) —OCF3, (S) —N(R)COR′ where R, R′ are as defined above, (T) —NRR′ where R, R′ are as defined above, (U) —SR where R is as defined above, (V) —CH2OH, (W) —CO—(C1-C6) alkyl, (X) —CONRR′ where R, R′ are as defined above, or (Y) —SO2NRR′ where R is as defined above, or (VIII) —(CH2)2—O—(CH2)2—OH; wherein R2 is selected from the group consisting of: (I) —H, (II) C1-C6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are as defined above, (III) —(CH2)0-4—R2-1 where R2-1 is R1-aryl or R1-heteroaryl where R1-aryl and R1-heteroaryl are as defined above; (IV) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (V) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1b are —H or C1-C6 alkyl, and (VI) —(CH2)0-4— C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl; wherein R3 is selected from the group consisting of: (I) —H, (II) C1-C6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are as defined above, (III) —(CH2)0-4—R2-1 where R2-1 is R1-aryl or R1-heteroaryl where R1-aryl and R1-heteroaryl are as defined above; (IV) C2-C6 alkenyl with one or two double bonds, (V) C2-C6 alkynyl with one or two triple bonds, and (VI) —(CH2)0-4— C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, and where R2 and R3 are taken together with the carbon to which they are attached to form a carbocycle of three, four, five, six and seven carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO2—, —NRN-2—, where RN-2 is as defined below; and wherein RC is selected from the group consisting of C1-C10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —OC═O NR235R240, —S(═O)0-2 R235, —NR235C═O NR235R240, —C═O NR235R240, and —S(═O)2 NR235R240; —(CH2)0-3—(C3-C8) cycloalkyl wherein the cycloalkyl is optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —CO2H, and —CO2—(C1-C4 alkyl); —(CR245R250)0-4-aryl; —(CR245R250)0-4-heteroaryl, —(CR245R250)0-4-heterocycloalkyl; —(CR245R250)0-4-aryl-heteroaryl; —(CR245R250)0-4-aryl-heterocycloalkyl; —(CR245R250)0-4aryl-aryl; —(CR245R250)0-4-heteroaryl-aryl; —(CR245R250)0-4-heteroaryl-heterocycloalkyl; —(CR245R250)0-4-heteroaryl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heterocycloalkyl; —(CR245R250)0-4-heterocycloalkyl-aryl; —[C(R255)(R260)]1-3—CO—N—(R255)2; —CH(aryl)2; —CH(heteroaryl)2; —CH(heterocycloalkyl)2; —CH(aryl)(heteroaryl); cyclopentyl, cyclohexyl, or cycloheptyl ring fused to aryl, heteroaryl, or heterocycloalkyl wherein one carbon of the cyclopentyl, cyclohexyl, or cycloheptyl is optionally replaced with one or two NH, NR215, O, or S(═O)0-2, and wherein the cyclopentyl, cyclohexyl, or cycloheptyl group can be optionally substituted with 1 or 2 groups that are independently R205, ═O, —CO—NR235R240, or —SO2—(C1-C4 alkyl); C2-C10 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C10 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)0-1—CH((CH2)0-6—OH)—(CH2)0-aryl; —(CH2)0-1—CH((CH2)0-6—OH—(CH2)0-1—heteroaryl; —CH(-aryl or -heteroaryl)—CO—O(C1-C4 alkyl); —CH(—CH2—OH)—CH(OH)-phenyl-NO2; (C1-C6 alkyl)—O—(C1-C6 alkyl)—OH; —CH2—NH—CH2—CH(—O—CH2-CH3)2; —H; and —(CH2)0-6—C(═NR235)(NR235R240); wherein each aryl is optionally substituted with 1, 2, or 3 R200; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200; each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210; R200 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; OH; —NO2; halogen; —CO2H; C≡N; —(CH2)0-4—CO—NR220R225; —(CH2)0-4—CO—(C1-C12 alkyl); —(CH2)0-4—CO—(C2-C12 alkenyl); —(CH2)0-4—CO—(C2-C12 alkynyl); —(CH2)0-4—CO—(C3-C7 cycloalkyl); —(CH2)0-4—CO-aryl; —(CH2)0-4—CO—heteroaryl; —(CH2)0-4—CO-heterocycloalkyl; —(CH2)0-4—CO—O—R215; —(CH2)0-4—SO2—NR220R225; —(CH2)0-4—SO—(C1-C8 alkyl); —(CH2)0-4—SO2—(C1-C2 alkyl); —(CH2)0-4—SO2—(C3-C7 cycloalkyl); —(CH2)0-4—N(H or R215)—CO—O—R215; —(CH2)0-4—N(H or R215)—CO—N(R215)2; —(CH2)0-4—N—CS—N(R215)2; —(CH2)0-4—N(—H or R215)—CO—R220; —(CH2)0-4—NR220R225; —(CH2)0-4—O—CO—(C1-C6 alkyl); —(CH2)0-4—O—P(O)—(OR240)2; —(CH2)0-4—O—CO—N(R215)2; —(CH2)0-4 —O—CS—N(R215)2; —(CH2)0-4—O—(R215); —(CH2)0-4—O—(R215)—COOH; —(CH2)0-4—S—(R215); —(CH2)0-4—O—(C1-C6 alkyl optionally substituted with 1, 2, 3, or 5-F); C3-C7 cycloalkyl; C2-C6 alkenyl optionally substituted with 1 or 2 R205 groups; C2-C6 alkynyl optionally substituted with 1 or 2 R205 groups; —(CH2)0-4—N(H or R215)—SO2—R220; and —(CH2)0-4— C3-C7 cycloalkyl; wherein each aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R205 or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein each heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; R205 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, halogen, —OH, —O-phenyl, —SH, —C≡N, —CF3, C1-C6 alkoxy, NH2, NH(C1-C6 alkyl), and N—(C1-C6 alkyl)(C1-C6 alkyl); R210 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; halogen; C1-C6 alkoxy; C1-C6 haloalkoxy; —NR220R225; OH; C≡N; C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —CO—(C1-C4 alkyl); SO2NR235R240; —CO—NR235R240; —SO2—(C1-C4 alkyl); and ═O; R215 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, —(CH2)0-2-(aryl), C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, and —(CH2)0-2-(heteroaryl), —(CH2)0-2-(heterocycloalkyl); wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R220 and R225 at each occurrence are independently selected from the group consisting of —H, —C1-C6 alkyl, hydroxy C1-C6 alkyl, amino C1-C6 alkyl; halo C1-C6 alkyl; —C3-C7 cycloalkyl, —(C1-C2 alkyl)—(C3-C7 cycloalkyl), —(C1-C6 alkyl)—O—(C1-C3 alkyl), —C2-C6 alkenyl, —C2-C6 alkynyl, —C1-C6 alkyl chain with one double bond and one triple bond, -aryl, -heteroaryl, and -heterocycloalkyl; wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R235 and R240 at each occurrence are independently H, or C1-C6 alkyl; R245 and R250 at each occurrence are independently selected from the group consisting of H, C1-C4 alkyl, C1-C4 alkylaryl, C1-C4 alkylheteroaryl, C1-C4 hydroxyalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, —(CH2)0-4—C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, and phenyl; or R245 and R250 are taken together with the carbon to which they are attached to form a carbocycle of 3, 4, 5, 6, or 7 carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO2—, and —NR220—; R255 and R260 at each occurrence are independently selected from the group consisting of H; C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)1-2—S(O)0-2—(C1-C6 alkyl); —(CH2)0-4—C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —(C1-C4 alkyl)-aryl; —(C1-C4 alkyl)-heteroaryl; —(C1-C4 alkyl)-heterocycloalkyl; -aryl; -heteroaryl; -heterocycloalkyl; —(CH2)1-4—R265—(CH2)0-4-aryl; —(CH2)1-4—R265—(CH2)0-4-heteroaryl; and; —(CH2)1-4—R265—(CH2)0-4-heterocycloalkyl; wherein R265 at each occurrence is independently —O—, —S—or —N(C1-C6 alkyl)-; each aryl or phenyl is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200, each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210. 2. A compound according to claim 1, wherein R, is G-L-A-E-W-, wherein E is a bond or C1-C3 alkylene; A is: (I) aryl or cycloalkyl where each aryl or cycloalkyl is optionally substituted with one, two or three independently selected R100 groups, where R100 is (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′)R, where R and R′ are independently hydrogen, C1-C6 alkyl, or —(CH2)0-2-aryl or —(CH2)0-2-cycloalkyl, where each aryl or cycloalkyl is optionally substituted with halogen, hydroxy, C1-C6 alkyl, C1-C6 alkyl, amino, mono(C1-C6)alkylamino, or di(C1-C6)alkylamino, (D) —CO2—R25, where R25 is selected from the group consisting of: (a) C1-C6 alkyl, (b) —(CH2)0-2-cycloalkyl, (c) —(CH2)0-2—aryl, where the aryl is optionally substituted with halogen, hydroxy, C1-C6 alkyl, C1-C6 alkyl, amino, mono(C1-C6)alkylamino, or di(C1-C6)alkylamino, and (d) hydrogen, (E) —NH—CO2—R25, (F) —O—(C2-C6 alkyl)—CO2H, (G) —NRR′, (H) —SR, (I) —CH2OH, (J) —C(O)—(C1-C6)alkyl, (K) —C(O)NRR′, (L) —SO2NRR′ (M) —CO2H, (N) C1-C6 alkyl, C1-C6 alkenyl with one or two double bonds, —C1-C6 alkynyl with one or two triple bonds, —CF3, —F, —Cl, —Br, —I, C1-C3 alkoxy, —OCF3, —NH2, —OH, or —CN, (O) halogen, and (P) —(CH2)0-2—O—(CH2)0-2—OH; (II) heteroaryl, provided that, when E is a bond, the heteroaryl group is bonded through one of its carbon atoms to W, and where the heteroaryl is optionally substituted with one or two independently selected R100 groups; (III) heterocycle, provided that, when E is a bond, the heterocycle group is bonded through one of its carbon atoms to W, where the heterocycle is optionally substituted with one or two independently selected R200 groups, where R200 is (1) ═O, (2) C1-C3 alkyl, (3) —CF3, (4) —F, Cl, —Br and —I, (5) C1-C3 alkoxy, (6) —CF3, (7) —NH2, (8) —OH, or (9) —C≡N; W is a bond, —S—, —S(O)—, —SO2—, —O—, —N(R)— where R is hydrogen or C1-C4 alkyl; L is a bond or absent when G is absent, or L is —C(O)—, —S(O)—, —SO2—, —O—, —C(R110)(R112)O—, —OC(R110)(R112)—, —N(R110)—, —CON(R110)—, —N(R110)CO—, —C(R110)(R′)—,—C(OH)R110—, —SO2NR110—, —N(R110)SO2—, —N(R110)CON(R112)—, N(R110)CSN(R112)—, —OCO2—, —NCO2—, or —OCON(R110)—, where R110 and R112 are independently hydrogen, or C1-C4 alkyl, where C1-C4 alkyl is optionally substituted with OH, C1-C4 alkoxy, or one to five F; G is absent or: (I) C1-C10 alkyl, optionally substituted with up to three groups independently selected from (A) —CO2H, (B) —CO2(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NRR′, (F) —C1-C6 haloalkyl, (G) —(C1-C10 alkyl)—O—(C1-C3 alkyl), (H) —C1-C10 alkenyl with one or two double bonds, (I) —C1-C10 alkynyl with one or two triple bonds, (J) —C1-C10 alkyl chain with one double bond and one triple bond, (K) aryl optionally substituted with R100, (L) heteroaryl optionally substituted with R100, (M) C1-C6 alkyl, (II) —(CH2)0-3—(C3-C7) cycloalkyl where cycloalkyl is optionally substituted with one, two or three substituents selected from the group consisting of: (A) —CO2H, (B) —CO2—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 haloalkyl, (G) —(C1-C10 alkyl)—O—(C1-C3 alkyl), (H) —C1-C10 alkenyl with one or two double bonds, (I) —C1-C10 alkynyl with one or two triple bonds, (J) —C1-C10 alkyl chain with one double bond and one triple bond, (K) aryl optionally substituted with R100, (L) heteroaryl optionally substituted with R100, (m) mono(C1-C6 alkyl)amino, and (n) di(C1-C6 alkyl) amino, (o) C1-C6 alkyl, (III) —(CRR)0-4-aryl where aryl is optionally substituted with R100, (IV) —(CH2)0-4-heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (V) —(CH2)0-4-heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, (VI) —C(R10)(R12)—CO—NH—R14 where R10 and R12 are the same or different and are selected from the group consisting of: (A) —H, (B) —C1-C6 alkyl, (C) —(C1-C4 alkyl)-aryl, where the aryl is optionally substituted with one, two, or three independently selected R100 groups, (D) —(C1-C4 alkyl)- heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (E) —(C1-C4 alkyl)- heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, (F) heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (G) heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, (H) —CH2)1-4—OH, (I) —(CH2)1-4—Y—(CH2)1-4-aryl where Y is —O—, —S—or —NRC-5— where R16 is hydrogen or C1-C6 alkyl, and where the aryl is optionally substituted with one, two, or three independently selected R100 groups, (J) —(CH2)1-4—Y—(CH2)1-4— heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, and (K) -aryl, where the aryl is optionally substituted with one, two, or three independently selected R100 groups, and R14 is: (A) —H, (B) —C1-C6 alkyl, (C) -aryl, where the aryl is optionally substituted with one, two, or three independently selected R100 groups, (D) -heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (E) -heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, (F) —(C1-C4 alkyl)-aryl, where the aryl is optionally substituted with one, two, or three independently selected R100 groups, (G) —(C1-C4 alkyl)-heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (H) —(C1-C4 alkyl)-heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, or (I) —CH2)0-2—O—(CH2)0-2—OH; R4 and R5 are independently hydrogen, halogen, C1-C6 alkoxy or C1-C4 alkyl. 3. A compound according to claim 1, wherein R1 is —(CH2)1-2—S(O)0-2—(C1-C6 alkyl), or C1-C6 alkyl optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, ═O, —SH, —C≡N, —CF3, —C1-C3 alkoxy, amino, mono- or dialkylamino, —OC(═O)-amino, -amino-C(═O)O—, and —OC(═O)-mono- or dialkylamino, or C1-C10 alkyl optionally substituted —C1-C3 alkoxy, or C2-C6 alkenyl or C2-C6 alkynyl, each of which is optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, amino, and mono- or dialkylamino, or aryl, heteroaryl, heterocyclyl, —C1-C6 alkyl-aryl, —C1-C6 alkyl-heteroaryl, or —C1-C6 alkyl-heterocyclyl, where the ring portions of each are optionally substituted with 1, 2, 3, or 4 groups independently selected from halogen, —OH, —SH, —C≡N, —NR7R′7, —C(═O)—(C1-C4) alkyl, —SO2-amino, —SO2-mono or dialkylamino, —C(═O)-amino, —C(═O)-mono or dialkylamino, —SO2—(C1-C4) alkyl, or —C1-C6 alkoxy optionally substituted with 1, 2, or 3 groups which are independently a halogen, or C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, —SH, —C≡N, —CF3, —C1-C3 alkoxy, amino, —C1-C6 alkyl and mono- or dialkylamino, or C1-C10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, —SH, —C≡N, —CF3, —C1-C3 alkoxy, amino, mono- or dialkylamino and —C1-C3 alkyl, or C2-C6 alkenyl, alk(di)enyl, C2-C6 alkynyl or alk(di)ynyl, each of which is optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, amino, —C1-C6 alkyl and mono- or dialkylamino; and the heterocyclyl group is optionally further substituted with oxo. 4. A compound according to claim 1, wherein R1 is: (I) C1-C6 alkyl, optionally substituted with one, two or three substit uents selected from the group consisting of C1-C3 alkyl, C1-C7 alkyl (optionally substituted with C1-C3 alkyl and C1-C3 alkoxy), —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, —OC═O NR1-aR1-b where R1-a and R1-b are as defined above, (II) —CH2—S(O)0-2—(C1-C6 alkyl), (III) —CH2-CH2—S(O)0-2—(C1-C6 alkyl), (IV) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (V) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (VI) —(CH2)n1—(R1-aryl) where n1 is zero or one and where R1-aryl is phenyl, 1-naphthyl, 2-naphthyl and indanyl, indenyl, dihydronaphthalyl, tetralinyl optionally substituted with one, two, three or four of the following substituents on the aryl ring: (A) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (B) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (C) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (D) —Cl, —Br and —I, (F) —C1-C6 alkoxy optionally substituted with one, two or three —F, (G) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (H) —OH, (I) —C≡N, (J) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-bR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (K) —CO—(C1-C4 alkyl), (L) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (M) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, or (N) —SO2—(C1-C4 alkyl), (VII) (CH2)n1—(R1-heteroaryl) where n1 is as defined above and where R1-heteroaryl is selected from the group consisting of: (A) pyridinyl, (B) pyrimidinyl, (C) quinolinyl, (F) benzothienyl, (G) indolyl, (H) indolinyl, (I) pryidazinyl, (J) pyrazinyl, (K) isoindolyl, (L) isoquinolyl, (M) quinazolinyl, (N) quinoxalinyl, (O) phthalazinyl, (P) imidazolyl, (Q) isoxazolyl, (R) pyrazolyl, (S) oxazolyl, (T) thiazolyl, (U) indolizinyl, (V) indazolyl, (W) benzothiazolyl, (X) benzimidazolyl, (Y) benzofuranyl, (Z) furanyl, (AA) thienyl, (BB) pyrrolyl, (CC) oxadiazolyl, (DD) thiadiazolyl, (EE) triazolyl, (FF) tetrazolyl, (II) oxazolopyridinyl, (JJ) imidazopyridinyl, (KK) isothiazolyl, (LL) naphthyridinyl, (MM) cinnolinyl, (NN) carbazolyl, (OO) beta-carbolinyl, (PP) isochromanyl, (QQ) chromanyl, (SS) tetrahydroisoquinolinyl, (TT) isoindolinyl, (UU) isobenzotetrahydrofuranyl, (VV) isobenzotetrahydrothienyl, (WW) isobenzothienyl, (XX) benzoxazolyl, (YY) pyridopyridinyl, (ZZ) benzotetrahydrofuranyl, (AAA) benzotetrahydrothienyl, (BBB) purinyl, (CCC) benzodioxolyl, (DDD) triazinyl, (EEE) phenoxazinyl, (FFF) phenothiazinyl, (GGG) pteridinyl, (HHH) benzothiazolyl, (III) imidazopyridinyl, (JJJ) imidazothiazolyl, (KKK) dihydrobenzisoxazinyl, (LLL) benzisoxazinyl, (MMM) benzoxazinyl, (NNN) dihydrobenzisothiazinyl, (OOO)benzopyranyl, (PPP) benzothiopyranyl, (QQQ) coumarinyl, (RRR) isocoumarinyl, (SSS) chromonyl, (TTT) chromanonyl, and (UUU) pyridinyl-N-oxide, where the R1-heteroaryl group is bonded to —CH2),n1— by any ring atom of the parent RN-heteroaryl group substituted by hydrogen such that the new bond to the R1-heteroaryl group replaces the hydrogen atom and its bond, where heteroaryl is optionally substituted with one, two, three or four of: (1) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (2) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (3) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (4) —F, Cl, —Br and —I, (6) —C1-C6 alkoxy optionally substituted with one, two, or three —F, (7) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (8) —OH, (9) —C≡N, (10) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (11) —CO—(C1-C4 alkyl), (12) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (13) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, or (14) —SO2—(C1-C4 alkyl), with the proviso that when n1 is zero R1-heteroaryl is not bonded to the carbon chain by nitrogen, (VIII) —(CH2)n1—(R1-heterocycle) where n1 is as defined above and R1-heterocycle is selected from the group consisting of: (A) morpholinyl, (B) thiomorpholinyl, (C) thiomorpholinyl S-oxide, (D) thiomorpholinyl S,S-dioxide, (E) piperazinyl, (F) homopiperazinyl, (G) pyrrolidinyl, (H) pyrrolinyl, (I) tetrahydropyranyl, (J) piperidinyl, (K) tetrahydrofuranyl, (L) tetrahydrothienyl, (M) homopiperidinyl, (N) homomorpholinyl, (O) homothiomorpholinyl, (P) homomorpholinyl S-oxide, (Q) homothiomorpholinyl S,S-dioxide, and (R) oxazolidinonyl, where the R1-heterocycle group is bonded by any atom of the parent R1-heterocycle group substituted by hydrogen such that the new bond to the R1-heterocycle group replaces the hydrogen atom and its bond, where heterocycle is optionally substituted with one, two, three or four of: (1) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (2) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (3) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (4) —F, Cl, —Br and —I, (5) C1-C6 alkoxy, (6) —C1-C6 alkoxy optionally substituted with one, two, or three —F, (7) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (8) —OH, (9) —C≡N, (10) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (11) —CO—(C1-C4 alkyl), (12) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (13) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, (14) —SO2—(C1-C4 alkyl), or (15) ═O, with the proviso that when n1 is zero R1-heterocycle is not bonded to the carbon chain by nitrogen; or (IX) G-L-A-W- where A is: (I) phenyl, 1-naphthyl, 2-naphthyl, indanyl, indenyl, dihydronaphthalyl, tetralinyl, cyclopentyl, cyclohexyl, and cycloheptyl optionally substituted with one or two of the following substituents on the ring: (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′) R, R′ defined below (D) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(CH2)0-2(R1-aryl) where R1-aryl is as defined above, (E) —NH—CO—O—RN-5 where RN-5 is as defined above, (F) —O—(C2-C6 alkyl)—COOH, (G) —NRR′ where R, R′ are H, C1-C6 alkyl, —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (H) —SR where R is H, C1-C6 alkyl, —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (I) —CH2OH, (J) —CO—(C1-C6) alkyl, (K) —CONRR′ where R, R′ are H, C1-C6 alkyl,—(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (L) —SO2NRR′ where R, R′ are H, C1-C6 alkyl, (M) —COOH, (N) —C1-C6 alkyl, (O) —C2-C6 alkenyl with one or two double bonds, or (P) —C2-C6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three of —CF3, —F, —Cl, —Br, —I, C1-C3 alkyoxy, —OCF3, —NH2, —OH, and —CN, and provided that G, L and W may not all be absent; (II) R1-heteroaryl as defined above, where the R1-heteroaryl group bonds to the subsistent W by a ring carbon atom, and where R1-heteroaryl is optionally substituted with one, two, three, or four substituents independently chosen from the group consisting of: (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′) where R, R′ are defined below, (D) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (E) —NH—CO—O—RN-5 where RN-5 is as defined above, (F) —O—(C2-C6 alkyl)—COOH, (G) —NRR′ where R, R′ are independently H, C1-C6 alkyl, and —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (H) —SR where R and R1-aryl are as defined above, (I) —CH2OH, (J) CO—(C1-C6) alkyl, (K) —CONRR′ where R, R′ and R1-aryl are as defined above, (L) —SO2NRR′ where R, R′ are H, C1-C6 alkyl, (M) —COOH, (N) —C1-C6 alkyl, (O) —C2-C6 alkenyl with one or two double bonds, and (P) —C2-C6 alkynyl with one or two triple bonds, wherein each of (N), (O) and P) may be optionally substituted by one to three substituent independently chosen from the group consisting of —CF3, —F, —Cl, —Br, —I, C1-C3 alkyoxy, —OCF3, —NH2, —OH, and —CN, and provided that G, L and W may not all be absent, or (III) R1-heterocycle as defined above: where the R1-heterocycle group bonds to the subsistent W by a ring carbon atom, and where R1-heteroaryl is optionally substituted with one to two substituents independently chosen from the group consisting of (1) ═O, (2) C1-C3 alkyl, (3) —CF3, (4) —F, Cl, —Br or —I, (5) C1-C3 alkoxy, (6) —O—CF3, (7) —NH2, (8) —OH, and (9) —C≡N, and provided that G, L and W may not all be absent, where W is —S(O)0-2—, —O—, —N—, or absent, and N is optionally substituted with C1-C4 alkyl; where L is —CO—, —S(O)1-2—, —O—, —C(Ra)(Rb)O—, —OC(Ra)(Rb)—, —N(Ra)—, —CON(Ra)—, —N(Ra)CO—, —C(Ra)(Rb)—, —C(OH)Ra—, —SO2NRa—, —N(Ra)SO2—, —N(Ra)CON(Rb)—, N(Ra)CSN(Rb)—, —OCOO—, —NCOO—, OCON(Ra)—, a bond, or L is absent when G is absent, and where Ra and Rb are independently H, C1-C4 alkyl which are optionally substituted. with OH, C1-C4 alkoxy, and up to five —F; where G is: (I) —C1-C10 alkyl optionally substituted with one substituent selected from the group consisting of: (A) —COOH, (B) —CO—O—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 alkyl optionally substituted with one to five —F (G) —(C1-C10 alkyl)-O—(C1-C3 alkyl), (H) —C2-C10 alkenyl with one or two double bonds, (I) C2-C10 alkynyl with one or two triple bonds, (J) —C4-C10 hydrocarbyl chain with one double bond and one triple bond, (K) —R1-aryl where R1-aryl is as defined above, (L) —R1-heteroaryl where R1-heteroaryl is as defined above, (II) —(CH2)0-3—(C3-C7) cycloalkyl where cycloalkyl can be optionally substituted with one, two or three substituents selected from the group consisting of: (A) —COOH, (B) —CO—O—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 alkyl optionally substituted with one to five —F (G) —(C1-C10 alkyl)-O—(C1-C3 alkyl), (H) —C2-C10 alkenyl with one or two double bonds, (I) —C2-C10 alkynyl with one or two triple bonds, (J) —C4-C10 hydrocarbyl chain with one double bond and one triple bond, (K) —R1-aryl where R1-aryl is as defined above, (L) —R1-heteroaryl where R1-heteroaryl is as defined above, (III) —(CR′R″)0-4—R1-aryl where R′, R″ and R1-aryl are as defined above, (IV) —(CH2)0-4—R1-heteroaryl where R1-heteroaryl is as defined above, (V) (CH2)0-4—R1-heterocycle where R1-heterocycle is as defined above, (VI) —C(RC-1)(RC-2)—CO—NH-RC-3where RC-1 and —RC-2 are independently selected from the group consisting of: (A) —H, (B) —C1-C6 alkyl, (C) —(C0-C4 alkyl)- R1-aryl wherein R1-aryl is as defined above, (D) —(C0-C4 alkyl)-R1-heteroaryl wherein R1-heteroaryl, is as defined above, (E) —(C0-C4 alkyl)-R1-heterocycle, wherein R1-heterocycle is as defined above, (F) —(CH2)1-4—OH, (G) —(CH2)1-4—RC-4—(CH2)1-4—RC′-aryl where RC-4 is —O—, —S— or (H) —NRC-5— where RC-5 is — or C1-C6 alkyl, and where RC′-aryl is defined above, and (I) —(CH2)1-4—RC-4—(CH2)1-4—RC-heteroaryl where RC4 and RC-heteroaryl are as defined above, wherein in (C), (D) and (E) C0 is merely a bond, and where —RC-3 is: (a) —H, (b) —C1-C6 alkyl, (c) —(C0-C4 alkyl)-R1-aryl where R1-aryl is as defined above, (d) —(C0-C4 alkyl)-R1-heteroaryl where R1-heteroaryl is as defined above, (e) —(C0-C4 alkyl)-R1-heterocycle where R1-heterocycle is as defined above, (VII) -cyclopentyl or -cyclohexyl ring fused to a phenyl or heteroaryl ring where heteroaryl is as defined above and phenyl and heteroaryl are optionally substituted with one, two or three of: (F) C1-C6 alkyl, (B) F3, (C) —F, Cl, —Br and —I, (D) C1-C3 alkoxy, (E) —OCF3, (F) —NH2, (G) —OH, (H) —C≡N, (I) —NO2 (J) —CO—OH, (K) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(C0-C2 alkyl)-(R1-aryl) where R1-aryl is as defined above, (L) —NH—CO—O—RN-5 where RN-5 is as defined above, (M) —O—(C2-C5 alkyl)-COOH, or (N) —OR where R is as defined above, (O) —NR—R′ where R and R′ are as defined above, (P) —SR where R is as defined above, (Q) —CF3, (R) —OCF3, (S) —N(R)COR′ where R, R′ are as defined above, (T) —NRR′ where R, R′ are as defined above, (U) —SR where R is as defined above, (V) —CH2OH, (W) —CO—(C1-C6) alkyl, (X) —CONRR′ where R, R′ are as defined above, or (Y) —SO2NRR′ where R is as defined above, or (VII) —(CH2)2—O—(CH2)2—OH. 5. A compound according to claim 1, wherein Rc is selected from the group consisting of C1-C10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —OC═O NR235R240, —S(═O)0-2 R235, —NR235C═O NR235R240, —C═O NR235R240, and —S(═O)2 NR235R240; —(CH2)0-3—(C3-C8) cycloalkyl wherein the cycloalkyl is optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —CO2H, and —CO2—(C1-C4 alkyl); —(CR245R250)1-4-aryl; —(CR245R250)0-4-heteroaryl, —(CR245R250)0-4-heterocycloalkyl; —(CR245R250)0-4-aryl-heteroaryl; —(CR245R250)0-4-aryl-heterocycloalkyl; —(CR245R250)0-4-aryl-aryl; —(CR245R250)0-4-heteroaryl-aryl; —(CR245R250)0-4-heteroaryl-heterocycloalkyl; —(CR245R250)0-4-heteroaryl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heterocycloalkyl; —(CR245R250)0-4-heterocycloalkyl-aryl; —[C(R255)(R260)]1-3—CO—N—(R255)2; —CH(aryl)2; —CH(heteroaryl)2; —CH(heterocycloalkyl)2; —CH(aryl)(heteroaryl); cyclopentyl, cyclohexyl, or cycloheptyl ring fused to aryl, heteroaryl, or heterocycloalkyl wherein one carbon of the cyclopentyl, cyclohexyl, or cycloheptyl is optionally replaced with one or two NH, NR215, O, or S(═O)0-2, and wherein the cyclopentyl, cyclohexyl, or cycloheptyl group can be optionally substituted with 1 or 2 groups that are independently R205, ═O, —CO—NR235R240, or —SO2—(C1-C4 alkyl); C2-C10 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C10 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)0-1—CH((CH2)0-6—OH)—(CH2)0-1-aryl; —(CH2)0-1—CH((CH2)0-6—OH—(CH2)0-1-heteroaryl; —CH(-aryl or -heteroaryl)-CO—O(C1-C4 alkyl); —CH(—CH2—OH)—CH(OH)-phenyl-NO2; (C1-C6 alkyl)-O—(C1-C6 alkyl)-OH; —CH2—NH—CH2—CH(—O—CH2—CH3)2; —H; and —(CH2)0-6—C(═NR235)(NR235R240); wherein each aryl is optionally substituted with 1, 2, or 3 R200; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200; each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210; R200 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; OH; —NO2; halogen; —CO2H; C≡N; —(CH2)0-4—CO—NR220R225; —(CH2)0-4—CO—(C1-C12 alkyl); —(CH2)0-4—CO—(C2-C12 alkenyl); —(CH2)0-4—CO—(C2-C12 alkynyl); —(CH2)0-4—CO—(C3-C7 cycloalkyl); —(CH2)0-4—CO-aryl; —(CH2)0-4—CO-heteroaryl; —(CH2)0-4—CO-heterocycloalkyl; —(CH2)0-4—CO—O—R215; —(CH2)0-4—SO2—NR220R225; —(CH2)0-4—SO—(C1-C8 alkyl); —(CH2)0-4—SO2—(C1-C12 alkyl); —(CH2)0-4—SO2—(C3-C7 cycloalkyl); —(CH2)0-4—N(H or R215)—CO—O—R215; —(CH2)0-4—N(H or R215)—CO—N(R215)2; —(CH2)0-4—N—CS—N(R215)2; —(CH2)0-4—N(—H or R215)—CO—R220; —(CH2)0-4—NR220R225; —(CH2)0-4—O—CO—(C1-C6 alkyl); —(CH2)0-4—O—P(O)—(OR240)2; —(CH2)0-4—O—CO—N(R215)2; —(CH2)0-4—O—CS—N(R215)2; —(CH2)0-4—O—(R215); —(CH2)0-4—O—(R215)—COOH; —(CH2)0-4—S—(R215); —(CH2)0-4—O—(C1-C6 alkyl optionally substituted with 1, 2, 3, or 5 —F); C3-C7 cycloalkyl; C2-C6 alkenyl optionally substituted with 1 or 2 R205 groups; C2-C6 alkynyl optionally substituted with 1 or 2 R205 groups; —(CH2)0-4—N(H or R215)—SO2—R220; and —(CH2)0-4—C3-C7 cycloalkyl; wherein each aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210 or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein each heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; R205 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, halogen, —OH, —O-phenyl, —SH, —C≡N, —CF3, C1-C6 alkoxy, NH2, NH(C1-C6 alkyl), and N—(C1-C6 alkyl)(C1-C6 alkyl); R210 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; halogen; C1-C6 alkoxy; C1-C6 haloalkoxy; —NR220R225; OH; C≡N; C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —CO—(C1-C4 alkyl); —SO2—NR235R240; —CO—NR235R240; —SO2—(C1-C4 alkyl); and ═O; R215 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, —(CH2)0-2-(aryl), C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, and —(CH2)0-2-(heteroaryl), —(CH2)0-2-(heterocycloalkyl); wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R220 and R225 at each occurrence are independently selected from the group consisting of —H, —C1-C6 alkyl, hydroxy C1-C6 alkyl, amino C1-C6 alkyl; halo C1-C6 alkyl; —C3-C7 cycloalkyl, —(C1-C2 alkyl)-(C3-C7 cycloalkyl), —(C1-C6 alkyl)-O—(C1-C3 alkyl), —C2-C6 alkenyl, —C2-C6 alkynyl, —C1-C6 alkyl chain with one double bond and one triple bond, -aryl, -heteroaryl, and -heterocycloalkyl; wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R235 and R240 at each occurrence are independently H, or C1-C6 alkyl; R245 and R250 at each occurrence are independently selected from the group consisting of H, C1-C4 alkyl, C1-C4 alkylaryl, C1-C4 alkylheteroaryl, C1-C4 hydroxyalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, —(CH2)0-4—C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, and phenyl; or R245 and R250 are taken together with the carbon to which they are attached to form a carbocycle of 3, 4, 5, 6, or 7 carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO2—, and —NR220—; R255 and R260 at each occurrence are independently selected from the group consisting of H; C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)1-2—S(O)0-2—(C1-C6 alkyl); —(CH2)0-4—C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —(C1-C4 alkyl)-aryl; —(C1-C4 alkyl)-heteroaryl; —(C1-C4 alkyl)-heterocycloalkyl; -aryl; -heteroaryl; -heterocycloalkyl; —(CH2)1-4—R265—(CH2)0-4-aryl; —(CH2)1-4—R265—(CH2)0-4-heteroaryl; and; —(CH2)1-4—R265—(CH2)0-4-heterocycloalkyl; wherein R265 at each occurrence is independently —O—, —S— or —N(C1-C6 alkyl)-; each aryl or phenyl is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200, each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210. 6. A compound according to claim 1, wherein Rc is selected from the group consisting of C1-C10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —OC═O NR235R240, —S(═O)0-2 R235, —NR235C═O NR235R240, —C═O NR235R240, and —S(═O)2 NR235R240; —(CH2)0-3—(C3-C8) cycloalkyl wherein the cycloalkyl is optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —CO2H, and —CO2—(C1-C4 alkyl); —(CR245R250)2-4-aryl; —(CR245R250)0-4-heteroaryl, —(CR245R250)0-4-heterocycloalkyl; —(CR245R250)0-4-aryl-heteroaryl; —(CR245R250)0-4-aryl-heterocycloalkyl; —(CR245R250)0-4-aryl-aryl; —(CR245R250)0-4-heteroaryl-aryl; —(CR245R250)0-4-heteroaryl-heterocycloalkyl; —(CR245R250)0-4-heteroaryl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heterocycloalkyl; —(CR245R250)0-4-heterocycloalkyl-aryl; —[C(R255)(R260)]1-3—CO—N—(R255)2; —CH(aryl)2; —CH(heteroaryl)2; —CH(heterocycloalkyl)2; —CH(aryl)(heteroaryl); cyclopentyl, cyclohexyl, or cycloheptyl ring fused to aryl, heteroaryl, or heterocycloalkyl wherein one carbon of the cyclopentyl, cyclohexyl, or cycloheptyl is optionally replaced with one or two NH, NR215, O, or S(═O)0-2, and wherein the cyclopentyl, cyclohexyl, or cycloheptyl group can be optionally substituted with 1 or 2 groups that are independently R205, ═O, —CO—NR235R240, or —SO2—(C1-C4 alkyl); C2-C10 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C10 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)0-1—CH((CH2)0-6—OH)—(CH2)0-1-aryl; —(CH2)0-1—CH((CH2)0-6—OH—(CH2)0-1-heteroaryl; —CH(-aryl or -heteroaryl)-CO—O(C1-C4 alkyl); —CH(—CH2—OH)—CH(OH)-phenyl-NO2; (C1-C6 alkyl)-O—(C1-C6 alkyl)-OH; —CH2—NH—CH2—CH(—O—CH2—CH3)2; —H; and —(CH2)0-6—C(═NR235)(NR235R240); wherein each aryl is optionally substituted with 1, 2, or 3 R200; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200; each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210; R200 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; OH; —NO2; halogen; —CO2H; C≡N; —(CH2)0-4—CO—NR220R225; —(CH2)0-4—CO—(C1-C12 alkyl); —(CH2)0-4—CO—(C2-C12 alkenyl); —(CH2)0-4—CO—(C2-C12 alkynyl); —(CH2)0-4—CO—(C3-C7 cycloalkyl); —(CH2)0-4—CO-aryl; —(CH2)0-4—CO-heteroaryl; —(CH2)0-4—CO-heterocycloalkyl; —(CH2)0-4—CO—O—R215; —(CH2)0-4—SO2—NR220R225; —(CH2)0-4—SO—(C1-C8 alkyl); —(CH2)0-4—SO2—(C1-C12 alkyl); —(CH2)0-4—SO2—(C3-C7 cycloalkyl); —(CH2)0-4—N(H or R215)—CO—O—R215; —(CH2)0-4—N(H or R215)—CO—N(R215)2; —(CH2)0-4—N—CS—N(R215)2; —(CH2)0-4—N(—H or R215)—CO—R220; —(CH2)0-4—NR220R225; —(CH2)0-4—O—CO—(C1-C6 alkyl); —(CH2)0-4—O—P(O)—(OR240)2; —(CH2)0-4—O—CO—N(R215)2; —(CH2)0-4—O—CS—N(R215)2; —(CH2)0-4—O—(R215); —(CH2)0-4—O—(R215)—COOH; —(CH2)0-4—S—(R215); —(CH2)0-4—O—(C1-C6 alkyl optionally substituted with 1, 2, 3, or 5 —F); C3-C7 cycloalkyl; C2-C6 alkenyl optionally substituted with 1 or 2 R205 groups; C2-C6 alkynyl optionally substituted with 1 or 2 R205 groups; —(CH2)0-4—N(H or R215)—SO2—R220; and —(CH2)0-4—C3-C7 cycloalkyl; wherein each aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210 or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein each heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; R205 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, halogen, —OH, —O-phenyl, —SH, —C≡N, —CF3, C1-C6 alkoxy, NH2, NH(C1-C6 alkyl), and N—(C1-C6 alkyl)(C1-C6 alkyl); R210 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; halogen; C1-C6 alkoxy; C1-C6 haloalkoxy; —NR220R225; OH; C≡N; C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —CO—(C1-C4 alkyl); —SO2—NR235R240; —CO—NR235R240; —SO2—(C1-C4 alkyl); and ═O; R215 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, —(CH2)0-2-(aryl), C2-C6 alkenyl, C2-C6 alkynyl, C3C7 cycloalkyl, and —(CH2)0-2-(heteroaryl), —(CH2)0-2-(heterocycloalkyl); wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R220 and R225 at each occurrence are independently selected from the group consisting of —H, —C1-C6 alkyl, hydroxy C1-C6 alkyl, amino C1-C6 alkyl; halo C1-C6 alkyl; —C3-C7 cycloalkyl, —(C1-C2 alkyl)-(C3-C7 cycloalkyl), —(C1-C6 alkyl)-O—(C1-C3 alkyl), —C2-C6 alkenyl, —C2-C6 alkynyl, —C1-C6 alkyl chain with one double bond and one triple bond, -aryl, -heteroaryl, and -heterocycloalkyl; wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R235 and R240 at each occurrence are independently H, or C1-C6 alkyl; R245 and R250 at each occurrence are independently selected from the group consisting of H, C1-C4 alkyl, C1-C4 alkylaryl, C1-C4 alkylheteroaryl, C1-C4 hydroxyalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, —(CH2)0-4—C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, and phenyl; or R245 and R250 are taken together with the carbon to which they are attached to form a carbocycle of 3, 4, 5, 6, or 7 carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO2—, and —NR220—; R255 and R260 at each occurrence are independently selected from the group consisting of H; C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)1-2—S(O)0-2—(C1-C6 alkyl); —(CH2)0-4—C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —(C1-C4 alkyl)-aryl; —(C1-C4 alkyl)-heteroaryl; —(C1-C4 alkyl)-heterocycloalkyl; -aryl; -heteroaryl; -heterocycloalkyl; —(CH2)1-4—R265—(CH2)0-4-aryl; —(CH2)1-4—R265—(CH2)0-4-heteroaryl; and; —(CH2)1-4—R265—(CH2)0-4-heterocycloalkyl; wherein R265 at each occurrence is independently —O—, —S— or —N(C1-C6 alkyl)-; each aryl or phenyl is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200, each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210. 7. A substituted aminoalcohol of formula (I): or a pharmaceutically acceptable salt or ester thereof, wherein B is H or C1-C10 straight or branched chain alkyl; R20, R2 and R3 are H; n is 0; R1 is 3,5-difluorophenyl; and Rc is where R is a C1-C4 straight or branched chain alkyl group, optionally substituted with —OB or —SO2B. 8. A method of treating a patient who has, or in preventing a patient from getting, a disease or condition selected from the group consisting of Alzheimer's disease, for helping prevent or delay the onset of Alzheimer's disease, for treating patients with mild cognitive impairment (MCI) and preventing or delaying the onset of Alzheimer's disease in those who would progress from MCI to AD, for treating Down's syndrome, for treating humans who have Hereditary Cerebral Hemorrhage with Amyloidosis of the Dutch-Type, for treating cerebral amyloid angiopathy and preventing its potential consequences, i.e. single and recurrent lobar hemorrhages, for treating other degenerative dementias, including dementias of mixed vascular and degenerative origin, dementia associated with Parkinson's disease, dementia associated with progressive supranuclear palsy, dementia associated with cortical basal degeneration, diffuse Lewy body type of Alzheimer's disease and who is in need of such treatment which comprises administration of a therapeutically effective amount of a compound selected from the group consisting of a substituted aminoalcohol of the formula (I): or pharmaceutically acceptable salt or ester thereof, wherein B is H, C1-C10 straight or branched chain alkyl; wherein R20 is H or C1-6 alkyl or alkenyl wherein n is 0 or 1; wherein R1 is: (I) C1-C6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, C1-C7 alkyl (optionally substituted with C1-C3 alkyl and C1-C3 alkoxy), —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, —OC═O NR1-aR1-b where R1-a and R1-b are as defined above, (II) —CH2—S(O)0-2—(C1-C6 alkyl), (III) —CH2—CH2—S(O)0-2—(C1-C6 alkyl), (IV) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (V) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (VI) —(CH2)n1—(R1-aryl) where n1 is zero or one and where R1-aryl is phenyl, 1-naphthyl, 2-naphthyl and indanyl, indenyl, dihydronaphthalyl, tetralinyl optionally substituted with one, two, three or four of the following substituents on the aryl ring: (A) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (B) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (C) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (D) —F, Cl, —Br and —I, (F) —C1-C6 alkoxy optionally substituted with one, two or three —F, (G) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (H)—OH, (I) —C≡N, (J) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (K) —CO—(C1-C4 alkyl), (L) —SO2NR1-aR1-b where R1-a and R1-b are as defined above, (M) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, or (N) —SO2—(C1-C4 alkyl), (VII) —(CH2)n1—(R1-heteroaryl) where n1 is as defined above and where R1-heteroaryl is selected from the group consisting of: (A) pyridinyl, (B) pyrimidinyl, (C) quinolinyl, (F) benzothienyl, (G) indolyl, (H) indolinyl, (I) pryidazinyl, (J) pyrazinyl, (K) isoindolyl, (L) isoquinolyl, (M) quinazolinyl, (N) quinoxalinyl, (O) phthalazinyl, (P) imidazolyl, (Q) isoxazolyl, (R) pyrazolyl, (S) oxazolyl, (T) thiazolyl, (U) indolizinyl, (V) indazolyl, (W) benzothiazolyl, (X) benzimidazolyl, (Y) benzofuranyl, (Z) furanyl, (AA) thienyl, (BB) pyrrolyl, (CC) oxadiazolyl, (DD) thiadiazolyl, (EE) triazolyl, (FF) tetrazolyl, (II) oxazolopyridinyl, (JJ) imidazopyridinyl (KK) isothiazolyl, (LL) naphthyridinyl (MM) cinnolinyl, (NN) carbazolyl, (OO) beta-carbolinyl, (PP) isochromanyl, (QQ) chromanyl, (SS) tetrahydroisoquinolinyl (TT) isoindolinyl, (UU) isobenzotetrahydrofuranyl, (VV) isobenzotetrahydrothienyl, (WW) isobenzothienyl (XX) benzoxazolyl, (YY) pyridopyridinyl (ZZ) benzotetrahydrofuranyl, (AAA) benzotetrahydrothienyl, (BBB) purinyl, (CCC) benzodioxolyl, (DDD) triazinyl, (EEE) phenoxazinyl, (FFF) phenothiazinyl, (GGG) pteridinyl, (HHH) benzothiazolyl, (III) imidazopyridinyl, (JJJ) imidazothiazolyl, (KKK) dihydrobenzisoxazinyl, (LLL) benzisoxazinyl, (MMM) benzoxazinyl, (NNN) dihydrobenzisothiazinyl, (OOO)benzopyranyl, (PPP) benzothiopyranyl, (QQQ) coumarinyl, (RRR) isocoumarinyl, (SSS) chromonyl, (TTT) chromanonyl, and (UUU) pyridinyl-N-oxide, where the R1-heteroaryl group is bonded to —CH2)n1— by any ring atom of the parent RN-heteroaryl group substituted by hydrogen such that the new bond to the R1-heteroaryl group replaces the hydrogen atom and its bond, where heteroaryl is optionally substituted with one, two, three or four of: (1) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (2) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (3) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —C1, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (4) —F, Cl, —Br and —I, (6) —C1-C6 alkoxy optionally substituted with one, two, or three —F, (7) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (8) —OH, (9) —C≡N, (10) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (11) —CO—(C1-C4 alkyl), (12) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (13) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, or (14) —SO2—(C1-C4 alkyl), with the proviso that when n1 is zero R1-heteroaryl is not bonded to the carbon chain by nitrogen, (VIII) —(CH2)n1—(R1-heterocycle) where n1 is as defined above and R1-heterocycle is selected from the group consisting of: (A) morpholinyl, (B) thiomorpholinyl, (C) thiomorpholinyl S-oxide, (D) thiomorpholinyl S,S-dioxide, (E) piperazinyl, (F) homopiperazinyl, (G) pyrrolidinyl, (H) pyrrolinyl, (I) tetrahydropyranyl, (J) piperidinyl, (K) tetrahydrofuranyl, (L) tetrahydrothienyl, (M) homopiperidinyl, (N) homomorpholinyl, (O) homothiomorpholinyl, (P) homomorpholinyl S-oxide, (Q) homothiomorpholinyl S,S-dioxide, and (R) oxazolidinonyl, where the R1-heterocycle group is bonded by any atom of the parent R1-heterocycle group substituted by hydrogen such that the new bond to the R1-heterocycle group replaces the hydrogen atom and its bond, where heterocycle is optionally substituted with one, two, three or four of: (1) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (2) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (3) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (4) —F, Cl, —Br and —I, (5) C1-C6 alkoxy, (6) —C1-C6 alkoxy optionally substituted with one, two, or three —F, (7) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (8) —OH, (9) —C≡N, (10) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (11) —CO—(C1-C4 alkyl), (12) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (13) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, (14) —SO2—(C1-C4 alkyl), or (15) ═O, with the proviso that when n1 is zero R1-heterocycle is not bonded to the carbon chain by nitrogen; or (IX) G-L-A-W- where A is: (I) phenyl, 1-naphthyl, 2-naphthyl, indanyl, indenyl, dihydronaphthalyl, tetralinyl, cyclopentyl, cyclohexyl, and cycloheptyl optionally substituted with one or two of the following substituents on the ring: (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′) R, R′ defined below (D) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (E) —NH—CO—O—RN-5 where RN-5 is as defined above, (F) —O—(C2-C6 alkyl)-COOH, (G) —NRR′ where R, R′ are H, C1-C6 alkyl, —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (H) —SR where R is H, C1-C6 alkyl, —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (I) —CH2OH, (J) —CO—(C1-C6) alkyl, (K) —CONRR′ where R, R′ are H, C1-C6 alkyl, —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (L) —SO2NRR′ where R, R′ are H, C1-C6 alkyl, (M) —COOH, (N) —C1-C6 alkyl, (O) —C2-C6 alkenyl with one or two double bonds, or (P) —C2-C6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three of —CF3, —F, —Cl, —Br, —I, C1-C3 alkyoxy, —OCF3, —NH2, —OH, and —CN, and provided that G, L and W may not all be absent; (II) R1-heteroaryl as defined above, where the R1-heteroaryl group bonds to the subsistent W by a ring carbon atom, and where R1-heteroaryl is optionally substituted with one, two, three, or four substituents independently chosen from the group consisting of: (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′) where R, R′ are defined below, (D) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (E) —NH—CO—O—RN-5 where RN-5 is as defined above, (F) —O—(C2-C6 alkyl)-COOH, (G) —NRR′ where R, R′ are independently H, C1-C6 alkyl, and —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (H) —SR where R and R1-aryl are as defined above, (I) —CH2OH, (J) —CO—(C1-C6) alkyl, (K) —CONRR′ where R, R′ and R1-aryl are as defined above, (L) —SO2NRR′ where R, R′ are H, C1-C6 alkyl, (M) —COOH, (N) —C1-C6 alkyl, (O) —C2-C6 alkenyl with one or two double bonds, and (P) —C2-C6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three substituent independently chosen from the group consisting of —CF3, —F, —Cl, —Br, —I, C1-C3 alkyoxy, —OCF3, —NH2, —OH, and —CN, and provided that G, L and W may not all be absent, or (III) R1-heterocycle as defined above: where the R1-heterocycle group bonds to the subsistent W by a ring carbon atom, and where R1-heteroaryl is optionally substituted with one to two substituents independently chosen from the group consisting of (1) ═O, (2) C1-C3 alkyl, (3) —CF3, (4) —F, Cl, —Br or —I, (5) C1-C3 alkoxy, (6) —O—CF3, (7) —NH2, (8) —OH, and (9) —C≡N, and provided that G, L and W may not all be absent, where W is —S(O)0-2—, —O—, —N—, or absent, and N is optionally substituted with C1-C4 alkyl; where L is —CO—, —S(O)1-2—, —O—, —C(Ra)(Rb)O—, —OC(Ra)(Rb)—, —N(Ra)—, —CON(Ra)—, —N(Ra)CO—, —C(Ra)(Rb)—, —C(OH)Ra—, —SO2NRa—, —N(Ra)SO2—, —N(Ra)CON(Rb)—, N(Ra)CSN(Rb)—, —OCOO—, —NCOO—, OCON(Ra)—, a bond, or L is absent when G is absent, and where Ra and Rb are independently H, C1-C4 alkyl which are optionally substituted. with OH, C1-C4 alkoxy, and up to five —F; where G is: (I) —C1-C10 alkyl optionally substituted with one substituent selected from the group consisting of: (A) —COOH, (B) —CO—O—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 alkyl optionally substituted with one to five —F (G) —(C1-C10 alkyl)-O—(C1-C3 alkyl), (H) —C2-C10 alkenyl with one or two double bonds, (I) —C2-C10 alkynyl with one or two triple bonds, (J) —C4-C10 hydrocarbyl chain with one double bond and one triple bond, (K) —R1-aryl where R1-aryl is as defined above, (L) —R1-heteroaryl where R1-heteroaryl is as defined above, (II) —(CH2)0-3—(C3-C7) cycloalkyl where cycloalkyl can be optionally substituted with one, two or three substituents selected from the group consisting of: (A) —COOH, (B) —CO—O—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 alkyl optionally substituted with one to five —F (G) —(C1-C10 alkyl)-O—(C1-C3 alkyl), (H) —C2-C10 alkenyl with one or two double bonds, (I) —C2-C10 alkynyl with one or two triple bonds, (J) —C4-C10 hydrocarbyl chain with one double bond and one triple bond, (K) —R1-aryl where R1-aryl is as defined above, (L) —R1-heteroaryl where R1-heteroaryl is as defined above, (III) —(CR′R″)0-4—R1-aryl where R′, R″ and R1-aryl are as defined above, (IV) (CH2)0-4—R1-heteroaryl where R1-heteroaryl is as defined above, (V) —(CH2)0-4—R1-heterocycle where R1-heterocycle is as defined above, (VI) —C(RC-1)(RC-2)—CO—NH—RC-3 where —RC-1 and —RC-2 are independently selected from the group consisting of: (A) —H, (B) —C1-C6 alkyl, (C) —(C0-C4 alkyl)-R1-aryl, wherein R1-aryl is as defined above, (D) —(C0-C4 alkyl)-R1-heteroaryl, wherein R1-heteroaryl is as defined above, (E) —(C0-C4 alkyl)-R1-heterocycle, wherein R1-heterocycle is as defined above, (F) —(CH2)1-4—OH, (G) —(CH2)1-4-RC-4—(CH2)1-4—RC′-aryl where —RC-4 is —O—, —S— or (H) —NRC-5— where —RC-5 is — or C1-C6 alkyl, and where RC′-aryl is defined above, and (I) —(CH2)1-4—RC-4—(CH2)1-4—RC-heteroaryl where RC-4 and RC-heteroaryl are as defined above, wherein in (C), (D) and (E) C0 is merely a bond, and where —RC-3 is: (a) —H, (b) —C1-C6 alkyl, (c) —(C0-C4 alkyl)-R1-aryl where R1-aryl is as defined above, (d) —(C0-C4 alkyl)-R1-heteroaryl where R1-heteroaryl is as defined above, (e) —(C0-C4 alkyl)-R1-heterocycle where R1-heterocycle is as defined above, (VII) -cyclopentyl or -cyclohexyl ring fused to a phenyl or heteroaryl ring where heteroaryl is as defined above and phenyl and heteroaryl are optionally substituted with one, two or three of: (G) C1-C6 alkyl, (B) —CF3, (C) —F, Cl, —Br and —I, (D) C1-C3 alkoxy, (E) —OCF3, (F) —NH2, (G) —OH, (H) —C≡N, (I) —NO2 (J) —CO—OH, (K) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(C0-C2 alkyl)-(R1-aryl) where R1-aryl is as defined above, (L) —NH—CO—O—RN-5 where RN-5 is as defined above, (M) —O—(C2-C5 alkyl)-COOH, or (N) —OR where R is as defined above, (O) —NR—R′ where R and R′ are as defined above, (P) —SR where R is as defined above, (Q) —CF3, (R) —OCF3, (S) —N(R)COR′ where R, R′ are as defined above, (T) —NRR′ where R, R′ are as defined above, (U) —SR where R is as defined above, (V) —CH2OH, (W) —CO—(C1-C6) alkyl, (X) —CONRR′ where R, R′ are as defined above, or (Y) —SO2NRR′ where R is as defined above, or (VIII) —(CH2)2—O—(CH2)2—OH; wherein R2 is selected from the group consisting of: (I) —H, (II) C1-C6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are as defined above, (III) —(CH2)0-4—R2-1 where R2-1 is R1-aryl or R1-heteroaryl where R1-aryl and R1-heteroaryl are as defined above; (IV) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl (V) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, and (VI) —(CH2)0-4—C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl; wherein R3 is selected from the group consisting of: (I) —H, (II) C1-C6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are as defined above, (III) —(CH2)0-4—R2-1 where R2-1 is R1-aryl or R1-heteroaryl where R1-aryl and R1-heteroaryl are as defined above; (IV) C2-C6 alkenyl with one or two double bonds, (V) C2-C6 alkynyl with one or two triple bonds, and (VI) —(CH2)0-4—C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, and where R2 and R3 are taken together with the carbon to which they are attached to form a carbocycle of three, four, five, six and seven carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO2—, —NRN-2—, where RN-2 is as defined below; and wherein Rc is selected from the group consisting of C1-C10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —OC═O NR235R240, —S(═O)0-2 R235, —NR235C═O NR235R240, —C═O NR235R240, and —S(═O)2 NR235R240; —(CH2)0-3—(C3-C8) cycloalkyl wherein the cycloalkyl is optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —CO2H, and —CO2—(C1-C4 alkyl); —(CR245R250)0-4-aryl; —(CR245R250)0-4-heteroaryl, —(CR245R250)0-4-heterocycloalkyl; —(CR245R250)0-4-aryl-heteroaryl; —(CR245R250)0-4-aryl-heterocycloalkyl; —(CR245R250)0-4-aryl-aryl; —(CR245R250)0-4-heteroaryl-aryl; —(CR245R250)0-4-heteroaryl-heterocycloalkyl; —(CR245R250)0-4-heteroaryl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heterocycloalkyl; —(CR245R250)0-4-heterocycloalkyl-aryl; —[C(R255)(R260)]1-3—CO—N—(R255)2; —CH(aryl)2; —CH(heteroaryl)2; —CH(heterocycloalkyl)2; —CH(aryl)(heteroaryl); cyclopentyl, cyclohexyl, or cycloheptyl ring fused to aryl, heteroaryl, or heterocycloalkyl wherein one carbon of the cyclopentyl, cyclohexyl, or cycloheptyl is optionally replaced with one or two NH, NR215, O, or S(═O)0-2, and wherein the cyclopentyl, cyclohexyl, or cycloheptyl group can be optionally substituted with 1 or 2 groups that are independently R205, ═O, —CO—NR235R240, or —SO2—(C1-C4 alkyl); C2-C10 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C10 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)0-1—CH((CH2)0-6—OH)—(CH2)0-1-aryl; —(CH2)0-1—CH((CH2)0-6—OH—(CH2)0-1-heteroaryl; —CH(-aryl or -heteroaryl)-CO—O(C1-C4 alkyl); —CH(—CH2—OH)—CH(OH)-phenyl-NO2; (C1-C6 alkyl)-O—(C1-C6 alkyl)-OH; —CH2—NH—CH2—CH(—O—CH2—CH3)2; —H; and —(CH2)0-6—C(═NR235)(NR235R240); wherein each aryl is optionally substituted with 1, 2, or 3 R200; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200; each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210; R200 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; OH; —NO2; halogen; —CO2H; C≡N; —(CH2)0-4CO—NR220R225; —(CH2)0-4—CO—(C1-C12 alkyl); —(CH2)0-4—CO—(C2-C12 alkenyl); —(CH2)0-4—CO—(C2-C12 alkynyl); —(CH2)0-4—CO—(C3-C7 cycloalkyl); —(CH2)0-4—CO-aryl; —(CH2)0-4—CO-heteroaryl; —(CH2)0-4—CO-heterocycloalkyl; —(CH2)0-4—CO—O—R215; —(CH2)0-4—SO2—NR220R225; —(CH2)0-4—SO—(C1-C8 alkyl); —(CH2)0-4—SO2—(C1-C12 alkyl); —(CH2)0-4—SO2—(C3-C7 cycloalkyl); —(CH2)0-4—N(H or R215)—CO—O—R215; —(CH2)0-4—N(H or R215)—CO—N(R215)2; —(CH2)0-4—N—CS—N(R215)2; —(CH2)0-4—N(—H or R215)—CO—R220; —(CH2)0-4—NR220R225; —(CH2)0-4—O—CO—(C1-C6 alkyl); —(CH2)0-4—O—P(O)—(OR240)2; —(CH2)0-4—O—CO—N(R215)2; —(CH2)0-4—O—CS—N(R215)2; —(CH2)0-4—O—(R215); —(CH2)0-4—O—(R215)—COOH; —(CH2)0-4—S—(R215); —(CH2)0-4—O—(C1-C6 alkyl optionally substituted with 1, 2, 3, or 5 —F); C3-C7 cycloalkyl; C2-C6 alkenyl optionally substituted with 1 or 2 R205 groups; C2-C6 alkynyl optionally substituted with 1 or 2 R205 groups; —(CH2)0-4—N(H or R215)—SO2—R220; and —(CH2)0-4—C3-C7 cycloalkyl; wherein each aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210 or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein each heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; R205 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, halogen, —OH, —O-phenyl, —SH, —C≡N, —CF3, C1-C6 alkoxy, NH2, NH(C1-C6 alkyl), and N—(C1-C6 alkyl)(C1-C6 alkyl); R210 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; halogen; C1-C6 alkoxy, C1-C6 haloalkoxy; —NR220R225; OH; C≡N; C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —CO—(C1-C4 alkyl); —SO2—NR235R240; —CO—NR235R240; —SO2—(C1-C4 alkyl); and ═O; R215 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, —(CH2)0-2-(aryl), C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, and —(CH2)0-2-(heteroaryl), —(CH2)0-2-(heterocycloalkyl); wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R220 and R225 at each occurrence are independently selected from the group consisting of —H, —C1-C6 alkyl, hydroxy C1-C6 alkyl, amino C1-C6 alkyl; halo C1-C6 alkyl; —C3-C7 cycloalkyl, —(C1-C2 akyl)-(C3-C7 cycloalkyl), —(C1-C6 alkyl)-O—(C1-C3 alkyl), —C2-C6 alkenyl, —C2-C6 alknyl, —C1-C6 alkyl chain with one double bond and one triple bond, -aryl, -heteroaryl, and -heterocycloalkyl; wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R235 and R240 at each occurrence are independently H, or C1-C6 alkyl; R245 and R250 at each occurrence are independently selected from the group consisting of H, C1-C4 alkyl, C1-C4 alkylaryl, C1-C4 alkylheteroaryl, C1-C4 hydroxyalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, —(CH2)0-4—C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, and phenyl; or R245 and R250 are taken together with the carbon to which they are attached to form a carbocycle of 3, 4, 5, 6, or 7 carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO2—, and —NR220—; R255 and R260 at each occurrence are independently selected from the group consisting of H; C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)1-2—S(O)0-2—(C1-C6 alkyl); —(CH2)0-4—C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —(C1-C4 alkyl)-aryl; —(C1-C4 alkyl)-heteroaryl; —(C1-C4 alkyl)-heterocycloalkyl; -aryl; -heteroaryl; -heterocycloalkyl; —(CH2)1-4—R265—(CH2)0-4-aryl; —(CH2)1-4—R265—(CH2)0-4-heteroaryl; and; —(CH2)1-4—R265—(CH2)0-4-heterocycloalkyl; wherein R265 at each occurrence is independently —O—, —S— or —N(C1-C6 alkyl)-; each aryl or phenyl is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200, each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210. 9. A method according to claim 5, wherein R1 is is G-L-A-E-W-, wherein E is a bond or C1-C3 alkylene; A is: (I) aryl or cycloalkyl where each aryl or cycloalkyl is optionally substituted with one, two or three independently selected R100 groups, where R100 is (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′)R, where R and R′ are independently hydrogen, C1-C6 alkyl, or —(CH2)0-2-aryl or —(CH2)0-2-cycloalkyl, where each aryl or cycloalkyl is optionally substituted with halogen, hydroxy, C1-C6 alkyl, C1-C6 alkyl, amino, mono(C1-C6)alkylamino, or di(C1-C6)alkylamino, (D) —CO2—R25, where R25 is selected from the group consisting of: (a) C1-C6 alkyl, (b) —(CH2)0-2-cycloalkyl, (c) —(CH2)0-2-aryl, where the aryl is optionally substituted with halogen, hydroxy, C1-C6 alkyl, C1-C6 alkyl, amino, mono(C1-C6)alkylamino, or di(C1-C6)alkylamino, and (d) hydrogen, (E) —NH—CO2—R25, (F) —O—(C2-C6 alkyl)-CO2H, (G) —NRR′, (H) —SR, (I) —CH2OH, (J) —C(O)—(C1-C6)alkyl, (K) —C(O)NRR′, (L) —SO2NRR′ (M) —CO2H, (N) C1-C6 alkyl, C1-C6 alkenyl with one or two double bonds, —C1-C6 alkynyl with one or two triple bonds, —CF3, —F, —Cl, —Br, —I, C1-C3 alkoxy, —OCF3, —NH2, —OH, or —CN, (O) halogen, and (P) —(CH2)0-2—O—(CH2)0-2—OH; (II) heteroaryl, provided that, when E is a bond, the heteroaryl group is bonded through one of its carbon atoms to W, and where the heteroaryl is optionally substituted with one or two independently selected R100 groups; (III) heterocycle, provided that, when E is a bond, the heterocycle group is bonded through one of its carbon atoms to W, where the heterocycle is optionally substituted with one or two independently selected R200 groups, where R200 is (1) ═O, (2) C1-C3 alkyl, (3) —CF3, (4) —F, Cl, —Br and —I, (5) C1-C3 alkoxy, (6) —OCF3, (7) —NH2, (8) —OH, or (9) —C≡N; W is a bond, —S—, —S(O)—, —SO2—, —O—, —N(R)— where R is hydrogen or C1-C4 alkyl; L is a bond or absent when G is absent, or L is —C(O)—, —S(O)—, —SO2—, —O—, —C(R110)(R112)O—, —OC(R110)(R112)—, —N(R110)—, —CON(R110)—, —N(R110)CO—, —C(R110)(R′)—, —C(OH)R110—, —SO2NR110—, —N(R110)SO2—, —N(R110)CON(R112)—, N(R110)CSN(R112)—, —OCO2—, —NCO2—, or —OCON(R110)—, where R110 and R112 are independently hydrogen, or C1-C4 alkyl, where C1-C4 alkyl is optionally substituted with OH, C1-C4 alkoxy, or one to five F; G is absent or: (I) C1-C10 alkyl, optionally substituted with up to three groups independently selected from (A) —CO2H, (B) —CO2(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NRR′, (F) —C1-C6 haloalkyl, (G) —(C1-C10 alkyl)-O—(C1-C3 alkyl), (H) —C1-C10 alkenyl with one or two double bonds, (I) —C1-C10 alkynyl with one or two triple bonds, (J) —C1-C10 alkyl chain with one double bond and one triple bond, (K) aryl optionally substituted with R100, (L) heteroaryl optionally substituted with R100, (M) C1-C6 alkyl, (II) —(CH2)0-3—(C3-C7) cycloalkyl where cycloalkyl is optionally substituted with one, two or three substituents selected from the group consisting of: (A) —CO2H, (B) CO2—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 haloalkyl, (G) —(C1-C10 alkyl)-O—(C1-C3 alkyl), (H) —C1-C10 alkenyl with one or two double bonds, (I) —C1-C10 alkynyl with one or two triple bonds, (J) —C1-C10 alkyl chain with one double bond and one triple bond, (K) aryl optionally substituted with R100, (L) heteroaryl optionally substituted with R100, (m) mono(C1-C6 alkyl)amino, and (n) di(C1-C6 alkyl) amino, (o) C1-C6 alkyl, (III) —(CRR)0-4-aryl where aryl is optionally substituted with R100, (IV) —(CH2)0-4-heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (V) —(CH2)0-4-heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, (VI) —C(R10)(R12)—CO—NH—R14 where R10 and R12 are the same or different and are selected from the group consisting of: (A) —H, (B) —C1-C6 alkyl, (C) —(C1-C4 alkyl)-aryl, where the aryl is optionally substituted with one, two, or three independently selected R100 groups, (D) —(C1-C4 alkyl)- heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (E) —(C1-C4 alkyl)-heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, (F) heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (G) heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, (H) —(CH2)1-4—OH, (I) —(CH2)1-4—Y—(CH2)1-4-aryl where Y is —O—, —S— or —N—RC-5— where R16 is hydrogen or C1-C6 alkyl, and where the aryl is optionally substituted with one, two, or three independently selected R100 groups, (J) —(CH2)1-4—Y—(CH2)1-4-heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, and (K) -aryl, where the aryl is optionally substituted with one, two, or three independently selected R100 groups, and R14 is: (A) —H, (B) —C1-C6 alkyl, (C) -aryl, where the aryl is optionally substituted with one, two, or three independently selected R100 groups, (D) -heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (E) -heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, (F) —(C1-C4 alkyl)-aryl, where the aryl is optionally substituted with one, two, or three independently selected R100 groups, (G) —(C1-C4 alkyl)-heteroaryl where the heteroaryl is optionally substituted with one, two, or three independently selected R100 groups, (H) —(C1-C4 alkyl)-heterocycle, where the heterocycle is optionally substituted with one or two R200 groups, or (I) —(CH2)0-2—O—(CH2)0-2—OH; R4 and R5 are independently hydrogen, halogen, C1-C6 alkoxy or C1-C4 alkyl. 10. A compound according to claim 5, wherein R1 is is —(CH2)1-2—S(O)0-2—(C1-C6 alkyl), or C1-C6 alkyl optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, ═O, —SH, —C≡N, —CF3, —C1-C3 alkoxy, amino, mono- or dialkylamino, —OC(═O)-amino, -amino-C(═O)O—, and —OC(═O)-mono- or dialkylamino, or C1-C10 alkyl optionally substituted —C1-C3 alkoxy, or C2-C6 alkenyl or C2-C6 alkynyl, each of which is optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, amino, and mono- or dialkylamino, or aryl, heteroaryl, heterocyclyl, —C1-C6 alkyl-aryl, —C1-C6 alkyl-heteroaryl, or —C1-C6 alkyl-heterocyclyl, where the ring portions of each are optionally substituted with 1, 2, 3, or 4 groups independently selected from halogen, —OH, —SH, —C≡N, —NR7R′7, —C(═O)—(C1-C4) alkyl, —SO2-amino, —SO2-mono or dialkylamino, —C(═O)-amino, —C(═O)-mono or dialkylamino, —SO2—(C1-C4) alkyl, or —C1-C6 alkoxy optionally substituted with 1, 2, or 3 groups which are independently a halogen, or C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, amino, —C1-C6 alkyl and mono- or dialkylamino, or C1-C10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, —SH, —C≡N, —CF3, —C1-C3 alkoxy, amino, mono- or dialkylamino and —C1-C3 alkyl, or C2-C6 alkenyl, alk(di)enyl, C2-C6 alkynyl or alk(di)ynyl, each of which is optionally substituted with 1, 2, or 3 groups independently selected from halogen, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, amino, —C1-C6 alkyl and mono- or dialkylamino; and the heterocyclyl group is optionally further substituted with oxo. 11. A method according to claim 8, wherein R1 is: (I) C1-C6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, C1-C7 alkyl (optionally substituted with C1-C3 alkyl and C1-C3 alkoxy), —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, —OC═O NR1-aR1-b where 1-a and R1-b are as defined above, (II) —CH2—S(O)0-2—(C1-C6 alkyl), (III) —CH2—CH2—S(O)0-2—(C1-C6 alkyl), (IV) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (V) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (VI) —(CH2)n1—(R1-aryl) where n1 is zero or one and where R1-aryl is phenyl, 1-naphthyl, 2-naphthyl and indanyl, indenyl, dihydronaphthalyl, tetralinyl optionally substituted with one, two, three or four of the following substituents on the aryl ring: (A) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR1-aR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (B) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (C) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (D) —Cl, —Br and —I, (F) —C1-C6 alkoxy optionally substituted with one, two or three —F, (G) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (H) —OH, (I) —C≡N, (J) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (K) —CO—(C1-C4 alkyl), (L) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (M) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, or (N) —SO2—(C1-C4 alkyl), (VII) —(CH2)1—(R1-heteroaryl) where n1 is as defined above and where R1-heteroaryl is selected from the group consisting of: (A) pyridinyl, (B) pyrimidinyl, (C) quinolinyl, (F) benzothienyl, (G) indolyl, (H) indolinyl, (I) pryidazinyl, (J) pyrazinyl, (K) isoindolyl (L) isoquinolyl, (M) quinazolinyl, (N) quinoxalinyl, (O) phthalazinyl, (P) imidazolyl, (Q) isoxazolyl, (R) pyrazolyl, (S) oxazolyl, (T) thiazolyl, (U) indolizinyl, (V) indazolyl (W) benzothiazolyl, (X) benzimidazolyl, (Y) benzofuranyl, (Z) furanyl, (AA) thienyl, (BB) pyrrolyl, (CC) oxadiazolyl, (DD) thiadiazolyl, (EE) triazolyl, (FF) tetrazolyl, (II) oxazolopyridinyl, (JJ) imidazopyridinyl, (KK) isothiazolyl, (LL) naphthyridinyl, (MM) cinnolinyl, (NN) carbazolyl, (OO) beta-carbolinyl, (PP) isochromanyl, (QQ) chromanyl, (SS) tetrahydroisoquinolinyl, (TT) isoindolinyl, (UU) isobenzotetrahydrofuranyl, (VV) isobenzotetrahydrothienyl, (WW) isobenzothienyl, (XX) benzoxazolyl, (YY) pyridopyridinyl, (ZZ) benzotetrahydrofuranyl, (AAA) benzotetrahydrothienyl, (BBB) purinyl, (CCC) benzodioxolyl, (DDD) triazinyl, (EEE) phenoxazinyl, (FFF) phenothiazinyl, (GGG) pteridinyl, (HHH) benzothiazolyl, (III) imidazopyridinyl, (JJJ) imidazothiazolyl, (KKK) dihydrobenzisoxazinyl, (LLL) benzisoxazinyl, (MMM) benzoxazinyl, (NNN) dihydrobenzisothiazinyl, (OOO) benzopyranyl, (PPP) benzothiopyranyl, (QQQ) coumarinyl, (RRR) isocoumarinyl, (SSS) chromonyl, (TTT) chromanonyl, and (UUU) pyridinyl-N-oxide, where the R1-heteroaryl group is bonded to —CH2)n1— by any ring atom of the parent RN-heteroaryl group substituted by hydrogen such that the new bond to the R1-heteroaryl group replaces the hydrogen atom and its bond, where heteroaryl is optionally substituted with one, two, three or four of: (1) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —1, —OH, —SH, —NR1-aR1-b where R1 a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (2) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (3) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —C1, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (4) —F, Cl, —Br and —I, (6) —C1-C6 alkoxy optionally substituted with one, two, or three —F, (7) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (8) —OH, (9) —C≡N, (10) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (11) —CO—(C1-C4 alkyl), (12) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (13) —O—NR1-aR1-b where R1-a and R1-b are as defined above, or (14) —SO2—(C1-C4 alkyl), with the proviso that when n1 is zero R1-heteroaryl is not bonded to the carbon chain by nitrogen, (VIII) —(CH2)n1—(R1-heterocycle) where n1 is as defined above and R1-heterocycle is selected from the group consisting of: (A) morpholinyl, (B) thiomorpholinyl, (C) thiomorpholinyl S-oxide, (D) thiomorpholinyl S,S-dioxide, (E) piperazinyl, (F) homopiperazinyl, (G) pyrrolidinyl, (H) pyrrolinyl, (I) tetrahydropyranyl, (J) piperidinyl, (K) tetrahydrofuranyl, (L) tetrahydrothienyl, (M) homopiperidinyl, (N) homomorpholinyl, (O) homothiomorpholinyl, (P) homomorpholinyl S-oxide, (Q) homothiomorpholinyl S,S-dioxide, and (R) oxazolidinonyl, where the R1-heterocycle group is bonded by any atom of the parent R1-heterocycle group substituted by hydrogen such that the new bond to the R1-heterocycle group replaces the hydrogen atom and its bond, where heterocycle is optionally substituted with one, two, three or four of: (1) C1-C6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C1-C3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR1-bR1-b where R1-a and R1-b are as defined above, —C≡N, —CF3, C1-C3 alkoxy, (2) C2-C6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —CN, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (3) C2-C6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (4) —F, Cl, —Br and —I, (5) C1-C6 alkoxy, (6) —C1-C6 alkoxy optionally substituted with one, two, or three —F, (7) —NRN-2RN-3 where RN-2 and RN-3 are as defined below, (8) —OH, (9) —C≡N, (10) C3-C7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF3, C1-C3 alkoxy, —NR1-aR1-b where R1-a and R1-b are —H or C1-C6 alkyl, (11) —CO—(C1-C4 alkyl), (12) —SO2—NR1-aR1-b where R1-a and R1-b are as defined above, (13) —CO—NR1-aR1-b where R1-a and R1-b are as defined above, (14) —SO2—(C1-C4 alkyl), or (15) ═O, with the proviso that when n1 is zero R1-heterocycle is not bonded to the carbon chain by nitrogen; or (IX) G-L-A-W- where A is: (I) phenyl, 1-naphthyl, 2-naphthyl, indanyl, indenyl, dihydronaphthalyl, tetralinyl, cyclopentyl, cyclohexyl, and cycloheptyl optionally substituted with one or two of the following substituents on the ring: (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′) R, R′ defined below (D) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (E) —NH—CO—O—RN-5 where RN-5 is as defined above, (F) —O—(C2-C6 alkyl)-COOH, (G) —NRR′ where R, R′ are H, C1-C6 alkyl, —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (H) —SR where R is H, C1-C6 alkyl, —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (I) —CH2OH, (J) —CO—(C1-C6) alkyl, (K) —CONRR′ where R, R′ are H, C1-C6 alkyl, —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (L) —SO2NRR′ where R, R′ are H, C1-C6 alkyl, (M) —COOH, (N) —C1-C6 alkyl, (O) —C2-C6 alkenyl with one or two double bonds, or (P) —C2-C6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three of —CF3, —F, —Cl, —Br, —I, C1-C3 alkyoxy, —OCF3, —NH2, —OH, and —CN, and provided that G, L and W may not all be absent; (II) R1-heteroaryl as defined above, where the R1-heteroaryl group bonds to the subsistent W by a ring carbon atom, and where R1-heteroaryl is optionally substituted with one, two, three, or four substituents independently chosen from the group consisting of: (A) —NO2, (B) —C≡N, (C) —N(R)CO(R′) where R, R′ are defined below, (D) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (E) —NH—CO—O—RN-5 where RN-5 is as defined above, (F) —O—(C2-C6 alkyl)-COOH, (G) —NRR′ where R, R′ are independently H, C1-C6 alkyl, and —(CH2)0-2—(R1-aryl) where R1-aryl is as defined above, (H) —SR where R and R1-aryl are as defined above, (I) —CH2OH, (J) —CO—(C1-C6) alkyl, (K) —CONRR′ where R, R′ and R1-aryl are as defined above, (L) —SO2NRR′ where R, R′ are H, C1-C6 alkyl, (M) —COOH, (N) —C1-C6 alkyl, (O) —C2-C6 alkenyl with one or two double bonds, and (P) —C2-C6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three substituent independently chosen from the group consisting of —CF3, —F, —Cl, —Br, —I, C1-C3 alkyoxy, —OCF3, —NH2, —OH, and —CN, and provided that G, L and W may not all be absent, or (III) R1-heterocycle as defined above: where the R1-heterocycle group bonds to the subsistent W by a ring carbon atom, and where R1-heteroaryl is optionally substituted with one to two substituents independently chosen from the group consisting of (1) ═O, (2) C1-C3 alkyl, (3) —CF3, (4) —F, Cl, —Br or —I, (5) C1-C3 alkoxy, (6) —O—CF3, (7) —NH2, (8) —OH, and (9) —C≡N, and provided that G, L and W may not all be absent, where W is —S(O)0-2—, —O—, —N—, or absent, and N is optionally substituted with C1-C4 alkyl; where L is —CO—, —S(O)1-2—, —O—, —C(Ra)(Rb)O—, —OC(Ra)(Rb)—, —N(Ra)—, —CON(Ra)—, —N(Ra)CO—, —C(Ra)(Rb)—, —C(OH)Ra—, —SO2NRa—, —N(Ra)SO2—, —N(Ra)CON(Rb)—, N(Ra)CSN(Rb)—, —OCOO—, —NCOO—, OCON(Ra)—, a bond, or L is absent when G is absent, and where Ra and Rb are independently H, C1-C4 alkyl which are optionally substituted. with OH, C1-C4 alkoxy, and up to five —F; where G is: (I) —C1-C10 alkyl optionally substituted with one substituent selected from the group consisting of: (A) —COOH, (B) —CO—O—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 alkyl optionally substituted with one to five —F (G) —(C1-C10 alkyl)-O—(C1-C3 alkyl), (H) —C2-C10 alkenyl with one or two double bonds, (I) —C2-C10 alkynyl with one or two triple bonds, (J) —C4-C10 hydrocarbyl chain with one double bond and one triple bond, (K) —R1-aryl where R1-aryl is as defined above, (L) —R1-heteroaryl where R1-heteroaryl is as defined above, (II) —(CH2)0-3—(C3-C7) cycloalkyl where cycloalkyl can be optionally substituted with one, two or three substituents selected from the group consisting of: (A) —COOH, (B) —CO—O—(C1-C4 alkyl), (C) C1-C6 alkoxy, (D) —OH, (E) —NH2, (F) —C1-C6 alkyl optionally substituted with one to five —F (G) —(C1-C10 alkyl)-O—(C1-C3 alkyl), (H) —C2-C10 alkenyl with one or two double bonds, (I) —C2-C10 alkynyl with one or two triple bonds, (J) —C4-C10 hydrocarbyl chain with one double bond and one triple bond, (K) —R1-aryl where R1-aryl is as defined above, (L) —R1-heteroaryl where R1-heteroaryl is as defined above, (III) —(CR′R′)0-4—R1-aryl where R′, R″ and R1-aryl are as defined above, (IV) —(CH2)0-4—R1-heteroaryl where R1-heteroaryl is as defined above (V) —(CH2)0-4—R1-heterocycle where R1-heterocycle is as defined above, (VI) —C(RC-1)(RC-2)—CO—NH—RC-3 where RC-1 and RC-2 are independently selected from the group consisting of: (A) —H, (B) —C1-C6 alkyl, (C) —(C0-C4 alkyl)-R1-aryl wherein R1-aryl, is as defined above, (D) —(C0-C4 alkyl)-R1-heteroaryl, wherein R1-heteroaryl is as defined above, (E) —(C0-C4 alkyl)-R1-heterocycle, wherein R1-heterocycle is as defined above, (F) —(CH2)1-4—OH, (G) —(CH2)1-4—RC-4—(CH2)1-4—RC′-aryl where —RC-4 is —O—, —S— or (H) —NRC-5— where —RC-5 is — or C1-C6 alkyl, and where RC′-aryl is defined above, and (I) —(CH2)1-4—RC-4—(CH2)1-4—RC-heteroaryl where RC-4 and RC-heteroaryl are as defined above, wherein in (C), (D) and (E) C0 is merely a bond, and where —RC-3 is: (a) —H, (b) —C1-C6 alkyl, (c) —(C0-C4 alkyl)-R1-aryl where R1-aryl is as defined above, (d) —(C0-C4 alkyl)-R1-heteroaryl where R1-heteroaryl is as defined above, (e) —(C0-C4 alkyl)-R1-heterocycle where R1-heterocycle is as defined above, (VII) -cyclopentyl or -cyclohexyl ring fused to a phenyl or heteroaryl ring where heteroaryl is as defined above and phenyl and heteroaryl are optionally substituted with one, two or three of: (H) C1-C6 alkyl, (B) —CF3, (C) —F, Cl, —Br and —I, (D) C1-C3 alkoxy, (E) —OCF3, (F) —NH2, (G) —OH, (H) —C≡N, (I) —NO2 (J) —CO—OH, (K) —CO—O—RN-5 where RN-5 is selected from the group consisting of: (a) C1-C6 alkyl, and (b) —(C0-C2 alkyl)-(R1-aryl) where R1-aryl is as defined above, (L) —NH—CO—O—RN-5 where RN-5 is as defined above, (M) —O—(C2-C5 alkyl)-COOH, or (N) —OR where R is as defined above, (O) —NR—R′ where R and R′ are as defined above, (P) —SR where R is as defined above, (Q) —CF3, (R) —OCF3, (S) —N(R)COR′ where R, R′ are as defined above, (T) —NRR′ where R, R′ are as defined above, (U) —SR where R is as defined above, (V) —CH2OH, (W) —CO—(C1-C6) alkyl, (X) —CONRR′ where R, R′ are as defined above, or (Y) —SO2NRR′ where R is as defined above, or (VIII) —(CH2)2—O—(CH2)2—OH. 12. A method according to claim 8, wherein Rc is selected from the group consisting of C1-C10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —OC═O NR235R240, —S(═O)0-2 R235, —NR235C═O NR235R240, —C═O NR235R240, and —S(═O)2 NR235R240; —(CH2)0-3—(C3-C8) cycloalkyl wherein the cycloalkyl is optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —CO2H, and —CO2—(C1-C4 alkyl); —(CR245R250)1-4-aryl; —(CR245R250)0-4-heteroaryl, —(CR245R250)0-4-heterocycloalkyl; —(CR245R250)0-4-aryl-heteroaryl; —(CR245R255)0-4-aryl-heterocycloalkyl; —(CR245R250)0-4-aryl-aryl; —(CR245R250)0-4-heteroaryl-aryl; —(CR245R250)0-4-heteroaryl-heterocycloalkyl; —(CR245R250)0-4-heteroaryl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heterocycloalkyl; —(CR245R250)0-4-heterocycloalkyl-aryl; —[C(R255)(R260)]1-3—CO—N—(R255)2; —CH(aryl)2; —CH(heteroaryl)2; —CH(heterocycloalkyl)2; —CH(aryl)(heteroaryl); cyclopentyl, cyclohexyl, or cycloheptyl ring fused to aryl, heteroaryl, or heterocycloalkyl wherein one carbon of the cyclopentyl, cyclohexyl, or cycloheptyl is optionally replaced with one or two NH, NR215, O, or S(═O)0-2, and wherein the cyclopentyl, cyclohexyl, or cycloheptyl group can be optionally substituted with 1 or 2 groups that are independently R205, ═O, —CO—NR235R240, or —SO2—(C1-C4 alkyl); C2-C10 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C10 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)0-1—CH((CH2)0-6—OH)—(CH2)0-1-aryl; —(CH2)0-1—CH((CH2)0-6—OH—(CH2)0-1-heteroaryl; —CH(-aryl or -heteroaryl)-CO—O(C1-C4 alkyl); —CH(—CH2—OH)—CH(OH)—phenyl-NO2; (C1-C6 alkyl)-O—(C1-C6 alkyl)-OH; —CH2—NH—CH2—CH(—O—CH2—CH3)2; —H; and —(CH2)0-6—C(═NR235)(NR235R240); wherein each aryl is optionally substituted with 1, 2, or 3 R200; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200; each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210; R200 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; OH; —NO2; halogen; —CO2H; C≡N; —(CH2)0-4—CO—NR220R225; —(CH2)0-4—CO—(C1-C12 alkyl); —(CH2)0-4—CO—(C2-C12 alkenyl); —(CH2)0-4—CO—(C2-C12 alkynyl); —(CH2)0-4—CO—(C3-C7 cycloalkyl); —(CH2)0-4—CO-aryl; —(CH2)0-4—CO-heteroaryl; —(CH2)0-4—CO-heterocycloalkyl; —(CH2)0-4—CO—O—R215; —(CH2)0-4—SO2—NR220R225; —(CH2)0-4—SO—(C1-C8 alkyl); —(CH2)0-4—SO2—(C1-C12 alkyl); —(CH2)0-4—SO2—(C3-C7 cycloalkyl); —(CH2)0-4—N(H or R215)—CO—O—R215; —(CH2)0-4—N(H or R215)—CO—N(R215)2; —(CH2)0-4—N—CS—N(R215)2; —(CH2)0-4—N(—H or R215)—CO—R220; —(CH2)0-4—NR220R225; —(CH2)0-4—O—CO—(C1-C6 alkyl); —(CH2)0-4—O—P(O)—(OR240)2; —(CH2)0-4—O—CO—N(R215)2; —(CH2)0-4—O—CS—N(R215)2; —(CH2)0-4—O—(R215); —(CH2)0-4—O—(R215)—COOH; —(CH2)0-4—S—(R215); —(CH2)0-4—O—(C1-C6 alkyl optionally substituted with 1, 2, 3, or 5 —F); C3-C7 cycloalkyl; C2-C6 alkenyl optionally substituted with 1 or 2 R205 groups; C2-C6 alkynyl optionally substituted with 1 or 2 R205 groups; —(CH2)0-4—N(H or R215)—SO2—R220; and —(CH2)0-4—C3-C7 cycloalkyl; wherein each aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210 or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein each heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; R205 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, halogen, —OH, —O-phenyl, —SH, —C≡N, —CF3, C1-C6 alkoxy, NH2, NH(C1-C6 alkyl), and N—(C1-C6 alkyl)(C1-C6 alkyl); R210 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; halogen; C1-C6 alkoxy; C1-C6 haloalkoxy; —NR220R225; OH; C≡N; C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —CO—(C1-C4 alkyl); —SO2—NR235R240; —CO—NR235R240; —SO2—(C1-C4 alkyl); and ═O; R215 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, —(CH2)0-2-(aryl), C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, and —(CH2)0-2-(heteroaryl), —(CH2)0-2-(heterocycloalkyl); wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R220 and R225 at each occurrence are independently selected from the group consisting of —H, —C1-C6 alkyl, hydroxy C1-C6 alkyl, amino C1-C6 alkyl; halo C1-C6 alkyl; —C3-C7 cycloalkyl, —(C1-C2 alkyl)-(C3-C7 cycloalkyl), —(C1-C6 alkyl)-O—(C1-C3 alkyl), —C2-C6 alkenyl, —C2-C6 alkynyl, —C1-C6 alkyl chain with one double bond and one triple bond, -aryl, -heteroaryl, and -heterocycloalkyl; wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R235 and R240 at each occurrence are independently H, or C1-C6 alkyl; R245 and R250 at each occurrence are independently selected from the group consisting of H, C1-C4 alkyl, C1-C4 alkylaryl, C1-C4 alkylheteroaryl, C1-C4 hydroxyalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, —(CH2)0-4—C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, and phenyl; or R245 and R250 are taken together with the carbon to which they are attached to form a carbocycle of 3, 4, 5, 6, or 7 carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO2—, and —NR220—; R255 and R260 at each occurrence are independently selected from the group consisting of H; C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)1-2—S(O)0-2—(C1-C6 alkyl); —(CH2)0-4—C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —(C1-C4 alkyl)-aryl; —(C1-C4 alkyl)-heteroaryl; —(C1-C4 alkyl)-heterocycloalkyl; -aryl; -heteroaryl; -heterocycloalkyl; —(CH2)1-4—R265—(CH2)0-4-aryl; —(CH2)1-4—R265—(CH2)0-4-heteroaryl; and; —(CH2)1-4—R265—(CH2)0-4-heterocycloalkyl; wherein R265 at each occurrence is independently —O—, —S— or —N(C1-C6 alkyl)-; each aryl or phenyl is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200, each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210. 13. A method according to claim 8, wherein Rc is selected from the group consisting of C1-C10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —OC═O NR235R240, —S(═O)0-2 R235, —NR235C═O NR235R240, —C═O NR235R240, and —S(═O)2 NR235R240; —(CH2)0-3—(C3-C8) cycloalkyl wherein the cycloalkyl is optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R205, —CO2H, and —CO2—(C1-C4 alkyl); —(CR245R250)2-4-aryl; —(CR245R250)0-4-heteroaryl, —(CR245R250)0-4-heterocycloalkyl; —(CR245R250)0-4-aryl-heteroaryl; —(CR245R250)0-4-aryl-heterocycloalkyl; —(CR245R250)0-4-aryl-aryl; —(CR245R250)0-4-heteroaryl-aryl; —(CR245R250)0-4-heteroaryl-heterocycloalkyl; —(CR245R250)0-4-heteroaryl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heteroaryl; —(CR245R250)0-4-heterocycloalkyl-heterocycloalkyl; —(CR245R250)0-4-heterocycloalkyl-aryl; —[C(R255)(R260)]1-3—CO—N—(R255)2; —CH(aryl)2; —CH(heteroaryl)2; —CH(heterocycloalkyl)2; —CH(aryl)(heteroaryl); cyclopentyl, cyclohexyl, or cycloheptyl ring fused to aryl, heteroaryl, or heterocycloalkyl wherein one carbon of the cyclopentyl, cyclohexyl, or cycloheptyl is optionally replaced with one or two NH, NR215, O, or S(═O)0-2, and wherein the cyclopentyl, cyclohexyl, or cycloheptyl group can be optionally substituted with 1 or 2 groups that are independently R205, ═O, —CO—NR235R240, or —SO2—(C1-C4 alkyl); C2-C10 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C10 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)0-1—CH((CH2)0-6—OH)—(CH2)0-1-aryl; —(CH2)0-1—CH((CH2)0-6—OH—(CH2)0-1-heteroaryl; —CH(-aryl or -heteroaryl)-CO—O(C1-C4 alkyl); —CH(—CH2—OH)—CH(OH)-phenyl-NO2; (C1-C6 alkyl)-O—(C1-C6 alkyl)-OH; —CH2—NH—CH2—CH(—O—CH2—CH3)2; —H; and —(CH2)0-6—C(═NR235)(NR235R240); wherein each aryl is optionally substituted with 1, 2, or 3 R200; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200; each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210; R200 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; OH; —NO2; halogen; —CO2H; C≡N; —(CH2)0-4—CO—NR220R225; —(CH2)0-4—CO—(C1-C12 alkyl); —(CH2)0-4—CO—(C2-C12 alkenyl); —(CH2)0-4—CO—(C2-C12 alkynyl); —(CH2)0-4—CO—(C3-C7 cycloalkyl); —(CH2)0-4—CO-aryl; —(CH2)0-4—CO-heteroaryl; —(CH2)0-4—CO-heterocycloalkyl; —(CH2)0-4—CO—O—R215; —(CH2)0-4—SO2—NR220R225; —(CH2)0-4—SO—(C1-C8 alkyl); —(CH2)0-4—SO2—(C1-C12 alkyl); —(CH2)0-4—SO2—(C3-C7 cycloalkyl); —(CH2)0-4—N(H or R215)—CO—O—R215; —(CH2)0-4—N(H or R215)—CO—N(R215)2; —(CH2)0-4—N—CS—N(R215)2; —(CH2)0-4—N(—H or R215)—CO—R220; —(CH2)0-4—NR220R225; —(CH2)0-4—O—CO—(C1-C6 alkyl); —(CH2)0-4—O—P(O)—(OR240); —(CH2)0-4—O—CO—N(R215)2; —(CH2)0-4—O—CS—N(R215)2; —(CH2)0-4—O—(R215); —(CH2)0-4—O—(215)—COOH; —(CH2)0-4—S—(R215); —(CH2)0-4—O—(C1-C6 alkyl optionally substituted with 1, 2, 3, or 5 —F); C3-C7 cycloalkyl; C2-C6 alkenyl optionally substituted with 1 or 2 R205 groups; C2-C6 alkynyl optionally substituted with 1 or 2 R205 groups; —(CH2)0-4—N(H or R215)—SO2—R220; and —(CH2)0-4—C3-C7 cycloalkyl; wherein each aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210 or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein each heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; R205 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, halogen, —OH, —O-phenyl, —SH, —C≡N, —CF3, C1-C6 alkoxy, NH2, NH(C1-C6 alkyl), and N—(C1-C6 alkyl)(C1-C6 alkyl); R210 at each occurrence is independently selected from the group consisting of C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; halogen; C1-C6 alkoxy; C1-C6 haloalkoxy, —NR220R225; OH; C≡N; C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —CO—(C1-C4 alkyl); —SO2—NR235R240; —CO—NR235R240; —SO2—(C1-C4 alkyl); and ═O; R215 at each occurrence is independently selected from the group consisting of C1-C6 alkyl, —(CH2)0-2-(aryl), C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, and —(CH2)0-2-(heteroaryl), —(CH2)0-2-(heterocycloalkyl); wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R220 and R225 at each occurrence are independently selected from the group consisting of —H, —C1-C6 alkyl, hydroxy C1-C6 alkyl, amino C1-C6 alkyl; halo C1-C6 alkyl; —C3-C7 cycloalkyl, —(C1-C2 alkyl)-(C3-C7 cycloalkyl), —(C1-C6 alkyl)-O—(C1-C3 alkyl), —C2-C6 alkenyl, —C2-C6 alkynyl, —C1-C6 alkyl chain with one double bond and one triple bond, -aryl, -heteroaryl, and -heterocycloalkyl; wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R205 or R210; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R210; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R210; R235 and R240 at each occurrence are independently H, or C1-C6 alkyl; R245 and R250 at each occurrence are independently selected from the group consisting of H, C1-C4 alkyl, C1-C4 alkylaryl, C1-C4 alkylheteroaryl, C1-C4 hydroxyalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, —(CH2)0-4-C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, and phenyl; or R245 and R250 are taken together with the carbon to which they are attached to form a carbocycle of 3, 4, 5, 6, or 7 carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO2—, and —NR220—; R255 and R260 at each occurrence are independently selected from the group consisting of H; C1-C6 alkyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkenyl optionally substituted with 1, 2, or 3 R205 groups; C2-C6 alkynyl optionally substituted with 1, 2, or 3 R205 groups; —(CH2)1-2—S(O)0-2—(C1-C6 alkyl); —(CH2)0-4—C3-C7 cycloalkyl optionally substituted with 1, 2, or 3 R205 groups; —(C1-C4 alkyl)-aryl; —(C1-C4 alkyl)-heteroaryl; —(C1-C4 alkyl)-heterocycloalkyl; -aryl; -heteroaryl; -heterocycloalkyl; (CH2)1-4—R265—(CH2)0-4-aryl; —(CH2)1-4—R265—(CH2)0-4-heteroaryl; and; —(CH2)1-4—R265—(CH2)0-4-heterocycloalkyl; wherein R265 at each occurrence is independently —O—, —S— or —N(C1-C6 alkyl)-; each aryl or phenyl is optionally substituted with 1, 2, or 3 groups that are independently R205, R210, or C1-C6 alkyl substituted with 1, 2, or 3 groups that are independently R205 or R210; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R200, each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R210. 14. A method of treating a patient who has, or in preventing a patient from getting, a disease or condition selected from the group consisting of Alzheimer's disease, for helping prevent or delay the onset of Alzheimer's disease, for treating patients with mild cognitive impairment (MCI) and preventing or delaying the onset of Alzheimer's disease in those who would progress from MCI to AD, for treating Down's syndrome, for treating humans who have Hereditary Cerebral Hemorrhage with Amyloidosis of the Dutch-Type, for treating cerebral amyloid angiopathy and preventing its potential consequences, i.e. single and recurrent lobar hemorrhages, for treating other degenerative dementias, including dementias of mixed vascular and degenerative origin, dementia associated with Parkinson's disease, dementia associated with progressive supranuclear palsy, dementia associated with cortical basal degeneration, diffuse Lewy body type of Alzheimer's disease and who is in need of such treatment which comprises administration of a therapeutically effective amount of a compound selected from the group consisting of a substituted aminoalcohol of the formula (I): or a pharmaceutically acceptable salt or ester thereof, wherein B is H or C1-C10 straight or branched chain alkyl; R20, R2 and R3 are H; n is 0; R1 is 3,5-difluorophenyl; and Rc is where R is a C1-C4 straight or branched chain alkyl group, optionally substituted with —OB or —O2B. 15. A method for making a compound of formula (I) or a pharmaceutically acceptable salt or ester thereof, wherein B, R20, R2, R3, n and Rc are as defined in claim 1. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention The invention is relates to substituted aminoalcohols and to such compounds that are useful in treatment of Alzheimer's disease and similar diseases, more specifically it relates to such compounds that inhibit β-secretase, an enzyme that cleaves amyloid precursor protein to produce Aβ peptide, a major component of the amyloid plaques found in the brains of Alzheimer's sufferers. 2. Description of the Related Art Alzheimer's disease (AD) is a progressive degenerative disease of the brain primarily associated with aging. Clinical presentation of AD is characterized by loss of memory, cognition, reasoning, judgement, and orientation. As the disease progresses, motor, sensory, and linguistic abilities are also affected until there is global impairment of multiple cognitive functions. These cognitive losses occur gradually, but typically lead to severe impairment and eventual death in the range of four to twelve years. Alzheimer's disease is characterized by two major pathologic observations in the brain: neurofibrillary tangles and beta amyloid (or neuritic) plaques, comprised predominantly of an aggregate of a peptide fragment know as A beta. Individuals with AD exhibit characteristic beta-amyloid deposits in the brain (beta amyloid plaques) and in cerebral blood vessels (beta amyloid angiopathy) as well as neurofibrillary tangles. Neurofibrillary tangles occur not only in Alzheimer's disease but also in other dementia-inducing disorders. On autopsy, large numbers of these lesions are generally found in areas of the human brain important for memory and cognition. Smaller numbers of these lesions in a more restricted anatomical distribution are found in the brains of most aged humans who do not have clinical AD. Amyloidogenic plaques and vascular amyloid angiopathy also characterize the brains of individuals with Trisomy 21 (Down's Syndrome), Hereditary Cerebral Hemorrhage with Amyloidosis of the Dutch-Type (HCHVA-D), and other neurogenerative disorders. Beta-amyloid is a defining feature of AD, now believed to be a causative precursor or factor in the development of disease. Deposition of A beta in areas of the brain responsible for cognitive activities is a major factor in the development of AD. Beta-amyloid plaques are predominantly composed of amyloid beta peptide (A beta, also sometimes designated betaA4). A beta peptide is derived by proteolysis of the amyloid precursor protein (APP) and is comprised of 39-42 amino acids. Several proteases called secretases are involved in the processing of APP. Cleavage of APP at the N-terminus of the A beta peptide by beta-secretase and at the C-terminus by one or more gamma-secretases constitutes the beta-amyloidogenic pathway, i.e. the pathway by which A beta is formed. Cleavage of APP by alpha-secretase produces alpha-sAPP, a secreted form of APP that does not result in beta-amyloid plaque formation. This alternate pathway precludes the formation of A beta peptide. A description of the proteolytic processing fragments of APP is found, for example, in U.S. Pat. Nos. 5,441,870; 5,721,130; and 5,942,400. An aspartyl protease has been identified as the enzyme responsible for processing of APP at the beta-secretase cleavage site. The beta-secretase enzyme has been disclosed using varied nomenclature, including BACE, Asp, am Mamepsin. See, for example, Sindla et.al., 1999, Nature 402:537-554 (p501) and published PCT application WO00/17369. Several lines of evidence indicate that progressive cerebral deposition of beta-amyloid peptide (A beta) plays a seminal role in the pathogenesis of AD and can precede cognitive symptoms by years or decades. See, for example, Selkoe, 1991, Neuron 6:487. Release of A beta from neuronal cells grown in culture and the presence of A beta in cerebrospinal fluid (CSF) of both normal individuals and AD patients has been demonstrated. See, for example, Seubert et al., 1992, Nature 359:325-327. It has been proposed that A beta peptide accumulates as a result of APP processing by beta-secretase, thus inhibition of this enzyme's activity is desirable for the treatement of AD. In vivo processing of APP at the beta-secretase cleavage site is thought to be a rate-limiting step in A beta production, and is thus a therapeutic target for the treatment of AD. See for example, Sabbagh, M., et al., 1997, Alz. Dis. Rev. 3, 1-19. BACE1 knockout mice fail to produce A beta, and present a normal phenotype. When crossed with transgenic mice that overexpress APP, the progeny show reduced amounts of A beta in brain extracts as compared with control animals (Luo et.al., 2001 Nature Neuroscience 4:231-232). This evidence further supports the proposal that inhibition of beta-secretase activity and reduction of A beta in the brain provides a therapeutic method for the treatment of AD and other beta amyloid disorders. Published PCT application WO00/47618 entitled “Beta-Secretase Enzyme Compositions and Methods” identifies the beta-secretase enzyme and methods of its use. This publication also discloses oligopeptide inhibitors that bind the enzyme's active site and are useful in affinity column purification of the enzyme. In addition, WO00/77030 discloses tetrapeptide inhibitors of beta-secretase activity that are based on a statine molecule Various pharmaceutical agents have been proposed for the treatment of Alzheimer's disease but without any real success. U.S. Pat. No. 5,175,281 discloses 21-aminosteroids as being useful for treating Alzheimer's disease. U.S. Pat. No. 5,502,187 discloses bicyclic heterocyclic amines as being useful for treating Alzheimer's disease. The hydroxyethylamine “nucleus” or isostere, of which the compounds of the invention is a truncated analog, has been used with success in the area of HIV protease inhibition. Many of these hydroxyethylamine compounds are known as well as how to make them. See for example, J. Am. Chem. Soc., 93,288-291 (1993), Tetrahedron Letters, 28(45) 5569-5572 (1987), J. Med. Chem., 38(4), 581-584 (1994), Tetrahedron Letters, 38(4), 619-620 (1997). European Patents, numbers 702 004, 678 503, 678 514, 678 503 and 716077 by Maibaum, et al. are directed to similar isosteric strategies directed at renin inhibition. See also, U.S. Pat. Nos. 5,606,078 and 5,559,111, both to Goschke, et. al.; U.S. Pat. No. 5,719,141, to Rasetti, et. al.; and U.S. Pat. No. 5,641,778, to Maibaum, et. al. At present there are no effective treatments for halting, preventing, or reversing the progression of Alzheimer's disease. Therefore, there is an urgent need for pharmaceutical agents capable of slowing the progression of Alzheimer's disease and/or preventing it in the first place. Compounds that are effective inhibitors of beta-secretase, that inhibit beta-secretase-mediated cleavage of APP, that are effective inhibitors of A beta production, and/or are effective to reduce amyloid beta deposits or plaques, are needed for the treatment and prevention of disease characterized by amyloid beta deposits or plaques, such as AD. |
<SOH> SUMMARY OF THE INVENTION <EOH>In a broad aspect, the invention provides substituted aminoalcohols of formula (I): or pharmaceutically acceptable salts or esters thereof, wherein B is H, C 1 -C 10 straight or branched chain alkyl; wherein R 20 is H or C 1-6 alkyl or alkenyl wherein n is 0 or 1; wherein R 1 is: (I) C 1 -C 6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C 1 -C 3 alkyl, C 1 -C 7 alkyl (optionally substituted with C 1 -C 3 alkyl and C 1 -C 3 alkoxy), —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, —OC═O NR 1-a R 1-b where R 1-a and R 1-b are as defined above, (II) —CH 2 —S(O) 0-2 —(C 1 -C 6 alkyl), (III) —CH 2 —CH 2 —S(O) 0-2 —(C 1 -C 6 alkyl), (IV) C 2 -C 6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (V) C 2 -C 6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (VI) —(CH 2 ) n1 —(R 1-aryl ) where n 1 is zero or one and where R 1-aryl is phenyl, 1-naphthyl, 2-naphthyl and indanyl, indenyl, dihydronaphthalyl, tetralinyl optionally substituted with one, two, three or four of the following substituents on the aryl ring: (A) C 1 -C 6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C 1 -C 3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR 1-a R 1-b where R 1-a and R 1-b are as defined above, —C≡N, —CF 3 , C 1 -C 3 alkoxy, (B) C 2 -C 6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (C) C 2 -C 6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (D) —F, Cl, —Br and —I, (F) —C 1 -C 6 alkoxy optionally substituted with one, two or three —F, (G) —NR N-2 R N-3 where R N-2 and R N-3 are as defined below, (H) —OH, (I) —C≡N, (J) C 3 -C 7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (K) —CO—(C 1 -C 4 alkyl), (L) —SO 2 —NR 1-a R 1-b where R 1-a and R 1-b are as defined above, (M) —CO—NR 1-a R 1-b where R 1-a and R 1-b are as defined above, or (N) —SO 2 —(C 1 -C 4 alkyl), (VII) —(CH 2 ) n1 —(R 1-heteroaryl ) where n 1 is as defined above and where R 1-heteroaryl is selected from the group consisting of: (A) pyridinyl, (B) pyrimidinyl, (C) quinolinyl, (F) benzothienyl, (G) indolyl, (H) indolinyl, (I) pryidazinyl, (J) pyrazinyl, (K) isoindolyl, (L) isoquinolyl, (M) quinazolinyl, (N) quinoxalinyl, (O) phthalazinyl, (P) imidazolyl, (Q) isoxazolyl, (R) pyrazolyl, (S) oxazolyl, (T) thiazolyl, (U) indolizinyl, (V) indazolyl, (W) benzothiazolyl, (X) benzimidazolyl, (Y) benzofuranyl, (Z) furanyl, (AA) thienyl, (BB) pyrrolyl, (CC) oxadiazolyl, (DD) thiadiazolyl, (EE) triazolyl, (FF) tetrazolyl, (II) oxazolopyridinyl, (JJ) imidazopyridinyl, (KK) isothiazolyl, (LL) naphthyridinyl, (MM) cinnolinyl, (NN) carbazolyl, (OO) beta-carbolinyl, (PP) isochromanyl, (QQ) chromanyl, (SS) tetrahydroisoquinolinyl, (TT) isoindolinyl, (UU) isobenzotetrahydrofuranyl, (VV) isobenzotetrahydrothienyl, (WW) isobenzothienyl, (XX) benzoxazolyl, (YY) pyridopyridinyl, (ZZ) benzotetrahydrofuranyl, (AAA) benzotetrahydrothienyl, (BBB) purinyl, (CCC) benzodioxolyl, (DDD) triazinyl, (EEE) phenoxazinyl, (FFF) phenothiazinyl, (GGG) pteridinyl, (HHH) benzothiazolyl, (III) imidazopyridinyl, (JJJ) imidazothiazolyl, (KKK) dihydrobenzisoxazinyl, (LLL) benzisoxazinyl, (MMM) benzoxazinyl, (NNN) dihydrobenzisothiazinyl, (OOO)benzopyranyl, (PPP) benzothiopyranyl, (QQQ) coumarinyl, (RRR) isocoumarinyl, (SSS) chromonyl, (TTT) chromanonyl, and (UUU) pyridinyl-N-oxide, where the R 1-heteroaryl group is bonded to —CH 2 ) n1 — by any ring atom of the parent R N-heteroaryl group substituted by hydrogen such that the new bond to the R 1-heteroaryl group replaces the hydrogen atom and its bond, where heteroaryl is optionally substituted with one, two, three or four of: (1) C 1 -C 6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C 1 -C 3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR 1-a R 1-b where R 1-a and R 1-b are as defined above, —C≡N, —CF 3 , C 1 -C 3 alkoxy, (2) C 2 -C 6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (3) C 2 -C 6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (4) —F, Cl, —Br and —I, (6) —C 1 -C 6 alkoxy optionally substituted with one, two, or three —F, (7) —NR N-2 R N-3 where R N-2 and R N-3 are as defined below, (8) —OH, (9) —C≡N, (10) C 3 -C 7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (11) —CO—(C 1 -C 4 alkyl), (12) —SO 2 —NR 1-a R 1-b where R 1-a and R 1-b are as defined above, (13) —CO—NR 1-a R 1-b where R 1-a and R 1-b are as defined above, or (14) —SO 2 —(C 1 -C 4 alkyl), with the proviso that when n, is zero R 1-heteroaryl is not bonded to the carbon chain by nitrogen, (VIII) —(CH 2 ) n1 —(R 1-heterocycle ) where n 1 is as defined above and R 1-heterocycle is selected from the group consisting of: (A) morpholinyl, (B) thiomorpholinyl, (C) thiomorpholinyl S-oxide, (D) thiomorpholinyl S,S-dioxide, (E) piperazinyl, (F) homopiperazinyl, (G) pyrrolidinyl, (H) pyrrolinyl, (I) tetrahydropyranyl, (J) piperidinyl, (K) tetrahydrofuranyl, (L) tetrahydrothienyl, (M) homopiperidinyl, (N) homomorpholinyl, (O) homothiomorpholinyl, (P) homomorpholinyl S-oxide, (Q) homothiomorpholinyl S,S-dioxide, and (R) oxazolidinonyl, where the R 1-heterocycle group is bonded by any atom of the parent R 1-heterocycle group substituted by hydrogen such that the new bond to the R 1-heterocycle group replaces the hydrogen atom and its bond, where heterocycle is optionally substituted with one, two, three or four of: (1) C 1 -C 6 alkyl optionally substituted with one, two or three substituents selected from the group consisting of C 1 -C 3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —NR 1-a R 1-b where R 1-a and R 1-b are as defined above, —C≡N, —CF 3 , C 1 -C 3 alkoxy, (2) C 2 -C 6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (3) C 2 -C 6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (4) —F, Cl, —Br and —I, (5) C 1 -C 6 alkoxy, (6) —C 1 -C 6 alkoxy optionally substituted with one, two, or three —F, (7) —NR N-2 R N-3 where R N-2 and R N-3 are as defined below, (8) —OH, (9) —C≡N, (10) C 3 -C 7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (11) —CO—(C 1 -C 4 alkyl), (12) —SO 2 —NR 1-a R 1-b where R 1-a and R 1-b are as defined above, (13) —CO—NR 1-a R 1-b where R 1-a and R 1-b are as defined above, (14) —SO 2 —(C 1 -C 4 alkyl), or (15) ═O, with the proviso that when n 1 is zero R 1-heterocycle is not bonded to the carbon chain by nitrogen; or (IX) G-L-A-W- where A is: (I) phenyl, 1-naphthyl, 2-naphthyl, indanyl, indenyl, dihydronaphthalyl, tetralinyl, cyclopentyl, cyclohexyl, and cycloheptyl optionally substituted with one or two of the following substituents on the ring: (A) —NO 2 , (B) —C≡N, (C) —N(R)CO(R′) R, R′defined below (D) —CO—O—R N-5 where R N-5 is selected from the group consisting of: (a) C 1 -C 6 alkyl, and (b) —(CH 2 ) 0-2 —(R 1-aryl ) where R 1-aryl is as defined above, (E) —NH—CO—O—R N-5 where R N-5 is as defined above, (F) —O—(C 2 -C 6 alkyl)-COOH, (G) —NRR′ where R, R′ are H, C 1 -C 6 alkyl, —(CH 2 ) 0-2 —(R 1-aryl ) where R 1-aryl is as defined above, (H) —SR where R is H, C 1 -C 6 alkyl, —(CH 2 ) 0-2 —(R 1-aryl ) where R 1-aryl is as defined above, (I) —CH 2 OH, (J) —CO—(C 1 -C 6 ) alkyl, (K) —CONRR′ where R, R′ are H, C 1 -C 6 alkl, —(CH 2 ) 0-2 —(R 1-aryl ) where R 1-aryl is as defined above, (L) —SO 2 NRR′ where R, R′ are H, C 1 -C 6 alkyl, (M) —COOH, (N) —C 1 -C 6 alkyl, (O) —C 2 -C 6 alkenyl with one or two double bonds, or (P) —C 2 -C 6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three of —CF 3 , —F, —Cl, —Br, —I, C 1 -C 3 alkyoxy, —OCF 3 , —NH 2 , —OH, and —CN, and provided that G, L and W may not all be absent; (II) R 1-heteroaryl as defined above, where the R 1-heteroaryl group bonds to the subsistent W by a ring carbon atom, and where R 1-heteroaryl is optionally substituted with one, two, three, or four substituents independently chosen from the group consisting of: (A) —NO 2 , (B) —C≡N, (C) —N(R)CO(R′) where R, R′ are defined below, (D) —CO—O—R N-5 where R N-5 is selected from the group consisting of: (a) C 1 -C 6 alkyl, and (b) —(CH 2 ) 0-2 —(R 1-aryl ) where R 1-aryl is as defined above, (E) —NH—CO—O—R N-5 where R N-5 is as defined above, (F) —O—(C 2 -C 6 alkyl)-COOH, (G) —NRR′ where R, R′ are independently H, C 1 -C 6 alkyl, and —(CH 2 ) 0-2 —(R 1-aryl ) where R 1-aryl is as defined above, (H) —SR where R and R 1-aryl are as defined above, (I) —CH 2 OH, (J) —CO—(C 1 -C 6 ) alkyl, (K) —CONRR′ where R, R′ and R 1-aryl are as defined above, (L) —SO 2 NRR′ where R, R′ are H, C 1 -C 6 alkyl, (M) —COOH, (N) —C 1 -C 6 alkyl, (O) —C 2 -C 6 alkenyl with one or two double bonds, and (P) —C 2 -C 6 alkynyl with one or two triple bonds, wherein each of (N), (O) and (P) may be optionally substituted by one to three substituent indepedendly chosen from the group consisting of —CF 3 , —F, —Cl, —Br, —I, C 1 -C 3 alkyoxy, —OCF 3 , —NH 2 , —OH, and —CN, and provided that G, L and W may not all be absent, or (III) R 1-heterocycle as defined above: where the R 1-heterocycle group bonds to the subsistent W by a ring carbon atom, and where R 1-heteroaryl is optionally substituted with one to two substituents independently chosen from the group consisting of (1) ═O, (2) C 1 -C 3 alkyl, (3) —CF 3 , (4) —F, Cl, —Br or —I, (5) C 1 -C 3 alkoxy, (6) —O—CF 3 , (7) —NH 2 , (8) —OH, and (9) —C≡N, and provided that G, L and W may not all be absent, where W is —S(O) 0-2 —, —O—, —N—, or absent, and N is optionally substituted with C 1 -C 4 alkyl; where L is —CO—, —S(O) 1-2 —, —O—, —C(Ra)(Rb)O—, —OC(Ra)(Rb)—, —N(Ra)—, —CON(Ra)—, —N(Ra)CO—, —C(Ra)(Rb)—, —C(OH)Ra—, —SO 2 NRa—, —N(Ra)SO 2 —, —N(Ra)CON(Rb)—, N(Ra)CSN(Rb)—, —OCOO—, —NCOO—, OCON(Ra)—, a bond, or L is absent when G is absent, and where Ra and Rb are independently H, C 1 -C 4 alkyl which are optionally substituted. with OH, C 1 -C 4 alkoxy, and up to five —F; where G is: (I) —C 1 -C 10 alkyl optionally substituted with one substituent selected from the group consisting of: (A) —COOH, (B) —CO—O—(C 1 -C 4 alkyl), (C) C 1 -C 6 alkoxy, (D) —OH, (E) —NH 2 , (L) —C 1 -C 6 alkyl optionally substituted with one to five —F (G) —(C 1 -C 10 alkyl)-O—(C 1 -C 3 alkyl), (H) —C 2 -C 10 alkenyl with one or two double bonds, (I) —C 2 -C 10 alkynyl with one or two triple bonds, (J) —C 4 -C 10 hydrocarbyl chain with one double bond and one triple bond, (K) —R 1-aryl where R 1-aryl is as defined above, (L) —R 1-heteroaryl where R 1-heteroaryl is as defined above, (II) —(CH 2 ) 0-3 —(C 3 -C 7 ) cycloalkyl where cycloalkyl can be optionally substituted with one, two or three substituents selected from the group consisting of: (A) —COOH, (B) —CO—O—(C 1 -C 4 alkyl), (C) C 1 -C 6 alkoxy, (D) —OH, (E) —NH 2 , (F) —C 1 -C 6 alkyl optionally substituted with one to five —F (G) —(C 1 -C 10 alkyl)-O—(C 1 -C 3 alkyl), (H) —C 2 -C 10 alkenyl with one or two double bonds, (I) —C 2 -C 10 alkynyl with one or two triple bonds, (J) —C 4 -C 10 hydrocarbyl chain with one double bond and one triple bond, (K) —R 1-aryl where R 1-aryl is as defined above, (L) —R 1-heteroaryl where R 1-heteroaryl is as defined above, (III) —(CR′R″) 0-4 —R 1-aryl where R′, R″ and R 1-aryl are as defined above, (IV) —(CH 2 ) 0-4 —R 1-heteroaryl where R 1-heteroaryl is as defined above, (V) —(CH 2 ) 0-4 —R 1-heterocycle where R 1-heterocycle is as defined above, (VI) —C(R C-1 )(R C-2 )—CO—NH—R C-3 where R C-1 and R C-2 are independently selected from the group consisting of: (A) —H, (B) —C 1 -C 6 alkyl, (C) —(C 0 -C 4 alkyl)-R 1-aryl , wherein R 1-aryl is as defined above, (D) —(C 0 -C 4 alkyl)-R 1-heteroaryl , wherein R 1-heteroaryl is as defined above, (E) —(C 0 -C 4 alkyl)-R 1-heterocycle , wherein R 1-heterocycle is as defined above, (F) —(CH 2 ) 1-4 —OH, (G) —(CH 2 ) 1-4 —R C-4 —(CH 2 ) 1-4 —R C′-aryl where R C-4 is —O—, —S— or (H) —NR C-5 — where R C-5 is — or C 1 -C 6 alkyl, and where R C′-aryl is defined above, and (I) —(CH 2 ) 1-4 —R C-4 —(CH 2 ) 1-4 —R C-heteroaryl where R C-4 and R C-heteroaryl are as defined above, wherein in (C), (D) and (E) C 0 is merely a bond,and where R C-3 is: (a) —H, (b) —C 1 -C 6 alkyl, (c) —(C 0 -C 4 alkyl)-R 1-aryl where R 1-aryl is as defined above, (d) —(C 0 -C 4 alkyl)-R 1-heteroaryl where R 1-heteroaryl is as defined above, (e) —(C 0 -C 4 allyl)-R 1-heterocycle where R 1-heterocycle is as defined above, (VII) -cyclopentyl or -cyclohexyl ring fused to a phenyl or heteroaryl ring where heteroaryl is as defined above and phenyl and heteroaryl are optionally substituted with one, two or three of: (A) C 1 -C 6 alkyl, (B) —CF 3 , (C) —F, Cl, —Br and —I, (D) C 1 -C 3 alkoxy, (E) —OCF 3 , (F) —NH 2 , (G) —OH, (H) —C≡N, (I) —NO 2 (J) —CO—OH, (K) —CO—O—R N-5 where R N-5 is selected from the group consisting of: (a) C 1 -C 6 alkyl, and (b) —(C 0 -C 2 aryl)-(R 1-aryl ) where R 1-aryl is as defined above, (L) —NH—CO—O—R N-5 where R N-5 is as defined above, (M) —O—(C 2 -C 5 alkyl)-COOH, or (N) —OR where R is as defined above, (O) —NR—R′ where R and R′ are as defined above, (P) —SR where R is as defined above, (Q) —CF 3 , (R) —OCF 3 , (S) —N(R)COR′ where R, R′ are as defined above, (T) —NRR′ where R, R′ are as defined above, (U) —SR where R is as defined above, (V) —CH 2 OH, (W) —CO—(C 1 -C 6 ) alkyl, (X) —CONRR′ where R, R′ are as defined above, or (Y) —SO 2 NRR′ where R is as defined above, or (VIII) —(CH 2 ) 2 —O—(CH 2 ) 2 —OH; wherein R 2 is selected from the group consisting of: (I) —H, (II) C 1 -C 6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C 1 -C 3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are as defined above, (III) —(CH 2 ) 0-4 —R 2-1 where R 2-1 is R 1-aryl or R 1-heteroaryl where R 1-aryl and R 1-heteroaryl are as defined above; (IV) C 2 -C 6 alkenyl with one or two double bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, (V) C 2 -C 6 alkynyl with one or two triple bonds, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, and (VI) —(CH 2 ) 0-4 —C 3 -C 7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl; wherein R 3 is selected from the group consisting of: (I) —H, (II) C 1 -C 6 alkyl, optionally substituted with one, two or three substituents selected from the group consisting of C 1 -C 3 alkyl, —F, —Cl, —Br, —I, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are as defined above, (III) —(CH 2 ) 0-4 —R 2-1 where R 2-1 is R 1-aryl or R 1-heteroaryl where R 1-aryl and R 1-heteroaryl are as defined above; (IV) C 2 -C 6 alkenyl with one or two double bonds, (V) C 2 -C 6 alkynyl with one or two triple bonds, and (VI) —(CH 2 ) 0-4 —C 3 -C 7 cycloalkyl, optionally substituted with one, two or three substituents selected from the group consisting of —F, —Cl, —OH, —SH, —C≡N, —CF 3 , C 1 -C 3 alkoxy, —NR 1-a R 1-b where R 1-a and R 1-b are —H or C 1 -C 6 alkyl, and where R 2 and R 3 are taken together with the carbon to which they are attached to form a carbocycle of three, four, five, six and seven carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO 2 —, —NR N-2 —, where R N-2 is as defined below; and wherein R C is selected from the group consisting of C 1 -C 10 alkyl optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R 205 , —OC═O NR 235 R 240 , —S(═O) 0-2 R 235 , —NR 235 C═O NR 235 R 240 , —C═O NR 235 R 240 , and —S(═O) 2 NR 235 R 240 ; —(CH 2 ) 0-3 —(C 3 -C 8 ) cycloalkyl wherein the cycloalkyl is optionally substituted with 1, 2, or 3 groups independently selected from the group consisting of R 205 , —CO 2 H, and —CO 2 —(C 1 -C 4 alkyl); —(CR 245 R 250 ) 0-4 -aryl; —(CR 245 R 250 ) 0-4 -heteroaryl, —(CR 245 R 250 ) 0-4 -heterocycloalkyl; —(CR 245 R 250 ) 0-4 -aryl-heteroaryl; —(CR 245 R 250 ) 0-4 -aryl-heterocycloalkyl; —(CR 245 R 250 ) 0-4 -aryl-aryl; —(CR 245 R 250 ) 0-4 -heteroaryl-aryl; —(CR 245 R 250 ) 0-4 -heteroaryl-heterocycloalkyl; —(CR 245 R 250 ) 0-4 -heteroaryl-heteroaryl; —(CR 245 R 250 ) 0-4 -heterocycloalkyl-heteroaryl; —(CR 245 R 250 ) 0-4 -heterocycloalkyl-heterocycloalkyl; —(CR 245 R 250 ) 0-4 -heterocycloalkyl-aryl; —[C(R 255 )(R 260 )] 1-3 —CO—N—(R 255 ) 2 ; —CH(aryl) 2 ; —CH(heteroaryl) 2 ; —CH(heterocycloalkyl) 2 ; —CH(aryl)(heteroaryl); cyclopentyl, cyclohexyl, or cycloheptyl ring fused to aryl, heteroaryl, or heterocycloalkyl wherein one carbon of the cyclopentyl, cyclohexyl, or cycloheptyl is optionally replaced with one or two NH, NR 215 , O, or S(═O) 0-2 , and wherein the cyclopentyl, cyclohexyl, or cycloheptyl group can be optionally substituted with 1 or 2 groups that are independently R 205 , ═O, —CO—NR 235 R 240 , or —SO 2 —(C 1 -C 4 alkyl); C 2 -C 10 alkenyl optionally substituted with 1, 2, or 3 R 205 groups; C 2 -C 10 alkynyl optionally substituted with 1, 2, or 3 R 205 groups; —(CH 2 ) 0-1 —CH((CH 2 ) 0-6 —OH)—(CH 2 ) 0-1 -heteroaryl; —(CH 2 ) 0-1 —CH((CH 2 ) 0-6 —OH—(CH 2 ) 0-1 -heteroaryl; —CH(-aryl or -heteroaryl)-CO—O(C 1 -C 4 alkyl); —CH(—CH 2 —OH)—CH(OH)-phenyl-NO 2 ; (C 1 -C 6 alkyl)-O—(C 1 -C 6 alkyl)-OH; —CH 2 —NH—CH 2 —CH(—O—CH 2 —CH 3 ) 2 ; —H; and —(CH 2 ) 0-6 —C(═NR 235 )(NR 235 R 240 ); wherein each aryl is optionally substituted with 1, 2, or 3 R 200 ; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R 200 ; each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R 210 ; R 200 at each occurrence is independently selected from the group consisting of C 1 -C 6 alkyl optionally substituted with 1, 2, or 3 R 205 groups; OH; —NO 2 ; halogen; —CO 2 H; C≡N; —(CH 2 ) 0-4 —CO—NR 220 R 225 ; —(CH 2 ) 0-4 —CO—(C 1 -C 12 alkyl); —(CH 2 ) 0-4 —CO—(C 2 -C 12 alkenyl); —(CH 2 ) 0-4 —CO—(C 2 -C 12 alkynyl); —(CH 2 ) 0-4 —CO—(C 3 -C 7 cycloalkyl); —(CH 2 ) 0-4 —CO-aryl; —(CH 2 ) 0-4 —CO-heteroaryl; —(CH 2 ) 0-4 —CO-heterocycloalkyl; —(CH 2 ) 0-4 —CO—O—R 215 ; —(CH 2 ) 0-4 —SO 2 —NR 220 R 225 ; —(CH 2 ) 0-4 —SO—(C 1 -C 8 alkyl); —(CH 2 ) 0-4 —SO 2 —(C 1 -C 12 alkyl); —(CH 2 ) 0-4 —SO 2 —(C 3 -C 7 cycloalkyl); —(CH 2 ) 0-4 —N(H or R 215 )—CO—O—R 215 ; —(CH 2 ) 0-4 —N(H or R 215 )—CO—N(R 215 ) 2 ; —(CH 2 ) 0-4 —N—CS—N(R 215 ) 2 ; —(CH 2 ) 0-4 —N(—H or R 215 )—CO—R 220 ; —(CH 2 ) 0-4 —NR 220 R 225 ; —(CH 2 ) 0-4 —O—CO—(C 1 -C 6 alkyl); —(CH 2 ) 0-4 —O—P(O)—(OR 240 ) 2 ; —(CH 2 ) 0-4 —O—CO—N(R 215 ) 2 ; —(CH 2 ) 0-4 —O—CS—N(R 215 ) 2 ; —(CH 2 ) 0-4 —O—(R 215 ); —(CH 2 ) 0-4 —O—(R 215 )—COOH; —(CH 2 ) 0-4 —S—(R 215 ); —(CH 2 ) 0-4 —O—(C 1 -C 6 alkyl optionally substituted with 1, 2, 3, or 5-F); C 3 -C 7 cycloalkyl; C 2 -C 6 alkenyl optionally substituted with 1 or 2 R 205 groups; C 2 -C 6 alkynyl optionally substituted with 1 or 2 R 205 groups; —(CH 2 ) 0-4 —N(H or R 215 )—SO 2 —R 220 ; and —(CH 2 ) 0-4 —C 3 -C 7 cycloalkyl; wherein each aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R 205 , R 210 or C 1 -C 6 alkyl substituted with 1, 2, or 3 groups that are independently R 205 or R 210 ; wherein each heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R 210 ; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R 205 , R 210 , or C 1 -C 6 alkyl substituted with 1, 2, or 3 groups that are independently R 205 or R 210 ; R 205 at each occurrence is independently selected from the group consisting of C 1 -C 6 alkyl, halogen, —OH, —O-phenyl, —SH, —C≡N, —CF 3 , C 1 -C 6 alkoxy, NH 2 , NH(C 1 -C 6 alkyl), and N—(C 1 -C 6 alkyl)(C 1 -C 6 alkyl); R 210 at each occurrence is independently selected from the group consisting of C 1 -C 6 alkyl optionally substituted with 1, 2, or 3 R 205 groups; C 2 -C 6 alkenyl optionally substituted with 1, 2, or 3 R 205 groups; C 2 -C 6 alkynyl optionally substituted with 1, 2, or 3 R 205 groups; halogen; C 1 -C 6 alkoxy, C 1 -C 6 haloalkoxy; —NR 220 R 225 ; OH; C≡N; C 3 -C 7 cycloalkyl optionally substituted with 1, 2, or 3 R 205 groups; —CO—(C 1 -C 4 alkyl); —SO 2 NR 235 R 240 ; —CO—NR 235 R 240 ; —SO 2 —(C 1 -C 4 alkyl); and ═O; R 215 at each occurrence is independently selected from the group consisting of C 1 -C 6 alkyl, —(CH 2 ) 0-2 -(aryl), C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C 3 -C 7 cycloalkyl, and —(CH 2 ) 0-2 -(heteroaryl), —(CH 2 ) 0-2 -(heterocycloalkyl); wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R 205 or R 210 ; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R 210 ; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R 210 ; R 220 and R 225 at each occurrence are independently selected from the group consisting of —H, —C 1 -C 6 alkyl, hydroxy C 1 -C 6 alkyl, amino C 1 -C 6 alkyl; halo C 1 -C 6 alkyl; —C 3 -C 7 cycloalkyl, —(C 1 -C 2 alkyl)-(C 3 -C 7 cycloalkyl), —(C 1 -C 6 alkyl)-O—(C 1 -C 3 alkyl), —C 2 -C 6 alkenyl, —C 2 -C 6 alkynyl, —C 1 -C 6 alkyl chain with one double bond and one triple bond, -aryl, -heteroaryl, and -heterocycloalkyl; wherein the aryl group at each occurrence is optionally substituted with 1, 2, or 3 groups that are independently R 205 or R 210 ; wherein the heterocycloalkyl group at each occurrence is optionally substituted with 1, 2, or 3 R 210 ; wherein each heteroaryl group at each occurrence is optionally substituted with 1, 2, or 3 R 210 ; R 235 and R 240 at each occurrence are independently H, or C 1 -C 6 alkyl; R 245 and R 250 at each occurrence are independently selected from the group consisting of H, C 1 -C 4 alkyl, C 1 -C 4 alkylaryl, C 1 -C 4 alkylheteroaryl, C 1 -C 4 hydroxyalkyl, C 1 -C 4 alkoxy, C 1 -C 4 haloalkoxy, —(CH 2 ) 0-4 —C 3 -C 7 cycloalkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, and phenyl; or R 245 and R 250 are taken together with the carbon to which they are attached to form a carbocycle of 3, 4, 5, 6, or 7 carbon atoms, optionally where one carbon atom is replaced by a heteroatom selected from the group consisting of —O—, —S—, —SO 2 —, and —NR 220 —; R 255 and R 260 at each occurrence are independently selected from the group consisting of H; C 1 -C 6 alkyl optionally substituted with 1, 2, or 3 R 205 groups; C 2 -C 6 alkenyl optionally substituted with 1, 2, or 3 R 205 groups; C 2 -C 6 alkynyl optionally substituted with 1, 2, or 3 R 205 groups; —(CH 2 ) 1-2 —S(O) 0-2 —(C 1 -C 6 alkyl); —(CH 2 ) 0-4 —C 3 -C 7 cycloalkyl optionally substituted with 1, 2, or 3 R 205 groups; —(C 1 -C 4 alkyl)-aryl; —(C 1 -C 4 alkyl)-heteroaryl; —(C 1 -C 4 alkyl)-heterocycloalkyl; -aryl; -heteroaryl; -heterocycloalkyl; —(CH 2 ) 1-4 —R 265 —(CH 2 ) 0-4 -aryl; —(CH 2 ) 1-4 —R 265 —(CH 2 ) 0-4 -heteroaryl; and; —(CH 2 ) 1-4 —R 265 —(CH 2 ) 0-4 -heterocycloalkyl; wherein R 265 at each occurrence is independently —O—, —S— or —N(C 1 -C 6 alkyl)-; each aryl or phenyl is optionally substituted with 1, 2, or 3 groups that are independently R 205 , R 210 , or C 1 -C 6 alkyl substituted with 1, 2, or 3 groups that are independently R 205 or R 210 ; each heteroaryl is optionally substituted with 1, 2, 3, or 4 R 200 , each heterocycloalkyl is optionally substituted with 1, 2, 3, or 4 R 210 . The invention also provides a method for making a compound of formula (I) or a pharmaceutically acceptable salt or ester thereof, wherein B, R 20 , R 2 , R 3 , n and R c are as defined above or below. The invention also includes a method of treating a patient who has, or in preventing a patient from getting, a disease or condition selected from the group consisting of Alzheimer's disease, for helping prevent or delay the onset of Alzheimer's disease, for treating patients with mild cognitive impairment (MCI) and preventing or delaying the onset of Alzheimer's disease in those who would progress from MCI to AD, for treating Down's syndrome, for treating humans who have Hereditary Cerebral Hemorrhage with Amyloidosis of the Dutch-Type, for treating cerebral amyloid angiopathy and preventing its potential consequences, i.e. single and recurrent lobar hemorrhages, for treating other degenerative dementias, including dementias of mixed vascular and degenerative origin, dementia associated with Parkinson's disease, dementia associated with progressive supranuclear palsy, dementia associated with cortical basal degeneration, or diffuse Lewy body type of Alzheimer's disease and who is in need of such treatment which comprises administration of a therapeutically effective amount of a compound of formula (I), where B, R 20 , n, R 1 , R 2 , R 3 , and R c are as defined herein, or pharmaceutically acceptable salts and esters thereof The invention also includes methods for inhibiting beta-secretase activity, for inhibiting cleavage of amyloid precursor protein (APP), in a reaction mixture, at a site between Met596 and Asp597, numbered for the APP-695 amino acid isotype; or at a corresponding site of an isotype or mutant thereof, for inhibiting production of amyloid beta peptide (A beta) in a cell, for inhibiting the production of beta-amyloid plaque in an animal, and for treating or preventing a disease characterized by beta-amyloid deposits in the brain which comprise administration of a therapeutically effective amount of a compound of formula (I), where B, R 20 , n, R 1 , R 2 , R 3 , and R C are as defined herein, or pharmaceutically acceptable salts and esters thereof The invention also includes a pharmaceutical composition that comprises a compound of formula (I), where B, R 20 , n, R 1 , R 2 , R 3 , and R C are as defined herein, or pharmaceutically acceptable salts and esters thereof, and one or more pharmaceutically acceptable inert carriers. The invention also includes the use of a substituted aminoalcohol of formula (I), where B, R 20 , n, R 1 , R 2 , R 3 , and R C are as defined herein, or pharmaceutically acceptable salts and esters thereof, for the manufacture of a medicament for use in treating a patient who has, or in preventing a patient from getting, a disease or condition selected from the group consisting of Alzheimer's disease, for helping prevent or delay the onset of Alzheimer's disease, for treating patients with mild cognitive impairment (MCI) and preventing or delaying the onset of Alzheimer's disease in those who would progress from MCI to AD, for treating Down's syndrome, for treating humans who have Hereditary Cerebral Hemorrhage with Amyloidosis of the Dutch-Type, for treating cerebral amyloid angiopathy and preventing its potential consequences, i.e. single and recurrent lobar hemorrhages, for treating other degenerative dementias, including dementias of mixed vascular and degenerative origin, dementia associated with Parkinson's disease, dementia associated with progressive supranuclear palsy, dementia associated with cortical basal degeneration, diffuse Lewy body type of Alzheimer's disease and who is in need of such treatment. The invention provides compounds, compositions, kits, and methods for inhibiting beta-secretase-mediated cleavage of amyloid precursor protein (APP). More particularly, the compounds, compositions, and methods of the invention are effective to inhibit the production of A beta peptide and to treat or prevent any human or veterinary disease or condition associated with a pathological form of A beta peptide. The compounds, compositions, and methods of the invention are useful for treating humans who have Alzheimer's Disease (AD), for helping prevent or delay the onset of AD, for treating patients with mild cognitive impairment (MCI), and preventing or delaying the onset of AD in those patients who would otherwise be expected to progress from MCI to AD, for treating Down's syndrome, for treating Hereditary Cerebral Hemorrhage with Amyloidosis of the Dutch Type, for treating cerebral beta-amyloid angiopathy and preventing its potential consequences such as single and recurrent lobar hemorrhages, for treating other degenerative dementias, including dementias of mixed vascular and degenerative origin, for treating dementia associated with Parkinson's disease, dementia associated with progressive supranuclear palsy, dementia associated with cortical basal degeneration, and diffuse Lewy body type AD. The invention also provides intermediates and methods useful for preparing the compounds of Formula I. The compounds of the invention possess beta-secretase inhibitory activity. The inhibitory activities of the compounds of the invention are readily demonstrated, for example, using one or more of the assays described herein or known in the art. detailed-description description="Detailed Description" end="lead"? |
Method and system for handling multiple registration |
Method for supporting multiple registration from the same user requested from different terminals in a telecommunications system requiring to manage information related to the location of said user and related to the plurality of identifiers that identify said user in said system. The method allowing further multiple session establishment to any of those terminals. In the home server of said user it is stored a plurality of private identities related to the subscriber data of said user together with, at least, a public identity. Each registration of said user contains a public identity assiged to said user and a private identity among the plurality of said private identities assigned to said user. |
1. A method for handling multiple registrations of a user in a telecommunications system which manages location information and identification information related to its users, each of said registrations being related to a subscription of said user in said system, the method comprising the steps of: (a) storing, related to said subscription, a plurality of private identities; (b) receiving registration requests, each registration request requesting to attach a terminal to said system for said subscription, and (c) processing each received registration request according to the private identity, among said plurality of private identities, received in said request wherein said registration request further includes a public identity associated with said subscription. 2. The method of claim 1, wherein the step of processing a received registration request according to said received private and public identities comprises the steps of: receiving a registration query in a home server entity (HSS) which stores data of said subscription, said registration query containing, at least, said received said received private and public identities, verifying in said home server (HSS) if said user is already registered with said private identity, answering said registration query with information for further handling said registration request; said information further comprises: a registration status indication stating if said user is not registered with said received private identity, the capabilities required for a session-control server entity in order to support session control for further sessions involving said user for said public identity and said private identity, information related to a session-control server that is already assigned to serve session control to said user for said received public identity and any of the private identities associated to the subscription of said user, a list containing information related to one or more of the plurality of session-control servers that are already assigned to serve session control to said user for any of the public and private identities associated to the subscription of said user. 3. The method of claim 2, further comprising the steps of: selecting, according to said information for handling said registration request, a session-control server entity for serving session control for further sessions involving said user for said public identity and said private identity, and granting the registration of said user from said terminal in said system. 4. The method of claim 3, wherein the step of granting comprises the step of granting said registration to said terminal from said selected session-control server through the first-contact-point server entity serving the access of said terminal to said system. 5. The method of claim 4, wherein the step of granting said registration from said selected session-control server further comprises the step of binding said received public identity with a list containing information of each first-contact-point server through which a registration containing said public identity has been granted from said session-control server. 6. The method of claim 4, wherein the step of granting said registration through said first-contact-point server entity further comprises the step of binding said received public identity with a list containing the individual address of each terminal that have got a granted registration through it and have used said public identity in the granted registration. 7. The method of claim 3, further comprising the steps of: sending from said selected session-control server (S CSCF) to said home server (HSS) information related to said selected session-control server, said received public identity and said received private identity; storing in said home server (HSS) information stating that said selected session-control server is assigned to serve session control for further sessions related to said user for said received public identity and said received private identity; said information being stored in addition to any eventual previously stored information concerning to any other session-control server already assigned to serve session control for further sessions related to said user for any public identity and any private identity assigned to the subscription of said user. 8. The method of claim 7, further comprising the step of binding in said home server (HSS) said received public identity with a list containing information related to each session-control server which has notified that is assigned to serve session control for further sessions related to said user for said public identity. 9. The method of claim 1, wherein the handling of a session establishment addressed to said user comprises the steps of: receiving a session request containing a public identity related to the subscription of said user in said telecommunications system, and processing said session request according to the registration status of the public identities and private identities of said user. 10. The method of claim 9, wherein the step of processing said session request comprises one step among: forwarding said session request to one terminal among a plurality of terminals which has a registration granted for said subscription; forwarding said session request sequentially to more than one of said plurality of terminals, until said session is awarded by one of them; forwarding said session request simultaneously to more than one of said plurality of terminals. 11. The method of claim 9, wherein the step of processing said session request according to the registration status of the public identities and private identities of said user comprises the steps of: receiving a location request query containing said received public identity in said home server entity (HSS), answering said location request query with information for further handling said session request; said information further comprising: a list containing information related to one or more session-control server entities that are assigned to serve session control to said user for said received public identity, a list containing information related to one or more session-control server entities that are assigned to serve session control to said user for any of his public identities; wherein, the information of a session-control server is further accompanied of a public identity to replace, as received public identity, the originally received public identity whenever said session-control server is serving session control to said user for a public identity different of the originally received public identity. 12. The method of claim 11, further comprising one step among: forwarding the session request to one session-control server received in said information for further handling said session request, forwarding the session request sequentially to more than one session-control server received in said information for further handling said session request, until the session is awarded by one of them, forwarding the session request simultaneously to more than one session-control server received in said information for further handling said session request. 13. The method of claim 12, further comprising one step among: forwarding a received session request from a session-control server to one first-contact-point server entity among a plurality of first-contact-point servers through which a registration containing the received public identity has been granted from said session-control server, forwarding a received session request from a session-control server sequentially to more than one first-contact-point server among said plurality of first-contact-point servers, until said session is awarded by one of them, forwarding a received session request from a session-control server simultaneously to more than one first-contact-point server among said plurality of first-contact-point servers. 14. The method of claim 13, further comprising one step among: forwarding a received session request from a first-contact-point server entity to one terminal, among a plurality of terminals said first-contact-point server is serving access that got a granted registration using said public identity, forwarding a received session request from a first-contact-point server entity sequentially to more than one terminal among said plurality of terminals, until said session request is awarded by one of them, forwarding a received session request from a first-contact-point server entity simultaneously to more than one terminal among said plurality of terminals. 15. A system for handling multiple registrations of a user in a telecommunications system which manages location information and identification information related to its users, each of said registrations being related to a subscription of said user in said system, the system comprising: storage means arranged to store, related to said subscription, a plurality of private identities, and processing means arranged to process received registration requests according to the private identity among said plurality of private identities received on each of said requests, wherein each of said registration request requests to attach a terminal to said system for said subscription; wherein said processing means are further arranged to process each of said received registration requests according to said received private identity and a public identity received in said request. 16. The system of claim 15, wherein said processing means comprise: means for receiving in a home server entity (HSS) which stores data of said subscription a registration query containing, at least, said received private and public identities, means in said home server for verifying if said user is already registered with said private identity, means in said home server for answering said registration query with information for further handling said registration request; said information comprising one or any combination thereof among: a registration status indication stating if said user is not registered with said received private identity, the capabilities required for a session-control server entity in order to support session control for further sessions involving said user for said public identity and said private identity, information related to a session-control server that is already assigned to serve session control to said user for said received public identity and any of the private identities associated to the subscription of said user, a list containing information related to one or more of the plurality of session-control servers that are already assigned to serve session control to said user for any of the public and private identities associated to the subscription of said user. 17. The system of claim 16, wherein said processing means further comprise: means for selecting, according to said information for handling said registration request, a session-control server entity for serving session control for further sessions involving said user for said public identity and said private identity, and means for granting the registration of said user from said terminal in said system. 18. The system of claim 17, wherein said means for granting comprise means for granting said registration from said selected session-control server to said terminal through the first-contact-point server entity serving the access of said terminal to said system. 19. The system of claim 18, wherein said selected session-control server is arranged to bind a given public identity with a list containing information of each first-contact-point server through which a registration containing said public identity was granted from said session-control server. 20. The system of claim 18, wherein said first-contact-point server entity is arranged to bind a given public identity with a list containing the individual address of each terminal that have got a granted registration through it and have used said public identity in the granted registration. 21. The system of claim 17, wherein said home server (HSS) is further arranged to store information of a session-control server which notifies it has been assigned to serve session control for further sessions related to said user for said received public identity and said received private identity; said information being stored in addition to any eventual previously stored information concerning to any other session-control server already assigned to serve session control for further sessions related to said user for any public identity and any private identity assigned to the subscription of said user. 22. The system of claim 21, wherein said home server (HSS) is further arranged to bind a given public identity with a list containing information related to the session-control servers which notified that are assigned to serve session control for further sessions related to said user for said public identity. 23. The system of claim 15, wherein for the handling of a session establishment addressed to a user, said processing means are further arranged to process a session request containing a public identity related to the subscription of said user according to the registration status of the public identities and private identities of said user. 24. The system of claim 23, wherein said processing means are arranged to: forward said session request to one terminal among a plurality of terminals which has a registration granted for said subscription, or forward said session request sequentially to more than one of said plurality of terminals, until said session is awarded by one of them, or forward said session request simultaneously to more than one of said plurality of terminals. 25. The system of claim 23, wherein said processing means comprise: means for receiving a location request query containing said received public identity in said home server entity (HSS), means for answering said location request query with information for further handling said session request; said information comprising one or any combination thereof among: a list containing information related to one or more session-control server entities that are assigned to serve session control to said user for said received public identity, a list containing information related to one or more session-control server entities that are assigned to serve session control to said user for any of his public identities; wherein, the information of a session-control server is further accompanied of a public identity to replace, as received public identity, the originally received public identity whenever said session-control server is serving session control to said user for a public identity different of the originally received public identity. 26. The system of claim 25, wherein said processing means are further arranged to: forward the session request to one session-control server received in said information for further handling said session request, or forward the session request sequentially to more than one session-control server received in said information for further handling said session request, until the session is awarded by one of them, or forward the session request sequentially to more than one session-control server received in said information for further handling said session request, until the session is awarded by one of them, or forward the session request simultaneously to more than one session-control server received in said information for further handling said session request. 27. The system of claim 26, wherein a session-control server receiving a session request is arranged to: forward said session request to one first-contact-point server entity among a plurality of first-contact-point servers through which a registration containing the received public identity has been granted from said session-control server, or forward said session request sequentially to more than one first-contact-point server among said plurality of first-contact-point servers, until said session is awarded by one of them, or forward said session request simultaneously to more than one first-contact-point server among said plurality of first-contact-point servers. 28. The system of claim 27, wherein a contact-point server entity receiving a session request is arranged to: forward said session request to one terminal, among a plurality of terminals said first-contact-point server is serving access that got a granted registration using said public identity, or forward said session request sequentially to more than one terminal among said plurality of terminals, until said session request is awarded by one of them, or forward said session request simultaneously to more than one terminal among said plurality of terminals. 29-36. (Cancelled) |
<SOH> BACKGROUND <EOH>Users subscribed to the services provided by a telecommunications system are usually assigned to identifiers (subscriber identifiers, subscriber identities, or subscriber-IDs). For a given subscription of a user in a given telecommunication system, at least one subscriber-ID is used to be assigned. Said subscriber-ID(s) identify uniquely said subscription and is used in said system for addressing and identification purposes. The type, content, and even the number of subscriber-ID(s) per user, depends basically on the characteristics of the telecommunications system. For instance, in a telecommunications systems such as a Public Switch Telephone Network (PSTN) or Integrated Services Digital Network (ISDN), users are assigned to one telephone number as subscriber-ID (although more than one telephone number can be assigned per user in said systems) These telephone numbers are according to the format specified in ITU-T recommendation E.164 (May 1997), and are assigned per user according to a specific numbering plan. Once an E.164 number is assigned to a user of a PSTN, said number is used both: for addressing (routing) calls to said user, and also to identify said user within the network. Since in this kind of wired systems the point in the telecommunications system where the user access to the service said system provides (the access point) is fixed, the user is supposed to be reachable in the terminal connected to said access point and, therefore, the user is usually not forced to register (attach) prior to get access to the services provided by the telecommunications system. In other telecommunications system, such as for instance in a 2G (second generation) mobile system (such as a Global System for Mobile communications, or GSM), or in a 3G (third generation) mobile systems (also known as Universal Mobile Telecommunications System, or UMTS), said subscriber-ID is not unique per user. A given user subscribed to one of said 2G or 3G systems is assigned to a unique private identifier (private identity or private-ID) and to, at least, one public identifier (public identity or public-ID). Also, as opposite to traditional telecommunications systems using fixed (wired) access technologies (e.g.: PSTN), in mobile systems the same user can access to said system from different access points; i.e.: from different locations. Due to this, said user register his/her presence from a different access point in a given moment (e.g.: each time from the same or different terminal through the same or different radio access server); therefore, the user registers (attach) his/her presence in a given access point from a given terminal prior to access to further services, such as make or receive calls. Within said process (hereinafter referred as registration), the user's terminal identifies the subscription he/she holds and wants to activate, and this is accomplished by sending (among other authentication and identification data) the private-ID associated to said subscription. Once the registration of a 2G or 3G user has run successfully, said user can receive incoming sessions (e.g.: voice calls) on his/her terminal from other users that have “dialled” the public-ID (or one of the public-IDs) associated to said subscription of said user. I.e.: the public-ID is utilized by other users as an aforementioned “telephone number”. At this point, it shall be noticed that the term “session”, whenever cited within this invention, encompasses various kind of communications that, according to the state-of-the-art telecommunication systems and telecommunication protocols, can be established between communication peers; thus, being not limited to traditional “voice calls” provided by well known circuit-switched based systems and protocols, but also comprising communications provided by packet-switched (or cell-switched) based systems and protocols, that provides communications with multiple media capabilities, such as audio, video and data, even simultaneously within the same communication. Examples of said communications, known as “multimedia communications” (also as “multimedia sessions” or “multimedia calls”), are described, for instance, in ITU-T recommendation H.323 (November 2000), or in IETF's RFC-2543 “Session Initiation Protocol”, SIP (March 1999). For a given subscription of a given user in a 2G or 3G system, a given home server in the system (known as Home Location Register or HLR, or Home Subscriber Server or HSS.) keeps, among other data, and as a part of the SD (subscriber data) related to said subscription, the relationship between said subscription of said user and the private-ID and public-ID(s) associated to it. Said home servers (for example HLRs or HSSs) are mainly in charge of attending request from other nodes or servers within the system whenever a registration request of a given user needs to be attended (i.e.: granted or rejected), or whenever location information of a given user is needed (e.g.: at call to said user). In 2G or 3G systems, the private-ID of a given user is unique per user subscription and it is used within the 2G or 3G system for internal identification purposes at registration, authorization, administration, etc. For a given subscription, said private-ID is also stored in a subscriber identity module known for example as SIM, or USIM for 3G, which is included in the subscriber's card for example a Subscriber Identity Module card or SIM card, or UMTS Integrated Circuit card or UICC, provided to said user, together with other security information related to said subscription such as secret keys used for authentication. Said subscriber's card (SIM card, UICC) is intended to be accommodated, either: fixed or removable, in user's terminals used for accessing said systems. Unlike Public-IDs, Private-IDs does not need to be known by the users of said systems, nor known by other users of other telecommunications systems, since they are not intended to be supplied (i.e.: “dialled”) by a given user for establishing a communication with another user; i.e.: said private-IDs are not intended to be used as “called number”, nor intended for identifying the calling or connected party in the end user terminal display. In 2G systems, a private-ID takes the format of IMSI (International Mobile Subscriber Identity); while in 3G systems, a private-ID takes the form of a NAI (Network Access Identifier) as defined in RFC-2486 “The Network Access Identifier” (January 1999), wherein the IMSI can be contained within the NAI. In said 2G or 3G systems, the public-ID(s) of a given user is, however, intended for addressing (routing) calls to said user, and, therefore, intended to be used as “telephone numbers” are in other telecommunication systems for example PSTN (Public Switched Telephone Network), ISDN (Integrates Services Digital Network), including calling and connected party identification purposes. So, public-IDs are used for establishing communications between users, and, therefore, intended to be known by the users, not only of said mobile systems (2G or 3G), but also by users of other telecommunications systems which can interwork with said 2G or 3G systems. In this way a user (user-A) who wants to establish a communication with another user (user-B) needs to supply (i.e.: to “dial”) the public-ID of said user-B (or one of the public-IDs of said user-B) in the call request said user-A makes. User-B, in turn, can (if said service is allowed) identify the calling party from the public-ID of user-A said user-B receives. The format of the public-ID(s) of a given user can vary depending on the particularities of the telecommunications system said user is subscribed. In 2G and 3G systems, public-IDs are in the format of E.164 numbers (known as MSISDN numbers) (i.e.: they are typical telephone numbers such as in PSTN). In 3G systems that implements the so called IM Subsystem (or IMS) (Internet Protocol Multimedia Subsystem), said public-IDs can also take another formats, such as SIP-URL (Uniform Resource Locator for Session Initiation Protocol), TEL-URL (Uniform Resource Locator for telephony), etc. Given that current mobile systems (2G or 3G) do only provide one private-ID per user subscription, and given that said unique private-ID is used in the registration process, said systems does not permit a given user to register into a mobile system referencing the same subscription (i.e.: by identifying the same private-ID on each registration request) from more than one terminal, since it would imply the existence of a SIM cloning situation, meaning the existence of two subscription cards with the same data on them. Therefore (and regardless various complex techniques for SIM cloning detection), if a given user tries to register and already has a registration active for his/her subscription, said new registration is considered a re-registration and all data related to the old registration are overwritten with the data related to the new one. With this situation, for a given user having only one subscription, only one registration can be active for said user and said single subscription, and no simultaneous locations are allowed for said single subscription. In this way, a given user who wants to have more than one terminal registered, has to hold more than one subscription and use a different subscription for registering each of said terminals. Modern telecommunication systems (such as 3G mobile systems) are, however, intended to offer a huge variety of services. Depending on the nature of said services, some of them would require some capabilities within the end-user terminal (e.g.: a service based on multimedia capabilities or file/data transfer capabilities) not needed for other services (e.g.: a service based on mere voice capabilities). This, would make desirable for a given user having one subscription in one of said systems to be registered from a plurality of terminals simultaneously (e.g.: having different capabilities each); and all this, without harming security aspects that rely on the identification of the subscription of said user nor forcing to said user to hold more than one subscription. FIG. 1 has been taken from the technical specification TS 23.228 (V5.0.0, April 2001) released by the 3GPP (3 rd Generation Partnership Project), which is the forum in charge of developing the standards ruling the 3G systems. Although this figure shows the relationship between private-ID and public-ID(s) of a given subscription (Internet Multimedia subscription, or IM-subscription) of a given user (IM-user) of the IMS (Internet Protocol Multimedia Subsystem) of a 3G system; it actually shows the state-of-the-art univocal relationship existing in mobile systems regardless its generation (2G or 3G) between one subscription and the private-ID associated to said subscription. Within said figure, it can be observed that, even though a given user holding a single subscription can be reached (i.e.: called) by means of different public-IDs, the subscription of said user is identified by a single (and only) private-ID. The relationship shown in FIG. 1 is maintained and held primarily in the home server of said user (HSS, HLR), although copies of said data and relationships can also be kept and used in other nodes (or servers) within the telecommunications system. However the logic inherent to the aforementioned univocal relationship is deployed across any server within the telecommunication system, thus disabling both: to have multiple active registrations of a given user holding a single subscription from a plurality of access points, and to have subsequent calls addressed to said user to be delivered to one or more of said of access points where said user can be located. Known standards for 3G systems have regarded the possibility of having UMTS subscriber cards holding more than one subscription (i.e.: more than one USIM within the same UICC) (e.g.: 3GPP TS 22.101, v4.0.0, June 2001), thus allowing the same terminal to be registered alternatively for different user subscriptions. However, only one of these subscription can be active in a given moment in said terminal, and, in any case, the capabilities inherent to said terminals related to the kind of sessions it can handle remains the same regardless the active subscription. SIP (Session Initiation Protocol) was selected by 3GPP as the protocol for handling user registrations and session control for users holding IM-subscriptions. The specification of SIP (RFC-2543) already allows a given user to indicate in a registration message REGISTER multiple contact points where said user can be contacted (i.e.: reached) for further incoming sessions addressed to the identity (i.e.: public-ID) contained in the “From” header or said REGISTER message. These contact points are included in subsequent “Contact” headers within one or subsequent REGISTER messages, wherein each “Contact” header contains an address of a given SIP endpoint (i.e.: a SIP enabled terminal). According to this, a SIP REGISTER message from a given user such as: REGISTER sip:server2.wcom.com Via: . . . From: <sip:[email protected]> To: . . . Call-ID: . . . CSeq: 1 REGISTER Contact: <sip:[email protected]> Contact: tel:+1-972-555-2222 Content-Length: . . . , if accepted by the registration server “server2.wcom.com”, would make that further sessions addressed to said user (i.e.: further INVITE messages indicating in the “To” header the identity “[email protected]”) are forwarded simultaneously to both contact points that were specified in the REGISTER message: the SIP application in host with IP-Addr (Internet Protocol address) 110.111.112.113 where said user has logged in as “UserB”, and to the telephone number “+1-972-555-2222”. However, the adaptation and use of the SIP protocol to the specific architecture of IMS in 3G systems has blocked said possibility, as it can be seen in the 3GPP specification that states the signaling flows for IM-users (TS 24.228, V1.0.0, June 2001) . In said specification it is stated that the content of the “Contact” header must be the IP-Addr said terminal is using to access to the 3G system (i.e. the IP-address said terminal got during the process it ran to get a radio bearer packet-based, known as PDP (Packet Data Protocol) Context Establishment process); that is to say, the address it uses to exchange packets with the server which is serving its access to the system. With this limitation, a given user holding a single IM-subscription in a 3G system, can have only one registration active at the same time, said registration being related to only one access point to the system and to only one terminal attached to said access point and identified by a single address (IP-Addr). Therefore, according to the state-of-the-art, a given user who would like to have multiple active registrations in any of said mobile systems (2G, 3G) that requires to manage information related to the location of said user for any of those registrations, as well as to manage information related to the identifiers that address and identify said user in said system, would be forced to hold different subscriptions. However, since each individual subscription is held separately in said systems, thus implying separate processing and administration (i.e.: separate accounting records, separate subscription records, separate location data, etc.) it would imply difficulties for the mobile system operator for allowing the same public-ID(s), related to the same user, to be assigned to more than one subscription; no mention to inconvenience for the user, having to deal with multiple bills for the same service. It should be then desirable a situation wherein, without having to appeal to a solution based on multiple subscriptions per user, a given user having a single subscription in a telecommunications system (such as a mobile system, or other telecommunications system of similar characteristics regarding user identities and location information), is allowed to register into said system from different terminals simultaneously, thus having multiple registrations active simultaneously; and wherein said user can receive calls in any of these registered terminals from other parties that have “dialled” one public-ID that is associated to said single subscription. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention provides a method for supporting multiple active registration of, at least, one user in a telecommunications system, being said registrations related to a single subscription of said user in said system and being requested each from a plurality of terminals (user equipment, or UE); and for the further handling of multiple session establishment towards any or each of said terminals where said user registered. The invention further relates to a system arranged for implementing said method. According to one aspect of the present invention, it is provided a method for handling multiple registration of a user in a telecommunications system that manages location information and identification information related to its users; said identification information containing at least, for each user, a unique private identity and one or more public identities. The method comprises the steps of (a) storing, assigned to said user in said telecommunications system, a plurality of private identities related to the subscriber data of said user in said system; (b) receiving subsequent registration requests, each registration request requesting to attach a subsequent terminal to said telecommunications system for said user; wherein each one of said subsequent registration requests contains, at least: a public identity associated to said user among the plurality of public identities associated to said user, and a private identity among the plurality of private identities associated to said user; and (c) processing each of said received subsequent registration requests according to the public identity and private identity received on each of said subsequent registration requests. Said method allows a given user having one subscription in said system to register on it from a plurality of terminals simultaneously; i.e.: to get granted registrations that can be active simultaneously. According to a further aspect of the invention, it is provided a method for handling session establishment towards a user having multiple registrations. The method comprises the step of (a) processing said session request according to the plurality of terminals that have a registration granted for said user in said system (i.e.: the plurality of terminals said user is presently registered with); wherein said processing step can consist on: (a1) forwarding said session request to one of these terminals among said plurality of terminals; or (a2) forwarding said session request sequentially to more than one of said plurality of terminals until said session is awarded by one of them; or (a3) forwarding said session request simultaneously to more than one of said plurality of terminals. Said method allows a given user to receive incoming sessions (voice calls, multimedia calls, multimedia conferences, data transfer, etc.) addressed to a public-ID of said user to be delivered to a plurality of terminals said user is presently registered with; allowing said session to be attended in the terminal with the best (or more appropriate) capabilities for said session; or simply, to be attended in the end-user terminal which is physically closest to said user. According to a further aspect of the invention, it is provided a telecommunications system for handling multiple registrations of a single subscription in said system. Said system comprises: (a) storage means arranged to store per user, at least, one or more public identities and a plurality of private identities; and (b) processing means arranged to process subsequent registration requests of a given user according to the public identity and according to the private identity (among said plurality of private identities) received on each of said registration requests. Said system allows multiple active registrations related to a single subscription. According to a further aspect of the invention, the aforementioned system for handling multiple registrations is further augmented for handling session establishment towards any or all the active registrations related to a single subscription. The system according to this aspect comprises (a) processing means arranged to process a received session request, said session request containing a public identity associated to said user, according to the plurality of terminals that have a registration granted for said user in said system; wherein said processing means can be further arranged to: (a1) forwarding said session request to one terminal among said plurality of terminals; or (a2) forwarding said session request sequentially to more than one of said plurality of terminals until said session is awarded by one of them; or (a3) forwarding said session request simultaneously to more than one of said plurality of terminals. Said system allows to deliver an incoming session to any of the terminals that have a granted registration for the subscription addressed by the public identity indicated in said incoming session. According to a preferred embodiment of this invention, the telecommunications system comprises one or a set of functional server entities in charge of various functions, such as: storing the subscriber data of the users of said system (referred also as home server entity, or HSS, HLR), serving the access to said system to the terminals (UEs) used by its users (referred also as first-contact-point server entity, or Proxy Call State Control Function, P-CSCF), serving the initial handling of transactions involving users of said system (referred also as interrogating server entity, or Interrogating Call State Control Function, I-CSCF), and serving session control services for sessions involving users of said system (referred also as session-control server entity, or Proxy Call State Control Function, Serving Call State Control Function, S-CSCF). If said functions are performed by a single server entity, or by a set of distributed or co-located functional server entities, does not affect the scope of the present invention. |
Bicycle fork bicycle frame and method for producing a bicycle frame |
The invention relates to a bicycle frame including a base frame and at least one device which is mounted on the base frame, provided in the form of a brace structure, and has an accommodating area for accommodating a wheel. The invention also relates to a bicycle fork and to a method for producing a bicycle frame. |
1. A bicycle frame comprising: a base frame and at least one device which is mounted on the base frame, provided in the form of a brace structure and has an accommodating area for accommodating a wheel, and at least one brace of the brace structure is configured resilient such that the accommodating area is spring-mounted. 2. The bicycle frame of claim 1, wherein said device is a bicycle rear body. 3. The bicycle frame according to claim 1, wherein said device is a bicycle fork. 4. The bicycle frame according to claim 1, wherein the rear body comprises at least one chain brace and/or at least one seat brace, and that at least one of said braces is configured resilient. 5. The bicycle frame according to claim 1, wherein the at least one resiliently configured brace acts as a spring by means of which a wheel receiver such as a front wheel receiver or a rear wheel receiver is spring-mounted. 6. The bicycle frame according to claim 1, wherein said device comprises two resilient and parallel-connected braces mounted on the same side of the plane of the wheel. 7. The bicycle frame according to claim 1, wherein a resiliently configured region of the at least one resiliently configured brace is mounted radially inwardly and axially outwardly of a wheel attached to the bicycle frame. 8. The bicycle frame according to claim 1, wherein the rear body is configured integrally. 9. The bicycle frame according to claim 1, wherein the rear body is integrally connected with the base frame. 10. The bicycle frame according to claim 1, wherein at least one adjust means is provided for adjusting the resilience properties of the bicycle frame and/or for adjusting the damping properties. 11. The bicycle frame according to claim 1, wherein by means of the adjust means the pre-load and/or the spatial position of at least one resilient brace is variable. 12. The bicycle frame according to claim 1, wherein in the region of at least one resiliently configured brace resilient additional components are detachably mounted such that by means of said resilient additional components the spring rate of the spring acting on the wheel accommodating area can be varied. 13. The bicycle frame according to claim 1, wherein said resilient additional components are configured as brace-types. 14. The bicycle frame according to claim 1, wherein at least one securing additional component is detachably mounted such that with the securing additional component attached, the wheel receiver is mounted substantially unsprung, and with the securing additional component not attached, the wheel receiver is substantially spring-mounted. 15. The bicycle frame according to claim 1, wherein at least one damper device is provided for damping the movement of the spring-mounted wheel receiver. 16. The bicycle frame according to claim 1, wherein the damper device engages with a chain brace of the rear body. 17. The bicycle frame according to claim 1, wherein the damper device is mounted between a chain brace of the rear body and a seat brace of the rear body. 18. The bicycle frame according to claim 1, wherein at least one damper is mounted at least partially radially inwardly and axially outwardly of a wheel attached to the bicycle frame. 19. The bicycle frame according to claim 1, wherein a guide device is provided to guide the wheel receiver during spring deflection and/or rebound. 20. The bicycle frame according to claim 1, wherein more than one resiliently configured braces are provided which, in particular in interaction, determine the path of movement of the wheel receiver during spring deflection and/or rebound. 21. The bicycle frame according to claim 1, wherein during spring deflection and/or rebound the wheel receiver for accommodating the rear wheel moves such that there is substantially no influence on the chain tension of a drive chain caused by said spring deflection and/or rebound. 22. The bicycle frame according to claim 1, wherein the wheel receiver for accommodating the rear wheel moves during spring deflection and/or rebound, that the rear wheel axle moves substantially on a section of a circular path which extends about the axis of a crank set housing of the bicycle frame. 23. The bicycle frame according to claim 1, wherein resilience is effectively present substantially on a plane parallel to the plane of the wheel. 24. The bicycle frame according to claim 1, wherein the wheel receiver is perpendicular to the plane of the wheel and is substantially non-movable. 25. The bicycle frame according to claim 1, wherein the resilient brace comprises carbon fibers and/or fiberglass. 26. A bicycle fork for a bicycle frame according to claim 1. 27. A method for producing a bicycle frame including the following steps: producing a bicycle frame wherein the geometry, in particular the geometry of the cross-sections of the braces, and the materials are selected such that a portion of the frame braces is configured resilient such that at least one wheel receiver is spring-mounted. |
In vivo bioreactors |
The present invention relates to an in vivo method of promoting the growth of autologous tissue and its use to form corrective structures, including tissue that can be explanted to other locations in the animal. In particular, the invention relates to methods and systems for (a) the site-specific regeneration of tissue, and (b) the synthesis of neotissue for transplantation. |
1. A method for promoting generation of soft tissue, or precursor cells for soft tissue, comprising the steps of: i. creating an artificial space or environment in an organ or cavity of an animal; and ii. introducing into the artificial space a matrix which is conducive to infiltration by, and growth and/or differentiation of pluripotent cells from the tissue surrounding the artificial space. 2. The method of claim 1, including the further step of harvesting the pluripotent cells, or tissue derived therefrom, from the artificial space. 3. The method of claim 2, wherein the harvested cells are reimplanted in the animal. 4. The method of claim 1, wherein the artificial space is created in or adjacent periosteum tissue. 5. The method of claim 1, wherein the artificial space is created between a mesenchymal portion of a soft tissue organ and an adjacent epithelium or compact mesenchymal layer of the organ. 6. The method of claim 1, wherein the tissue is selected from the group consisting of liver, pancreas, kidney, muscle, spleen, teeth, dentin, mucosa and bone. 7. The method of claim 1, wherein the artificial space is created with retractor having a fluid-operated portion, such as a balloon or bladder, to retract a portion of the soft tissue. 8. The method of claim 1, wherein the area in which the artificial space is to be created is treated with an agent to partially degrade the connective tissue at the site, freeing cells to promote formation of the space and/or promote migration of cells into the space. 9. The method of claim 7, wherein the agent is selected from the group consisting of trypsin, chymotrypsin, collagenase, elastase, hyaluronidase, pronase and chondroitinase. 10. The method of claim 1, wherein the matrix is a porous, biodegradable polymer. 11. The method of claim 1, wherein the matrix is a solution at the time of injection into the artificial space or environment, but which gains dimensional stability in situ. 12. The method of claim 1, wherein the matrix is a hydrogel. 13. The method of claim 12, wherein the hydrogels is selected from the group consisting of a Pluronics hyrgogel, an alginates, a hydrogel formed from polyethylene glycol polylactic acid copolymers, and a Tetronics hydrogel. 14. The method of claim 1, wherein the matrix includes appropriate nutrients for promoting growth of said infiltrating cells. 15. The method of claim 1, wherein the matrix includes one or more growth factors for promoting growth and/or differentiation of said infiltrating cells. 16. The method of claim 15, wherein said one or more growth factors are selected from the group consisting of basic fibroblast growth factor (bFGF, or FGF-2), acid fibroblast growth factor (aFGF), epidermal growth factor (EGF), heparin binding growth factor (HBGF), fibroblast growth factor (FGF), vascular endothelium growth factor (VEGF), transforming growth factor (including TGF-α, TGF-β, and bone morphogenic proteins such as BMP-2, -3, -4, -7), Wnts, hedgehogs (including sonic, indian and desert hedgehogs), transforming growth factor-(x (TGF-α), noggin, activins, inhibins, insulin-like growth factor (such as IGF-I and IGF-II), growth and differentiation factors 5, 6, or 7 (GDF 5, 6, 7), leukemia inhibitory factor (LIF/HILDA/DIA), Wnt proteins, platelet-derived growth factors (PDGF), vitronectin (VN), laminin (LN), bone sialoprotein (BSP), and osteopontin (OPN), parathyroid hormone related polypeptide (PTHrP), and the like. 17. The method of claim 1, wherein the matrix includes one or more anti-angiogenic agents. 18. The method of claim 1, wherein the matrix includes one or more extracellular matrix proteins selected from the group consisting of collagen, chondronectin, fibronectin, vitronectin, proteoglycans, and glycoasminoglycans chains. 19. The method of claim 1, wherein the matrix includes is a composite of naturally and artificial polymers. 20. The method of claim 1, wherein the biodegradable matrix includes a chemotactic substance for promoting migration of said infiltrating cells into said artificial space. 21. The method of claim 1, wherein the shields and/or spacers are placed in the artificial space. 22. A method for promoting generation of cartilage or bone tissue, comprising the steps of: i. creating an artificial space in or adjacent periosteum tissue of an animal; and ii. introducing into the artificial space a porous, biodegradable polymer matrix which is compatible with growth of chondrocytes from the periosteum surrounding the artificial space. 23. The method of claim 22, wherein the biodegradable matrix includes appropriate nutrients for promoting growth of said chondrocytes. 24. The method of claim 22, wherein the biodegradable matrix includes one or more growth factors for promoting growth of said chondrocytes. 25. The method of claim 24, wherein said growth factors are selected from the group consisting of a somatomedin, a hedgehog protein, parathyroid related hormone, a basic fibroblast growth factor, a transforming growth factor-β, a cartilage growth factor, and combinations thereof. 26. The method of claim 25, wherein the biodegradable matrix includes one or more anti-angiogenic agents. 27. The method of claim 22, wherein the artificial space is treated with an agent to partially degrade the connective tissue at the site, freeing cells to promote formation of the space and/or promote migration of cells into the space. 28. The method of claim 27, wherein the agent is selected from the group consisting of trypsin, chymotrypsin, collagenase, elastase, hyaluronidase, pronase and chondroitinase. 29. A kit for promoting generation of tissue in vivo, comprising: a. a tissue retractor for generating the artificial space; b. a matrix which is conducive to infiltration by, and growth and/or differentiation of pluripotent cells; and c. (optionally) an agent to partially degrade the connective tissue at the site, freeing cells to promote formation of the space and/or promote migration of cells into the space. 30. A kit for promoting generation of tissue in vivo, comprising: a. a matrix precursor(s) capable of forming a dimensionally stable matrix in vivo, which matrix is conducive to infiltration by, and growth and/or differentiation of pluripotent cells, which matrix precursor(s) is in the form of a solution; b. a TGF-β and b-FGF, admixed with said matrix precursor(s) or in a form which is amenable to mixture with said matrix precursor(s); and c. instructions (written or pictorial) associated with said kit, said instructions describing the preparation of the matrix precursor(s), TGF-β and b-FGF for injection into an artificial space or environment in vivo. 31. A method of conducting a regenerative medicine business, comprising: a. marketing a kit of claim 29 or 30, and b. providing instruction to customers purchasing the kit on how to use the kit for generating tissue in vivo. 32. A method of conducting a regenerative medicine business, comprising: a. providing instruction for carrying out the method of claim 1 or 22 to isolate cells or tissue from a patient; and b. providing a cell banking services for preserving the isolated cells or tissue. 33. A method of conducting a regenerative medicine business, comprising: a. providing instruction for carrying out the method of claim 1 or 22 to isolate cells or tissue from a patient; and b. providing a services for further processing the isolated cells or tissue, as for example, to expand the cell population or differentiate the cells. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Cell differentiation is the central characteristic of morphogenesis which initiates in the embryo, and continues to various degrees throughout the life of an organism in adult tissue repair and regeneration mechanisms. The degree of morphogenesis in adult tissue varies among different tissues and is related, among other things, to the degree of cell turnover in a given tissue. On this basis, tissues can be divided into three broad categories: (1) tissues with static cell populations such as nerve and skeletal muscle where there is no cell division and most of the cells formed during early development persist throughout adult life; (2) tissues containing conditionally renewing populations such as liver where there is generally little cell division but, in response to an appropriate stimulus, cells can divide to produce daughters of the same differentially defined type; and (3) tissues with permanently renewing populations including blood, testes and stratified squamous epithelia which are characterized by rapid and continuous cell turnover in the adult. Here, the terminally differentiated cells have a relatively short life span and are replaced through proliferation of a distinct subpopulation of cells, known as stem or progenitor cells. Tissue engineering has emerged as a scientific field which has the potential to aid in human therapy by producing anatomic tissues and organs for the purpose of reconstructive surgery and transplantation. It combines the scientific fields of materials science, cell and molecular biology, and medicine to yield new devices for replacement, repair, and reconstruction of tissues and structures within the body. Many approaches have been advocated over the last decade. One approach is to combine tissue specific cells with open porous polymer scaffolds which can then be implanted. Large numbers of cells can be added to the polymer device in cell culture and maintained by diffusion. After implantation, vascular ingrowth occurs, the cells remodel, and a new stable tissue is formed as the polymer degrades by hydrolysis. A number of approaches have been described for fabricating tissue regeneration devices for either in vitro or in vivo growth of cells. Polymeric devices have been described for replacing organ function or providing structural support. Such methods have been reported by Vacanti, et al., Arch. Surg. 123:545-49 (1988); U.S. Pat. No. 4,060,081 to Yannas, et al.; U.S. Pat. No. 4,485,097 to Bell; and U.S. Pat. No. 4,520,821 to Schmidt, et al. In general, the methods used by Vacanti, et al., and Schmidt, et al., can be practiced by selecting and adapting existing polymer fiber compositions for implantation and seeding with cells, while the methods of Yannas and Bell produce very specific modified collagen sponge-like structures. However, in most instances, the prior art requires the use of allogeneic transplants, e.g., cells which have at least one MHC mismatch between the donor and recipient. As a consequence, such transplants can be problematic to commercialization as a result of the potential of immuno-rejection of the graft, and/or graft-versus-host response where the graft includes lymphocytes. Accordingly, there is a need for sources of autologous cells for transplantation. |
<SOH> SUMMARY OF THE INVENTION <EOH>One aspect of the present invention relates to a method for promoting generation of soft tissue, or precursor cells for soft tissue, comprising the steps of: i. creating an artificial space or environment in an organ or cavity of an animal, such as a mammal, and preferably a human; and ii. introducing into the artificial space or environment a matrix, preferably a dimensionally stable matrix, which is conducive to infiltration by, and growth and/or differentiation of pluripotent cells from the tissue surrounding the artificial space. In certain preferred embodiments, the artificial space is created adjacent or in periosteum tissue. For instance, the present invention provides a method for promoting generation of cartilage or bone tissue, comprising the steps of: i. creating an artificial space adjacent or in periosteum tissue of an animal; and ii. introducing into the artificial space a porous, biodegradable polymer matrix which is compatible with growth of chondrocytes from the periosteum surrounding the artificial space. In certain preferred embodiments, the artificial space is created between between tissue layers of an organ, such as between mesenchymal portion of the soft tissue and an adjacent epithelium or compact mesenchymal layer, e.g., the tissue is selected from the group consisting of liver, pancreas, kidney, muscle, spleen, teeth, dentin, mucosa and bone. In certain other embodiments, the artificial space is created in cardiac tissue. In still other embodiments, the subject method involves creating an artificial environment in a pre-existing bodily cavity, such as in the pericardial, peritoneal, pleural, synovial, lymph or cerebrospinal cavities/spaces. The subject method can include the further step of harvesting the pluripotent cells, or tissue derived therefrom, from the artificial space, e.g., to be banked or reimplanted in the animal. In certain embodiments, the artificial space is created with retractor having a fluid-operated portion, such as a balloon or bladder, to retract a portion of the soft tissue. In certain preferred embodiments, the area in which the artificial space is to be created is treated with an agent to partially degrade the connective tissue at the site, freeing cells to promote formation of the space and/or promote migration of cells into the space. For example, the area can be treated with an agent is selected from the group consisting of trypsin, chymotrypsin, collagenase, elastase, hyaluronidase, pronase and chondroitinase. In certain preferred embodiments, the matrix used in the artificial space is a biodegradable matrix, such as a porous, biodegradable polymer. The matrix can include appropriate nutrients for promoting growth of the infiltrating cells. The matrix can also include one or more growth factors for promoting growth of the infiltrating cells. It may also include chemotactic substance for promoting migration of progentior cells into said artificial space. In certain preferred embodiments, the subject matrix includes one or more fibroblast growth factors (FGF) and one or more transforming growth factors, and in even more preferred embodiments, includes basic FGF (bFGF) and TGF-β1 or TGF-β2. In certain embodiments, such as where the subject method is used to form cartilage or tissue which develops in a relatively avascular environment, it may be desirable to include one or more antiangiogenic agents in the matrix. In the formation of certain tissues, such as cartilage, it may also be advantageous to apply external pressure to the matrix, such as by application of a pressure bandage or inflated air blatter in the proximal to the cavity. In certain embodiments, the matrix is a material which is a solution at the time of injection, but which solidifies (gains dimensional stability) in situ. However, after solidification, the matrix should still porous enough to permit migration/infiltration of cells from the surrounding tissue. There are many hydrogels which possess these characteristics, including Pluronics™, sodium or calcium alginates, polyethylene glycol polylactic acid copolymers, and Tetronics™. The matrix can also include one or more extracellular matrix proteins selected from the group consisting of collagen, chondronectin, fibronectin, vitronectin, proteoglycans, and glycoasmine glycans chains. Another aspect of the invention relates to a kit for promoting generation of tissue in vivo, comprising: a. a tissue retractor for generating the artificial space; b. a matrix which is conducive to infiltration by, and growth and/or differentiation of pluripotent cells; and c. (optionally) an agent to partially degrade the connective tissue at the site, freeing cells to promote formation of the space and/or promote migration of cells into the space. Yet another aspect of the invention relates to a method of conducting a regenerative medicine business, comprising: a. marketing a kit, such as described above, and b. providing instruction to customers purchasing the kit on how to use the kit for generating tissue in vivo. Still another aspect of the invention relates to a method of conducting a regenerative medicine business, comprising: a. providing instruction for carrying out the subject method for isolating cells or tissue from a patient; and b. providing a cell banking services for preserving the isolated cells or tissue. Another aspect of the invention provides a method for conducting a regenerative medicine business, comprising: a. providing instruction for carrying out the subject method to isolate cells or tissue from a patient; and b. providing a services for further processing the isolated cells or tissue, as for example, to expand the cell population or differentiate the cells. |
Methods for modulating gap junctions |
A method for modulating gap junctions is provided. In a first step, the transcription of connexin is enhanced and the gap junction is relocalized at the cell membrane; in a second step, gap junction function is restored by properly gating the channel and/or inducing apoptosis. The method preferably comprises a providing a cell or an animal with a first compound for increasing the activity of protein kinase A (PKA) and in the second step providing the cell or animal with a second compound for specifically inhibiting or activating one or more protein kinase C (PKC) isoforms and/or for specifically inhibiting p38 MAP kinase. |
1. A method of modulating gap junction mediated intercellular communication in vertebrate cells characterized by dysfunctional gap junction communication, comprising a step of providing the cells with a compound that re-localizes the gap junctions at the cells' membrane. 2. A method according to claim 1, where the compound also increases the expression level of connexin in the cells. 3. A method according to claim 1 or wherein the compound is an activator of a selected protein kinase A (PKA) isoform. 4. A method according to claim 1, including the additional step of providing the cells with another compound that restores gap junction gating. 5. A method according to claim 4, wherein the another compound is a modulator for specifically modulating one or more selected PKC isoforms. 6. A method according to claim 4 wherein the step and the additional step are preformed sequentially or simultaneously. 7. A method of modulating gap junction mediated intercellular communication in vertebrate cells characterized by dysfunctional gap junction communication, comprising a step of providing the cells with a compound that restores gap junction gating. 8. A method according to claim 7, wherein the compound is a modulator for specifically modulating one or more selected PKC isoforms. 9. A method of modulating intercellular gap junction communication in an animal between diseased cell tissue and adjacent healthy cell tissue, comprising the steps of (a) providing the cells with a compound that re-localizes the gap junctions at the cells' membrane, and (b) providing the cells with another compound that restores intercellular gap junction gating. 10. A method according to claim 1, wherein the cells are cancer cells. 11. A method according to claim 10, wherein the cancer cells are neuroblastoma cells. 12. A method according to claim 11, wherein the PKA isoform that is activated is PKA sub-type I, PKA sub-type II or a mixture thereof. 13. A method according to claim 12, wherein the PKA activator is forskolin, sulbutamol, isobutylmethylzanthine or phosphodiesterase inhibitors. 14. A method according to claim 11, wherein the PKC modulator is a PKC inhibitor. 15. A method according to claim 14, wherein the PKC inhibitor is an inhibitor of one or more of PKC isoforms alpha, beta I and beta II. 16. A method according to claim 2, wherein the connexin is connexin 43. 17. A method of treating a cancer tumour in a patient, comprising the steps of: (a) providing the cell with a protein kinase A (PKA) activator; and (a) providing the cell with modulator for specifically inhibiting or activating one or more PKC isoforms. 18. An assay for testing drug candidates for treating diseases, disorders or conditions characterized by dysfunctional gap junction mediated intercellular communication, and/or which exhibit modulation of the activity of protein kinase A, comprising a step of administering a drug candidate compound to cells having dysfunctional gap junction mediated intercellular communication and/or abnormal localization within the cells of connexin, and/or a low level of connexin expression, wherein a quantitative estimation of an increase in the transcription of connexin e.g. by Western blot, and a re-localization of the connexin to the cells's membrane, and/or a measurement of increased activity of a selected PKA isoform, as determined e.g. by immunostaining, followed by microscope imaging analysis, denotes a positive result. 19. An assay for testing drug candidates for treating diseases, disorders or conditions characterized by dysfunctional gap junction mediated intercellular communication, and/or which exhibit modulation of the activity of protein kinase C, comprising a step of administering a drug candidate compound to cells having dysfunctional gap junction mediated intercellular communication, wherein an observation, of an improvement in gap junction mediated intercellular communication as measured e.g. by scrape loading dye transfer assay, and/or a measurement of inhibition or activation of one or more selected PKC isoforms, denotes a positive result. |
<SOH> BACKGROUND OF THE INVENTION <EOH>It has been established that in many chronic diseases, such as cancer, cardiac conditions, and central nervous system diseases, gap junction mediated intercellular communications are dysfunctional (see for example Bruzzone, R. et al, European Journal of Neuroscience, 9:1-6 (1997); Holder, J. et al., Cancer Research, 53:3475-3485 (1993); Yamasaki, H., Environmental health perspectives, 93:191-197 (1991), Peters, N., Clinical Science, 90:447-452 (1996); Mesnil, M. et al., M/S Mini - Synthése, 12:1435-1438 (1996); Dilber, M. et al., Gene Therapy, 4:273-274 (1997); Pal, J. et al., American Physiological Society, 1443-1446 (1999); Marques Jr., W. et al., Journal Of Neurology, Neurosurgery And Psychiatry, 66:803-804 (1999); Heller, S. et al., Nature Medicine, 4:560-561 (1998); and Holt, J. et al, Neuron, 22:217-219 (1999)). A gap junction is a membrane structure detectable at points of contact between adjacent cells. Gap junctions serve as passageways or channels between the interiors of contiguous cells, and mediate intercellular communication by the passage of small molecules from the cytoplasm of one cell to that of adjacent cells. Gap junctions are composed of clusters of membrane proteins collectively termed connexins which form structures called connexons. The proteins are peripherally disposed around a central channel. Gap junction transmembrane passages are formed when a connexon of one cell aligns with a connexon of an adjacent cell. In this way, transmembrane intercellular pathways are formed that permit the passage of molecules between coupled cells. The diameter of the connexon channels is about 1.5 to 2 nm. This diameter allows only small molecule substances of less than approximately 1,000 daltons, such as ions, sugars, nucleic acids, amino acids, fatty acids, and small peptides, to pass but not large molecules, such as proteins, complex lipids, polysaccharides and polynucleotides. The protein subunits of connexons may vary from cell to cell. The connexins (Cx), form a multi-gene family whose members are distinguished according to their predicted molecular mass in kDa (e.g. Cx32, Cx43). Connexins are expressed in a cell-, tissue-, and developmentally-specific manner. See Beyer et al., J. Membr. Biol., 116:187-194 (1990); Dermietzel, R. et al., Anat. Embryol., 182:517-258 (1990; Warner, A., Seminars in Cell Biology, 3:81-91 (1992); Kumar, N. M. et al., Seminars in Cell Biology, 3:3-16 (1992). For instance, Cx43 is the predominant connexin expressed in cardiac muscle and in liver epithelial cells. In adult liver parenchymal cells, the predominant connexins are Cx32 and Cx26; non parenchymal liver cells express other connexins. Each connexin forms channels with different conductance, regulatory, and permeability properties. In those tissues where more than one connexin is expressed, gap junctions may contain more than one connexin. However, it is not known whether individual connexons may be comprised of more than one connexin type. Gap junctions do not necessarily remain open. Elevation of the intracellular level of calcium ions, among other factors, leads to a graded closure of gap junctions. In healthy, normal cells, these channels are fully open when the calcium ion level is less than 10 −7 M and are shut when the level of this ion is higher than 5×10 −5 M. As the concentration of calcium ion increases in this range, the effective diameter of gap junctions decreases so that they become impermeable first to larger molecules. When the normally very low (10 −8 M) intracellular calcium levels rise, the gap junction proteins undergo conformational changes that close the gap. In certain diseases, the gap junction gating is dysfunctional resulting in numerous problems. Many solid tumors, for instance, have deficient gap junctions, a condition that prevents the communication among cancer cells and between the cancer cells and healthy surrounding cells leading to an alteration in the intracellular levels of calcium, and other small molecules. This leads to an upset in normal tissue homeostasis and favours uncontrolled cell proliferation. One method of combating tumours is proposed in U.S. Pat. No. 6,149,904 to Fick et al. issued on Nov. 21, 2000. Fick et al. seek to provide cells that are genetically engineered to increase their ability to interact with and to inhibit tumour cells. Described is a method of providing engineered cells that express a heterologous nucleic acid that encodes a connexin and that contains a pro-drug activating gene. The target tumour cells are contacted with the engineered cells to form functional gap junctions between the two groups of cells. In this way, the invention aims to have the therapeutic molecule pass through a gap junction into the target tumour cell. However, this method seeks to employ gene therapy associated with a toxin to stop proliferation of the tumour rather than re-establishing a more normal gap junction function, as a method of controlling the tumour. The ability of adjacent cells to form gap junctions may depend on a number of factors including the ability of cells to interact with their neighbours (reportedly requiring the presence of compatible cell adhesion molecules), the level of connexin expressed, whether the connexins expressed by one cell are capable of forming a connexon that is capable of linking with a connexon of a second cell to form a functional channel, and whether a molecule, such as a carcinogen or the product of an oncogene is expressed in a cell and interferes with the normal signaling pathways. Most oncogenes or carcinogens alter the gating of the gap junction channel by affecting the activity of protein kinases that use connexins as a substrate (such as, PKA, PKCs, c-src, MAPK). By controlling gap junctions, communication between cells in diseased tissue can be restored. As a consequence, the tissue or organ may regain normal function and regain growth homeostasis. For instance, in the case of tumours, re-establishment of intercellular communication and/or increase in cell coupling between malignant cells and the surrounding healthy cells restores the normal phenotype of malignant cells and leads to growth arrest. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is, thus desirable to provide a method for modulating gap junction channels in order to treat chronic diseases and disorders characterized by dysfunctional gap junctions, or increase “bystander effects”. Examples are cancer, such as neuroblastoma and other malignant solid tumours, cardiac conditions, such as arrhythmia, and central nervous system diseases. In a first aspect, the invention provides a method step of modulating gap junction mediated intercellular communication in mammalian cells characterized by dysfunctional gap junction communication, comprising providing the cells with a compound that re-localizes the gap junctions at the cells' membrane. In one embodiment, this is effected, by re-locating connexins in the cells' cytoplasm from a perinuclear location, to the cell membrane. In another embodiment, the expression of connexin is also increased. In yet another embodiment, the compound is an activator of a selected protein kinase A(PKA) isoform. In a second aspect, the invention provides a method step of modulating gap junction mediated intercellular communication in mammaalian cells characterized by dysfunctional gap junction communication, comprising providing the cells with a compound that restores gap junction gating. In one embodiment, the compound is a modulator for specifically inhibiting or activating one or more selected PKC isoforms. The two steps may be performed, individually, sequentially or simultaneously, depending upon the requirement. In some cases, only one step is required, while in others, both steps may be required. It may be enough to increase the level of expression of connexin, and/or localize the connexin to the cells' membrane e.g. by activation of a selected PKA isoform. In other cases, the gap junctions may be properly localized at the cells' membrane, but not properly gated to permit effective intercellular communication. In one situation, the gating with surrounding healthy tissue cannot be made. In another situation, the gating is made with surrounding tissue with which it is not supposed to communicate. In such cases, only the second type of drug candidate e.g. a selected modulator on one or more PKC isoforms, would be required. In another aspect, the invention provides a method of modulating gap junction operation in a cell or in an animal comprising the steps of providing the cell or animal with a first compound for increasing the activity of PKA and providing the cell or animal with a second compound for inducing apoptosis. Regarding apoptosis, we rely upon our observations of cytoplasmic leakage. A method of modulating gap junction operation in a cell, comprising the steps of: (a) providing the cell with a protein kinase A (PKA) activator; and (b) providing the cell with a p38 MAP kinase inhibitor. According to yet another aspect of the invention, an assay for testing drug candidates, for treating diseases, disorders or conditions characterized by dysfunctional gap junction mediated intercellular communication, and/or which exhibit modulation of the activity of protein kinase A and/or protein kinase C is also provided. In one embodiment, the method comprises, a step of administering a drug candidate compound to cells having dysfunctional gap junction mediated intercellular communication and /or abnormal localization within the cells of connexin, and/or a low level of connexin expression. An estimation of the increase of connexin transcription by quantitative Western blot and a re-localization of the connexin to the cells's membrane, as determined e.g. by immunostaining, followed by microscope imaging analysis, denotes a positive result. In another embodiment, the method comprises, a step of administering a drug candidate compound to cells having dysfunctional gap junction mediated intercellular communication. An observation, of an improvement in gap junction mediated intercellular communication as measured e.g. by scrape loading dye transfer assay, and/or a measurement of inhibition or activation of one or more selected PKC isoforms, denotes a positive result. In yet another aspect, a method of treating a cancer tumour in a patient is provided, comprising the steps of: (a) providing the cell with a protein kinase A (PKA) activator; and (b) providing the cell with modulator for specifically inhibiting or activating one or more PKC isoforms. The control of gap junctions in many types of tumours, such as neuroblastoma, results in the down-regulation of the tumour growth and the restoration of the normal cellular phenotype. Other features and advantages of the invention will become apparent from the following description and from the claims. |
Surface roughness quantification of pharmaceuticals, herbal, nutritional dosage forms and cosmetic preparations |
Dosage forms are identified based on a comparison of surface roughness parameters. One or more of the following surface roughness parameters are measured: 1) mean peak to valley height (Rz); 2) geometric average height from a mean line (Rq); 3) maximum profile peak height (Rp); 4) roughness depth (Rt); 5) and arithmetic mean roughness (Ra). The surface roughness parameters of a first dosage form are determined and compared to the surface roughness parameters of a second dosage form. This method provides a way of “fingerprinting” dosage forms to help identify adulterated and misbranded drugs. In addition, a variety of characteristics relating to composition and process for making the dosage form may be determined by the quantitative method. |
1. A method for evaluating a dosage form, comprising; a) determining for a first dosage form at least one surface roughness parameter selected from the group comprising: a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean; b) determining for a second dosage form at least one surface roughness parameter selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth, and an arithmetic mean roughness; c) comparing said at least one surface roughness parameter of said first dosage form to a corresponding surface roughness parameter of said second dosage form to obtain a roughness differential; and d) evaluating a characteristic of said second dosage form based on said roughness differential. 2. The method of claim 1, wherein said dosage form is selected from the group comprising a pharmaceutical dosage form, a herbal dosage form, a nutritional dosage form, and a cosmetic dosage form. 3. The method of claim 1, wherein said step of measuring said second dosage form is performed using a perthometer. 4. The method of claim 1, wherein said dosage form is selected from the group comprising a coated tablet, an uncoated tablet, a cataplasm, a coated bead, an uncoated bead, a granule, a paste, a cream and an ointment. 5. The method of claim 4, wherein said coated tablet has an organic based coating or an aqueous based coating. 6. The method of claim 1, further comprising determining at least two surface roughness parameters selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness for said second dosage form. 7. The method of claim 1, further comprising determining at least three surface roughness parameters selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness for said second dosage form. 8. The method of claim 1, further comprising determining at least four surface roughness parameters selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness for said second dosage form. 9. The method of claim 1, further comprising determining a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness for said second dosage form. 10. The method of claim 1, further comprising measuring at least two surface roughness parameters selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness of said second dosage form. 11. The method of claim 1, further comprising measuring at least three surface roughness parameters selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness of said second dosage form. 12. The method of claim 1, further comprising measuring at least four surface roughness parameters selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness of said second dosage form. 13. The method of claim 1, further comprising measuring a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness of said second dosage form. 14. The method of claim 1, wherein said characteristic of said second dosage form is selected from the group comprising nature of an ingredient, concentration of an ingredient, process used for preparation, optimum coating end point, grade of an ingredient, coating defect, compression defect, lubricant mixing time, order of mixing an ingredient, and time of mixing an ingredient. 15. The method of claim 1, wherein said at least one surface roughness parameter of said first dosage form is a known surface roughness parameters to provide a standard. 16. The method of claim 15, wherein said at least one surface roughness parameter of said second dosage form is measured. 17. A method for determining a characteristic of a coating for a dosage form comprising, a) determining at least one roughness parameter for a first dosage form; b) measuring at least one roughness parameter for a second dosage form; c) comparing said roughness parameter of said first dosage form to a corresponding roughness parameter of said second dosage form to obtain a roughness differential; and d) determining said characteristic based on said roughness differential. 18. The method of claim 17, wherein said characteristic is optimum amount of coating or coating defect. 19. The method of claim 17, wherein said roughness parameter for said first dosage form and said second dosage form is selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness. 20. The method of claim 17, wherein said coating is an organic or aqueous based coating. 21. A method for determining a characteristic of an ingredient in a dosage form comprising, a) determining at least one surface roughness parameter for a first dosage form; b) measuring at least one surface roughness parameter for a second dosage form; c) comparing said roughness parameter of said first dosage form to a corresponding roughness parameter of said second dosage form to obtain a roughness differential; and d) determining the characteristic of the ingredient based on said roughness differential. 22. The method of claim 21, wherein said ingredient is selected from the group comprising a diluent, a binder, a glidant, a lubricant, and a drug. 23. The method of claim 21, wherein said roughness parameter for said first dosage form and said second dosage form is selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness. 24. The method of claim 21, wherein said characteristic of an ingredient is selected from the group comprising a nature of the ingredient, a concentration of the ingredient, a grade of the ingredient, an order of mixing of an ingredient, and a time of mixing of an ingredient. 25. A method for determining a process for preparing a dosage form comprising, a) determining at least one surface roughness parameter for a first dosage form; b) measuring at least one surface roughness parameter for a second dosage form; c) comparing said roughness parameter of said first dosage form to a corresponding roughness parameter of said second dosage form to obtain a roughness differential; and d) determining the process for preparing said dosage form based on said roughness differential. 26. The method of claim 25, wherein said roughness parameter for said first dosage form and said second dosage form is selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness. 27. The method of claim 25, wherein said process for preparing said dosage form is selected from the group comprising direct compression, wet granulation, and lubricant mixing time. 28. A method for determining a release characteristic of a drug in a dosage form comprising, a) determining at least one surface roughness parameter for a first dosage form; b) measuring at least one surface roughness parameter for a second dosage form; c) comparing said roughness parameter of said first dosage form to a corresponding roughness parameter of said second dosage form to obtain a roughness differential; and d) determining the release characteristics of a drug based on said roughness differential. 29. The method of claim 28, wherein said roughness parameter for said first dosage form and said second dosage form is selected from the group comprising a mean peak to valley height, a geometric average height from a mean line, a maximum profile peak height, a roughness depth and an arithmetic mean roughness. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention Surface roughness parameters of a dosage form are quantitatively measured in order to determine one or more characteristics of the dosage form. 2. Background Information Several classes of natural, synthetic and biotechnologically-derived drugs are being discovered by scientists all over the world. In order for these drugs to become effective, they need to be available in the body between a certain minimal effective concentration and a particular toxic concentration. With certain drugs, the rate at which the drug substance becomes available can be very high or none at all. For example, a bioavailability difference of 10 to 100% has been shown in commercial digoxin preparations. In most of the cases, the variability in bioavailability is directly related to formulation considerations. An important role of product development is to make safe and effective dosage forms by a careful selection of additives, manufacturing techniques, and by a thorough consideration of the variables affecting the composition, stability and utility of the product. Although there are a variety of dosage forms available, the most common dosage form is a tablet. Traditionally, tablets are prepared either by direct compression of a drug with additives or by a wet granulation process. The wet granulation process involves the mixing of all ingredients, granulation by using a binder, drying, dry granulation, lubrication and compression. Depending upon the end requirements, tablets are coated by film coating, chocolate coating, or sugar coating. The common problems associated with tabletting are capping and lamination, picking and sticking, mottling, weight variation, punch variation, hardness variation, friability, and variations in disintegration and dissolution. Film defects reported are sticking and picking, roughness, orange peel effect, bridging and filling, blistering, color variation and cracking. To design tablets and later monitor tablet production quality, quantitative evaluation and assessment of a tablet's chemical, physical and bioavailability properties must be done. Currently tablets are evaluated by their general appearance, size and shape, organoleptic properties, hardness, friability, weight variation, disintegration, dissolution and content uniformity. Prior techniques for assessing the picking, sticking or roughness in the surface measurements include a qualitative estimation of the surface of the tablets. This evaluation procedure can be very subjective; therefore, a quantitative roughness measuring method should be of considerable interest to pharmacy students, pharmaceutical companies and also to the State and Federal Regulating Agencies. Besides measuring the extent of picking and sticking quantitatively, the roughness measurements would aid in the determination of optimum level of coating solution or dispersion application on tablets, evaluation of the effect of moisture and other variables on the quality of surface smoothness of coated and uncoated tablets, and for the forensic purpose wherein the adulterated tablets can be easily identified. The roughness of uncoated tablets can be caused by crystalline behavior of ingredients, retention of undesired levels of moisture, surface drying, or uneven compression pressures. For coated tablets, roughness can be due to blistering of the film, orange peeling, uneven application of coating solutions or dispersion, and mottling. Consequently, a need exists for a method of quantitatively determining the surface roughness characteristics of a dosage form to permit evaluation of various properties of the dosage form, including methods of production, physical properties and chemical compositions. |
<SOH> BRIEF SUMMARY OF THE INVENTION <EOH>Various characteristics of dosage forms may be evaluated by comparing one or more surface roughness parameters of at least a first dosage form to corresponding surface roughness parameters of at least a second dosage form. The surface roughness parameters used for this purpose are one or more of the following: 1) mean peak to valley height (Rz); 2) geometric average height from a mean line (Rq); 3) maximum profile peak height (Rp); 4) roughness depth (Rt); 5) and arithmetic mean roughness (Ra). Once the surface roughness parameters are obtained, a surface roughness comparison using the measured values is determined to provide a roughness differential, and this roughness differential is then used to determine a specified characteristic of the dosage form. These surface roughness parameters are preferably determined by measuring peaks generated by a perthometer. Quantitative surface roughness measurements using a combination of several surface roughness parameters have an important application in the area of dosage form design and evaluation, for when the type and concentration of ingredients, and the processes for making the dosage form are changed, the roughness profiles of the dosage form will also change. This change in profile can be used to identify the ingredients and processes used in manufacturing the dosage form. The measured surface roughness parameters are used to identify a variety of characteristics of a dosage form including, but are not limited to, the following: 1) the ingredients and grades of material used to make the dosage; 2) the optimum amount of coating solution or dispersion needed for a dosage form; and 3) the processes used to make the dosage form. In essence, these surface roughness parameters provide a “fingerprint” of a dosage form which specifically identifies that dosage form. In order to obtain the most information about a dosage form, and thus its “fingerprint”, all five surface roughness parameters are measured; however, valuable information about certain characteristics of a dosage form may be obtained by using less then all five surface roughness parameters. Specific identification of a dosage form may be used to monitor the production quality of the dosage form, including the chemical and physical properties of the dosage form and bioavailability of the drug in the dosage form. In addition, the “fingerprint” of the dosage form helps determine whether an unauthorized production of the dosage form has been performed or whether a dosage form has been misbranded. A surface roughness comparison may be used to compare surface roughness parameters of a known dosage form to an unknown dosage form to determine, for example, whether a drug is being properly manufactured, whether the drug has been properly marked, or whether the drug is a counterfeit. In addition, the surface roughness parameters of at least two unknown dosage forms may be compared in order to determine, for example, the optimum amount of coating solution for a dosage form, the effects of direct compression on a dosage form, the effects of wet granulation on a dosage form, and the rate of dissolution of a drug in the dosage form. The quantitative method of the present invention for comparing the surface roughness parameters of dosage forms thus has a variety of applications. The surface roughness parameters may be used as a method to “fingerprint” coated and uncoated pharmaceutical, herbal and nutritional dosage forms as well as cosmetic preparations. The nature and concentration of the ingredients used to formulate the dosage form may be identified by comparing the surface roughness parameters of known dosage forms with sample dosage forms obtained from the production line. Additionally, the surface roughness parameters of a known dosage form may be used to ensure the quality of a process used for preparing dosage forms. Using surface roughness parameters is useful in determining the coating end points of both organic and aqueous based coatings of dosage forms. Surface roughness parameters may also help determine the exact grade of any ingredients in the formulation of the dosage form, coating defects of the dosage form, compression defect in the dosage form, lubricant mixing times needed to obtain a uniform dosage form, and the order and time of mixing of ingredients in gels, pastes, creams, ointments, plasters and cataplasms. By using a quantitative method for determining the surface roughness of dosage forms, more precise characteristics may be determined as compared to prior subjective determinations which evaluate the surface roughness of the dosage form using qualitative and visual testing techniques. Surface roughness techniques which have been traditionally used in the testing of tools and automobile parts can now be applied to surface testing of dosage forms. Quantitative testing solves the “forensic” problem of differentiating an original dosage form from legal or illegal duplicates and adulterated or misbranded products. For a given dosage form, the present method will help determine the ingredients and process employed for preparing the dosage form without actually having to damage the dosage form. |
Antitumoral formulations of thioxanthenone |
The invention relates to a formulation of N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide, or a pharmaceutically acceptable acid-addition salt thereof, and to the method of use thereof in the treatment of tumors and cancers. |
1. A formulation comprising N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide, or a pharmaceutically acceptable acid-addition salt thereof; an acidic buffering agent; a pharmaceutically acceptable carrier; and a sufficient quantity of a base to adjust the pH of the formulation to from about 3 to about 8. 2. A formulation according to claim 1 wherein the ratio of N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide, or a pharmaceutically acceptable acid-addition salt thereof, to buffering agent is from about 1:1 to about 3:1. 3. A formulation according to claim 2 wherein the ratio of N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide, or a pharmaceutically acceptable acid-addition salt thereof, to buffering agent is from about 2.4:1. 4. A formulation according to claim 3 wherein the pharmaceutically acceptable carrier is water and the acidic buffering agent is citric acid. 5. A formulation according to claim 4 wherein the base is sodium hydroxide. 6. A formulation according to claim 5 wherein a sufficient quantity of sodium hydroxide is added to adjust the pH of the formulation to from about 4 to 6. 7. A formulation according to claim 6 wherein a sufficient quantity of sodium hydroxide is added to adjust the pH of the formulation to from about 5 to 5.5. 8. A formulation according to claim 7 wherein a sufficient quantity of sodium hydroxide is added to adjust the pH of the formulation to about 5.2. 9. A formulation according to claim 1 comprising from about 0.1 mg/mL to about 100 mg/mL of N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide, or a pharmaceutically acceptable acid-addition salt thereof. 10. A formulation according to claim 9 comprising from about 1 mg/mL to about 50 mg/mL of N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide, or a pharmaceutically acceptable acid-addition salt thereof. 11. A formulation according to claim 10 comprising from about 5 mg/mL to about 20 mg/mL of N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide, or a pharmaceutically acceptable acid-addition salt thereof. 12. A formulation according to claim 11 comprising about 10 mg/mL of N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide, or a pharmaceutically acceptable acid-addition salt thereof. 13. A formulation according to claim 1 further comprising a tonicity modifier. 14. A formulation according to claim 13 wherein the tonicity modifier is sodium chloride or dextrose and is present in an amount from about 0.1% w/v to about 6% w/v. 15. A formulation according to claim 14 wherein the tonicity modifier is sodium chloride and it is present in an amount from about 1.0% w/v to about 0.9% w/v. 16. A formulation according to claim 15 wherein the sodium chloride is present in an amount of about 0.84% w/v. 17. A formulation according to claim 16 comprising 10 mg/mL of N-[[1-[[2-(diethylamino)ethyl]amino]-7-methoxy-9-oxothioxanthen-4-yl]-methyl]formamide; water as the pharmaceutically acceptable carrier; 4.2 mg/mL of citric acid; and 8.4 mg/mL of sodium chloride, the pH of said formulation being adjusted to 5.2 with sodium hydroxide. 18. (canceled) 19. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of a formulation according to claim 1. 20. (canceled) 21. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 2. 22. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 3 23. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 4. 24. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 5. 25. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 6. 26. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 7. 27. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 8. 28. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 9. 29. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 10. 30. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 11. 31. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 12. 32. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 13. 33. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 14. 34. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 15. 35. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 16. 36. A method for the treatment of cancer or a tumor which comprises administering to a patient in need of such treatment an effective amount of formulation according to claim 17. |
Slicing method and device |
The invention relates to a method for slicing food products having an irregular inner structure such as sausages or ham, wherein the products (11) are cut into slices (S) and especially offset portions or stacked portions are formed and transported away from the slicing area (31). During said slicing process, information on the contour and structure of the slices of products is obtained by means of an opto-electronic detector device in a series of successive detection steps (E) by illuminating the slicing area, whereupon the illuminated rays reflected from the cutting surfaces (13) of the slices of product which are to be respectively separated and from the edge area (15) of said slices are detected and evaluated Said illumination is carried out in at least one and preferably in all of the detection steps (E) in several directionally independent components (k) which are different from each other at least with respect to an illumination parameter. The invention also relates to a slicing device which is especially suitable for carrying out the inventive slicing method. |
1-38. (canceled) 39. A method for the slicing of food products having an irregular inner structure such as sausage or ham, in which the products (11) are cut into slices (S) and in particular overlapping portions or stacked portions are formed and transported away from the slicing region (31) and in which information is gained on the contour and on the structure of the product slices (S) during slicing by means of an optoelectronic detection device in a series of detection procedures (E), in that the slicing region (31) is illuminated and illuminating radiation reflected from the cut surfaces (13) of the respective slices (S) to be cut off from the product (11) and reflected from the marginal region (15) of the slices (S) is detected and evaluated, characterized in that, in at least one detection procedure (E), and preferably in each detection procedure (E), the illumination is effected in a plurality of direction-independent components (K) which differ from another at least with respect to one illumination parameter. 40. A method in accordance with claim 39, characterized in that at least some illumination components (K) are effected simultaneously. 41. A method in accordance with claim 39, characterized in that at least some illumination components (K) are effected after one another timewise. 42. A method in accordance with claim 39, characterized in that at least some illumination components (K) differ with respect to the wavelength (λ) of the radiation used. 43. A method in accordance with claim 39, characterized in that the wavelengths (λ) are selected in dependence on the different components of the product (11a, 11b), in particular on the fat component, on the one hand, and on the lean component, on the other hand, and/or on whether the slice structure or the slice contour should be detected. 44. A method in accordance with claim 39, characterized in that at least some illumination components (K) differ from one another with respect to the intensity (I) of the radiation used and/or with respect to the intensity of illumination produced in the respectively illuminated region. 45. A method in accordance with claim 39, characterized in that at least some illumination components (K) differ from one another with respect to the polarization properties (P) of the radiation used. 46. A method in accordance with claim 39, characterized in that the or each detection procedure (E) includes precisely one product slice (S). 47. A method in accordance with claim 39, characterized in that the or each detection procedure (E) includes a plurality, and in particular two or three directly sequential product slices (S). 48. A method in accordance with claim 39, characterized in that pieces of information gained at one or different product slices (S) are put together to form joint information on both the contour and the structure of the product slices (S). 49. A method in accordance with claim 39, characterized in that information is gained on one product slice (S) about its structure and on another product slice (S) about its contour. 50. A method in accordance with claim 39, characterized in that information is gained on the different components of the product (11a, 11b), in particular on the fat component, on the one hand, and on the lean component, on the other hand, on different product slices (S). 51. A method in accordance with claim 39, characterized in that a plurality of illumination components (K), and in particular all illumination components (K) are effected from a single direction (R) and in particular by means of a single radiation source. 52. A method in accordance with claim 39, characterized in that the illumination components (K) are effected from different directions (R) and in particular by means of a plurality of radiation sources (17, 19, 21) spatially separated from one another. 53. A method in accordance with claim 39, characterized in that, for the production of the contrast between the cut surface (13) and its marginal region (15), a higher intensity of illumination is produced in the latter than on the cut surface (13). 54. A method for the slicing of food products having an irregular inner structure such as sausage or ham, in which the products (11) are cut into slices (S) and in particular overlapping portions or stacked portions are formed and transported away from the slicing region (31) and in which information is gained on the contour and on the structure of the product slices (S) during slicing by means of an optoelectronic detection device in a series of detection procedures (E), in that the slicing region (31) is illuminated and illuminating radiation reflected from the cut surfaces (13) of the respective slices (S) to be cut off from the product (11) and reflected from the marginal region (15) of the slices (S) is detected and evaluated, characterized in that in at least one detection procedure (E), and preferably in every detection procedure (E), the illumination is effected only from the half space disposed in front of the slicing region (31) in a plurality of illumination components (K) from different directions. 55. A method in accordance with claim 54, characterized in that at least some illumination components (K) are effected simultaneously. 56. A method in accordance with claim 54, characterized in that at least some illumination components (K) are effected after one another timewise. 57. A method in accordance with claim 54, characterized in that at least some illumination components (K) differ with respect to the wavelength (λ) of the radiation used. 58. A method in accordance with claim 54, characterized in that the wavelengths (λ) are selected in dependence on the different components of the product (11a, 11b), in particular on the fat component, on the one hand, and on the lean component, on the other hand, and/or on whether the slice structure or the slice contour should be detected. 59. A method in accordance with claim 54, characterized in that at least some illumination components (K) differ from one another with respect to the intensity (I) of the radiation used and/or with respect to the intensity of illumination produced in the respectively illuminated region. 60. A method in accordance with claim 54, characterized in that at least some illumination components (K) differ from one another with respect to the polarization properties (P) of the radiation used. 61. A method in accordance with claim 54, characterized in that the or each detection procedure (E) includes precisely one product slice (S). 62. A method in accordance with claim 54, characterized in that the or each detection procedure (E) includes a plurality, and in particular two or three directly sequential product slices (S). 63. A method in accordance with claim 54, characterized in that pieces of information gained at one or different product slices (S) are put together to form joint information on both the contour and the structure of the product slices (S). 64. A method in accordance with claim 54, characterized in that information is gained on one product slice (S) about its structure and on another product slice (S) about its contour. 65. A method in accordance with claim 54, characterized in that information is gained on the different components of the product (11a, 1b), in particular on the fat component, on the one hand, and on the lean component, on the other hand, on different product slices (S). 66. A method in accordance with claim 54, characterized in that a plurality of illumination components (K), and in particular all illumination components (K) are effected from a single direction (R) and in particular by means of a single radiation source. 67. A method in accordance with claim 54, characterized in that the illumination components (K) are effected from different directions (R) and in particular by means of a plurality of radiation sources (17, 19, 21) spatially separated from one another. 68. A method in accordance with claim 54, characterized in that, for the production of the contrast between the cut surface (13) and its marginal region (15), a higher intensity of illumination is produced in the latter than on the cut surface (13). 69. An apparatus for the slicing of food products having an irregular inner structure such as sausage or ham, with which the products (11) are cut into slices (S) and in particular overlapping portions or stacked portions are formed and transported away from the slicing region (31), there being a lighting device including at least one radiation source (17, 19, 21) for the illumination of the slicing region (31), a detection device (23) for illuminating radiation reflected from the cut surfaces (13) of the respective slices (S) to be cut off from the product (11) and from the marginal region (15) of the slices (S), and an evaluation device (25) for the evaluation of the detected radiation, characterized in that the lighting device for the production of a contrast sufficient for the detection of the contour and of the structure of the product slices (S) between the cut surface (13) and its marginal region (15), on the one hand, and between different portions of the product (11a, 11b) on the cut surface (13), on the other hand, is operable such that the illumination can be effected in at least one detection procedure (E) and preferably in each detection procedure (E) in a plurality of detection-independent components (K) which differ from one another at least with respect to an illumination parameter. 70. An apparatus in accordance with claim 69, characterized in that at least some illumination components (K) can be effected simultaneously with the lighting device. 71. An apparatus in accordance with claim 69, characterized in that at least some illumination components (K) can be effected after one another timewise with the lighting device. 72. An apparatus in accordance with claim 69, characterized in that the lighting device is made for the transmission of radiation of different wavelengths (λ). 73. An apparatus in accordance with claim 69, characterized in that the lighting device is made for the transmission of radiation of different intensities (I). 74. An apparatus in accordance with claim 69, characterized in that the lighting device is made for the transmission of radiation of different polarization properties (P). 75. An apparatus in accordance with claim 69, characterized in that the lighting device includes precisely one radiation source. 76. An apparatus in accordance with claim 69, characterized in that the lighting device includes a plurality of radiation sources (17, 19, 21) spatially separate from one another. 77. An apparatus in accordance with claim 69, characterized in that at least one radiation source (17, 19), or each radiation source (17, 19) is arranged in the half space disposed in front of the slicing region (31). 78. An apparatus in accordance with claim 77, characterized in that at least one radiation source (17) is arranged beneath the product support surface (27) and is in particular of an elongate shape extending transversely to the product conveying direction (T). 79. An apparatus in accordance with claim 69, characterized in that the lighting device includes a luminous frame or luminous tunnel (21) arranged at least partly in the slicing region (31) and partly or fully surrounding the product (11) in operation. 80. An apparatus in accordance with claim 79, characterized in that the lighting device includes, in addition to the luminous frame or luminous tunnel (21), at least one radiation source (17, 19) arranged in the half space disposed in front of the slicing region (31). 81. An apparatus in accordance with claim 69, characterized in that the radiation source (17, 19, 21) is movable for the changing of the lighting direction. 82. An apparatus in accordance with claim 69, characterized in that the detection device (23) includes at least one sensor which is associated with a plurality of illumination components (K) and in particular with all illumination components (K). 83. An apparatus in accordance with claim 69, characterized in that at least one sensor of the detection device (23) is provided for the simultaneous detection of radiation of different wavelengths (λ) and is in particular provided in the form of a color camera. 84. An apparatus in accordance with claim 69, characterized in that the detection device (23) includes a plurality of individual sensors which are associated with different illumination components (K). 85. An apparatus in accordance with claim 69, characterized in that individual sensors of the detection device (23) are provided in each case in the form of a black and white camera provided with filter devices. 86. An apparatus in accordance with claim 69, characterized in that at least one sensor of the detection device (23) can be read out repeatedly in accordance with a time sequence of illumination components (K). 87. An apparatus in accordance with claim 69, characterized in that a plurality of individual sensors of the detection device (23) can be read out after one another timewise in accordance with a time sequence of illumination components (K). 88. An apparatus for the slicing of food products having an irregular inner structure such as sausage or ham, with which the products (11) are cut into slices (S) and in particular overlapping portions or stacked portions are formed and transported away from the slicing region (31), there being a lighting device including at least one radiation source (17, 19, 21) for the illumination of the slicing region (31), a detection device (23) for illuminating radiation reflected from the cut surfaces (13) of the respective slices (S) to be cut off from the product (11) and from the marginal region (15) of the slices (S), and an evaluation device (25) for the evaluation of the detected radiation, characterized in that the lighting device includes only radiation sources which are arranged in the half space disposed in front of the slicing region (31) and with which the illumination can be effected in a plurality of illumination components (K) from different directions. 89. An apparatus in accordance with claim 88, characterized in that at least some illumination components (K) can be effected simultaneously with the lighting device. 90. An apparatus in accordance with claim 88, characterized in that at least some illumination components (K) can be effected after one another timewise with the lighting device. 91. An apparatus in accordance with claim 88, characterized in that the lighting device is made for the transmission of radiation of different wavelengths (λ). 92. An apparatus in accordance with claim 88, characterized in that the lighting device is made for the transmission of radiation of different intensities (I). 93. An apparatus in accordance with claim 88, characterized in that the lighting device is made for the transmission of radiation of different polarization properties (P). 94. An apparatus in accordance with claim 88, characterized in that the lighting device includes precisely one radiation source. 95. An apparatus in accordance with claim 88, characterized in that the lighting device includes a plurality of radiation sources (17, 19, 21) spatially separate from one another. 96. An apparatus in accordance with claim 88, characterized in that at least one radiation source (17, 19), or each radiation source (17, 19) is arranged in the half space disposed in front of the slicing region (31). 97. An apparatus in accordance with claim 96, characterized in that at least one radiation source (17) is arranged beneath the product support surface (27) and is in particular of an elongate shape extending transversely to the product conveying direction (T). 98. An apparatus in accordance with claim 88, characterized in that the lighting device includes a luminous frame or luminous tunnel (21) arranged at least partly in the slicing region (31) and partly or fully surrounding the product (11) in operation. 99. An apparatus in accordance with claim 98, characterized in that the lighting device includes, in addition to the luminous frame or luminous tunnel (21), at least one radiation source (17, 19) arranged in the half space disposed in front of the slicing region (31). 100. An apparatus in accordance with claim 88, characterized in that the radiation source (17, 19, 21) is movable for the changing of the lighting direction. 101. An apparatus in accordance with claim 88, characterized in that the detection device (23) includes at least one sensor which is associated with a plurality of illumination components (K) and in particular with all illumination components (K). 102. An apparatus in accordance with claim 88, characterized in that at least one sensor of the detection device (23) is provided for the simultaneous detection of radiation of different wavelengths (λ) and is in particular provided in the form of a color camera. 103. An apparatus in accordance with claim 88, characterized in that the detection device (23) includes a plurality of individual sensors which are associated with different illumination components (K). 104. An apparatus in accordance with claim 88, characterized in that individual sensors of the detection device (23) are provided in each case in the form of a black and white camera provided with filter devices. 105. An apparatus in accordance with claim 88, characterized in that at least one sensor of the detection device (23) can be read out repeatedly in accordance with a time sequence of illumination components (K). 106. An apparatus in accordance with claim 88, characterized in that a plurality of individual sensors of the detection device (23) can be read out after one another timewise in accordance with a time sequence of illumination components (K). |
Total synthesis of galanthamine, analogues and derivatives thereof |
The invention relates to a method for the synthesis of galanthamine, the derivatives and analogues thereof of formula (1) where R1=a hydrogen atom. R2=a hydroxy group, R1 and R2 together form =0, R3, R4, and R5 independently=a hydrogen atom, a hydroxy group or a (C1-C2) alkoxy group, R6-11 , (C1-C12) alkyl, (CH2)nNR7R8, or —(CH2)nN′R7R8R9 where n−1 to 12 Z=two hydrogen atoms, or an oxygen atom and X=an oxygen, sulphur or nitrogen atom, or a —SO, —SO2, or —NR6 group where R6 is as defined above or is an amine protecting group. |
1. A method of synthesizing compounds of formula (1) in which either R1 represents a hydrogen atom and R2 represents a hydroxyl group, or R1 and R2 together form =0, R3, R4 and R5 represent each independently of one another a hydrogen atom, a hydroxyl group or a (C1-C12)alkoxy group, R6 represents a hydrogen atom, a (C1-C12)alkyl group, a group —(CH2)nNR7R8 or a group —(CH2)nN+R7R8R9 where n=1 to 12, R7 and R8 represent each independently of one an hydrogen atom; a cyano; (C1-C4)alkyl; aryl(C1-C4)alkyl; aryl(C1-C4)alkenyl; (C1-C4)alkyl-carbonyl or arylcarbonyl radical; the alkyl, alkenyl, and aryl radicals being optionally substituted by one or more identical or different radicals selected from halo, hydroxyl, alkoxy, alkylthio, acyl, free, salt-form or esterified carboxyl, cyano, nitro, mercapto or amino radicals, the amino radical being itself optionally substituted by one or more identical or different alkyl radicals; or R7 and R8 are linked to each other and form, together with the nitrogen atom to which they are attached, a hetrocycle; and R9 represents a hydrogen atom or a cyano, (C1-C4)alkyl, aryl(C1-C4)alkyl, aryl(C1-C4)alkenyl, alkylcarbonyl or arylcarbonyl radical, the alkyl, alkenyl, and aryl radicals being optionally substituted by one or more identical or different radicals selected from halo, hydroxyl, alkoxy, alkylthio, acyl, free, salt-form or esterified carboxyl, cyano, nitro, mercapto or amino radicals, the amino radical being itself optionally substituted by one or more identical or different alkyl radicals; Z represents either two hydrogen atoms or one oxygen atom, and X represents alternatively an oxygen atom or a sulfur atom or a nitrogen atom or an -SO group or an —SO2 group or a group —NR6 where R6 is as defined above or represents an amine-protective group, characterized in that it comprises a step in which an α,β-ethylenic ketone of formula (10) is oxidized to a spirodienone of formula (11), 2. A method according to claim 1, characterized in that the oxidation is performed in the presence of benzeneselininic anhydride mixed with a support, preferably an inorganic support. 3. A method according to claim 1, characterized in that the support is selected from the group consisting of molecular sieves and mixtures of silica and alumina. 4. A method according to claim 3, characterized in that the mixture of silica and alumina is a 50/50 mixture. 5. A method according to claim 1, characterized in that a derivative of formula (6) in which Hal represents a halogen atom selected from bromine and iodine atoms, R3, R4, and R5 are as defined in claim 1, and R10 represents an amine group or a hydroxyl group is reacted with (1,4-dioxaspiro[4.5]dec-7-en-8-yl)acetic acid of formula (7), and a compound of formula (8) is obtained which is cyclized by an intramolecular Heck reaction to give a compound of formula (9) in the presence of a palladium or a palladium(0) precursor catalyst and of bidentate alkylphosphine ligands in a solvent, then the dioxolane function of the compound of formula (9) is deprotected to give the α,β-ethylenic ketone of formula (10) which is oxidized in the presence of benzeneseleninic anhydride, to which a mixture, preferably 50/50, of silica and alumina has been added, to give a compound of formula (11) which is reacted with an amine of formula NHR6 where R6 is as defined in claim 1 to give, by opening of the lactone, the corresponding amide of formula (12) which is cyclized to give a compound of formula (1a), which is optionally subjected to a diastereoselective reduction to give the corresponding derivative of formula (1b), whose amide function can also be reduced, if desired, to give a compound of formula (1c) 6. A method according to claim 5, characterized in that the compound of formula (12) is resolved and then the synthesis is continued to give the compounds of formula (la) to (1c) in their optically active forms. 7. A method according to claim 5, characterized in that the compound of formula (la) is resolved and then the synthesis is continued to give the compounds of formula (1b) to (1c) in their optically active forms. 8. A method according to claim 1, characterized in that galanthamine is prepared in the form of the racemate or of its optically pure isomers. 9. Compounds of formulae (11) and (12) in which R3, R4, R5, R6, and X are as defined in claim 1, useful as synthesis intermediates in a method according to claim 1. 10. Compounds according to claim 9, characterized in that R3═OCH3, R4═R5═H and X═O, NH or N—CH3. 11. Compounds of formulae (8) and (9) in which Hal, R3, R4, and R5 are as defined in claim 1 and X represents alternatively a sulfur atom or a nitrogen atom or an —SO group, an —SO2 group or a group —NR6 where R6 is as defined in claim 1 or represents an amine-protective group. 12. Compounds according to claim 11, characterized in that Hal=I, R3═OCH3, R4═R5═H and X═NH or N—CH3. |
Agents for Treating Diseases Caused by Nonsense Mutations |
The present invention comprises compositions for treating diseases caused by nonsense mutations, including dipeptide antibiotics of Formula (I) shown below, such as negamycin. Unlike aminoglycoside antibiotics such as gentamicin, dipeptide antibiotics can induce the expression of mature proteins by readthrough nonsense mutations without generating serious side effects. |
1. A composition comprising a dipeptide antibiotic for treating a disease caused by a nonsense mutation. 2. The composition of claim 1, wherein the dipeptide antibiotic is the compound of Formula (I) shown below, or an analog of said compound that can promote readthrough of the nonsense mutation. 3. The composition of claim 1 or 2, wherein the disease caused by the nonsense mutation is selected from the group consisting of muscular dystrophy, cystic fibrosis, Hurler's disease, and infantile neuronal ceroid lipofuscinosis. |
<SOH> BACKGROUND ART <EOH>Many genetic diseases are caused by premature stop mutations in human genes, which result in premature termination of translation and the generation of truncated, inactive, and unstable products (Atkinson, J., and Martin, R. (1994) Mutations to nonsense codons in human genetic disease: implications for gene therapy by nonsense suppressor tRNAs. Nucleic Acid. Res. 22, 1327-1334). An example is Duchenne muscular dystrophy (DMD), an X-linked recessive disorder characterized by a lack of dystrophin protein in sarcolemma (plasma membranes of striated muscle fibres), which affects one in 3,500 males. The mdx mouse is an animal model for DMD used for identifying diseases caused by stop mutations, and for developing methods for treating such diseases. The mdx mouse has a nonsense mutation ( C AA to T AA) at the 3,185 th nucleotide of the dystrophin gene. This nonsense mutation produces a stop codon at exon 23 (Bulfiled, G., Siller, W. G., Weight, P. A., Moore, K. J. (1989) X chromosome-linked muscular dystrophy (mdx) in the mouse. Proc. Natl. Acad. Sci. USA 81, 1189-1192; Sicinski, P., Geng, Y., Ryder-Cook, A. S., Barnard, E. A., Darlison, M. G., Barnard, P. J. (1989) The molecular basis of muscular dystrophy in the mdx mouse. Science 244, 1578-1582). The stop codon causes premature termination of protein synthesis and thus inhibits the expression of dystrophin and dystrophin-associated glycoprotein complex. This results in a deficiency of these proteins in the muscle cell membrane. Explicit translocations (mainly, deletions or duplications) of the dystrophin gene are found in 65% of young male patients affected by DMD. However, the remaining 35% have nonsense mutations or other point mutations which affect mRNA splicing. So far, pharmacological therapy for DMDpatients andmdx mice has consisted of corticosteroids such as prednisone and deflazacort, or azathioprine, an agent used to reduce corticosteroid use. However, the use of corticosteroids is associated with side effects, and thus they can be used to advantage only for a short time (Granchelli, J. A., Pollina, C., Hudecki, M. S. (2000) Pre-clinical screening of drugs using the mdx mouse. Neuromuscular Disorders. 10, 235-239; Griggs, R. C., Moxley, R. T 3 rd ., Mendell, J. R., Fenichel, G. M., Brooke, M. H., Pestronk, A., Miller, J. P., Cwik, V. A., Pandya, S., and Robinson, J. (1993) Duchenne dystrophy: randomized, controlled trial of prednisone (18 months) and azathioprine. Neurology 43, 520-527). Thus, identifying a clinically useful method for suppressing premature stop mutations in the dystrophin gene will benefit a significant number of DMD patients. In recent years, the possibility of chemotherapy which targets nonsense mutations has been gaining strength. Gentamicin (GM) is an aminoglycoside antibiotic that decreases the fidelity of translation and provides a readily accessible treatment for diseases caused by nonsense mutations. GM induces the suppression of stop codons during translation in both prokaryotic and eukaryotic cells. GM is already being used in clinical trials using cells from patients with cystic fibrosis, Hurler's disease, and infant neuronal ceroidlipofuscinosis, all caused by nonsense mutations. Moreover, it is reported that GM restores dystrophin function in drug-treated mdx mice (Barton-Davis, E. R., Cordiner, L., Shoturma, D. I., Leiland, S. E., Sweeney, H. L. (1999) Aminoglycoside antibiotics restore dystrophin function to skeletal muscles of mdx mice. J. Clin. Invest. 104, 375-381). Thus, GM is currently undergoing clinical trials for Duchenne and limb girdle muscular dystrophy. However, like other aminoglycoside antibiotics, GM tends to cause many side effects such as kidney disorders and hearing loss. Furthermore, the long-term use of a single agent promotes the emergence of bacteria resistant to that agent. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 depicts photographs showing the presence of dystrophin expression and rates of muscle degeneration in Negamycin-treated and untreated mdx TA muscles. Immunofluorescence and EBD stainings were carried out as described in Materials and Methods. Panels A, C, and E are the results of immunofluorescent staining using B10 control mice, untreated mdx mice, and NM-treated mdx mice respectively. Panels B, D, and F are EBD staining patterns of B10 control mice, untreated mdx mice, and NM-treated mdx mice respectively. The bar=100 μm. FIG. 2 is a graph that shows the ratio of the expression level of dystrophin (immunofluorescence-positive fiber) and degenerated muscle fiber (EBD dye-positive fiber) in TA muscle fibers of antibiotic-treated mice. The black bar (referred to as “dys” in this figure) indicates the ratio of dystrophin positive fibers; the gray bar (referred to as “EB” in this figure) indicates the ratio of Evans Blue-positive fibers. “NM” indicates mdx mice (seven week-old, six individuals) that were injected with NM in PBS at a dose of 1.2×10 −5 mol/kg/day subcutaneously for two weeks; “GM” indicates mdx mice (seven week-old, six individuals) that were injected with GM in PBS at a dose of 1.2×10 −5 mol/kg/day subcutaneously for two weeks. PBS (0.1 ml) alone was injected to control “mdx” mice (n=6) and C57BL/10 (“B10”) (n=6) mice. About 350-550 muscle fibers were counted in each mouse (n=6). The bar indicates the mean±standard deviation. FIG. 3 depicts photographs showing the result of immunoblotting analysis for dystrophin expression. Panel (1) shows immunoblotting results for dystrophin expressed in B10 control mice (lanes A, B, and C); control mdx mice (lane D, E, and F); and NM-treated mdx mice (lane G, H, and I). Panel (1) shows, from the left, Dystrophin expression in hind leg muscles (lanes A, D, and G), the diaphragm (lanes B, E, and H), and cardiac muscles (lanes C, F, and I) of each mouse. Panel (2) shows the immunoblotting results for dystrophin expressed in hind leg muscles. Lane A shows NM-treated mdx mice; lane B, a sample buffer; lane C, NM-treated mdx mice (×100 of lane A); lane D, NM-untreated control mdx mice; and lane E, B10 control mice. FIG. 4 depicts photographs showing the expression of dystrophin in cultured mdx skeletal muscle cells (mdx-sk). Panels C and D show the expression of dystrophin in the cells presented in panels A and B, respectively. Panel A shows NM (50 μg/ml negamycin)-treated myotubes observed under a phase contrast microscope; panel B, NM-untreated myotubes observed under a phase contrast microscope; panel C, NM (50 μg/ml negamycin)-treated myotubes stained with dystrophin; panel D, NM-untreated myotubes stained with dystrophin. The bar=40 μm. FIG. 5 depicts photographs showing the results of immunoblotting for dystrophin (427 kDa) in cultured mdx skeletal muscle cells (mdx-sk). Lanes Aand B show results for myotubes treated with NM (100 μg/ml) for seven days; lane C shows results for untreated mdx myotubes; and lane D for C2C12 myotubes. FIG. 6 is a graph that shows weight changes of mdx mice during NM administration. Negamycin-treated mdx mice at a dose of 1.2×10 −5 mol/kg (NM1: solid diamond); 1.2×10 −4 mol/kg (NM10: solid square); 6.0×10 −4 mol/kg (NM50: solid triangle); 1.2×10 −3 mol/kg (NM100: X); and NM-untreated control mdx mice (solid line and solid square). FIG. 7 shows the result of a hearing test based on auditory brain stem response in antibiotic-treatedmice. A, B, and C show the results for antibiotic-untreated mice, NM-treated mice and GM-treated mice respectively. detailed-description description="Detailed Description" end="lead"? |
Data storage device |
A data storage device including a non-volatile semiconductor memory and an attribute information storage unit. In an attribute information storage unit of the data storage device, there are stored the number of sectors in one block and the information indicating the logical address of a sector lying at a block boundary. A host device, on which is mounted the data storage device, grasps the number of clusters that make up one block in the data storage device and the location of the leading cluster position of the block and records the data on the block basis. |
1. A removable data storage device detachably mounted to a host apparatus, comprising a non-volatile semiconductor memory in which data recorded thereon is erased batch-wise in terms of a block of a predetermined data volume as a unit; and a system information storage unit having the inner information of the data storage device recorded therein; wherein a user area, as an area in which data is recorded by a user, is provided in a storage area of said semiconductor memory; file management data corresponding to the logical format supervising the recorded data by setting logical addresses from one sector as a data read/write unit to another and also supervising the relationship of interconnection of the recorded data in terms of a cluster, composed of a predetermined number of physically consecutive sectors, as a unit, is recorded in said user area, said user area being accessed by the host apparatus based on said logical format; and wherein the number of sectors in one block and the information indicating the logical address of the sector of the block boundary position are stored in said system information storage unit. 2. The data storage device according to claim 1 wherein the block size is n times the cluster size, where n is an integer not less than 2, and wherein the logical format is formed so that the leading sector of each block in the user area is coincident with the leading sector of said cluster. 3. The data storage device according to claim 2 wherein said file management data is made up by a master boot record (MBR), recorded in a sector of a leading logical address of said user area, a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR, and a route directory entry recorded across a plurality of sectors beginning from the sector of the next logical address to each FAT; said MBR stating the logical address of the sector where the PBR has been recorded; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; said entity data recorded in each partition being recorded as from a sector next following the route directory entry. 4. The data storage device according to claim 2 wherein said file management data is made up by a partition boot record (PBR), recorded in a sector of a leading logical address in said user area, a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR, and a route directory entry recorded across a plurality of sectors beginning from the sector of the next logical address to each FAT; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; said entity data recorded in each partition being recorded as from a sector next following the route directory entry. 5. The data storage device according to claim 2 wherein said file management data is made up by a master boot record (MBR), recorded in a sector of a leading logical address of said user area, a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, and a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR; said MBR stating the logical address of the sector where the PBR has been recorded; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; recording being made as from a sector next following the route directory entry. 6. The data storage device according to claim 4 wherein said logical format is set so that a recording area for the interconnection information for n consecutive clusters recorded in one block is formed in a self-complete form in one sector. 7. The data storage device according to claim 6 wherein a logical sector for recording the PBR is stored in said system information storage unit. 8. The data storage device according to claim 1 wherein said system information storage unit is formed on a recording area of said semiconductor memory. 9. A host device on which is detachably mounted a removable data storage device, said host device comprising a host side interface for accessing said data recording device; wherein said data storage device including a non-volatile semiconductor memory in which data recorded thereon is erased batch-wise in terms of a block of a predetermined data volume as a unit; and a system information storage unit having the inner information of the host device recorded therein; wherein a user area, as an area in which data is recorded by a user, is provided in a storage area of said semiconductor memory; file management data corresponding to the logical format supervising the recorded data by setting a logical address from one sector as a data read/write unit to another and also supervising the relationship of interconnection of the recorded data in terms of a cluster, composed of a predetermined number of physically consecutive sectors, as a unit, is recorded in said user area; wherein the number of sectors in one block and the information indicating the logical address of the sector lying at the block boundary position are stored in said system information storage unit, and wherein said host side interface accesses the data storage device based on said logical format. 10. The host device according to claim 9 wherein the block size is n times the cluster size, where n is an integer not less than 2, and wherein the logical format is formed so that the leading sector of each block in the user area is coincident with the leading sector of said cluster. 11. The host device according to claim 10 wherein said file management data is made up by a master boot record (MBR), recorded in a sector of a leading logical address of said user area, a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR, and a route directory entry recorded across a plurality of sectors beginning from the sector of the next logical address to each FAT; said MBR stating the logical address of the sector where the PBR has been recorded; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; said entity data recorded in each partition being recorded as from a sector next following the route directory entry. 12. The host device according to claim 10 wherein said file management data is made up by a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following the PBR, and a route directory entry recorded across a plurality of sectors beginning from the sector of the next logical address to the FAT; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; said entity data recorded in each partition being recorded as from a sector next following the route directory entry. 13. The host device according to claim 10 wherein said file management data is made up by a master boot record (MBR), recorded in a sector of a leading logical address of said user area, a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, and a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR; said MBR stating the logical address of the sector where the PBR has been recorded; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; recording being made as from a sector next following the route directory entry. 14. The host device according to claim 12 wherein said logical format is set so that a recording area for the interconnection information for n consecutive clusters recorded in one block is formed in a self-complete form in one sector. 15. The host device according to claim 14 wherein a logical sector for recording the PBR is stored in said system information storage unit of the data storage apparatus. 16. The host device according to claim 9 wherein said system information storage unit is formed on a recording area of a semiconductor memory. 17. A data recording system having a host device and a removable data storage device detachably mounted to the host device, wherein said data storage device includes a non-volatile semiconductor memory in which data recorded thereon is erased batch-wise in terms of a block of a predetermined data volume as a unit, and a system information storage unit having the inner information of the data storage device recorded therein; wherein a user area, as an area in which data is recorded by a user, is provided in a storage area of said semiconductor memory; file management data corresponding to the logical format supervising the recorded data by setting logical addresses from one sector as a data read/write unit to another and also supervising the relationship of interconnection of the recorded data in terms of a cluster, composed of a predetermined number of physically consecutive sectors, as a unit, is recorded in said user area; and wherein the number of sectors in one block and the information indicating the logical address of the sector of the block boundary position are stored in said system information storage unit. 18. The data recording system according to claim 17 wherein the block size is n times the cluster size, where n is an integer not less than 2 and wherein the logical format is formed so that the leading sector of each block in the user area is coincident with the leading sector of said cluster. 19. The data recording system according to claim 18 wherein said file management data is made up by a master boot record (MBR), recorded in a sector of a leading logical address of said user area, a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR, and a route directory entry recorded across a plurality of sectors beginning from the sector of the next logical address to each FAT; said MBR stating the logical address of the sector where the PBR has been recorded; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; said entity data recorded in each partition being recorded as from a sector next following the route directory entry. 20. The data recording system according to claim 18 wherein said file management data is made up by a partition boot record (PBR), recorded in a sector of a leading logical address of said user area, a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following said PBR, and a route directory entry recorded across a plurality of sectors beginning from the sector of the next logical address to each FAT; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; said entity data recorded in each partition being recorded as from a sector next following the route directory entry. 21. The data recording system according to claim 18 wherein said file management data is made up by a master boot record (MBR), recorded in a sector of a leading logical address of said user area, a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, and a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR; said MBR stating the logical address of the sector where the PBR has been recorded; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; recording being made as from a sector next following the route directory entry. 22. The data recording system according to claim 20 wherein said logical format is set so that a recording area for the interconnection information for n consecutive clusters recorded in one block is formed in a self-complete form in one sector. 23. The data recording system according to claim 22 wherein a logical sector for recording the PBR is stored in said system information storage unit. 24. The data recording system according to claim 17 wherein said system information storage unit is formed on a recording area of a semiconductor memory. 25. A data management method for a removable data storage device detachably mounted to a host apparatus, said data storage device comprising a non-volatile semiconductor memory in which data recorded thereon is erased batch-wise in terms of a block of a predetermined data volume as a unit, and a system information storage unit having the inner information of the data storage apparatus recorded therein; wherein a user area, as an area in which data is recorded by a user, is provided in a storage area of said semiconductor memory; file management data corresponding to the logical format supervising the recorded data by setting logical addresses from one sector as a data read/write unit to another and also supervising the relationship of interconnection of the recorded data in terms of a cluster, composed of a predetermined number of physically consecutive sectors, as a unit, is recorded in said user area, said user area being accessed by the host apparatus based on said logical format; and wherein the number of sectors in one block and the information indicating the logical address of the sector of the block boundary position are stored in said system information storage unit. 26. The data management method according to claim 25 wherein the block size is n times the cluster size, where n is an integer not less than 2, and wherein the logical format is formed so that the leading sector of each block in the user area is coincident with the leading sector of said cluster. 27. The data management method according to claim 26 wherein said file management data is made up by a master boot record (MBR), recorded in a sector of a leading logical address of said user area, a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR, and a route directory entry recorded across a plurality of sectors beginning from the sector of the next logical address to each FAT; said MBR stating the logical address of the sector where the PBR has been recorded; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; said entity data recorded in each partition being recorded as from a sector next following the route directory entry. 28. The data management method according to claim 26 wherein said file management data is made up by a partition boot record (PBR), recorded in a sector of a leading logical address of each partition formed in said user area, a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following said PBR, and a route directory entry recorded across a plurality of sectors beginning from the sector of the next logical address to said FAT; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; said entity data recorded in each partition being recorded as from a sector next following the route directory entry. 29. The data management method according to claim 26 wherein said file management data is made up by a master boot record (MBR), recorded in a sector of a leading logical address of said user area, a partition boot record (PBR), recorded in a sector of a leading logical addresss of each partition formed in said user area, and a file allocation table (FAT) recorded across a plurality of sectors beginning from the sector of the logical address next following each PBR; said MBR stating the logical address of the sector where the PBR has been recorded; said PBR stating the information pertinent to the partition where said PBR has been recorded; said FAT having formed, in association with the totality of the clusters in the partition, an area for storage of the interconnection information specifying the cluster connected next to a cluster in question; said route directory entry stating the entry information for a file arranged in the uppermost directory and a subdirectory; recording being made as from a sector next following the route directory entry. 30. The data management method according to claim 28 wherein said logical format is set so that a recording area for the interconnection information for n consecutive clusters recorded in one block is formed in a self-complete form in one sector. 31. The data management method according to claim 30 wherein a logical sector for recording the PBR is stored in said system information storage unit. 32. The data management method according to claim 25 wherein said system information storage unit is formed on a recording area of a semiconductor memory. |
<SOH> BACKGROUND ART <EOH>Up to now, as an electrically erasable non-volatile memory, a NAND flash memory has been in use. With this sort of the NAND flash memory, new data is written as data recorded therein has been erased. The flash memory is provided with an erasure block for batch-wise data erasure and, after the recorded data has been erased on the erasure block basis, new data is written in the memory. With the flash memory, the size of the erasure block differs from that of the data write unit (physical sector) such that plural physical sectors are provided in one erasure block. In the flash memory, data needs to be recorded towards a physically fixed direction in one erasure block. The reason in that, in case data has been recorded in an optional physical sector in the erasure block, the contents of the recorded data are kept as for the sectors lying in a fixed direction from the sector of interest, while the contents of the recorded data are not necessarily kept as for the sectors lying in the opposite direction from the sector of interest. Thus, with the flash memory, the routine practice is to set the physical addresses and the logical addresses in such a manner that, if the data are recorded in a forward direction, the contents of the recorded data are necessarily assured. Meanwhile, the contents of data recorded in an erasure block different from the erasure block as a subject of recording are assured at all times without dependency on the data recording position. As a form of application of this NAND flash memory, there is known a removable small-sized IC memory, termed a memory card. The memory card is able to store a large variety of digital data, such as still image data, moving picture data, speech data or music data. For this reason, the memory card is used as an external storage medium in a wide variety of host devices, such as a portable information terminal, a desk top computer, a notebook computer, a mobile phone, an audio device or a household electrical device. The host device, employing the memory card as an external storage medium, is sometimes provided with an internal storage medium, such as a hard disc. The hard disc is usually accessed with a logical format from the host device, using a file system, called the MS-DOS (trademark), as a vehicle. For compatibility to such other storage mediums, the common file system, including the MS-DOS, is desirably applicable to the memory card. The MS-DOS provides for a unit, termed a cluster, as an accessing unit for a storage medium. The MS-DOS generates the FAT (file allocation table), in terms of this cluster, as a unit, to oversee the relationship of interconnections of data recorded in the storage medium. Thus, the host device logically accesses the storage medium, on the cluster basis, to read out data recorded on the storage medium, or to write data on the storage medium. Meanwhile, in the conventional memory card, the flash memory has a smaller capacity, with the cluster size coinciding with the erasure block size. Thus, as long as data is recorded on the cluster basis, the contents of the recorded data are kept, without dependency on the sort of the recording performed. However, as the capacity of the flash memory is increased and, in keeping up therewith, the erasure block is increased in size, the cluster size of a memory card employing a flash memory of an increased capacity becomes smaller than the erasure size, if the MS-DOS is used in the file system. When the cluster size is smaller than the erasure block size, and data recording is made on the cluster basis, there is a possibility that the contents of the recorded data may not necessarily be kept. For keeping the contents of the recorded data, in the memory card employing the flash memory of an increased capacity, the processing for producing a memory area, termed a garbage collection, is carried out, in case the represented cluster is located in rear of the cluster as the subject of writing. Specifically, the garbage collection in the memory card is carried out as follows: When data is to be written in a certain cluster in an erasure block, it is verified whether or not there is any recorded valid data in a cluster the address for which is on the rear side of the address of the cluster as a subject of writing in the erasure block. In case the recorded valid data is located in a cluster the address for which is on the rear side with respect to the address of the cluster as the subject of writing in the erasure block, all data in the erasure block, with the exception of the data of the cluster of interest, are temporarily read out to a buffer. A new erasure block is produced and data corresponding to the synthesis of the data in the buffer and the data as the subject of writing is written in the so produced new erasure block. This processing is the processing of garbage collection performed in the memory card. The garbage collection is routinely executed in the CPU in the memory card and hence is not recognized by the operating system of the host device. In this manner, redundant operations, such as data readout and buffering, need to be performed in the garbage collection in the memory card, despite the fact that the processing is carried out at the time of recording. As a consequence, the speed of recording between the host device and the memory card is lowered on the occasion of the occurrence of the garbage collection. It is therefore inherently desirable that data recording may be made at all times without producing garbage collection. For not producing the garbage collection, it is sufficient if the physical address in the memory is directly supervised from the host side in the course of data writing. However, with the MS-DOS, the medium is not managed by the physical address, so that, for directly accessing the physical addresses in the memory, it is necessary to apply a special file system different from the MS-DOS. This, however, is not desirable because compatibility with other mediums may not be maintained with such special file system. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 is a perspective view showing a memory card embodying the present invention and a host device employing this memory card. FIG. 2 is a perspective view showing the memory card from its front side. FIG. 3 is a perspective view showing the memory card from its rear side. FIG. 4 is a block diagram showing an internal block structure of the memory card. FIG. 5 shows the structure of the interfacing functions for data transfer between the memory card and the host device. FIG. 6 shows a data structure recorded in an attribute information area. FIG. 7 is a flowchart showing data recording processing contents of the host device. FIG. 8 depicts an image of a medium in case the format of a first specified instance is applied. FIG. 9 depicts the values of the parameters in case the format of the first specified instance is applied. FIG. 10 depicts the contents of description of MBR in case the format of the first specified instance is applied. FIG. 11 depicts the contents of description of PBR in case the format of the first specified instance is applied. FIG. 12 depicts an image of a medium in case the format of a second specified instance is applied. FIG. 13 depicts values of respective parameters in case the format of the second specified instance is applied. FIG. 14 depicts the contents of description of MBR in case the format of the second specified instance is applied. FIG. 15 depicts the contents of description of MBR in case the format of the second specified instance is applied. FIG. 16 depicts the state of the FAT in case the format of the first specified instance is applied. FIG. 17 depicts the state of the FAT in case the format of the second specified instance is applied. FIG. 18 depicts an image of a medium of a routine format. FIG. 19 depicts an image of a medium of a memory card in which the cluster size is smaller than the block size. FIG. 20 depicts an image of a medium of a memory card in which the block size is equal to the cluster size. detailed-description description="Detailed Description" end="lead"? |
Methods and apparatus for signal distortion correction |
The digital predistorter multiplies the input signal with coefficients obtained from look-up tables. To reduce the amount of storage required, the coefficients are stored in partial form and are either reconstituted by addition of a constant (44, FIG. 3b) prior to application to the input signal or the retrieved coefficients are applied directly to the input signal and the resulting modified signal is then combined with the original input signal (34, FIG. 2a). |
1-28. (canceled) 29. A method for applying adjustments to signal processing associated with signal handling equipment, the method comprising: retrieving partial coefficients corresponding to portions of complete coefficients associated with the adjustments; and applying the partial coefficients to generate the adjustments, wherein corrections are made for the use of the partial coefficients to give the effect that the adjustments have been generated by retrieving and applying complete coefficients. 30. The invention of claim 29, wherein: the signal handling equipment comprises one or more amplifiers; and the adjustments to the signal processing reduce distortion in an output signal produced by the one or more amplifiers. 31. The invention of claim 29, wherein the adjustments to the signal processing correspond to at least one of predistortion of an input signal prior to application to the signal handling equipment and feed-forward distortion correction of an output signal generated by the signal handling equipment. 32. The invention of claim 31, wherein the adjustments to the signal processing correspond to the predistortion of the input signal prior to application to the signal handling equipment. 33. The invention of claim 29, wherein: the corrections correspond to a linear part of the adjustments; and the partial coefficients correspond to deviations from the linear part. 34. The invention of 33, wherein: the linear part corresponds to a coefficient value of one; and the partial coefficients correspond to deviations of the complete coefficients from the coefficient value of one. 35. The invention of claim 29, wherein: the partial coefficients are applied to a first digital part of an input signal to generate partial adjustments; and the partial adjustments are combined with complementary adjustments, wherein the complementary adjustments correct for the use of the partial coefficients during the generation of the partial adjustments. 36. The invention of claim 35, wherein the first digital part of the input signal corresponds to an in-phase component I of the input signal. 37. The invention of claim 29, wherein each partial coefficient is combined with a complementary coefficient prior to being applied to a first digital part of an input signal. 38. The invention of claim 37, wherein the first digital part of the input signal corresponds to an in-phase component I of the input signal. 39. The invention of claim 29, wherein: the partial coefficients are retrieved by applying indices to a lookup table; and at least one of the indices and the partial coefficients are filtered prior to generating the adjustments. 40. The invention of claim 39, wherein the filtering applies memory characteristics to the adjustments to the signal processing. 41. The invention of claim 39, wherein the filtering is applied to the indices prior to retrieving the partial coefficients. 42. The invention of claim 29, wherein: the partial coefficients correspond to partial adjustments of an in-phase component I of the input signal; a second set of coefficients corresponding to adjustment of a quadrature-phase component Q of the input signal is retrieved by applying the indices to another lookup table; a first filter is applied to at least one of the indices and the partial coefficients; and a second filter is applied to at least one of the indices and the second set of coefficients, wherein the first and second filters apply different memory characteristics to the adjustments to the signal processing. 43. The invention of claim 42, wherein the first and second filters are independently applied to the indices prior to retrieving the partial coefficients and the second set of coefficients, respectively. 44. An apparatus for applying adjustments to signal processing associated with signal handling equipment, the apparatus comprising: means for retrieving partial coefficients corresponding to portions of complete coefficients associated with the adjustments; and means for applying the partial coefficients to generate the adjustments, wherein the applying means is adapted to make corrections for the use of the partial coefficients to give an effect that the adjustments have been generated by retrieving and applying the complete coefficients. 45. An apparatus for applying adjustments to signal processing associated with signal handling equipment, the apparatus comprising: a first lookup table (LUT) adapted to store partial coefficients corresponding to portions of complete coefficients associated with the adjustments; and adjustment circuitry adapted to apply the partial coefficients to generate the adjustments, wherein the adjustment circuitry is adapted to make corrections for the use of the partial coefficients to give an effect that the adjustments have been generated by retrieving and applying the complete coefficients. 46. The invention of claim 45, wherein: the signal handling equipment comprises one or more amplifiers; and the adjustment circuitry is adapted to reduce distortion in an output signal produced by the one or more amplifiers. 47. The invention of claim 45, wherein the adjustments to the signal processing correspond to at least one of predistortion of an input signal prior to application to the signal handling equipment and feed-forward distortion correction of an output signal generated by the signal handling equipment. 48. The invention of claim 47, wherein the adjustments to the signal processing correspond to the predistortion of the input signal prior to application to the signal handling equipment. 49. The invention of claim 45, wherein: the corrections correspond to a linear part of the adjustments; and the partial coefficients correspond to deviations from the linear part. 50. The invention of 49, wherein: the linear part corresponds to a coefficient value of one; and the partial coefficients correspond to deviations of the complete coefficients from the coefficient value of one. 51. The invention of claim 45, wherein the adjustment circuitry comprises: a first multiplier adapted to apply the partial coefficients retrieved from the first LUT to a first digital part of an input signal to generate partial adjustment components; and one or more combiners (34) adapted to combine a signal corresponding to the partial adjustment components with the input signal to generate the adjustments. 52. The invention of claim 51, wherein the adjustment circuitry further comprises: a second LUT adapted to store a second set of coefficients associated with the adjustments; and a second multiplier adapted to apply the second set of coefficients retrieved from the second LUT to a second digital part of the input signal to generate second adjustment components, wherein: the one or more combiners are adapted to combine the partial adjustment components, the second adjustment components, and the input signal to generate the adjustments. 53. The invention of claim 52, wherein: the first LUT is adapted to store partial I coefficients; and the second LUT is adapted to store Q coefficients. 54. The invention of claim 53, wherein: the partial I coefficients and the Q coefficients are retrieved from the first and second LUTs based on indices; and the adjustment circuitry further comprises: a first filter adapted to filter at least one of the indices and the partial I coefficients; and a second filter adapted to filter at least one of the indices and the Q coefficients, wherein the first and second filters are adapted to apply different memory characteristics to the adjustments. 55. The invention of claim 54, wherein the first and second filters are independently applied to the indices prior to retrieving the partial I coefficients and the Q coefficients, respectively. 56. The invention of claim 45, wherein the adjustment circuitry comprises: a first combiner adapted to combine the partial coefficients retrieved from the first LUT with a constant to generate the complete coefficients; and a first multiplier adapted to apply the complete coefficients to a first part of an input signal to generate first adjustment components for the adjustments. 57. The invention of claim 56, wherein the adjustment circuitry further comprises: a second LUT adapted to store a second set of coefficients associated with the adjustments; a second multiplier adapted to apply the second set of coefficients retrieved from the second LUT to a second digital part of the input signal to generate second adjustment components for the adjustments; and a second combiner adapted to combine the first and second adjustment components to generate the adjustments. 58. The invention of claim 57, wherein: the first lookup table is adapted to store partial I coefficients; and the second lookup table is adapted to store Q coefficients. 59. The invention of claim 58, wherein: the partial I coefficients and the Q coefficients are retrieved from the first and second LUTs based on indices; and the adjustment circuitry further comprises: a first filter adapted to filter at least one of the indices and the partial I coefficients; and a second filter adapted to filter at least one of the indices and the Q coefficients, wherein the first and second filters are adapted to apply different memory characteristics to the adjustments. 60. The invention of claim 59, wherein the first and second filters are independently applied to the indices prior to retrieving the partial I coefficients and the Q coefficients, respectively. 61. The invention of claim 45, wherein: the partial coefficients are retrieved from the first LUT based on indices; and the adjustment circuitry further comprises a filter adapted to filter at least one of the indices and the partial coefficients. 62. The invention of claim 61, wherein the filter is adapted to apply memory characteristics to the adjustments. 63. The invention of claim 61, wherein the filter is applied to the indices prior to retrieving the partial coefficients. |
Control scheme for signal processing arrangement |
The control scheme uses the input and output signals of an amplifier (10) to control a lineariser (24) operating on the amplifier (10). The input and output signals are sensed and used to develop assay signals that have ideal inter-relationships when the amplifier is operating as desired. The control scheme modifies the operation of the lineariser to account for any departures observed in the relationships. |
1-21. (canceled) 22. An apparatus for controlling distortion counteracting equipment, said counteracting equipment operating to ameliorate distortion in an output signal produced by signal handling equipment in response to an input signal, the apparatus comprising: an input preprocessor adapted to generate a sensed input signal based on the input signal; an output preprocessor adapted to generate a sensed output signal based on the output signal; and a controller adapted to produce at least two assay signals, the at least two assay signals comprising (1) an input envelope signal produced from the sensed input signal and (2) a first component correlation signal produced from the sensed input and output signals, wherein the at least two assay signals are for use in developing control signals for controlling the counteracting equipment. 23. The invention of claim 22, wherein: the signal handling equipment is an amplifier; and the counteracting equipment is a predistorter or a feed-forward arrangement adapted to linearize the output signal produced by the amplifier. 24. The invention of claim 22, wherein the first component correlation signal is produced through a difference of two products of component vectors of the sensed input and output signals. 25. The invention of claim 24, wherein: the component vector of the sensed input signal comprises in-phase component Iin and quadrature-phase component Qin; the component vector of the sensed output signal comprises in-phase component Iout and quadrature-phase component Qout; and the first component correlation signal is produced through a difference of (1) a product of Iin and Qout and (2) a product of Iout and Qin. 26. The invention of claim 22, wherein the first component correlation signal is produced through a sum of two products of component vectors of the sensed input and output signals. 27. The invention of claim 26, wherein: the component vector of the sensed input signal comprises in-phase component Iin and quadrature-phase component Qin; the component vector of the sensed output signal comprises in-phase component Iout and quadrature-phase component Qout; and the first component correlation signal is produced through a sum of (1) a product of Iin and Iout and (2) a product of Qin and Qout. 28. The invention of claim 22, wherein the controller is further adapted to assess a relationship between the input envelope signal and the first component correlation signal and to use departures of the relationship from a specified ideal relationship to develop the control signals to cause the counteracting equipment to ameliorate the departures. 29. The invention of claim 28, wherein the apparatus is adapted to time-align the sensed input and output signals before the relationship is assessed for departures. 30. The invention of claim 29, wherein the apparatus comprises: a fixed delay element adapted to apply a fixed delay to the sensed input signal; and a variable delay element adapted to apply a programmable delay to at least one of the sensed input signal and the sensed output signal, wherein the variable delay is adapted to be adjusted to time-align the sensed input and output signals. 31. The invention of claim 30, wherein the variable delay is adapted to be adjusted to minimize variance in the first component correlation signal to time-align the sensed input and output signals. 32. The invention of claim 28, further comprising a phase-alignment element adapted to phase-align the sensed input and output signals before the relationship is assessed for departures. 33. The invention of claim 32, wherein the phase-alignment element is part of a downconverter adapted to downconvert the sensed output signal. 34. The invention of claim 22, wherein the controller is further adapted to produce a second component correlation signal from the sensed input and output signals, wherein the input envelope signal and the first and second component correlation signals are for use in developing the control signals for controlling the counteracting equipment. 35. The invention of claim 34, wherein: the first component correlation signal is produced through a difference of two products of component vectors of the sensed input and output signals; and the second component correlation signal is produced through a sum of two products of the component vectors of the sensed input and output signals. 36. The invention of claim 35, wherein: the component vector of the sensed input signal comprises in-phase component Iin and quadrature-phase component Qin; the component vector of the sensed output signal comprises in-phase component Iout and quadrature-phase component Qout; the first component correlation signal is produced through a difference of (1) a product of Iin and Qout and (2) a product of Iout and Qin; and the second component correlation signal is produced through a sum of (1) a product of Iin and Iout and (2) a product of Qin and Qout. 37. The invention of claim 36, wherein the controller is further adapted to: assess a first relationship between the input envelope signal and the first component correlation signal and use departures of the first relationship from a specified first ideal relationship to develop a first control signal to cause the counteracting equipment to ameliorate the departures; and assess a second relationship between the input envelope signal and the second component correlation signal and use departures of the second relationship from a specified second ideal relationship to develop a second control signal to cause the counteracting equipment to ameliorate the departures. 38. The invention of claim 37, wherein: the first ideal relationship is a ratio of 1:0 between the input envelope signal and the first component correlation signal; and the second ideal relationship is a ratio of 1:1 between the input envelope signal and the second component correlation signal. 39. The invention of claim 38, wherein: the counteracting equipment is a predistorter adapted to predistort the input signal applied to the signal handling equipment; the first control signal is used to adjust predistortion of a quadrature-phase component of the input signal; and the second control signal is used to adjust predistortion of an in-phase component of the input signal. 40. A method for controlling distortion counteracting equipment, said counteracting equipment operating to ameliorate distortion in an output signal produced by signal handling equipment in response to an input signal, the method comprising: generating a sensed input signal based on the input signal; generating a sensed output signal based on the output signal; and producing at least two assay signals, the at least two assay signals comprising (1) an input envelope signal produced from the sensed input signal and (2) a first component correlation signal produced from the sensed input and output signals, wherein the at least two assay signals are for use in developing control signals for controlling the counteracting equipment. 41. The invention of claim 40, further comprising producing a second component correlation signal from the sensed input and output signals, wherein the input envelope signal and the first and second component correlation signals are for use in developing the control signals for controlling the counteracting equipment. 42. The invention of claim 41, wherein: the first component correlation signal is produced through a difference of two products of component vectors of the sensed input and output signals; and the second component correlation signal is produced through a sum of two products of the component vectors of the sensed input and output signals. 43. The invention of claim 42, wherein: the component vector of the sensed input signal comprises in-phase component Iin and quadrature-phase component Qin; the component vector of the sensed output signal comprises in-phase component Iout and quadrature-phase component Qout; the first component correlation signal is produced through a difference of (1) a product of Iin and Qout and (2) a product of Iout and Qin; and the second component correlation signal is produced through a sum of (1) a product of Iin and Iout and (2) a product of Qin and Qout. 44. The invention of claim 43, further comprising: assessing a first relationship between the input envelope signal and the first component correlation signal and using departures of the first relationship from a specified first ideal relationship to develop a first control signal to cause the counteracting equipment to ameliorate the departures; and assessing a second relationship between the input envelope signal and the second component correlation signal and using departures of the second relationship from a specified second ideal relationship to develop a second control signal to cause the counteracting equipment to ameliorate the departures. 45. The invention of claim 44, wherein: the first ideal relationship is a ratio of 1:0 between the input envelope signal and the first component correlation signal; and the second ideal relationship is a ratio of 1:1 between the input envelope signal and the second component correlation signal. 46. The invention of claim 45, wherein: the counteracting equipment is a predistorter adapted to predistort the input signal applied to the signal handling equipment; the first control signal is used to adjust predistortion of a quadrature-phase component of the input signal; and the second control signal is used to adjust predistortion of an in-phase component of the input signal. 47. An apparatus for controlling distortion counteracting equipment, said counteracting equipment operating to ameliorate distortion in an output signal produced by signal handling equipment in response to an input signal, the apparatus comprising: means for generating a sensed input signal based on the input signal; means for generating a sensed output signal based on the output signal; and means for producing at least two assay signals, the at least two assay signals comprising (1) an input envelope signal produced from the sensed input signal and (2) a first component correlation signal produced from the sensed input and output signals, wherein the at least two assay signals are for use in developing control signals for controlling the counteracting equipment. |
Removable cavity wound dressings |
A packaged wound dressing comprising an elongated, absorbent cavity wound dressing that is packaged in contact with two opposed sheets of microorganism-impermeable plastic sheet material, wherein the opposed sheets contact the dressing to form a microorganism-impermeable barrier around the circumference of the dressing in at least a region of the dressing. The invention also provides a method of making such a wound dressing comprising the steps of: providing an elongated microorganism-impermeable plastic sheet; providing one or more mold cavities in said elongated sheet for molding an elongated wound dressing; introducing a fluid precursor of a solid wound dressing material into said one or more mold cavities; and allowing said fluid precursor to set in said plurality of mold cavities. |
1. A packaged wound dressing comprising an elongated, absorbent cavity wound dressing that is packaged in contact with two opposed sheets of microorganism-impermeable plastic sheet material, wherein the opposed sheets contact the dressing to form a microorganism-impermeable barrier around the circumference of the dressing at least at intervals along the length of the dressing, whereby lengths can be cut from the dressing without the remainder of the dressing becoming contaminated. 2. A packaged wound dressing according to claim 1, wherein the absorbent dressing comprises a hydrophilic foam or a hydrogel. 3. A packaged wound dressing according to claim 1 or 2, comprising a plurality of absorbent bodies linked by one or more flexible bodies. 4. A packaged wound dressing according to claim 3, wherein the plurality of absorbent bodies comprises at least five absorbent bodies. 5. A packaged wound dressing according to claim 3 or 4, wherein the absorbent bodies each have a volume of from 0.001 to 10 cm3. 6. A packaged wound dressing according to claim 5, wherein the absorbent bodies each have a volume of from 0.01 to 1 cm3. 7. A packaged wound dressing according to any of claims 3 to 6, wherein the one or more flexible bodies comprise a filament, a thread or a string. 8. A packaged wound dressing according to claim 7, wherein the absorbent bodies are spaced along the filament, thread or string. 9. A packaged wound dressing according to claim 7 or 8, wherein the filament, thread or string extends through the absorbent bodies. 10. A packaged wound dressing according to any preceding claim, wherein the plastic films are bonded together at least in part by means of a releasable adhesive so that the package can be opened by peeling apart the films. 11. A packaged wound dressing according to any preceding claim, wherein an internal surface of the polymer films that contacts the dressing comprises a non-stick or release material to assist removal of the dressing from the package. 12. A packaged wound dressing according to any preceding claim, wherein the absorbent body comprises a single elongated absorbent body that extends the length of the dressing. 13. A packaged wound dressing according to any preceding claim, wherein the opposed sheets contact the dressing to form a microorganism-impermeable barrier around the circumference of the dressing substantially along the whole length of the dressing. 14. A packaged wound dressing according to any of claims 1 to 12, wherein the opposed sheets contact the dressing to form a microorganism-impermeable barrier around the circumference of the dressing at a plurality of intervals along the length of the dressing. 15. A method of making a packaged wound dressing as defined in any preceding claim, said method comprising the steps of: providing a microorganism-impermeable plastic sheet; providing one or more mold cavities in said plastic sheet for molding an elongated wound dressing; introducing a fluid precursor of a solid wound dressing material into said one or more mold cavities; and allowing said fluid precursor to set in said plurality of mold cavities. 16. A method according to claim 15, wherein the step of providing the mold cavities comprises providing first and second sheets of plastics material in face to face relationship, optionally with an elongated filament, thread or string extending between the sheets, and pressing the sheets together at intervals to define said molds. 17. A method according to claim 15, comprising the steps of: providing a two sheets of microorganism impermeable polymer film in face to face relationship with an elongated cavity therebetween; introducing a fluid precursor of a solid wound dressing material into said elongated cavity; allowing the fluid precursor to set in the elongated cavity to provide an elongated cavity wound dressing in said cavity. 18. A method according to any one of claims 15 to 17, wherein said precursor comprises an isocyanate capped polyurethane prepolymer. 19. A method according to any one of claims 15 to 18, further comprising the step of sterilizing the cavity wound dressing while it is encapsulated between said microorganism impermeable sheets. 20. A method according to any one of claims 15 to 19, wherein said method is carried out in continuous fashion to manufacture indefinite lengths of said packaged wound dressing. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.