text
stringlengths 0
1.67M
|
|---|
1-32. (canceled) 33. An isolated nucleic acid molecule comprising a first polynucleotide sequence at least 95% identical to a second polynucleotide sequence selected from the group consisting of: (a) a polynucleotide fragment of SEQ ID NO:X as referenced in Table 1A; (b) a polynucleotide encoding a full length polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein said fragment has biological activity; (e) a polynucleotide encoding a polypeptide domain of SEQ ID NO:Y as referenced in Table 1B; (f) a polynucleotide encoding a polypeptide domain of SEQ ID NO:Y as referenced in Table 2; (g) a polynucleotide encoding a predicted epitope of SEQ ID NO:Y as referenced in Table 1B; and (h) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(g), wherein said polynucleotide does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence of only A residues or of only T residues. 34. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises a nucleotide sequence encoding a secreted form of SEQ ID NO:Y or a secreted form of the polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y, as referenced in Table 1A. 35. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises a nucleotide sequence encoding the sequence identified as SEQ ID NO:Y or the polypeptide encoded by the cDNA sequence included in ATCC Deposit No:Z, which is hybridizable to SEQ ID NO:X, as referenced in Table 1A. 36. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises the entire nucleotide sequence of SEQ ID NO:X or the cDNA sequence included in ATCC Deposit No:Z, which is hybridizable to SEQ ID NO:X, as referenced in Table 1A. 37. The isolated nucleic acid molecule of claim 34, wherein the nucleotide sequence comprises sequential nucleotide deletions from either the C-terminus or the N-terminus. 38. The isolated nucleic acid molecule of claim 35, wherein the nucleotide sequence comprises sequential nucleotide deletions from either the C-terminus or the N-terminus. 39. A recombinant vector comprising the isolated nucleic acid molecule of claim 33. 40. A method of making a recombinant host cell comprising the isolated nucleic acid molecule of claim 33. 41. A recombinant host cell produced by the method of claim 40. 42. The recombinant host cell of claim 41 comprising vector sequences. 43. A polypeptide comprising a first amino acid sequence at least 95% identical to a second amino acid sequence selected from the group consisting of: (a) a full length polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (b) a secreted form of SEQ ID NO:Y or a secreted form of the polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein said fragment has biological activity; (e) a polypeptide domain of SEQ ID NO:Y as referenced in Table 1B; (f) a polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (g) a predicted epitope of SEQ ID NO:Y as referenced in Table 1B. 44. The polypeptide of claim 43, wherein said polypeptide comprises a heterologous amino acid sequence. 45. The isolated polypeptide of claim 43, wherein the secreted form or the full length protein comprises sequential amino acid deletions from either the C-terminus or the N-terminus. 46. An isolated antibody that binds specifically to the isolated polypeptide of claim 43. 47. A recombinant host cell that expresses the isolated polypeptide of claim 43. 48. A method of making an isolated polypeptide comprising: (a) culturing the recombinant host cell of claim 47 under conditions such that said polypeptide is expressed; and (b) recovering said polypeptide. 49. The polypeptide produced by claim 48. 50. A method for preventing, treating, or ameliorating cancer or other hyperproliferative disorder, comprising administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 43. 51. A method of diagnosing cancer or other hyperproliferative disorder in a subject comprising: (a) determining the presence or absence of a mutation in the polynucleotide of claim 33; and (b) diagnosing the cancer or other hyperproliferative disorder based on the presence or absence of said mutation. 52. A method of diagnosing cancer or other hyperproliferative disorder in a subject comprising: (a) determining the presence or amount of expression of the polypeptide of claim 43 in a biological sample; and (b) diagnosing the cancer or other hyperproliferative disorder based on the presence or amount of expression of the polypeptide. 53. A method for identifying a binding partner to the polypeptide of claim 43 comprising: (a) contacting the polypeptide of claim 43 with a binding partner; and (b) determining whether the binding partner effects an activity of the polypeptide. 54. The gene corresponding to the cDNA sequence of SEQ ID NO:X. 55. A method of identifying an activity in a biological assay, wherein the method comprises: (a) expressing SEQ ID NO:X in a cell; (b) isolating the supernatant; (c) detecting an activity in a biological assay; and (d) identifying the protein in the supernatant having the activity. 56. The product produced by the method of claim 53. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Cancer and other hyperproliferative disorders are a diverse group of disorders and diseases sharing one characteristic in common; all result from uncontrolled cell proliferation. The human body is composed of many different cell types, e.g. liver cells, muscle cells, brain cells, etc. Normally, these cells grow and divide to produce more cells only as the body needs them (e.g. to regenerate blood cells or replace epithelial cells lining the stomach). Sometimes, however, cells begin to divide unchecked even though new cells are not needed. These extra cells accumulate and form a mass of tissue, called a tumor. Although each of the over 200 cell types in the body can potentially become cancerous, some cell types become cancerous at relatively high rates while many other cell types rarely become cancerous. Tumors are either benign or malignant. Benign tumors are not cancerous; they can usually be removed, they do not spread to other parts of the body and, they rarely threaten life. Malignant tumors, however, are cancerous. Cells in malignant tumors can invade and damage nearby or distant tissues and organs. The spread of cancerous cells is called metastasis. Malignant (or metastatic) cells can invade adjacent organs by proliferating directly from the primary tumor. Additionally, malignant cells can also metastasize to distant organs by breaking away from the primary tumor, entering the bloodstream or lymphatic system, and settling down in a new organ or tissue to produce a secondary tumor. The origin of secondary tumors is established by comparing cells comprising these tumors to cells in the original (primary) tumor. In contrast to solid organ cancers (such as cancer in the liver, lung, and brain) cancer can also develop in blood-forming cells. These cancers are referred to as leukemias or lymphomas. Leukemia refers to cancer of blood forming cells such as red blood cells, platelets, and plasma cells. Lymphomas are a subset of leukemias, primarily involving white blood cells, in which the cancerous cells originated in, or are associated with, the lymph system and lymph organs (e.g. T-lymphocytes in the lymph nodes, spleen, or thymus). In 1999 over 1.1 million people were newly diagnosed with 23 different types of cancer. The vast majority of these cases (˜75%) involved cancers of the prostate, breast, lung, colon, or urinary tract, or non-Hodgkin's lymphoma. Among the most fatal cancers are pancreatic, liver, esophageal, lung, stomach, and brain cancers, having up to 96% mortality rates depending on the specific cancer. In all, some 23 different types of cancer are expected to kill over 86,000 people each year. Most cancers are treated with one or a combination therapies consisting of surgery, radiation therapy, chemotherapy, hormone therapy, and/or biological therapy. These five therapeutic modes are either local or systemic treatment strategies. Local treatments affect cancer cells in the tumor and imediately adjacent areas (for example, surgical tumor removal is a local treatment as are most radiation treatments). In contrast, systemic treatments travel through the bloodstream, and reach cancer and other cells all over the body. Chemotherapy, hormone therapy, and biological therapy are examples of systemic treatments. Whether systemic or local, it is often difficult or impossible to protect healthy cells from the harmful effects of cancer treatment; healthy cells and tissues are inevitably damaged in the process of treating the cancerous cells. Damage and disruption of the normal functioning of healthy cells and tissues often produces the undesirable side effects experienced by patients undergoing cancer treatment. Recombinant polypeptides and polynucleotides derived from naturally occurring molecules, as well as antibodies specifically targeted to these molecules, used alone or in conjunction with other existing therapies, hold great promise as improved therapeutic agents for the treatment of neoplastic disorders. Currently, most biological therapy can be classified as immunotherapy because these treatments often use naturally occurring molecules to assist the body's immune system in fighting the disease or in protecting the body from side effects of other cancer treatment(s). Among the most commonly used compounds in biological therapies are proteins called cytokines (e.g. interferons, interleukins, and colony stimulating factors) and monoclonal antibodies (targeted to particular cancer cells). Side effects caused by these commonly used biological therapies range from flu-like symptoms (chills, fever, muscle aches, weakness, loss of appetite, nausea, vomiting, and diarrhea) to rashes, swelling, easy bruising, or bleeding. eted proteins associated with initiation, progression, of neoplastic diseases (including antibodies that eptides), satisfies a need in the art by providing new on, prevention, diagnosis, treatment, prevention, liferative disorders. |
<SOH> SUMMARY OF THE INVENTION <EOH>ases human secreted proteins/polypeptides, and isolated proteins/polypeptides, useful for detecting, preventing, ad/or ameliorating cancer and other hyperproliferative lypeptides are also encompassed by the present invention; ombinant and synthetic methods for producing said ntibodies. The invention further encompasses screening antagonists of polynucleotides and polypeptides of the encompasses methods and compositions for inhibiting or f the polypeptides of the present invention. detailed-description description="Detailed Description" end="lead"? |
Human secreted proteins |
The present invention relates to human secreted polypeptides, and isolated nucleic acid molecules encoding said polypeptides, useful for diagnosing and treating cardiovascular diseases, disorders, and/or conditions related thereto. Antibodies that bind these polypeptides are also encompassed by the present invention. Also encompassed by the invention are vectors, host cells and recombinant and synthetic methods for producing said polynucleotides, polypeptides, and/or antibodies. The invention further encompasses screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The present invention further encompasses methods and compositions for inhibiting or enhancing the production and function of the polypeptides of the present invention. |
1-32. (canceled) 33. An isolated nucleic acid molecule comprising a first polynucleotide sequence at least 95% identical to a second polynucleotide sequence selected from the group consisting of: (a) a polynucleotide fragment of SEQ ID NO:X as referenced in Table 1A; (b) a polynucleotide encoding a full length polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein said fragment has biological activity; (e) a polynucleotide encoding a polypeptide domain of SEQ ID NO:Y as referenced in Table 1B; (f) a polynucleotide encoding a polypeptide domain of SEQ ID NO:Y as referenced in Table 2; (g) a polynucleotide encoding a predicted epitope of SEQ ID NO:Y as referenced in Table 1B; and (h) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(g), wherein said polynucleotide does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence of only A residues or of only T residues. 34. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises a nucleotide sequence encoding a secreted form of SEQ ID NO:Y or a secreted form of the polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y, as referenced in Table 1A. 35. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises a nucleotide sequence encoding the sequence identified as SEQ ID NO:Y or the polypeptide encoded by the cDNA sequence included in ATCC Deposit No:Z, which is hybridizable to SEQ ID NO:X, as referenced in Table 1A. 36. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises the entire nucleotide sequence of SEQ ID NO:X or the cDNA sequence included in ATCC Deposit No:Z, which is hybridizable to SEQ ID NO:X, as referenced in Table 1A. 37. The isolated nucleic acid molecule of claim 34, wherein the nucleotide sequence comprises sequential nucleotide deletions from either the C-terminus or the N-terminus. 38. The isolated nucleic acid molecule of claim 35, wherein the nucleotide sequence comprises sequential nucleotide deletions from either the C-terminus or the N-terminus. 39. A recombinant vector comprising the isolated nucleic acid molecule of claim 33. 40. A method of making a recombinant host cell comprising the isolated nucleic acid molecule of claim 33. 41. A recombinant host cell produced by the method of claim 40. 42. The recombinant host cell of claim 41 comprising vector sequences. 43. A polypeptide comprising a first amino acid sequence at least 95% identical to a second amino acid sequence selected from the group consisting of: (a) a full length polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table IA; (b) a secreted form of SEQ ID NO:Y or a secreted form of the polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein said fragment has biological activity; (e) a polypeptide domain of SEQ ID NO:Y as referenced in Table 1B; (f) a polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (g) a predicted epitope of SEQ ID NO:Y as referenced in Table 1B. 44. The polypeptide of claim 43, wherein said polypeptide comprises a heterologous amino acid sequence. 45. The isolated polypeptide of claim 43, wherein the secreted form or the full length protein comprises sequential amino acid deletions from either the C-terminus or the N-terminus. 46. An isolated antibody that binds specifically to the isolated polypeptide of claim 43. 47. A recombinant host cell that expresses the isolated polypeptide of claim 43. 48. A method of making an isolated polypeptide comprising: (a) culturing the recombinant host cell of claim 47 under conditions such that said polypeptide is expressed; and (b) recovering said polypeptide. 49. The polypeptide produced by claim 48. 50. A method for preventing, treating, or ameliorating cardiovascular disorder, comprising administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 43. 51. A method of diagnosing cardiovascular disorder in a subject comprising: (a) determining the presence or absence of a mutation in the polynucleotide of claim 33; and (b) diagnosing the cardiovascular disorder based on the presence or absence of said mutation. 52. A method of diagnosing cardiovascular disorder in a subject comprising: (a) determining the presence or amount of expression of the polypeptide of claim 43 in a biological sample; and (b) diagnosing the cardiovascular disorder based on the presence or amount of expression of the polypeptide. 53. A method for identifying a binding partner to the polypeptide of claim 43 comprising: (a) contacting the polypeptide of claim 43 with a binding partner; and (b) determining whether the binding partner effects an activity of the polypeptide. 54. The gene corresponding to the cDNA sequence of SEQ ID NO:X. 55. A method of identifying an activity in a biological assay, wherein the method comprises: (a) expressing SEQ ID NO:X in a cell; (b) isolating the supernatant; (c) detecting an activity in a biological assay; and (d) identifying the protein in the supernatant having the activity. 56. The product produced by the method of claim 53. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The cardiovascular system is a component of a complex physiological network involved in maintaining the oxygen and nutrient supply to tissues of the body. The heart is the anatomical and functional centerpiece of the cardiovascular system. Weighing only 250-350 grams (less than a pound), the heart is one of our strongest and hardest working organs. It is composed of innervated muscle tissue with unique properties; e.g., it can pace itself in contraction. The main center of rhythm regulation is the sinoatrial (SA) node. Certain cardiac cells repeatedly fire impulses that trigger heart contractions. These autorhythmic cells have two important functions. One is to act as a pacemaker (set the pace for the entire heart), and the other is to form a conduction system, the route for conducting impulses throughout the heart muscle. This conduction system controls the pattern of blood flow through the heart. The heart pumps at least five quarts of blood through a full circuit of the body every minute. The heart consists of two pumps, side by side. The pump on the right side moves blood to the lungs, where waste gases, such as carbon dioxide, are removed and oxygen is added. Freshly oxygenated blood returns to the pump on the left side, which moves it out into the rest of the body. Blood flows away from the heart to the lungs or to the rest of your body, though blood vessels called arteries. Arteries branch extensively, each branch become smaller, forming blood vessels called arterioles. Arterioles also become repeatedly smaller and smaller until they are tiny vessels called capillaries. Throughout the arteries and smaller vessels that stem from them, the blood delivers nutrients and oxygen to the tissues and picks up waste. This task is completed in the capillaries. As the blood moves on through the capillaries the blood vessels gradually become larger, eventually becoming veins. Veins ultimately carry blood back to the heart. The cycle then begins again. Disorders of the cardiovascular system are many and varied, killing more Americans each year than any other category of disorders. For example, damage to the conduction system leads to arrhythmia, an irregular beating of the heart. If left untreated, the heart becomes unable to effectively pump blood, frequently leading to permanent heart damage and/or cardiac arrest. One of the most prevalent conditions in industrialized countries today is atherosclerosis. Atherosclerosis is the buildup of fatty deposits in the intima of large and medium-sized arteries. The buildup of deposits narrowing of the arteries, reducing or potentially blocking the ability of blood to flow through the arteries. Untreated, atherosclerosis typically results in cardiac arrest and, frequently, death. Clearly, the discovery of new human cardiovascular-associated polynucleotides, the polypeptides encoded by them, and antibodies that immunospecifically bind these polypeptides, satisfies a need in the art by providing new compositions which are useful in the diagnosis, treatment, prevention and/or prognosis of cardiovascular disorders. Cardiovascular disorders include, but are not limited to, stroke, cardiovascular abnormalities, such as arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome. Congenital heart defects include, but are not limited to, aortic coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of fallot, transposition of great vessels, double outlet right ventricle, tricuspid atresia, persistent truncus arteriosus, and heart septal defects, such as aortopulmonary septal defect, endocardial cushion defects, Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal defects. Cardiovascular disorders also include, but are not limited to, heart disease, such as arrhythmias, carcinoid heart disease, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial), heart aneurysm, cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction heart rupture, ventricular septal rupture, heart valve diseases, myocardial diseases, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous), pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tuberculosis. Arrhythmias include, but are not limited to, sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus syndrome, tachycardias, and ventricular fibrillation. Tachycardias include paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal reentry tachycardia, ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal reentry tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular tachycardia. Heart valve diseases include, but are not limited to, aortic valve insufficiency, aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency, and tricuspid valve stenosis. Myocardial diseases include, but are not limited to, alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Keams Syndrome, myocardial reperfusion injury, and myocarditis. Myocardial ischemias include, but are not limited to, coronary disease, such as angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning. Cardiovascular diseases also include vascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease, Klippel-Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic diseases, Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive diseases, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-occlusive disease, hypertension, hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia, atacia telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose veins, varicose ulcer, vasculitis, and venous insufficiency. Aneurysms include, but are not limited to, dissecting aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms. Arterial occlusive diseases include, but are not limited to, arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal artery obstruction, retinal artery occlusion, and thromboangiitis obliterans. Cerebrovascular disorders include, but are not limited to, carotid artery diseases, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery diseases, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient), subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency. Embolisms include, but are not limited to, air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and thromoboembolisms. Thrombosis include, but are not limited to, coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and thrombophlebitis. Ischemic disorders include, but are not limited to, cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and peripheral limb ischemia. Vasculitis includes, but is not limited to, aortitis, arteritis, Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention encompasses human secreted proteins/polypeptides; and isolated nucleic acid molecules encoding said proteins/polypeptides, useful for detecting, preventing, diagnosing, prognosticating, treating, and/or ameliorating cardiovascular diseases and disorders. Antibodies that bind these polypeptides are also encompassed by the present invention; as are vectors, host cells, and recombinant and synthetic methods for producing said polynucleotides, polypeptides, and/or antibodies. The invention further encompasses screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The present invention also encompasses methods and compositions for inhibiting or enhancing the production and function of the polypeptides of the present invention. detailed-description description="Detailed Description" end="lead"? |
Human secreted proteins |
The present invention relates to human secreted polypeptides, and isolated nucleic acid molecules encoding said polypeptides, useful for diagnosing and treating hematopoietic and hematologic diseases, disorders, and/or conditions related thereto. Antibodies that bind these polypeptides are also encompassed by the present invention. Also encompassed by the invention are vectors, host cells, and recombinant and synthetic methods for producing said polynucleotides, polypeptides, and/or antibodies. The invention further encompasses screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The present invention further encompasses methods and compositions for inhibiting or enhancing the production and function of the polypeptides of the present invention. |
1-32. (canceled) 33. An isolated nucleic acid molecule comprising a first polynucleotide sequence at least 95% identical to a second polynucleotide sequence selected from the group consisting of: (a) a polynucleotide fragment of SEQ ID NO:X as referenced in Table 1A; (b) a polynucleotide encoding a full length polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein said fragment has biological activity; (e) a polynucleotide encoding a polypeptide domain of SEQ ID NO:Y as referenced in Table 1B; (f) a polynucleotide encoding a polypeptide domain of SEQ ID NO:Y as referenced in Table 2; (g) a polynucleotide encoding a predicted epitope of SEQ ID NO:Y as referenced in Table 1B; and (h) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(g), wherein said polynucleotide does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence of only A residues or of only T residues. 34. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises a nucleotide sequence encoding a secreted form of SEQ ID NO:Y or a secreted form of the polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y, as referenced in Table 1A. 35. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises a nucleotide sequence encoding the sequence identified as SEQ ID NO:Y or the polypeptide encoded by the cDNA sequence included in ATCC Deposit No:Z, which is hybridizable to SEQ ID NO:X, as referenced in Table 1A. 36. The isolated nucleic acid molecule of claim 33, wherein the polynucleotide fragment comprises the entire nucleotide sequence of SEQ ID NO:X or the cDNA sequence included in ATCC Deposit No:Z, which is hybridizable to SEQ ID NO:X, as referenced in Table 1A. 37. The isolated nucleic acid molecule of claim 34, wherein the nucleotide sequence comprises sequential nucleotide deletions from either the C-terminus or the N-terminus. 38. The isolated nucleic acid molecule of claim 35, wherein the nucleotide sequence comprises sequential nucleotide deletions from either the C-terminus or the N-terminus. 39. A recombinant vector comprising the isolated nucleic acid molecule of claim 33. 40. A method of making a recombinant host cell comprising the isolated nucleic acid molecule of claim 33. 41. A recombinant host cell produced by the method of claim 40. 42. The recombinant host cell of claim 41 comprising vector sequences. 43. A polypeptide comprising a first amino acid sequence at least 95% identical to a second amino acid sequence selected from the group consisting of: (a) a full length polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (b) a secreted form of SEQ ID NO:Y or a secreted form of the polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit No:Z corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein said fragment has biological activity; (e) a polypeptide domain of SEQ ID NO:Y as referenced in Table 1B; (f) a polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (g) a predicted epitope of SEQ ID NO:Y as referenced in Table 1B. 44. The polypeptide of claim 43, wherein said polypeptide comprises a heterologous amino acid sequence. 45. The isolated polypeptide of claim 43, wherein the secreted form or the full length protein comprises sequential amino acid deletions from either the C-terminus or the N-terminus. 46. An isolated antibody that binds specifically to the isolated polypeptide of claim 43. 47. A recombinant host cell that expresses the isolated polypeptide of claim 43. 48. A method of making an isolated polypeptide comprising: (a) culturing the recombinant host cell of claim 47 under conditions such that said polypeptide is expressed; and (b) recovering said polypeptide. 49. The polypeptide produced by claim 48. 50. A method for preventing, treating, or ameliorating a hematopoietic or hematologic disorder, comprising administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 43. 51. A method of diagnosing a hematopoietic or hematologic disorder in a subject comprising: (a) determining the presence or absence of a mutation in the polynucleotide of claim 33; and (b) diagnosing the hematopoietic or hematologic disorder based on the presence or absence of said mutation. 52. A method of diagnosing a hematopoietic or hematologic disorder in a subject comprising: (a) determining the presence or amount of expression of the polypeptide of claim 43 in a biological sample; and (b) diagnosing the hematopoietic or hematologic disorder based on the presence or amount of expression of the polypeptide. 53. A method for identifying a binding partner to the polypeptide of claim 43 comprising: (a) contacting the polypeptide of claim 43 with a binding partner; and (b) determining whether the binding partner effects an activity of the polypeptide. 54. The gene corresponding to the cDNA sequence of SEQ ID NO:X. 55. A method of identifying an activity in a biological assay, wherein the method comprises: (a) expressing SEQ ID NO:X in a cell; (b) isolating the supernatant; (c) detecting an activity in a biological assay; and (d) identifying the protein in the supernatant having the activity. 56. The product produced by the method of claim 53. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Blood is composed of a fluid component, plasma, in which are suspended red blood cells, white blood cells, and platelets. This suspension, circulating through the cardiovascular system, forms the basis of the immune system, provides all of the body's tissues with oxygen and nutrients, and removes carbon dioxide and other metabolic byproducts for excretion. Immune cells, red blood cells, and platelets, are derived from common precursor stem cells and develop through a process known as hematopoiesis. During fetal life hematopoiesis occurs in the liver and spleen, but in the adult, hematopoiesis occurs primarily in the bone marrow and thymus. The stem cells from which all blood cells are derived proliferate and differentiate into the various blood cell lineages, (e.g., lymphoid cells (B or T cells), myeloid cells (basophils, eosinophils, neutrophils, macrophages, mast cells), thrombocytes (platelets), or erythrocytes (red blood cells)) in response to cytokines and other signals received from cells (e.g., stromal cells) in the bone marrow microenvironment. Many of the cytokines that promote the growth and differentiation of hematopoietic stem cells are known as “colony stimulating factors”. For example, interleukin-3 (IL-3, and also known as multi-colony stimulating factor) and granulocyte macrophage colony stimulating factor (GM-CSF), which are released by activated macrophages and T cells, stimulate the production of macrophages and granulocytes (myelopoiesis). Stem cell factor (SCF, c-kit ligand) is a growth factor for primitive lymphoid and myeloid hematopoietic bone marrow progenitor cells expressing the early cell surface marker CD34. Other hematopoietic cytokines/growth factors include, but are not limited to macrophage colony stimulating factor (M-CSF), granulocyte colony stimulating factor (G-CSF), and erythropoietin (EPO). Interleukins-1, 6, and 7 have also been shown to function as hematopoietic growth factors/cytokines. Deficiencies in the quantities of mature red or white blood cells, either as a result of insufficient production or excessive destruction, may result in anemias and/or immunodeficiencies. In addition to the cellular component of the blood, there are a remarkable variety of soluble blood-borne proteins that serve important physiological functions. Descriptions of some of the functional classes of blood proteins, along with representative members of these classes, are given below. Coagulation Factors The formation of insoluble protein aggregates at the site of vascular injury or inflammation, termed coagulation, is the result of multiple interacting coagulation factors (Dahlback, B., Lancet 355:1627-32). This cascade of interdependent proteins (including Factors V, VIII, IX, X XI, and XII) results in the production of the protease, thrombin. Thrombin converts blood-soluble fibrinogen into fibrin, which polymerizes into insoluble clots that are stabilized by the activity of Factor XIII. This process is balanced by the activity of coagulation inhibitors such as antithrombin III, heparin cofactor II, Protein C and Protein S. Imbalance between pro-clotting factors and coagulation inhibitors leads to potentially serious medical conditions, including improper wound healing and the bleeding disorders hemophilia A and B, as well as excessive clotting disorders such as thrombosis (e.g. cerebral, coronary, and placental), pulmonary embolus, stroke, and coronary artery disease. For a more extensive review see Triplett, D., Clin Chem 46:1260-9. Immunoproteins Blood plasma contains a number of proteins that contribute to the immune response. Immunoglobulin antibodies are glycoproteins with similar structural domains, which bind to specific antigenic invaders and trigger other components of the immune system. The complement cascade, a network of about 20 interacting proteins, is activated by antigen-antibody complexes and results in the lysis of infected cells, as well as other important immune functions. Immunoproteins are important tools for the diagnosis and treatment of infection, cancer, and other disorders. For more detailed discussion of immunoproteins see Meri, J. and Jarva, H., Vox Sang 74 suppl. 2:291-302 and Chapter 23 of Molecular Biology of the Cell, 3 rd Edition, edited by Alberts, B. et al. Hormones The blood serves as a major vehicle for hormones and other secreted signaling molecules that act at a site distant to their release. A number of peptide hormones function as regulators of homeostatic processes. For example, parathyroid hormone and calcitonin oppositely regulate serum levels of calcium. Blood-borne peptide hormones that regulate carbohydrate metabolism include insulin, glucagon, and adrenocorticotropin hormone. Vasopressin, angiotensin, and bradykinin are hormones that modulate vasodilation and blood pressure. Follicle-stimulating hormone and leutinizing hormone play important roles in both male and female reproductive functions. Dysfunction of these hormones can lead to a wide spectrum of disorders, including osteoporosis, diabetes, psychiatric disorders, hypoglycemia, obesity, infertility, as well as hypo- and hypertension. Cytokines Cytokines are a class of circulating proteins that act primarily as intercellular signaling molecules regulating hematopoiesis, angiogenesis, and immune system functions. One subgroup of cytokines, the hematopoietins, regulates hematopoietic stem cell differentiation to maintain the proper number and proportions of each blood cell type. For example, the production of erythrocytes is stimulated by the release of erythropoietin from the kidneys in response to decreased blood oxygen levels. Similarly, thrombopoietin stimulates the proliferation and differentiation of megakaryocytes, leading to increased platelet production. Another cytokine subgroup, the chemokines, is secreted by cells of the immune system, and act to coordinate the immune response to an invading antigen. This is a large and diverse class of proteins, and includes RANTES, eotaxin, lymphotactin, MIP-1, and the interleukins. Many of these polypeptides have uses in the diagnosis and treatment of immunological disorders and infection (Holldack. J. et al., Med Ped Oncol Suppl 2:2-9; Chapter 23 , Immunology , edited by Elgert, K.). Carrier Proteins A number of soluble proteins found in blood function as carriers of other molecules such as nutrients and waste products. Carrier proteins can also bind exogenously delivered drugs and influence pharmacokinetic properties such as serum half-life and tissue adsorption. Serum albumin, comprising about half of the protein found in blood plasma, regulates osmotic pressure of blood, as well as binds many bioactive molecules. Transferrin is a blood carrier protein that regulates iron levels, while ceruloplasmin regulates copper levels. Thus there exists a clear need for novel polynucleotides and polypeptides (as well as antibodies, agonists, and antagonists) useful in diagnostic and therapeutic methods for detecting, preventing, diagnosing, prognosticating, treating, and/or ameliorating hematopoietic and hematologic diseases and disorders; such as, for example, leukemias, lymphomas, hemophilias, anemias, immunodeficiency disorders (including AIDS), amongst many other conditions. See, e.g., “Blood Related Disorders” and “Immune Activity” sections, infra. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention encompasses human secreted proteins/polypeptides, and isolated nucleic acid molecules encoding said proteins/polypeptides, useful for detecting, preventing, diagnosing, prognosticating, treating, and/or ameliorating hematopoeitic and hematololgic disorders and diseases. Antibodies that bind these polypeptides are also encompassed by the present invention; as are vectors, host cells, and recombinant and synthetic methods for producing said polynucleotides, polypeptides, and/or antibodies. The invention further encompasses screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The present invention also encompasses methods and compositions for inhibiting or enhancing the production and function of the polypeptides of the present invention. detailed-description description="Detailed Description" end="lead"? |
Mis hydrogen sensors |
Hydrogen gas sensors employ an epitaxial layer of the thermodynamically stable form of aluminum nitride (AlN) as the “insulator” in an MIS structure having a thin metal gate electrode suitable for catalytic dissociate of hydrogen, such as palladium, on a semiconductor substrate. The AlN is deposited by a low temperature technique known as Plasma Source Molecular Beam Epitaxy (PSMBE). When silicon (Si) is used the semiconducting substrate, the electrical behavior of the device is that of a normal nonlinear MIS capacitor. When a silicon carbide (SiC) is used, the electrical behavior of the device is that of a rectifying diode. Preferred structures are Pd/AlN/Si and Pd/AlN/SiC wherein the SiC is preferably 6H—SiC. |
1. A device for the detection of hydrogen gas, comprising: a semiconductor substrate; an epitaxial layer of AlN disposed on a face surface of the semiconductor substrate as an insulating layer; and a metal electrode disposed on the insulating layer, the metal electrode being a catalyst for hydrogen diffusion. 2. The device of claim 1 wherein the metal electrode is selected from the group consisting of palladium, platinum, rhodium, and alloys thereof. 3. The device of claim 2 wherein the metal electrode is palladium. 4. The device of claim 1 wherein the semiconductor substrate is silicon. 5. The device of claim 1 wherein the semiconductor substrate is silicon carbide 6. The device of claim 5 wherein the silicon carbide substrate is 6H—SiC. 7. A method of making a hydrogen gas sensor comprising the steps of: a) depositing an epitaxial layer of AlN on a doped semiconductor substrate; and b) applying a catalytic metal layer on the epitaxial layer of AlN. 8. The method of claim 7 wherein the AlN layer is deposited by the steps of: a) forming a plasma of high energy activated aluminum ions and activated nitrogen ion species by the application of rf power to a source of aluminum and nitrogen; b) exposing the substrate to a low energy flux of the plasma; and c) growing an epitaxial AlN film on the substrate. 9. The method of claim 8 wherein the epitaxial AlN film is grown on the substrate at a temperature in the range of 300° C.-900° C. 10. The method of claim 8 wherein the rf power is between about 100 W-300 W. 11. The method of claim 7 wherein the catalytic metal layer is deposited by evaporation or sputtering. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention This invention relates generally to gas sensors, and more particularly, to solid state sensors that can selectively detect the presence of hydrogen. 2. Description of the Related Art A device that can detect the concentration of hydrogen in the presence of other gases would have multiple uses in, inter alia, the transportation industry. For example, in the space program, a mass spectrometer is employed to detect the presence of hydrogen in and around the space shuttle. This known device suffers from the disadvantage that, while it can detect the presence of hydrogen, it is incapable of identifying the source, or location of hydrogen leakage. There is therefore, a need for small, relatively inexpensive sensors, that can be placed in multiple locations for detecting a source of hydrogen gas emission. As another example, the automotive industry has been developing new power sources, such as a hydrogen combustion engine and a hydrogen fuel cell. The safe use of these new power sources will require hydrogen sensors that can operate over a broad range of temperatures, pressures, and gas compositions. Although there has been some effort expended to develop hydrogen sensors in the past, most, if not all, known hydrogen sensors have not entered commercial production because they have failed to meet all of the required parameters. Hydrogen can be detected readily in an environment that contains only hydrogen. However, it is considerably more difficult, with current technology, to detect hydrogen when it is mixed with other gases. Furthermore, with current technology, if a sensor is optimized to overcome the selectivity problem, temperature and pressure requirements are not satisfied. There is a need, therefore, for a sensor that overcomes all the present problems of selectivity, temperature, and pressure, whereby the sensor would be made usable in a realistic environment. It is known that catalytic metals can be used as gates for gas sensitive field effect devices, such as transistors, capacitors, diodes, and the like. Known devices include metal-insulator-semiconductor (MIS) or metal-oxide-semiconductor (MOS) structures. Gas sensitivity occurs because reaction intermediaries give rise to electrical phenomena at the metal-insulator or metal-semiconductor boundaries. In a hydrogen sensor, for example, molecular hydrogen dissociates at the catalytic metal electrode surface and the hydrogen atoms produced diffuse through the electrode and are adsorbed at the electrode/insulator interface. The dipole moment of the adsorbed atoms produce a detectable change in threshold voltage of the device, thereby giving an indicate of the concentration of hydrogen in the gas to which the device is exposed. The prior art has determined that palladium is the ideal catalyst for hydrogen diffusion. Hydrogen travel time within a palladium thin film is sufficiently small for this catalyst to be used as a selective “membrane.” Palladium (Pd) may provide acceptable selectivity, but when pure Pd films are used, other problems are typically encountered. For example, below 300° C., Pd undergoes an a-b phase transformation in the presence of a high concentration of hydrogen. Also, contraction and expansion of a Pd film leads to embrittlement and eventual fracture of the metal. To overcome these problems, the prior art has suggested using Pd in combination with other materials. In particular, the prior art has explored the use of Pd/Ni alloy and Pd/Group V/Pd membranes. However, such membranes have exhibited temperature range limitations. For example, if these known devices are used at high temperatures, the membrane layers will melt into each other, preventing hydrogen from diffusing therethrough. Moreover, electron beam evaporation is used in the construction of the known alloys, requiring a substrate that also melts if used at high temperatures. In one effort to overcome these temperature limitations, a polycrystalline diamond film was applied over a Pd thin film by plasma-enhanced chemical vapor deposition. The temperature problem was not overcome since this device was useful only to 200° C. It is additionally a problem that palladium is a good catalyst for many reactions, and therefore, poisoning occurs on the palladium surface. By “poisoning,” it is meant that other gases also adsorb at the palladium surface, closing the pores necessary for the diffusion of hydrogen. Some of the many adverse gases in this scenario are oxygen (O 2 ), and particularly carbon monoxide (CO). The presence of O 2 at the Pd surface results in dissociation into single oxygen atoms, which then react in the presence of hydrogen ions to form water. Fortunately, the water evaporates and frees the Pd sites. In fact, in order to purge palladium films from hydrogen, a flow of oxygen gas is supplied on the surface of the device, and vice versa, to purge a Pd film from oxygen poisoning, hydrogen gas is used. On the other hand, on a Pd surface, CO does not react easily with other elements, and therefore, CO poisoning is a significant problem in the art. There is, therefore, a need for a hydrogen sensor that can operate over extended ranges of temperature and pressure, and in the presence of multiple gases and contaminants. |
<SOH> SUMMARY OF THE INVENTION <EOH>The foregoing needs and other objects are achieved by this invention which provides, in a first device embodiment, a semiconductor device, that can be used, in a preferred embodiment, as a hydrogen sensor. More-specifically, the hydrogen sensor of the present invention is an MIS device that differs from previously developed MIS devices, by employing aluminum nitride (AlN) as the insulator in the MIS structure. AlN is a wide bandgap (˜6.2 EV) semiconductor, found to be chemically stable and to have the capability of withstanding high temperatures. In MIS sensors, a catalytic film (i.e., one which dissociates molecules) is separated from a semiconductor film by a dielectric film. Exposure to a gas, e.g., hydrogen, changes the capacitance of the sensor. The change in capacitance can then be measured as an indication of gas concentration. In a broad device embodiment of the present invention, a sensor for the detection of hydrogen gas comprises a semiconductor substrate; an epitaxial layer of AlN disposed on a face surface of the semiconductor substrate as an insulating layer; and a metal electrode disposed on the insulating layer, the metal electrode being a catalyst for hydrogen diffusion. Of course, the choice of catalytic metal for the electrode will depend on the particular chemical substance being detected. The use of rhodium, for example, would enable the detection of nitric oxide. The use of the MIS device to detect hydrogen is intended to be illustrative, and not limiting. Examples of suitable metals known to be useful in detecting chemical species include, but are not limited to Pt, Pd, Ir, Rh, Ru, Os, Fe, Ag, Au, Cu, and Ni, either alone or alloyed with each other. It is also within the contemplation of the invention that the catalytic metals can be alloyed with non-catalytic metals, or insulators, to increase the active surface area of the catalyst and to prevent surface poisoning as is known in the art. Since the catalytic metal electrode operates as a “selective membrane” for the chemical species to be detected, any combination of materials known or developed, that can selectively detect a chemical species, is within the contemplation of the present invention. In the preferred hydrogen sensor embodiment described in detail herein, the preferred catalytic metals include Pd, Pt, Rh, and alloys thereof, and most preferably Pd. The catalytic metal electrode layer in the device of the preferred embodiment is typically a thin film of pure Pd ranging in thickness from about 1000 Å to 1 micron, and most preferably about 1000 Å to 2000 Å. The semiconductor substrate is a semiconductor material of one conductivity type (doped p- or n-type). Typically, the semiconductor substrate is a silicon (Si) wafer or silicon carbide (SiC) wafer. The semiconductor substrate material affects the operation of the device as will be described in detail hereinbelow. Silicon carbide, and particularly 6H—SiC, is especially useful in high temperature embodiments. The insulating aluminum nitride layer is an epitaxial layer of AlN (the thermodynamically stable wurtzite form). In a preferred embodiment, the epitaxal layer of AlN is grown by a Plasma Source Molecular Beam Epitaxy (PSMBE) technique that is described in detail in International Publication WO 00/61839 published on Oct. 19, 2000, the text of which is incorporated herein by reference. In preferred embodiments, the insulating AlN layer has a thickness of between about 500 Å to 5000 Å, and preferably about 1000 Å. In one preferred embodiment of the invention, silicon is the substrate for a Pd/AlN/Si MIS hydrogen sensor. In a specific illustrative embodiment, the Si substrate is an n-type (111)-oriented wafer. The insulating aluminum nitride layer is an epitaxial layer of AlN deposited by PSMBE and the gate layer is a thin film of Pd that may be deposited on the AlN film in any known manner, illustratively by magnetron sputtering through a hard mask. In a second preferred embodiment of the invention, silicon carbide (SiC), and preferably n-type 6H—SiC, is the substrate for a device having the structure Pd/AlN/SiC. Although both embodiments have an MIS structure, and are capable of selectively detecting hydrogen, the silicon carbide-based device has a different electrical characteristic than the Pd/AlN/Si device. The Pd/AlN/Si device responds to the presence of hydrogen by a shift in its ac capacitance versus bias voltage characteristic, similar to known MOS devices, whereas the Pd/AlN/SiC device responds by a shift in its forward I(V) characteristic, similar to a rectifying diode. Of course, multilayered devices having additional layers of metals and/or semiconductors are within the contemplation of the invention. For example, a layer of a Group VB metal, such as zirconium, can be interposed between the insulating layer and the palladium gate electrode, by standard deposition techniques. The sensors may be also be fabricated to incorporate additional features, such as a built-in heating coil, may be micromachined for industrial applications. The gas-sensitive MIS field effect transistor structures are described herein by way of example. It is to be understood that the invention can encompass other electrical devices that can be devised including, for example, varieties of field effect transistor (FET) structures other than the examples described herein, MIS diodes and transistors, Schottky barrier devices, electrochemical cells, surface acoustic wave devices, piezo-electric crystal oscillators and chemoresistive devices. In a method of embodiment of the present invention, the AlN insulating layer is epitaxially deposited on a first surface of a semiconductor substrate and a layer of catalytic metal is deposited on the epitaxial layer of AlN by any known technique, such as by sputtering. In a particularly preferred method embodiment of the present invention, the AlN layer is deposited by PSMBE, and more specifically by forming a plasma of high energy activated aluminum ions and activated nitrogen ion species by the application of rf power to a source of aluminum and nitrogen so as to create a low energy flux of plasma; exposing the semiconductor substrate to a low energy flux of the plasma so as to deposit an epitaxial layer of AlN film on the exposed face of the substrate. In specific preferred embodiments, the PSMBE is conducted at a temperature in the range of 300° C.-900° C. and the rf power applied to create the plasma is between about 100 W-300 W. PSMBE deposits a thermodynamically stable, wurtzite AlN layer, epitaxially oriented on the substrate, to any desired thickness, illustratively, between about 500 Å to 5000 Å. |
Generation of multipotent central nervous system stem cells |
Methods for generating various cellular phenotypes from central nervous system stem cells are disclosed. Cellular differentiation into phenotypes of organs and tissues within and outside of the central nervous system is induced by co-culture with target cell types or by soluble trophic factors and elements of the extracellular matrix. Established pluripotent CNS stem cell lines are also disclosed. |
1. A pluripotent mammalian central nervous system (CNS) stem cell line, comprising: stem cells isolated from fetal, neonatal or adult brain having the capacity of proliferating perpetually in an undifferentiated state as CNS stem cells and differentiating into functional cells of the ectoderm, mesoderm or endoderm tissue groups, wherein said capacity is manifest when said stem cells are grown in an environment selected from the group consisting of an environment comprising cells selected from one of said tissue groups, an environment comprising one or more stimulating factors produced by selected cells from one of said tissue groups, an environment comprising one or more stimulating factors from a non-cell source, and an environment comprising the absence of one or more stimulating factors. 2. A cell line according to claim 1, wherein the presence or absence of stimulating factors or signals from other mammalian cell types induces said stem cells to differentiate into neurons and glia. 3. A cell line according to claim 2 wherein the absence of beta Fibroblast Growth Factor in the growth medium induces said stem cells to differentiate into cells with glial properties. 4. A cell line according to claim 1, wherein stimulating factors or signals from adjacent endocrine cell types induces said stem cells to differentiate into endocrine cells. 5. A cell line according to claim 4, wherein the induced endocrine cells produce insul. 6. A cell line according to claim 4, wherein the differentiated cells are insulin-producing pancreatic beta cells. 7. A cell line according to claim 1, wherein said stem cells differentiate into endocrine cell types having the capability to produce one or more members of the group of pituitary factors consisting of growth hormone, prolactin, and pit1. 8. A cell line according to claim 7, wherein said differentiation is induced by factors or signals isolated from mammalian pituitary cells. 9. A cell line according to claim 7, wherein the differentiation is induced by contact with mammalian pituitary cells. 10. A cell line according to claim 7, wherein the endocrine cells are pituitary cells. 11. A cell line according to claim 1, wherein the stem cells differentiate into cardiac cell types through the exposure of said stem cells to horse serum and GDNF. 12. A cell line according to claim 11, wherein the cardiac cell types are pulsatile cardiac cells. 13. A cell line according to claim 12, wherein the pulsatile cardiac cells express one or more cardiac transcription factors. 14. A cell line according to claim 13, wherein the transcription factor is a member of the group consisting essentially of GATA4, myosin, or troponin IC. 15. A cell line according to claim 1, wherein said stem cells differentiate into glial cell types in the presence of other mammalian cell types. 16. A cell line according to claim 15, wherein said stem cells differentiate into glial cell types in the presence of mammalian Post Natal-5 days primary astrocytes culture. 17. A cell line according to claim 15, wherein said stem cells differentiate into glial cell types in the presence of mammalian glioma cultures. 18. A cell line according to claim 1, wherein said stem cells differentiate into glial cell types in the presence of isolated factors and or signals from other mammalian cell types. 19. A cell line according to claim 1, wherein said stem cells are capable of differentiating into neurons in the presence or absence of factors or signals from other mammalian cell types. 20. A cell line according to claim 20, wherein said stem cells respond to the presence of EGF and bFGF by differentiating into neurons expressing microtubule associated protein 2 (Map-2) marker. 21. A cell line according to claim 20, wherein the cells respond to the presence of BDNF by differentiating into neurons expressing Map-2 marker. 22. A method for inducing trans-differentiation of pluripotent stem cells into other cell types, comprising: harvesting the pluripotent stem cells from tissues and/or organs; placing the harvested cells into cell culture; culturing the cells under conditions suitable for maintaining pluripotency; contacting the cultured pluripotent cells with differentiation-inducing factors; and determining differentiation into a particular cell type. 23. The method according to claim 22, wherein the harvesting comprises teasing or trituration of fetal, neonatal or adult CNS tissue. 24. The method according to claim 22, wherein said harvested cells are placed on poly-L-omithine coated culture plates. 25. The method according to claim 22, wherein the contacting is accomplished by differentiation-inducing factors. 26. The method according to claim 22, wherein the culturing conditions comprise maintaining inducing cells in standard media, harvesting the conditioned media, and exposing CNS stem cells to the conditioned media containing soluble stimulants secreted by the inducing cells. 27. The method according to claim 26, wherein the stimulants are isolated from the conditioned media. 28. The method according to claim 22, wherein the contacting is accomplished by co-culturing with organ-specific inducing cell types. 29. The method according to claim 22, wherein the deter g is made by quantitative reverse transcriptase-polymerase chain reaction (QRT-PCR). 30. The method according to claim 22, wherein the determination is made by immunocytochemical characterization of the expression of cell-specific markers. 31. The method according to claim 22, wherein the cell-specific markers are members of the group consisting essentially of nestin, MAP-2, GFAP, Lhx-3, Pit-1, prolactin, Isl-1, insulin, GATA-4, myosin and troponin IC, and wherein the presence of nestin indicates stem cell properties, the presence of MAP-2 indicates differentiation into neuronal cells, the presence of GFAP indicates differentiation into glial cells, the presence of transcription factors Lhx-3 and/or Pit-1 and/or the hormones hGH and Prl indicate differentiation into pituitary cells, the presence of GATA-4, myosin, and/or troponin IC indicate differentiation into pulsatile cardiac cells, and the presence of Isl-1 and/or insulin indicate differentiation into pancreatic cells. 32. A method for treating a subject by populating and/or repopulating cells in depleted or defective organs and/or tissues with pluripotent CNS stem cells induced in vivo or in vitro to specifically differentiate into functional cell types of the affected organ or tissues, comprising: inducing trans-differentiation of pluripotent CNS stem cells into various other cell types by harvesting pluripotent stem cells from CNS tissue; placing the harvested cells into cell culture, culturing the cells under conditions suitable for maintaining their pluripotency, contacting the cultured pluripotent cells in vitro or in vivo with differentiation-inducing factors; determining presence of differentiation into a particular cell type by characterizing expression of cell-specific properties; and introducing these differentiated cell types to populate and/or repopulate defective areas of said tissues and/or organs. 33. The method according to claim 32, wherein the differentiation-inducing factors are soluble. 34. The method according to claim 32, wherein the source of differentiation-inducing factors are cells in co-culture or the cells of said subject in vivo. 35. The method according to claim 32, wherein the populating and/or repopulating is accomplished by a member of the group including grafting, gene therapy, factor delivery, tissue engineering and organ development. 36. The method according to claim 32, wherein the differentiated CNS cells are used as a conduit for gene therapy or factor delivery to prevent or treat disease. 37. A method for identifying functionality of certain genes, proteins and regulation in various organ and tissue cell types useful in gene discovery, drug discovery, elucidation of differentiation pathways, genetic markers, regulatory factors and biological regulation, comprising: inducing bans-differentiation of pluripotent central nervous system stem cells into various other cell types by harvesting the pluripotent stem cells from tissues and organs, placing the harvested cells into cell culture, culturing the cells under conditions suitable for maintaining their pluripotency, contacting the cultured pluripotent cells with differentiation-inducing soluble factors or differentiated cells; determining the differentiation into a particular cell type by characterizing expression cell-specific properties; and using these cell types to identify involvement of genes, efficacy of drugs, differentiation pathways, genetic markers and regulatory factors and biological regulation. 38. The method according to claim ?37, wherein the differentiated CNS cells can be used to produce biological factors such as hormones and other vital proteins. 39. A method for isolating and identifying soluble differentiation-inducing factors capable of inducing differentiation of pluripotent central nervous system stem cells into various other cell Apes, comprising: placing differentiation-inducing cells into cell culture; culturing the cells under conditions suitable for maintaining their integrity, harvesting partially spent and conditioned culture medium; fractionating the conditioned medium; contacting pluripotent stem cells with the fractions in cell culture; determining differentiation-inducing effectiveness of each fraction by characterizing expression of cell-specific properties acquired by the induced stem cells to identify the fraction comprising differentiation-inducing factor or factors; isolating the factor, and identifying the molecular composition of the factor. 40. The method according to claim 39, wherein the isolated factors are produced in quantity to provide available resources for differentiating pluripotent cells from autologous, homologous, heterologous, or stem cell line sources. 41. The method according to claim 40, wherein the production is by chemical means. 42. The method according to claim 40, wherein the production is by genetic expression. 43. The method according to claim 42, wherein the expression is a natural occurrence in certain cell types. 44. The method according to claim 42, wherein the expression is induced by gene insertion. 45. The method according to claim 44, wherein the gene is inserted into pluripotent stem cells, which cells are capable of proliferation and expression of large amounts of said factors. 46. The method according to claim 44, wherein the gene is inserted into the gene pool of other organisms suitable for expression and recovery of large amounts of said factors. 47. The method according to claim 44, wherein the gene insertion is by methods known to those accomplished in the field. 48. The method according to claim 39, wherein the isolated factor is used to stimulate pluripotent stem cells into directed differentiation in the absence of inducing cell types. wherein the inducing cells are unavailable for co-culture, or are depleted or defective in a subject. 49. The method according to claim 48, wherein the stimulation is in vitro or in vivo. 50. The method according to claim 49, wherein the in vivo stimulation is accomplished by contacting a subject's cells with the isolated factor. 51. The method according to claim 50, wherein the contacting is by injection or infusion, or other means known to those in the field of administering drugs to subjects. 52. A pharmaceutical composition, comprising: an effective amount of a differention-inducing factor in a pharmaceutically acceptable carrier. |
<SOH> BACKGROUND OF THE INVENTION <EOH>This application claims priority under 35 U.S.C. § 119(e), to U.S. provisional patent application Ser. No. 60/278,510, filed Mar. 23, 2001. cross-reference-to-related-applications description="Cross Reference To Related Applications" end="tail"? |
<SOH> SUMMARY OF THE INVENTION <EOH>To address the beforementioned problem and the above solution the inventors disclose their invention as follows. The instant invention contemplates pluripotent stem cells, for example, mammalian central nervous system (CNS) stem cells isolated from fetal, neonatal or adult brain, as well as resulting cell lines and cell cultures. These cells have the capacity to proliferate perpetually in an undifferentiated state as, for example, CNS stem cells. When these stem cells, for example, CNS stem cells, are grown in or exposed to an environment of cells comprising ectoderm, mesoderm or endoderm tissue cells, or soluble stimulating factors, or media conditioned by such cells or factors, they have the capability to differentiate into functional cells of the ectoderm, mesoderm or endoderm tissue groups. Co-culturing with other mammalian cell types, or culturing in the presence or absence of soluble factors or signals induces stem cells, for example CNS stem cells to differentiate into neurons, glia and other cell types. For example, in one embodiment the absence of beta Fibroblast Growth factor (bFGF) in their growth medium induces these cells to differentiate into cells with glial and neuronal properties. In another embodiment, isolated factors or signals from adjacent endocrine cell types induces the isolated stem cells, for example CNS cells to differentiate into endocrine cells that are capable of producing, for example, insulin Thus, the isolated stem cells, for example CNS cells, can be differentiated to become insulin-producing beta cells normally found in the islets of Langerhans cells of the pancreas. In another embodiment, for example, stem cells, for example CNS stem cells isolated in accordance with the invention described and claimed herein can be induced to differentiate to pituitary cells that have the capability to produce one or more members of the group of pituitary factors consisting of growth hormone, prolactin, and pit1. In another more preferred embodiment, pituitary differentiation is induced by factors or signals isolated from other mammalian pituitary cells, causing the generation of pituitary cells. In yet another embodiment, the isolated pluripotent stem cells, for example are differentiated into cardiac cell types. Such cardiac cell types include pulsatile cardiac cells, having the capacity to express one, or more, cardiac transcription factors. Preferably, these transcription factors comprise the group consisting of GATA-4, myosin, or troponin IC. In yet a farther embodiment, the isolated stem cells, for example CNS cells differentiate into glial cell types in the presence of other mammalian cell types. This can be accomplished by exposing stem cells, for example, CNS stem cells to mammalian Post Natal-5 days primary astrocytes culture, mammalian glioma cultures, or isolated factors and/or signals from other mammalian cell types. Differentiation may be confirmed, for example, by analysis for the presence or expression of glial fibrillary acidic protein (GFAP). In another embodiment the stem cells are differentiated into neurons in the presence or absence of factors or signals from other mammalian cell types. Preferably, the cells respond to the presence of epidermal growth factor (EGF) and bFGF by differentiating into neurons expressing microtubule associated protein 2 (Map-2) marker. The cells also respond to the presence of BDNF by differentiating into neurons expressing Map-2 marker. Also contemplated by the instant invention is a method for inducing trans-differentiation of pluripotent central nervous system stem cells into various other cell types. This method comprises harvesting the pluripotent stem cells from tissues and organs, placing the harvested cells into cell culture, and culturing the cells under conditions suitable for maintaining their pluripotency. Subsequently, the cultured pluripotent cells are contacted with differentiation-inducing factors. Thereafter, differentiation into a particular cell type can be determined, for example, by characterizing the expression of cell-specific properties. One method for harvesting the cells comprises teasing or trituration of fetal, neonatal or adult CNS tissue, for example, and placing the dissociated cells on poly-L-ornithine coated culture plates. Differentiation is accomplished, for example, by contacting the isolated cells with desired soluble factors, cell-conditioned media, or with co-cultured non-homologous cells, i.e., cells from a desired tissue source. The differentiation inducing cells are typically maintained in standard media, after which the conditioned media may be decanted and added to stem cells in culture, thereby exposing them to soluble stimulants secreted by the inducing cells. Alternately, the contacting can be accomplished by co-culturing with organ-specific inducing cell types, as noted above. Induction of differentiation can also be achieved by exposure to tissue specific factor(s)(e.g., transcriptional factor[s]) or insertion into the stem cells. Determination of stem cell differentiation may be made, for example, by quantitative reverse transcriptase-polymerase chain reaction (QRT-PCR). This determination can also be made, for example, by immunocytochemical characterization of the expression of cell-specific markers. For example, Cell-specific markers that may be used to identify various directed differentiated cells of the present invention include protein molecules such as nestin, MAP-2, GFAP, Insulin, Lhx-3, Pit-1, prolactin, GATA4, myosin and troponin IC. The presence of nestin indicates that the proliferating cells have stem cell properties. MAP-2 indicates differentiation into neuronal cells, whereas GFAP indicates differentiation into glial cells. Transcription factors Lhx-3 and Pit-1 as well as growth hormones hGH and Pr1, indicate differentiation into pituitary cells, and GATA-4, myosin, or troponin IC indicate differentiation into pulsatile cardiac cells. It can be seen, therefore, that the number of differentiated cell types is quite extensive, and may extend to even other, previously uncontemplated cell types. Further contemplated by this invention is a method for treating diseases involving various CNS and non-CNS organs and tissues of a subject by populating or repopulating cells in, for example, depleted or defective organs or tissues with pluripotent CNS stem cells. Preferably, these cells are induced to differentiate in vivo upon being transplanted into a subject More preferably, they are induced to differentiate in vitro into functional cell types of the target organ or tissues prior to transplanting by placing the harvested pluripotent CNS cells into cell culture and culturing and/or contacting them with, for example, differentiation-inducing cells, cell-conditioned media, and/or factors. Most preferably, after determining the presence of differentiation into a desired cell type, committed progenitor cells are transplanted into a subject to populate or repopulate target tissue or, for example, defective or depleted areas of target tissues and organs. The populating or repopulating can be accomplished, for example, by grafting, gene therapy, factor delivery, tissue engineering and organ development In yet another preferred embodiment, differentiated stem cells, for example, differentiated CNS stem cells can be used as a conduit for gene therapy or for factor delivery to prevent or treat a disease. Still further contemplated by the invention is a method for identifying functionality of certain genes, proteins and regulation in various organ and tissue cell types. This is useful in gene discovery, drug discovery, elucidation of differentiation pathways, genetic markers, regulatory factors and determination of biological regulation. Most preferably, the differentiated stem cells, for example, differentiated CNS stem cells can be used in vitro or in vivo to produce biological factors such as hormones and other vital proteins. These and other aspects and attributes of the present invention will become increasingly clear upon reference to the following drawings and accompanying specification. |
Hydrocyclones |
A hydrocyclone which includes a main body having a chamber therein, the chamber including an inlet section, and a separating section, the separating section having an inner side wall which tapers inwardly away from the inlet section, the hydrocyclone further including a feed inlet feeding a particle bearing slurry mixture into the inlet section of the chamber, an overflow outlet at one end of the chamber adjacent the inlet section thereof, and an underflow outlet at the other end of the chamber remote from the inlet section of the chamber. The hydrocyclone further includes an overflow outlet control chamber adjacent the inlet section of the chamber of the hydrocyclone and in communication therewith via the overflow outlet, the overflow outlet control chamber including a tangentially located discharge outlet and a centrally located air core stabilising orifice which is remote from the overflow outlet. |
1. A hydrocyclone which includes a main body having a chamber therein, the chamber including an inlet section, and a separating section, the separating section having an inner side wall which tapers inwardly away from the inlet section, the hydrocyclone further including a feed inlet feeding a particle bearing slurry mixture into the inlet section of the chamber, an overflow outlet at one end of the chamber adjacent to the inlet section thereof and an underflow outlet at the other end of the chamber remote from the inlet section of the chamber, the hydrocyclone further including an overflow outlet control chamber adjacent to the inlet section of the chamber of the hydrocyclone and in communication therewith via the overflow outlet, the overflow outlet control chamber including a tangentially located discharge outlet and a centrally located air core stabilising orifice which is remote from the overflow outlet. 2. A hydrocyclone according to claim 1 wherein the stabilising orifice, overflow outlet and underflow outlet are generally axially aligned. 3. A hydrocyclone according to claim 2 wherein the overflow outlet control chamber has an inner surface which is generally in the shape of a volute for directing material entering the overflow outlet control chamber from the separation chamber towards the discharge outlet. 4. A hydrocyclone according to claim 3 wherein the volute extends around the inner surface for up to 360°. 5. A hydrocyclone according to claim 4 wherein the inlet section of the chamber has an inner surface which is generally in the shape of a volute, the volute being ramped axially toward the converging end of the separation chamber and extends around the inner surface for up to 360°. 6. A hydrocyclone according to claim 5 further including a vortex finder at the overflow outlet of the separation chamber. 7. A hydrocyclone according to claim 6 wherein the stabilising orifice comprises tapering side walls which extend into the control chamber. 8. A hydrocyclone according to claim 7 wherein the orifice has a generally conical shaped inlet section. 9. A control unit which is suitable for use with a hydrocyclone, the hydrocyclone including a main body having a chamber therein, the chamber including an inlet section and a separating section, the separating section having an inner side wall which tapers inwardly away from the inlet section, a feed inlet for a feeding mixture into the inlet section of the chamber, an overflow outlet at one end of the chamber adjacent the inlet section and an underflow outlet at the other end of the chamber remote from the inlet section of the chamber, the control unit including a control chamber having a discharge outlet. a communication port operatively connected to the overflow outlet and a stabilising orifice which is remote from the overflow outlet. 10. A control unit according to claim 9 wherein the overflow outlet control chamber has an inner surface which is generally in the shape of a volute for directing material entering the overflow outlet control chamber from the separation chamber towards the discharge outlet. 11. A control unit according to claim 10 wherein the volute extends around the inner surface for up to 360°. 12. A control unit according to claim 11 wherein the stabilising orifice comprises tapering side walls which extend into the control chamber. 13. A control unit according to claim 12 wherein the orifice has a generally conical shaped inlet section. 14. A method of stabilising the air core of a hydrocyclone when in use, the method including the steps of providing a chamber above the overflow outlet of a hydrocyclone and arranging for discharge from that chamber through a discharge outlet and incorporating an air core stabilising orifice in a wall of that chamber remote from the overflow outlet. |
Type II thioesterase from streptomyces coelicolor a3(2) and the coding sequence |
The invention concerns a biosynthesis of nonaramatic polyketide compounds. More particularly, the present invention relates to a isolated polynucleotide molecule, a nucleic acid vector comprising the molecule, and isolated polypeptide and uses thereof. A new, type II thioestrerase can be obtained as an application outcome of this invention. The enzyme is active in polyketide, especially macrolide, biosynthesis when associated with a multienzyme complex of a polyketide synthase. The activity of the enzyme results in a increase of polyketide biosynthesis efficiency. |
1. An isolated polynucleotide comprising the sequence having at least 60% homology to the nucleic acid sequence of SEQ ID NO. 1 or its complementary strand or fragments thereof. 2. The polynucleotide of claim 1, comprising the sequence having at least 70% homology to the nucleic acid sequence of SEQ ID NO:1 or its complementary strand or fragments thereof. 3. The polynucleotide of claim 1, comprising the sequence having at least 80% homology to the nucleic acid sequence of SEQ ID NO:1 or its complementary strand or fragments thereof. 4. The polynucleotide of claim 1, comprising the sequence having at least 90% homology to the nucleic acid sequence of SEQ ID NO:1 or its complementary strand or fragments thereof. 5. The polynucleotide according to one of claim 1-4, characterised in that encodes tioesterase type II proteine. 6. The polynucleotide of claim 1, wherein said polynucleotide encodes at least 15 contiguous amino acids from SEQ ID NO:2. 7. The polynucleotide of claim 1, wherein said polynucleotide encodes at least 50 contiguous amino acids from SEQ ID NO:2. 8. The polynucleotide of claim 1, wherein said polynucleotide encodes at least 150 contiguous amino acids from SEQ ID NO:2. 9. The polynucleotide of claim 1, wherein said polynucleotide encodes polypeptide comprising the amino acid sequence of SEQ ID NO:2. 10. The polynucleotide of claim 1 or 9, comprising the sequence of SEQ ID NO:1 or SEQ ID NO:3 or complementary strand thereof. 11. A nucleic acid vector comprising the polynucleotide according to anyone of claims 1 to 9. 12. A protein or fragment thereof encoded by a polynucleotide according to anyone of claims 1 to 10. 13. A use of a polynucleotide according to anyone of claims 1 to 10 for an expression of a protein. 14. The use according to claim 13 wherein the protein have the TE II activity. 15. A use of a polypeptide comprising an amino acid sequence essentially consistent with the sequence SEQ ID No. 2 or fragments thereof for polyketide synthesis. 16. The use according to claim 15 characterized in, that the protein is used in a multienzyme polyketide synthase assembly. 17. The use according to claim 15 characterized in, that the protein is used in order to increase biosynthetic efficiency of a polyketide synthase complex. |
Process for producing trunkamide a compounds |
Trunkamide A and other cyloheptatides can be made by solid phase synthesis of a linear precursor. |
1 The preparation of a cycloheptapeptide by a solid phase synthesis of a linear heptapeptide precursor. 2. A process for preparing a cycloheptapeptide containing a 5-membered heterocyclic ring as part of the backbone of the cyclic peptide, which process comprises solid phase synthesis of a linear peptide precursor set up for cyclisation, the precursor either being set up for heterocyclic ring formation or containing the heterocyclic ring, cyclising the linear heptapeptide and if necessary forming the heterocyclic ring. 3. A process according to claim 2, where the solid phase is a super-acid labile chlorotrityl chloride resin. 4. A process according to claim 2, where the peptide chain is lengthened using a fluorenylmethyloxycarbonyl base strategy. 5. A process according to claim 2, which comprises cyclising a linear heptapeptide set up for heterocyclic ring formation to give a cycloheptapeptide set up for heterocyclic ring formation, and then forming the heterocyclic ring. 6. A process according to claim 5, which includes the step: where Aaa2, Aaa3, Aaa4, Aaa5 and Aaa6 represent amino acids, X is O or S, and A is O or NH. 7. A process according to claim 6, where X is O or S and the closed ring is an oxazoline or thiazoline. 8. A process according to claim 7, wherein X is S and the closed ring is a thiazoline. 9. A process according to claim 2, which comprises forming a linear heptapeptide precursor including the heterocyclic ring and then cyclising the linear heptapeptide. 10. A process according to claim 9, which includes the step: where Fmoc is fluorenylmethyloxycarbonyl, peptide is Aaa2, Aaa3, Aaa4, Aaa5 and Aaa6 which represent amino acids, the filled sphere is a solid phase, and D is S, O or NH. 11. A process according to claim 9, wherein the heterocyclic ring formed by the cyclisation of the linear heptapeptide is further reacted to form an aromatic heterocyclic ring. 12. A compound of the following formula (III): wherein Aaa2, Aaa3, Aaa4, Aaa5, and Aaa6 are independently α-amino acids of L or D configuration, if applies; wherein Aaa1 is independently an amino azole five member heterocyclic; wherein R1, R2, R3, R4, R5, R6, R7, R8 are each independently H or an organic group selected from the group consisting of an alkyl group, an alkenyl group, an aryl group, an aralkyl group, and their substituted derivatives with an hydroxy group, a mercapto group, an amino group, a guanidino group, a halogeno group; wherein X is independently O, S, or NH; wherein Ra, Rb, Rc, Rd, Re, Rf, and Rg are each independently H or an organic group selected from the group consisting of an alkyl group and Rg may be absent; wherein the pairs Ra—R1, Rb—R3, Rc-R5, Rd-R6, Re—R7, and Rf-R8 can form part of the same alkyl group and therefore the corresponding amino acids are cyclic ones; wherein Y is independently C or CH; wherein each Z is independently CH or CH2; and the dash line indicates a permitted second bond; with the exception of trunkamide A and the stereoisomer have the L-configuration at the C (45) stereocentre. 13. A compound of the following formula (II): wherein Aaa2, Aaa3, Aaa4, Aaa5, and Aaa6 are independently α-amino acids of L or D configuration, if applies; wherein Aaa1 is independently an amino azole five member heterocyclic; wherein R1, R2, R3, R4, R5, R6, R7 R8 are each independently H or an organic group selected from the group consisting of an alkyl group, an alkenyl group, an aryl group, an aralkyl group, and their substituted derivatives with an hydroxy group, a mercapto group, an amino group, a guanidino group, a halogeno group; wherein X is independently O, S, or NH; wherein Ra, Rb, Rc, Rd, Re, and Rf, are each independently H or an organic group selected from the group consisting of an alkyl group; wherein the pairs Ra—R1, Rb—R3, Rc-R5, Rd-R6, Re—R7, and Rf-R8 can form part of the same alkyl group and therefore the corresponding amino acids are cyclic ones; wherein Y is independently C or CH; wherein Z is independently CH or CH2., with the exception of trunkamide A and the stereoisomer have the L-configuration at the C (45) stereocentre. 14. A pharmaceutical composition comprising a compound according to claim 12 together with a pharmaceutically acceptable carrier. 15. The use of a compound according to claim 12 in the preparation of a medicament for the treatment of cancer. 16. A method of treating cancer which involves administering a compound according to claim 12. 17. A pharmaceutical composition comprising a compound according to claim 13 together with a pharmaceutically acceptable carrier. 18. The use of a compound according to claim 13] in the preparation of a medicament for the treatment of cancer. 19. A method of treating cancer which involves administering a compound according to claim 13. 20. A method of treating cancer which involves a composition according to claim 14. 21. A method of treating cancer which involves a composition according to claim 17. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Trunkamide A is a cyclic heptapeptide cyclo[D-Phe-Tzn-Thr(rPr)-Ser(rPr)-Ile-Ala-Pro] isolated from the colonial ascidian Lissoclinum sp. Trunkamide A was first isolated by Bowden and co-workers (Carroll, A. R.; Coil, J. C.; Bourne, D. J.; McLeod, J. K.; Zabriskie, T. M.; Ireland, C. M.; Bowden, B. F. Aust. J. Chem. 1996, 49, 659-667) but the absolute configuration of the stereocentre exocyclic to the heterocyclic ring was assigned to the L-configuration. More recently Wipf and co-workers have first demonstrated that the initial assignation was erroneous (Wipf, P.; Uto, Y. Tetrahedron Lett. 1999, 40, 5165-5169) and later demonstrated that the stereocentre at C(45) has a D-configuration (Wipf, P.; Uto, Y. J. Org. Chem. 2000, 65, 1037-1049). Thus, the structure of trunkamide A is: The D-Phe-Tzn is formed from two amino acids, which we refer to as amino acids one and seven of the cycloheptapeptide, where the D-Phe is amino acid seven. Trunkamide A has promising antitumor activity and is the subject of WO 9739025. In the article J. Org. Chem. 2000, 65, 1037-1049, Wipf and co-workers provide a synthesis of trunkamide A which involves a ring closure in solution between alanine and isoleucine to form a cycloheptapeptide having an oxazoline in place of the thiazoline ring. Trunkamide A is then obtained by further processing. The authors mention that they explored other possibilities for ring closure, such as the proline/phenylalanine amide, but they were unable to provide a viable alternative. A further synthesis in solution by McKeever and Pattenden of trunkamide A is now also to be seen in Tetrahedron Letters 42 (2001) 2573-2577. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention provides a new synthesis of trunkamide A and related compounds, along with new trunkamide A derivatives. In particular, the invention involves the preparation of a cycloheptapeptide by a solid phase synthesis of a linear heptapeptide precursor. The invention is especially directed at the preparation of a cycloheptapeptide containing a 5-membered heterocyclic ring as part of the backbone of an amino acid, such as thiazoline. To this end, the invention involves the preparation of a cycloheptapeptide by a solid phase synthesis of a linear heptapeptide precursor, where the linear precursor includes the ring or includes functional groups suited to form the ring. In this aspect of the invention, the process comprises solid phase synthesis of a linear peptide precursor set up for cyclisation, the precursor either being set up for heterocyclic ring formation or containing the heterocyclic ring, cyclising the linear heptapeptide and if necessary forming the heterocyclic ring. Typically the 5-membered heterocyclic ring is of the formula: wherein X is independently O, S, or NH; each Y is independently C or CH; Z is independently CH or CH 2 ; R g is H or an organic group or is absent; and each dash line indicates a permitted second bond. Thus products of this invention take the general form: where Aaa 2 , Aaa 3 , Aaa 4 , Aaa 5 , and Aaa 6 are independently α-amino acid residues, R 1 is H or an organic group; and R g , X, Y, Z and the dash line are as defined. The heterocyclic ring is formed through fusion of part of an amino acid Aaa 1 with an amino acid Aaa 7 . The synthetic process of the present invention enables the formation of compounds such as those of the following formula (III): wherein Aaa 2 , Aaa 3 , Aaa 4 , Aaa 5 , and Aaa 6 are independently α-amino acids of L or D configuration, if applies; wherein Aaa 1 with Aaa 7 gives an amino azole five member heterocyclic ring; wherein R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 are each independently H or an organic group selected from the group consisting of an alkyl group, an alkenyl group, an aryl group, an aralkyl group, and their substituted derivatives with an hydroxy group, a mercapto group, an amino group, a guanidino group, a halogeno group; wherein X is independently O, S, or NH; wherein R a , R b , R c , R d , R e , R f , and R g are each independently H or an organic group selected from the group consisting of an alkyl group and R g may be absent; wherein the pairs R a -R 1 ,R b -R 3 , R c -R 5 , R d -R 6 , R e -R 7 , and R f -R 8 can form part of the same alkyl group and therefore the corresponding amino acids are cyclic ones; wherein Y is independently C or CH; wherein each Z is independently CH or CH 2 ; and the dash line indicates a permitted second bond; with the exception of trunkamide A and the stereoisomer have the L-configuration at the C(45) stereocentre. Pharmaceutical compositions of the compounds are provided, along with the use of the compounds in preparing such compositions and the use of the compounds in methods of treatment. detailed-description description="Detailed Description" end="lead"? |
Record medium with different latencies |
Latency information is used for coding of additional information in a record medium. This additional information which gets embossed in the record medium might be used for verification purposes in that only storage media with the correct latency information are judged to be authentic or might be decoded in a proper way. This technique is applicable to record media, recordable record media, an emulator for recordable or non-recordable record media, a method for producing recordable or non-recordable record media, a method for verifying recordable or non-recordable record media, a record medium writing device for producing recordable or non-recordable record media, and a record medium accessing device for verifying recordable or non-recordable record media. |
1. Record medium comprising different storage areas with respective corresponding latencies, characterized in that a respective latency of at least one part of said different storage areas is altered in respect to said respective corresponding latency, or storage areas with different corresponding latencies are arranged in a predetermined pattern on said record medium, which pattern is irregular with respect to the type of record medium. 2. Record medium according to claim 1, characterized in that said record medium is a semiconductor memory or a hard disk comprising a predetermined number of memory cells as said storage areas, wherein said corresponding latencies are determined based on a possible access speed of said memory cells and said altered latencies are shorter or longer latencies than said corresponding latencies. 3. Record medium according to claim 2, characterized in that longer latencies are achieved by delaying the output of a corresponding memory cell. 4. Record medium according to claim 2, characterized in that said semiconductor memory is integrated in a chip card or any other comparable existing or future storage medium. 5. Record medium according to claim 1, characterized in that said record medium is an optical or a magneto-optical record carrier comprising a predetermined number of memory blocks as said storage areas, wherein said corresponding latencies are determined based on a density of bits written in said memory blocks and said altered latencies of said at least one part of said memory blocks are shorter or longer latencies than said corresponding latencies. 6. Record medium according to claim 5, characterized in that said shorter and longer latencies are achieved on basis of line speed variations. 7. Record medium according to claim 5, characterized in that shorter latencies are achieved by writing the bits within a corresponding memory blocks in a higher density and longer latencies are achieved by writing the bits within a corresponding memory blocks in a lower density. 8. Record medium according to claim 5, characterized in that said optical or a magneto-optical record carrier is a read-only record carrier, or a recordable or rewriteable record carrier, e.g. a CD, a CD-R, a DVD, a DVD-R or any other comparable existing or future storage medium. 9. Recordable or rewriteable record medium, characterized by a pre-formatted recording density information or latency information indicating storage areas with different latencies or recording densities which are arranged in a predetermined pattern on said record medium, which pattern is irregular with respect to the type of record medium. 10. Recordable or rewriteable record medium according to claim 9, characterized in that said pre-formatted recording density information or latency information is a frequency information written to the pre-grove of the record medium. 11. Recordable or rewriteable record medium according to claim 9, characterized in that a respective latency of at least one part of said different storage areas is altered in respect to said respective corresponding latency or storage areas with different corresponding latencies are arranged in a predetermined pattern on said record medium, which pattern is irregular with respect to the type of record medium. 12. Emulator for a record medium comprising different storage areas with respective corresponding latencies, characterized by emulating a respective latency of said different storage areas so that a respective latency of at least one part of said different storage areas is emulated to be altered in respect to said respective corresponding latency, or storage areas with different corresponding latencies are emulated to be arranged in a predetermined pattern on said record medium, which pattern is irregular with respect to the type of record medium. 13. Cancelled 14. Computer program product comprising computer program means embodying the emulator as defined in claim 12 when being executed on a computer, digital signal processor, or the like. 15. Method for producing a record medium or recording data on a record medium, said record medium comprises different storage areas with respective corresponding latencies, characterized by the steps: determining a respective latency of at least one part of said different storage areas which is altered in respect to said respective corresponding latency, and preparing said record medium so that data is recorded on said record medium with said corresponding latencies in all different storage areas, but said at least one part of said different storage areas, and with said respective altered latency in said at least one part of said different storage areas, and/or recording data on said record medium with said corresponding latencies in all different storage areas, but said at least one part of said different storage areas, and with said respective altered latency in said at least one part of said different storage areas, or by the steps of determining a pattern of storage areas with different corresponding latencies for said record medium, which pattern is irregular with respect to the type of record medium arranging storage areas with different corresponding latencies in said predetermined pattern on said record medium, and/or. recording data on said record medium in said storage areas with different corresponding latencies in said predetermined pattern. 16. Method according to claim 15, characterized in that said preparing step is performed by recording format information onto said record medium. 17. Method according to claim 16, characterized in that said format information comprises an information in respect to a density of bits to be recorded onto said record medium. 18. Method according to claim 17, characterized in that said format information is a frequency information written to the pre-grove of the record medium. 19. Method according to claim 15, characterized in that said recording step is performed by changing a relative speed of writing data bits and rotating the record medium. 20. Method according to claim 15, characterized in that said at least one part of said different storage areas corresponds to a predetermined number of information blocks or bits of said record medium. 21. Computer program product comprising computer program means adapted to perform the method as defined in claim 15 when being executed on a computer, digital signal processor, or the like. 22. Method for verifying a record medium comprising different storage areas with respective corresponding latencies, characterized by the step of: determining whether a respective latency of at least one part of said different storage areas is altered in respect to said respective corresponding latency, or determining whether storage areas with different corresponding latencies are arranged in a predetermined pattern on said record medium, which pattern is irregular with respect to the type of record medium. 23. Method according to claim 22, characterized by directly measuring the latency of said at least one part of said different storage areas to determine an alteration of the latency or a predetermined pattern of storage areas with different corresponding latencies on said record medium. 24. Method according to claim 22, characterized by directly measuring the latency of said at least one part of said different storage areas and/or directly measuring the latency of a storage area with corresponding latency to determine an alteration of the latency or a predetermined pattern of storage areas with different corresponding latencies on said record medium on basis of a comparison of the measuring results. 25. Method according to claim 24, characterized by the following steps: a) accessing a first predetermined storage unit of a storage area with first assumed latency, b) accessing a second predetermined storage unit of said storage area with first assumed latency which has a predetermined distance to said first predetermined storage unit and access said second storage unit, c) measure a first time interval needed for performance of step b), d) accessing a third predetermined storage unit of a storage area with second assumed latency, e) accessing a fourth predetermined storage unit of said storage area with second assumed latency which has a predetermined distance to said third predetermined storage unit and access said fourth storage unit, f) measure a second time interval needed for performance of step e), g) determine an alteration of the latency or at least a part of a predetermined pattern of storage areas on basis of a comparison of said first and second time intervals. 26. Method according to claim 22, characterized by the step of distinguishing proper measurement results from noise on basis of statistical considerations. 27. Computer program product comprising computer program means adapted to perform the method as defined in claim 22 when being executed on a computer, digital signal processor, or the like. 28. Record medium writing device for writing data onto a record medium comprising different storage areas with respective corresponding latencies, characterized by recording density variation means to alter a respective latency of at least one part of said different storage areas in respect to said respective corresponding latency, or to arrange storage areas with different corresponding latencies in a predetermined pattern on said record medium, which pattern is irregular with respect to the type of record medium. 29. Record medium writing device according to claim 28, characterized in that said recording density variation means changes the relative speed of writing data bits and rotating the record medium. 30. Record medium writing device according to claim 29, characterized in that said recording density variation means obtains information for changing the relative speed of writing data bits and rotating the record medium from a pre-formatted recording density information or latency information on the record medium. 31. Record medium writing device according to claim 29, characterized in that said recording density variation means obtains information for changing the relative speed of writing data bits and rotating the record medium from an external control signal. 32. Record medium accessing device for accessing data from a record medium comprising different storage areas with respective corresponding latencies, characterized by a storage area latency output supplying a respective latency of at least one storage area of an accessed record medium. 33. Record medium accessing device according to claim 32, characterized by a wanted latency input receiving at least one storage area of an accessed record medium of which the corresponding latency should be supplied to said storage area latency output. 34. Record medium accessing device for accessing data from a record medium comprising different storage areas with respective corresponding latencies, characterized by record medium verification means to determine whether a respective latency of at least one part of said different storage areas is altered in respect to said respective corresponding latency, or to determine whether storage areas with different corresponding latencies are arranged in a predetermined pattern on said record medium, which pattern is irregular with respect to the type of record medium. |
Valve |
A valve for an aerosol comprises a valve body 1 and a surrounding rubber sleeve 2. The body defines an inlet and outlet passages 3, 4 and bores 5, 6 connecting these passages to the surface of the valve. When the pressure of fluid in the inlet passage 3 and bore 5 builds to a sufficient value the sleeve is pushed away from the body permitting flow through the bores between the passages. When the pressure falls the sleeve closes the bores to interrupt the flow. |
1. A valve comprising a valve body and a flexible member surrounding the valve body, the valve body defining an inlet and an outlet and means for enabling the inlet and outlet to communicate and the flexible member being displaceable under the action of pressure in the inlet from a closed position in which communication between inlet and outlet is prevented to an open position in which communication between inlet and outlet is permitted, wherein the interior surface of the flexible member is tacky so that it adheres to the valve body so as to increase the force required to displace the flexible member from the closed position to the open position, the force at which the flexible member returns to its closed position being unchanged, and/or wherein the flexible member is constructed of a material which requires greater force to displace it from the closed position than the force that the flexible member can exert through elasticity to return to its closed position when the displacing force is removed. 2. A valve as claimed in claim 1, in which the valve body is moulded from synthetic plastics material. 3. A valve as claimed in claim 1, in which the valve body is made from metal. 4. A valve as claimed in claim 1, in which the flexible member comprises a sleeve. 5. A valve as claimed in claim 1, in which the flexible member is made from rubber. 6. A valve as claimed in claim 1, in which the flexible member is made from a synthetic plastics material. 7. A valve as claimed in claim 1 wherein the interior surface of the flexible member is provided with a tackifying coating. 8. A valve as claimed in claim 1, in which the means for enabling the inlet and outlet to communicate comprises bores respectively connecting the inlet and outlet with the surface of the valve body. 9. A valve as claimed in claim 1, in which means are provided for retaining the flexible member on the valve body. 10. A valve as claimed in claim 9, in which the means comprise annular formations on the valve body. 11. A device incorporating a valve according to claim 1. 12. A device as claimed in claim 11 which is pressurisable. 13. A device as claimed in claim 12 wherein the pressure in the device is generated by means of a manual pump. 14. A device as claimed in claim 11 which has a pressurised container. 15. A device as claimed in claim 14 which provides a pulsed release of the contents of the pressurised container. 16. A device comprising a first chamber containing a pressurised liquid propellant and a second chamber containing in liquid form a material to be issued from the device in dispersed form, wherein there is restricted communication between the chambers such that propellant may bleed into the second chamber, and wherein a valve providing intermittent communication between the second chamber and the exterior of the device issues a pulse of the said material once the propellant has raised the pressure within the second chamber to a threshold level required to operate the valve. 17. A device as claimed in claim 16 comprising a valve having a valve body and a flexible member surrounding the valve body, the valve body defining an inlet and an outlet and means for enabling the inlet and outlet to communicate and the flexible member being displaceable under the action of pressure in the inlet from a closed position in which communication between inlet and outlet is prevented to an open position in which communication between inlet and outlet is permitted, wherein the interior surface of the flexible member is tacky so that it adheres to the valve body so as to increase the force required to displace the flexible member from the closed position to the open position, the force at which the flexible member returns to its closed position being unchanged, and/or wherein the flexible member is constructed of a material which requires greater force to displace it from the closed position than the force that the flexible member can exert through elasticity to return to its closed position when the displacing force is removed. |
Printing couple in a printing machine with a pivotable transfer cylinder |
A printing couple in a printing machine is comprised of at least three cylinders, a forme cylinder, a transfer cylinder and a counter-pressure cylinder. The counter-pressure cylinder forms a printing location or point in cooperation with the transfer cylinder. The transfer cylinder is mounted in at least one lever which can be pivoted about an eccentrically pivoting axis in relation to the rotational axis of the forme cylinder. When the three cylinders are in a print position, a connecting plane through the axis of rotation of the forme cylinder and the pivoting axis of the lever forms an angle of between 25° and 65° with a plane through the axis of rotation of the cylinder forming the printing point. |
1-37. (Cancelled) 38-147. (Not Entered) 148. A printing group of a printing press, having at least three cylinders (02, 03, 07, 11), namely a forme cylinder (02, 11), a transfer cylinder (03, 07) and a counter-pressure cylinder (07, 03), which forms a printing position (09) together with the transfer cylinder (03, 07), wherein for engagement or disengagement the transfer cylinder (02, 03, 07, 11) is seated in at least one pivotable lever (18), which is seated eccentrically in respect to an axis of rotation (R02, R11) of the forme cylinder (02, 11), characterized in that by means of the first adjusting device the forme cylinder (02, 11) is seated to be movable in a direction perpendicularly to its axis of rotation (R02, R11) in respect to a lateral frame (20), the lever (18) has a length between the seating of an axis of rotation (R03, R07) of the transfer cylinder (03, 07) and the pivot axis (S), which is greater than the distance of the axis of rotation (R03, R07) of the transfer cylinder (03, 07) from an axis of rotation (R02, R11) of the associated forme cylinders (02, 11) in the print-on position (AN), and that in the print-on position (AN) of the three cylinders (02, 03, 07, 11), a connecting plane (V) through the axis of rotation (R02, R11) of the forme cylinder (02, 11) and the pivot axis (S) encloses an angle (epsilon-S) with a plane (D) through the axes of rotation (R03, R07) of the cylinders (03, 07) forming the printing position (09), which lies between 25° and 65°. 149. A printing group of a printing press, having at least three cylinders (02, 03, 07, 11), namely a forme cylinder (02, 11), a transfer cylinder (03, 07) and a counter-pressure cylinder (07, 03), whose axes of rotation (R02, R03, R07, R11) are located in a print-on position (AN) of the cylinders (02, 03, 07, 11) in a comon plane (E), and wherein for engagement or disengagement the transfer cylinder (02, 03, 07, 11) is seated in at least one lever (18), which is pivotable around a pivot axis (S), characterized in that the axis of rotation (R02, R11) of the forme cylinder (02, 11) is fixedly seated during engagement or disengagement, and that, by pivoting the lever (18), only the transfer cylinder (03, 07) can be placed against or away from the forme cylinder (02, 11) and from the counter-pressure cylinder (07, 03). 150. The printing group in accordance with claim 149, characterized in that the lever (18) has a length between the seating of an axis of rotation (R03, R07) of the transfer cylinder (03, 07) and the pivot axis (S), which is greater than the distance of the axis of rotation (R03, R07) of the transfer cylinder (03, 07) from an axis of rotation (R02, R11) of the associated forme cylinders (02, 11) in the print-on position (AN). 151. A printing group in accordance with claim 148, characterized in that the pivot axis (S) of the lever (18) coincides with a pivot axis (S51) of an adjusting device of the forme cylinder (02, 11). 152. A printing group in accordance with claim 149, characterized in that the pivot axis (S) of the lever (18) coincides with a pivot axis (S51) of an adjusting device of the forme cylinder (02, 11). 153. The printing group in accordance with claim 148, characterized in that a first adjusting device is provided, by means of which the distance between a rotary shaft (R012, R11) of the forme cylinder (02, 11) and a rotary shaft (R03, R07) of the transfer cylinder can be set. 154. The printing group in accordance with claim 149, characterized in that a first adjusting device is provided, by means of which the distance between a rotary shaft (R012, R11) of the forme cylinder (02, 11) and a rotary shaft (R03, R07) of the transfer cylinder can be set. 155. The printing group in accordance with claim 148, characterized in that a second adjusting device is provided, by means of which the distance between a rotary shaft (R03, R07) of the transfer cylinder (03, 07) and a rotary shaft (R07, R03) of the counter-pressure cylinder (02, 11) can be set. 156. The printing group in accordance with claim 149, characterized in that a second adjusting device is provided, by means of which the distance between a rotary shaft (R03, R07) of the transfer cylinder (03, 07) and a rotary shaft (R07, R03) of the counter-pressure cylinder (02, 11) can be set. 157. A printing group of a printing press, having at least three cylinders (02, 03, 07, 11), namely a forme cylinder (02, 11), a transfer cylinder (03, 07) and a counter-pressure cylinder (07, 03), wherein for engagement and disengagement the transfer cylinder (02, 03, 07, 11) is seated in at least one lever (18), which is pivotable around a pivot axis (S), and wherein a first adjusting device is provided, by means of which the distance between a rotary shaft (R02, R11) of the forme cylinder (02, 11) and a rotary shaft (R03, R07) of the transfer cylinder can be set, characterized in that by means of the first adjusting device the forme cylinder (02, 11) is seated to be movable in a direction perpendicularly to its axis of rotation (R02, R11) in respect to a lateral frame (20), that a second adjusting device is provided, by means of which the distance between a rotary shaft (R03, R07) of the transfer cylinder (03, 07) and a rotary shaft (R07, R03) of the counter-pressure cylinder (02, 11) can be set in that the transfer cylinder (02, 03, 07, 11) is pivotable seated in the lever (18) around a pivot axis (S23) which is eccentrically arranged in respect to its axis of rotation (R03, R07). 158. The printing group in accordance with claim 148, characterized in that the pivot axis (S) of the lever (18) coincides with a pivot axis (S51) of the first adjusting device. 159. The printing group in accordance with claim 157, characterized in that the pivot axis (S) of the lever (18) coincides with a pivot axis (S51) of the first adjusting device. 160. The printing group in accordance with claim 157, characterized in that in the print-on position (AN) of the three cylinders (02, 03, 07, 11), a connecting plane through the axis of rotation (R03, R07) of the transfer cylinders (03, 07) and the pivot axis (S23) encloses an angle (epsilon-S23) with a plane (D) through the axes of rotation (R03), R07) of the cylinders (03, 07) forming the printing position (09), which lies between 70° and 110°. 161. The printing group in accordance with claim 148, characterized in that a drive motor (14) for rotatory driving, which is mechanically independent from the other cylinder (02, 03, 07, 11), is assigned to each of the forme cylinders (02, 11) and the transfer cylinder (03, 07). 162. The printing group in accordance with claim 149, characterized in that a drive motor (14) for rotatory driving, which is mechanically independent from the other cylinder (02, 03, 07, 11), is assigned to each of the forme cylinders (02, 11) and the transfer cylinder (03, 07). 163. The printing group in accordance with claim 157, characterized in that a drive motor (14) for rotatory driving, which is mechanically independent from the other cylinder (02, 03, 07, 11), is assigned to each of the forme cylinders (02, 11) and the transfer cylinder (03, 07). 164. The printing group in accordance with claim 148, characterized in that a common drive motor (14) for rotatory driving, which drives the forme cylinder (02, 11) or the transfer cylinder (03, 07), is assigned to the pair consisting of the forme cylinder (02, 11) and the transfer cylinder (03, 07). 165. The printing group in accordance with claim 149, characterized in that a common drive motor (14) for rotatory driving, which drives the forme cylinder (02, 11) or the transfer cylinder (03, 07), is assigned to the pair consisting of the forme cylinder (02, 11) and the transfer cylinder (03, 07). 166. The printing group in accordance with claim 157, characterized in that a common drive motor (14) for rotatory driving, which drives the forme cylinder (02, 11) or the transfer cylinder (03, 07), is assigned to the pair consisting of the forme cylinder (02, 11) and the transfer cylinder (03, 07). 167. The printing group in accordance with claim 161, characterized in that the drive motor (14) driving the forme cylinder (02, 11) is arranged fixed on the frame. 168. The printing group in accordance with claim 162, characterized in that the drive motor (14) driving the forme cylinder (02, 11) is arranged fixed on the frame. 169. The printing group in accordance with claim 163, characterized in that the drive motor (14) driving the forme cylinder (02, 11) is arranged fixed on the frame. 170. The printing group in accordance with claim 164, characterized in that the drive motor (14) driving the forme cylinder (02, 11) is arranged fixed on the frame. 171. The printing group in accordance with claim 165, characterized in that the drive motor (14) driving the forme cylinder (02, 11) is arranged fixed on the frame. 172. The printing group in accordance with claim 166, characterized in that the drive motor (14) driving the forme cylinder (02, 11) is arranged fixed on the frame. 173. The printing group in accordance with claim 161, characterized in that the drive motor (14) driving the transfer cylinder (03, 07) is arranged fixed on the frame. 174. The printing group in accordance with claim 162, characterized in that the drive motor (14) driving the transfer cylinder (03, 07) is arranged fixed on the frame. 175. The printing group in accordance with claim 163, characterized in that the drive motor (14) driving the transfer cylinder (03, 07) is arranged fixed on the frame. 176. The printing group in accordance with claim 164, characterized in that the drive motor (14) driving the transfer cylinder (03, 07) is arranged fixed on the frame. 177. The printing group in accordance with claim 165, characterized in that the drive motor (14) driving the transfer cylinder (03, 07) is arranged fixed on the frame. 178. The printing group in accordance with claim 166, characterized in that the drive motor (14) driving the transfer cylinder (03, 07) is arranged fixed on the frame. 179. The printing group in accordance with claim 173, characterized in that a coupling (61), which compensates an angle and/or offset, is arranged between the drive motor (14) and the transfer cylinder (03, 07). 180. The printing group in accordance with claim 174, characterized in that a coupling (61), which compensates an angle and/or offset, is arranged between the drive motor (14) and the transfer cylinder (03, 07). 181. The printing group in accordance with claim 175, characterized in that a coupling (61), which compensates an angle and/or offset, is arranged between the drive motor (14) and the transfer cylinder (03, 07). 182. The printing group in accordance with claim 176, characterized in that a coupling (61), which compensates an angle and/or offset, is arranged between the drive motor (14) and the transfer cylinder (03, 07). 183. The printing group in accordance with claim 177, characterized in that a coupling (61), which compensates an angle and/or offset, is arranged between the drive motor (14) and the transfer cylinder (03, 07). 184. The printing group in accordance with claim 178, characterized in that a coupling (61), which compensates an angle and/or offset, is arranged between the drive motor (14) and the transfer cylinder (03, 07). 185. The printing group in accordance with claim 167, characterized in that the driving connection between the forme cylinder (03, 07) and the associated drive motor (14) is embodied to absorb a relative movement between the forme cylinder (02, 11) and the drive motor (14). 186. The printing group in accordance with claim 168, characterized in that the driving connection between the forme cylinder (03, 07) and the associated drive motor (14) is embodied to absorb a relative movement between the forme cylinder (02, 11) and the drive motor (14). 187. The printing group in accordance with claim 169, characterized in that the driving connection between the forme cylinder (03, 07) and the associated drive motor (14) is embodied to absorb a relative movement between the forme cylinder (02, 11) and the drive motor (14). 188. The printing group in accordance with claim 170, characterized in that the driving connection between the forme cylinder (03, 07) and the associated drive motor (14) is embodied to absorb a relative movement between the forme cylinder (02, 11) and the drive motor (14). 189. The printing group in accordance with claim 171, characterized in that the driving connection between the forme cylinder (03, 07) and the associated drive motor (14) is embodied to absorb a relative movement between the forme cylinder (02, 11) and the drive motor (14). 190. The printing group in accordance with claim 172, characterized in that the driving connection between the forme cylinder (03, 07) and the associated drive motor (14) is embodied to absorb a relative movement between the forme cylinder (02, 11) and the drive motor (14). 191. The printing group in accordance with claim 153, characterized in that by means of the first adjusting device the forme cylinder (02, 11) is seated to be movable in a direction perpendicularly to its axis of rotation (R02, R11) in respect to a lateral frame (20). 192. The printing group in accordance with claim 154, characterized in that by means of the first adjusting device the forme cylinder (02, 11) is seated to be movable in a direction perpendicularly to its axis of rotation (R02, R11) in respect to a lateral frame (20). 193. The printing group in accordance with claim 157, characterized in that by means of the first adjusting device the forme cylinder (02, 11) is seated to be movable in a direction perpendicularly to its axis of rotation (R02, R11) in respect to a lateral frame (20). 194. The printing group in accordance with claim 191, characterized in that the first adjusting device has an eccentric bushing (52), which is seated in the lateral frame (20) to be pivotable around a pivot axis (S51) and receives a journal (51) of the forme cylinder (02, 11). 195. The printing group in accordance with claim 192, characterized in that the first adjusting device has an eccentric bushing (52), which is seated in the lateral frame (20) to be pivotable around a pivot axis (S51) and receives a journal (51) of the forme cylinder (02, 11). 196. The printing group in accordance with claim 193, characterized in that the first adjusting device has an eccentric bushing (52), which is seated in the lateral frame (20) to be pivotable around a pivot axis (S51) and receives a journal (51) of the forme cylinder (02, 11). 197. The printing group in accordance with claim 194, characterized in that in the print-on position (AN) of the forme cylinders and associated transfer cylinders (02, 03, 07, 11), a connecting plane through the axis of rotation (R02, R11) of the forme cylinder (02, 11) and the pivot axis (S) encloses an angle (epsilon-S51) with a plane (E) through the axes of rotation (R02, R03, R07, R11) of the forme cylinders and associated transfer cylinders (02, 03, 07, 11), which lies between 25° and 65°. 198. The printing group in accordance with claim 195, characterized in that in the print-on position (AN) of the forme cylinders and associated transfer cylinders (02, 03, 07, 11), a connecting plane through the axis of rotation (R02, R11) of the forme cylinder (02, 11) and the pivot axis (S) encloses an angle (epsilon-S51) with a plane (E) through the axes of rotation (R02, R03, R07, R11) of the forme cylinders and associated transfer cylinders (02, 03, 07, 11), which lies between 25° and 65°. 199. The printing group in accordance with claim 196, characterized in that in the print-on position (AN) of the forme cylinders and associated transfer cylinders (02, 03, 07, 11), a connecting plane through the axis of rotation (R02, R11) of the forme cylinder (02, 11) and the pivot axis (S) encloses an angle (epsilon-S51) with a plane (E) through the axes of rotation (R02, R03, R07, R11) of the forme cylinders and associated transfer cylinders (02, 03, 07, 11), which lies between 25° and 65°. 200. The printing group in accordance with claim 155, characterized in that the transfer cylinder (03, 07) is seated movable in respect to the lever (18) in a direction perpendicular to its axes of rotation (R03, R07) by means of the second adjusting means. 201. The printing group in accordance with claim 156, characterized in that the transfer cylinder (03, 07) is seated movable in respect to the lever (18) in a direction perpendicular to its axes of rotation (R03, R07) by means of the second adjusting means. 202. The printing group in accordance with claim 157, characterized in that the transfer cylinder (03, 07) is seated movable in respect to the lever (18) in a direction perpendicular to its axes of rotation (R03, R07) by means of the second adjusting means. 203. The printing group in accordance with claim 200, characterized in that the second adjusting means has an eccentric bushing (57), which is seated, pivotable around a pivot axis (S23), in the lever (18) and receives a journal (23) of the transfer cylinder (03, 07). 204. The printing group in accordance with claim 201, characterized in that the second adjusting means has an eccentric bushing (57), which is seated, pivotable around a pivot axis (S23), in the lever (18) and receives a journal (23) of the transfer cylinder (03, 07). 205. The printing group in accordance with claim 202, characterized in that the second adjusting means has an eccentric bushing (57), which is seated, pivotable around a pivot axis (S23), in the lever (18) and receives a journal (23) of the transfer cylinder (03, 07). 206. printing group in accordance with claim 203, characterized in that in the print-on position (AN) of at least the forme cylinder, the associated transfer cylinder and the counter-pressure cylinder (02, 03, 07, 11), a connecting plane through the axis of rotation (R03, R07) of the transfer cylinder (03, 07) and the pivot axis (S23) encloses an angle (epsilon-S23) with a plane (D) through the axes of rotation (R03, R07) of the cylinders (03, 07) forming the printing position (09), which lies between 70° and 110°. 207. printing group in accordance with claim 204, characterized in that in the print-on position (AN) of at least the forme cylinder, the associated transfer cylinder and the counter-pressure cylinder (02, 03, 07, 11), a connecting plane through the axis of rotation (R03, R07) of the transfer cylinder (03, 07) and the pivot axis (S23) encloses an angle (epsilon-S23) with a plane (D) through the axes of rotation (R03, R07) of the cylinders (03, 07) forming the printing position (09), which lies between 70° and 110°. 208. printing group in accordance with claim 205, characterized in that in the print-on position (AN) of at least the forme cylinder, the associated transfer cylinder and the counter-pressure cylinder (02, 03, 07, 11), a connecting plane through the axis of rotation (R03, R07) of the transfer cylinder (03, 07) and the pivot axis (S23) encloses an angle (epsilon-S23) with a plane (D) through the axes of rotation (R03, R07) of the cylinders (03, 07) forming the printing position (09), which lies between 70° and 110°. 209. The printing group in accordance with claim 148, characterized in that the pivot axis (S) for the lever (18) is seated eccentrically in respect to an axis of rotation (R02, R11) of the forme cylinder (02, 11). 210. The printing group in accordance with claim 149, characterized in that the pivot axis (S) for the lever (18) is seated eccentrically in respect to an axis of rotation (R02, R11) of the forme cylinder (02, 11). 211. The printing group in accordance with claim 157, characterized in that the pivot axis (S) for the lever (18) is seated eccentrically in respect to an axis of rotation (R02, R11) of the forme cylinder (02, 11). 212. The printing group in accordance with claim 148, characterized in that the pivot axis (S) is arranged stationary in respect to a lateral frame (20). 213. The printing group in accordance with claim 149, characterized in that the pivot axis (S) is arranged stationary in respect to a lateral frame (20). 214. The printing group in accordance with claim 157, characterized in that the pivot axis (S) is arranged stationary in respect to a lateral frame (20). 215. The printing group in accordance with claim 148, characterized in that an eccentricity (e-S) of the pivot axis (S) in respect to the axis of rotation (R02, R11) of the forme cylinder (02, 11) lies between 7 and 15 mm. 216. The printing group in accordance with claim 209, characterized in that an eccentricity (e-S) of the pivot axis (S) in respect to the axis of rotation (R02, R11) of the forme cylinder (02, 11) lies between 7 and 15 mm. 217. The printing group in accordance with claim 210, characterized in that an eccentricity (e-S) of the pivot axis (S) in respect to the axis of rotation (R02, R11) of the forme cylinder (02, 11) lies between 7 and 15 mm. 218. The printing group in accordance with claim 211, characterized in that an eccentricity (e-S) of the pivot axis (S) in respect to the axis of rotation (R02, R11) of the forme cylinder (02, 11) lies between 7 and 15 mm. 219. The printing group in accordance with claim 149, characterized in that in the print-on position (AN) of at least the forme cylinder, the associated transfer cylinder and the counter-pressure (02, 03, 07, 11), a connecting plane (V) through the axis of rotation (R02, R11) of the forme cylinder (02, 11) and the pivot axis (S) encloses an angle (epsilon-S) with a plane (D) through the axes of rotation (R03, R07) of the cylinders (03, 07) forming the printing position (09), which lies between 30° and 60°. 220. The printing group in accordance with claim 157, characterized in that in the print-on position (AN) of at least the forme cylinder, the associated transfer cylinder and the counter-pressure (02, 03, 07, 11), a connecting plane (V) through the axis of rotation (R02, R11) of the forme cylinder (02, 11) and the pivot axis (S) encloses an angle (epsilon-S) with a plane (D) through the axes of rotation (R03, R07) of the cylinders (03, 07) forming the printing position (09), which lies between 30° and 60°. 221. The printing group in accordance with claim 148, characterized in that a plane (E) of an axis of rotation (R02, R03 R07, R11) of at least one forme cylinder and associated transfer cylinder (02,03, 07, 11) extends inclines by an angle (alpha) of 75° to 85° in respect to the plane of a web (08) passing through the printing group. 222. The printing group in accordance with claim 149, characterized in that a plane (E) of an axis of rotation (R02, R03 R07, R11) of at least one forme cylinder and associated transfer cylinder (02,03, 07, 11) extends inclines by an angle (alpha) of 75° to 85° in respect to the plane of a web (08) passing through the printing group. 223. The printing group in accordance with claim 157, characterized in that a plane (E) of an axis of rotation (R02, R03 R07, R11) of at least one forme cylinder and associated transfer cylinder (02,03, 07, 11) extends inclines by an angle (alpha) of 75° to 85° in respect to the plane of a web (08) passing through the printing group. 224. The printing group in accordance with claim 148, characterized in that during engagement or disengagement the axis of rotation (R02, R11) of the forme cylinder (02, 11) is seated fixed in a frame. 225. The printing group in accordance with claim 149, characterized in that during engagement or disengagement the axis of rotation (R02, R11) of the forme cylinder (02, 11) is seated fixed in a frame. 226. The printing group in accordance with claim 153, characterized in that during engagement or disengagement the axis of rotation (R02, R11) of the forme cylinder (02, 11) is seated fixed in a frame. 227. The printing group in accordance with claim 154, characterized in that during engagement or disengagement the axis of rotation (R02, R11) of the forme cylinder (02, 11) is seated fixed in a frame. 228. The printing group in accordance with claim 157, characterized in that during engagement or disengagement the axis of rotation (R02, R11) of the forme cylinder (02, 11) is seated fixed in a frame. 229. The printing group in accordance with claim 148, characterized in that a print-on position (AN) of the cylinders (02, 03, 07, 11), the axes of rotation (R02, R03, R07, R11) of the forme, transfer and counter-pressure cylinders (02,03, 07, 11) are located in a common plane (E). 230. The printing group in accordance with claim 149, characterized in that a print-on position (AN) of the cylinders (02, 03, 07, 11), the axes of rotation (R02, R03, R07, R11) of the forme, transfer and counter-pressure cylinders (02,03, 07, 11) are located in a common plane (E). 231. The printing group in accordance with claim 157, characterized in that a print-on position (AN) of the cylinders (02, 03, 07, 11), the axes of rotation (R02, R03, R07, R11) of the forme, transfer and counter-pressure cylinders (02,03, 07, 11) are located in a common plane (E). 232. The printing group in accordance with claim 148, characterized in that at least two of the cylinders (02, 03, 07, 11) have at least one axially extending interruption (04, 06) on their effective jacket surfaces, which are arranged to alternatingly roll off on each other. 233. The printing group in accordance with claim 149, characterized in that at least two of the cylinders (02, 03, 07, 11) have at least one axially extending interruption (04, 06) on their effective jacket surfaces, which are arranged to alternatingly roll off on each other. 234. The printing group in accordance with claim 157, characterized in that at least two of the cylinders (02, 03, 07, 11) have at least one axially extending interruption (04, 06) on their effective jacket surfaces, which are arranged to alternatingly roll off on each other. 235. The printing group in accordance with claim 148, characterized in that at least the forme and transfer cylinders (02, 03, 07, 11) each have a circumference substantially corresponding to the length of a section of a printed page in newspaper format. 236. The printing group in accordance with claim 149, characterized in that at least the forme and transfer cylinders (02, 03, 07, 11) each have a circumference substantially corresponding to the length of a section of a printed page in newspaper format. 237. The printing group in accordance with claim 157, characterized in that at least the forme and transfer cylinders (02, 03, 07, 11) each have a circumference substantially corresponding to the length of a section of a printed page in newspaper format. 238. The printing group in accordance with claim 148, characterized in that the forme cylinder (02, 11) has a circumference substantially corresponding to the length of a section of a printed page in newspaper format, and the transfer cylinder (03, 07) has a circumference (U) corresponding to a whole number multiple not equal to one of the circumference of the associated forme cylinder (02, 11). 239. The printing group in accordance with claim 149, characterized in that the forme cylinder (02, 11) has a circumference substantially corresponding to the length of a section of a printed page in newspaper format, and the transfer cylinder (03, 07) has a circumference (U) corresponding to a whole number multiple not equal to one of the circumference of the associated forme cylinder (02, 11). 240. The printing group in accordance with claim 157, characterized in that the forme cylinder (02, 11) has a circumference substantially corresponding to the length of a section of a printed page in newspaper format, and the transfer cylinder (03, 07) has a circumference (U) corresponding to a whole number multiple not equal to one of the circumference of the associated forme cylinder (02, 11). 241. The printing group in accordance with claim 148, characterized in that in the area of their barrels the cylinders (02, 03, 07, 11) have a length (L02, L03) in the longitudinal direction corresponding substantially to four widths of a newspaper page. 242. The printing group in accordance with claim 149, characterized in that in the area of their barrels the cylinders (02, 03, 07, 11) have a length (L02, L03) in the longitudinal direction corresponding substantially to four widths of a newspaper page. 243. The printing group in accordance with claim 157, characterized in that in the area of their barrels the cylinders (02, 03, 07, 11) have a length (L02, L03) in the longitudinal direction corresponding substantially to four widths of a newspaper page. 244. The printing group in accordance with claim 148, characterized in that at least two of the cylinders (02, 03, 07, 11) each have at least two interruptions (04, 06) on their effective jacket surface, which in the longitudinal direction of the respective cylinder (02, 03, 07, 11) are arranged next to each other, but in the circumferential direction are offset in respect to each other. 245. The printing group in accordance with claim 149, characterized in that at least two of the cylinders (02, 03, 07, 11) each have at least two interruptions (04, 06) on their effective jacket surface, which in the longitudinal direction of the respective cylinder (02, 03, 07, 11) are arranged next to each other, but in the circumferential direction are offset in respect to each other. 246. The printing group in accordance with claim 157, characterized in that at least two of the cylinders (02, 03, 07, 11) each have at least two interruptions (04, 06) on their effective jacket surface, which in the longitudinal direction of the respective cylinder (02, 03, 07, 11) are arranged next to each other, but in the circumferential direction are offset in respect to each other. 247. The printing group in accordance with claim 148, characterized in that the counter-pressure cylinder (07, 03) is embodied as a transfer cylinder (07, 03), to which a further forme cylinder (11, 02) is assigned. 248. The printing group in accordance with claim 149, characterized in that the counter-pressure cylinder (07, 03) is embodied as a transfer cylinder (07, 03), to which a further forme cylinder (11, 02) is assigned. 249. The printing group in accordance with claim 157, characterized in that the counter-pressure cylinder (07, 03) is embodied as a transfer cylinder (07, 03), to which a further forme cylinder (11, 02) is assigned. 250. The printing group in accordance with claim 244, characterized in that both transfer cylinders (03, 07) are seated in pivotable levers (18). 251. The printing group in accordance with claim 245, characterized in that both transfer cylinders (03, 07) are seated in pivotable levers (18). 252. The printing group in accordance with claim 246, characterized in that both transfer cylinders (03, 07) are seated in pivotable levers (18). 253. The printing group in accordance with claim 148, characterized in that at least two of the cooperating cylinders (02, 03, 07, 11) each have at least two interruptions (04, 06) on their effective jacket surface, which in the longitudinal direction of the respective cylinder (02, 03, 07, 11) are arranged next to each other, but in the circumferential direction are offset in respect to each other. 254. The printing group in accordance with claim 149, characterized in that at least two of the cooperating cylinders (02, 03, 07, 11) each have at least two interruptions (04, 06) on their effective jacket surface, which in the longitudinal direction of the respective cylinder (02, 03, 07, 11) are arranged next to each other, but in the circumferential direction are offset in respect to each other. 255. The printing group in accordance with claim 157, characterized in that at least two of the cooperating cylinders (02, 03, 07, 11) each have at least two interruptions (04, 06) on their effective jacket surface, which in the longitudinal direction of the respective cylinder (02, 03, 07, 11) are arranged next to each other, but in the circumferential direction are offset in respect to each other. 256. The printing group in accordance with claim 253, characterized in that the interruptions (04, 06) on the effective jacket surface of the cylinders (02, 03, 07, 11) are each arranged to roll off in pairs on each other. 257. The printing group in accordance with claim 254, characterized in that the interruptions (04, 06) on the effective jacket surface of the cylinders (02, 03, 07, 11) are each arranged to roll off in pairs on each other. 258. The printing group in accordance with claim 255, characterized in that the interruptions (04, 06) on the effective jacket surface of the cylinders (02, 03, 07, 11) are each arranged to roll off in pairs on each other. |
Tyre for vehicle wheels with a reinforced bead |
Tyre for vehicle wheels comprising; a) a carcass structure having at least one carcass ply associated with respective left and right bead wires, each bead wire being enclosed in a respective bead, said bead comprising a bead filler b) a belt structure comprising at least one belt strip applied circumferentially over said carcass structure; c) a tread band circumferentially superimposed on said belt structure; d) a pair of side walls applied laterally on opposite sides relative to said carcass structure; in which said bead filter is obtained by vulcanization of an elastomeric composition comprising discontinuous fibres and at least one elastomeric groups. The abovementioned bead filler is capable of having a positive influence on the performance qualities of the tyre, in particular on the performance qualifies at high speed, such as, for example, the cornering stability, the control on a wet surface and the ride comfort. |
1. Tyre for vehicle wheels comprising: a carcass structure having at least one carcass ply shaped in a substantially toroidal configuration, the opposite lateral edges of which are associated with respective left and right bead wires, each bead wire being enclosed in a respective bead, said bead comprising a bead filler, wherein said bead filler is obtained by vulcanization of an elastomeric composition comprising discontinuous fibres and at least one elastomeric Polymer containing epoxide groups; a belt structure comprising at least one belt strip applied circumferentially over said carcass structure; a tread band circumferentially superimposed on said belt structure; and a pair of sidewalls applied laterally on opposite sides relative to said carcass structure. 2. Tyre according to claim 1, in which the discontinuous fibres are aramid fibres. 3. Tyre according to claim 2, in which the aramid fibres are short fibrillated poly (para-phenylene-terephthalamide) fibres. 4. Tyre according to claim 2, in which the aramid fibres are predispersed in a polymer matrix chosen from: natural rubber, butadiene/styrene copolymers, or ethylene/vinyl acetate copolymers. 5. Tyre according to claim 4, in which the polymer matrix is natural rubber. 6. Tyre according to claim 1, in which the discontinuous fibres are derived from polyamides other than aramids, polyesters, polyolefins, polyvinyl alcohols, or glass fibres. 7. Tyre according to claim 1, in which the discontinuous fibres are present in an amount of between 2 phr and 12 phr. 8. Tyre according to claim 7, in which the discontinuous fibres are present in an amount of between 4 phr and 10 phr. 9. Tyre according to claim 1, in which the elastomeric polymer containing epoxide groups is a homopolymer or copolymer with elastomeric properties having a glass transition temperature (Tg) of less than 23° C. 10. Tyre according to claim 1, in which the elastomeric polymer containing epoxide groups contains at least 0.05 mol % of epoxide groups relative to the total number of moles of monomers present in the polymer. 11. Tyre according to claim 10, in which the elastomeric polymer containing epoxide groups contains from 1 mol % to 70 mol % of epoxide groups relative to the total number of moles of monomers present in the polymer. 12. Tyre according to claim 1, in which the elastomeric polymer containing epoxide groups has an average molecular weight of between 10,000 and 1,000,000. 13. Tyre according to claim 12, in which the elastomeric polymer containing epoxide groups has an average molecular weight of between 50,000 and 500,000. 14. Tyre according to claim 1, in which the elastomeric polymer containing epoxide groups is an epoxidized diene homopolymer or copolymer having a base polymer structure, in which the base polymer structure is derived from one or more conjugated diene monomers, optionally copolymerized with monovinylarenes and/or polar comonomers. 15. Tyre according to claim 14, in which the base polymer structure is chosen from: natural rubber, polybutadiene, polyisoprene, styrene/butadiene copolymers, butadiene/isoprene copolymers, styrene/isoprene copolymers, nitrile rubbers, or blends thereof. 16. Tyre according to claim 13, in which the elastomeric polymer containing epoxide groups is chosen from elastomeric copolymers of one or more monoolefins with an olefinic comonomer containing one or more epoxide groups. 17. Tyre according to claim 1, in which the elastomeric polymer containing epoxide groups is epoxidized natural rubber. 18. Tyre according to claim 1, in which the elastomeric polymer containing epoxide groups is present in an amount of between 30 phr and 100 phr. 19. Tyre according to claim 18, in which the elastomeric polymer containing epoxide groups is present in an amount of between 50 phr and 100 phr. 20. Tyre according to claim 19, in which the elastomeric polymer containing epoxide groups is present in an amount of between 70 phr and 100 phr. 21. Tyre according to claim 1, in which the elastomeric composition further comprises at least one diene elastomer not containing epoxide groups. 22. Tyre according to claim 21, in which the diene elastomer not containing epoxide groups is chosen from: natural rubber; polybutadiene; polyisoprene; styrene/butadiene copolymers; butadiene/isoprene copolymers; styrene/isoprene copolymers; butyl rubbers or halobutyl rubbers; ethylene/propylene copolymers; ethylene/propylene/non-conjugated diene terpolymers; or blends thereof. 23. Tyre according to claim 22, in which the diene elastomer not containing epoxide groups is natural rubber or polyisoprene. 24. Tyre according to claim 21, in which the diene elastomer not containing epoxide groups is present in an amount of between 0 phr and 70 phr. 25. Tyre according to claim 24, in which the diene elastomer not containing epoxide groups is present in an amount of between 10 phr and 50 phr. 26. Tyre according to claim 1, in which the elastomeric composition further comprises at least one reinforcing filler chosen from carbon black, silica, alumina, aluminosilicates, calcium carbonate, kaolin, or mixtures thereof. 27. Tyre according to claim 26, in which the reinforcing filler is carbon black. 28. Tyre according to claim 26, in which the reinforcing filler is present in an amount of between 50 phr and 150 phr. 29. Tyre according to claim 28, in which the reinforcing filler is present in an amount of between 60 phr and 100 phr. 30. Tyre according to claim 1, in which the elastomeric composition further comprises at least one thermosetting resin. 31. Tyre according to claim 30, in which the thermosetting resin is of the two-component type. 32. Tyre according to claim 30, in which the thermosetting resin is of the precondensed type. 33. Tyre according to claim 30, in which the thermosetting resin is present in an amount of between 0.5 phr and 15 phr. 34. Tyre according to claim 33, in which the thermosetting resin is present in an amount of between 2 phr and 10 phr. 35. Tyre according to claim 1, in which the carcass ply further comprises a plurality of reinforcing cords coated with a vulcanized elastomeric composition comprising at least one elastomeric polymer containing epoxide groups. 36. Tyre according to claim 35, in which the elastomeric polymer containing epoxide groups is a homopolymer or copolymer with elastomeric properties having a glass transition temperature (Tg) of less than 23° C. 37. Elastomeric composition comprising: discontinuous fibres, and at least one polymer containing epoxide groups. 38. Elastomeric composition according to claim 37, in which the elastomeric polymer containing epoxide groups is a homopolymer or copolymer with elastomeric properties having a glass transition temperature (Tg) of less than 23° C. 39. Elastomeric composition according to claim 37, further comprising at least one diene elastomer not containing epoxide groups. 40. Elastomeric composition according to claim 39, in which the diene elastomer not containing epoxide groups is chosen from: natural rubber; polybutadiene; polyisoprene; styrene/butadiene copolymers; butadiene/isoprene copolymers; styrene/isoprene copolymers; butyl rubbers or halobutyl rubbers; ethylene/propylene copolymers; ethylene/propylene/non-conjugated diene terpolymers; or blends thereof. 41. Elastomeric composition according to claim 39, further comprising at least one reinforcing filler. 42. Elastomeric composition according to claim 41, in which the reinforcing filler is chosen from carbon black, silica, alumina, aluminosilicates, calcium carbonate, kaolin, or mixtures thereof. 43. Elastomeric composition according to claim 39, further comprising at least one thermosetting resin. 44. Elastomeric composition according to claim 43, in which the thermosetting resin is of the two-component type. 45. A vulcanized elastomeric manufactured product obtained by a process comprising vulcanizing an elastomeric composition of claim 39. 46. Elastomeric composition according to claim 39, in which the diene elastomer not containing epoxide groups is present in an amount of between 0 phr and 70 phr. 47. Elastomeric composition according to claim 46, in which the diene elastomer not containing epoxide groups is present in an amount of between 10 phr and 50 phr. 48. Elastomeric composition according to claim 41, in which the reinforcing filler is present in an amount of between 50 phr and 150 phr. 49. Elastomeric composition according to claim 48, in which the reinforcing filler is present in an amount of between 60 phr and 100 phr. 50. Elastomeric composition according to claim 43, in which the thermosetting resin is of the precondensed type. 51. Elastomeric composition according to claim 43, in which the thermosetting resin is present in an amount of between 0.5 phr and 15 phr. 52. Elastomeric composition according to claim 51, in which the thermosetting resin is present in an amount of between 2 phr and 10 phr. 53. Tyre according to claim 35, in which the elastomeric polymer containing epoxide groups contains at least 0.05 mol % of epoxide groups relative to the total number of moles of monomers present in the polymer. 54. Tyre according to claim 53, in which the elastomeric polymer containing epoxide groups contains from 1 mol % to 70 mol % of epoxide groups relative to the total number of moles of monomers present in the polymer. 55. Tyre according to claim 35, in which the elastomeric polymer containing epoxide groups has an average molecular weight of between 10,000 and 1,000,000. 56. Tyre according to claim 55, in which the elastomeric polymer containing epoxide groups has an average molecular weight of between 50,000 and 500,000. 57. Tyre according to claim 35, in which the elastomeric polymer containing epoxide groups is an epoxidized diene homopolymer or copolymer having a base polymer structure, in which the base polymer structure is derived from one or more conjugated diene monomers, optionally copolymerized with monovinylarenes and/or polar comonomers. 58. Tyre according to claim 57, in which the base polymer structure is chosen from: natural rubber, polybutadiene, polyisoprene, styrene/butadiene copolymers, butadiene/isoprene copolymers, styrene/isoprene copolymers, nitrile rubbers, or blends thereof. 59. Tyre according to claim 35, in which the elastomeric polymer containing epoxide groups is chosen from elastomeric copolymers of one or more monoolefins with an olefinic comonomer containing one or more epoxide groups. 60. Tyre according to claim 35, in which the elastomeric polymer containing epoxide groups is epoxidized natural rubber. 61. Tyre according to claim 35, in which the elastomeric polymer containing epoxide groups is present in an amount of between 30 phr and 100 phr. 62. Tyre according to claim 61, in which the elastomeric polymer containing epoxide groups is present in an amount of between 50 phr and 100 phr. 63. Tyre according to claim 62, in which the elastomeric polymer containing epoxide groups is present in an amount of between 70 phr and 100 phr. 64. Tyre according to claim 37, in which the elastomeric polymer containing epoxide groups contains at least 0.05 mol % of epoxide groups relative to the total number of moles of monomers present in the polymer. 65. Tyre according to claim 53, in which the elastomeric polymer containing epoxide groups contains from 1 mol % to 70 mol % of epoxide groups relative to the total number of moles of monomers present in the polymer. 66. Tyre according to claim 37, in which the elastomeric polymer containing epoxide groups has an average molecular weight of between 10,000 and 1,000,000. 67. Tyre according to claim 66, in which the elastomeric polymer containing epoxide groups has an average molecular weight of between 50,000 and 500,000. 68. Tyre according to claim 37, in which the elastomeric polymer containing epoxide groups is an epoxidized diene homopolymer or copolymer having a base polymer structure, in which the base polymer structure is derived from one or more conjugated diene monomers, optionally copolymerized with monovinylarenes and/or polar comonomers. 69. Tyre according to claim 68, in which the base polymer structure is chosen from: natural rubber, polybutadiene, polyisoprene, styrene/butadiene copolymers, butadiene/isoprene copolymers, styrene/isoprene copolymers, nitrile rubbers, or blends thereof. 70. Tyre according to claim 37, in which the elastomeric polymer containing epoxide groups is chosen from elastomeric copolymers of one or more monoolefins with an olefinic comonomer containing one or more epoxide groups. 71. Tyre according to claim 37, in which the elastomeric polymer containing epoxide groups is epoxidized natural rubber. 72. Tyre according to claim 37, in which the elastomeric polymer containing epoxide groups is present in an amount of between 30 phr and 100 phr. 73. Tyre according to claim 72, in which the elastomeric polymer containing epoxide groups is present in an amount of between 50 phr and 100 phr. 74. Tyre according to claim 73, in which the elastomeric polymer containing epoxide groups is present in an amount of between 70 phr and 100 phr. |
Methods of delivery of exogenous proteins to the cytosol and uses thereof |
The present invention is directed to a method for delivering exogenous proteins to the cytosol, by binding a target antigen (such as a protein) to a transport factor that contains a fragment of a bipartite protein exotoxin, but not the corresponding protective antigen. Preferably, the target antigen is fused to the transport factor. Preferred transport factors include the protective antigen binding domain of lethal factor (LFn) from B. anthracis, consisting of amino acids 1-255, preferably a fragment of at least 80 amino acids that shows at least 80% homology to LFn, and a fragment of about 105 amino acids from the carboxy portion that does not bind PA. The target antigen can include any molecule for which it would be desirable to elicit a CMI response, including viral antigens and tumor antigens. |
1. A method of delivering a target antigen to the cytosol of a cell, comprising binding the target antigen to a transport factor, wherein the transport factor contains a fragment of a bipartite protein exotoxin that is not toxic to the cell, and wherein protective antigen (PA) is not used. 2. The method of claim 1, wherein the transport factor comprises SEQ ID NO:2 (LFn) or a portion thereof. 3. The method of claim 2, wherein the transport factor is a fragment that does not contain the portion of SEQ ID NO:2 that binds PA. 4. The method of claim 3, wherein the transport factor is the 80 carboxy-most amino acids of LFn. 5. The method of claim 3, wherein the transport factor does not contain amino acids 1-149 of SEQ ID NO:2. 6. The method of claim 3, wherein the transport factor is encoded by SEQ ID NO:3. 7. The method of claim 1, wherein the transport factor is a fragment of at least 80 amino acids that has at least 80% homology to SEQ ID NO:2. 8. The method of claim 1, wherein the transport factor a fragment is 350 amino acids or less. 9. The method of claim 1, wherein the transport factor is 300 amino acids or less. 10. The method of claim 1, wherein the transport factor is 250 amino acids or less. 11. The method of claim 1, wherein the transport factor is 105 amino acids or less. 12. The method of claim 11, wherein the transport factor is amino acids 150-253 of SEQ ID NO:2 or less. 13. The method of claim 1, wherein the target antigen is selected from the group consisting of viral antigens, bacterial antigens, and tumor antigens. 14. The method of claim 13, wherein the viral antigen is an HIV antigen. 15. The method of claim 1, wherein the transport factor is bound to the target antigen by expression of a fusion polypeptide wherein a single nucleic acid coding sequence encodes both the transport factor and the target antigen. 16. The method of claim 1, wherein the transport factor is bound to the target antigen by a chemical linkage. 17. An isolated polypeptide comprising a target antigen and a transport factor, wherein the transport factor contains a fragment of a bipartite protein exotoxin that is not toxic to the cell and functions to deliver the target antigen to the cytosol of a cell. 18. The isolated polypeptide of claim 17, wherein the transport factor does not contain a domain that binds to a corresponding protective antigen (PA). 19. An isolated DNA encoding the polypeptide of claim 18. 20. The isolated DNA of claim 16 further comprising a 5′-flanking region containing at least one promoter sequence for expression of the peptide. 21. A vector containing the isolated DNA of claim 20. 22. A pharmaceutical composition comprising an immunogenic amount of an isolated polypeptide comprising a target antigen and a transport factor, wherein the transport factor contains a fragment of a bipartite protein exotoxin that is not toxic to the cell and functions to deliver the target antigen to the cytosol of a cell, and wherein a corresponding protective antigen is not present. 23. The pharmaceutical composition of claim 22, further comprising an adjuvant. 24. The pharmaceutical composition of claim 23, wherein the adjuvant is Alum. 25. A method of generating a cell mediated immune response in a mammal, comprising administering to the mammal the pharmaceutical composition of claim 22. 26. The method of claim 25, wherein the pharmaceutical composition is administered by subcutaneous or intramuscular administration. 27. The method of claim 25, wherein the pharmaceutical composition is administered by oral ingestion. 28. A method of producing a protein, comprising expressing the isolated nucleic acid of claim 18 in a cell. 29. The method of claim 28, wherein the cell is selected from the group consisting of bacterial cells, insect cells, and mammalian cells. 30. The method of claim 29, wherein the cell is a bacterial cell. 31. A method for measuring a cell mediated immune response, comprising using the polypeptide of claim 17 in a cell mediated immune response assay. 32. The method of claim 31, wherein the cell mediated immune response assay is selected from the group consisting of Elispot assays and flow-based intracellular cytokine assays. 33. A kit for measuring cell mediated immune responses in vitro, comprising the novel polypeptide of claim 17. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Much attention has focused on methods for generating immune reactions. One class of immune reaction to foreign antigens is the production of antibodies, typically referred to as humoral immunity. A second form of immune reaction results from the presentation of antigen by an antigen presenting cell (APC). This type of immune reaction is broadly referred to as cell mediated immunity (CMI), or T cell responses. Although both types of immune responses are important, considerable attention has recently focused on CMI. In dealing with infectious diseases such as AIDS, caused by the Human Immunodeficiency Virus (HIV), the antibody responses to the virus and portions thereof have not proven sufficient to confer immunity. Similarly, in dealing with exogenous proteins associated with many malignancies, the antibody responses have also not proven sufficient. Thus, speculation has focused on generating CMI responses. In order to elicit CMI, an antigen must be bound to a major histocompatibility complex (MHC) class I or II molecule on the surface of the APC. The class I molecules typically present antigens externally, such as endogenous proteins, those from viral infections, and tumor antigens. Antigen-specific T cells typically recognize infected target cells when the pathogen-derived (or cancerous) peptide epitopes (usually 8 to 10 amino acids) are presented by molecules encoded by the host class I MHC (7). These epitopes are derived from cytoplasmic proteins cleaved by the proteosome into small peptide fragments. These are then transported into the lumen of the endoplasmic reticulum (ER), where they complex with newly synthesized MHC-I molecules and are subsequently transported to the cell surface, where recognition by T cells occurs (8-13). Antigens in the extracellular fluid (exogenous antigens) generally do not gain access into this processing compartment in most cells. Thus, a significant challenge to eliciting CMI with a vaccine is the delivery of exogenous antigens to the cytosol for presentation by MHC class I molecules. It would be desirable to be able to generate vaccines to a wide variety of infectious diseases, such as HIV, as well as cancers, such as prostate cancer, breast cancer and melanoma. For example, growing evidence suggests that CMI plays an essential role in controlling HIV infection (Ogg et al., Science 279:2103-6 (1998); Schmitz et al., Science 283:857-60 (1999); Brodie et al., Nat. Med. 5:34-41 (1999)). Individuals who have been exposed to HIV but remain uninfected often have antiviral CMI but no antibody response. The viremia of primary infection resolves as viral specific cytotoxic T lymphocytes (CTL) develop, before the development of specific antibodies (Letvin, Science 280:1875-96 (1998)). These data illustrate the central role CMI plays in controlling HIV infection. Many tumors are associated with the expression of a particular protein and/or the over-expression of certain proteins. For example, prostate cancer is associated with elevated levels of protein such as Prostate Specific Antigen (PSA). Breast cancers can be associated with the expression and/or over-expression of protein such as Her-2, Muc-1, CEA, etc. Thus, considerable attention has been aimed at trying to generate immune responses, particularly developing CMI, to such antigens in the treatment of such malignancies. Approaches to developing cell mediated immunity to infectious diseases have included using the entire infectious agent, for example, by making genetically engineered inactivated viruses or using a killed infectious agent. Another approach has been subunit vaccines, which is presenting one or more antigens (but not the entire virus) to a subject. In order to generate CMI, antigen must be delivered to the interior of the cell. Exogenous proteins are poorly taken up by the cell. Accordingly, the preferred method has been using procedures such as viral vectors, liposomes, naked DNA or a similar approach. However, such approaches have many draw backs. For example, many recombinant viruses generate antigenic reactions themselves, upon repeated administration. Since standard forms of generating immune reactions typically require an initial injection, referred to as the prime, and subsequent injections, referred to as boosts, to achieve a satisfactory immunity, this can be a serious problem. Moreover, while much attention has been placed on improving the safety of viral vectors, there are always certain risks. For example, many of the target populations, such as those infected with HIV, may have a weakened immune system. Thus, certain viral vectors that are perfectly safe in many individuals may pose some degree of risk to these individuals. Methods of delivering protein to cells have also not proven entirely satisfactory as of this time. Accordingly, there is a need for new and simple methods to deliver an antigen to the cytosol to stimulate CMI. In trying to develop CMI responses, there have also been technical problems with the difficulty in measuring these responses. Current available laboratory assays to detect cell-mediated immune responses have serious shortcomings, especially when applied to large vaccine efficacy trials in various clinical settings. This is because the available equipment and technical support required to measure CMI using current techniques are often minimal in the setting where they are required, in the field. CTL are thought to play a crucial role in controlling HIV-1 infection, and many HIV-1 vaccine candidates are designed to stimulate T cell responses as well as neutralizing antibodies (1-6). However, the standard laboratory methods for detecting CMI, such as HIV-specific CTL, are complex, time consuming, and often restricted to highly specialized facilities. An improved method for measuring T cell responses will have a significant effect on the development of all T cell dependent vaccines or immune therapies. This strategy can potentially be applicable to other fields of research where CMI responses are known to play an important role in prevention and control of the diseases. One difficulty in reliably detecting CMI response in vitro results from the unique requirement for antigen presentation. As described above, the delivery of exogenous proteins to the cytosol for presentation to T cells by MHC class I molecules represents a significant challenge. This physical partition of the class I pathway has been a major barrier to detect T cell responses in vitro. Consequently, most of the current laboratory methods in measuring CMI utilize live viral or bacterial vectors to deliver antigens into cytosol, among which recombinant pox such as vaccinia viruses are the most commonly used. Another approach is to externally load MHC-I molecules on surface of target cells with synthetic peptides (10 to 20 amino acids) derived from known CTL epitopes. These methods have serious limitations in general clinical uses. The use of a live viral vector, such as a recombinant vaccinia virus, requires trained and immunized laboratory personnel, including minimum containment facilities as precautionary safety measures. Synthetic peptides are not only prohibitively expensive, but the design of the “universal” peptide profile that fit the diversified MHC-I molecules in various populations is extremely difficult. The challenge for the development of assays to measure T cell responses is, therefore, to deliver large pieces of exogenous antigens into cytosol without resorting to live recombinant viral or bacterial vectors. Accordingly, it would be desirable to have kits that could be used for measuring CMI in vitro. It would be particularly desirable to have kits that could be readily used in remote locations such as Africa, India and Asia, where there are many proposals to test a number of vaccine candidates such as vaccines against HIV. We have now discovered that a family of bipartite protein exotoxins, such as Bacillus anthracis , contains fragments that can be used for the delivery of exogenous antigens, such as proteins, to the cytosol. One preferred protein fragment from these proteins is from the N-terminal portion that contains the protective antigen (PA) binding domain, but not those portions resulting in toxicity to the cell. More preferably, that fragment has been modified to remove the specific domain that binds to PA. B. anthracis is the causative agent of anthrax in animals and humans. The toxin produced by B. anthracis consists of two bipartite protein exotoxins, lethal toxin (LT) and edema toxin. LT is composed of protective antigen (PA) and lethal factor (LF), whereas edema toxin consists of PA and edema factor (EF). None of these three components, PA, LF, and EF, alone is toxic. Once combined however, edema toxin causes edema and LT causes death by systemic shock in animals and humans. Consistent with its critical role in forming both toxins, PA has been identified as the protective component in vaccines against anthrax. The molecular mechanism of anthrax toxin action is currently hypothesized as follows: PA is a 735-amino acid polypeptide that binds to the surface of mammalian cells by cellular receptors. Once bound, PA is activated by proteolytic cleavage by cellular proteases to a 63-kDa molecule capable of forming a ring-shaped heptamer in the plasma membrane of the targeted cell ( FIG. 1 ) (6, 7). The PA heptamer then binds either EF or LF, which are internalized by endocytosis. After endosomal acidification, PA enables EF or LF to enter the cytosol, presumably by means of a pore formed by the heptamer. Within the cytosol, EF acts as an adenylate cyclase (8) to convert ATP to cAMP. Abnormally elevated levels of cAMP perturb cellular metabolism. The action of LF in the cytosol causes the death of host cells by a mechanism that is not well understood. LF induces over-production of a number of lymphokines (9), contributing to lethal systemic shock in host animals. Recent studies also show that LF has two enzymatic activities: it can act as a zinc metalloprotease (10), and it inactivates the mitogen-activated protein kinase (11). Although it is still not clear how these two enzymatic activities of LF are connected, both are required for LF toxicity. It has previously been reported that anthrax toxin B moieties may be used to deliver eptiopes which in turn elicit an antibody response by the immune system, in the presence of PA (WO 97/23236). LF is a 796-aa polypeptide, and the functional domain for both enzymatic activities is located between amino acids 383 and 796 ( FIG. 2A ) (12). The N-terminal truncated LF without this catalytic domain completely lacks any toxic effect when mixed with PA and added to cultured macrophages or when injected into animals. It does, however, still bind to PA effectively. The PA binding domain of LF (LFn) consists of amino acids 1-255 ( FIG. 2B ) (12). |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention provides methods of delivering exogenous antigens to the cytosol, novel fusion proteins, and uses thereof. We have now further found that one can use a transport factor that is lethal factor modified to inactivate toxin domains, fragments thereof such as LFn and fragments of LFn, such as a fragment containing the carboxy portion of that fragment, as a transport factor, fused to a target antigen, without PA to deliver the antigen to the cytosol. Preferably, the transport factor is LFn or a fragment thereof. One preferred group is LFn fragments do not contain the PA binding domain. More preferably, the transport factor is an LFn fragment. For example, the 60 carboxy most amino acids of LFn can be used as a transport factor, still more preferably the 80 carboxy-most amino acids. One can also use other fragments. For example, one can use fragments containing more of the lethal factor protein as long as one inactivates the toxin portion. Preferably the transport factor fragment contains a portion of the 80 carboxy-most amino acid residues of LFn and contains other portions of the fragment as long as those portions containing toxicity are removed. Preferably the fragment is 350 amino acids or less, still more preferably it is 300 amino acids or less, even more preferably it is 250 amino acids or less. One preferred fragment is 105 amino acids or less. A more preferred fragment is 80 amino acids or less. This transport factor is then linked to the antigen you wish to bring to the cytosol. This can be done by techniques well known in the art. For example, one could prepare fusion proteins containing the antigen or antigens that one wants to bring to the cytosol of the cell. The preferred methods of the invention are characterized by novel polypeptides which elicit in treated animals the formation of a cell mediated immune response. This invention provides DNA sequences that code for the novel fusion polypeptides of the invention, recombinant DNA molecules that are characterized by those DNA sequences, unicellular hosts transformed with those DNA sequences and molecules, and methods of using those sequences, molecules and hosts to produce the novel polypeptides and CMI immune response to desired antigens this invention. In another preferred embodiment, this invention provides a pharmaceutical composition comprising one or more novel fusion peptides of this invention. Such a composition is effective in eliciting cell mediated immune responses. In one preferred embodiment it can be used as a vaccine. In another embodiment, these fusion proteins can be used to create producer cells, preferably bacterial producer cells for a variety of proteins, particularly proteins that have proven difficult to express in such cells. In another preferred embodiment, this invention provides a method for measuring cell mediated immune responses. In a further preferred embodiment, this invention provides a kit for measuring cell mediated immune responses in vitro. |
Leinamycin biosynthesis gene cluster and its components and their uses |
This invention provides detailed sequence analysis and characterization of the gene cluster responsible for the synthesis of leinamycin in Streptomyces atroolivaceus. The leinamycin gene cluster provides a hybrid polyketide synthase/nonribosomal peptide synthetase pathway. Elucidation of the various modules and enzymatic domains characterizing the pathway provides convenient synthetic routes for leinamycins, leinamycin analogs, and various other polyketides, peptides, and hybrid peptide-polyketide natural products. |
1. An isolated nucleic acid comprising a nucleic acid selected from the group consisting of a nucleic acid encoding one or more leinamycin (inn) open reading frames (ORFs) identified in Tables 1 and 2 (ORFs −35 through −1, lnmA through lnmZ and +1 through +9); a nucleic acid encoding a polypeptide encoded by any one or more of leinamycin (lnm) open reading frames (ORFs) identified in Tables 1 and 2 (ORFs −35 through −1, lnmA throug lnmZ and +1 through +9); a nucleic acid comprising the nucleotide sequence of a nucleic acid amplified by polymerase chain reaction (PCR) using any one of the primer pairs identified in Table 2 and the nucleic acid of a leinamycin-producing organism as a template; and a nucleic acid that encodes a protein comprising at least one catalytic domain selected from the group consisting of a condensation (C) domain, an adenylation (A) domain, a peptidyl carrier protein (PCP) domain, a condensation/cyclization domain (Cy), an acyl-carrier protein (ACP)-like domain, an oxidization domain (Ox), an NADH dehydrogenase domain, a methyltransferase domain, a phosphotransferase domain, a peptide synthetase domain, and an aminotransferase domain, and that specifically hybridizes to one or more leinamycin (lnm) open reading frames (ORFs) identified in Tables 1 and 2 (ORFs −35 through −1, lnmA through lnmZ, and +1 through +9) under stringent conditions. 2. The isolated nucleic acid of claim 1, wherein said nucleic acid comprises a nucleic acid encoding at least two open reading frames identified in Tables 1 and 2, said open reading fraes being selected from the group consisting of −35, −34, −33, −32, −31, −30, −29, −28, −27, −26, −25, −24, −23, −22, −21, −20, −19, −18, −17, −16, −15, −14, −13, −12, −11, −10, −9, −8. −7, −7, −5, −4, −3, −2, −1, lnmA, lnmB, lnmC, lnmD, lnmE, lnmF, lnmG, lmnH, lnmI, lnmJ, lmnK, lnmL, lnmM, lnmN, lmnO, InmP, lnmQ, lmnR, lnmS, lnmT, lnmU, lnmV, lnmW, lnmX, lnmY, lnmZ, =1, +2, +3, +4, +5, +6, +7, +8, and +9. 3. The isolated nucleic acid of claim 1, wherein said nucleic acid comprises a nucleic acid encoding at least three open reading frames identified in Tables 1 and 2, said open reading frames being selected from the group consisting of −35, −34, −33, −32, −31, −30, −29, −28, −27, −26, −25, −24, −23, −22, −21, −20, −19, −18, −17, −16, −15, −14, −13, −12, −11, −10, −9, −8. −7, −7, −5, −4, −3, −2, −1, lnmA, lnmB, lnmC, lnmD, lnmE, lnmF, lnmG, lnmH, lnmI, lnmJ, lnmK, lnmL, lnmM, lnmN, lnmO, lnmP, lnmQ, lnmR, lnmS, lnmT, lnmU, lnmV, lnmW, lnmX, lnmY, lnmZ, =1, +2, +3, +4, +5, +6, +7, +8, and +9. 4. The isolated nucleic acid of claim 1, wherein said nucleic acid encodes a module. 5. An isolated nucleic acid of claim 4, comprising a nucleic acid encoding a module comprising two or more catalytic domains of a protein encoded by a nucleic acid of a leinamycin (lnm) gene cluster wherein said catalytic domains are selected from the group consisting of a condensation (C) domain, an adenylation (A) domain, a peptidyl carrier protein (PCP) domain, a condensation/cyclization domain (Cy), an acyl-carrier protein (ACP)-like domain, an oxidization domain (Ox), an enoyl reductase domain, a methyltransferase domain, a phosphotransferase domain, a peptide synthetase domain, and an aminotransferase domain. 6. The isolated nucleic acid of claim 1, wherein said nucleic acid comprises an open reading frame from SEQ ID NO: 1 or the complement of SEQ ID NO:1. 7. The isolated nucleic acid of claim 1, wherein said nucleic acid has the nucleotide sequence of a nucleic acid amplified by polymerase chain reaction (PCR) using any one of the primer pairs identified in Table 2 and the nucleic acid of a leinamycin-producing organism as a template 8. An isolated nucleic acid comprising a leinamycin (lnm) open reading frame (ORF) or an allelic variant thereof. 9. The nucleic acid of claim 8, wherein said nucleic acid comprises a nucleic acid that is a single nucleotide polymorphism (SNP) of a leinamycin (lnm) open reading frame (ORF). 10. An isolated gene cluster comprising open reading frames encoding polypeptides sufficient to direct the assembly of a leinamycin. 11. An isolated multi-functional protein complex comprising both a polyketide synthase (PKS) and a peptide synthetase (NRPS), wherein said polyketide synthase (PKS) or said peptide synthetase (NRPS) have the amino acid sequence of a PKS or an NRPS found encoded by a nucleic acid from the leinamycin gene cluster. 12. An isolated nucleic acid encoding a multi-functional protein complex comprising both a polyketide synthase (PKS) and a peptide synthetase (NRPS), wherein said polyketide synthase or said peptide synthetase, in its native state, is present in a leinamycin (lnm) gene cluster. 13. An isolated polypeptide comprising a poly eptide selected from the group consisting of: a catalytic domain encoded by one or more leinamycin (lnm) open reading frames (ORPs) identified in Tables 1 and 2 (ORFs −35 through −1, lnmA through lnmZ and +1 through +9); a catalytic domain encoded by a nucleic acid having the sequence of a nucleic acid amplified by polymerase chain reaction (PCR) using any one of the primer pairs identified in Table 2; and a module comprising two or more catalytic domains of a protein encoded by a nucleic acid of a leinamycin gene cluster. 14. The polypeptide of claim 13, wherein said polypeptide comprises an enzymatic domain selected from the group consisting of a condensation (C) domain, an adenylation (A) domain, a peptidyl carrier protein (PCP) domain, a condensation/cyclization domain (Cy), an acyl-carrier protein (ACP)like domain, an oxidization domain (Ox), a enoyl reductase domain, a methyltransferase domain, a phosphotransferase domain, a peptide synthetase domain, and an aminotransferase domain. 15. The polypeptide claim 13, wherein the nucleic acid of a leinamycin gene cluster comprises a nucleic acid encoding at least two open reading frames identified in Tables 1 and 2, said open reading frames being selected from the group consisting of −35, −34, −33, −32, −31, −30, −29, −28, −27, −26, −25, −24, −23, −22, −21, −20, −19, −18, −17, −16, −15, −14, −13, −12, −11, −10, −9, −8. −7, −7, −5, −4, −3, −2, −1, lnmA, lnmB, lnmC, lnmD, lnmE, lnmF, lnmG, lnmH, lnmI, lnmJ, lnmK, lnmL, lnmM, lnmN, lnmO, lnmP, lnmQ, lnmR, lnmS, lnmT, lnmU, lnmV, lnmW, lnmX, lnmY, lnmZ, =1, +2, +3, +4, +5, +6, +7, +8, and +9. 16. The polypeptide claim 13, wherein said nucleic acid of a leinamycin gene cluster comprises a nucleic acid encoding at least three open reading frames identified in Tables 1 and 2, said open reading frames being selected from the group consisting of −35, −34, −33, −32, −31, −30, −29, −28, −27, −26, −25, −24, −23, −22, −21, −20, −19, −18, −17, −16, −15, −14, −13, −12, −11, −10, −9, −8. −7, −7, −5, −4, −3, −2, −1, lnmA, lnmB, lnmC, lnmD, lnmE, lnmF, lnmG, lnmH, lnmI, lnmJ, lnmK, lnmL, lnmM, lnmN, lnmO, lnmP, lnmQ, lnmR, lnmS, lnmT, lnmU, lnmV, lnmW, lnmX, lnmY, lnmZ, =1, +2, +3, +4, +5, +6, +7, +8, and +9. 17. The polypeptide of claim 13, wherein said polypeptide comprises a module comprising two or more catalytic domains of a protein encoded by a nucleic acid of a leinamycin gene cluster wherein said catalytic domains are selected from the group consisting of a condensation (C) domain, an adenylation (A) domain, a peptidyl carrier protein (PCP) domain, a condensation/cyclization domain (Cy), an acyl-carrier protein (ACP)-like domain, an oxidization domain (Ox), an enoyl reductase domain (ER), a methyltransferase domain, a phosphotransferase domain, a peptide synthetase domain, and an aminotransferase domain. 18. An isolated polypeptide comprising a module wherein said module is specifically bound by an antibody that specifically binds to a leinamycin (lnm) module. 19. The polypeptide of claim 18, wherein said polypeptide is specifically bound by an antibody that specifically binds to a polypeptide encoded by a leinamycin open reading frame. 20. An expression vector comprising a nucleic acid of any one of claims 1 through 12. 21. A host cell transformed with an expression vector of claim 20. 22. The host cell of claim 21, wherein said cell is transformed with an exogenous nucleic acid comprising a gene cluster encoding polypeptides sufficient to direct the assembly of a leinamycin or leinamycin analog. 23. The cell of claim 21, wherein said cell is a bacterial cell. 24. The cell of claim 23, wherein said cell is a Streptomyces cell. 25. The cell of claim 21, wherein said cell is a eukaryotic cell. 26. The cell of claim 21, wherein said cell is an insect cell. 27. A method of chemically modifying a molecule, said method comprising contacting a molecule that is a substrate for a polypeptide encoded by one or more leinamycin biosynthesis gene cluster open reading frames with a polypeptide encoded by one or more leinamycin biosynthesis bene cluster open reading frames, whereby said polypeptide chemically modifies said molecule. 28. The method of claim 27, wherein said method comprising contacting said molecule with at least two different polypeptides encoded by leinamycin (lnm) gene cluster open reading frames. 29. The method of claim 27, wherein said method comprising contacting said molecule with at least three different polypeptides encoded by leinamycin (lnm) gene cluster open reading frames. 30. The method of claim 27, wherein said contacting is in a host cell. 31. The method of claim 30, wherein said host cell is a bacterium. 32. The method of claim 27, wherein said contacting ex vivo. 33. The method of claim 27, wherein said molecule is an endogenous metabolite produced by said host cell. 34. The method of claim 27, wherein said molecule is an exogenous supplied metabolite. 35. The method of claim 27, wherein said host cell is a eukaryotic cell. 36. The method of claim 35, wherein said eukaryotic cell is selected from the group consisting of a mammnalian cell, a yeast cell, a plant cell, a fungal cell, and an insect cell. 37. The method of claim 27, wherein said molecule is an amino acid and said polypeptide is a peptide synthetase. 38. The method of claim 27, wherein said polypeptide is an amino transferase. 39. A cell that overexpresses leinamycin. 40. The cell of claim 39, wherein said cell overexpresses a polypeptide encoded by leinamycin open reading frame lnmL. 41. A cell that produces leinamycin, wherein one or more proteins that synthesize said leinamycin are encoded by one or more heterologous nucleic acids. 42. The cell of claim 41, wherein said heterologous nucleic acids comprise at least three open reading frames identified in Tables 1 and 2, said open reading frames being selected from the group consisting of −35, −34, −33, −32, −31, −30, −29, −28, −27, −26, −25, −24, −23, −22, −21, −20, −19, −18, −17, −16, −15, −14, −13, −12, −11, −10, −9, −8, −7, −7, −5, −4, −3, −2, −1, lnmA, lnmB, lnmC, lnmD, lnmE, lnmF, lnmG, lnmH, lnmI, lnmJ, lnmK, lnmL, lnmM, lnmN, lnmO, lnmP, lnmQ, lnmR, lnmS, lnmT, lnmU, lnmV, lnmW, lnmX, lnmY, lnmZ, +1, +2, +3, +4, +5, +6, +7, +8, and +9 43. A method of coupling a first amino acid to a second amino acid, said method comprising contacting the first and second amino acid with a recombinantly expressed leinamycin nonribosomal peptide synthetase (NRPS). 44. The method of claim 49, wherein said NRPS is selected from the group consisting of NRPS-1, and NRPS-2. 45. The method of claim 49, wherein said contacting is in a host cell. 46. A method of coupling a first fatty acid to a second fatty acid, said method comprising contacting the first and second fatty acids with a recombinantly expressed leinamycin polyketide synthase (PKS). 47. The method of claim 46, wherein said PKS is selected from the group consisting of lnm PKS-1, PKS-2, PKS-3, PKS-4, PKS-5, and PKS-6. 48. The method of claim 46, said contacting is in a host cell. 49. A method of producing a leinamycin or leinamycin analog, said method comprising: providing a cell transformed with an exogenous nucleic acid comprising a leinamycin gene cluster encoding polypeptides sufficient to direct the assembly of said leinamycin or leinamycin analog; culturing the cell under conditions permitting the biosynthesis of leinamycin or leinamycin analog; and isolating said leinamycin or leinamycin analog from said cell. 50. A method of producing a leinamycin analog, said method comprising: providing a cell comprising a leinamycin gene cluster; transfecting the cell with a nucleic acid that alters the leinamycin gene cluster through homologous recombination so that the gene cluster encodes a biosynthetic pathway that synthesizes,said leinamycin analog; culturing the cell under conditions permitting the biosynthesis of the leinamycin analog; and isolating the leinamycin analog from the cell. 51. An isolated nucleic acid comprising a nucleic acid encoding a phosphopantetheinyl transferase said nucleic acid encoding a phosphopantetheinyl transferase being selected from the group consisting of: a nucleic acid encoding the protein comprising the amino acid sequence encoded by lmp of FIG. 5; a nucleic acid encoding a polypeptide having phosphopantetheinyl transferase activity where said nucleic acid specifically hybridizes to the nucleic acid having the sequence encoded by lmp of FIG. 5 under stringent conditions. 52. The nucleic acid of claim 51, wherein said nucleic acid comprises the sequence of lmp in FIG. 5. 53. The nucleic acid of claim 51, wherein said nucleic acid comprises a vector. 54. A polypeptide comprising a phosphopantetheinyl transferase encoded by a nucleic acid of claim 51. 55. A vector comprising the nucleic acid of claim 51. 56. A cell transfected with the vector of claim 55. 57. A method of converting an apo-carrier protein to a holo-carrier protein comprising reacting said apo-carrier protein with a recombinant phosphopantetheinyl transferase encoded by the nucleic acid of claim 51 and coenzyme A thereby producing a holo-carrier protein. 58. A cell comprising a modified leinamycin gene cluster nucleic acid, said cell producing elevated amounts of leinamycin as compared to the wild type cell. 59. The cell of claim 58, wherein said cell overexpresses a resistance gene from the leinamycin gene cluster. 60. The cell of claim 59, wherein said resistance gene is a gene listed in Table 2. 61. An antibody that specifically binds to a polypeptide encoded by an lnm open reading frame identified in Table 2. 62. The antibody of claim 61, wherein said antibody is a single chain antibody. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Polyketides and nonribosomal peptides are two large families of natural products that include many clinically valuable drugs, such as erythromycin and vancomycin (antibacterial), FK506 and cyclosporin (immunosuppresant), and epothilone, and bleomycin, or leinamycin (antitumor). The biosyntheses of polyketides and nonribosomal peptides are catalyzed by polyketide synthases (PKSs) (Hopwood (1997) Chem. Rev. 97: 2465; Katz (1997) Chem. Rev., 97: 2557; C. Khosla, (1997) Chem. Rev., 97: 2577; Ikeda and Omura, (1997) Chem. Rev., 97: 2591; Staunton and Wilkinson(1997) Chem. Rev., 97: 261 1; Cane et al.(1998) Science 282: 63) and nonribosomal peptide synthetases (NRPSs) (Cane et al.(1998) Science 282: 63. Marahiel et al. (1997) Chem. Rev. 97: 2651; von Döhren et al. (1997) Chem. Rev. 97: 2675), respectively. Remarkably, PKSs and NRPSs use a very similar strategy for the assembly of these two distinct classes of natural products by sequential condensation of short carboxylic acids and amino acids, respectively, and utilize the same 4′-phosphopantetheine prosthetic group, via a thioester linkage, to channel the growing polyketide or peptide intermediate during the elongation processes. Both type I PKSs and NRPSs are multifunctional proteins that are organized into modules. (A module is defined as a set of distinctive domains that encode all the enzyme activities necessary for one cycle of polyketide or peptide chain elongation and associated modifications.) The number and order of modules and the type of domains within a module on each PKS or NRPS protein determine the structural variations of the resulting polyketide and peptide products by dictating the number, order, choice of the carboxylic acid or amino acid to be incorporated, and the modifications associated with a particular cycle of elongation. Since the modular architecture of both PKS (Cane et al. (1998) Science, 282: 63; Katz and Danadio (1993) Ann. Rev. Microbiol. 47: 875 (1993); Hutchinson and Fuji (1995) Ann. Rev. Microbiol. 49: 201) and NRPS (Cane et al. (1998) Science 282: 63, Stachelhaus et al. (1995) Science 269: 69; Stachelhaus et al. (198) Mol. Gen. Genet. 257: 308; Belshaw et al. (1999) Science 284,486) has been exploited successfully in combinatorial biosynthesis of diverse “unnatural” natural products, a hybrid PKS and NRPS system, capable of incorporating both carboxylic acids and amino acids into the final products, can lead to even greater chemical structural diversity. Leinamycin (Lnm) is a novel antitumor antibiotic produced by several Streptomyces species (Hara et al. (1989) J. Antibiot. 42: 333-335; Hara et al. (1989) J. Antibiot. 42: 1768-1774; Nakano et al. (1992) Pages 72-75 In Harnessing Biotechnol. 21 st Century, Proc. Int. Biotechnol. Symp. Expo. 9 th, Ladisch, M. R. and Bose, A., eds., ACS:Washington, D.C.). Its structure was revealed by X-ray crystallographical (Hirayama and Matsuzawa (1993) Chem. Lett. 1957-1958) and spectroscopic analyses (Hara et al. (1989) J. Antibiot. 42: 333-335; Hara et al. (1989) J. Antibiot. 42: 1768-1774) and confirmed by total synthesis (Kanda and Fukuyama (1993) J. Am. Chem. Soc. 115: 8451-8452; Fukuyama and Kanda (194) J. Synth. Org. Chem. Japan, 52, 888-899). It contains an unusual 1,3-dioxo-1,2-dithiolane moiety that is spiro-fused to a thiazole-containing 18-membered lactam ring, a molecular architecture that has not been found to date in any other natural product ( FIG. 1 ). Lnm exhibits a broad spectrum of antimicrobial activity against Gram-positive and Gram-negative bacteria, but not against fungi. Lnm shows potent antitumor activity in murine tumor models in vivo, including HeLa S3, sarcoma180, B-16, Colon 26, and leukemia P388. It is also active against murine models inoculated with tumors that are resistant to clinically important antitumor drugs, such as cisplatin, doxorubicin, mitomycin, or cyclophosphamide (Hara et al. (1989) J. Antibiot. 42: 333-335; Hara et al. (1989) J. Antibiot. 42.71768-1774; Nakano et aL (1992) Pages 72-75 In Harnessing Biotechnol. 21 st Century, Proc. Int. BiotechnoL Symp. Expo. 9 th, Ladisch, M. R. and Bose, A., eds., ACS:Washington, D.C.). Lnm preferentially inhibits DNA synthesis and interacts directly with DNA to cause single-strand scission of DNA in the presence of thiol agents as cofactors. The presence of the sulfoxide group in the dithiolane moiety is essential for the DNA-cleaving activity (Hara et al. (1990) Biochemistry 29: 5676-5681). Interestingly, simple 1,3-dioxo-1,2-dithiolanes are also thiol-dependent DNA cleaving agents in vitro (Behroozi et al (1995) J. Org. Chem. 60: 3964-3966; Behroozi et al. (1996) Biochemistry 35: 1768-1774; Mitra et al. (1997) J. Am. Chem. Soc. 119: 11691-11692). However, the mechanisms for DNA cleavage by simple 1,3-dioxo-1,2-dithiolanes and Lnm are distinct oxidative cleavage by 1,3-dioxo-1,2-dithiolanes that convert molecular oxygen to DNA-cleaving oxygen radicals mediated by polysulfides (Behroozi et al (1995) J. Org. Chem. 60: 3964-3966; Behroozi et al. (1996) Biochemistry 35: 1768-1774; Mitra et al. (1997) J. Am. Chem. Soc. 119: 11691-11692) and allylative cleavage by Lnm mediated by an episulfonium ion intermediate (Mitra et al. (1997) J. Am. Chem. Soc. 119: 11691-11692; Asai et al. (1996) J. Am. Chem Soc. 118: 6802-6803; Asai et aL (1997) Bioorg. Med. Chem. 5: 723-729) ( FIG. 1 ). The latter mechanism represents an unprecedented mode of action for the thiol-dependent DNA cleavage by Lnm. Aimed at discovering clinically useful Lnm analogs, both total synthesis (Kanda and Fukuyama (1993) J. Am. Chem. Soc. 115: 8451-8452; Fukuyama and Kanda (194) J. Synth. Org. Chem. Japan, 52, 888-899; Pattenden and Shuker (1991) Tetrahedron Lett. 32: 6625-6628; Pattenden and Shuker (1992) J. Chem. Soc. Perkin Trans I, 1215-1221; Kanda et al. (1992) Tetrahedron Lett. 33: 5701-5704; Pattenden and Thom (1993) Synlett 215-216) and chemical modification of the natural Lnm have been investigated. Modifications at both C-8 hydroxy and C-9 keto groups as well as at the 1,3-dioxo-1,2-dithiolane moiety have generated a number of lnm analogs with improved antitumor activity and in vivo stability (Kanda et al. (1998) Bioorg. Med. Chem. Lett. 8: 909-912; Kanda et al. (1999) J. Med. Chem. 42: 1330-1332), supporting the wisdom of making novel anticancer drugs based on the Lnm scaffold. However, for a complex molecule like Lnm, chemical total synthesis has very limited practical value, and chemical modification only can access to limited functional groups, often requiring multiple extra protection/deprotection steps. |
<SOH> SUMMARY OF THE INVENTION <EOH>This invention pertains to the isolation and elucidation of the leinamycin gene cluster (see SEQ ID NO:1). This gene cluster (nucleic acid sequence) encodes all of the open reading frames (ORPs) that encode polypeptides sufficient to direct the biosynthesis of leinamycin. The nucleic acids can be used in their “native” format or recombined in a wide variety of manners to create novel synthetic pathways. Thus, in one embodiment, this invention provides an isolated nucleic acid comprising a nucleic acid selected from the group consisting of: 1) A nucleic acid encoding one or more leinamycin (lnm) open reading frames (ORFs) identified in Tables 1 and 2 (ORFs −35 through −1, lnmA through lnmZ, and +1 through +9)). A nucleic acid encoding a polypeptide encoded by any one or more of leinamycin (lnm) open reading frames (ORFs) identified in Tables 1 and 2 (ORFs −35 through −1, lnmA through lnmZ, and +1 through +9); 3) A nucleic acid comprising the nucleotide sequence of a nucleic acid amplified by polymerase chain reaction (PCR) using any one of the primer pairs identified in Table 2 and the nucleic acid of a leinamycin-producing organism as a template; and 4) A nucleic acid that encodes a protein comprising at least one catalytic domain selected from the group consisting of a condensation (C) domain, an adenylation (A) domain, a peptidyl carrier protein (PCP) domain, a condensation/cyclization domain (Cy), an acyl-carrier protein (ACP)-like domain, an oxidization domain (Ox), an enoyl reductase domain (ER), a methyltransferase domain, a phosphotransferase domain, a peptide synthetase domain, and an aminotransferase domain, and that specifically hybridizes to one or more of lnm ORFs −35 through −1, lnmA through lnmZ, and/or +1 through +9 under stringent conditions. In certain embodiments, the isolated nucleic acid comprises a nucleic acid encoding at least two, preferably at least three, more preferably at least four, and most preferably at least five, open reading frames independently selected from the group consisting of leinamycin (lnm) open reading frames −35 through −1, lnmA through lnmZ, and +1 through +9. In particularly preferred embodiments, the isolated nucleic acid encodes a module. In another embodiment, the nucleic acid comprises a nucleic acid encoding a module comprising two or more catalytic domains of a protein encoded by a nucleic acid of a leinamycin (lnm) gene cluster where the catalytic domains are selected from the group consisting of a condensation (C) domain, an adenylation (A) domain, a peptidyl carrier protein (PCP) domain, a condensation/cyclization domain (Cy), an acyl-carrier protein (ACP)-like domain, an oxidization domain (Ox), an enoyl reductase domain, a methyltraasferase domain, a phosphotransferase domain, a peptide synthetase domain, and an aminotransferase domain. In particularly preferred embodiments, the nucleic acid comprises an open reading frame from SEQ ID NO: 1 or the complement therof (e.g. as described in Table 2). In other preferred embodiments, the nucleic acid has the nucleotide sequence of a nucleic acid amplified by polymerase chain reaction (PCR) using any one of the primer pairs identified in Table 2 and the nucleic acid of a leinamycin-producing organism (e.g. S. atroolivaceus ) as a template. In still yet another embodiment, this invention provides an isolated nucleic acid comprising a leinamycin (lnm) open reading frame (ORF) or an allelic variant thereof (e.g. a single nucleotide polymorphism (SNP) of a leinamycin (lnm) open reading frame (ORF)). In another embodiment, this invention provides an isolated gene cluster comprising open reading frames encoding polypeptides sufficient to direct the assembly of a leinamycin. In one embodiment, this invention provides an isolated nucleic acid encoding a multi-functional protein complex comprising both a polyketide synthase (PKS) and a peptide synthetase (NRPS), where the polyketide synthase or the peptide synthetase, has the amino acid sequence of a PKS or an NRPS encoded by the leinamycin (lnm) gene cluster. This invention also provides for various proteins. Thus, in one embodiment, this invention provides an isolated multi-functional protein complex comprising both a polyketide synthase (PKS) and a peptide synthetase (NRPS), where the polyketide synthase (PKS) and/or the peptide synthetase (NRPS) ahs the amino acid sequence of a PKS or an NRPS found encoded by a nucleic acid from the leinamycin gene cluster. In another embodiment, this invention provides a polypeptide selected from the group consisting of: 1) A catalytic domain encoded by one or more leinamycin (lnm) open reading frames (ORFs) e.g., ORFs 35 through −1, lnmA through lnmZ, and +1 through +9, (e.g. as identified in Table 2); 2) A catalytic domain encoded by a nucleic acid having the sequence of a nucleic acid amplified by polymerase chain reaction (PCR) using any one of the primer pairs identified in Table 2; and 3) A module comprising two or more catalytic domains of a protein encoded by a nucleic acid of a leinamycin gene cluster. In preferred embodiments, the polypeptide comprises an enzymatic domain selected from the group consisting of a condensation (C) domain, an adenylation (A) domain, a peptidyl carrier protein (PCP) domain, a condensation/cyclization domain (Cy), an acyl-carrier protein (ACP)-like domain, an oxidization domain (Ox), an NADH dehydrogenase domain, a methyltransferase domain, a phosphotransferase domain, a peptide synthetase domain, and an aminotransferase domain. In certain embodiments, the polypeptide comprises domains encoded by at least two, preferably at least three, more preferably at least four, and most preferably at least five, open reading frames independently selected from the group consisting of leinamycin (lnm) open reading frames 1 through 72. In certain embodiments, the polypeptide can comprise a module comprising two or more catalytic domains of a protein encoded by a nucleic acid of a leinamycin gene cluster where the catalytic domains are selected from the group consisting of a condensation (C) domain, an adenylation (A) domain, a peptidyl carrier protein (PCP) domain, a condensation/cyclization domain (Cy), an acyl-carrier protein (ACP)-like domain, an oxidization domain (Ox), an enoyl reductase domain (ER), a methyltransferase domain, a phosphotransferase domain, a peptide synthetase domain, and an aminotransferase domain. In another embodiment this invention provides an isolated polypeptide comprising a module where the module is specifically bound by an antibody that specifically binds to a leinamycin (lnm) module (e.g. is cross-reactive with an lnm polypeptide). IN preferred embodiments, the polypeptide is specifically bound by an antibody that specifically binds to a polypeptide encoded by a leinamycin open reading frame. In certain embodiments, this invention provides an expression vector comprising any one or more of the nucleic acids described herein. The nucleic acids are preferably operably linked to a promoter (e.g. constitutive promoter, inducible promoter, tissue specific promoter, etc.). Also provided are host cells transfected and/or transformed with such a vector. Thus, in one embodiment this invention provides a host cell (e.g. bacterial cell) transfected and/or transformed with an exogenous nucleic acid comprising a gene cluster encoding polypeptides sufficient to direct the assembly of a leinamycin or leinamycin analog and/or with a nucleic acid sufficient to introduce a modification into an lnm gene cluster (e.g. via homologous recombination). Particularly preferred cells include, but are not limited to, eukaryotic cells, insect cells, and bacterial cells (e.g. Streptomyces cells). This invention also provides a method of chemically modifying a molecule. The method involves contacting a molecule that is a substrate for a polypeptide encoded by one or more leinamycin biosynthesis gene cluster open reading frames (e.g. a leinamycin intermediate metabolite) with a polypeptide encoded by one or more leinamycin biosynthesis gene cluster open reading frames, whereby the polypeptide chemically modifies the molecule. In preferred embodiments, the method comprises contacting the molecule with at least two, preferably at least 3, more preferably at least 4 and most preferably at least 5 different polypeptides encoded by leinamycin (lnm) gene cluster open reading frames. The contacting can be ex vivo or in a host cell (e.g. a bacteriu such as Streptomyces ). The molecule can include, but is not limited to, an endogenous metabolite produced by the host cell or an exogenous supplied metabolite. In certain embodiments, the cell is a eukaryotic cell (e.g. a mammalian cell, a yeast cell, a plant cell, a fungal cell, and an insect cell). In certain embodiments, the (substrate) molecule is an amino acid and the polypeptide is a peptide synthetase. In certain embodiments, the polypeptide is an amino transferase. In still another embodiment, this invention provides a cell that overexpresses leinamycin. A particularly preferred cell overexpresses a polypeptide encoded by leinamycin open reading frame lnmG and/or lnmL. This invention also provides a method of coupling a first amino acid to a second amino acid. The method involves comprising contacting the first and second amino acid with a recombinantly expressed leinamycin nonribosomal peptide synthetase (NRPS) (e.g. NRPS-1, NRPS-2, etc.). The contacting can be ex vivo or in a host cell (e.g. a bacterium). This invention also provides a method of coupling a first fatty acid to a second fatty acid. This method involves contacting the first and second fatty acids with a recombinantly expressed leinamycin polyketide synthase (PKS) (e.g. PKS-1, PKS-2, PKS-3, PKS4, PKS-5, PKS-6). The contacting can be ex vivo or in a host cell (e.g. a bacterium). In one embodiment, this invention provides a method of producing a leinamycin or leinamycin analog. The method involves providing a cell transformed with an exogenous nucleic acid comprising a leinamycin gene cluster encoding polypeptides sufficient to direct the assembly of the leinamycin or leinamycin analog; culturing the cell under conditions permitting the biosynthesis of leinamycin or leinamycin analog; and isolating the leinamycin or leinamycin analog from the cell. In another embodiment, this invention provides a method of producing a leinamycin analog. The method involves providing a cell comprising a leinamycin gene cluster, transfecting the cell with a nucleic acid that alters the leinamycin gene cluster through homologous recombination, culturing the cell under conditions permitting the biosynthesis of the leinamycin analog; and isolating the leinamycin analog from the cell. In still another embodiment, this invention provides an isolated nucleic acid comprising a nucleic acid encoding a phosphopantetheinyl transferase (PPTase) the nucleic acid encoding a phosphopantetheinyl transferase being selected from the group consisting of: 1) A nucleic acid encoding the protein comprising the amino acid sequence encoded by sap ( Streptomyces atroolivaceus phosphopantetheinyl transferase) of FIG. 5 ; 2) A nucleic acid encoding a polypeptide having phosphopantetheinyl transferase activity where said nucleic acid specifically hybridizes to the nucleic acid having the sequence encoded by sap ( Streptomyces atroolivaceus phosphopantetheinyl transferase) of FIG. 5 under stringent conditions. In a particularly preferred embodiment, the nucleic acid comprises the sequence of lmp in FIG. 5 . As described above, the nucleic acid comprises a vector and cells comprising such a vector are provided herein. Also provided is a polypeptide encoded by a phosphopantetheinyl transferase nucleic acid described herein. This invention also provides a method of converting an apo-carrier protein to a holo-carrier protein comprising reacting the apo-carrer protein with a recombinant phosphopantetheinyl transferase encoded by the lnm PPTase nucleic acid described herein and coenzyme A thereby producing a holo-carrier protein. In still yet another embodiment, this invention provides a cell comprising a modified leinamycin gene cluster nucleic acid, where the cell produces elevated amounts of leinamycin as compared to the wild type cell. Particularly preferred cells overexpress a resistance gene from the leinamycin gene cluster (e.g. a resistance gene listed in Table 2). This invention also provides antibodies that specifically bind to a polypeptide encoded by an lnm open reading frame identified in Table 2. The antibodies include, but are not limited to intact antibodies, antibody fragments, and single chain antibodies. |
Catalyst composition |
A catalyst composition for the oxidation of carbon monoxide and volatile organic compounds and for hydrogenation reactions comprises at least two different high surface area oxide support materials wherein at least one of the high surface area support material supports at least one base metal promoter. |
1. A catalyst composition for the oxidation of carbon monoxide (CO) and volatile organic compounds (VOC), which composition comprising at least two different high surface area oxide support materials wherein at least one of the high surface area support material supports at least one base metal promoter. 2. A catalyst composition according to claim 1, further comprising at least one platinum group metal (PGM). 3. A catalyst composition according to claim 2, wherein the or each PGM is selected from platinum (Pt), palladium (Pd), rhodium (Rh), ruthenium (Ru) and iridium (Ir). 4. A catalyst composition according to claim 1, wherein each high surface area support material is selected from the group consisting of ceria (CeO2), perovskites, nickel oxide (NiO), manganese dioxide (MnO2), praseodymium (III) oxide (Pr2O3), titania (TiO2), silica (SiO2), alumina (Al2O3), zirconia (ZrO2) and a composite oxide or a mixed oxide of any two or more thereof. 5. A catalyst composition according to claim 1, wherein at least one of the at least two high surface area support materials is stabilised. 6. A catalyst composition according to claim 5, wherein the or each stabiliser is selected from at least one transition element and at least one alkaline earth metal. 7. A catalyst composition according to claim 6, wherein the transition element is at least one of zirconium (Zr), lanthanum (La), aluminium (Al), yttrium (Y), praseodymium (Pr) or neodymium (Nd) or an oxide thereof or a composite oxide or a mixed oxide of any two or more thereof. 8. A catalyst composition according to claim 6, wherein the alkaline earth metal is barium (Ba). 9. A catalyst composition according to claim 1, wherein at least one high surface area support material is Zr-stabilised CeO2. 10. A catalyst composition according to claim 9, wherein the Zr-stabilised CeO2 contains from about 2 to about 50% ZrO2. 11. A catalyst composition according to claim 10, wherein the Zr-stabilised CeO2 comprises about 58% by weight CeO2 and about 42% by weight ZrO2. 12. A catalyst composition according to claim 1, wherein at least one high surface area support material is La-stabilised Al2O3. 13. A catalyst composition according to claim 12, wherein the La-stabilised Al2O3 contains from about 2 to about 7% by weight La oxide. 14. A catalyst composition according to claim 1, wherein the high surface area support materials comprise La-stabilised Al2O3 and Zr-stabilised CeO2. 15. A catalyst composition according to claim 1, wherein the high surface area support materials have a mean particle size of less than about 20 μm. 16. A catalyst composition according to claim 15, wherein the mean particle size of the high surface area support materials is about 5 μm. 17. A catalyst composition according to claim 1, wherein the at least one base metal catalyst promoter is selected from the group consisting of Nd, Ba, Ce, La, Pr, magnesium (Mg), calcium (Ca), manganese (Mn), cobalt (Co), nickel (Ni), zinc (Zn), niobium (Nb), Zr, molybdenum (Mo), tin (Sn), tantalum (Ta) and strontium (Sr). 18. A catalyst composition according to claim 17, comprising Ce and Mn base metal catalyst promoters. 19. A catalyst composition according to claim 1, wherein said at least two high surface area support materials consist La-stabilised Al2O3 and Zr-stabilised CeO, and said catalyst composition further comprises Ce and Mn supported on said at least two high surface area support materials. 20. A catalyst composition according to claim 1 supported on a substantially inert substrate material comprising a flow through monolith or at least one pellet. 21. A method of oxidising at least one of CO and VOC in a fluid, which method comprising contacting the fluid with the catalyst composition according to claim 1. 22. A method of hydrogenating at least one substrate in a fluid, which method comprising contacting the fluid with the catalyst composition according to claim 1. 23. A method of making a catalyst composition according to claim 1, which method comprising: (a) forming on a non-porous substrate a combined washcoat of a first high surface area support material and a second high surface area support material from a slurry in which each of the high surface area support materials is of sufficiently large particle size so as to prevent each catalyst support material from forming a solution or a sol with the liquid medium of the slurry; and (b) impregnating at least one base metal catalyst promoter into each catalyst support material either before or after formation of the washcoat on the non-porous substrate, the amounts of first and second high surface area support materials present in the catalyst composition being determined by the amount of base metal required in each high surface area support material and the respective incipient water absorption capability of each high surface area support material. 24. A method according to claim 23, wherein separate slurries of the first high surface area support material and the second high surface area support material are prepared and the two slurries are then blended together and coated onto the non-porous substrate. 25. A method according to claim 23, wherein the slurry comprises the first and second high surface area support material, the at least one base metal catalyst promoter and at least one compound which is effective in preventing preferential absorption of the base metal in one or other of the first and second high surface area support materials. 26. A method according to claim 25, wherein the at least one compound is citric acid, acetic acid and oxalic acid. 27. A method according to claim 23, wherein the water absorption capabilities of the first high surface area support material and the second high surface area support material are respectively 0.2 to 1.0 ml/g and 0.5 to 2.5 ml/g. 28. A catalyst composition for the oxidation of carbon monoxide (CO) and volatile organic compounds (VOC), which composition consisting of at least two different high surface area oxide support materials, wherein at least one of the high surface area support material supports at least one base metal promoter. 29. A catalyst composition for the hydrogenation of a substrate, which composition consisting of at least two different high surface area oxide support materials, wherein at least one of the high surface area support material supports at least one base metal promoter. |
Alpha conotoxin peptides with analgesic properties |
This invention relates to novel α-conotoxin-like peptides comprising the following sequence of amino acids: Xaa1CCSXaa2Xaa3Xaa4CXaa5Xaa6Xaa7Xaa8Xaa9Xaa10Xaa11C—NH2 in which Xaa1 is G or D; Xaa3 is proline, hydroxyproline or glutamine; each of Xaa2 to Xaa8 and Xaa11 is independently any amino acid; Xaa9 is proline, hydroxyproline or glutamine; Xaa10 is aspartate, glutamate or γ-carboxyglutamate; Xaa11 is optionally absent; and the C-terminus is optionally amidated, with the proviso that the peptide is not α-conotoxin Ep1 or α-conotoxin Im1. The peptides are useful in the treatment or prevention of pain, in recovery from nerve injury, and in the treatment of painful neurological conditions such as stroke. |
1. An isolated α-conotoxin-like peptide comprising the following sequence of amino acids: Xaa1-Cys-Cys-Ser-Xaa2-Xaa3-Xaa4-Cys-Xaa5-Xaa6- Xaa7-Xaa8-Xaa9-Xaa10-Xaa11-Cys wherein Xaa1 is glycine or aspartate; Xaa3 is proline or hydroxyproline; each of Xaa2 to Xaa8 and Xaa11 is independently any amino acid; Xaa9 is proline, hydroxyproline or glutamine; Xaa10 is aspartate, glutamate or γ-carboxyglutamate; Xaa11 is optionally absent; and the C-terminus is optionally amidated, with the proviso that the peptide is not α-conotoxin epI, α-conotoxin ImI, α-conotoxin PnIA or α-conotoxin PnIB. 2. A peptide according to claim 1, in which Xaa2 is D,H or N; Xaa4 is A, P or R; Xaa5 is N,A or Y; Xaa6 is A, Y,H,M or V; Xaa7 is N or D; Xaa8 is H or N; and Xaa11 is I or Y. 3. A peptide according to claim 1 or claim 2, in which Xaa1 is G or D; Xaa2 is D, H or N; Xaa3 is P or 4-Hyp; Xaa4 is A, P or R; Xaa5 is N, A or Y; Xaa6 is A, Y, H, M or V; Xaa7 is N or D; Xaa8 is H or N; Xaa9 is proline, hydroxyproline or glutamine; Xaa10 is aspartate, glutamate or γ-carboxyglutamate; Xaa11 is I or Y; and the C-terminus is amidated. 4. (canceled) 5. A peptide according, comprising the following sequence of amino acids: [SEQ ID NO: 1] Gly-Cys-Cys-Ser-Asp-Xaa1-Arg-Cys-Asn-Tyr-Asp-His- Xaa2-Xaa3-Ile-Cys in which Xaa1 is proline or hydroxyproline; Xaa2 is proline, hydroxyproline or glutamine; Xaa3 is aspartate, glutamate or γ-carboxyglutamate; and the C-terminus is optionally amidated. with the proviso that the peptide is not α-conotoxin EpI, α-conotoxin ImI, α-conotoxin PnIA or α-conotoxin PnIB. 6. A peptide according to claim 1, which has one or more of the following activities: (a) inhibits a neuronal nicotinic acetylcholine receptor (nAChR), or (b) acts as an analgesic in mammals, or (c) accelerates recovery from nerve injury, and/or (d) does not affect muscle-type nicotinic responses in rats. 7. (canceled) 8. A peptide according to claim 1, which comprises the a sequence selected from the group consisting (SEQ ID NO: 2) (i) Gly-Cys-Cys-Ser-Asp-Pro-Arg-Cys-Asn-Tyr- Asp-His-Pro-Glu-Ile-Cys-NH2 (SEQ ID NO:7) (ii) Gly-Cys-Cys-Ser-Asp-4Hyp-Arg-Cys-Asn- Tyr-Asp-His-Pro-γ-carboxy-Glu-Ile-Cys-NH2 (SEQ ID NO:8) (iii) Asp-Cys-Cys-Ser-Asn-Pro-Pro-Cys-Ala- His-Asn-Asn-Pro-Asp-Cys-NH2; and (SEQ ID NO: 9) (iv) Gly-Cys-Cys-Ser-His-Pro-Ala-Cys-Tyr- Ala-Asn-Asn-Gln-Asp-Tyr-Cys-NH2, wherein the C-terminal cysteine in each of said sequences is amidated. 9. A peptide according to claim 8, which has the sequence set out in SEQ ID NO: 2. 10. An addition, substitution, deletion or peptidomimetic variant of a peptide according to claim 8, which retains one of more of the following activities: (a) inhibits inhibition of the ability to inhibit the activity of a neuronal nicotinic acetylcholine receptor, (b) induces analgesia, and (c) accelerates the rate of recovery from nerve injury. 11-13. (canceled) 14. A peptide according to claim 1, in which the post-translational modification is hydroxylation of proline or γ-carboxylation of glutamate. 15. An isolated or synthetic nucleic acid molecule, comprising: (a) a nucleotide sequence encoding a peptide according to claim 1; (b) a nucleotide sequence complementary to the sequence of (a); (c) a nucleotide sequence such that said molecule hybridizes to the nucleic acid of (a) or (b) under at least moderately stringent conditions; or (d) a sequence which has at least 75% sequence identity to (a). 16. A nucleic acid molecule according to claim 15, which is able to hybridize under stringent conditions to the molecule comprising the nucleotide sequence (a). 17. A nucleic acid molecule according to claim 15, which comprises the sequence (d). 18. A nucleic acid molecule according to claim 15, which hybridizes under at least moderately stringent conditions with a nucleic acid with the sequence SEQ ID NO: 5 or SEQ ID NO: 6. 19. A nucleic acid molecule according to claim 15, which comprises the sequence SEQ ID NO: 3. 20. A genetic construct comprising a vector portion and a nucleic acid molecule according to claim 15. 21. A composition comprising a peptide according to claim 1, together with a physiologically acceptable carrier. 22. A method for treating a condition mediated by a nicotinic acetylcholine receptor and treatable by inhibition of activity mediated by said receptor, comprising the step of administering an effective amount of a peptide according to claim 1 to a mammal in need of such treatment. 23. A method according to claim 22, in which the condition is mediated by a neuronal nicotinic acetylcholine receptor. 24. A method according to claim 22, in which the condition is selected from the group consisting of stroke, pain, epilepsy, nicotine addiction, schizophrenia, Parkinson's disease, small cell lung carcinoma and Alzheimer's disease. 25. A method according to claim 22, in which the condition includes neurogenic or neuropathic pain. 26. A method of treating or preventing pain, comprising the step of administering an effective amount of a peptide according to claim 1 to a mammal in need of such treatment. 27. A method according to claim 26, in which the pain is of a type or due to a condition selected from the group consisting of cancer pain, post-surgical pain, oral or dental pain, referred trigeminal neuralgia, post-herpetic neuralgia, phantom limb pain, fibromyalgia, and reflex sympathetic dystrophy. 28. A method according to claim 26, in which the pain is associated with an inflammatory condition. 29. A method of accelerating recovery from nerve injury, comprising the step of administering an effective amount of a peptide according to claim 1 to a mammal in need of such treatment. 30. A method according to claim 28 wherein the inflammatory condition is associated with rheumatoid arthritis, another inflammatory arthritis, or degenerative arthritis. 31. A peptide according to claim 1 wherein Xaa1 is G or D, Xaa2 is D, Xaa3 is P or Hyp, Xaa4 is R, Xaa5 is N, Xaa6 is Y, Xaa7 is D, Xaa8 is H, Xaa9 is P or Hyp, Xaa1 0 is D, E or γ-carboxyglutamate, and Xaa11 is I. 32. A peptide according to claim 10 which has 16 amino acid residues s arranged according to the formula: Xaa-Cys-Cys-(Xaa)4-Cys-(Xaa)7-Cys, where the subscripted integer refers to the number of repeats of an Xaa amino acid. 33. A peptide according to claim 1 which includes one or more amino acids which are derivatized with groups characteristic of natural post-translationally modified amino acids. 34. A peptide according to claim 33, in which the derivatized amino acid is hydroxyproline or γ-carboxyglutamate |
<SOH> BACKGROUND OF THE INVENTION <EOH>All references, including any patents or patent applications, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. The discussion of the references states what their authors assert, and the applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art, in Australia or in any other country. Predatory marine snails of the genus Conus (cone snails) are a highly diverse family of marine molluscs which capture their prey by envenomation (Screenivasan, 2002). The venom of a typical cone snail is a complex mixture comprising about one hundred different peptides, which target different ion channels and receptors and interfere with their function, resulting in immobilisation of the prey (Olivera et al, 1990; Olivera and Cruz, 2001). The mixture of peptides present depends on the species of cone snail and the prey on which it feeds, and may vary with time even in individual molluscs (Lewis et al 1994; Jones et al 1996; Bingham et al 1996). Classes of peptides found in Conus venoms include the α-, αA- and Ψ-conotoxins (antagonists at nicotinic acetylcholine receptors), μ-, μO-conotoxins (antagonists at voltage-gated sodium ion channels), δ-conotoxins (agonists, which inhibit inactivation at voltage-sensitive sodium channels), ω-conotoxins (antagonists at voltage-sensitive calcium channels), κ- and κA-conotoxins (antagonists at potassium channels), σ-conotoxins (inhibitors of 5 HT receptors), χ-conotoxins (inhibitors of noradrenaline uptake), conantokins and conodynes (antagonists at NMDA receptors), ρ-conotoxins (inhibitors of the α1-adrenoceptors), conorfamides (Maillo et al., 2001), and contulakins (inhibitors of neurotensin receptors). For review see Jones and Bulaj, 2000; McIntosh and Jones, 2001). The α-conotoxins are typically found in cone snails which prey on fish or on marine snails or marine worms. They are typically 12-19 amino acids in length, and have four cysteine residues which form two disulfide bonds, forming a two-loop structure (McIntosh et al, 1999). They are characterised by an ability to inhibit the nicotinic acetylcholine receptor (nAChR). nAChRs are ligand-gated ion channels which consist of five subunits arranged around a cation-conducting pore (Sargent 1993; Lukas et al 1999; Karlin, 2002). There are two main classes of nAChRs: 1) the neuronal type; and 2) the muscle type. Neuronal type nAChRs are present both pre- and post-synaptically in the central and peripheral nervous systems, while the muscle type nAChRs are found post-synaptically at skeletal neuromuscular junctions (Wonnacott 1997). The main difference between these receptors is their subunit composition. The neuronal type receptors are formed from the combination of α and β subunits or a subunits alone, while the muscle type receptors are composed of α, β, γ and ε (or δ) subunits. The functional receptors have different combinations of subunits (see Karlin, 2002), and have a range of pharmacological properties (see Albuquerque et al., 1997; Lukas et al 1999 for review). Specific α-conotoxins display different affinity and selectivity for muscle and neuronal nAChRs and their subtypes. Compounds of the α-conotoxin class may be useful in the treatment of disorders which involve the neuronal nAChR. The neuronal nAChR has been implicated in the pathophysiology of Alzheimer's disease (Guan et al, 2000), Parkinson's disease (Aubert et al, 1992), schizophrenia (Mukherjee et al, 1994), small cell lung carcinoma (Codignola et al, 1996) nicotine addiction (U.S. Pat. No. 5,780,433, U.S. Pat. No. 5,866,682), pain (Marubio et al 1999), and as neuromuscular blocking agents, such as muscle relaxants (U.S. Pat. No. 6,268,473 and U.S. Pat. No. 6,277,825) and in certain forms of epilepsy (Steinlein et al 1995). Conotoxins of another class, the ω-conotoxin class, have provided lead compounds for stroke and for pain. ω-conotoxin MVIIA (Neurex SNX-111, Warner-Lambert CI-1009, or Elan's Ziconotide) and ω-conotoxin CVID (AMRAD AM336) are presently undergoing clinical trials for the treatment of manifestations of stroke (Zhao et al 1994; Heading, 1999; Shen et al 2000; Jones and Bulaj, 2000) and for chronic pain (Bowersox et al 1996; 1997; Jain, 2000; Jones and Bulaj, 2000). These compounds target N-type calcium channels in nerves. However, the members of the ω-conotoxin class still have undesirable side effects in some patients (Penn and Paice, 2000), and the US Food and Drug Administration has requested a repeat of the Stage III clinical trials for Ziconotide (re-named Prialt™ by Elan) for treatment of cancer pain. Yet another class of conopeptide, the conantokins, having 10-30 amino acids, including preferably two or more γ-carboxyglutamic acid residues, have been developed for the treatment of neurological and psychiatric disorders, including pain, e.g., as an analgesic agent (U.S. Pat. No. 6,277,825). In addition, a novel class of conopeptide, whose target receptor is yet to be defined (McIntosh et al 2000), has been shown to have analgesic activity in the mouse. We have recently found that a specific amino acid at position 10 (Leu 10 ) of α-conotoxin PnIB is responsible for conferring potency for the neuronal-type nicotinic response (Broxton et al 2000). We have also found that splice variants of the α-conotoxins PnIA and PnIB from Conus pennaceus show improved selectivity for α7 subunits of nAChRs (U.S. patent application Ser. No. 09/639,565; see also Hogg et al, 1999; Broxton et al, 2000). We have now found that a previously unexamined Conus species, Conus victoriae , which is found along the north-western coast of Australia, has novel α-conotoxins with unexpectedly powerful analgesic activity. Surprisingly, the ability of one particular α-conotoxin (Vc1.1) to inhibit sensory nerve function, and consequently its analgesic activity, is even higher than that of ω-conotoxin MVIIA (ziconotide, Prialt™) from Conus magus . In addition, we have found that a post-translational modification of this peptide lacks analgesic activity but retains the ability of the parent compound to accelerate recovery from nerve injury. We have also identified two other new α-conotoxins, conotoxin An1.1 from Conus anemone and conotoxin Vg1.1 from Conus virgo , which have similar sequences to Vc1.1, and have similar pharmacological actions. |
<SOH> SUMMARY OF THE INVENTION <EOH>In a first aspect, the present invention provides an isolated α-conotoxin peptide comprising the following sequence of amino acids: Xaa 1 CCSXaa 2 Xaa 3 Xaa 4 CXaa 5 Xaa 6 Xaa 7 Xaa 8 Xaa 9 Xaa 10 Xaa 11 C—NH 2 (SEQ ID NO:11), in which Xaa 1 is G or D; Xaa 3 is proline, hydroxyproline or glutamine; each of Xaa 2 to Xaa 8 and Xaa 11 is independently any amino acid; Xaa 9 is proline, hydroxyproline or glutamine; Xaa 10 is aspartate, glutamate or γ-carboxyglutamate; Xaa 11 is optionally absent; and the C-terminus is optionally amidated, with the proviso that the peptide is not α-conotoxin EpI or α-conotoxin ImI. Preferably Xaa 2 is D, H or N; Xaa 4 is A, P or R; Xaa 5 is N, A or Y; Xaa 6 is A, Y, H, M or V; Xaa 7 is N or D; Xaa 8 is H or N; and Xaa 11 is I or Y. More preferably the peptide comprises the following sequence of amino acids: Xaa 1 C C S Xaa 2 Xaa 3 Xaa 4 C Xaa 5 Xaa 6 Xaa 7 Xaa 8 Xaa 9 Xaa 10 Xaa 11 C—NH 2 (SEQ ID NO:10) in which Xaa 1 is G or D; Xaa 2 is D, H or N; Xaa 3 is P or 4-Hyp, Xaa 4 is A, P or R; Xaa 5 is N, A or Y; Xaa 6 is A, Y, H, M or V; Xaa 7 is N or D; Xaa 8 is H or N; Xaa 9 is proline, hydroxyproline or glutamine; Xaa 10 is aspartate, glutamate or γ-carboxyglutamate; Xaa 11 is I or Y; and the C-terminus is amidated. Even more preferably Xaa 1 is G or D, Xaa 3 is R, Xaa 4 is N, Xaa 5 is Y, Xaa 6 is D, Xaa 7 is H, and Xaa 10 is I. Most preferably the peptide comprises the following sequence of amino acids: GCCSDXaa 1 RCNyDHXaa 2 Xaa 3 IC [SEQ ID NO.1] in which Xaa 1 is proline, hydroxyproline or glutamine; Xaa 2 is proline or hydroxyproline; Xaa 3 is aspartate, glutamate or γ-carboxyglutamate, and the C-terminus is optionally amidated. More preferably Xaa 1 is proline; Xaa 2 is proline and Xaa 3 is glutamate. The C terminus may be amidated, or may contain a free carboxylic acid group. Preferably the C terminus is amidated. The peptide of the invention preferably has one or more of the following abilities: (a) to inhibit a neuronal nicotinic acetylcholine receptor (nAChR), or (b) to act as an analgesic in mammals, or (c) to accelerate recovery from nerve injury. Preferably also the peptide does not affect muscle-type nicotinic responses in rats. In particularly preferred embodiments, the peptide comprises the sequence set out in any one of GCCSDPRCNYDHPEIC-NH 2 (SEQ ID NO:2) GCCSD4-HypRCNYDHPgammacarboxy- GluIC-NH 2 (SEQ ID NO:7) DCCSNPPCAHNNPDC-NH 2 ; (SEQ ID NO:8) and GCCSHPACYANNQDYC-NH 2 (SEQ ID NO:9) in each of which the C-terminal cysteine is amidated. It will be clearly understood that the peptide may be isolated from a mollusc of the genus Conus , or may be synthetic or recombinant. One or more L-amino acids present in the naturally-occurring sequence may be replaced by its corresponding D-amino acid. Preferably the peptide is synthetic, and may be prepared by methods known in the art, for example by conventional solid-phase peptide synthesis using BOC or fMOC methods. Where the peptide is isolated from a mollusc of the genus Conus , the Conus is preferably Conus victoriae, Conus anemone or Conus virgo. It will also be clearly understood that all isomers of the peptide, including all disulfide connectivity forms (see Price-Carter et al 2002) are within the scope of the invention. The four cysteine residues in the peptide are oxidized to provide two intramolecular disulfide bonds. Since this reaction proceeds spontaneously, the reduced form is a source of the active form. This linking of cysteine residues via disulfide bonds may occur in three alternative ways: first to second, first to third or first to fourth cysteine, followed by linking of the two remaining cysteines in each case (see Gehrmann et al 1998). Other possible sulphydryl linkings are those known to produce active peptide at the neuronal nicotinic receptor, such as the 4:6 link in α-conotoxin AuIB from Conus aulicus (Luo et al 1998), or the 4:3 loop found in α-conotoxin Im1 from Conus imperialis (McIntosh et al, 1994). Preferably the peptide has four cysteine residues in a CC—(X) 4 —C—(X) 7 —(C), or so-called 4:7 loop, framework in which the linking of the cysteine residues via disulfide bonds occurs with the first to third and second to fourth cysteine. Amino acid deletions give rise to smaller loops, which may also provide active peptides, for example, the 4:6 loop α-conotoxin AuIB from Conus aulicus. The peptide bonds of the primary sequence would normally be of a trans geometry, but one or more peptide bonds may assume a cis geometry. Furthermore, the disulfide bonds themselves are chiral, and the particular geometry assumed by each disulfide bond allows up to four forms as a result of this source of isomerism (Lin et al., 1999). All of these forms are within the scope of the invention. Some interconversion between the various isomers is feasible under physiological conditions, so that any isomer may be a source of the active form; the invention includes within its scope all fully reduced forms, all partially oxidized forms and all oxidized forms encompassed by the types of isomerism described above. The invention also encompasses amino acid sequence variants of the specific sequences disclosed herein, including sequences which have undergone one or more amino acid substitutions, additions, deletions or side chain modifications, provided that the peptide retains the ability to inhibit the activity of a nAChR, which is preferably a neuronal nAChR, to prevent pain, and/or to accelerate recovery from nerve injury. Such substitutions may have a different effect on activity. For example, we have found that γ-carboxylation of glutamate results in significant reduction in analgesic activity, but does not affect the ability of the peptide to accelerate recovery from nerve injury. Other derivatives contemplated by the invention include glycosylation variants, ranging from a completely unglycosylated molecule to a modified glycosylated molecule. Altered glycosylation patterns may result from expression of recombinant molecules in different host cells. In one preferred embodiment, the C-terminal glycine of the precursor peptide (see FIG. 1 ) is removed and replaced by amidation of the C-terminal cysteine in the synthesized peptide, to imitate the C-terminus of known active α-conotoxins. Other specific post-translational modifications (PTMs) include hydroxylation of proline (eg. to give 4-hydroxy proline in Vc1.1ptm) and γ-carboxylation of the glutamate (see Bandyopadhyay et al., 2002), both of which we have engineered with Vc1.1ptm: (SEQ ID NO:7) GCCSD4 -HypRCNYDHPgammacarboxy-GluIC-NH 2 in which the C-terminus cysteine is amidated. Still other PTMs which are known in conopeptides include 5-bromotryptophan for tryptophan, O-sulfated tyrosine for tyrosine, pyroglutamate for glutamate at the N-terminus (as in κA-conotoxin SIVA and μ-conotoxin PIIIA), threonine-O-gal(Nac)-Gal for threonine and D-tryptophan for tryptophan, and those described in International patent application No. WO00/44769. In a preferred embodiment, the α-conotoxin peptide has the following sequence: GCCSDPRCNYDHPEIC-NH 2 [SEQ ID NO: 2] This preferred peptide is designated Vc1.1. The peptides of the invention may be naturally-occurring conopeptides, or may be derivatives of such naturally-occurring peptides. The derivatives of the naturally-occurring conopeptides may differ from their naturally occurring counterparts by one or more amino acid substitutions, deletions or additions, as described below. Substitutions encompass amino acid alterations in which an amino acid is replaced with a different naturally-occurring or a non-conventional amino acid residue. Such substitutions may be classified as “conservative”, in which case an amino acid residue contained in a peptide is replaced with another naturally-occurring amino acid of similar character, for example Gly to Ala, Asp to Glu, Asn to Gln or Trp to Tyr. Possible alternative amino acids include serine or threonine, aspartate or glutamate or carboxyglutamate, proline or hydroxyproline, arginine or lysine, asparagine or histidine, histidine or asparagine, tyrosine or phenylalanine or tryptophan, aspartate or glutamate, isoleucine or leucine or valine. It is to be understood that some non-conventional amino acids may also be suitable replacements for the naturally occurring amino acids. Substitutions encompassed by the present invention may also be “non-conservative”, in which an amino acid residue which is present in a polypeptide is substituted with an amino acid having different properties, such as naturally-occurring amino acid from a different group (eg. substituting a charged or hydrophilic or hydrophobic amino acid with alanine), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid. Additions encompass the addition of one or more naturally occurring or non-conventional amino acid residues. Deletions encompass the deletion of one or more amino acid residues. Without wishing to limit the scope of the invention, it is presently believed that the cysteine residues and 3 to 4 consensus amino acids are likely to be essential to the biological activity of the molecule, and therefore the scope of substitution at these points may be limited, as discussed further below. It is to be clearly understood that the invention also encompasses peptide analogues, which include but are not limited to the following: 1. Compounds in which one or more amino acids is replaced by its corresponding D-amino acid. The skilled person will be aware that retro-inverso amino acid sequences can be synthesised by standard methods; see for example Chorev and Goodman, 1993; 2. Peptidomimetic compounds, in which the peptide bond is replaced by a structure more resistant to metabolic degradation. See for example Olson et al, 1993; and 3. Compounds in which individual amino acids are replaced by analogous structures for example, gem-diaminoalkyl groups or alkylmalonyl groups, with or without modified termini or alkyl, acyl or amine substitutions to modify their charge. The use of such alternative structures can provide significantly longer half-life in the body, since they are more resistant to breakdown under physiological conditions. Methods for combinatorial synthesis of peptide analogues and for screening of peptides and peptide analogues are well known in the art (see for example Gallop et al, 1994; Hogan, 1997). The peptides or peptidomimetics of the invention may be synthesised using standard solid phase techniques, such as Fmoc or BOC chemistry, followed by oxidative disulfide bond formation. Methods for the synthesis of conotoxins are known in the art; see for example Loughnan et al (1998), Groebe et al (1997), Favreau et al (1999), Miranda and Alewood, 1999. Following deprotection and cleavage from the solid support the reduced peptides may be purified using methods known in the art, such as preparative chromatography. The peptide of the invention may also be prepared using recombinant DNA technology. A nucleotide sequence encoding the peptide sequence may be inserted into a suitable vector and protein expressed in an appropriate expression system. In some instances, further chemical modification of the expressed peptide may be appropriate, for example C-terminal amidation. Under some circumstances it may be desirable to undertake oxidative bond formation of the expressed peptide as a chemical step following peptide expression. This may be preceded by a reductive step to provide the unfolded peptide. Those skilled in the art will readily be able to determine appropriate conditions for the reduction and oxidation of the peptide. Thus in a second aspect, the invention further provides an isolated or synthetic nucleic acid molecule comprising: the nucleotide sequence set out in SEQ ID NO: 3 and FIG. 1 : (SEQ ID NO: 3) ATGGGCATGCGGATGATGTT CACCGTGTTTCTGTTGGTTGTCTTGGCAAC CACTGTCGTTTCCTCCACTTCAGGTCGTCGTGAATTTCGTGGCAGGAATG CCGCAGCCAAAGCGTCTGACCTGGTCAGTTTGACCGACAAGAAGCGAGGA TGCTGTAGTGATCCTCGCTGTAACTATGATCATCCAGAAATTTGTGGTTG AAGACGCTGATGCTCCACGACCCTCTGAACCACGACACGCCGCCCTCTGC C TGACCTGCTTCACTTTCCG ; (b) a nucleotide sequence complementary to that defined in (a); or (c) a nucleotide sequence able to hybridize to the sequence defined in either (a) or (b) under at least moderately stringent conditions. (d) a nucleic acid molecule which has at least 75% sequence identity to (a). More preferably in (c) the nucleic acid molecule is able to hybridise under stringent conditions to the molecule of (a). More preferably in (d) the nucleic acid molecule has at least about 75%, preferably at least 80%, even more preferably at least 90% sequence identity to the molecule of (a). “Stringent conditions” for hybridization or annealing of nucleic acid molecules are those that (1) employ low ionic strength and high temperature for washing, for example 0.015 M NaCl/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate (SDS) at 50□C, or (2) employ during hybridization a denaturing agent such as formamide, for example 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42° C. Another example is use of 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5× Denhardt's solution, sonicated salmon sperm DNA (50 μg/mL), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC and 0.1% SDS. Preferably the nucleic acid encodes peptide Vc1.1. The nucleic acid molecules of the invention may be DNA or RNA. When the nucleic acid molecule is a DNA, it may be genomic DNA or cDNA. When the nucleic acid molecule is RNA, it is generally an mRNA. The nucleic acid molecules of the present invention may be integrated into or ligated to, or otherwise fused or associated with, other genetic molecules such as vectors, in particular expression vectors. Vectors and expression vectors are generally capable of replication and, if applicable, expression in one or both of a prokaryotic cell or a eukaryotic cell. Preferred prokaryotic cells include E. coli, Bacillus sp and Pseudomonas sp. Preferred eukaryotic cells include yeast, fungal, plant, mammalian and insect cells. Preferred bacterial expression systems (reviewed by Baneyx, 1999), which provide the special needs of the peptides referred to above, would include (1) strains of Escherichia coli coexpressing DnaK - DnaL or GroEL - GroES chaperones (Nichihara et al 1998; Castanie et al 1997; Thomas and Baneyx, 1996) to aid folding; (2) strains that express disuphide isomerases and disulphide oxidoreductases to aid disulphide-bond formation (Qiu et al 1998); and (3) strains that express peptidyl prolyl cis/trans isomerases (Hottenrott et al 1997, Stoller et al 1995) to catalyse trans to cis isomerisation of prolyl residues. In a third aspect the invention provides a probe for detection of nucleic acid encoding Vc1.1, comprising at least 15, preferably at least 20, more preferably at least 30 consecutive nucleotides from the sequence set out in SEQ ID NO:3. Preferably the probe has the sequence set out in SEQ ID NO: 5 or SEQ ID NO: 6. In a fourth aspect, the invention provides a genetic construct comprising a vector portion and a nucleic acid encoding a peptide according to the invention. Preferably the nucleic acid is operably linked to a promoter on the vector, so that the promoter is capable of directing expression of the nucleic acid in an appropriate cell. In a fifth aspect, the invention provides a composition comprising a peptide according to the invention, together with a physiologically acceptable carrier. In one preferred embodiment, the carrier is a pharmaceutically acceptable carrier, and the composition is suitable for administration to a mammalian subject. In a second preferred embodiment, the carrier is suitable for use in tissue cultures or in experimental tests of nicotinic acetylcholine receptor function. It is contemplated that the peptide of the invention is suitable both for pharmaceutical use and as a research reagent in assessment of nicotinic acetylcholine receptor function and other physiological parameters. In particular, the peptide is useful in modulating a particular subset of sensory neurones (small unmyelinated C fibres) which represents the first order neurone in the pain-conducting pathway for investigating the role of these receptors. In a sixth aspect, the invention provides a method of treatment of a condition mediated by a nAChR, comprising the step of administering an effective amount of a peptide of the invention to a mammal in need of such treatment. Preferably the condition is mediated by a neuronal nAChR. More preferably the condition is selected from the group consisting of stroke, pain, epilepsy, nicotine addiction, schizophrenia, Parkinson's disease, small cell lung carcinoma and Alzheimer's disease. An extended list of such conditions is given in U.S. Pat. No. 6,265,541. Most preferably the condition is pain, which may result from any condition associated with neurogenic or neuropathic pain, including but not limited to cancer pain, post-surgical pain, oral or dental pain, referred trigeminal neuralgia, post-herpetic neuralgia, phantom limb pain, fibromyalgia, reflex sympathetic dystrophy and neurogenic pain conditions, including pain associated with inflammatory conditions such as rheumatoid arthritis and other inflammatory arthritides; or degenerative arthritis, e.g. osteoarthritis. In a preferred embodiment, the invention further provides a method of treating or preventing pain, comprising the step of administering an effective amount of a peptide of the invention to a mammal in need of such treatment. In a seventh aspect the invention provides a method of accelerating functional recovery from nerve injury, comprising the step of administering an effective amount of a peptide of the invention to a mammal in need of such treatment. The term “functional recovery” is to be understood to mean a return of function to normal. We have found that Vc1.1 and Vc1.1 ptm enhance (or “accelerate”) the rate at which this process occurs, ie functional recovery returns sooner than would otherwise have been the case; a faster return than with saline control or with MVIIA is observed. The mammal may be a human, or may be a domestic or companion animal. While it is particularly contemplated that the compounds of the invention are suitable for use in medical treatment of humans, they are also applicable to veterinary treatment, including treatment of companion animals such as dogs and cats, and domestic animals such as horses, cattle and sheep, or zoo animals such as felids, canids, bovids, and ungulates. The compounds and compositions of the invention may be administered by any suitable route, and the person skilled in the art will readily be able to determine the most suitable route and dose for the condition to be treated. Dosage will be at the discretion of the attendant physician or veterinarian, and will depend on the nature and state of the condition to be treated, the age and general state of health of the subject to be treated, the route of administration, and any previous treatment which may have been administered. The carrier or diluent, and other excipients, will depend on the route of administration, and again the person skilled in the art will readily be able to determine the most suitable formulation for each particular case. Methods and pharmaceutical carriers for preparation of pharmaceutical compositions are well known in the art, as set out in textbooks such as Remington's Pharmaceutical Sciences, 17th Edition, Mack Publishing Company, Easton, Pa., USA. The peptide may be delivered using any suitable delivery means, including oral administration; injection, either subcutaneously, intravenously, intra-arterially, intrathecally, intracerebrally, intramuscularly; or via microencapsulation (see for example U.S. Pat. Nos. 4,352,883; 4,353,888; 5,084,350); macroencapsulation (see for example U.S. Pat. Nos. 5,284,761; 5,158,881, 4,976,859); topical lotions or delivery via a vector or an osmotic pump, or via iontophoretic or electrophoretic means. We have demonstrated that peptide Vc1.1 inhibits the neuronal nAChR, and has analgesic activity. It is not yet known whether the activity of the peptide of the invention is mediated by actual binding of the peptide to the target receptor, or whether it otherwise interferes with receptor activity. However, we have shown that the in vitro actions of the peptide are consistent with a competitive mode of action with nicotinic agonists, and are not mediated via voltage-activated ion channels. Further, the peptide does not inhibit the muscle-type nicotinic acetylcholine responses. For example, Vc1.1 did not inbibit the release of noradrenaline or adrenaline from bovine chromaffin cells in culture when stimulated by 56 mM K + (see FIG. 3 ). Our results, obtained using a rat model to investigate the effect of the compound on sensory nerve activity, indicate that Vc1.1 is more effective than MVIIA in inhibiting sensory nerve activity as demonstrated by a decrease in the inflammatory vascular response, which is dependent on sensory peptide release from sensory nerves (see FIGS. 9 a and b ). Additional results, obtained using a rat model of neuropathic pain, indicate that the peptide of the invention has superior and longer lasting activity than MVIIA and previously-known conopeptides, and is suitable for parenteral administration (see FIGS. 6 and 7 ). Moreover, so far we have not observed any adverse side-effects, and the rats utilised in the experiments were alive 10 months after completion of the treatment. The peptide did not have any effect on resting systemic blood pressure in the rat (see FIG. 15 ). For the purposes of this specification it will be clearly understood that the word “comprising” means “including but not limited to”, and that the word “comprises” has a corresponding meaning. |
Method of Detecting the Expression of Aspergillus Gene |
The present invention provides a method of detecting the expression of a koji mold gene, and a DNA for specifically assaying the fermentation conditions for a koji mold. Specifically, the DNA for specifically assaying the fermentation conditions for a koji mold of the present invention may be characterized in that the DNA can be expressed in a koji mold when the koji mold is cultured under at least one culture condition selected from the group consisting of nutrient-rich culture, nutrient-deficient culture, solid culture, early germination culture, alkaline culture, high temperature culture and low temperature culture conditions. |
1. A DNA (a) or (b) as shown below: (a) a DNA comprising a nucleotide sequence represented by any one of SEQ ID NOS: 1 to 6006; and (b) a DNA hybridizing under stringent conditions to the DNA comprising the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 6006, which can be expressed in filamentous fungi when the filamentous fungi are cultured under at least one culture condition selected from the group consisting of a nutrient-rich culture, nutrient-deficient culture, solid culture, early germination culture, alkaline culture, high temperature culture, low temperature culture and maltose culture conditions. 2. A DNA that can be expressed in filamentous fungi when filamentous fungi are cultured under at least one culture condition selected from the group consisting of a nutrient-rich culture, nutrient-deficient culture, solid culture, early germination culture, alkaline culture, high temperature culture, low temperature culture and maltose culture conditions. 3. The DNA of claim 2 comprising a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 1st row of Table 1, which can be expressed in filamentous fungi when the filamentous fungi are cultured under a nutrient-rich culture condition. 4. The DNA of claim 2 comprising a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 2nd row of Table 1, which can be expressed in filamentous fungi when the filamentous fungi are cultured under a nutrient-deficient culture condition. 5. The DNA of claim 2 comprising a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 3rd row of Table 1, which can be expressed in filamentous fungi when the filamentous fungi are cultured under a solid culture condition. 6. The DNA of claim 2 comprising a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 4th row of Table 1, which can be expressed in filamentous fungi when the filamentous fungi are cultured under an early germination culture condition. 7. The DNA of claim 2 comprising a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 5th row of Table 1, which can be expressed in filamentous fungi when the filamentous fungi are cultured under an alkaline culture condition. 8. The DNA of claim 2 comprising a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 6th row of Table 1, which can be expressed in filamentous fungi when the filamentous fungi are cultured under a high temperature culture condition. 9. The DNA of claim 2 comprising a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 7th row of Table 1, which can be expressed in filamentous fungi when the filamentous fungi are cultured under a low temperature culture condition. 10. The DNA of claim 2 comprising a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 8th row of Table 1, which can be expressed in filamentous fungi when the filamentous fungi are cultured under a maltose culture condition. 11. The DNA of any one of claims 1 to 10, wherein the filamentous fungi are microorganisms belonging to the genus Aspergillus, the genus Penicillium, the genus Humicola, the genus Trichoderma, the genus Mucor or the genus Fusarium. 12. The DNA of claim 11, wherein the microorganism belonging to the genus Aspergillus is a koji mold. 13. The DNA of claim 12, wherein the koji mold is Aspergillus oryzae. 14. A primer set of at least two primers for amplifying a filamentous fungus gene, wherein the two primers are selected from the group consisting of nucleotide sequences prepared from the whole or the partial regions of a plurality of DNAs selected from the DNAs of claims 1 to 10. 15. A probe for detecting a filamentous fungus gene, comprising a nucleotide sequence prepared from the whole or the partial regions of a plurality of DNAs selected from the DNAs of claims 1 to 10. 16. A method of detecting filamentous fungi, comprising synthesizing cDNA from RNA extracted from filamentous fungi, amplifying the cDNA using the primer set of claim 14, and detecting a filamentous fungus gene from the obtained amplification product. 17. A method of detecting filamentous fungi, comprising hybridizing the probe of claim 15 to RNA extracted from filamentous fungi and detecting a filamentous fungus gene from the obtained product. 18. A method of estimating the growth states or the fermentation function of filamentous fungi using the results obtained by the detection method of claim 16 or 17 as an indicator. 19. The method of any one of claims 16 to 18, wherein the filamentous fungi are microorganisms belonging to the genus Aspergillus, the genus Penicillium, the genus Humicola, the genus Trichoderma, the genus Mucor or the genus Fusarium. 20. The method of claim 19, wherein the microorganism belonging to the genus Aspergillus is a koji mold. 21. The method of claim 20, wherein the koji mold is Aspergillus oryzae. |
<SOH> BACKGROUND ART <EOH>In fermentation production using a koji mold, it is important to monitor in detail the growth states and the expression of various fermentation functions (or genes) and the like of a koji mold. Furthermore, the processes of fermentation production do not always rely exclusively on the function of a sole strain of microorganisms, but may employ a plurality of different strains of microorganisms that are evolutionarily related each other. In addition, the fermentation production processes are passively contaminated with these microorganisms from the natural environment without artificially inoculating these microorganisms. These microorganisms to be contaminated are essential in many cases for fermentation production, and their contamination is originally expected. Thus, there are many cases where contamination itself cannot be prevented. In the meantime, in the natural environment, a number of microorganisms unfavorable for fermentation production are present, of which are biological species that are a very closely related evolutionarily to a koji mold. Accordingly in fermentation production, it is necessary to precisely assay the above items only for a koji mold from among many other microbial species that are difficult to be discriminated from a koji mold. In the past, there was no method for directly monitoring these items. Observation by engineers (technical experts) using visual inspection or olfactory inspection via odor, or the like, or observation based on componential analysis or the like of organic acids, esters and the like in products have been performed, and then growth states and the expression of the fermentation functions have been inferred based on past experiences. However, these observations are nonobjective and indirect, so that the results of these observations are difficult to quantify. Thus, it has often been difficult to apply automation and laborsaving measures to be applied to these cases. |
<SOH> SUMMARY OF THE INVENTION <EOH>The purpose of the present invention is to provide a method of detecting the expression of a koji mold gene, and a DNA for specifically assaying the fermentation conditions for a koji mold. As a result of intensive studies to solve the above problems, we have succeeded in detecting the growth state and the fermentation degree of a koji mold using many koji mold genes, and thus completed the present invention. That is, the present invention relates to the following DNA (a) or (b): (a) a DNA comprising a nucleotide sequence represented by any one of SEQ ID NOS: 1 to 6006; and (b) a DNA hybridizing under stringent conditions to the DNA comprising the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 6006, which can be expressed in filamentous fungi when the filamentous fungi are cultured under at least one culture condition selected from the group consisting of a nutrient-rich culture, nutrient-deficient culture, solid culture, early germination culture, alkaline culture, high temperature culture, low temperature culture and maltose culture conditions. Furthermore, the present invention is a DNA that can be expressed in a koji mold when the koji mold is cultured under at least one culture condition selected from the group consisting of a nutrient-rich culture, nutrient-deficient culture, solid culture, early germination culture, alkaline culture, high temperature culture, low temperature culture and maltose culture conditions. The above DNA can be expressed when a koji mold is cultured under at least one culture condition selected from the group consisting of the nutrient-rich culture, nutrient-deficient culture, solid culture, early germination culture, alkaline culture, high temperature culture, low temperature culture and maltose culture conditions. Examples of such DNAs are as follows: (a) a DNA that can be expressed in a koji mold when the koji mold is cultured under a nutrient-rich culture condition and comprises a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 1st row of Table 1; (b) a DNA that can be expressed in a koji mold when the koji mold is cultured under a nutrient-deficient culture condition and comprises a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 2nd row of Table 1; (c) a DNA that can be expressed in a koji mold when the koji mold is cultured under a solid culture condition and comprises a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 3rd row of Table 1; (d) a DNA that can be expressed in a koji mold when the koji mold is cultured under an early germination culture condition and comprises a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 4th row of Table 1; (e) a DNA that can be expressed in a koji mold when the koji mold is cultured under an alkaline culture condition and comprises a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 5th row of Table 1; (f) a DNA that can be expressed in a koji mold when the koji mold is cultured under a high temperature culture condition and comprises a nucleotide sequence represented by any one of SEQ ID NOS. shown in the 6th row of Table 1; (g) a DNA that can be expressed in a koji mold when the koji mold is cultured under a low temperature culture condition and comprises a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 7th row of Table 1; and (h) a DNA that can be expressed in a koji mold when the koji mold is cultured under a maltose culture condition and comprises a nucleotide sequence represented by any one of the SEQ ID NOS. shown in the 8th row of Table 1. Furthermore, the present invention is a primer set of at least two primers for amplifying a koji mold gene, wherein the two primers are selected from the group consisting of nucleotide sequences prepared from the whole or partial regions of a plurality of DNAs selected from the above DNAs. Furthermore, the present invention is a probe for detecting a filamentous fungus gene, which comprises a nucleotide sequence prepared from the whole or partial regions of a plurality of DNAs selected from the above DNAs. Furthermore, the present invention is a method of detecting filamentous fungi, comprising synthesizing cDNA from RNA extracted from filamentous fungi, amplifying the cDNA using the above primer set, and detecting a filamentous fungus gene from the obtained amplification product. Furthermore, the present invention is a method of detecting filamentous fungi, comprising hybridizing the above probe to RNA extracted from filamentous fungi, and detecting a filamentous fungus gene from the obtained product. Furthermore, the present invention is a method of estimating the growth states or the fermentation function of filamentous fungi using the results obtained by the above detection method as an indicator. Examples of filamentous fungi include microorganisms belonging to the genus Aspergillus, the genus Penicillium, the genus Humicola, the genus Trichoderma, the genus Mucor or the genus Fusarium. In addition, an example of a microorganism belonging to the genus Aspergillus is a koji mold (for example, Aspergillus oryzae ). The present invention will be described in detail as follows. 1. Introduction The present invention is intended to solve the above problems using the nucleotide sequences of many koji mold genes. Specifically, by the use of a number of hybridization probes or PCR primers having the nucleotide sequences according to the present invention, the amount of a koji mold DNA and the expression amount of koji mold genes can be precisely measured. This makes it possible to directly and precisely measure the growth state or the expression of the fermentation function of a koji mold among many other microbial species present in the fermentation production processes. The present invention include almost all the nucleotide sequences of genes expressed under various representative fermentation production conditions, by which, for example, the expression of the fermentation function of a koji mold during the fermentation production processes can be monitored in detail. Even if microorganisms that are different from those being evolutionarily closely related to a koji mold is present in the fermentation production processes, more precise assay can be performed by analysis using the nucleotide sequences of a large number of genes than when assaying with a smaller number of genes. With this method, not only is it possible to realize automation and laborsaving that have been extremely difficult to achieve thus for, but also improvement of the reliability of fermentation production and standardization of fermentation production can be achieved. Thus, a large decrease in the production costs can be realized. A koji mold is extensively used in the fermentation industry. In the present invention, culture conditions are determined in detail to improve the production efficiency. A koji mold-derived DNA is cloned, and then the nucleotide sequence thereof is used for designing and producing a probe for the hybridization or primers for PCR, in order to monitor in detail the fermentation state of a koji mold. 2. Cloning of a Koji Mold-Derived DNA A koji mold-derived mRNA can be prepared by techniques that are generally employed. For example, products resulting from fermentation by a koji mold is treated with guanidium thiocyanate, phenol reagent or the like to obtain total RNA. Then, poly (A+) RNA (mRNA) is obtained by the affinity column method or the batch method using poly U-sepharose or the like with oligo dT-cellulose or sepharose 2B as a carrier. After a single-stranded cDNA is synthesized using the thus obtained mRNA as a template, oligo dT primers and reverse transcriptase, a double-stranded cDNA is synthesized from the single-stranded cDNA. The thus obtained double-stranded cDNA is incorporated into appropriate cloning vectors to construct recombinant vectors. Escherichia coli or the like is transformed with the obtained recombinant vectors, and then transformants are selected for tetracycline resistance and ampicillin resistance as markers, so that cDNA libraries can be obtained. Here, Escherichia coli can be transformed by, for example, a method wherein recombinant vectors are added to competent cells prepared by allowing co-existence with calcium chloride, magnesium chloride or rubidium chloride. When a plasmid is used as a vector, it is required to contain a drug resistance gene, such as a tetracycline resistance gene or an ampicillin resistance gene. In addition, cloning vectors other than plasmids, such as a λ phage, can also be used. The nucleotide sequences of the obtained clones are determined. The nucleotide sequence can be determined by any known method, such as the Maxam-Gilbert's chemical modification method or the dideoxynucleotide-chain termination method using the M13 phage. In general, sequencing is performed using an autosequencer (for example, the Autosequencer (model ABI 377) manufactured by Applied Biosystem). The all obtained nucleotide sequences are represented by SEQ ID NOS: 1 to 6006. In addition to those having the nucleotide sequences of SEQ ID NOS: 1 to 6006, the DNAs of the present invention also encompass DNAs that hybridize under stringent conditions to the DNAs having the nucleotide sequences of SEQ ID NOS: 1 to 6006, and are (a) DNAs which can be expressed in filamentous fungi when the filamentous fungi are cultured under at least one culture condition selected from the group consisting of a nutrient-rich culture, nutrient-deficient culture, solid culture, early germination culture, alkaline culture, high temperature culture, low temperature culture, and maltose culture conditions, or (b) DNAs which encode proteins having functions identical to those of the expression products of the DNAs. The term “stringent conditions” means conditions wherein specific hybrids are formed, but non-specific hybrids are not formed. Under an example of such conditions, DNA having high homology (of 60% or more and preferably 80% or more) hybridizes. A more specific example of the conditions consists of a sodium concentration of 150 to 900 mM, preferably 600 to 900 mM, and temperature of 60 to 68° C. Moreover, the DNAs of the present invention differ in their expression modes depending on the culture conditions. To show the relationship between culture conditions and DNAs to be expressed, and specifically, which DNA is expressed under which culture condition, culture conditions and SEQ ID NOS. are summarized in Table 1. TABLE 1 DNA expressed under each culture condition (SEQ ID NO:) 4th row 7th row 1st row 2nd row early 5th row 6th row low 8th row nutrient-rich nutrient-deficient germination alkaline high temperature Maltose culture culture 3rd row culture culture temperature culture culture SEQ ID SEQ ID solid culture SEQ ID SEQ ID culture SEQ ID SEQ ID NO: NO: SEQ ID NO: NO: NO: SEQ ID NO: NO: NO: 1 502 459 1270 459 2086 2604 3112 3626 4132 818 75 1791 5366 321 12 2 503 740 1271 741 2087 2605 3113 3627 4133 824 80 1820 5368 627 59 3 504 741 1272 742 2088 2606 3114 3628 4134 842 115 2055 5369 748 311 4 506 742 1273 745 2089 2607 3115 3629 4135 892 159 2292 5371 781 368 5 508 743 1274 773 2090 2609 3116 3630 4136 901 287 2317 5373 875 435 6 509 744 1275 781 2091 2610 3117 3631 4137 906 510 2514 5374 901 556 7 512 745 1277 782 2092 2611 3118 3632 4138 994 511 2536 5375 943 639 8 513 746 1278 788 2093 2612 3119 3633 4139 996 516 3112 5376 986 745 9 514 747 1279 796 2094 2613 3120 3634 4140 1004 523 4795 5378 1042 835 10 515 748 1280 800 2095 2615 3121 3635 4141 1025 669 4796 5379 1134 858 11 517 749 1281 802 2096 2616 3122 3636 4142 1032 670 4797 5380 1139 875 13 518 750 1282 806 2097 2617 3123 3637 4143 1042 671 4798 5381 1189 953 14 519 751 1283 818 2098 2618 3124 3638 4144 1048 672 4799 5382 1200 994 15 520 752 1284 840 2099 2619 3125 3639 4145 1066 673 4800 5383 1234 998 16 521 753 1285 841 2101 2620 3126 3640 4146 1078 674 4801 5384 1239 1012 17 522 754 1286 869 2103 2621 3127 3641 4147 1129 677 4802 5385 1261 1025 18 524 755 1287 874 2104 2623 3128 3642 4148 1139 678 4803 5387 1313 1065 19 525 756 1288 875 2105 2624 3129 3643 4149 1203 679 4804 5388 1373 1084 20 526 757 1289 877 2106 2625 3130 3644 4150 1304 683 4805 5389 1385 1119 21 527 758 1290 900 2108 2627 3131 3645 4151 1358 687 4806 5390 1389 1179 22 528 759 1292 901 2109 2628 3132 3646 4152 1483 688 4807 5391 1396 1275 23 529 760 1293 906 2110 2629 3133 3647 4153 1538 707 4808 5392 1398 1371 24 530 762 1294 907 2111 2630 3134 3648 4154 1559 718 4809 5393 1416 1377 25 531 763 1295 912 2112 2631 3135 3649 4155 1580 727 4810 5394 1423 1392 26 532 764 1296 921 2113 2633 3136 3651 4156 1645 828 4811 5397 1465 1393 27 533 765 1297 928 2114 2634 3137 3652 4157 1795 875 4812 5398 1466 1398 28 534 766 1298 929 2115 2635 3138 3653 4158 1796 883 4814 5399 1467 1401 29 535 767 1299 931 2116 2636 3139 3655 4159 1825 919 4815 5400 1468 1411 30 536 768 1300 935 2117 2637 3140 3656 4160 1887 1056 4816 5401 1469 1423 31 537 769 1302 947 2118 2638 3141 3657 4161 1933 1093 4817 5402 1470 1449 32 538 770 1303 951 2119 2639 3142 3658 4162 1939 1096 4818 5403 1471 1466 33 539 771 1304 967 2121 2640 3143 3659 4163 1947 1121 4819 5404 1472 1500 34 540 772 1305 980 2122 2641 3144 3660 4164 2054 1223 4820 5405 1473 1506 35 541 773 1306 981 2123 2642 3145 3661 4165 2065 1240 4821 5406 1474 1515 36 542 774 1307 982 2124 2644 3146 3662 4166 2102 1250 4822 5407 1475 1550 37 543 776 1308 986 2125 2646 3147 3663 4167 2136 1273 4823 5408 1476 1551 38 544 777 1310 994 2126 2647 3148 3664 4168 2153 1319 4824 5412 1477 1567 39 545 778 1311 995 2127 2648 3149 3665 4169 2182 1365 4825 5413 1478 1683 40 546 779 1312 1002 2128 2649 3150 3666 4170 2208 1406 4827 5414 1479 1694 41 547 780 1313 1006 2130 2650 3151 3667 4171 2268 1419 4828 5415 1480 1897 42 548 781 1314 1029 2131 2651 3152 3668 4173 2284 1423 4829 5416 1481 1926 43 549 782 1315 1032 2132 2653 3155 3669 4174 2403 1529 4830 5417 1482 2008 44 550 783 1316 1037 2133 2654 3156 3670 4175 2436 1629 4831 5418 1483 2033 45 551 784 1317 1039 2134 2655 3157 3671 4176 2507 1786 4832 5420 1485 2179 46 552 785 1318 1048 2135 2656 3158 3672 4177 2547 1825 4833 5421 1486 2226 47 553 787 1319 1053 2136 2657 3159 3673 4178 2548 1843 4834 5423 1487 2281 48 554 788 1320 1064 2137 2658 3160 3675 4179 2555 1863 4836 5425 1488 2291 49 555 789 1321 1069 2138 2659 3161 3676 4180 2583 1895 4837 5426 1489 2428 50 557 790 1322 1089 2140 2660 3162 3677 4181 2646 1904 4838 5427 1490 2489 51 558 791 1323 1093 2141 2661 3163 3678 4182 2722 1910 4839 5428 1491 2523 52 559 792 1324 1094 2142 2662 3164 3679 4183 2724 1925 4840 5429 1492 2586 53 560 793 1325 1097 2143 2663 3165 3680 4184 2729 1943 4841 5430 1493 2642 54 561 794 1326 1102 2144 2664 3166 3681 4185 2786 1947 4842 5432 1494 2740 55 562 795 1327 1112 2145 2665 3167 3682 4262 2811 2065 4843 5433 1495 2746 57 563 796 1328 1120 2146 2666 3168 3683 4294 2852 2115 4844 5434 1496 2783 58 564 797 1329 1124 2147 2667 3169 3684 4326 2906 2136 4845 5435 1498 2801 60 565 798 1331 1128 2148 2668 3170 3685 4798 2910 2148 4846 5436 1499 2817 61 566 799 1332 1139 2149 2669 3171 3686 4801 2912 2173 4848 5437 1500 2819 62 567 800 1334 1142 2150 2670 3173 3687 4802 2980 2250 4850 5438 1501 2849 63 568 801 1335 1171 2151 2671 3174 3688 4806 3002 2295 4851 5439 1502 2867 64 569 802 1336 1189 2152 2672 3175 3689 4808 3022 2407 4852 5440 1503 2873 65 570 803 1338 1194 2153 2673 3176 3690 4811 3104 2479 4853 5441 1504 2937 66 571 804 1339 1199 2154 2674 3177 3691 4821 3139 2574 4854 5442 1505 2941 67 572 806 1340 1201 2156 2675 3178 3692 4825 3232 2596 4855 5443 1506 2970 68 573 807 1341 1203 2157 2676 3179 3693 4834 3241 2602 4856 5444 1507 3001 69 574 808 1342 1212 2158 2677 3180 3694 4836 3375 2622 4857 5445 1508 3015 70 575 809 1343 1216 2159 2678 3181 3695 4843 3388 2676 4858 5446 1509 3022 71 576 810 1344 1219 2160 2679 3182 3696 4847 3427 2684 4861 5447 1510 3143 72 577 811 1346 1228 2161 2680 3183 3697 4848 3512 2739 4862 5448 1511 3310 73 578 812 1347 1234 2163 2681 3184 3698 4850 3669 2782 4863 5449 1512 3367 74 580 814 1348 1237 2164 2682 3185 3699 4864 3683 2788 4864 5450 1513 3376 76 581 815 1349 1238 2165 2683 3186 3700 4867 3695 2836 4866 5452 1514 3480 77 582 817 1350 1239 2167 2685 3187 3701 4878 3798 2932 4867 5453 1515 3512 78 583 818 1351 1244 2168 2686 3188 3702 4887 3807 2947 4868 5454 1516 3522 79 584 819 1352 1248 2169 2687 3189 3703 4889 3819 3073 4869 5455 1517 3531 81 585 821 1354 1261 2170 2688 3191 3704 4890 3847 3172 4870 5456 1518 3622 82 586 822 1355 1267 2171 2689 3192 3705 4894 3862 3183 4871 5458 1519 3665 83 587 823 1356 1281 2172 2690 3193 3706 4897 3982 3194 4872 5459 1520 3694 84 588 824 1358 1292 2174 2691 3196 3707 4905 4116 3220 4876 5460 1521 3697 85 589 825 1359 1298 2175 2692 3197 3708 4914 4158 3237 4877 5461 1522 3727 86 590 826 1360 1308 2176 2693 3198 3709 4919 4186 3307 4878 5462 1523 3769 87 591 827 1361 1317 2177 2694 3199 3710 4933 4187 3434 4879 5464 1524 3783 88 592 829 1362 1319 2178 2696 3200 3711 4937 4188 3437 4880 5465 1525 3793 89 593 830 1363 1334 2179 2697 3201 3712 4940 4189 3512 4881 5466 1526 3817 90 594 831 1364 1346 2180 2698 3202 3713 4947 4190 3590 4882 5468 1527 3839 91 595 832 1366 1352 2181 2699 3203 3714 4950 4191 3602 4883 5469 1528 3857 92 597 833 1367 1364 2182 2700 3204 3715 4953 4192 3610 4884 5470 1529 3862 93 598 834 1368 1367 2183 2701 3205 3716 4954 4193 3803 4885 5471 1530 3912 94 599 835 1369 1369 2184 2702 3206 3717 4968 4194 3996 4887 5472 1532 3914 95 600 836 1370 1384 2185 2703 3207 3718 4969 4195 4047 4888 5473 1533 3942 96 601 837 1371 1388 2186 2704 3208 3719 4973 4196 4100 4889 5475 1534 3950 97 602 838 1372 1390 2187 2705 3210 3720 4975 4197 4101 4890 5477 1535 3994 98 603 840 1373 1408 2188 2706 3211 3721 4987 4198 4646 4891 5478 1536 4028 99 604 841 1375 1410 2189 2707 3212 3722 4992 4199 4813 4892 5479 1537 4066 100 605 842 1376 1413 2190 2708 3213 3723 4993 4200 4847 4893 5480 1538 4303 101 606 844 1377 1415 2191 2709 3214 3724 4998 4201 4873 4894 5482 1539 4326 102 607 845 1378 1423 2192 2710 3215 3725 5003 4202 4875 4895 5483 1540 4329 103 608 846 1379 1467 2193 2711 3216 3726 5005 4203 4950 4896 5484 1541 4384 104 609 847 1380 1478 2194 2712 3218 3727 5009 4204 4996 4897 5485 1542 4503 105 610 848 1381 1483 2195 2713 3219 3728 5010 4205 5014 4898 5486 1543 4504 106 611 849 1382 1494 2196 2714 3220 3729 5014 4206 5035 4899 5487 1544 4505 107 612 852 1383 1500 2197 2715 3221 3730 5021 4207 5037 4900 5488 1545 4506 108 613 853 1384 1503 2199 2716 3222 3731 5026 4208 5087 4902 5489 1546 4507 109 614 854 1385 1508 2200 2717 3223 3732 5040 4209 5113 4904 5490 1547 4508 110 615 855 1386 1515 2202 2718 3225 3733 5043 4210 5138 4905 5492 1548 4509 111 616 856 1387 1527 2203 2719 3226 3734 5048 4211 5140 4906 5493 1549 4510 112 617 857 1388 1533 2204 2720 3227 3735 5056 4212 5141 4907 5494 1550 4511 113 618 858 1389 1535 2205 2721 3228 3736 5064 4213 5178 4908 5496 1551 4512 114 619 859 1390 1542 2206 2722 3229 3737 5066 4214 5181 4909 5497 1552 4513 116 620 860 1391 1550 2207 2723 3230 3738 5071 4215 5304 4910 5498 1553 4514 117 621 861 1392 1552 2208 2724 3231 3739 5073 4216 5323 4911 5499 1554 4515 118 622 862 1393 1559 2209 2725 3232 3740 5075 4217 5346 4913 5500 1555 4516 119 624 863 1394 1565 2210 2726 3233 3741 5077 4218 5349 4914 5501 1556 4517 120 625 864 1395 1576 2211 2727 3234 3742 5080 4219 5350 4915 5502 1557 4518 121 626 865 1396 1579 2212 2728 3235 3743 5083 4220 5354 4916 5503 1558 4519 122 628 866 1397 1580 2213 2729 3236 3744 5087 4221 5362 4917 5504 1559 4520 123 630 867 1398 1581 2214 2730 3237 3745 5088 4222 5587 4918 5505 1560 4521 124 631 868 1399 1589 2215 2731 3238 3746 5092 4223 5597 4919 5506 1561 4522 125 632 869 1400 1604 2216 2732 3239 3747 5093 4224 5645 4920 5507 1562 4523 126 633 870 1402 1615 2217 2733 3240 3748 5097 4225 5668 4921 5508 1563 4524 127 634 871 1403 1624 2218 2734 3241 3749 5099 4226 5716 4922 5509 1564 4525 128 635 872 1404 1629 2219 2735 3242 3750 5102 4227 5717 4923 5511 1565 4526 129 636 873 1405 1644 2220 2736 3243 3751 5103 4228 5718 4924 5512 1566 4527 130 637 874 1407 1645 2221 2737 3244 3752 5112 4229 5719 4925 5513 1567 4528 131 647 875 1408 1646 2222 2738 3245 3753 5113 4230 5720 4926 5514 1568 4529 132 648 876 1409 1651 2223 2739 3246 3754 5115 4231 5721 4927 5515 1569 4530 133 649 877 1410 1652 2224 2740 3248 3755 5119 4232 5722 4928 5517 1570 4531 134 650 878 1411 1665 2225 2741 3249 3756 5124 4233 5723 4929 5518 1571 4532 135 651 879 1412 1693 2226 2742 3250 3757 5127 4234 5724 4930 5519 1572 4533 136 652 880 1413 1696 2227 2743 3251 3758 5128 4235 5725 4931 5520 1574 4534 137 653 881 1414 1716 2228 2744 3252 3759 5129 4236 5726 4932 5521 1575 4535 138 654 882 1415 1717 2229 2745 3254 3760 5143 4237 5727 4933 5522 1576 4536 139 655 884 1416 1718 2230 2746 3255 3761 5148 4238 5728 4934 5523 1577 4537 140 656 886 1417 1719 2231 2747 3256 3762 5164 4239 5729 4935 5524 1578 4538 142 657 887 1418 1720 2232 2748 3257 3763 5165 4240 5730 4936 5525 1579 4539 143 658 888 1419 1721 2233 2749 3258 3764 5168 4241 5731 4937 5526 1580 4540 144 659 889 1420 1722 2234 2750 3259 3765 5179 4242 5732 4938 5527 1581 4541 145 660 890 1421 1723 2235 2751 3260 3766 5190 4243 5733 4939 5528 1582 4542 146 661 891 1422 1724 2236 2752 3261 3767 5192 4244 5734 4940 5529 1583 4543 147 662 892 1423 1725 2237 2753 3262 3768 5196 4245 5735 4943 5530 1584 4544 148 663 893 1424 1726 2239 2755 3263 3769 5197 4246 5736 4945 5531 1585 4545 149 664 894 1425 1727 2240 2756 3264 3770 5198 4247 5737 4946 5532 1586 4546 150 665 895 1426 1728 2241 2757 3265 3771 5203 4248 5738 4947 5533 1587 4547 151 666 896 1427 1729 2242 2758 3266 3772 5208 4249 5739 4950 5534 1588 4548 152 667 897 1428 1730 2243 2759 3267 3773 5214 4250 5740 4951 5535 1589 4549 153 668 898 1429 1731 2244 2760 3268 3774 5218 4251 5741 4953 5536 1590 4550 154 638 899 1430 1732 2245 2761 3269 3775 5224 4252 5742 4954 5537 1591 4551 155 640 900 1431 1733 2246 2762 3270 3776 5228 4253 5743 4955 5538 1592 4552 156 641 901 1432 1734 2247 2763 3271 3777 5231 4254 5744 4956 5539 1593 4553 157 642 903 1433 1735 2248 2764 3272 3778 5244 4255 5745 4957 5540 1594 4554 158 643 904 1434 1736 2249 2765 3273 3779 5246 4256 5746 4959 5541 1595 4555 160 644 905 1435 1737 2250 2766 3274 3780 5247 4257 5747 4960 5542 1596 4556 161 645 906 1436 1738 2251 2767 3275 3781 5251 4258 5748 4961 5543 1597 4557 162 646 907 1437 1739 2253 2768 3276 3782 5270 4259 5749 4963 5544 1598 4558 163 675 909 1438 1740 2254 2769 3277 3783 5272 4260 5750 4966 5545 1599 4559 164 676 910 1439 1742 2255 2770 3279 3784 5277 4261 5751 4967 5546 1600 4560 165 680 911 1440 1743 2256 2771 3280 3785 5281 4262 5752 4968 5547 1601 4561 166 681 912 1441 1744 2257 2772 3281 3786 5291 4263 5753 4969 5548 1602 4562 167 682 914 1442 1745 2258 2773 3282 3787 5293 4264 5754 4971 5549 1603 4563 168 684 915 1443 1746 2259 2774 3283 3788 5294 4265 5755 4972 5551 1604 4564 169 685 916 1444 1747 2260 2775 3285 3789 5310 4266 5756 4973 5552 1605 4565 170 686 917 1445 1748 2261 2776 3286 3790 5316 4267 5757 4974 5554 1606 4566 171 689 918 1446 1749 2262 2777 3287 3791 5318 4268 5758 4975 5555 1607 4567 172 690 919 1447 1750 2263 2778 3288 3792 5329 4269 5759 4976 5556 1608 4568 173 691 920 1448 1751 2264 2779 3289 3793 5335 4270 5760 4977 5557 1609 4569 174 692 921 1449 1752 2265 2780 3290 3794 5337 4271 5761 4978 5558 1610 4570 175 693 922 1450 1753 2266 2781 3291 3795 5341 4272 5762 4979 5560 1611 4571 176 694 926 1451 1754 2267 2783 3292 3796 5344 4273 5763 4981 5561 1612 4572 177 695 927 1452 1755 2268 2784 3293 3797 5346 4274 5764 4982 5562 1613 4573 178 696 928 1453 1757 2269 2785 3294 3798 5348 4275 5765 4985 5563 1614 4574 179 697 929 1454 1758 2270 2786 3295 3799 5350 4276 5766 4986 5564 1615 4575 180 698 930 1455 1759 2271 2787 3296 3800 5357 4277 5767 4987 5565 1616 4576 181 699 931 1456 1760 2273 2788 3297 3801 5366 4278 5768 4989 5566 1617 4577 182 700 932 1457 1761 2274 2789 3298 3802 5374 4279 5769 4992 5567 1618 4578 183 701 933 1458 1762 2275 2790 3299 3803 5382 4280 5770 4993 5568 1619 4579 184 702 934 1459 1763 2276 2791 3300 3804 5383 4281 5771 4994 5569 1620 4580 185 703 935 1460 1764 2277 2793 3301 3805 5390 4282 5772 4995 5570 1621 4581 186 704 936 1461 1765 2278 2794 3302 3806 5393 4283 5773 4998 5571 1622 4582 187 705 937 1462 1766 2279 2795 3303 3807 5403 4284 5774 4999 5572 1623 4583 188 706 938 1463 1767 2280 2796 3304 3809 5406 4285 5775 5000 5573 1624 4584 189 708 939 1464 1768 2281 2797 3305 3810 5408 4286 5776 5001 5574 1625 4585 190 709 940 1500 1769 2282 2798 3306 3811 5416 4287 5777 5002 5575 1626 4586 191 710 941 1535 1770 2283 2799 3308 3812 5417 4288 5778 5003 5576 1628 4587 192 711 942 1559 1771 2284 2800 3309 3813 5433 4289 5779 5004 5577 1629 4588 193 712 943 1565 1772 2285 2801 3310 3814 5435 4290 5780 5005 5578 1630 4589 194 713 944 1576 1773 2286 2802 3311 3815 5436 4291 5781 5007 5580 1632 4590 195 714 945 1622 1774 2287 2803 3312 3816 5438 4292 5782 5008 5581 1633 4591 196 715 946 1624 1775 2288 2804 3313 3819 5439 4293 5783 5009 5582 1634 4592 197 716 947 1645 1776 2290 2805 3314 3820 5440 4294 5784 5010 5583 1635 4593 198 717 948 1651 1777 2291 2806 3315 3821 5443 4295 5785 5011 5584 1636 4594 199 719 949 1709 1778 2292 2808 3316 3822 5444 4296 5787 5012 5588 1637 4595 200 720 950 1721 1779 2293 2809 3317 3823 5445 4297 5788 5015 5589 1639 4596 201 721 951 1764 1780 2294 2810 3318 3825 5449 4298 5789 5017 5590 1640 4597 202 722 952 1792 1781 2295 2811 3319 3826 5450 4299 5790 5018 5591 1641 4598 203 723 953 1795 1782 2296 2812 3320 3827 5453 4300 5791 5019 5592 1642 4599 204 724 954 1827 1783 2297 2813 3321 3828 5458 4301 5792 5020 5593 1643 4600 205 725 955 1875 1784 2298 2814 3322 3829 5464 4302 5793 5021 5594 1644 4601 206 726 956 1880 1785 2299 2815 3323 3831 5471 4303 5794 5022 5595 1645 4602 207 728 957 1925 1786 2300 2816 3324 3832 5472 4304 5795 5025 5596 1646 4603 208 729 958 1926 1787 2301 2817 3325 3833 5478 4305 5796 5026 5599 1647 4604 209 730 959 2039 1788 2302 2818 3326 3834 5479 4306 5797 5027 5600 1648 4605 210 731 960 2103 1789 2303 2819 3327 3835 5488 4307 5798 5028 5601 1649 4606 211 732 962 2115 1790 2304 2820 3329 3836 5489 4308 5799 5029 5602 1650 4607 212 733 963 2206 1791 2305 2821 3330 3837 5498 4309 5800 5030 5603 1651 4608 213 734 964 2221 1792 2306 2822 3331 3838 5499 4310 5801 5031 5604 1652 4609 214 735 965 2231 1793 2307 2823 3332 3839 5500 4311 5802 5032 5605 1653 4610 215 736 966 2233 1794 2308 2824 3333 3840 5504 4312 5803 5033 5606 1654 4611 216 737 967 2305 1795 2309 2825 3334 3841 5513 4313 5804 5034 5608 1655 4612 217 738 968 2307 1796 2310 2826 3335 3842 5514 4314 5805 5036 5610 1656 4613 218 739 969 2323 1797 2311 2828 3338 3843 5519 4315 5806 5038 5611 1657 4614 219 761 971 2329 1798 2312 2829 3339 3844 5525 4316 5807 5039 5612 1658 4615 220 775 972 2344 1799 2313 2830 3340 3845 5526 4317 5808 5040 5613 1659 4616 221 805 973 2365 1800 2314 2831 3341 3846 5529 4318 5809 5041 5614 1660 4617 222 813 974 2375 1801 2315 2832 3342 3847 5544 4319 5810 5042 5615 1661 4618 223 816 975 2422 1803 2316 2833 3343 3848 5549 4320 5811 5043 5617 1662 4619 224 820 977 2424 1804 2317 2834 3344 3849 5551 4321 5812 5044 5618 1663 4620 225 839 978 2443 1805 2318 2835 3345 3850 5562 4322 5813 5046 5619 1664 4621 226 843 979 2449 1806 2319 2837 3346 3851 5563 4323 5814 5047 5620 1665 4622 227 850 980 2453 1807 2320 2838 3347 3852 5564 4324 5815 5048 5624 1666 4623 229 851 981 2455 1808 2321 2839 3348 3853 5570 4325 5816 5049 5626 1667 4624 230 885 982 2456 1809 2322 2840 3349 3854 5573 4326 5817 5050 5627 1668 4625 231 902 983 2461 1810 2323 2841 3350 3855 5576 4327 5818 5051 5628 1669 4626 232 908 984 2492 1811 2324 2842 3351 3856 5582 4328 5819 5052 5629 1670 4627 233 913 985 2505 1812 2326 2843 3352 3857 5590 4329 5820 5054 5630 1671 4628 234 923 986 2512 1813 2327 2844 3353 3858 5602 4330 5821 5055 5631 1672 4629 235 924 987 2513 1814 2328 2845 3354 3859 5604 4331 5822 5056 5632 1673 4630 236 925 988 2535 1815 2329 2846 3355 3860 5608 4332 5823 5057 5633 1674 4631 237 961 990 2573 1816 2330 2847 3356 3861 5617 4333 5824 5058 5634 1675 4632 238 976 991 2583 1817 2331 2848 3357 3862 5619 4334 5825 5059 5635 1676 4633 239 989 992 2598 1818 2332 2849 3358 3863 5624 4335 5826 5060 5636 1677 4634 240 1014 993 2638 1819 2333 2850 3359 3864 5628 4336 5827 5063 5637 1678 4635 241 1036 994 2715 1820 2334 2851 3360 3865 5629 4337 5828 5064 5638 1679 4636 242 1050 995 2746 1821 2335 2852 3361 3866 5633 4338 5829 5065 5639 1680 4637 243 1058 996 2753 1822 2336 2853 3362 3867 5635 4339 5830 5066 5640 1681 4638 244 1062 997 2781 1823 2337 2854 3363 3868 5639 4340 5831 5068 5643 1682 4639 245 1077 998 2794 1824 2338 2855 3364 3869 5642 4341 5832 5069 5644 1683 4640 246 1086 999 2810 1825 2340 2856 3365 3870 5645 4342 5833 5071 5646 1684 4641 247 1091 1000 2812 1826 2341 2857 3366 3871 5668 4343 5834 5072 5647 1685 4642 248 1108 1001 2824 1827 2342 2858 3367 3872 5670 4344 5835 5073 5648 1686 4643 249 1146 1002 2837 1828 2343 2859 3368 3874 5671 4345 5836 5075 5649 1687 4644 250 1148 1003 2845 1829 2344 2860 3369 3875 5672 4346 5837 5076 5650 1688 4645 251 1174 1004 2906 1830 2345 2861 3370 3876 5685 4347 5838 5077 5651 1689 4647 252 1178 1005 2986 1831 2346 2862 3371 3877 5694 4348 5839 5078 5652 1690 4648 253 1197 1006 2999 1832 2347 2863 3372 3878 5697 4349 5840 5079 5653 1691 4649 254 1210 1007 3055 1833 2348 2864 3373 3879 5701 4350 5841 5080 5654 1692 4650 255 1211 1008 3109 1834 2349 2865 3374 3880 5703 4351 5842 5081 5655 1693 4651 256 1233 1009 3118 1835 2350 2866 3375 3881 5705 4352 5843 5083 5656 1694 4652 257 1257 1010 3158 1836 2351 2867 3376 3882 5707 4353 5844 5084 5657 1695 4653 258 1259 1011 3165 1837 2352 2868 3377 3883 5708 4354 5845 5088 5658 1696 4654 259 1263 1012 3210 1839 2353 2869 3378 3885 5709 4355 5846 5089 5659 1697 4655 260 1276 1013 3231 1841 2354 2871 3380 3886 5781 4356 5847 5091 5660 1698 4656 261 1291 1015 3239 1842 2356 2872 3382 3887 5838 4357 5848 5092 5661 1699 4657 262 1309 1016 3242 1844 2357 2873 3383 3888 5863 4358 5849 5093 5662 1700 4658 263 1330 1017 3342 1845 2358 2874 3384 3889 4359 5850 5095 5663 1701 4659 264 1333 1018 3346 1846 2359 2875 3385 3890 4360 5851 5097 5664 1702 4660 265 1337 1019 3359 1847 2360 2876 3386 3891 4361 5852 5098 5665 1703 4661 266 1345 1020 3363 1848 2361 2877 3387 3892 4362 5853 5099 5666 1704 4662 267 1353 1021 3371 1849 2362 2878 3388 3893 4363 5854 5100 5667 1705 4663 268 1357 1022 3421 1850 2363 2879 3389 3894 4364 5855 5101 5668 1707 4664 269 1374 1023 3427 1851 2364 2880 3390 3895 4365 5856 5102 5669 1709 4665 270 1484 1024 3447 1852 2365 2881 3391 3897 4366 5857 5103 5671 1710 4666 271 1497 1025 3458 1853 2366 2882 3392 3898 4367 5858 5104 5672 1711 4667 272 1531 1026 3481 1854 2367 2883 3393 3899 4368 5859 5105 5673 1712 4668 273 1573 1027 3498 1855 2368 2884 3394 3900 4369 5860 5106 5674 1713 4669 274 1631 1028 3525 1856 2369 2885 3395 3901 4370 5861 5107 5675 1714 4670 275 1638 1029 3617 1857 2370 2886 3396 3902 4371 5862 5108 5676 1715 4671 276 1706 1030 3622 1858 2371 2887 3397 3903 4372 5863 5110 5677 1843 4672 277 1708 1031 3658 1859 2373 2888 3398 3904 4373 5864 5111 5678 1911 4673 278 1741 1032 3665 1860 2374 2889 3399 3905 4374 5865 5112 5679 1917 4674 279 1756 1033 3745 1861 2375 2890 3401 3906 4375 5866 5113 5680 2020 4675 280 1802 1034 3787 1862 2376 2891 3402 3907 4376 5867 5114 5681 2102 4676 281 1838 1035 3790 1863 2377 2892 3403 3908 4377 5868 5115 5682 2141 4677 282 1840 1037 3796 1864 2378 2894 3404 3909 4378 5869 5117 5683 2257 4678 283 1867 1038 3810 1865 2379 2895 3405 3910 4379 5870 5118 5684 2258 4679 284 1881 1039 3828 1866 2380 2896 3406 3911 4380 5871 5119 5685 2281 4680 285 1909 1040 3835 1868 2381 2897 3407 3912 4381 5872 5121 5686 2305 4681 286 1924 1041 3838 1869 2382 2898 3408 3913 4382 5873 5122 5688 2538 4682 288 1944 1042 3846 1870 2383 2899 3409 3914 4383 5874 5123 5689 2567 4683 290 1995 1043 3888 1871 2384 2900 3410 3915 4384 5875 5124 5690 2638 4684 292 2038 1044 3908 1872 2385 2901 3411 3916 4385 5876 5125 5691 2711 4685 293 2050 1045 3912 1873 2386 2902 3412 3917 4386 5877 5126 5692 2794 4686 294 2100 1046 3929 1874 2387 2903 3413 3918 4387 5878 5127 5694 2835 4687 295 2107 1047 3942 1875 2388 2904 3414 3919 4388 5879 5128 5695 2850 4688 296 2120 1048 3946 1876 2389 2905 3415 3920 4389 5880 5129 5696 2958 4689 297 2129 1049 3949 1877 2391 2906 3416 3922 4390 5881 5131 5697 3063 4690 298 2139 1051 3977 1878 2392 2907 3417 3923 4391 5882 5132 5698 3143 4691 299 2155 1052 3982 1879 2393 2908 3418 3924 4392 5883 5133 5700 3231 4692 300 2162 1053 3987 1880 2394 2909 3419 3925 4393 5884 5135 5701 3375 4693 301 2198 1054 3990 1882 2395 2910 3420 3926 4394 5885 5136 5702 3510 4694 302 2238 1055 3991 1883 2396 2911 3421 3927 4395 5886 5137 5703 3647 4695 303 2252 1057 4021 1884 2397 2912 3422 3929 4396 5887 5139 5704 3685 4696 304 2272 1059 4027 1885 2398 2913 3423 3930 4397 5888 5142 5705 3790 4697 305 2289 1060 4757 1886 2400 2914 3424 3931 4398 5889 5143 5706 3862 4698 306 2325 1061 4821 1887 2401 2915 3425 3932 4399 5890 5144 5707 3873 4699 307 2339 1063 4824 1888 2402 2916 3427 3933 4400 5891 5145 5708 3876 4700 308 2390 1064 4825 1889 2403 2917 3428 3934 4401 5892 5146 5709 3879 4701 309 2399 1065 4832 1890 2404 2918 3429 3935 4402 5893 5147 5710 3935 4702 310 2412 1066 4847 1891 2405 2919 3430 3936 4403 5894 5148 5711 3977 4703 312 2427 1067 4848 1892 2406 2920 3431 3937 4404 5895 5150 5712 3996 4704 313 2442 1068 4864 1893 2408 2921 3432 3938 4405 5896 5151 5713 4007 4705 314 2450 1069 4867 1894 2409 2922 3433 3939 4406 5897 5152 5714 4021 4706 315 2483 1070 4889 1896 2410 2923 3434 3940 4407 5898 5155 4088 4707 316 2487 1071 4894 1897 2411 2924 3435 3941 4408 5899 5156 4807 4708 317 2497 1072 4923 1898 2413 2925 3436 3942 4409 5900 5157 4821 4709 318 2516 1073 4930 1899 2414 2926 3438 3943 4410 5901 5158 4870 4710 319 2522 1074 4940 1900 2415 2927 3439 3944 4411 5902 5159 4904 4711 320 2552 1075 4944 1901 2416 2928 3440 3945 4412 5903 5160 4940 4712 322 2568 1076 4947 1902 2417 2929 3441 3946 4413 5904 5161 4947 4713 323 2599 1078 4953 1903 2418 2930 3442 3948 4414 5905 5164 4998 4714 324 2608 1079 4968 1905 2419 2931 3443 3949 4415 5906 5165 5005 4715 325 2614 1081 4973 1906 2420 2933 3444 3950 4416 5907 5167 5010 4716 326 2626 1082 4977 1907 2421 2934 3445 3952 4417 5908 5168 5027 4717 327 2632 1083 4982 1908 2422 2935 3446 3953 4418 5909 5169 5092 4718 328 2643 1084 4992 1911 2423 2936 3447 3954 4419 5910 5170 5093 4719 329 2645 1085 4998 1912 2424 2937 3448 3955 4420 5911 5171 5112 4720 330 2695 1087 5003 1913 2425 2939 3449 3956 4421 5912 5172 5128 4721 331 2754 1088 5010 1914 2426 2940 3451 3957 4422 5913 5173 5131 4722 332 2792 1089 5017 1915 2428 2941 3452 3958 4423 5914 5174 5143 4723 333 2807 1090 5019 1916 2429 2942 3453 3959 4424 5915 5175 5160 4724 334 2870 1092 5021 1918 2430 2943 3455 3960 4425 5916 5176 5179 4725 335 2893 1093 5026 1919 2431 2944 3456 3961 4426 5917 5177 5181 4726 336 2938 1094 5035 1920 2432 2945 3457 3962 4427 5918 5179 5190 4727 337 2972 1095 5061 1921 2433 2946 3458 3964 4428 5919 5180 5196 4728 338 2975 1096 5064 1922 2434 2948 3459 3965 4429 5920 5181 5203 4729 339 2989 1097 5066 1923 2435 2949 3460 3966 4430 5921 5182 5234 4730 340 3009 1098 5093 1925 2436 2950 3461 3967 4431 5922 5183 5236 4732 341 3053 1099 5096 1926 2437 2951 3462 3968 4432 5923 5184 5259 4733 342 3057 1100 5108 1927 2438 2952 3463 3969 4433 5924 5185 5288 4734 343 3075 1101 5112 1928 2439 2953 3464 3970 4434 5925 5186 5294 4735 344 3153 1102 5113 1929 2440 2954 3465 3971 4435 5926 5188 5310 4736 345 3154 1103 5115 1930 2441 2955 3466 3972 4436 5927 5189 5332 4737 346 3190 1104 5124 1931 2443 2956 3467 3973 4437 5928 5190 5350 4738 347 3195 1105 5126 1932 2444 2957 3468 3974 4438 5929 5191 5375 4739 348 3209 1106 5128 1933 2445 2958 3469 3975 4439 5930 5192 5395 4740 349 3217 1107 5137 1934 2446 2959 3470 3976 4440 5931 5194 5397 4741 350 3224 1109 5141 1935 2447 2960 3471 3977 4441 5932 5195 5420 4743 351 3247 1110 5143 1936 2448 2961 3472 3978 4442 5933 5196 5437 4744 352 3253 1111 5144 1937 2449 2962 3473 3979 4443 5934 5197 5438 4745 353 3278 1112 5154 1938 2451 2963 3474 3980 4444 5935 5198 5448 4746 354 3284 1113 5160 1939 2452 2964 3475 3981 4445 5936 5200 5460 4747 355 3336 1114 5164 1940 2453 2965 3476 3982 4446 5937 5201 5465 4748 356 3337 1115 5168 1941 2454 2966 3477 3983 4447 5938 5202 5471 4749 357 3379 1116 5170 1942 2455 2967 3478 3984 4448 5939 5203 5475 4750 358 3381 1117 5179 1945 2456 2968 3479 3985 4449 5940 5204 5476 4751 359 3400 1118 5188 1946 2457 2969 3480 3986 4450 5941 5207 5489 4752 360 3426 1119 5203 1947 2458 2970 3481 3987 4451 5942 5208 5499 4753 361 3450 1120 5228 1948 2459 2971 3483 3988 4452 5943 5209 5504 4754 362 3454 1122 5229 1949 2460 2973 3484 3989 4453 5944 5210 5528 4755 363 3482 1123 5236 1950 2461 2974 3485 3990 4454 5945 5211 5573 4756 364 3520 1124 5251 1951 2462 2976 3486 3991 4455 5946 5212 5585 4757 365 3521 1125 5253 1952 2463 2977 3487 3992 4456 5947 5213 5617 4758 366 3562 1126 5268 1953 2464 2978 3488 3993 4457 5948 5214 5635 4759 367 3578 1127 5272 1954 2465 2979 3489 3994 4458 5949 5215 5674 4760 369 3583 1128 5275 1955 2466 2980 3490 3995 4459 5950 5216 5685 4761 370 3591 1129 5281 1956 2467 2981 3491 3996 4460 5951 5217 5687 4762 371 3595 1130 5291 1957 2468 2982 3492 3997 4461 5952 5218 5697 4763 372 3650 1131 5294 1958 2469 2983 3493 3998 4462 5953 5219 5708 4764 373 3654 1132 5310 1959 2470 2984 3494 3999 4463 5954 5220 4765 374 3674 1133 5313 1960 2471 2985 3495 4000 4464 5955 5221 4766 375 3808 1134 5316 1961 2472 2986 3496 4002 4465 5956 5222 4767 376 3818 1135 5318 1962 2473 2987 3497 4003 4466 5957 5224 4768 377 3824 1136 5319 1963 2474 2988 3498 4005 4467 5958 5225 4769 378 3830 1137 5325 1964 2475 2990 3499 4006 4468 5959 5228 4770 379 3884 1138 5329 1965 2476 2991 3500 4007 4469 5960 5229 4771 380 3896 1139 5341 1966 2477 2992 3501 4008 4470 5961 5230 4772 381 3921 1140 5346 1967 2478 2993 3502 4009 4471 5962 5231 4773 382 3928 1141 5366 1968 2480 2994 3503 4010 4472 5963 5232 4774 383 3947 1143 5381 1969 2481 2995 3504 4011 4473 5964 5233 4775 384 3951 1144 5394 1970 2482 2996 3505 4013 4474 5965 5234 4776 385 3963 1145 5397 1971 2484 2997 3506 4014 4475 5966 5236 4777 386 4001 1147 5408 1972 2485 2998 3507 4015 4476 5967 5237 4778 387 4004 1149 5416 1973 2486 2999 3508 4017 4477 5968 5238 4779 388 4016 1150 5426 1974 2488 3000 3509 4018 4478 5969 5239 4780 389 4030 1151 5436 1975 2489 3001 3510 4019 4479 5970 5240 4781 390 4048 1152 5437 1976 2490 3002 3511 4020 4480 5971 5242 4782 391 4093 1153 5438 1977 2491 3003 3512 4021 4481 5972 5244 4783 392 4731 1154 5440 1978 2492 3004 3513 4022 4482 5973 5245 4784 393 4742 1155 5443 1979 2493 3005 3514 4023 4483 5974 5246 4785 394 4826 1156 5445 1980 2494 3006 3515 4024 4484 5975 5247 4786 395 4835 1157 5447 1981 2495 3007 3516 4025 4485 5976 5250 4787 396 4859 1158 5460 1982 2496 3008 3517 4026 4486 5977 5251 4788 397 4874 1159 5464 1983 2498 3010 3518 4027 4487 5978 5252 4789 398 4886 1160 5465 1984 2499 3011 3519 4028 4488 5979 5253 4790 399 4901 1161 5472 1985 2500 3012 3522 4029 4489 5980 5254 4791 400 4903 1162 5476 1986 2501 3013 3523 4031 4490 5981 5255 4792 401 4912 1163 5489 1987 2502 3014 3524 4032 4491 5982 5256 4793 402 4941 1164 5490 1988 2503 3015 3525 4033 4492 5983 5258 4794 403 4948 1165 5495 1989 2504 3016 3526 4034 4493 5984 5260 4798 404 4949 1166 5500 1990 2505 3017 3527 4035 4494 5985 5261 4848 406 4952 1167 5504 1991 2506 3018 3528 4036 4495 5986 5262 4850 407 4958 1168 5507 1992 2507 3019 3529 4037 4496 5987 5263 4858 408 4962 1169 5514 1993 2508 3020 3530 4038 4497 5988 5264 4867 409 4965 1170 5523 1994 2509 3021 3531 4039 4498 5989 5265 4872 410 4970 1171 5525 1996 2510 3022 3532 4040 4499 5990 5267 4875 411 4980 1172 5535 1997 2511 3023 3533 4041 4500 5991 5268 4906 412 4984 1173 5539 1998 2512 3024 3534 4042 4501 5992 5269 4907 413 4988 1175 5551 1999 2513 3025 3535 4043 4502 5993 5270 4940 414 4990 1176 5563 2000 2514 3026 3536 4044 4582 5994 5272 4942 415 4997 1177 5569 2001 2515 3027 3537 4045 4806 5995 5273 4944 416 5006 1179 5573 2002 2517 3028 3538 4046 4812 5996 5274 4947 417 5013 1180 5577 2003 2518 3029 3539 4049 4821 5997 5275 4953 418 5016 1181 5580 2004 2519 3030 3540 4050 4825 5998 5276 4972 419 5023 1182 5597 2005 2520 3031 3541 4051 4843 5999 5277 4973 420 5045 1183 5600 2006 2521 3032 3542 4052 4853 6000 5278 4986 421 5053 1184 5603 2007 2523 3033 3543 4053 4875 6001 5280 4991 422 5062 1185 5613 2008 2524 3034 3544 4054 4883 6002 5281 4998 424 5067 1186 5617 2009 2525 3035 3545 4055 4887 6003 5282 5007 425 5070 1187 5628 2010 2526 3036 3546 4056 4906 6004 5283 5010 426 5074 1188 5633 2011 2527 3037 3547 4057 4907 6005 5284 5017 427 5082 1189 5634 2012 2528 3038 3548 4058 4922 6006 5285 5035 428 5085 1190 5635 2013 2529 3039 3549 4059 4937 5286 5056 429 5086 1191 5637 2014 2530 3040 3550 4060 4942 5287 5058 430 5094 1192 5671 2015 2531 3041 3551 4061 4953 5288 5069 432 5109 1193 5685 2016 2532 3042 3552 4062 4961 5289 5071 433 5116 1194 5687 2017 2533 3043 3553 4063 4968 5291 5119 434 5120 1195 5701 2018 2534 3044 3554 4064 4973 5292 5129 436 5130 1196 5703 2019 2535 3045 3555 4065 4977 5293 5143 437 5134 1198 5706 2020 2536 3046 3556 4067 4981 5294 5162 438 5149 1199 5708 2021 2537 3047 3557 4068 5003 5295 5172 439 5153 1200 5709 2022 2539 3048 3558 4069 5010 5296 5186 440 5163 1201 2023 2540 3049 3559 4070 5019 5297 5192 441 5166 1202 2024 2541 3050 3560 4071 5056 5298 5196 442 5193 1203 2025 2542 3051 3561 4072 5073 5299 5208 443 5205 1204 2026 2543 3052 3563 4073 5092 5300 5209 444 5206 1205 2027 2544 3054 3564 4074 5101 5301 5240 445 5223 1206 2028 2545 3055 3565 4075 5102 5302 5253 446 5226 1207 2029 2546 3056 3566 4076 5113 5303 5267 447 5227 1208 2030 2547 3058 3567 4077 5143 5304 5269 448 5235 1209 2031 2548 3059 3568 4078 5173 5306 5275 449 5241 1212 2032 2549 3060 3569 4079 5179 5307 5298 450 5243 1213 2033 2550 3061 3570 4080 5187 5308 5303 451 5248 1214 2034 2551 3062 3571 4081 5198 5310 5304 452 5249 1215 2035 2553 3063 3572 4082 5208 5312 5310 453 5257 1217 2036 2554 3064 3573 4083 5211 5313 5316 454 5266 1218 2037 2555 3065 3574 4084 5229 5314 5344 455 5271 1219 2039 2556 3066 3575 4085 5231 5315 5346 456 5279 1220 2040 2557 3067 3576 4086 5236 5316 5350 457 5305 1221 2041 2558 3068 3577 4087 5259 5317 5381 458 5309 1222 2042 2559 3069 3579 4088 5288 5318 5385 460 5311 1223 2043 2560 3070 3580 4089 5303 5319 5401 461 5327 1224 2044 2561 3071 3581 4090 5322 5320 5406 462 5343 1225 2045 2562 3072 3582 4091 5332 5321 5407 463 5352 1226 2046 2563 3073 3584 4092 5350 5322 5416 464 5364 1227 2047 2564 3074 3585 4094 5354 5323 5418 465 5367 1228 2048 2565 3076 3586 4095 5366 5324 5447 466 5370 1229 2049 2566 3077 3587 4096 5373 5325 5449 467 5377 1230 2051 2567 3078 3588 4097 5375 5326 5450 468 5396 1231 2052 2569 3079 3589 4098 5380 5328 5460 469 5409 1232 2053 2570 3080 3590 4099 5386 5329 5465 470 5410 1234 2054 2571 3081 3592 4100 5390 5330 5466 471 5419 1235 2055 2572 3082 3593 4102 5393 5331 5489 472 5422 1236 2056 2573 3083 3594 4103 5406 5332 5491 473 5424 1237 2057 2574 3084 3596 4104 5417 5333 5495 474 5431 1238 2058 2575 3085 3597 4105 5420 5334 5507 475 5451 1239 2059 2576 3086 3598 4106 5436 5335 5533 476 5457 1241 2060 2577 3087 3599 4107 5441 5336 5563 477 5463 1242 2061 2578 3088 3600 4108 5447 5337 5596 478 5467 1243 2062 2579 3089 3601 4109 5460 5338 5600 479 5474 1244 2063 2580 3090 3603 4110 5476 5339 5628 480 5481 1245 2064 2581 3091 3604 4111 5495 5340 5635 481 5510 1246 2066 2582 3092 3605 4112 5499 5341 5660 483 5516 1247 2067 2583 3093 3606 4113 5500 5342 5671 484 5550 1248 2068 2584 3094 3607 4114 5502 5344 5674 485 5553 1249 2069 2585 3095 3608 4115 5528 5345 5677 486 5559 1251 2070 2586 3096 3609 4116 5563 5346 5689 487 5579 1252 2071 2587 3097 3611 4117 5583 5347 5706 488 5586 1253 2072 2588 3098 3612 4118 5596 5348 489 5607 1254 2073 2589 3099 3613 4119 5597 5350 490 5609 1255 2074 2590 3100 3614 4120 5628 5351 491 5616 1256 2075 2591 3101 3615 4121 5639 5353 492 5621 1258 2076 2592 3102 3616 4122 5655 5354 493 5622 1260 2077 2593 3103 3617 4123 5671 5355 494 5623 1261 2078 2594 3104 3618 4124 5677 5356 495 5641 1262 2079 2595 3105 3619 4125 5685 5357 496 5693 1264 2080 2597 3106 3620 4126 5687 5358 497 5699 1265 2081 2598 3107 3621 4127 5694 5359 498 5786 1266 2082 2600 3108 3622 4128 5710 5360 499 1267 2083 2601 3109 3623 4129 5715 5361 500 1268 2084 2602 3110 3624 4130 5363 501 1269 2085 2603 3111 3625 4131 5365 3. Culture Conditions for Filamentous Fungi The nucleotide sequences of the above DNAs consist of the nucleotide sequences of genes whose expressions are regulated (promoted or suppressed) by one or a combination of the various culture conditions for filamentous fungi. The use of these genes as primers or probes makes it possible to precisely assay in detail the state of the combination of various conditions. In the present invention, examples of various culture conditions include nutrient-rich, nutrient-deficient, solid, early germination, alkaline, high temperature and low temperature culture conditions. Examples of filamentous fungi to be cultured include microorganisms belonging to the genus Aspergillus (including the genus Emericella ), the genus Penicillium, the genus Humicola, the genus Trichoderma, the genus Mucor and the genus Fusarium (see the following genera): the genus Penicillium: all the known species classified into the genus Penicillium; the genus Humicola: all the known species classified into the genus Humicola; the genus Trichoderma: all the known species classified into the genus Trichoderma; the genus Mucor: all the known species classified into the genus Mucor; and the genus Fusarium: all the known species classified into the genus Fusarium. Aspergillus: Aspergillus oryzae, Aspergillus fumigatus, Aspergillus flavus, Aspergillus sojae, Aspergillus paraciticus, Aspergillus niger, Aspergillus awamori, Aspergillus kawachii, Aspergillus nidulans and Emericella nidulans. Further, in the present invention, Aspergillus oryzae is preferably used. Aspergillus oryzae strain RIB40 used for the determination of the nucleotide sequences of the present invention was deposited on Mar. 4, 2002, with the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Chuo-6, 1-1-1 Higashi, Tsukuba, Ibaraki, Japan) under Accession Number: FERM BP-7935. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.