text
stringlengths 0
1.67M
|
|---|
1-11. (canceled) 12. A method of multicast routing for a telecommunications network comprising a plurality of communication nodes interconnected by multiple paths, for establishing a multicasting connection between a source node and a plurality of destination nodes, comprising the steps of: a) making the source node generate a destination notification message which is propagated in the network until the destination notification message reaches the destination nodes, to inform the destination nodes of a need to connect to the source node; b) making each destination node generate, on receipt of the destination notification message, a connection request containing information on weighted connection costs; c) propagating the connection request in the network towards the source node, while collecting further information on the weighted connection costs accumulated along a path; and d) receiving at the source node the connection requests propagated in the network from the destination nodes, selecting multicasting paths with satisfactory costs according to the information received from the source node with the connection requests, and making the multicasting connection along the multicasting paths selected in this way. 13. The method according to claim 12, in which the connection request which is sent by the destination nodes and which is propagated in the network towards the source node contains at least the following information: i) Previous Hop (PH): address of a device node sending the message; ii) Dr: set of the destination nodes which can be reached via the PH; and iii) Accumulated Cost (AC): sum of the costs of the connections along which the message passes from Dr to the device node. 14. The method according to claim 13, in which a node which receives information propagated from the destination nodes extracts useful information and stores the useful information in a receive table, and in which the node calculates, from the receive table, a send table, from which new information is extracted and propagated in the network towards the source node. 15. The method according to claim 14, in which the receive table has a generic i-th input having the following fields: i) the Dr; ii) ACr=accumulated cost of the path from this node to all the nodes in the Dr; iii) the PH; and iv) En=unique identifier of the input in the table. 16. The method according to claim 15, in which the send table is obtained from the receive table by closure with respect to a combination of the discrete sets Dr, and has the following properties: i) for each set R of indices such that ∩R Dr=ø, there is an index m such that Dm=∪R Dr. ii) for each set R of indices and for each index m such that ∩R Dr=ø and Dm=∪R Dr, it is true that ACm≦ΣRACr. 17. The method according to claim 16, in which, when a node receives a multicast connection creation request message, it takes the set of nodes Dr which can be reached by the PH from the address field, and then looks in its send table to find an input i in the table with Di=Dr; if the input exists and ACi<ACr, the message is automatically rejected; otherwise, the i-th input in the receive table is replaced and/or supplemented with the information in the message. 18. The method according to claim 17, in which the node, in order to update its send table, tests all the possible combinations with an empty intersection between the new record and all the records in the table; if one or more of the combinations matches the properties of the send table, they are added or substituted in it; otherwise, they are rejected. 19. The method according to claim 16, in which the send table has an additional field (DF) indicating a set of records in the receive table from which it has been derived. 20. The method according to claim 19, in which, for the propagation of the multicast connection creation requests, whenever a record of the send table is updated and/or created in one node, a creation request message is sent to all the neighboring nodes, with the exclusion, if necessary, of the PH of the inputs of the receive table indicated by the DF field. 21. The method according to claim 14, in which, when the messages arrive at the source node, the source node selects the path between the source node and the destination nodes by selecting, among the records in its receive table, the one having all the desired destination nodes in the Dr field and having the lowest total cost AC. 22. A telecommunications network, comprising: a plurality of communication nodes interconnected by multiple paths, for the establishment of a multicasting connection between a source node and a plurality of destination nodes, in which a method according to claim 12 is performed for the multicast routing. |
Signal processing circuit |
A signal processing circuit comprises a difference stage for receiving an input signal to be processed and a feedback signal taken from an output signal of the circuit. The difference stage generates a difference signal corresponding to the difference between the input and feedback signal. An integrator stage is coupled to the difference stage to receive the difference signal and output an integrated signal. A time continuous pulse width modulating stage is coupled to the integrator stage to receive the integrated signal and to modulate the signal with reference to a continuously varying carrier signal. A continuous time feedback path is coupled to the output of the modulating stage and an input or the difference stage. The integrator stage comprises at least two integrators to provide second or higher order integration. |
1. A signal processing circuit comprising: a difference stage for receiving an input signal to be processed and a feedback signal taken from an output signal of the circuit, the difference stage generating a difference signal corresponding to the difference between the input and feedback signal; an integrator stage coupled to said difference stage to receive said difference signal and outputting an integrated signal; a time continuous pulse width modulating stage coupled to the integrator stage to receive the integrated signal and to modulate said signal with reference to a continuously varying spread spectrum carrier signal non-correlated to the input signal; and a continuous time feedback path coupled to the output of the modulating stage and an input of the difference stage; wherein the integrator stage comprises at least two integrators to provide second or higher order integration. 2. A signal processing circuit according to claim 1, wherein the modulating stage comprises a comparator which receives said integrated and reference carrier signals, and a reference signal generator which supplies a non-signal correlated spread spectrum carrier signal to said comparator. 3. A signal processing circuit according to claim 2, wherein said reference signal generator comprises a clock which is modulated to spread the spectrum of the signal. 4. A signal processing circuit according to claim 1, wherein the spectrum of the carrier signal is spread by introducing noise into the signal path before feedback to the difference stage. 5. A signal processing circuit according to claim 1, further comprising a power switching stage having an input and an output, the input being coupled to the output of the modulator stage and the feedback path being couple to the output of the switching stage. 6. A signal processing circuit according to claim 1, wherein the integrator stage comprises two or more cascaded integrators and an adder which sums the outputs of the integrators. 7. A signal processing circuit according to claim 6, wherein said integrators are coupled together via tap coefficients which stabilize the integrator stage. 8. A signal processing circuit according to claim 1, wherein the difference stage and integrating stage are combined by provision of a combined subtractor/integrator. 9. A signal processing circuit according to claim 2, further comprising a power switching stage having an input and an output, the input being coupled to the output of the modulator stage and the feedback path being couple to the output of the switching stage. 10. A signal processing circuit according to claim 3, further comprising a power switching stage having an input and an output, the input being coupled to the output of the modulator stage and the feedback path being couple to the output of the switching stage. 11. A signal processing circuit according to claim 4, further comprising a power switching stage having an input and an output, the input being coupled to the output of the modulator stage and the feedback path being couple to the output of the switching stage. 12. A signal processing circuit according to claim 2, wherein the integrator stage comprises two or more cascaded integrators and an adder which sums the outputs of the integrators. 13. A signal processing circuit according to claim 3, wherein the integrator stage comprises two or more cascaded integrators and an adder which sums the outputs of the integrators. 14. A signal processing circuit according to claim 4, wherein the integrator stage comprises two or more cascaded integrators and an adder which sums the outputs of the integrators. 15. A signal processing circuit according to claim 5, wherein the integrator stage comprises two or more cascaded integrators and an adder which sums the outputs of the integrators. 16. A signal processing circuit according to cliam 2, wherein the difference stage and integrating stage are combined by provision of a combined subtractor/integrator. 17. A signal processing circuit according to claim 3, wherein the difference stage and integrating stage are combined by provision of a combined subtractor/integrator. 18. A signal processing circuit according to claim 4, wherein the difference stage and integrating stage are combined by provision of a combined subtractor/integrator. 19. A signal processing circuit according to claim 5, wherein the difference stage and integrating stage are combined by provision of a combined subtractor/integrator. 20. A signal processing circuit according to claim 6, wherein the difference stage and integrating stage are combined by provision of a combined subtractor/integrator. |
Process for the production of hydrogen peroxide |
The invention relates to a process for the production of hydrogen peroxide by the anthraquinone process, comprising a hydrogenation stage, an oxidation stage and an extraction stage. According to the invention, catalytic hydrogenation of anthraquinone derivatives dissolved in a working solution is carried out in the presence of added molecular oxygen. Per mol hydrogen, 0.1 to 10 mmol oxygen is preferably introduced into the hydrogenation stage with the hydrogenating gas, in mixture with an inert gas and/or dissolved and/or dispersed in the working solution. This increases the residence time of the catalyst. |
1-8. (Cancelled) 9. In a process for the production of hydrogen peroxide, comprising: a) a hydrogenation stage reaction comprising the hydrogenation of an anthraquinone derivative with a hydrogen-containing gas in the presence of a hydrogenating catalyst to form an anthrahydroquinone derivative, said anthraquinone derivative and anthrahydroquinone derivative being contained within a working solution; b) an oxidation stage reaction comprising the reconversion of said anthrahydroquinone of step a) back to said anthraquinone derivative using an oxygen-containing gas, said reconversion being accompanied by the formation of hydrogen peroxide; and c) an extraction stage comprising isolating said hydrogen peroxide formed in step b) and then returning the working solution to said hydrogenation stage reaction, the improvement comprising adding molecular oxygen (O2) in the form of a gas containing molecular oxygen as a component to said hydrogenation stage reaction in a quantity of at least 0.02 mmol O2 per mole H2 and less than the explosion limit under the hydrogenation conditions. 10. The process of claim 9, wherein said molecular oxygen is added to said hydrogenation step reaction in a form selected from the group consisting of: O2 alone; air alone; O2 or air in mixture with said hydrogen-containing gas of said hydrogenation stage reaction; and O2 or air in mixture with an inert gas. 11. The process of claim 9, wherein said molecular oxygen is added to said hydrogenation stage reaction in a quantity of 0.1 to 20 mmol O2 per mole of hydrogen. 12. The process of claim 11, wherein molecular oxygen is added in a quantity of 0.5 to 10 mmol of O2 per mole of hydrogen. 13. The process of claim 9, wherein said hydrogen-containing gas in said hydrogenation stage reaction has an oxygen content of 100 vpm (volume parts per million) to 5000 vpm. 14. The process of claim 9, wherein said hydrogenation stage reaction is carried out in a fixed bed reactor with an LHSV (liquid hourly space velocity) of 0.1 h−1 to 20 h−1. 15. The process of claim 9, wherein a precious metal-containing fixed bed catalyst of particles having an average diameter of 0.5-20 mm is used for said process. 16. The process of claim 15, wherein said fixed bed catalyst contains palladium. 17. The process of claim 14, wherein said fixed bed reactor is operated as a trickle bed. 18. The process of any one of claim 9-17, wherein, after the isolation of said hydrogen peroxide in said extraction stage, said working solution is brought into contact with said molecular oxygen or gas containing molecular oxygen before being returned to said hydrogen stage reaction. 19. The process of any one of claims 9-17, wherein said molecular oxygen or gas containing molecular oxygen is added directly to a reactor in which said hydrogenation stage reaction is taking place, said addition occurring after the isolation of said hydrogen peroxide, and wherein said addition is made in a quantity of 0.1 to 20 mmol of O2 per mole of hydrogen. |
Method and device for evaluating a parameter of a moving object |
A method for measuring a parameter of a movement of an object, in which a series of successive first time-spaced linear images and a second spaced linear image are taken, (a) a first development of first linear images and (b) a second development consisting of at least one second image are formed, and linear images of the first development are compared at least partly with at least a part of a linear image of the second development to determine the part of a spaced linear image of the first development which best corresponds to a part of a linear image of the second development. |
1. A method to characterise, at least partially, a movement of an object relative to a measurement device, this method determining at least one time-function parameter, in which, by means of a measurement device, from a first determined time, a series of at least three successive first time-spaced linear images are taken in a shot-direction, at a determined time interval, said series forming a first element, and at least, from a second determined time later than the first determined time, at least one second element selected from the group consisting of one single second linear image and a series of second linear images of the object in relative movement is taken, each second linear image being taken in a direction forming an angle with the shot-direction of the first image, each second linear image being spaced from the first linear images, in which (a) a first development of images in function of time made up of at least a first element and (b) a second development of image made up of at least a second element are formed, in which at least partially at least one linear image of the first development is compared with at least a part of a linear image of the second development to determine the part of time-spaced linear image of the first development which best corresponds to a part of a linear image of the second development and to determine at least one time-function parameter for which at least a part of the first time-spaced image of the said period best corresponds to a part of a second linear image. 2. The method of claim 1, wherein the first linear images are taken in a first direction and each second linear image or in a second direction, this second direction forming an angle with the first direction of less than 10°. 3. A method to characterise, at least partially, a movement of an object relative to a measurement device, this method determining at least one time-function parameter, wherein by means of a measurement device, from a first determined time, a series of at least three successive first linear images are taken in a shot direction, at a determined time interval, and at least, from a second determined time later than the first determined time, a series of second linear images of the object in relative movement are taken, said second linear images being taken in a direction forming an angle with the shot-direction of the first images and being spaced from the first images, wherein (a) a first development of images in function of time consisting of at least a series of first linear images spaced in time taken from the first determined time and (b) a second development of images made up of a series of second spaced linear images taken at a determined time interval are formed, and wherein at least partially, at least one linear image of the first development is compared with at least a part of at least one linear image of the second development to determine the part of at least one time-spaced linear image of the first development which best corresponds to a part of one linear image of the second development and to determine at least one time gap for which at least a part of a first spaced linear image best corresponds to a part of a second linear image. 4. The method of claim 1, in which the first element consists of a series of groups of spaced first linear images of the object in relative movement taken from of a first determined time these groups being spaced in time, and in which the second element consists of at least one group of second linear images taken at a time later than the first determined time, in which (a) the first development of images in function of time consists at least partially of a series of groups of first linear images taken from a first determined time is formed and (b) the second development comprises at least partly a group of second images, in which at least partially, a part of groups of linear images of the first development is compared with at least a part of at least one group of second linear images of the second development, to determine the part of the group of linear images of the first development which best corresponds to a part of the group of second linear images and to determine a time-function parameter for which at least a part of a group of linear images of the first development best corresponds to a part of the group of second linear images. 5. The method of claim 1, in which at least for a part of linear images of the first development, a parameter selected from the group consisting of factor of correspondence and a gap in correspondence with at least one second linear image of at least a part of the second development is determined, in which an optimum parameter selected from the group consisting of the maximum of the factor of correspondence and the minimum of gap of correspondence is determined for determining a first element selected from the group consisting of one single spaced linear image and a group of spaced linear images of the first development which best corresponds to a second element selected from the group consisting of a single linear image and a group of second linear images of the second development. 6. The method of claim 1, wherein at least partially, an element selected from the group consisting of linear images, the first development and the second development is filtered before determining at least the part of time spaced linear image of the first development of which at least a part best corresponds to a part of a linear image of the second development. 7. The method of claim 1, wherein, for at least one linear image taken by a sensor, a compensation is carried out in function of at least one factor selected from the group consisting of distribution of light on the sensor, difference of sensitivities of pixels of linear elements of the sensor, differences and variations bringing about systematic errors in the comparison of linear images. 8. The method of claim 1, wherein the linear images are taken by means of at least one sensor, whereby in order to determine a speed of the object relative to the sensor, the distance between the measurement device and the object in movement relative to the measurement device is determined. 9. The method of claim 8, wherein a relative speed of the object is determined in relation to the sensor from at least one parameter selected from the group consisting of: the gap of time separating the taking of a first spaced linear image and the taking of a second linear image, for which at least a part of a first spaced linear image best corresponds to a part of a second linear image, the distance between the object and the sensor, the angular difference between the shot directions of linear images, the focal length of a camera taking at least one linear image and the distance separating two linear sensors taking linear images. 10. The method of claim 1, wherein the object is located at a distance from at least one sensor of a camera taking linear images time-spaced of a period of time, whereby the distance separating the object from the sensor is determined from: the period of time separating the taking of a first spaced linear image and the taking of a second linear image, for which at least a part of a first spaced linear image best corresponds to a part of a second linear image, the angular difference between the shot directions of first and second linear images, the focal length of the camera taking linear images, the distance separating the two linear sensors taking linear images, and the relative speed separating the object from the sensor. 11. The method of claim 1, wherein the first linear images formed each of a series of pixels are taken by at least one sensor defining a plane in which the at least one sensor is operative, and in that the object is subject to a relative movement in relation to the at least one sensor parallel to the plane in which the at least one sensor is operative. 12. The method of claim 1, wherein at least a first pair of parallel linear images and a second pair of parallel linear images are taken successively in time, in which at least a first pair of developments of images is formed from the first successive pairs of images and a second pair of developments of images from the second successive pairs of images, in which from the first pair of developments a first time-function parameter is determined and from the second pair of developments a second time-function parameter is determined, and in which this first parameter is compared with this second parameter to determine an accuracy degree selected from the group consisting of degree of exactness and degree of error of the value given to the said first parameter. 13. The method of claim 1, wherein over time a series of images corresponding to segments of a first linear image and of a second linear image are taken, so as to form a series of developments of first segment linear images and a series of second segment linear images, and in which at least partially, at least one image of a development of a first segment image are compared with at least one image of a development of a second segment image. 14. A measurement device for establishing a method to characterise, at least partially, a movement of an object relative to a measurement device, this method determining at least one time-function parameter, in which, by means of the measurement device, from a first determined time, a series of at least three successive first time-spaced linear images are taken in a shot-direction, at a determined time interval, said series forming a first element, and at least, from a second determined time later than the first determined time, at least one second element selected from the group consisting of one single second linear image, a series of second linear images of the object in relative movement is taken, each second linear image being taken in a direction forming an angle with the shot-direction of the first image, each second linear image being spaced from the first linear images, in which (a) a first development of images in function of time made up of at least a first element and (b) a second development of image made up of at least a second element are formed, in which at least partially at least one linear image of the first development is compared with at least a part of a linear image of the second development to determine the part of time-spaced linear image of the first development which best corresponds to a part of a linear image of the second development and to determine at least one time-function parameter for which at least a part of the first time-spaced image of the said period best corresponds to a part of a second linear image, said device including at least: a sensor set taking at least one first linear image by a first sensor means and at least one series of second linear images by a second sensor means, in particular taken at successive times, the said second linear images being taken from a different angle relative to the first linear image, a means generating a series of first images spaced in time, a comparison device receiving signals from the sensor set and from the means generating a series of first images spaced in time, this comparison device comparing, at least partially, the series of first spaced images with at least one second linear image and determining, for at least a part of the series of first spaced images a parameter selected from the group consisting of a factor of correspondence and a discrepancy of correspondence with at least a part of a second linear image, this comparison device being programmed for determining a time parameter corresponding to an optimum parameter selected from the group consisting of maximum of the factor of correspondence and minimum of discrepancy of correspondence between at least a part of a first linear image spaced in time and at least a part of a second linear image. 15. The device of claim 14, wherein the first sensor means is arranged to take at least one linear image in a first direction, while the second sensor means is arranged to take at least one linear image in a second direction, this second direction forming an angle with the said first direction of less than 10°. 16. The device of claim 15, wherein the sensor set takes linear images in the form of a set of pixels and attributes to each pixel a parametric value, this set moreover comprising a means of correction of the parametric value attributed to pixels of at least one image selected from the group consisting of at least one second linear image and first linear images spaced in time, in function of at least one parameter selected from the group consisting of distribution of light, differences and variations bringing about systemic errors in the comparison of the images and differences of sensitivity of sensor means. 17. The device of claim 14, wherein the device comprises a sensor, at least bi-linear, defining a plane of image reception and focalisation lens focalising an image of an object in movement relative to the said reception plane of the sensor. 18. The device of claim 14, which comprises: a sensor comprising at least a first means receiving a first series of rows of pixels or lines of an image and a second means receiving a second series of rows of pixels or lines of the image at least partially distanced from the pixels of the first row or line, a delay memory which memorises, at least partially, the first series of rows of pixels or lines and which emits, with pre-determined delays, the values memorised corresponding to that first series of rows of pixels or lines, a comparison device receiving signals from the sensor corresponding to the values of the pixels of the second series of rows or lines over time, and signals coming from the delay-memory, this comparison device being programmed for determining the delay to attribute to the first series of rows of pixels or lines for which the values memorised corresponding to the said first series of rows of pixels or lines best correspond to the values of the second series of rows of pixels or lines. 19. The device of claim 18, wherein the comparison device determines, for delays pre-determined by the delay-memory, a difference of value of pixels between the pixels of the first row taken at different moments and the value of the pixels of the second row, and emits signals comprising the differences of values of pixels associated to pre-determined delays to a processor which determines, by calculation step selected from the group consisting of interpolation, extrapolation, approximation, successive iteration, and combinations thereof, the delay for which the difference of value of pixels is minimal. 20. The device of claim 14, which comprises a focalisation lens including a cylinder lens. 21. The device of claim 14, which comprises distinct focalisation lenses for each means sensing a row of pixels. 22. The device of claim 14 which comprises at least one filter for the linear images. 23. The device of claim 14, which comprises a means of checking the quality of the parameter determined by the processor, this means advantageously comprising a means to determine a factor of quality from signals coming from the processor and an attenuator receiving the factor of quality determined and weighting the parameter determined by the processor in function of the factor of quality. 24. The device of claim 14, which comprises a low-channel filter to attenuate variations selected from the group consisting of errors due to the tri-dimensional form of the object in relative movement and high-frequency noises introduced into the measurements. 25. The device of claim 14, wherein the sensor set receives signals coming from the comparison device. 26. The device of claim 14, wherein the sensor set takes at least one first linear image and at least one second linear image, said first and second linear image being selected from the group consisting of images in at least two colours and linear RGB images. 27. The device claim 26, wherein the sensor set comprises at least 2 linear sensors. 28. (new) A method to characterise, at least partially, a movement of an object relative to a measurement device, this method determining at least one time-function parameter, in which, by means of a measurement device, from a first determined time, a series of at least three successive first time-spaced linear images are taken in a shot-direction, at a determined time interval, said series forming a first element, and at least, from a second determined time later than the first determined time, at least one second element selected from the group consisting of one single second linear image and a series of second linear images of the object in relative movement is taken, each second linear image being taken in a direction forming an angle with the shot-direction of the first image, each second linear image being spaced from the first linear images, in which (a) a first development of images in function of time made up of at least a first element and (b) a second development of image made up of at least a second element are formed, in which at least partially linear images of the first development are compared with at least a part of linear images of the second development to determine the part of time-spaced linear images of the first development which best correspond to a part of linear images of the second development and to determine at least one time-function parameter for which at least a part of the first time-spaced images of the said period best corresponds to a part of second linear images. 29. The method of claim 1, in which the first linear images are taken in a first direction and each second linear image in a second direction, this second direction forming an angle with the first direction of less than 5°. 30. The method of claim 1, in which the first linear images are taken in a first direction and each second linear image in a second direction, this second direction forming an angle with the first direction of less than 3°. 31. A method to characterise, at least partially, a movement of an object relative to a measurement device, this method determining at least one time-function parameter, in which by means of a measurement device, from a first determined time, a series of at least three successive first linear images are taken in a shot direction, at a determined time interval, and at least, from a second determined time later than the first determined time, a series of second linear images of the object in relative movement are taken, said second linear images being taken in a direction forming an angle with the shot-direction of the first images and being spaced from the first images, in which (a) a first development of images in function of time consisting of at least a series of first linear images spaced in time taken from the first determined time and (b) a second development of images made up of a series of second spaced linear images taken at a determined time interval are formed, and in which at least partially, linear images of the first development are compared with at least a part of linear images of the second development to determine the part of time-spaced linear images of the first development which best corresponds to a part of linear images of the second development and to determine at least one time gap for which at least a part of a first spaced linear images best correspond to a part of second linear images. 32. The method of claim 31, in which the time gap is expressed as a number of lines of pixels. 33. The method of claim 1, in which the first element consists of a series of groups of spaced first linear images of the object in relative movement taken from of a first determined time, these groups being spaced in time, and in which the second element consists of at least a series of groups of time-spaced second linear images at least taken from a time later than the first determined time and at a determined interval of time, in which (a) the first development of images in function of time consists at least partially of a series of groups of first linear images taken from a first determined time is formed and (b) the second development comprises at least partially of a series of groups of second linear images in function of time taken from an angle different from the shot direction of the group of first linear images, in which at least partially, a part of groups of linear images of the first development is compared with at least a part of groups of second linear images of the second development, to determine the part of the group of linear images of the first development which best corresponds to a part of the group of second linear images and to determine a time-function parameter for which at least a part of a group of linear images of the first development best corresponds to a part of the group of second linear images. 34. The method of claim 1, in which the linear images are taken by means of at least one sensor, whereby in order to determine an acceleration of the object relative to the sensor, the distance between the measurement device and the object in movement relative to the measurement device is determined. 35. The method of claim 1, in which the linear images are taken by means of at least one sensor, whereby in order to determine an acceleration of the object relative to the sensor, the measurement device is placed at a known distance, at least for a given time, relative to the object in movement relative to the measurement device. 36. The method of claim 1, in which the linear images are taken by means of at least one sensor, whereby in order to determine an speed of the object relative to the sensor, the measurement device is placed at a known distance, at least for a given time, relative to the object in movement relative to the measurement device. 37. The method of claim 1, in which the second linear images formed each of a series of pixels are taken by at least one sensor defining a plane in which the at least one sensor is operative, and in that the object is subject to a relative movement in relation to the at least one sensor parallel to the plane in which the at least one sensor is operative. 38. The method of claim 1, in which over time a series of images corresponding to segments distant from each other, of a first linear image and of a second linear image are taken, so as to form a series of developments of first segment linear images and a series of second segment linear images, and in which at least partially, several first linear segment images are compared with several second linear segment images. 39. The device of claim 14, in which the first sensor means is arranged to take at least one group of linear images in a first direction, while the second sensor means is arranged to take at least one group of linear images in a second direction, this second direction forming an angle with the said first direction of less than 10°. 40. The device of claim 14, in which the first sensor means is arranged to take at least one linear image in a first direction, while the second sensor means is arranged to take at least one linear image in a second direction, this second direction forming an angle with the said first direction of less than 5°. 41. The device of claim 14, in which the first sensor means is arranged to take at least one linear image in a first direction, while the second sensor means is arranged to take at least one linear image in a second direction, this second direction forming an angle with the said first direction of less than 3°. 42. The device of claim 18, in which the distance separating these first and second series of rows or lines is a multiple of the size of a pixel, these rows or lines being parallel to each other. 43. The device of claim 18, in which the comparison device is linked to a processor to determine the delay to attribute to the first series of rows of pixels or lines for which the values memorised corresponding to the said first series of rows of pixels or lines best correspond to the values of the second series of rows of pixels or lines. 44. The device of claim 14, which comprises several filters for the linear images. 45. The device of claim 14, which comprises an processing means selected from the group consisting of a processor determining a time parameter, an attenuator adapting the frequency of shots of linear images, and an attenuator adapting an increment of delay between two shots of linear images, and in which the sensor set receives signals coming from at least one processing means. 46. The device of claim 14, in which the sensor set comprises at least one matrix sensor which is addressable line by line. |
Control of weed with a fungal pathogen |
The present invention provides an isolated biocontrol agent, which is a strain of Pyricularia setariae. The present invention also relates to a biocontrol composition comprising at least one fungal biocontrol agent, which is a strain of Pyricularia setariae. Examples of the biocontrol agent of the presnet invention include Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), and Pyricularia setariae 01-071A (IDAC 290102-02). Preferably, the biocontrol composition comprises an acceptable medium such as a liquid culture medium or a solid culture medium. The biocontrol agent or biocontrol composition may be used to suppress the growth of a weeds such as green foxtail (Setaria viridis [L.] Beauv.). |
1. An isolated fungal biocontrol agent, which is a strain of Pyricularia setariae. 2. The biocontrol agent of claim 1, wherein the strain is Pyricularia setariae 94-904A, deposited as IDAC 190701-1. 3. The biocontrol agent of claim 1, wherein the strain is Pyricularia setariae 01-069A, deposited as IDAC 290102-01. 4. The biocontrol agent of claim 1, wherein the strain is Pyricularia setariae 01-071A, IDAC 290102-02. 5. A method for suppressing weed growth comprising applying the isolated biocontrol agent of claim 1 to a weed. 6. The method of claim 5, wherein the weed is green foxtail (Setala viridis[L.] Beauv.), yellow foxtail (S. glauca) or giant foxtail (S. faber). 7. The method of claim 5, wherein the weed is green foxtail (Setaria viridis[L.] Beauv.). 8. A biocontrol composition comprising at least one isolated fungal biocontrol agent, which is a strain of Pyicularia setariae; and a suitable medium. 9. The biocontrol composition of claim 8, wherein said at least one biocontrol agent is Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof. 10. The composition of claim 8, wherein the agent is present in an amount of about 106 to about 107 spores per ml. 11. The composition of claim 8, wherein the suitable medium is a liquid culture medium, a solid culture medium or a combination thereof. 12. The composition of claim 8, wherein the suitable medium is a liquid culture medium. 13. A method for suppressing weed growth comprising applying the composition of claim 8 to a weed. 14. The method of claim 13, wherein the weed is green foxtail (Setaria viridis[L.] Beauv.), yellow foxtail (S. glauca), or giant foxtail (S. faberi). 15. The method of claim 13, wherein the weed is green foxtail (Setaria viridis[L.] Beauv.). 16. The method of claim 13, wherein the composition is applied by spraying. 17. The method of claim 16, wherein said spraying comprises airbrush or broadcast spraying. 18. The method of claim 17, wherein said broadcast spraying is performed with a nozzle selected from the group consisting of X8001, X8002 and X8004. 19. A biocontrol composition comprising at least one isolated fungal biocontrol agent, which is a strain of Pyricularia setariae; and an herbicide. 20. The biocontrol composition of claim 19, wherein said at least one biocontrol agent is Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (EDAC 290102-01), Pyricularia setariae 01-071A (DAC 290102-02), or a mixture thereof. 21. The composition of claim 19, wherein the agent is present in an amount of about 106 to about 107 spores per ml. 22. The composition of claim 19, which further comprises a suitable medium. 23. The composition of claim 22, wherein the suitable medium is a liquid culture medium, a solid culture medium or a combination thereof. 24. The composition of claim 22, wherein the suitable medium is a liquid culture medium. 25. A method for suppressing weed growth comprising applying the composition of claim 19 to a weed. 26. The method of claim 25, wherein the weed is green foxtail (Setaria viridis[.] Beauv.), yellow foxtail (S. glauca) or giant foxtail (S. faberi). 27. The method of clairm 25, wherein the weed is green foxtail (Setaria viridis [L.] Beauv.). 28. The method of claim 25, wherein the composition is applied by spraying. 29. The method of claim 28, wherein said spraying comprises airbrush or broadcast spraying. 30. The method of claim 29, wherein said broadcast spraying is performed with a nozzle selected from the group consisting of X8001, X8002 and X8004. 31. A method of suppressing weeds during crop growth comprising: a) adding to soil an effective amount of a biocontrol composition comprising at least one isolated fungal biocontrol agent which is a strain of Pyricularia setariae, formulated in an acceptable medium, to produce a treated soil; b) planting crops in said treated soil; and c) growing said crops. 32. The method of claim 31, wherein said at least one biocontrol agent is Pyricularia setariae 94-904A IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 29010201), Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof. 33. The method of claim 31, wherein the weed is green foxtail (Setaria viridis [L.] Beauv.), yellow foxtail (S. glauca) or giant foxtail (S. faberi). 34. The method of claim 31, wherein the weed is green foxtail (Setaria viridis [L.] Beauv.). 35. A method of suppressing weeds during crop growth comprising: a) adding to soil an effective amount of a biocontrol composition comprising: (i) at least one fungal biocontrol agent, which is a strain of Pyricularia setariae; and (ii) an herbicide; formulated in an acceptable medium, to produce a treated soil; b) planting crops in said treated soil; and c) growing said crops. 36. The method of claim 35, wherein said at least one biocontrol agent is Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), Pyricularia setariae 01-071A (IDAC 290102-02), or a miture thereof. 37. The method of claim 35, wherein the weed is green foxtail (Setaria viridis [L.] Beauv.), yellow foxtail (S. glauca) or giant foxtail (S. faberi). 38. The method of claim 35, wherein the weed is green foxtail (Setaria viridis [L.] Beauv.). 39. A method of suppressing weeds during crop growth comprising: b) spraying an area of plants with an effective amount of a biocontrol composition comprising at least one isolated flngal biocontrol agent, which is a strain of Pyricularia setariae, formulated in an acceptable medium; and b) growing said plants. 40. The method of claim 39, wherein said at least one biocontrol agent is Pyricularia setariae 94-904A (IDAC 19070-1-1), Pyricularia setariae 01-069A (IDAC 29010201), Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof. 41. The method of claim 39, wherein the weed is green foxtail (Setaria viridis [L.] Beauv.), yellow foxtail (S. glauca) or giant formafil (S. faberi). 42. The method of claim 39, wherein the weed is green foxtail (Setaria viridis [.] Beauv.). 43. The method of claim 39, wherein said spraying comprises airbrush or broadcast spraying. 44. The method of claim 43, wherein said broadcast spraying is performed with a nozzle selected from the group consisting of X8001, X8002 and X8004. 45. A method of suppressing weeds during crop growth comprising: a) spraying an area of plants with an effective amount of a biocontrol composition comprising: (i) at least one fungal biocontrol agent, which is a strain of Pyricularia setariae, and (iii) an herbicide, formulated in an acceptable medium; and b) growing said plants. 46. The method of claim 45, wherein said at least one biocontrol agent is Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof. 47. The method of claim 45, wherein the weed is green foxtail (Setaria viridis [L.] Beauv.), yellow foxtail (S. glauca) or giant foxtail (S. faberi). 48. The method of claim 45, wherein the weed is green foxtail (Setaria viridis[L.] Beauv.). 49. The method of claim 45, wherein said spraying comprises airbrush or broadcast spraying. 50. The method of claim 49, wherein said broadcast spraying is perfamed with a nozzle selected from the group consisting of X8001, X8002 and X8004. 51. A method of inhibiting foxtail weeds in a desired area, said method comprising spraying said desired area with between about 250 L/Ha to about 2000 L/Ha of a biocontrol composition comprising between about 106 to about 107 spores of at least one isolated fungal biocontrol agent, which is a strain of Pyricularia setariae. 52. The method of claim 51, wherein said at least one biocontrol agent is Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 29010241), Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof. 53. The method of claim 51, wherein the weed is green foxtail (Setaria viridis[L.] Beauv.), yellow foxtail (S. glauca) or giant foxtail (S. faberi). 54. The method of claim 51, wherein the weed is green foxtail (Setaria vihdis[L.] Beauv.). 55. The method of claim 51, wherein said spraying comprises airbrush or broadcast spraying. 56. The method of claim 55, wherein said broadcast spraying is performed with a nozzle selected from the group consisting of X8001, X8002 and X8004. 57. A biocontrol composition comprising an extract from a strain of Pyricularia setariae. 58. The biocontrol composition of claim 57, wherein said strain is Pyricularia setariae 94904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof. 59. A method for suppressing weed growth comprising applying the biocontrol composition of claim 57 to a weed. 60. The method of claim 58, wherein the weed is green foxtail (Setaria viridis [L.] Beauv.), yellow foxtail (S. glauca) (S. glauca) or giant foxtail (S. faberi). |
<SOH> BACKGROUND OF THE INVENTION <EOH>Control of weeds is an important aspect of crop management. Due to several undesirable properties associated with the use of chemical herbicides, alternative weed control practices, including the use of biological herbicides, are desired. For example, rising economic, environmental and social costs associated with agricultural inputs, spray drift, pesticide residues, government legislation for reduced pesticide use, along with the development of herbicide resistance in weeds, make biocontrol agents attractive strategies for weed control. Biological control of weeds with microorganisms (bioherbicides), preferably involves the production and application of a weed-specific pathogen to a target weed. The weed specific pathogen is typically a fungus or bacterial pathogen that inhibits or suppresses root, shoot or both root and shoot growth, development, or both growth and development, thereby reducing weed competition. The development of biological crop protection products (bioherbicides) for economically important weed problems in agricultural field crops may help to facilitate harvests, secure yields, and protect the environment. Biological control provides an additional tool to complement an integrated weed management system and helps sustainable agricultural systems by maintaining the ecosystem balance through the preservation of plant and microbial diversity in the field. There are several documents disclosing the use of fungi as biocontrol agents. For example, U.S. Pat. No. 5,993,802 teaches methods for suppressing the growth of Calamagrostis canadensis using an isolate of a low temperature basidiomycete fungus, Coprinus psychromorbidus . U.S. Pat. No. 5,472,690 teaches of a mycoherbicide (including at least one or both of Fusarium nivalis and Colletotrichum calamagrostidis ) effective in the control of Calamagrostis canadensis and/or related grasses. The control of crabgrass using fungi is disclosed in U.S. Pat. No. 5,952,264, using the fungus Cochliobolus intermedius , and U.S. Pat. No. 5,635,444 using a fungus selected from the genus Curvularia . U.S. Pat. No. 5,747,029, teaches the control of sicklepod weeds using the fungus Myrothecium verrucaria . The control of nutsedge weeds using the fungus Dactylaria higginsii is disclosed in WO 98/08389. U.S. Pat. No. 4,606,751 teaches the biocontrol of Johnson grass using Bipolaris sorghicola spores that are suspended in a solution of water and surfactant, and sprayed onto a field in which the weed is growing. Annual grassy weeds such as Setaria viridis (L.) Beauv. (commonly known as green foxtail, pigeongrass, wild millet, green bristlegrass, and bottlegrass) develop dense competitive stands and have heavy seed production in spring sown crops. Green foxtail is a principal weed of corn, soybean, cereals, flax, canola, sugar beets, and pastures. The amount of damage to the crop depends on the density of the stand, time of emergence, and length of time the weed and crop are competing. Weed surveys for herbicide-resistant green foxtail have revealed that many of these plants exhibit some degree of herbicide resistance (Beckie, H.J., A. Legere, A.G. Thomas, L.T. Juras, and M.D. Devine. 1996 Survey of Herbicide-Resistant Wild Oat and Green Foxtail in Saskatchewan: Interim Report AAFC Report, 22 pp.). Therefore, biocontrol of these plants is highly desirable. However, at present for most of these weeds there are no known satisfactory biocontrol agents for control of green foxtail. An important aspect in the development of a successful biological control agent is an effective delivery system. For biocontrol agents delivered onto target weeds by spraying, it is common for the erect top leaf to survive the attack due to the poor retention of the biocontrol agent on this portion of the plant. Thus, new methods of applying biocontrol agents are desired in the art. Further, traditional application methods such as run-off spraying are generally not suitable for treatment of large areas and thus there is a need in the art for methods to reduce the application volumes of biocontrol agents without reducing the efficacy of the biocontrol agent on the target weeds. To date, variable efficacy has been observed with biopesticide agents at reduced application volumes (Jones 1994, Smith and Bouse, 1981) Previous attempts to control green foxtail weeds with biocontrol compositions have been relatively poor. In particular, it was noted in other studies that the top leaf of green foxtail consistently exhibited the least amount of disease development following biocontrol application, and reduced spray retention is speculated as a cause because of the erect leaf architecture of green foxtail weeds. Further, the surviving leaf often contributes to regrowth from the apical meristem, reducing the effectivity of the biocontrol agent. Other factors, such as but not limited to age (Green and Bailey 2000) and mineral nutrient content (Filippi and Prabhu 1998) of the leaves, may affect the susceptibility of green foxtail weeds to fungal pathogens. In field crops, application volumes over 600 L/ha are considered high (Matthews, 1992), and the trend is generally toward volume reduction. In previous experiments, when applied at volumes between 100 to 800 L/ha, the agent 94-409A showed significantly lower efficacy in comparison to the runoff airbrush spray using the same spore concentration. Commonly the erect top leaf developed little disease and survived the attack. It is believed that the poorer efficacy is related to a lower amount of fungal propagules received and retained on the plant It is an object of the present invention to overcome drawbacks of the prior art. The above object is met by a combination of the features of the main claims. The sub claims disclose further advantageous embodiments of the invention. |
<SOH> SUMMARY OF THE INVENTION <EOH>The invention relates to biocontrol agents for suppressing weed growth. More specifically, the present invention relates to fungal biocontrol agents for suppression of weed growth. The present invention provides an isolated fungal biocontrol agent, which is a strain of Pyricularia setariae . In a preferred embodiment, the present invention provides an isolated fungal biocontrol agent, which is Pyricularia setaniae 94904A (International Depository of Canada (DAC) 190701-1; deposited on Jul. 19, 2001), Pyricularia setariae 01-069A (IDAC 290102-01, deposited on Jan. 29, 2002), and Pyricularia setariae 01-071A (IDAC 290102-02, deposited on Jan. 29, 2002), which exhibit weed suppressive activity. Also provided by the present invention is the use of the above biocontrol agents for controlling or suppressing the growth of foxtail weeds. According to another aspect, the present invention provides a method for suppressing weed growth by applying an isolated biocontrol agent, which is a strain of Pyricularia setariae to a weed. In a preferred embodiment, the present invention provides a method for suppressing weed growth comprising applying Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof, to a weed. Preferably, the weed is green, yellow or giant foxtail ( Setaria viridis [L.] Beauv., S. glauca, or S. faberi, respectively). According to a further aspect, the present invention provides a biocontrol composition comprising at leastone isolated fungal biocontrol agent, which is a strain of Pyricularia setariae , and a suitable medium. In a preferred embodiment, the present invention provides a biocontrol composition comprising Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), or Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof, and a suitable medium. The suitable medium medium may comprise a liquid culture medium, a solid culture medium or a combination thereof. Preferably, the suitable medium is a liquid culture medium. According to another aspect, the present invention provides a biocontrol composition comprising at least one isolated fungal biocontrol agent, which is a stain of Pyricularia setariae ; and an herbicide. In a preferred embodiment, the present invention provides a biocontrol composition comprising Pyricularia setariae 94904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), or Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof, and an herbicide. According to another aspect, the present invention provides a synergisitc biocontrol composition comprising a synergistic amount of at least one isolated fungal biocontrol agent, which is a strain of Pyricularia setariae ; and a synergistic amount of an herbicide. In a preferred embodiment, the present invention provides a synergisitc biocontrol composition comprising a synergistic amount of Pyricularia setariae 94904A (RDAC 190701-1), Pyricularia setariae 01-069A (DDAC 290102-01), or Pyricularia setariae 01-071A (DDAC 290102-02), or a mixture thereof, and a synergistic amount of an herbicide. The present invention also provides the use of the above-indicated compositions for controlling or suppressing the growth of foxtail weeds. Preferably, the weed is green, yellow or giant foxtail ( Setaria viridis [L.] Beauv., S. glauca, or S. faberi , respectively). According to another aspect, the present invention provides a method for suppressing weed growth by applying the above-indicated compositions to a weed Preferably, the weed is green, yellow or giant foxtail ( Setaria viridis [.] Beauv., S. glauca, or S. faberi , respectively). According to another aspect, the present invention provides a method of suppressing weeds during crop growth comprising: a) adding to soil an effective amount of a biocontrol composition comprising at least one isolated fungal biocontrol agent, which is a strain of Pyricularia setariae , formulated in an acceptable medium, to produce a treated soil; b) planting crops in said treated soil; and c) growing said crops. Also according to the present invention, there is provided a method of suppressing weeds during crop growth comprising; a) adding to soil an effective amount of a biocontrol composition comprising: (i) at least one fungal biocontrol agent, which is a strain of Pyricularia setariae ; and (ii) an herbicide; formulated in an acceptable medium, to produce a treated soil; b) planting crops in said treated soil; and c) growing said crops. Also according to the present invention, there is provided a method of suppressing weeds during crop growth comprising; a) adding to soil an effective amount of a synergistic biocontrol composition comprising: (i) a synergistic amount of at least one fungal biocontrol agent, which is a strain of Pyricularia setariae ; and (ii) a synergistic amount of an herbicide; formulated in an acceptable medium, to produce a treated soil; b) planting crops in said treated soil; and c) growing said crops. The present invention also provides a method of suppressing weeds during crop growth comprising: a) spraying an area of plants with an effective amount of a biocontrol composition comprising at least one isolated fungal biocontrol agent, which is a strain of Pyricularia setariae , formulated in an acceptable medium; and b) growing said plants. The present invention further provides a method of suppressing weeds during crop growth comprising: a) spraying an area of plants with an effective amount of a biocontrol composition comprising: (i) at least one fungal biocontrol agent, which is a strain of Pyricularia setariae , and (ii) an herbicide, formulated in an acceptable medium; and b) growing said plants. The present invention further provides a method of suppressing weeds during crop growth comprising: a) spraying an area of plants with an effective amount of a synergistic biocontrol composition comprising: (i) a synergistic amount of at least one fungal biocontrol agent, which is a strain of Pyricularia setariae , and (ii) a synergistic amount of an herbicide, formulated in an acceptable medium; and b) growing said plants. In a preferred embodiment, the fungal biocontrol agent of the present invention is used in an amount of about 10 6 to about 10 7 spores per ml. In a further aspect, the present invention provides a method of inhibiting foxtail weeds in a desired area, said method comprising spraying said desired area with between about 250 L/Ha to about 2000 L/Ha of a biocontrol composition comprising between about 10 6 to about 10 7 spores of at least one isolated fungal biocontrol agent, which is a strain of Pyricularia setariae. In a preferred embodiment, the biocontrol agent used in the above-described methods is Pyricularia setariae 94-904A (IDAC 190701-1), Pyricularia setariae 01-069A (IDAC 290102-01), or Pyricularia setariae 01-071A (IDAC 290102-02), or a mixture thereof. The biocontrol agent or biocontrol composition may be applied to weeds by any method known in the art, but is preferably applied by spraying, for example, but not limited to airbrush spraying or broadcast spraying. Broadcast application may be effected using a nozzle which enhances the reduction of the size of the droplets which are emitted during application of the biocontrol agent or composition as defined above. Preferably the nozzles are selected from the group consisting of X8001, X8002 and X8004. However, other nozzles may also be employed to deliver the biocontrol agent or composition of the present invention. This summary does not necessarily describe all necessary features of the invention but that the invention may also reside in a sub-combination of the described features. |
Fischer tropsch process |
A process for the conversion of synthesis gas to product comprising liquid hydrocarbons wherein said process comprises contacting synthesis gas at an elevated temperature and pressure with a mixed particulate catalyst comprising a mixture of a particulate Fischer-Tropsch catalyst and a particulate hydrocracking and/or isomerisation catalyst. |
1. A process for the conversion of synthesis gas to a product comprising liquid hydrocarbons wherein said process comprises contacting synthesis gas at an elevated temperature and pressure with a mixed particulate catalyst comprising a mixture of a particulate Fischer-Tropsch catalyst and a particulate hydrocracking and/or isomerisation catalyst. 2. A process according to claim 1 wherein the process comprises contacting synthesis gas at elevated temperature and pressure with the mixed particulate catalyst comprising a particulate Fischer-Tropsch catalyst and a particulate hydrocracking and/or isomerisation catalyst suspended in a liquid medium in a reactor system comprising at least one high shear mixing zone and a reactor vessel wherein the process comprises: a) passing the suspension through the high shear mixing zone(s) where the synthesis gas is mixed with the suspension; b) discharging a mixture comprising the synthesis gas and the suspension from the high shear mixing zone(s) into the reactor vessel; and c) converting the synthesis gas to liquid hydrocarbons in the reactor vessel to form a product suspension comprising the mixed particulate catalyst suspended in the liquid medium and liquid hydrocarbon products. 3. A process according to claim 2 wherein the reactor vessel is a tank reactor or a tubular loop reactor. 4. A process according to claim 2 wherein the high shear mixing zone(s) project through the walls of the reactor vessel such that the high shear mixing zone(s) discharges its contents into the reactor vessel or is located within the reactor vessel. 5. A process according to claim 2 wherein the reactor system comprises up to 250 high shear mixing zones. 6. A process according claim 2 wherein the high shear mixing zone(s) comprise an injector-mixing nozzle(s). 7. A process according to claim 6 wherein the injector mixing nozzle(s) is a venturi nozzle(s) or a gas blast nozzle(s). 8. A process according to claim 1 wherein the Fischer-Tropsch reaction is carried out at a temperature of 180-280° C. and at a pressure of 5-50 bar. 9. A process according to claim 1 wherein the ratio of hydrogen to carbon monoxide in the synthesis gas is in the range of 20:1 to 0.1:1 by volume. 10. A process according to claim 1 wherein the ratio of Fischer-Tropsch catalyst to hydrocracking and/or the isomerisation catalyst is the range of 25:1 to 1:10 by weight. 11. A process according to claim 1 wherein the mixed particulate catalyst comprises a mixture of a Fischer-Tropsh catalyst and a hydrocracking catalyst. 12. A process according to claim 11 wherein the hydrocracking catalyst is cobalt and molybdenum supported on silica-alumina. 13. A process according to claim 1 wherein the Fischer-Tropsch catalyst is cobalt supported on zinc oxide. |
Complexes for transferring substances of interest into a cell |
The present invention concerns new polar compounds, complexes and compositions comprising them, wherein said compound comprises: (i) a polar headgroup spacer, (ii) at least one hydrophobic moiety, and (iii) at least one hydrophilic polymer, and wherein said polar headgroup spacer is coupled to said hydrophobic moiety and to said hydrophilic polymer. |
1. A compound comprising: (i) a polar headgroup spacer, (ii) at least one hydrophobic moiety, and (iii) at least one hydrophilic polymer, wherein said polar headgroup spacer is coupled to said hydrophobic moiety and to said hydrophilic polymer. 2. The compound of claim 1 wherein said polar headgroup spacer is a cationic headgroup spacer. 3. The compound of claim 2 wherein said cationic headgroup spacer comprises from 2 to 7 positive charges. 4. The compound of claim 2 wherein said polar headgroup spacer coupled to said hydrophobic moiety is a cationic lipid. 5. The compound of claim 4 wherein said cationic lipid is of Formula I: in which: R1 and R2, which are identical or different, are alkyl or alkenyl radicals having 6 to 23 carbon atoms (noted C6-C23), which are linear or branched, or radicals —C(═O)—(C6-C23) alkyl or —C(═O)—(C6-C23) alkenyl, or more particularly —C(═O)—(C12-C20) alkyl or —C(═O)—(C12-C20) alkenyl, which are linear or branched, aryl radicals, cycloalkyl radicals, fluoroalkyl radicals, oxyethylene or oxymethylene groups which are optionally repeated, linear or branched, optionally substituted, X is an oxygen atom or an amino radical —NR3, R3 being a hydrogen atom or an alkyl radical having 1 to 4 carbon atoms, n is a positive integer from 1 to 6, preferably from 2 to 4, m is a positive integer from 1 to 6, preferably from 2 to 4, and when n>1, m may be identical or different from said n. 6. The compound of claim 1 wherein said hydrophilic polymer is selected from the group consisting of polyalkylethers, ganglioside Gm1, polyvinylpyrrolidone, polyalkyloxazoline, polyalkylacrylamide, polyalkylacrylate, polyalkylcellulose, polyaspartamide, tetritols, pentitols, hexitols, dulcitol. 7. The compound of claim 1 wherein said hydrophilic polymer is a polyethyleneglycol (PEG). 8. The compound of claim 7 wherein said polyethyleneglycol has a molecular weight ranging between about 1,000 and about 5,000 daltons (Da). 9. The compound of claim 5 which is of formula VII: in which Ri, R2, X, n and m are as mentioned in claim 5, p is a positive integer from 4 to 220. 10. The compound of claim 9 which is of formula VIII: 11. A complex comprising (a) at least one compound of claim 1 and (b) at least one substance of interest. 12. The complex of claim 11 wherein said substance of interest is selected from the group consisting of proteins and nucleic acid molecules. 13. The complex of claim 11 which further comprises: (c) at least one substituting moiety; and/or (d) at least one targeting component; and/or (e) at least one peptide which is capable of causing membrane disruption; and/or (f) at least one cationic compound selected from the group consisting of cationic lipids and cationic polymers; and/or (g) at least one colipid. 14. A composition comprising at least one compound of claim 1 and a pharmaceutically acceptable carrier therefor. 15. A method for the preparation of a pharmaceutical composition for curative, preventive or vaccine treatment of mammals comprising administering to a patient in need of such treatment an effective amount of the compound according to claim 1. 16. A method for transferring an anionic substance of interest into a cell comprising using an effective amount of the compound according to claim 1. |
Compositions for use in treating ige-associated disorders |
The present invention provides methods of treating IgE-associated disorders and products for use therein. The methods comprise administering to a subject an amount of a first composition comprising an immunogenie antigen and an amount of a second composition that inhibits the activity of IgE. The methods are particularly useful in treatment of allergies such as allergic rhinitis. These combination methods offer significant advantages, such as improving the efficacy of therapy while showing a good safety profile. |
1. A method of treating a subject having an IgE associated disorder comprising administering to the subject an amount of a first composition comprising an immunogenic antigen and administering to the subject an amount of a second composition that inhibits the activity of IgE. 2. The method according to claim 1, wherein the antigen is capable of eliciting or modulating an immune response in a human being. 3. The method according to claim 1, wherein the antigen is an allergen. 4. The method according to claim 3, wherein the allergen is administered in an amount sufficient to induce desensitization to the allergen. 5. The method according to claim 3, wherein the allergen is an aeroallergen. 6. The method according to claim 5, wherein the aeorallergen is an grass pollen. 7. The method according to claim 1, wherein the median symptom load is reduced by at least 10%, by at least 20% or even by at least 40%. 8. The method according to claim 1, wherein the days with intake of any allergy medication are reduced by at least 10%, by at least 20% or by at least 60%. 9. The method according to claim 1, wherein the median use of rescue medication is reduced by at least 10%, by at least 20% or by at least 60%. 10. The method according to claim 1, wherein the IgE associated disorder is an allergy or allergy-related disorder. 11. The method according to claim 10, wherein the IgE associated disorder is SAR. 12. The method according to claim 1, wherein the patient has an age of 6-17 years. 13. The method according to claim 10, wherein the IgE associated disorder is allergic asthma. 14. The method according to claim 1, wherein the composition that inhibits the activity of IgE comprises an anti-IgE antibody. 15. The method according to claim 14, wherein the anti-IgE antibody is a humanized murine antibody. 16. The method according to claim 15, wherein the anti-IgE antibody is Omalizumab. 17. The method according to claim 1, wherein the first composition is administered before the second composition. 18. The method according to claim 1, wherein the first composition is administered with the second composition. 19. The method according to claim 1, wherein in a first treatment period the first composition is titrated up to a maintenance dose, and in a second treatment period the second composition is administered in addition to the maintenance dose of the first composition. 20. The method according to claim 1, wherein the efficacy of treatment is monitored by the measurement of one or more suitable surrogate markers during the treatment period. 21 (canceledl): 22. A pharmaceutical composition comprising an immunogenic antigen and a composition that inhibits the activity of IgE as a combined preparation for simultaneous, separate or sequential use in the therapy of an IgE associated disorder. 23. A pharmaceutical formulation comprising a composition that inhibits the activity of IgE and a composition comprising an immunogenic antigen. 24. A method of treating an allergic response to an antigen or allergy-related disorder during antigen-specific immunotherapy of a subject comprising administering to the subject an amount of a first composition that inhibits the activity of IgE sufficient to decrease the activity of IgE in the subject and administering to the subject a second composition comprising an amount of the antigen sufficient to modulate the immune response to the antigen. 25. The method of claim 24, wherein the composition that inhibits the activity of IgE comprises an anti-IgE antibody. 26. A composition comprising an antigen for use in immunotherapy according to claim 24, wherein the antigen is at a concentration higher than acceptable for use in allergy desensitization therapy. 27. A kit comprising the composition of claim 26 in suitable packaging with instruction for proper use. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Allergy is an altered state of immune reactivity, usually denoting hypersensitivity. Hypersensitivity reactions involve humoral mediators such as interleukins and interferons, complement proteins, and immunoglobulins. One of the most common pathologic features of allergic conditions is the presence of inflammation caused by activation of the immune system. For an allergic reaction to occur, an individual must have had prior exposure to an allergen. Following the initial antigen exposure, the immune system produces IgE specific for the inciting antigen. The antigen-specific IgE then binds to mast cell membranes via IgE receptors. When re-exposed to the antigen, the antigen-specific IgE antibody binds to the antigen and activates the mast cells. Such mast cell activation causes a release of vasoactive and neuronal stimulatory mediators such as histamines, leukotrienes, prostaglandins, bradykinin, and platelet-activating factor and inflammatory mediators such as eosinophils, basophils, neutrophils, and CD4 T-lymphocytes. Allergic rhinitis is a clinical disorder characterized by nasal congestion, rhinorrhea, sneezing, and itching. Severity of these symptoms can vary from year to year, with occasional spontaneous remissions. Therefore, allergic rhinitis is classified by whether symptoms occur during certain seasons (SAR or seasonal allergic rhinitis) or year-round (PAR or perennial allergic rhinitis). The seasonal variety is usually caused by pollens from plants that depend on the wind for cross-pollination, such as grasses, trees, weeds, and mold spores. Serious complications, such as nasal polyps, recurrent sinusitis, recurrent ear infections, and hearing loss, can occur if allergic rhinitis is not treated or is undertreated. Psychosocial effects can include frequent absences from work or school, poor performance, poor appetite, malaise, and chronic fatigue. Allergic asthma as a clinical disorder that is characterized by three components: airway inflammation; airway obstruction, which is reversible; and increased sensitivity, referred to as hyperreactivity. Obstruction to airflow is measured by a decrement in forced expired volume in one second (FEV I) which is obtained by comparison to baseline spirometry. Hyperreactivity of the airways is recognized by decreases in FEVI in response to very low levels of histamine or methacholine. Hyperreactivity may be exacerbated by exposure of the airways to allergen. Generally, an optimal treatment for allergy would reduce or remove the symptoms and also correct the immune system's abnormal reactions. Use of symptomatic drugs such as antihistamines or steroids can reduce symptoms, but they do not deal with the underlying disease. Specific immunotherapy, which is also known as specific allergy vaccination, desensitization or hyposensibilisation, is a treatment option that interferes with the basic mechanisms of the allergic disease. Specific immunotherapy is used for respiratory allergies—e.g. tree pollens, grass pollens, animal dander, moulds and house dust mites. It is also effective as protection against severe allergic reactions to bee and wasp stings. Regular vaccination with minute quantities of the offending allergen in gradually increasing doses stimulates the immune system to develop an increased tolerance. In view of the above-described advantages of specific immunotherapy, it is highly desirable to further increase the efficacy of this therapeutical option in allergic disorders, while maintaining or even improving the safety profile of specific immunotherapy. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention now provides a method of treating a subject having an IgE associated disorder comprising administering to the subject an amount of a first composition comprising an immunogenic antigen and administering to the subject an amount of a second composition that inhibits the activity of IgE. In another aspect of the invention there is provided the use of a composition that inhibits the activity of IgE for the manufacture of a medicament for the treatment of a subject having an IgE associated disorder, wherein the subject is treated simultaneously or sequentially with a composition comprising an immunogenic antigen. In yet another aspect of the invention products are provided which contain a composition comprising an immunogenic antigen and a composition that inhibits the activity of IgE as a combined preparation for simultaneous, separate or sequential us in the therapy of an IgE associated disorder. Also within the scope of this invention is a pharmaceutical formulation comprising a composition that inhibits the activity of IgE and a composition comprising an immunogenic antigen. Furthermore, there is provided a method of treating an allergic response to an antigen or allergy-related disorder during antigen-specific immunotherapy of a subject comprising administering to the subject an amount of a first composition that inhibits the activity of IgE sufficient to decrease the activity of IgE in the subject and administering to the subject a second composition comprising an amount of the antigen sufficient to modulate the immune response to the antigen. detailed-description description="Detailed Description" end="lead"? |
Enzyme and snp marker for disease |
The present invention relates to an isolated nucleic acid sequence which encodes a novel protein, where the protein is a new member in a family of enzymes with peptidase activity. Also provided is the use of the nucleic acid sequence and/or protein in medicine and research, a method for diagnosing, or determining predisposition to disease, methods for preventing or treating disease, and kits for use in the methods and the use of the nucleic acid sequence, protein and inhibitors thereof in treating or preventing inflammatory diseases, and in screens for identifying new inhibitors. Also provided are nucleic acid expression vectors, host cells, screens and non-human transgenic animals. |
1. An isolated nucleic acid sequence comprising a DPP10 mRNA sequence. 2. An isolated nucleic acid sequence according to claim 1 where the sequence encodes a human DPP10, or a sequence complementary or substantially homologous thereto, or a fragment thereof 3. An isolated nucleic acid sequence according to claim 1 where the sequence encodes a mouse DPP10, or a sequence complementary or substantially homologous thereto, or a fragment thereof. 4. An isolated nucleic acid sequence according to claim 1 comprising one or more exons of DPP10, or a sequence complementary or substantially homologous thereto, or a fragment thereof. 5. (canceled) 6. (canceled) 7. A vector comprising the isolated nucleic acid sequence of claim 1 to enable in vitro or in vivo expression of DPP10. 8. A polypeptide sequence encoded by the isolated nucleic acid of claim 1 or a sequence substantially homologous thereto, or a fragment thereof. 9. A polypeptide sequence according to claim 8 where the polypeptide is a soluble DPP10 protein lacking a transmembrane domain. 10. A polypeptide according to claim 8 which is operably linked to a secretion signal. 11. A polypeptide according to claim 10 where the polypeptide comprises a Histidine tag. 12. A fusion protein comprising the polypeptide of claim 8 where the fusion protein is linked to a carrier. 13. A polypeptide sequence according to claim 8 where the polypeptide is post-translationally modified. 14. An antibody specific for the polypeptide sequence of claim 8. 15. An antibody which reacts with an antigen of a polypeptide according to claim 8. 16. An antibody according to claim 14 which is specific for the soluble form of DPP 10, the β-propeller domain, the external domain or the catalytic domain. 17. An antibody according to claim 15 which reacts with the soluble form of DPP 10, the β-propeller domain the external domain or the catalytic domain. 18. An antibody according to claim 16 where the antibody is a chimeric antibody or is humanised. 19. (canceled) 20. A process for the preparation of a nucleic acid sequence according to claim 1 comprising ligating together successive nucleotide and/or oligonucleotide residues. 21. A process for the preparation of a polypeptide according to claim 8 comprising ligating together successive amino acids and/or oligopeptides. 22. A process according to claim 21 where the polypeptide is produced in a cell free system. 23. A transgenic non-human animal comprising the vector of claim 7. 24. A transgenic non-human animal that does not substantially express DPP10. 25. A transgenic non-human animal that encodes a variant of DPP10 which results in disease. 26. A method of diagnosing, or determining susceptibility of a subject to inflammatory disease comprising determining the presence of a variant of DPP10 which is associated with a disease state, or measuring the level of DPP10, in a sample. 27. A method for diagnosing disease or predisposition to DPP10 related disease, comprising determining the presence or absence of a risk allele of a SNP at position 259007, 267901 and/or 318524 of FIG. 1, wherein presence of the risk allele is diagnostic of disease or predisposition to disease. 28. A method according to claim 27 wherein the risk allele is any nucleotide residue other than adenine at position 259007; any nucleotide residue other than adenine at position 267901 and any nucleotide residue other than thymine at position 318524 of FIG. 1. 29. A method according to claim 27 wherein the risk allele is a cytosine residue at position 259007; a guanine residue at position 267901 and a cytosine residue at position 318524 of FIG. 1. 30. A method accordingly to claim 27, further comprising determining the presence or absence of a risk allele of one or more of the SNPs of Table 1a, 1b, 1c or Table 3. 31. A method according to claim 27, wherein the method is performed on a sample. 32. A method according to claim 27 comprising removing a sample from a subject, and isolating nucleic acid therefrom. 33. A method of preventing or treating disease in a subject wherein the method comprises modulating the activity, expression, half life or post-translational modification of DPP10. 34. A method according to claim 33 where the disease is inflammatory bowel disease, asthma, atopy, rheumatoid arthritis or psoriasis. 35. A method of treating or preventing disease according to claim 33 comprising determining the presence or absence of a risk allele of a SNP at position 259007, 267901 and/or 318524 of FIG. 1; and if a risk allele is present, administering treatment in order to prevent, delay or reduce the disease. 36. A method according to claim 35 where the treatment comprises administration to a subject of an agent capable of modulating the effects of the risk allele. 37. A method according to claim 35 where the disease is inflammatory disease, such as inflammatory bowel disease, asthma, atopy, rheumatoid arthritis or psoriasis. 38. An isolated nucleic acid molecule comprising a SNP in a DPP10 nucleic acid molecule. 39. An isolated nucleic acid molecule as claimed in claim 38 comprising part of a sequence of FIG. 1, and comprising one or more SNPs at positions which correspond to the positions of FIG. 1 listed in any one or more of Tables 1a, 1b, 1c or 3. 40. An isolated nucleic acid molecule comprising a SNP at the position corresponding to position 318524 of FIG. 1, or at the position corresponding to position 259007 of FIG. 1, or at the position corresponding to position 267901 of FIG. 1. 41. An isolated nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid of claim 38. 42. An isolated nucleic acid molecule according to claim 41, which is capable of distinguishing between alleles of a SNP of Table 1. 43. A primer sequence as described in Table 2. 44. A vector comprising an isolated nucleic acid molecule of claim 38. 45. A host cell comprising the vector of claim 44. 46. A polypeptide sequence encoded by the isolated nucleic acid of claim 38 or a sequence substantially homologous thereto, or a fragment thereof. 47. A polypeptide sequence according to claim 46 where the polypeptide is a soluble DPP10 protein lacking a transmembrane domain. 48. A polypeptide soluble DPP10 protein according to either claim 47 which is operably linked to a secretion signal. 49. A polypeptide according to claim 48 where the polypeptide comprises a Histidine tag. 50. A fusion protein comprising the polypeptide of claim 46 where the polypeptide or fusion protein is linked to a carrier. 51. A polypeptide sequence according to claim 46 where the polypeptide is post-translationally modified. 52. An antibody specific for the polypeptide sequence of claim 46. 53. An antibody which reacts with an antigen of the polypeptide according to claim 46. 54. An antibody according to claim 52 where the antibody is a chimeric antibody or humanised or bifunctional. 55. (canceled) 56. A host cell comprising the vector of claim 7 for producing recombinant DPP10 gene products, or for use in the regulation or analysis of DPP10. 57. A host cell comprising the vector of claim 7 for producing recombinant DPP10 gene products, or for use in drug screening systems to identify agents for use in diagnosis or treatment of individuals having or being susceptible to inflammatory disease. 58. (canceled) 59. A transgenic non-human animal comprising the isolated nucleic acid molecule of claim 38. 60. A kit for diagnosis of disease or predisposition to disease, comprising a means for determining the presence or absence of a risk allele of a SNP of Table 1a, 1b, 1c or Table 3, wherein the risk allele is diagnostic of disease or predisposition to disease. 61. A kit accordingly to claim 60, comprising means for determining the presence or absence of a risk allele of a SNP at position 259007, position 267901, and/or position 318524 of FIG. 1. 62. A method of identifying a compound for treatment of disease, comprising (a) administering a compound to tissue comprising an isolated nucleic acid molecule comprising a SNP at a position listed in Table 1a, 1b, 1c or Table 3; and (b) determining whether the compound modulates downstream effects of the SNP. 63. (canceled) 64. (canceled) 65. A pharmaceutical composition comprising a polypeptide according to claim 8. 66. A pharmaceutical composition comprising an antibody according to claim 14. 67. A screen for identifying an agent which modulates DPP10 activity comprising: providing a DPP10 polypeptide sequence as claimed in claim 8; providing a DPP10 substrate; providing an agent to be tested; measuring whether the agent to be tested modulates DPP10 by measuring processing of the DPP10 substrate. 68. A screen according to claim 67 where the substrate is a molecule having the XPXS motif, a molecule having the generic formula of NH2X—P(X)yS—(X)n, or a chemokine. 69. A screen according to claim 68 where the XPXS motif or the generic formula NH2X—P(X)yS—(X)n is present in a small peptide molecule. 70. A screen according to claim 67 where the substrate is fluorescently labelled. 71. A screen according to claim 67 where the DPP10 polypeptide is purified. 72. A screen according to claim 67 where the measurement of the processing of the substrate comprises measuring protease activity. 73. A screen according to claim 67 where the DPP10 polypeptide is expressed by a cell. 74. A screen according to claim 67 where the agent to be tested is a non-biological molecule or a biological molecule. 75. A screen for identifying an agent which modulates DPP1O activity comprising: providing a DPP10 polypeptide as claimed in claim 8; providing an agent to be tested; providing a first cell; and measuring whether the agent to be tested modulates DPP10 by measuring adhesion of the cell to a surface. 76. A screen according to claim 75 where the surface is the surface of a second cell. 77. A screen according to claim 75 where the surface comprises a non-biological molecule. 78. A screen according to claim 75 where the surface is a biological molecule. 79. A screen according to claim 75 where one or more of the first cells are immobilized. 80. A screen according to claim 75 where one or more of the first cells are a lymphocyte. 81. A screen according to claim 75 where one or more of the first cells is a cell transfected with a vector comprising an isolated nucleic acid sequence comprising a DPP10 mRNA sequence. 82. A screen for identifying an agent which modulates DPP10 activity comprising: providing a DPP10 polypeptide as claimed in claim 8; providing an agent to be tested; providing a cell; measuring a change in differentiation or proliferation of the cell. 83. A screen according to claim 82 where the cell is expressing the DPP10 polypeptide. 84. A screen according to claim 82 where the cell is a T-lymphocyte. 85. A screen according to claim 82 where the change in cellular differentiation is T-cell activation. 86. A screen according to claim 82 where the change in cellular differentiation involves a change in expression of a cell signalling factor. 87. A screen according to claim 86 where the cell signalling factor is an immunomodulator or a peptide regulatory factor. 88. A screen according to claim 82 where the cell is cultured following removal from a patient or experimental animal. 89. A screen for identifying an agent which modulates DPP10 activity comprising: providing a transgenic animal according claim 23; providing an agent to be tested; contacting the transgenic animal with the agent to be tested; detecting a change in the transgenic animals phenotype. 90. A screen according to claim 89 where the change in phenotype involves a change in T-cell phenotype. 91. A screen according to claim 89 where the change in phenotype involves a change in B-cell phenotype. 92. A screen for detecting a side effect associated with the use of an agent which modulates DPP10 comprising: providing a cell which does not substantially express DPP10; providing an agent to be tested; contacting the agent to be tested with with the cell; and measuring any side effect produced by the agent on the cell. 93. A screen according to claim 92 where the side effect involves a change in cell differentiation. 94. A screen according to claim 92 where the side effect involves a change in cell proliferation. 95. A screen according to claim 92 where the cell is part of a transgenic animal. 96. A screen according to claim 92 where the side effect is a measure of the change of phenotype. 97. A screen for identifying an agent which modulates DPP10 activity comprising: providing a DPP10 nucleic acid according to claim 1; providing an agent to be tested; measuring whether the agent to be tested modulates DPP10 by measuring the interaction of the agent with the sample of nucleic acid. 98. A screen according to claim 97 where the screen is an in vitro transcription assay measuring transcription of DPP10. 99. (canceled) |
Application of fluid bed technology in brewing |
The aim of the invention is firstly to dry the wort necessary for beer production and subsequently to re-dissolve the above for the further processing, in particular, the fermentation. According to the invention, the application of fluid bed technology is particularly suitable for the production of dried wort, in particular fluid-bed drying and fluid-bed coating. The advantage of said method for the production of granulates is that no loss of quality in the wort occurs during suitable temperature changes during the drying. The granulate can thus be coated with one or several further coatings, in particular with further flavourings. Above all flavourings can be encapsulated within the dried wort, such that the above is not lost on storage and possible transport. |
1-30. (Canceled) 31. Method for the production of dried original wort for use in the production of brewed and fermented beverages comprising: a) conditioning of brew water, b) grinding of malt, c) mashing for dissolving malt content substances in the brew water and for the degradation of high-molecular, organic substances in a water soluble form by enzymes of the malt, whereby a mash is produced, d) lautering for separating soluble contents of the mash from insoluble contents, e) wort cooking for evaporating water for adjusting an original wort content, separating high-molecular protein, inactivating the enzymes for fixing composition of the original wort, sterilizing the original wort, isomerization of hops bitter substances, formation of flavorings and removal of undesired flavorings, f) hot trub separation for separating hot trub contained in the original wort, g) vacuum evaporation for withdrawal of water from the original wort, and h) drying and granulating the original wort by application of a fluid bed whereby original flavor thereof is preserved. 32. Method according to claim 31, further comprising adding at least one flavoring to the original wort granulate. 33. Method according to claim 31, wherein the granulating comprises at least one of encapsulation, compacting and agglomeration. 34. Method according to claim 31, wherein the malt is produced by a method comprising at least one of steeping, germination and kilning. 35. Method according to claim 31, wherein at least one of the following cereals or substances is used as starting material for production of the original wort or the malt: barley, wheat, rye, spelt, emmer, maize, rice, sorghum, other malted or unmalted cereals and sugar. 36. Method according to claim 31, wherein at least one of highly concentrated beer wort, sugar, cereal flour, hops, hops compounds and flavorings is used as germ bud. 37. Method according to claim 31, wherein the dried original wort has a water content of not more than 5 weight percent. 38. Method according to claim 31, wherein water recovered during the drying or granulating is recycled for preparation of an additional quantity of the beverage. 39. Method according to claim 31, wherein vacuum evaporation is carried out during wort cooking. 40. Apparatus for production of dried original wort for use in production of brewed and fermented beverages comprising: a) a brew water conditioning plant for providing brew water, b) a grinding mill for grinding malt, c) a mash tun or a mash kettle for dissolving malt content substances in the brew water and for degradation of high-molecular organic substances in a water soluble form by enzymes of the malt, whereby a mash is produced, d) a lauter tun for separating soluble parts of the mash from insoluble parts, e) a wort kettle for wort cooking for evaporating water in order to adjust an original wort content, separate high-molecular protein, inactivate enzymes for fixing the composition of the original wort, sterilize the original wort, isomerize hops bitter substances, form flavorings and remove undesired flavorings, f) a whirlpool for separating the hot trub contained in the original wort, g) a vacuum evaporator for withdrawing water from the original wort, and h) apparatus for drying the original wort, the apparatus for drying the original wort comprising a fluid bed. 41. Apparatus according to claim 40, further comprising apparatus for recycling water which has been recovered during the drying or granulating. 42. Method according to claim 31, for use in the production of beer, wherein the application of a fluid bed comprises at least one of fluid bed drying, fluid bed granulating, fluid bed spray granulating and fluid bed coating. 43. Method according to claim 32, wherein the flavoring comprises at least one of sugars, hops and yeast. 44. Method according to claim 31, wherein the dried original wort has a water content of not more than 2 weight percent. 45. Method according to claim 31, wherein the dried original wort has a water content of not more than 1 weight percent. 46. Method according to claim 39, wherein the vacuum evaporation is carried out at the end of wort cooking. 47. Method according to claim 40, wherein the apparatus comprising a fluid bed comprises at least one of a fluid bed drying plant, a fluid bed granulation plant, a fluid bed spray granulation plant and a fluid bed coating plant. |
Right angle measuring device |
The invention concerns a device comprising a flexible and non-elastic yarn divided by at least three retaining means fixed to predetermined locations and at least three fixing means adapted to support the retaining means and whereof the diameter of each fixing means is substantially equal to the internal diameter of the retaining means so as to position the yard along a direction perpendicular to that of the axis of the corresponding fixing means. |
1. A device designed to materialize limits perpendicular to existing or future limits, characterized in that it comprises a flexible and inelastic material divided by at least three retaining means fixed at predetermined locations, and at least three fixing means adapted to support the retaining means the diameter of each fixing means being substantially equal to the an inside diameter of the retaining means so as to position the material along a direction perpendicular to the direction of an axis of the corresponding fixing means. 2. The device according to claim 1, characterized in that it comprises a flexible and inelastic material divided by rings to form strands, at least three rings fixed on the material at predetermined locations starting from one end of the material, a predetermined length of material remaining free beyond the third location, and at least three plugs adapted to support the rings and the diameter of each plug being substantially equal to an inside diameter of the ring so that the material can be positioned along a direction perpendicular to the direction of the axis of the corresponding plug, the fixing locations of the rings on the material being chosen such that when the material is tensioned between the rings, the remaining length of the material is free to form a first end of a right angled triangle in which the hypotenuse and the third side are defined by the two distances between the first and second fixing locations and between the second and third fixing locations. 3. The device according to claim 2, characterized in that a fourth retaining means is fixed at the end of the predetermined length of material beyond the third location, so that it can be superposed on the first ring at end of material to form the first side of the triangle. 4. The device according to claim 2, characterized in that the rings are sized so that each ring fits on each plug, the diameter of which is substantially equal to the inside diameter of the ring, whereas an angular window is formed on the periphery of plug delimiting an angular sector between the ring and the plug enabling positioning of the material in a direction perpendicular to the axis of the plug, using a terminal loop of the material around the ring and penetrating into the sector. 5. The device according to claim 2, characterized in that the ring is circular and bears on a shoulder of the plug. 6. The device according to claim 2, characterized in that an axial hole is arranged in each plug, to place it on a support. 7. The device according to claim 6, characterized in that the axial hole is prolonged by an axial reaming adapted to receive a headless nail to fix the plug on a hard surface. 8. The device according to claim 2, characterized in that the ring delimits a peripheral shape configured so as to define a characteristic angle or a right angle in the material. 9. The device according to claim 2, characterized in that at least two shoulders are formed on each plug forming concentric stages which can hold rings with dimensions corresponding to right angled triangles with different complementary angles, or with dimensions adapted to the application considered. 10. The device according to claim 1, characterized in that sets of rings with different colors and/or shapes are fixed to the material at appropriate locations, such that there is a right angled triangle with determined complementary dimensions and angles, for each different set of rings. 11. The device according to claim 2, characterized in that two rings with different diameters are fixed beyond the first four rings on the material at distances calculated so that it is possible to make a right angled triangle either with the first four rings with complementary angles of 30 degrees and 60 degrees, or using the first ring and the last three rings to form a right angled triangle with two complementary angles of 45 degrees each. 12. The device according to claim 1, characterized in that the length of the material is connected to the fixing location to form a material loop. 13. A device designed to materialize limits perpendicular to existing or future limits according to claim 1, characterized in that it comprises a housing in the form of a right angled triangle, at least one winder guided in rotation inside the housing, at least one flexible and inelastic material, at least three retaining means fixed on the material at predetermined locations starting from one end of the material, and at least three fixing means adapted to support the corresponding retaining means. 14. The device according to claim 13, characterised in that the retaining means is an eyelet forming a small diameter ring. 15. The device according to claim 13, characterized in that the fixing means are plugs, pegs or headless nails for which the diameter is substantially equal to the diameter of the retaining means. 16. The device according to claim 13, characterized in that it comprises a housing in the form of a right angled triangle comprising a winder guided in rotation and on which a flexible and inelastic material is wound, arranged in a loop. 17. The device according to claim 14, characterized in that the flexible material comprises at least one set of three eyelets forming small rings, each set of eyelets being identified with a different colour to materialize different sizes of right angled triangles. 18. The device according to claim 13, characterized in that a hole is drilled in the housing is at the vertex of the right angle to keep it in position with a fixing means. 19. The device according to claim 13, characterized in that two marks are made at the vertex of the right angle on the housing, materializing the alignment of the tensioned material. 20. The device according to claim 16, characterized in that the material is crimped to the winder at one of its ends, while the other end is crimped free to move around a pin fixed to one of the ends of the housing forming one of the sides of the right angle to form a material loop. 21. The device according to claim 16, characterized in that a window is located near the periphery of the housing through which the material passes and that is large enough to allow the eyelets to pass through when the device is being put into place. 22. The device according to claim 16, characterized in that the housing comprises a recess near the window, a pin being fixed in the recess to attach the third eyelet of each set. 23. The device according to claim 16, characterized in that the eyelets in each set are crimped on the material at distances such that when the device is in place, it defines a large right angled triangle. 24. The device according to claim 13, characterized in that it comprises a housing in the shape of a right angled triangle, three winders inside the housing being guided in rotation, a flexible and inelastic material being wound around these winders, at least two of the winders being able to completely come out of the housing in order to form the ends of the sides of the right angle of the housing, while the lengths of the three portions of flexible, inelastic material that connect the winders in pairs are calculated such that when they are tensioned and in contact with their stops, they form a right angled triangle materialized both by the tensioned material and by the pegs or headless nails passing through the retaining means fixed to the material. 25. The device according to claim 24, characterized in that a hole in each of the mobile winders holds them in position using headless nails or pegs. 26. The device according to claims 13, characterized in that it comprises a housing in the form of a right angle triangle comprising a first straight edge and a second straight edge perpendicular to the first straight edge, retaining means crimped onto the material and the outside diameter of which is in line with the said edges of the housing. 27. The device according to claim 24, characterized in that the mobile winders comprise an outside edge that is in line with the straight edges of the housing when it is in position. |
Novel vaccine |
The present invention relates to intradermal delivery of influenza vaccines, specific influenza formulations and methods for preparing and using them. |
1. An intradermal delivery device for the intradermal delivery of a flu vaccine, the device comprising: i a container comprising a flu vaccine and having an outlet port; ii a needle in fluid communication with the outlet port, the needle having a forward end that is adapted to penetrate skin; and iii a limiter that surrounds the needle and has a skin engaging surface that is adapted to be received against the skin to receive an intradermal injection, the needle forward end extending beyond the skin engaging surface a selected distance such that the limiter portion limits an amount that the needle is able to penetrate through the skin. 2. The device of claim 1, wherein the drug container is a syringe including a generally hollow, cylindrical body portion and a plunger that is received within the reservoir, the plunger being selectively movable within the reservoir to cause the substance to be forced out of the outlet port during an injection. 3. The device of claim 1, including a hub portion that supports the needle and the hub portion is selectively secured to the drug container near the outlet port. 4. The device of claim 1, wherein the drug container is a syringe having a resevoir adapted to contain the vaccine, the syringe including a generally flat body portion that at least partially surrounds the reservoir, the body portion and the reservoir being made from two sheets of thermoplastic material such that side wails of the reservoir are selectively deflected toward each other to expel a substance from the reservoir during an injection. 5. The device of claim 4, including a hub that supports the needle and is selectively secured to the syringe near the outlet port and a receiver adjacent the outlet port that is generally circular and the hub is completely received within the receiver and wherein the limiter is integrally formed with the receiver such that the limiter is permanently supported by the body portion adjacent the outlet port. 6. The device of claim 5, wherein the skin engaging surface surrounds the needle, and has a thickness defined between an inner diameter and an outer diameter and wherein the inner diameter is at least five times greater than an outside diameter of the needle. 7. The device of claim 6, wherein the skin engaging surface is generally circular. 8. The device of claim 5, wherein the needle forward end extends away from the hub in a first direction and a needle back end extends away from the hub in a second direction, and including a sealing membrane that closes off the outlet port and wherein the needle back end pierces the sealing membrane when the hub is received by the receiver. 9. The device of claim 4, including a hub that supports the needle and is selectively secured to the syringe near the outlet port and a receiver adjacent the outlet port that is generally circular and the hub is completely received within the receiver and wherein the limiter is formed separately from the receiver and is at least partially received by the receiver. 10. The device of claim 9, wherein the limiter and the hub are integrally formed into a single piece structure. 11. The device of claim 1, wherein the needle has a length and wherein the selected distance is much less than the needle length. 12. The device of claim 11, wherein the selected distance is fixed and is in the range from approximately 0.5 mm to approximately 3 mm. 13. The device of claim 1, wherein the skin engaging surface is generally flat and extends through a plane that is generally perpendicular to an axis of the needle. 14. The device of claim 1, wherein the skin engaging surface includes a central opening that is slightly larger than an outside dimension of the needle and the skin engaging surface is continuous. 15. The device of claim 1, wherein the skin engaging surface includes a contact surface area that is large enough to stabilise the assembly in a desired orientation relative to the skin. 16. The device of claim 1, wherein the desired orientation is generally perpendicular to the skin. 17. The device of claim 1, wherein the drug container is pre-filled with a substance. 18. A kit for use in intradermal flu vaccine delivery comprising: i a vaccine container comprising a flu vaccine and ii a hypodermic needle assembly, the assembly comprising: a hub portion that is able to be attached to a drug container; a needle supported by the hub portion, the needle having a hollow body with a forward end extending away from the hub portion; and a limiter portion that surrounds the needle and extends away from the hub portion toward the forward end of the needle, the limiter portion having a skin engaging surface that is adapted to be received against the skin of an animal to receive an intradermal injection, the needle forward end extending beyond the skin engaging surface a selected distance such that the limiter portion limits an amount that the needle is able to penetrate through the skin of an animal. 19. The kit according to claim 18, wherein the hub portion and the limiter portion are integrally formed as a single piece made from a plastic material. 20. The kit according to claim 18, wherein wherein the hub portion and the limiter portion are formed as separate pieces. 21. The kit according to claim 20, wherein the limiter portion includes an inner cavity that receives at least a portion of the hub portion and the inner cavity includes an abutment surface that engages corresponding structure on the hub portion to thereby limit the amount that the needle forward end extends beyond the skin engaging surface. 22. The kit according to claim 20, wherein the limiter portion is integrally formed as part of the syringe and the hub portion is received within the limiter portion. 23. The kit according to claim 22, wherein the skin engaging surface surrounds the needle, and has a thickness defined between an inner diameter and an outer diameter and wherein the inner diameter is at least five times greater than an outside diameter of the needle. 24. The kit according to claim 23, wherein the skin engaging surface is generally circular. 25. The kit according to claim 18, wherein the skin engaging surface includes a central opening that is slightly larger than an outside diameter of the needle and the skin engaging surface is continuous. 26. The kit according to claim 18, wherein the skin engaging surface is generally flat and extends through a plane that is generally perpendicular to an axis of the needle. 27. The kit according to claim 18, wherein the selected distance that the forward end of the needle extends beyond the skin engaging surface is fixed. 28. The kit according to claim 18, wherein the selected distance is in the range from approximately 0.5 mm to approximately 3 mm. 29. The kit according to claim 18, wherein the skin engaging surface includes a contact surface area that is large enough to stabilise the assembly in a desired orientation relative to the skin. 30. The kit according to claim 29, wherein the desired orientation is generally perpendicular to the skin. 31. The kit according to claim 18, wherein the drug container is a syringe and the animal is human. 32. A device according to any of claims, or a kit according to any of claims 1-31, wherein the flu vaccine is obtainable by the following process: (i) harvesting of virus-containing material from a culture; (ii) clarification of the harvested material to remove non-virus material; (iii) concentration of the harvested virus; (iv) a further step to separate whole virus from non-virus material; (v) splitting of the whole virus using a suitable splitting agent in a density gradient centrifugation step; (vi) filtration to remove undesired materials; wherein the steps are performed in that order but not necessarily consecutively. 33. A device or kit according to claim 32, wherein the intradermal flu vaccine is a trivalent non-live vaccine. 34. A device or kit according to claim 32, wherein the virus is grown on embryonated hen eggs and the harvested material is allantoic fluid. 35. A device or kit according to claim 32, wherein the clarification step is performed by centrifugation at a moderate speed. 36. A device or kit according to claim 32, wherein the concentration step employs an adsorption method such as CaHPO4 adsorption. 37. A device or kit according to claim 32, wherein the further separation step (iv) is a zonal centrifugation separation using a sucrose gradient. 38. A device or kit according to claim 32, wherein the splitting step is performed in a further sucrose gradient, wherein the sucrose gradient contains the splitting agent. 39. A device or kit according to claim 38, wherein the splitting agent is sodium deoxycholate. 40. A device or kit according to claim 32, wherein the filtration step (vi) is an ultrafiltration step which concentrates the split virus material. 41. A device or kit according to claim 32, wherein there is at least one sterile filtration step, optionally at the end of the process. 42. A device or kit according to claim 32, wherein an inactivation step is performed prior to the final filtration step. 43. A device or kit according to claim 32, wherein the method comprises the further step of adjusting the concentration of one or more detergents in the vaccine composition. 44. A device or kit according to claim 32, wherein the vaccine is provided in a dose volume of between about 0.1 and about 0.2 ml. 45. A device or kit according to claim 32, wherein the vaccine is provided with an antigen dose of 1-5 μg haemagglutinin per strain of influenza present. 46. A device or kit according to claim 32, wherein the vaccine meets the EU criteria for at least two strains. 47. A device or kit according to claim 32, wherein the vaccine further comprises a bile acid or cholic acid, or derivative thereof such as sodium deoxycholate. 48. A device or kit according to claim 32, wherein the vaccine comprises at least one non-ionic surfactant. 49. A device or kit according to claim 32, wherein the at least one non-ionic surfactant selected from the group consisting of the octyl- or nonylphenoxy polyoxyethanols (for example the commercially available Triton™ series), polyoxyethylene sorbitan esters (Tween™ series) and polyoxyethylene ethers or esters of general formula (I): HO(CH2CH2O)n-A-R (I) wherein n is 1-50, A is a bond or —(O)—, R is C1-50 alkyl or phenyl C1-50 alkyl; and combinations of two or more of these. 50. A device or kit according to claim 49, wherein the vaccine comprises a combination of polyoxyethylene sorbitan monooleate (Tween 80) and t-octylphenoxy polyethoxyethanol (Triton X-100). |
Chain wheel |
A chain wheel for a chain drive, in particular for a control drive of an internal combustion engine, comprising a basic body and a gear rim arranged thereon, the basic body and/or said gear rim being produced at least in certain areas thereof from at least one duroplastic material. |
1-9. (Cancelled). 10. A chain wheel (1) for a chain drive, in particular for a control drive of an internal combustion engine, comprising a basic body (2) and a gear rim (3) being produced at least in certain areas thereof from at least one duroplastic material, the basic body (2) comprises a duroplastic material whose damping properties are different from the damping properties of the duroplastic material of the gear rim (3). 11. A chain wheel (1) according to claim 10, which consists fully of at least one duroplastic material. 12. A chain wheel (1) according to claim 10, wherein the surfaces of the basic body (2) and of the gear rim (3) are formed by a duroplastic-material forming process such that no post-processing steps are required. 13. A chain wheel (1) according to claim 10, wherein all the surfaces are formed by a duroplastic-material forming process such that no post-processing steps are required. 14. A chain wheel (1) according to claim 10, wherein the at least one duroplastic material is a phenolic resin-based plastic comprising at least one filler. 15. A chain wheel (1) according to claim 14, wherein the at least one duroplastic material has a high thermal stability of up to at least 160° C. 16. A chain wheel (1) according to claim 14, wherein the at least one filler is selected from the following group: glass fibres glass balls mineral matter graphite PTFE MoS2. 17. A chain wheel (1) according to claim 15, wherein the at least one duroplastic material has a high thermal stability of up to at least 140° C. |
Method for manufacturing stent-grafts |
A sewing machine is provided which is capable of sewing reinforcing wire to tubular grafts in order to form stent grafts. A bobbin (which may be seated in a shuttle) carries a bottom thread through the bore of the tubular graft and forms a stitch in combination with a top thread carried on a needle which pierces the graft wall. |
1-27. (canceled) 28. A method for attaching reinforcement wire to the surface of a medical implant, comprising the steps of: a. determining the position at which the wire is to be attached, b. locating the wire proximate said position, c. employing a needle to move the wire closer to said position, and d. employing said needle to make a stitch in the surface. 29. A method as claimed in claim 28, wherein the needle is provided on a mechanized sewing machine. 30. A method as claimed in claim 28, wherein the needle is: a. positioned on the side of the wire opposite to the position at which the wire is to be attached, with the tip of the needle disposed between the plane of the surface and the plane of the tangent of the wire parallel to the plane of the surface, b. moved towards said position such that it contacts the wire and moves it closer to said position, and c. moved substantially perpendicular to the surface to make a stitch therein. 31. A method as claimed in claim 28, wherein: a. the steps of claim 28 are cyclically repeated, and b. the needle is employed in the second cycle to move the wire closer to the stitch formed in the first cycle, with the thread passing over the wire from the first to the second stitch, thereby attaching the wire to the surface close to or at the said position. 32. A method as claimed in claim 28, wherein the implant is a tubular graft. 33. An apparatus for attaching reinforcement wire to the surface of a medical implant, comprising: a. a support for the implant, b. a needle to drive a first thread through the surface, c. a bobbin for carrying a second thread to make a stitch in combination with the first thread, and c. means for locating the wire proximate to the position at which the wire is to be attached to the surface, wherein the needle is moveable perpendicular and parallel to the plane of the implant surface, whereby the needle can be employed to move the wire closer to said position before making a stitch. 34. An apparatus as claimed in claim 33, additionally comprising means for determining the level of the graft surface and controlling the height of the needle relative to said level. 35. An apparatus as claimed in claim 33, wherein the needle and the bobbin are disposed so that the longitudinal axes thereof lie in a common plane. 36. An apparatus for stitching thread to the wall of a tubular medical implant, comprising: a. a support for the implant, b. a needle to drive a first thread through the wall and into the bore of the implant, and c. a bobbin for carrying a second thread through an open end of the implant into said bore in order to form a stitch in combination with the first thread, wherein the needle and the bobbin are disposed so that the longitudinal axes thereof lie in a common plane. 37. An apparatus as claimed in claim 36, wherein an elongate bobbin support is provided to support the bobbin inside the bore of the implant. 38. An apparatus as claimed in claim 36, wherein the bobbin support is a rod having a recess in which the bobbin can be seated. 39. An apparatus as claimed in claim 36, wherein the bobbin support is a runner in which the bobbin is free to move into and out of said bore. 40. An apparatus as claimed in claim 39, in which the runner is in the form of a tube with a slot provided therein to allow the needle access to the bobbin through the slot. 41. An apparatus as claimed in claim 36, in which the bobbin sits in a shuttle. 42. An apparatus as claimed in claim 41, wherein the shuttle is an elongate element with a D-shaped cross section for at least part of its length. 43. An apparatus as claimed in claim 36, additionally comprising means for tensioning the first thread, wherein the means for tensioning operates independently of the mechanism for driving the needle. 44. A method for stitching thread to the wall of a tubular medical implant, comprising the steps of: a. driving a first thread through the wall and into the bore of the implant using a needle, b. forming a loop of the first thread, c. moving a bobbin carrying a second thread through an open end of the implant into said bore, d. passing the second thread through the loop formed in the first thread, e. closing said loop in order to form a stitch, and f. withdrawing the bobbin from said bore, wherein the bobbin and the needle are disposed so that the longitudinal axes thereof lie in a common plane, and wherein the needle is withdrawn sufficiently before the second thread is passed through said loop so that the bobbin and the needle do not make contact. 45. A method as claimed in claim 44, wherein said loop is formed in the first thread by beginning to withdraw the needle, but wherein the end of the needle is withdrawn completely from the bore only after the shuttle has engaged said loop. 46. A method for attaching reinforcement wire to the wall of a tubular medical implant, comprising the steps of: a. positioning the wire proximate the intended attachment point, b. driving a first thread through the wall and into the bore of the implant using a needle, c. forming a loop of the first thread, d. moving a bobbin along the longitudinal axis of the graft in order to carry a second thread through the loop formed in the first thread, e. closing said loop in order to form a first stitch, f. withdrawing the needle from the implant, g. moving the needle to a position on the side of the wire opposite to the first stitch, and h. repeating the foregoing steps b-e to form a second stitch. 47. A method as claimed in claim 46, additionally comprising the steps of: a. determining the position at which the wire is to be attached, b. locating the wire proximate said position, c. employing a needle to move the wire closer to said position, and d. employing said needle to make a stitch in the surface. 48. A method as claimed in claim 46, wherein all of the said steps are carried out under the control of a first program. 49. A method as claimed in claim 46, wherein the method steps are repeated a plurality of times in order to form a plurality of stitches in the graft. 50. A method as claimed in claim 49, wherein the number and position of said plurality of stitches is controlled by means of a second program. 51. A method as claimed in claim 50 wherein the second program can control the first. 52. A method as claimed in claim 50 wherein the first and second programs are in the form of computer software. 53. A method as claimed in claim 46, wherein the needle is employed to deform the wire into a required configuration. 54. A method as claimed in claim 46 wherein said configuration is a zig-zag. |
Breast cancer-associated genes and uses thereof |
The present invention relates to seven isolated breast cancer-associated (BCA) polynucleotides, polypeptides, and variants thereof. The invention also relates to BCA antagonists. The invention also encompasses pharmaceutical compositions comprising BCA polynucleotides, BCA polypeptides, or BCA antagonists. The invention also contemplates methods for preventing or treating cancer, particularly breast cancer, comprising administering to a patient in need of such treatment a composition comprising a BCA polynucleotide, polypeptide, antagonist, or variant thereof. The invention also relates to methods for diagnosing, staging or determining a prognosis of a BCA-related disorder. |
1. An isolated polynucleotide comprising: (a) the nucleotide sequence of the human BCA3 gene according to SEQ ID NO: 5; (b) a nucleotide sequence that encodes a human BCA3 polypeptide; (c) a nucleotide sequence that encodes the BCA3 polypeptide according to SEQ ID NO:6, 20, or 22; (d) at least 12 consecutive bases of the human BCA3 gene, wherein said polynucleotide is not F29989, BG754249, BG654786, AU146189, AU145473, AV729000, AV725974, BE349302, BE205860, AW406755, AW339687, AI635272, AI365988, BM469324, BM558580, AW510839, BF337353, AA640772, AL599210, AL571890, BF913170, BE149796, BG681808, AA478355, BE304890, BI058894, BM042507, BG773327, AA521399, AA521323, AI873852, BI030630, BI023028, BG819532, BE909262, BE293845, BE293802, AW675725, AW193295, F19258, AI358229, AA478297, BG566176, AJ400877, NM—020642, or BM449949; or (e) a nucleotide sequence that is a complement of (d). 2. An isolated polynucleotide comprising a nucleotide sequence of 640 bases in length that hybridizes under highly stringent conditions to: (a) a nucleotide sequence complementary to the coding region of the human BCA3 gene; or (b) the nucleotide sequence of a human BCA3 mRNA. 3. An isolated polynucleotide comprising a nucleotide sequence encoding a fragment of the human BCA3 protein, wherein said fragment displays one or more functional activities. 4. An isolated polynucleotide comprising a BCA1 nucleotide sequence, herein said sequence is selected from the group consisting of residues 1-2659, 1-2500, 1-2000, 1-1500, 1-1000, 1-500, 1-124, 2516-2659, 2500-2659, 2000-2659, 1500-2659, 1000-2659, 500-2659, 124-2659, 363-377, 551-674 of SEQ ID NO: 1,5′-CCGCCGCCGCCATAT-3′ (SEQ ID NO.: 29), and 5′-TGTGTGATCTGTATGATGGACTTTGTTTATGGGGACCCAATTCGATTTCTGCCGTGCATGCACATCTATCACCTGGACTGTATAGATGACTGGTTGATGAGATCCTTCACGTGCCCCTCCTGC-3′ (SEQ ID NO.:30). 5. An isolated polynucleotide comprising a BCA2 nucleotide sequence, wherein said sequence is selected from the group consisting of residues 1-2176, 1-2000, 1-1500, 1-1000, 1-500, 1-100, 2000-2176, 1500-2176, 1000-2176, 500-2176, 100-2176, 768-782, 980-1052 of SEQ ID NO: 3, 5′-ATGGACAACTGTTTGGCGA-3′ (SEQ ID NO.:31), AGGGAAGACCAGGTCCACGC-3′ (SEQ ID NO: 46), 5′-AACCCTGGGGACTAT-3′ (SEQ ID NO: 47), 5′-AACCCTGGGGACTAT-3′ (SEQ ID NO.:32) and 5′-CCAAATGCCTCTTATCCCTGAATTCAGAGTGATAATTTTATAAGTGTGAAACTTAATTATGTAGGGCTCCCCCCGTCTGAATAGAATTAATTCCTTAAAGTCTAGTTAGGGTCCTGCTGTCTGTCATGTTGCCTTGTAACGGATGTTTCCACCTCCTTCTCCAACCTCTACCCCACCATTAGTGTATTTTACTATAAAAACAGTGGAACCACAGCCCTAAAGTCCTGCTGATATAAAGTCCTTTTGTCTTAATTGTATTTAAAAAAAAAAAAAAAACTACTCTTGATCACATTAGCTATG-3′ (SEQ ID NO.:33). 6. An isolated polynucleotide comprising a BCA3 nucleotide sequence, wherein said sequence is selected from the group consisting of residues 1-1756, 1-1686, 1-1500, 1-1000, 1-500, 1-100, 1686-1756, 1500-1756, 1000-1756, 500-1756, 100-1756, 399-410, 446-457, 606-617, 618-629, 630-641 of SEQ ID NO: 5, 5′-TATTATTCATCT-3′ (SEQ ID NO.:34), 5′-TATCACAGAGGC-3′ (SEQ ID NO.:35), 5′-TACATAGAAGTA-3′ (SEQ ID NO.:36), 5′-TATCCAGGGACC-3′ (SEQ ID NO.:37), and 5′-TATTCTGTCACT-3′ (SEQ ID NO.:38). 7. An isolated polynucleotide comprising a nucleotide sequence of at least 12 consecutive bases encoding a portion of a domain of a human BCA1 polynucleotide or polypeptide, wherein said domain is selected from the group consisting of a RING H2 finger, PY motif, glycosylation site, phosphorylation site, SH2-binding motif, open-reading frame, exon 1, exon 2, exon 3, intron 1, intron 2, 5′ untranslated region, and 3′ untranslated region. 8. An isolated polynucleotide comprising a nucleotide sequence of at least 12 consecutive bases encoding a portion of a domain of a human BCA2 polynucleotide or polypeptide, wherein said domain is selected from the group consisting of a RING H2, NPXXY motif, PXXP motif, zinc finger, glycosylation site, phosphorylation site, SH3-binding motif, open-reading frame, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, 5′ untranslated region, and 3′ untranslated region. 9. An isolated polynucleotide comprising a nucleotide sequence of at least 12 consecutive bases encoding a portion of a domain of a human BCA3 polynucleotide or polypeptide, wherein said domain is selected from the group consisting of a SH2 site YYSS (SEQ ID NO.:39), SH2 site YSSV (SEQ ID NO.:40), SH2 site YHRG (SEQ ID NO.:41), SH2 site YIEV (SEQ ID NO.:42), SH2 site YPGT (SEQ ID NO.:43), SH2 site YSVT (SEQ ID NO.:44), tyrosine phosphorylation site, RTMAEFMDY (SEQ ID NO.:45), glycosylation site, phosphorylation site, tyrosine phosphorylation motif, SH2-binding motif, open-reading frame, open-reading frame lacking exon 3, open-reading frame lacking exon 3 and exon 5, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, 5′ untranslated region, and 3′ untranslated region. 10. An isolated polynucleotide comprising a polynucleotide sequence encoding a chimeric protein, wherein said sequence is selected from the group consisting of the human BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 gene. 11. An isolated RNA encoding a human BCA3 polypeptide. 12. A human BCA3 polypeptide comprising SEQ ID NO:6. 13. A human BCA1 polypeptide comprising SEQ ID NO:2. 14. A human BCA2 polypeptide comprising SEQ ID NO:4. 15. A fragment of a human BCA1 polypeptide comprising at least 5 consecutive amino acids of a human BCA1 polypeptide, wherein said fragment is a portion of a domain selected from the group consisting of a RING H2 finger, PY motif, glycosylation site, phosphorylation site, SH2-binding motif, open-reading frame, exon 1, exon 2, exon 3, intron 1, intron 2, 5′ untranslated region, and 3′ untranslated region. 16. A fragment of a human BCA2 polypeptide comprising at least 5 consecutive amino acids of a human BCA2 polypeptide, wherein said fragment is a portion of a domain selected from the group consisting of a RING H2, NPXXY motif, PXXP motif, zinc finger, glycosylation site, phosphorylation site, SH3-binding motif, open-reading frame, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, 5′ untranslated region, and 3′ untranslated region. 17. A fragment of a human BCA3 polypeptide comprising at least 5 consecutive amino acids of a human BCA3 polypeptide, wherein said fragment is a portion of a domain selected from the group consisting of a SH2 site SH2 site YYSS (SEQ ID NO.:39), SH2 site YSSV (SEQ ID NO.:40), SH2 site YHRG (SEQ ID NO.:41), SH2 site YIEV (SEQ ID NO.:42), SH2 site YPGT (SEQ ID NO.:43), SH2 site YSVT (SEQ ID NO.:44), tyrosine phosphorylation site, RTMAEFMDY (SEQ ID NO.:45), glycosylation site, phosphorylation site, tyrosine phosphorylation motif, SH2-binding motif, open-reading frame, open-reading frame lacking exon 3, open-reading frame lacking exon 3 and exon 5, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, 5′ untranslated region, and 3′ untranslated region. 18. A polypeptide comprising an amino acid sequence that has at least 90% identity to the fragment of claim 17, 18 or 19, wherein the percent identity is determined over an amino acid sequence of identical size to said fragment. 19. A complex comprising BCA1 polypeptide and a binding partner selected from the group consisting of a gene product of AIP4, Smurf2, polyubiquitin UbC, DUT, EPS15, ZBRK1, chromosome 19 open reading frame 5, AMSH, PLAT, TOM1L2, FLJ11626, clone 155, VIM, INVS, clone 287, clone 292, and POLR2J. 20. A polypeptide comprising an amino acid sequence that has 90% sequence identity relative to SEQ ID NO:2, and wherein said polypeptide binds to a binding partner selected from the group consisting of a gene product of AIP4, Smurf2, polyubiquitin UbC, DUT, EPS15, ZBRK1, chromosome 19 open reading frame 5, AMSH, PLAT, TOM1L2, FLJ11626, clone 155, VIM, INVS, clone 287, clone 292, and POLR2J. 21. An antibody that immunospecifically binds to a human BCA polypeptide, wherein said polypeptide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7. 22. The antibody of claim 21 that immunospecifically binds to a human BCA polypeptide when bound to a binding partner, wherein said polypeptide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7. 23. The antibody of claim 21 that immunospecifically binds to a human BCA polypeptide when bound to a binding partner; wherein said antibody does not bind to said polypeptide when not bound to said binding partner; and wherein said polypeptide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7. 24. An expression vector comprising a human BCA polynucleotide, wherein said polynucleotide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7. 25. A cell comprising a recombinant human BCA polynucleotide, wherein said polynucleotide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7. 26. A transgenic non-human animal comprising a transgene that comprises a human BCA polynucleotide, wherein said polynucleotide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7. 27. A method for making a BCA-3 polypeptide comprising the steps of: (a) culturing a cell comprising a recombinant BCA-3 polynucleotide under conditions that allow said BCA-3 polypeptide to be expressed by said cell; and (b) isolating the expressed BCA-3 polypeptide. 28. The product of the process of claim 27. 29. A method for preventing or treating breast cancer, said method comprising administering to a subject in need thereof an amount of a pharmaceutical composition comprising: (a) a BCA polynucleotide; (b) a BCA polypeptide; or (c) an antibody that immunospecifically binds to a BCA polypeptide; effective for preventing or treating said cancer, and a pharmaceutically acceptable carrier, wherein said polynucleotide or polypeptide is selected from the group consisting of a BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 polynucleotide or polypeptide. 30. A method for preventing or treating breast cancer, said method comprising administering to a subject in need thereof an amount of: (a) an expression vector comprising a human BCA polynucleotide; or (b) an antisense BCA polynucleotide; effective for preventing or treating said cancer, wherein said polynucleotide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7. 31. A method for diagnosing a BCA-related disorder in a subject comprising the steps of: (a) contacting a BCA antibody with a sample, suspected of containing a BCA polypeptide, from said subject under conditions that allow said BCA antibody to bind said BCA polypeptide; and (b) detecting or measuring binding of said BCA antibody to said BCA polypeptide; wherein said BCA polypeptide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7; and wherein said BCA-related disorder is determined to be present when the presence or amount of BCA polypeptide indicated by the detection or measurement of binding differs from a control value representing the amount of BCA polypeptide present in an analogous sample from a subject not having said BCA-related disorder. 32. A method for staging a BCA-related disorder in a subject comprising the steps of: (a) contacting a BCA antibody with a sample, suspected of containing a BCA polypeptide, from said subject under conditions that allow said BCA antibody to bind said BCA polypeptide; and (b) detecting or measuring binding of said BCA antibody to said BCA polypeptide; wherein said BCA polypeptide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7; and wherein the stage of a BCA-related disorder in a subject is determined when the presence or amount of BCA polypeptide indicated by the detection or measurement of binding is compared with the amount of BCA polypeptide present in an analogous sample from a subject having a particular stage of a BCA-related disorder. 33. The method of claim 31 or 32, wherein said BCA-related disorder is breast cancer. 34. A method for identifying an analyte that binds a BCA polypeptide comprising the steps of: (a) contacting said BCA polypeptide with an analyte under conditions that allow said analyte to bind said BCA polypeptide; and (b) detecting binding of said BCA polypeptide to said analyte; wherein said BCA polypeptide is selected from the group consisting of a BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 polypeptide. 35. A method for identifying a protein that binds a BCA polypeptide comprising the steps of: (a) contacting said BCA polypeptide with a positionally addressable array comprising a plurality of proteins, with each protein being at a different position on a solid support; and (b) detecting binding of said BCA polypeptide to a protein on said array; wherein said BCA polypeptide is selected from the group consisting of a BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 polypeptide. 36. A method for identifying an analyte that binds a complex comprising a BCA polynucleotide or BCA polypeptide comprising the steps of: (a) contacting said complex with said analyte under conditions that allow said analyte to bind said complex; and (b) detecting binding of said BCA polynucleotide or BCA polypeptide to said analyte; wherein said analyte binds to said BCA polynucleotide or BCA polypeptide when bound to said binding partner, and does not bind to said BCA polynucleotide or BCA polypeptide when not bound to said binding partner. 37. A method for identifying an analyte that inhibits formation of a complex comprising a BCA polynucleotide or BCA polypeptide comprising the steps of: (a) contacting said complex with said analyte; and (b) measuring the amount of said complex; wherein a reduction in the amount of complex indicates that said analyte inhibits formation of said complex. 38. A method for identifying an inhibitor of growth of a breast cancer cell comprising the steps of: (a) contacting said cell with: (i) a BCA polynucleotide; (ii) a BCA polypeptide; or (iii) an antibody that immunospecifically binds to a BCA polypeptide; (b) measuring cell growth; wherein said polynucleotide or polypeptide is elected from the group consisting of a BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 polynucleotide or polypeptide; and wherein an inhibition of cell growth indicates the presence of an inhibitor of growth of a breast cancer cell. 39. A kit comprising, in a first container, a purified BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist, and in a second container, a molecule that binds to the BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist when bound to an analyte in a biological sample. |
<SOH> 2. BACKGROUND <EOH>Breast cancer is the most common neoplastic disease in females, accounting for up to one third of all new cases of cancer in North American women. Breast cancer is the second leading cause of cancer-related deaths of women in the United States. About 180,000 new cases of breast cancer are diagnosed each year, a quarter of them fatal. Early detection is the key to the survival of these patients. However, there are no molecular markers to detect breast cancer at very early stages. Progress in finding a cure for breast cancer will be aided by identifying specific etiologic agents, ascertaining the precise time of initiation, and uncovering the molecular mechanisms responsible for breast cancer initiation and progression. Despite the uncertainties surrounding the origin of breast cancer, breast cancer risk appears to be related to endocrinologic and reproductive factors. The development of breast cancer usually depends on endocrine conditions, such as early menarche, late menopause, and parity. However, the specific hormone or hormone combinations responsible for cancer initiation have not been identified, and their role as protective or risk factors remains incompletely understood. Estrogen is involved in the development of a variety of cancers, but it is still unclear whether estrogens are carcinogenic to the human breast. Epidemiologic studies have shown that a family history of breast cancer increases a woman's risk of breast cancer when compared with the general population. Familial breast cancer is characterized by early onset and bilateral tumors, and also, in some cases, associated malignancies, most commonly ovarian cancer. Clinical studies suggest that breast cancer may be inherited as an autosomal dominant disease involving rare genes in which carriers have a high probability of developing the disease, perhaps as great as 100% in some families. It is estimated that 5-10% of all breast cancer cases are due to autosomal dominant genes segregating with the disease. Several genes are known to correlate with inherited susceptibility to breast cancer, such as the ataxia-telangiectasia (AT) gene (11q22-q23), TP53 gene (17p13.1), androgen receptor (Xq11.2-q12), BRCA1 gene (17q21), and BRCA2 gene (13q12-q13). These genes differ dramatically, however, in terms of the breast cancer risk that these genes confer, the proportion of breast cancer incidences that express these genes, as well as other cancers with which these genes are associated. Germline mutations in the TP53 gene are responsible for a high proportion of LI-Fraumeni families, in which breast cancer occurs in association with childhood sarcomas and other cancers. In such families, the risk of breast cancer is over 50% by age 50, and the risk of some type of cancer is nearly 100%. Germline TP53 mutations are probably responsible for less than one percent of all breast cancer, however (Easton et al., 1993, Cancer Surv. 18:95-113). By contrast, heterozygotes for the AT gene exhibit a moderate risk of breast cancer, but because this gene is more common in the population, the AT gene may account greater than 7% of breast cancer cases (Easton et al., 1993, Cancer Surv 18:95-113). Germline mutations in the androgen receptor are known to cause male breast cancer, but this has only been demonstrated in two families. Genetic linkage studies have shown that some high risk breast cancer families, particularly those where breast cancer occurs in association with ovarian cancer, involve the BRCA1 gene (Easton et al., 1993, Cancer Surv 18:95-113). The BRCA1 gene confers a breast cancer risk of about 70% by age 70, but accounts for only for approximately 2% of breast cancer cases. Mutations in BRCA1 result in truncation and presumed inactivation of the BRCA1 protein. Analysis of BRCA1 function have indicated that it may act as an inhibitor of cell proliferation and, at least in mice, is necessary for normal development. The presence of a motif in BRCA1 characteristic of a family of proteins known as granins, has led to the suggestion that the protein is secreted into the extracellular space. BRCA1 is infrequently somatically mutated in sporadic breast or ovarian cancer. The BRCA2 gene has recently been identified (Stratton, 1996, Hum Mol Genet 5:1515-9). The BRCA2 gene carries a risk of breast cancer similar to that of BRCA1, but is associated with a lower risk of ovarian cancer and a higher risk of male breast cancer. In addition to breast and ovarian cancer, germline BRCA2 mutations probably confer a small risk of a wide range of cancers. Somatic mutations of BRCA2 in sporadic breast and ovarian cancer are very rare. The prevalence and penetrance of mutations in BRCA1 and BRCA2 have been studied extensively, yet only a small proportion of breast cancer is due to mutations in these genes. Phenotypic expression and penetrance of the known mutations in BRCA1 and BRCA2 is not currently predictable. Since the epidemiologic and genetic data suggest that breast cancer is a heterogeneous disease, it is likely that other genes play a role in breast cancer. Evidence for additional high penetrance genes exists, but an understanding of multiple lower penetrance alleles will be necessary to fully define breast cancer risk. Multiple approaches are being used to identify additional high and low penetrance genes. One approach has focused on the analysis of polymorphisms of potential functional significance in several classes of genes, including those involved in carcinogen metabolism, estrogen metabolite biosynthesis, steroid hormone receptor activation and DNA repair. For example, families with three or more breast cancer cases are being used in traditional linkage studies, which are expected to yield only moderate or high penetrance susceptibility genes. Breast cancer case-control studies are being used to look for genetic variants or polymorphisms that confer an increased risk of breast cancer in a wide variety of cellular pathways, ranging from the detoxification of environmental carcinogens to steroid hormone metabolism, DNA damage repair and immune surveillance, an approach useful primarily to identify low penetrance susceptibility genes. However, this approach has failed to produce convincing results to date. Another approach, using BRCA1 and BRCA2 mutation carriers to identify genes that are associated with modification of breast cancer risk, has met with limited success. Clearly, breast cancer susceptibility is a complex phenomenon, in which multiple genes are likely involved. Thus, there remains a great need to explore different approaches to identify breast cancer-related genes. To this end, a greater understanding of the molecular changes in the development and maintenance of breast cancer would greatly facilitate efforts to detect and cure breast cancer. |
<SOH> 3. SUMMARY OF THE INVENTION <EOH>The invention relates to isolated breast cancer-associated (BCA) polynucleotides, polypeptides, and antagonists (e.g., antibodies directed to BCA polypeptides), and their uses for drug screening. The invention also encompasses uses of BCA polynucleotides, polypeptides, and antagonists for the prevention, diagnosis, prognosis and management of cancer, particularly hormone-sensitive cancer, more particularly breast cancer. The present invention is based, at least in part, on the discovery of cDNA molecules which encode BCA proteins that are differentially expressed in breast cancer cells as compared to normal breast cells. BCA proteins and variants thereof of the present invention are collectively referred to as “polypeptides” or “proteins” of the invention. Nucleic acid molecules encoding the polypeptides or proteins of the invention, or their complements thereof (i.e., antisense polynucleotide), are collectively referred to as “polynucleotides” or “nucleic acid sequences” of the invention. The present invention provides isolated polynucleotides encoding a polypeptide of the invention. The invention further provides isolated polynucleotides, or variants thereof, which can be used, for example, as hybridization probes or primers to detect or amplify nucleic acids encoding a polypeptide of the invention. The present invention also provides isolated polynucleotides, or variants thereof, that can be used, for example, to screen for DNA-binding proteins, including but not limited to proteins that affect DNA conformation or modulate transcriptional activity (e.g., enhancers, transcription factors). In another embodiment, such probes can be used to screen for RNA-binding factors, including but not limited to proteins, steroid hormones, or other small molecules. In yet another embodiment, such probes can be used to detect and identify molecules that bind or affect the pharmacokinetics or activity (e.g., enzymatic activity) of a polypeptide of the invention. The present invention also encompasses DNA vectors that comprise polynucleotide of the invention. In a further embodiment, the polynucleotides of the invention are operatively associated with a regulatory element that directs the expression of the polynucleotide. The invention also encompasses genetically engineered host cells that comprise any of the polynucleotides of the invention, operatively associated with a regulatory element that directs the expression of the polynucleotide in the host cell. Regulatory elements include, but are not limited to, inducible and non-inducible promoters, enhancers, operators and other elements that drive or regulate expression, which are known to the skilled artisan. The present invention provides compositions comprising agonists or antagonists of a BCA polynucleotide, BCA polypeptide or complexes comprising a BCA polynucleotide or BCA polypeptide. Compositions comprising inhibitors of such agonists and antagonists are also encompassed by the present invention. The present invention further provides methods for identifying such agonists, antagonists, or corresponding inhibitors. Such agonists, antagonists, or inhibitors can be small molecules (i.e., less than 500 daltons) that bind a BCA polynucleotide or BCA polypeptide of the invention. Accordingly, the present invention relates to a composition comprising a BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist, inhibitor of a BCA agonist, inhibitor of a BCA antagonist, and/or a variant thereof. The present invention also encompasses a composition comprising a BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist,inhibitor of a BCA agonist, inhibitor of a BCA antagonist, and/or a variant thereof; and another therapeutic agent. The present invention also relates to a method for preventing or treating a BCA-related disorder (e.g., breast cancer), comprising administering to a patient in need thereof an effective amount of a BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist, inhibitor of a BCA agonist, inhibitor of a BCA antagonist, and/or a variant thereof. The present invention also relates to a method for preventing or treating a BCA-related disorder (e.g., breast cancer), comprising administering to a patient in need thereof an effective amount of a BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist, inhibitor of a BCA agonist, inhibitor of a BCA antagonist, and/or a variant thereof; and another therapeutic agent. The present invention also relates to a method for increasing a patient's sensitivity to a therapeutic agent, comprising administering to a patient in need thereof an effective amount of a BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist, inhibitor of a BCA agonist, inhibitor of a BCA antagonist, and/or a variant thereof. The present invention also relates to a method for diagnosing, staging or determining a prognosis of a BCA-related disorder, comprising the step of determining a level of BCA nucleic acid or BCA polypeptide expression in a biological tissue. Accordingly, the present invention provides compositions and methods for the use of a BCA agonist or antagonist to prevent or treat a BCA-related disorder, such as cancer, in particular breast cancer. BCA agonists include, but are not limited to, small molecules that bind a BCA polypeptide, antibodies directed to a BCA polypeptide, and other compounds that interact with a BCA polypeptide or a BCA gene to enhance its activity or expression. BCA antagonists include, but are not limited to, antibodies to BCA polypeptides, BCA antisense oligonucleotides, BCA ribozymes, BCA triple-helix molecules, molecules that inhibit binding of regulatory proteins to regulatory regions of a BCA gene or otherwise inhibit BCA expression, and other small molecules that bind a BCA polypeptide, or otherwise inhibit BCA gene product activity. The present invention also provides pharmaceutical compositions comprising a BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist, inhibitor of a BCA agonist, inhibitor of a BCA antagonist, and/or a variant thereof; and a pharmaceutically acceptable carrier. The present invention also encompasses pharmaceutical compositions comprising a BCA nucleic acid, BCA polypeptide, BCA agonist, BCA antagonist, inhibitor of a BCA agonist, inhibitor of a BCA antagonist, and/or a variant thereof, another therapeutic agent; and a pharmaceutically acceptable carrier. In particular, the present invention provides pharmaceutical compositions comprising a BCA antagonist, as well as methods for prophylactic and therapeutic use of pharmaceutical compositions comprising a BCA antagonist. The invention also provides for drug delivery means and therapeutic regimens for the pharmaceutical compositions of the invention. In one embodiment, the pharmaceutical compositions of the invention are delivered by gene therapy. A BCA antagonist can also be used to prevent occurrence, recurrence, or stop progression of a BCA-related disorder. For example, aside from affecting diseased tissue, a BCA antagonist can affect normal tissues, which include tissues containing cells that normally express a BCA gene. Additionally, a BCA antagonist can affect normal tissues that, although not expressing a BCA gene, are compromised by diseased tissues. In a particular embodiment, a BCA antagonist directly acts on diseased tissue thereby protecting normal surrounding tissues that do or do not normally express a BCA gene. In one embodiment, a BCA antagonist is administered, to a patient in need of such treatment, to prevent or treat cancer, wherein a BCA mRNA or protein is expressed at above-normal levels. In another embodiment, a BCA antagonist is administered to a patient in need of such treatment, at a high dose to prevent or treat cancer. In another embodiment, a BCA antagonist is administered, to a patient in need of such treatment, at a low or reduced dose to prevent or treat cancer. In yet another embodiment, a BCA antagonist is administered, to a patient in need of such treatment, for a short treatment cycle to prevent or treat cancer. The invention further encompasses use of a BCA antagonist in combination therapy to prevent or treat cancer. Such therapy includes the use of one or more different molecules; compounds or treatments that assist in the prevention or treatment of a disease. In a specific embodiment, the invention provides for a BCA antagonist that is administered to a human, in combination with one or more cancer therapeutic agents, to prevent or treat cancer. Such cancer therapeutics include one or more molecules, compounds or treatments that have anti-cancer activity. Examples of contemplated therapeutics include biologicals, chemicals, and therapeutic treatments (e.g., irradiation treatment). Accordingly, in a specific embodiment, the present invention provides for preventing or treating cancer comprising administering, to a patient in need of such treatment, a pharmaceutical composition comprising a BCA antagonist, and one or more therapeutic agents. In one embodiment, the BCA antagonist potentiates the effect of additional therapeutic agents. In another embodiment, the BCA antagonist sensitizes the patient to subsequent administration of additional therapeutic agents. Such combination treatments can reduce the overall toxicity of a therapeutic regimen. For example, lower dosages, fewer administrations, and shorter treatment periods can demonstrate fewer side effects or improved efficacy as compared to most standard treatments, such as standard treatments for cancer. In a particular embodiment, the invention provides for a BCA antagonist that is administered to a human, in combination with one of more cancer therapeutic agents at reduced doses, to prevent or treat cancer. Such treatments may involve high, standard, or low doses of one or more BCA antagonists, and treatment cycles may be of long or short duration. In a specific embodiment, the invention provides for a particularly high dose of a BCA antagonist that is administered to a human, in combination with one of more cancer therapeutic agents at reduced doses, for short treatment cycles to prevent or treat cancer. Preferred embodiments of the invention encompass a method for preventing or treating breast cancer, said method comprising administering to a subject in need thereof an amount of a pharmaceutical composition comprising a BCA polynucleotide; a BCA polypeptide; or an antibody that immunospecifically binds to a BCA polypeptide, effective for preventing or treating said cancer, and a pharmaceutically acceptable carrier, wherein said polynucleotide or polypeptide is selected from the group consisting of a BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 polynucleotide or polypeptide. Also included is a method for preventing or treating breast cancer, said method comprising administering to a subject in need thereof an amount of (a) an expression vector comprising a human BCA polynucleotide; or (b) an antisense BCA polynucleotide; effective for preventing or treating said cancer, wherein said polynucleotide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7. Also included is a method for diagnosing a BCA-related disorder in a subject comprising the steps of (a) contacting a BCA antibody with a sample, suspected of containing a BCA polypeptide, from said subject under conditions that allow said BCA antibody to bind said BCA polypeptide; and (b) detecting or measuring binding of said BCA antibody to said BCA polypeptide; wherein said BCA polypeptide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7; and wherein said BCA-related disorder is determined to be present when the presence or amount of BCA polypeptide indicated by the detection or measurement of binding differs from a control value representing the amount of BCA polypeptide present in an analogous sample from a subject not having said BCA-related disorder. Also encompassed is a method for staging a BCA-related disorder in a subject comprising the steps of (a) contacting a BCA antibody with a sample, suspected of containing a BCA polypeptide, from said subject under conditions that allow said BCA antibody to bind said BCA polypeptide; and (b) detecting or measuring binding of said BCA antibody to said BCA polypeptide; wherein said BCA polypeptide is selected from the group consisting of BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7; and wherein the stage of a BCA-related disorder in a subject is determined when the presence or amount of BCA polypeptide indicated by the detection or measurement of binding is compared with the amount of BCA polypeptide present in an analogous sample from a subject having a particular stage of a BCA-related disorder. Other preferred embodiments of the invention involve uses in drug screening for example, a method for identifying an analyte that binds a BCA polypeptide comprising the steps of (a) contacting said BCA polypeptide with an analyte under conditions that allow said analyte to bind said BCA polypeptide; and (b) detecting binding of said BCA polypeptide to said analyte; wherein said BCA polypeptide is selected from the group consisting of a BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 polypeptide. Also included is a method for identifying a protein that binds a BCA polypeptide comprising the steps of (a) contacting said BCA polypeptide with a positionally addressable array comprising a plurality of proteins, with each protein being at a different position on a solid support; and (b) detecting binding of said BCA polypeptide to a protein on said array; wherein said BCA polypeptide is selected from the group consisting of a BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 polypeptide. Also included is a method for identifying an analyte that binds a complex comprising a BCA polynucleotide or BCA polypeptide comprising the steps of (a) contacting said complex with said analyte under conditions that allow said analyte to bind said complex; and (b) detecting binding of said BCA polynucleotide or BCA polypeptide to said analyte; wherein said analyte binds to said BCA polynucleotide or BCA polypeptide when bound to said binding partner, and does not bind to said BCA polynucleotide or BCA polypeptide when not bound to said binding partner. Also encompassed is a method for identifying an analyte that inhibits formation of a complex comprising a BCA polynucleotide or BCA polypeptide comprising the steps of (a) contacting said complex with said analyte; and (b) measuring the amount of said complex; wherein a reduction in the amount of complex indicates that said analyte inhibits formation of said complex. Also encompassed is a method for identifying an inhibitor of growth of a breast cancer cell comprising the steps of (a) contacting said cell with (i) a BCA polynucleotide; (ii) a BCA polypeptide; or (iii) an antibody that immunospecifically binds to a BCA polypeptide; (b) measuring cell growth; wherein said polynucleotide or polypeptide is selected from the group consisting of a BCA1, BCA2, BCA3, BCA4, BCA5, BCA6, and BCA7 polynucleotide or polypeptide; and wherein an inhibition of cell growth indicates the presence of an inhibitor of growth of a breast cancer cell. |
Arrangement for mounting two coaxial shaftlines |
In an assembly with two concentric shafts, one of which projects beyond the other, a seal support sleeve placed between them has a conical shape and bears on a spacer of the external shaft, so that an assembly nut of the forward end is accessible to be unscrewed from the back through the space between the two shafts, thus enabling the external shaft to be disassembled. The invention may be applicable to front bearings of gas turbine high pressure shafts and makes it possible to disassemble the high pressure body from behind, without needing to disassemble equipment, such as a fan on the front of the machine, or hindering the installation of a gear. |
1. An assembly comprising: an internal shaft and an external shaft, said internal and external shafts being coaxial and a forward part of the internal shaft projecting beyond a forward end of the external shaft; a sleeve surrounding the shafts and holding first and second seals, the first seal sealing a portion of the internal shaft and the second seal sealing a portion of the external shaft; a first bearing supporting the forward end of the external shaft; a nut screwed around said forward end for providing a stop for said first bearing; and a spacer having a first part adjusted around the external shaft and retained between the nut and the first bearing, and a second part extending around the nut on which the second seal sealing with the external shaft rubs. 2. (canceled) 3. The assembly according to claim 1, further comprising: a gear arranged under the nut, the spacer and the sleeve in a direction substantially perpendicular to both shafts; a gear support housing surrounding the gear; and a gear hub holding the gear in said direction, wherein a second bearing for the gear is installed around a shaft of the gear by an ascending displacement from below the housing, and the sleeve comprises a flange in abutment with a part of the housing, the abutment being obtained by a forward displacement of the flange. 4. The assembly according to claim 3, further comprising: a single shell fixed to the housing, in which the second bearing and a third bearing installed around the shaft of the gear are installed. 5. The assembly according to claim 1, wherein a diameter of the second seal is larger than a diameter of the first seal. 6. The assembly according to claim 1, wherein the sleeve is conical. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention This invention relates to an assembly for the installation of two coaxial shafts, particularly a so-called low pressure shaft as shown in FIG. 1 connecting the low pressure compressor 1 to the low pressure turbine 2 in a gas turbine, surrounded by a high pressure shaft connecting the high pressure compressor 3 to the high pressure turbine 4 . 2. Description of Related Art In this type of machine, the internal shaft 15 (low pressure) projects beyond the front of the external shaft 16 (high pressure) and can finish at a shaft end 5 supporting a large volume fan 6 on which large radius blades are fitted to discharge air into an auxiliary stream 7 surrounding the main gas stream 8 , and if there is an accidental breakage in this fan, there will be a severe out-of-balance mass on the internal shaft 15 . Thus, some arrangements need to be made. Firstly, a bearing 9 called the number 1 bearing right at the front of the internal shaft 15 may be made fusible or breakable, in other words it may be installed on a low resistance support 10 that breaks as soon as an out-of-balance mass develops, so that the resulting large forces that are then generated are not transmitted to the rest of the stator structure. The shaft end 5 is then free to tilt by moving under the effect of the out-of-balance mass until the assembly that it forms with the fan 6 moves into a new position in equilibrium in rotation and without necessarily causing any further damage until the machine stops. The shaft end 5 makes this movement tilting around a so-called bearing number 2 behind the previous bearing, that supports its back end and a main shaft in the internal shaft 15 . This bearing is denoted reference 17 . It thus controls the axial position of the internal shaft 15 . A movement control gear 20 , designed particularly to start the machine and activated by a transmission shaft 25 perpendicular to the shafts 15 and 16 , must be placed between this bearing 17 and a so-called bearing number 3 (reference 18 ) that provides support to the forward end of the external shaft 16 . The previous shaft bearing 17 , being as far backwards as possible to improve the dynamic resistance of the internal shaft 15 , is only separated from it by just sufficient space to contain the gear 20 . An assembly nut is screwed around the forward end of the external shaft 16 to hold it in place against this bearing 18 by stopping in contact on the bearing. This nut, that extends forwards from the bearing 18 and on the movement control gear 20 , is difficult to access, particularly because a seal support sleeve must be placed behind the bearing 17 immediately in front of the nut, overlapping the forward end of the external shaft 16 and a portion of the internal shaft 15 to create a seal between them. Disassembly of the high pressure shaft 16 , before maintenance, is usually only possible after disassembling the machine in front of the nut, and particularly the fan 6 , so that it can be reached and unscrewed. Refer to French patent 2 783 579 for a description of an assembly by which the nut can be unscrewed from behind using a special tool inserted into the annular space between the shafts, which is more convenient despite the fact that this space is narrow since there is then no need for any major disassembly of elements of the machine to be able to remove the high pressure shaft; but the selected assembly consists of screwing the nut in the external shaft whereas it is conventionally screwed around the shaft, which changes the entire design of the forward end of the shaft and it can introduce other disadvantages. In this case, another solution is proposed to provide easy access to the nut holding the external shaft 16 in place from behind without making any major change to the design; the narrow space around the nut makes a few modifications to surrounding parts of the machine necessary, but it will be seen that they are mainly applicable to sealing and movement control devices, for which the design is less restrictive. |
<SOH> BRIEF SUMMARY OF THE INVENTION <EOH>In its most general form, the representative assembly of the invention comprises coaxial internal and external shafts, a forward part of the internal shaft projecting beyond a forward end of the external shaft, a sleeve surrounding the shafts and supporting a seal associated with each of the shafts, a bearing supporting the external shaft close to the forward end and a bearing retaining nut screwed around the forward end, characterized in that it comprises a spacer with an adjustment part slid around the external shaft and tightened between the nut and the bearing, and a sealing part arranged around the nut and on which the seal associated with the external shaft rubs. |
Novel therapeutic indication of azithromycin for treatment of non-infective inflamatory diseases |
The invention relates to the use of 9-deoxo-9-dihydro-9a-methyl-9a-homoerythromycin. A (generic name: azithromycin) for the therapy of neutrophil-dominated non-infective inflammatory diseases, pharmaceutical compositions containing azithromycin for enteral or parenteral administration and methods for the production of these pharmaceutical compositions. |
1. A method for treating neutrophil-dominated, non-infective inflammatory diseases in human beings and animals comprising administering to said human beings and animals a therapeutically or pharmaceutically effective amount of an active ingredient which comprises azithromycin, or a pharmaceutically acceptable derivative, hydrate, complex, chelate, or salt thereof. 2. The method according to claim 1, whereby the active ingredient is an 0-methyl-derivative of azithromycin. 3. The method according to claim 1, whereby the active ingredient is an ester of azithromycin. 4. The method according to claim 1, whereby the active ingredient is a monohydrate of azithromycin. 5. The method according to claim 1, whereby the active ingredient is a dihydrate of azithromycin. 6. The method according to claim 1, whereby the active ingredient is a complex or chelate of azithromycin with metal ions. 7. The method according to claim 6, whereby the ratio between azithromycin to metal is 1:1 to 1:4. 8. The method according to claim 6, whereby the metal ions are bivalent metal ions. 9. The method according to claim 6, whereby the metal ions are trivalent metal ions. 10. The method according to claim 1, whereby the active ingredient is an alkali metal, alkaline earth metal, or an ammonium salt of azithromycin. 11. The method according to claim 1, whereby the active ingredient is an acid addition salt of azithromycin. 12. The method according to claim 11, whereby the acid addition salt is formed with an inorganic acid. 13. The method according to claim 11, whereby the inorganic acid is hydrobromic acid, nitric acid, phosphoric acid or sulphuric acid. 14. The method according to claim 11, whereby the acid addition salt is formed with an organic acid. 15. The method according to claim 14, whereby the organic acid is acetic acid, benzoic acid, cinnamic acid, citric acid, ethanesulfonic acid, fumaric acid, glycolic acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, oxalic acid, p-toluenesulfonic acid, pyruvic acid, salicylic acid, succinic acid or tartaric acid. 16. The method according to claim 1, whereby the pharmaceutical compositions contain the active ingredient in an amount sufficient to abolish or to reduce the disease or to stop its progression. 17. The method according to claim 16, whereby the pharmaceutical compositions are administered one to three times a day in a dose of 10 mg to 200 mg active ingredient. 18. The method according to claim 17, whereby the pharmaceutical compositions are administered one to three times a day in a dose of 30 mg to 1500 mg active ingredient. 19. The method according to claim 1, whereby the pharmaceutical compositions are orally administered in solid or liquid dosage forms. 20. The method according to claim 19, whereby the solid pharmaceutical compositions for oral administration are capsules, lingualettes, tablets, pills, powders, liposomes, patches, time delayed coatings and granules. 21. The method according to claim 19, whereby the solid pharmaceutical compositions for oral administration. contain at least one inert pharmaceutically acceptable carrier. 22. The method according to claim 21, whereby the inert pharmaceutical carrier is lactose, sucrose, or starch. 23. The method according to claim 19, whereby the solid pharmaceutical compositions for oral administration comprise additional substances selected from the group consisting of lubricating agents such as magnesium stearate, bulking and/or buffering agents and flavouring agents. 24. The method according to claim 19, whereby the solid pharmaceutical compositions for oral administration are prepared with enteric coatings: 25. The method according to claim 19, whereby the liquid pharmaceutical compositions for oral administration are pharmaceutically acceptable emulsions, solutions, suspensions or syrups. 26. The method according to claim 25, whereby the liquid pharmaceutical composition for oral administration contains at least one inert pharmaceutical carrier. 27. The method according to claim 26, whereby the inert pharmaceutical carrier is water or physiological saline. 28. The method according to claim 25, whereby the liquid pharmaceutical composition for oral administration comprises additional substances, selected from the group consisting of adjuvants, salts for varying the osmotic pressure, pH-adjusting compounds, skin penetration agents, wetting agents, emulsifying and suspending agents. 29. The method according claim 1, whereby the pharmaceutical compositions are parenterally administered. 30. The method according to claim 29, whereby the pharmaceutical compositions for parenteral administration are infusions or injections. 31. The method according to claim 29, whereby the pharmaceutical compositions for parenteral administration are sterile aqueous or non-aqueous solutions, suspensions or emulsions. 32. The method according to claim 29, whereby the pharmaceutical compositions for parenteral administration comprise non-aqueous solvents or vehicles. 33. The method according to claim 32, whereby the non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and corn oil, gelatine, and injectable organic esters such as ethyl oleate. 34. The method according to claim 29, whereby the pharmaceutical compositions for parenteral administration comprise adjuvants such as preserving, wetting, emulsifying, and dispersing agents. 35. The method according to claim 1, whereby the pharmaceutical compositions are rectally or vaginally administered. 36. The method according to claim 35, whereby the pharmaceutical compositions for rectal or vaginal administration are suppositories, clysters or foams. 37. The method according to claim 35, whereby the pharmaceutical compositions for rectal or vaginal administration contain excipients such as cocoa butter or a suppository wax. 38. The method according to claim 1, whereby the pharmaceutical compositions for the treatment of neutrophil-dominated, non-infective inflammatory diseases contain one or more additional active ingredients useful for the treatment of such diseases selected from the group consisting of non-steroidal anti-inflammatory agents, steroidal anti-inflammatory agents, bronchodilating agents, antirheumatic agents, immunomodulating agents, immunosuppressive agents, corticosteroids, β2-agonists and cholinergic antagonists. 39. The method according to claim 38, whereby the, dose of the additional active ingredients is reduced in comparison to pharmaceutical compositions, containing exclusively one of the additional active ingredients. 40. A pharmaceutical composition for the treatment of neutrophil-dominated, non-infective inflammatory diseases in human beings and animals comprising an active ingredient which comprises azithromycin, or a pharmaceutically acceptable derivate, hydrate, complex, chelate, or salt thereof 41. The pharmaceutical composition according to claim 40, whereby the active ingredient is an O-methyl-derivative or an ester of azithromycin. 42. The pharmaceutical composition according to claim 40, whereby the active ingredient is a monohydrate or a dehydrate of azithromycin. 43. The pharmaceutical composition according to claim 40, whereby the active ingredient is a complex or chelate of azithromycin with bivalent or trivalent metal ions. 44. The pharmaceutical composition according to claim 43, whereby the ratio between azithromycin and metal ions is 1:1 to 1:4. 45. The pharmaceutical composition according to claim 40, whereby the active ingredient is an alkali metal, alkaline earth metal, or an ammonium salt of azithromycin. 46. The pharmaceutical composition according to claim 40, whereby the active ingredient is an acid addition salt of azithromycin. 47. The pharmaceutical composition according to claim 46, whereby the acid addition salt is formed with an inorganic acid, such as hydrobromic acid, nitric acid, phosphoric acid or sulphuric acid. 48. The pharmaceutical composition according to claim 46, whereby the acid addition salt is farmed with an organic acid, such as acetic acid, benzoic acid, cinnamic acid, citric acid, ethanesulfonic acid, fumaric acid, glycolic acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid; oxalic acid, p-toluenesulfonic acid, pyruvic acid, salicylic acid, succinic acid or tartaric acid. 49. The pharmaceutical composition according to claim 40, whereby the active ingredient is contained in an amount sufficient to abolish or to reduce the disease or to stop its progression. 50. The pharmaceutical composition according to claim 40, comprising one or more additional active ingredients useful for the treatment of such diseases selected from the group consisting of non-steroidal anti-inflammatory agents, steroidal anti-inflammatory agents, bronchodilating agents, antirheumatic agents, immunomodulating agents, immunosuppressive agents, corticosteroids, β2-agonists and cholinergic antagonists. 51. The pharmaceutical composition according to claim 50, whereby the dose of the additional active ingredients is reduced in comparison to pharmaceutical compositions, containing exclusively one of the additional active ingredients. 52. A method for the production of a pharmaceutical composition comprising azithromycin, or a pharmaceutically acceptable derivative, hydrate, chelate, or salt thereof as an active ingredient, for the treatment of neutrophil-dominated, non-infective inflammatory diseases in human beings and animals which comprises (i) admixing the active ingredient with additives and optionally with additional active ingredients useful for the treatment of such diseases, (ii) dissolving or suspending the resulting admixture in sterile aqueous or aqueous/alcoholic solution, (iii) adjusting the pH of the solution to a value of about 4 to 7 by the use of pH adjusting agents, and (iv) filling the pH adjusted solution into vials or ampules. 53. The method according to claim 52, whereby the additional active ingredients are selected from the group consisting of non-steroidal anti-inflammatory agents, steroidal anti-inflammatory agents, bronchodilating agents, antirheumatic agents, immunomodulating agents, immunosuppressive agents, corticosteroids, β2-agonists and cholinergic antagonists. 54. The method of claim 1, wherein the neutrophil-dominated, non-infective inflammatory disease is selected from the group consisting of an adult respiratory distress syndrome (ARDS), emphysema, a neutrophil dermatosis, auto-immune bullous dermatoses, vessel-based neutrophilic dermatoses, an autoimmune disease in which neutrophil infiltration is exacerbated by activated complement factors, and an auto-immune disease characterized by acute neutrophil-dominated phases. 55. The method of claim 54, wherein the neutrophil dermatosis is selected from the group consisting of psoriasis and Reiter's syndrome. 56. The method of claim 54, wherein the vessel-based neutrophilic dermatoses disease is selected from the group consisting of leukocytoclastic vasculitis, Sweet's syndrome, pustular vasculitis, erythemanodosum, familial Mediterranean fever, and pyoderma gangrenosum. 57. The method of claim 54, wherein the auto-immune disease in which neutrophil infiltration is exacerbated by activated complement factors, is a renal disease. 58. The method of claim 57, wherein the renal disease is glomerulonephritis. 59. The method of claim 54, wherein the auto-immune disease characterized by acute neutrophil-dominated phases is rheumatoid arthritis. 60. The pharmaceutical composition of claim 40, wherein the neutrophil-dominated, non-infective inflammatory disease is selected from the group consisting of adult respiratory distress syndrome (ARDS), emphysema, a neutrophil dermatosis, auto-immune bullous dermatoses, vessel-based neutrophilic dermatoses, an auto-immune disease in which neutrophil infiltration is exacerbated by activated complement factors, and an autoimmune disease characterized by acute neutrophil-dominated phases. 61. The pharmaceutical composition of claim 60, wherein the neutrophil dermatosis is selected from a group consisting of psoriasis and Reiter's syndrome. 62. The pharmaceutical composition of claim 60, wherein the vessel-based neutrophilic dermatoses is selected from the group consisting of leukocytoclastic vasculitis, Sweet's syndrome, pustular vasculitis, erythema nodosum, familial Mediterranean fever, and pyoderma gangrenosum. 63. The pharmaceutical composition of claim 60, wherein the auto-immune disease in which neutrophil infiltration is exacerbated by activated complement factors, is a renal disease. 64. The pharmaceutical composition of claim 63, wherein the renal disease is glomerulonephritis. 65. The pharmaceutical composition of claim 60, wherein the autoimmune disease characterized by acute neutrophil-dominated phases is rheumatoid arthritis. 66. The method of claim 52, wherein the neutrophil-dominated, non-infective inflammatory disease is selected from the group consisting of adult respiratory distress syndrome (ARDS), emphysema, a neutrophil dermatosis, auto-immune bullous dermatoses, vessel-based neutrophilic dermatoses, an auto-immune disease in which neutrophil infiltration is exacerbated by activated complement factors, and an autoimmune disease characterized by acute neutrophil-dominated phases. 67. The method of claim 66, wherein the neutrophil dermatosis is selected from the group consisting of psoriasis and Reiter's syndrome. 68. The method of claim 66, wherein the vessel-based neutrophilic dermatoses is selected from the group consisting of leukocytoclastic vasculitis, Sweet's syndrome, pustular vasculitis, erythema nodosum, familial Mediterranean fever, and pyoderma gangrenosum. 69. The method of claim 66, wherein the auto-immune disease in which neutrophil infiltration is exacerbated by activated complement factors, is a renal disease. 70. The method of claim 69, wherein the renal disease is glomerulonephritis. 71. The method of claim 66, wherein the autoimmune disease characterized by acute neutrophil-dominated phases is rheumatoid arthritis. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.