text
stringlengths 0
1.67M
|
|---|
Method for controlling a printer or copier using a toner mark band and reflex sensor working according to the triangulation principle |
A method and device controls a printer or copier to generate a plurality of marks that are assembled into a coherent marking band that is then inked by the toner. A sensor measures the marking band. The printer or copier are controlled based on the output of the sensor. |
1-52. (canceled) 53. A method to control a print or copier, comprising the steps of: storing marking data for toner markings for a character generator in an image control; generating a latent image on an intermediate carrier using the character generator corresponding to the marking data; combining a plurality of markings in the image control into a coherent marking band, each marking having a spatially defined position within the marking band on the intermediate carrier; inking the marking band with toner material; scanning the toner markings of the marking band by at least one sensor; controlling a print process using a signal of the at least one sensor; storing measurement data for a plurality of toner markings; assembling at least one marking band from the plurality of toner markings; and selecting an appropriate marking band dependent on a selected print process. 54. A method according to claim 53, further comprising the step of: defining a single marking band whose toner markings permit a plurality of print processes of a device type to control a printer or copier. 55. A method according to claim 53, further comprising the step of: applying the at least one marking band with the plurality of toner markings to the intermediate carrier in a region that lies within a print image to be printed in order to be able to implement test functions and compensation functions. 56. A method according to claim 53, further comprising the step of: applying the at least one marking band to the intermediate carrier along an edge track outside of a print image to be printed in order to not disturb the print image. 57. A method according to claim 53, further comprising the step of: synchronizing a beginning of the at least one marking band with a beginning of a print side after each print start, a beginning of the marking band coinciding with a beginning of a print side. 58. A method according to claim 53, wherein said at least one marking band comprises a plurality of marking bands, and further comprising the step of: controlling beginnings of successive ones of said plurality of marking bands by the image control independent of pages to be printed. 59. A method according to claim 58, further comprising the steps of: synchronizing each of said plurality of marking bands with a beginning of each print side, a beginning of a respective marking band coincides with a beginning of a respective print side. 60. A method according to claim 53, wherein said at least one marking band comprises a plurality of marking bands, and further comprising the steps of: serially connecting said plurality of marking bands given a greater page length of a print side. 61. A method according to claim 53, further comprising the step of: combining data for print sides and data for marking bands in a transfer of data to the character generator. 62. A method according to claim 53, further comprising the step of: combining data of the marking bands and data for the print sides in the image control before generation of image raster data. 63. A method according to claim 53, wherein an electronic diaphragm control acts on the character generator such that the character generator only generates latent images on the intermediate carrier for predetermined toner markings of a marking band. 64. A method according to claim 63, further comprising the step of: selecting toner markings by the device control depending on a selected print process. 65. A method according to claim 53, further comprising the steps of: providing a plurality of scanning sensors to scan toner markings; signaling a beginning of a marking band via a trigger pulse using a device control; and actively switching respective ones of said plurality of scanning sensors with regard to this trigger pulse to scan predetermined toner markings. 66. A method according to claim 53, providing a band shaped intermediate carrier as said intermediate carrier. 67. A method as claimed in claim 66, wherein said intermediate carrier band is an OPC band. 68. A method according to claim 53, further comprising the steps of: providing two printing units within a device, each of said two printing units having one respective intermediate carrier band; providing a top of a carrier material with a toner image using an intermediate carrier band; providing a bottom of the carrier material with a toner image using the other intermediate carrier band; and applying marking bands with toner markings to each intermediate carrier band. 69. A method according to claim 68, wherein said step of applying the marking bands on both intermediate carrier bands ensues such that two toner markings inked with toner are not simultaneously juxtaposed at the common transfer printing location for both transfer bands. 70. A method according to claim 53, further comprising the step of: selecting a length of the marking band such that it is not an even-number multiple of a length of the intermediate carrier. 71. A method according to claim 53, further comprising the steps of: determining a thickness of the toner layer of the toner marking according to a triangulation method using an optical reflex sensor as a sensor to scan respective toner marking; and controlling the print process dependent on a determined thickness of the toner layer. 72. A method according to claim 71, wherein said optical reflex sensor includes: at least one laser diode that radiates radiation in a direction of the toner marking as a radiation source; and one of a linear detector array and a two-dimensional detector array as a receiver. 73. A method according to claim 72, further comprising the steps of: generating at least one measurement spot using at least one laser diode; and imaging said at least one measuring spot on said detector array via a lens. 74. A method according to claim 73, further comprising the steps of: determining a curve of brightness along the respective measurement spot for each measurement spot; and determining a center of the respective measurement spot dependent on the curve; and determining a thickness of the toner layer dependent on the separation between the centers of the measurement spots. 75. A method according to claim 74, further comprising the step of: using a balance point of the curve of the brightness as a center for the respective measurement spot. 76. A method according to claim 71, further comprising the step of: determining a mass coating with regard to area is determined from the thickness of the toner layer via calibration. 77. A method as claimed in claim 76, wherein said determining step determines the mass coating in grams per unit area of the toner. 78. A method according to claim 71, wherein said reflex sensor includes a color filter on a receiver side via which extraneous light is suppressed. 79. A method as claimed in claim 78, wherein said color filter is a bandpass filter. 80. A method according to claim 72, further comprising the step of: using a controlled power supply for the laser diode; and measuring supplied current such that the signal of the detector array lies within a predetermined range. 81. A method according to claim 72, further comprising the step of: adjusting current for the laser diode such that a signal on a side of the receiver remains constant and independent of the reflection property of at least one of toner marking and the intermediate carrier. 82. A method as claimed in claim 81, wherein said intermediate carrier is a photoconductor surface. 83. A method according to claim 73, further comprising the step of: varying a position of said at least one measurement spot on the toner marking from rotation to rotation of the intermediate carrier. 84. A method according to claim 72, wherein a beam emitted by the laser diode is one of attenuated and interrupted. 85. A method according to claim 84, further comprising the step of: interrupting the beam using a mechanical diaphragm. 86. A method according to claim 84, further comprising the step of: interrupting the beam using a voltage-controlled liquid crystal shutter. 87. A method according to claim 71, further comprising the step of: using a radiation source as the reflex sensor having a radiation wavelength outside of a sensitivity range for the wavelength of the light of said intermediate carrier. 88. A method according to claim 71, wherein said radiation source of the reflex sensor radiates radiation with two different wavelengths. 89. A method according to claim 88, further comprising the steps of: coupling the radiation of two laser diodes in a mutual beam path to generate the radiation of different wavelengths. 90. A method as claimed in claim 89, wherein said step of coupling uses semi-permeable mirrors. 91. A method according to claim 71, further comprising the step of: using a VCSEL radiation source as a radiation source. 92. A method according to claim 71, further comprising the step of: using an individual radiation receiver on the receiver side to which radiation is supplied via a mirror that can be varied with regard to its angle of rotation. 93. A device to control a print or copier, comprising: an intermediate carrier; an image control operable to control storage of marking data for toner markings; a character generator connected to said image control and operable to generate a latent image on said intermediate carrier corresponding to the marking data; said image control being operable to combine a plurality of markings into a coherent marking band, each marking having a spatially defined position within the marking band on the intermediate carrier; an inking apparatus positioned adjacent to said intermediate carrier and operable to ink the latent image with toner material; at least one sensor operable to scan the toner markings of the marking band and connected to provide an output signal to control the print process; and a storage in which measurement data are stored for a plurality of toner markings; said image control being operable to assemble at least one marking band from said plurality of toner markings, an appropriate marking band being selected dependent on a selected print process. 94. A device according to claim 93, wherein a single marking band is defined whose toner markings permit the plurality of print processes of a device type to control a printer or copier. 95. A device according to claim 93, wherein the at least one marking band with the plurality of toner markings is applied to the intermediate carrier in a region that lies within the print image to be printed, in order to be able to implement test functions and compensation functions. 96. A device according to claim 93, wherein the at least one marking band is applied to the intermediate carrier along an edge track outside of the print image to be printed, in order to not disturb the print images. 97. A device according to claim 93, wherein the beginning of the first marking band is synchronized with the beginning of the first print side after each print start, whereby the beginning of the first marking band preferably coincides with the beginning of the first print side. 98. A device according claim 93, wherein the image control administrates the beginnings of the successive marking bands independent of the pages to be printed. 99. A device according to claim 98, wherein each marking band is synchronized with the beginning of each print side, whereby the beginning of the respective marking band preferably coincides with the beginning of the respective print side. 100. A device according to claim 93, wherein a plurality of marking bands are connected serially given the greater page length of a print side. 101. A device according to claim 93, wherein the data for print sides and the data for marking bands are combined in the transfer of the data to the character generator. 102. A device according to claim 93, wherein the data of the marking bands and the data for the print sides are combined in the image control before the generation of the image raster data. 103. A device according to claim 93, further comprising: an electronic diaphragm control acts on the character generator such that the character generator only generates latent images on the intermediate carrier from predetermined toner markings of a marking band. 104. A device according to claim 93, further comprising: a plurality of scanning sensors are provided to scan toner markings; a device control signals the beginning of a marking band via a trigger pulse; and the respective scanning sensor is actively switched with regard to this trigger pulse to scan predetermined toner markings. 105. A device according to claim 93, wherein said intermediate carrier is an intermediate carrier band, preferably an OPC band. 106. A device according to claim 93, further comprising: two printing units, with respectively one intermediate carrier band, are provided within a device, whereby an intermediate carrier band provides the top of a carrier material with a toner image, and the other intermediate carrier band provides the bottom of the carrier material with a toner image, and in which marking bands with toner markings are applied to each intermediate carrier band. 107. A device according to claim 106, in which the application of the marking bands on both intermediate carrier bands ensues such that two toner markings inked with toner are not simultaneously juxtaposed at the common transfer printing location for both transfer bands. 108. A device according to claim 93, wherein the length of the marking band is selected such that it is not an even-number multiple of the length of the intermediate carrier. 109. A device according to claim 93, further comprising: an optical reflex sensor that determines the thickness of the toner layer of the toner marking according to the triangulation method is used as a sensor to scan the respective toner marking, and that the print process is controlled dependent on the determined thickness of the toner layer. |
Growth factor isoform |
An isolated VEGF polypeptide having anti-angiogenic activity, said polypeptide including the amino acid sequence of SEQ. ID NO. 1, or variants thereof. |
1. An isolated VEGF polypeptide having anti-angiogenic activity, said polypeptide including the amino acid sequence of SEQ.ID NO.1, or variants thereof. 2. An isolated VEGF polypeptide having anti-angiogenic activity, said polypeptide having at least 66% identity to the amino acid sequence of SEQ.ID NO.1. 3. An isolated VEGF polypeptide having anti-angiogenic activity, said polypeptide having at least 83% identity to the amino acid sequence of SEQ.ID NO.1. 4. An isolated VEGF polypeptide according to claim 1 wherein said polypeptide is capable of binding to endogenous VEGF and preventing or reducing stimulation of mitosis. 5. An isolated VEGF polypeptide according to claim 1, wherein said polypeptide comprises the amino acid sequence of SEQ. ID NO.3, or variants thereof. 6. An isolated nucleotide sequence capable of encoding a VEGF polypeptide according to claim 1. 7. An isolated nucleotide sequence encoding a VEGF polypeptide having anti-angiogenic activity, the nucleotide sequence comprising the nucleotide sequence of SEQ.ID NO.2, or variants thereof. 8. An isolated nucleotide sequence-encoding a VEGF polypeptide having anti-angiogenic activity, the nucleotide sequence comprising the nucleotide sequence of SEQ.ID NO.4, or variants thereof. 9. An isolated nucleotide sequence comprising a nucleotide sequence that hybridises under stringent conditions to the nucleotide sequence of SEQ.ID.NO:2, or variants thereof. 10. An isolated nucleotide sequence according to claim 6 wherein the nucleotide sequence is selected from the group consisting of unprocessed RNA, ribozyme RNA, hairpin siRNA, siRNA, mRNA, cDNA, genomic DNA, B-DNA, E-DNA and Z-DNA. 11. An isolated polypeptide according to claim 1, derived from a mammalian sequence. 12. An isolated polypeptide sequence or nucleotide sequence according to claim 11 wherein the mammalian sequence is selected from the group consisting of a primate, rodent, bovine sand a porcine sequence. 13. (CANCEL) 14. (CANCEL) 15. (CANCEL) 16. (CANCEL) 17. (CANCEL) 18. (CANCEL) 19. A method for treating or preventing angiogenesis in a mammalian patient comprising supplying to the patient a polypeptide comprising the sequence of a VEGF polypeptide according to claim 1. 20. A method for treating or preventing angiogenesis in a mammalian patient comprising supplying to the patient a polynucleotide comprising a nucleotide sequence according to claim 6. 21. An isolated VEGF polypeptide according to claim 1, wherein said polypeptide is capable of binding endogenous VEGF thereby preventing or reducing VEGF-mediated cell proliferation. 22. A method for preventing or reducing VEGF-mediated cell proliferation in a mammalian patient comprising supplying to the patient a polypeptide comprising the sequence of an isolated VEGF polypeptide according to claim 1. 23. A method for preventing or reducing VEGF-mediated cell proliferation in a mammalian patient comprising supplying to the patient a polynucleotide comprising the sequence of an isolated nucleotide according to claim 6. 24. (CANCEL) 25. A pharmaceutical composition for the prevention or reduction of VEGF-mediated cell proliferation comprising the nucleotide sequence to claim 6 and a pharmaceutically acceptable diluent. 26. An isolated VEGF polypeptide according to claim 1 wherein said polypeptide is capable of binding endogenous VEGF thereby preventing or reducing VEGF165-mediated vasodilatation. 27. A method for preventing or reducing VEGF165-mediated vasodilatation in a mammalian patient comprising supplying to the patient a polypeptide comprising the sequence of a VEGF polypeptide according to claim 26. 28. (CANCEL) 29. (CANCEL) 30. A method for preventing or reducing VEGF165-mediated vasodilatation in a mammalian patient comprising supplying to the patient a polynucleotide comprising the sequence of an isolated nucleotide according to claim 6. 31. (CANCEL) 32. (CANCEL) 33. A pharmaceutical composition comprising a VEGF polypeptide according to claim 1 and a pharmaceutically acceptable diluent. 34. A pharmaceutical composition comprising a nucleotide sequence according to claim 12 and a pharmaceutically acceptable diluent. 35. An expression vector comprising a nucleotide sequence according to claim 6. 36. A host cell comprising an expression vector according to claim 34. 37. (CANCEL) 38. An antibody raised against a polypeptide comprising the sequence of a VEGF polypeptide according to claim 1. 39. An antibody produced against a polynucleotide comprising a nucleotide sequence according to claim 6. 40. An antibody according to claim 38 wherein the antibody is a chimeric antibody. 41. An antibody according to claim 38 wherein the antibody is a humanised antibody. 42. A method of screening compounds to identify an agonist of the anti-angiogenic activity of a polypeptide according to claim 1 wherein said polypeptide and a labelled ligand of said polypeptide are incubated in the presence and absence of a candidate compound, wherein increased anti-angiogenic activity of said peptide in the presence of said candidate compound when compared to the anti-angiogenic activity in the absence of said compound indicates that the candidate compound is an agonist. 43. A method according to claim 42, comprising the steps of: a) incubating the polypeptide and the labeled ligand in the presence and absence of a candidate compound; b) comparing the anti-angiogenic activity of the peptide incubated in the presence of the candidate compound with the anti-angiogenic activity of the peptide incubated in the absence of the candidate compound; wherein increased anti-angiogenic activity of the peptide incubated in the presence of the candidate compound compared with the anti-angiogenic activity of the peptide incubated in the absence of the candidate compound indicates that the candidate compound is an agonist. 44. A method according to claim 43, further comprising the step of synthesising the agonist and incorporating the agonist into a pharmaceutical composition. 45. A method of screening compounds to identify an antagonist of the anti-angiogenic activity of a polypeptide according to claim 1 wherein said polypeptide and a labelled ligand of said polypeptide are. incubated in the presence and absence of a candidate compound, wherein decreased anti-angiogenic activity of said peptide in the presence of said candidate compound when compared to the anti-angiogenic activity in the absence of said compound indicates that the candidate compound is an antagonist. 46. A method according to claim 45, comprising the steps of: a) incubating the polypeptide and the labeled ligand in the presence and absence of a candidate compound; b) comparing the anti-angiogenic activity of the peptide incubated in the presence of the candidate compound with the anti-angiogenic activity of the peptide incubated in the absence of the candidate compound; wherein increased anti-angiogenic activity of the peptide incubated in the presence of the candidate compound compared with the anti-angiogenic activity of the peptide incubated in the absence of the candidate compound indicates that the candidate compound is an antagonist. 47. A method according to claim 46, further comprising the step of synthesising the antagonist and incorporating the antagonist into a pharmaceutical composition. 48. A compound identified by a method according to claim 44. 49. A method for treating a disorder comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of claim 63, wherein the disorder is selected from the group consisting of tumour growth and metastasis, rheumatoid arthritis, atherosclerosis, neointimal hyperplasia, diabetic retinopathy and other complications of diabetes, trachoma, retrolental fibroplasia, neovascular glaucoma, age-related macular degeneration, hemangiomas, immune rejection of transplanted corneal tissue, corneal angiogenesis associated with ocular injury or infection, vascular disease, obesity, psoriasis, arthritis, disease, obesity, psoriasis, arthritis, and gingival hypertrophy. 50. A method for treating pre-eclampsia, comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of claim 63. 51. (CANCEL) 52. A pharmaceutical composition for treating a lack of VEGF165-mediated vasodilatation comprising an inhibitor of a VEGF165b polypeptide according to claim 1. 53. A pharmaceutical composition for treating a lack of VEGF165-mediated vasodilatation comprising an antibody according to claim 38. 54. The pharmaceutical composition according to claim 52 wherein the lack of vasodilatation is associated with pre-eclampsia. 55. A pharmaceutical composition for treating a lack of VEGF165-mediated vasodilatation comprising a polynucleotide having a complementary sequence to a nucleotide sequence according to claim 6. 56. (CANCEL) 57. (CANCEL) 58. A method for preventing or ameliorating a lack of VEGF165-mediated vasodilatation in a mammalian patient comprising supplying to the patient an inhibitor according to claim 52. 59. A method according to claim 58 wherein the lack of vasodilatation is associated with pre-eclampsia. 60. An assay for the specific detection of VEGF165b in a sample comprising carrying out a polymerase chain reaction on at least a portion of the sample, using an annealing temperature of at least 59° C. and the following primer sequences: exon 4 (forward primer): GAGATGAGCTTCCTACAGCAC 9H (reverse primer): TTAAGCTTTCAGTCTTTCCTGGTGAGAGATCTGCA or variants thereof, wherein the variants retain the same annealing properties with respect to the VEG165 nucleotide sequence as the above primers. 61. An assay according to claim 60 wherein the primers are combined with fluorescent detection probes for the detection of VEGF165b using real time PCR protocols. 62. An assay according to claim 61 wherein the real time PCR protocols are selected from the group consisting of Molecular Beacon, FRET, TaqMan, and Scorpion. 63. A pharmaceutical composition comprising the compound of claim 48 and a pharmaceutically acceptable carrier. |
Fusion protein |
The present invention relates to a fusion protein comprising a functional IL-6 molecule and a functional DS-sIL-6R molecule. The present invention also relates to a nucleic acid encoding the fusion protein, methods for producing the fusion protein and the use of the fusion protein in the treatment of infectious diseases and inflammatory and immunological disorders. |
1. A fusion protein comprising a functional IL-6 molecule and a functional DS-sIL-6R molecule, wherein the protein increases the expression of one or more of MIP-1α, MIP-1β, RANTES and IP-10. 2. The fusion protein of claim 1, wherein the functional IL-6 molecule and the functional DS-sIL-6R molecule are linked together by a linker. 3. The fusion protein according to claim 2 wherein the linker comprises the sequence RGGGGSGGGGSVE (SEQ ID NO:15). 4. The fusion protein according to claim 1 wherein the functional IL-6 molecule comprises residues 29 to 212 of FIG. 3 (SEQ ID NO:9, or a functionally equivalent homologue thereof. 5. The fusion protein according to claim 1 wherein the functional IL-6 molecule comprises the sequence given in FIG. 3 (SEQ ID NO:9), or a functionally equivalent homologue thereof. 6. The fusion protein according to claim 1, wherein the functional DS-sIL-6R molecule comprises residues 113 to 364 of FIG. 4 (SEQ ID NO: 10), or a functionally equivalent homologue thereof. 7. The fusion protein according to claim 1, wherein the functional DS-sIL-6R molecule comprises the sequence of FIG. 4 (SEQ ID NO: 10, or a functional equivalent thereof. 8. The fusion protein according to claim 1, comprising one or more functional IL-6 molecules and one or more functional DS-sIL-6R molecules. 9. The fusion protein according to claim 1 which comprises one functional IL-6 molecule and one functional DS-sIL-6R molecule. 10. The fusion protein according to claim 1, wherein the fusion protein increases the expression of MIP-1α, MIP-1β and RANTES. 11. The fusion protein according to claim 1, wherein the fusion protein increases the expression of MIP-1α, MIP-1β, RANTES and IP-10. 12. The fusion protein according to claim 1, wherein the fusion protein increases the expression of MIP-α, MIP-β or RANTES by at least 5 fold. 13. A nucleic acid molecule encoding the fusion protein of clams 1. 14. An expression vector comprising the nucleic acid molecule of claim 13. 15. The vector of claim 14, which comprises a promoter and other regulatory sequences in order to obtain expression of the nucleic acid molecule. 16. A host cell transformed with the vector of claim 14 or claim 15. 17. A method for producing a fusion protein comprising expressing the nucleic acid molecule of claim 13 in a suitable host cell and isolating the protein. 18. The method of claim 17, comprising transforming a host cell with a vector, culturing the host cell under suitable conditions for the production of the fusion protein, and isolating the fusion protein. 19. A screening method for identifying agonists or antagonists of the fusion protein according to claim 1, comprising testing a candidate molecule in order to determine if it affects the function of the fusion protein. 20-22. (Canceled) 23. A method for modulating a signaling pathway in a cellular syste, comprising: delivering the fusion protein according to claim 1 to said cellular system. 24. A pharmaceutical composition comprising the fusion protein according to claim 1 and a pharmaceutically acceptable carrier, diluent or vehicle. 25. A pharmaceutical composition comprising the nucleic acid of claim 13, and a pharmaceutically acceptable carrier, diluent or vehicle. 26-28. (Canceled) 29. A method of treating or preventing an infectious disease comprising administering to an individual in need of such treatment an effective dose of the fusion protein according to claim 1, the nucleic acid according to claim 13, or the expression vector according to claim 14 when it is desirable to increase or resolve an immune response. 30. The method of claim 29, wherein the infectious disease is AIDS caused by a M-trophic strain of HIV. 31. The the method of claim 29, wherein the infectious disease is bacterial peritonitis. 32-33. (Canceled) |
Molecular vector for the genophenotypic characterisation of v3 sequences of hiv-1 gp120 and process for preparation thereof |
Recombinant vector essentially consisting of: a) a plasmid component able to carry out exactly and efficiently vector replication in bacteria and viral insert expression in eukaryotic cells; b) an HIV component characterised in that the V3 portion sequence of env gene has been deleted and substituted by Nrul enzyme restriction site. In addition the invention relates to a method for the genophenotypic evaluation of HIV genomic sequences. |
1. Recombinant vector essentially consisting of: a) a plasmid component able to carry out exactly and efficiently vector replication in bacteria and viral insert expression in eukaryotic cells; b) an HIV component characterised in that the V3 portion sequence of env gene has been deleted and substituted by Nrul enzyme restriction site. 2. Method for genophenotypic evaluation of HIV genome sequences and corresponding structures involved during the virus entry step of in vivo selected or in vitro generated variants, comprising essentially the following steps: 1) amplification of the sequence encoding for V3 region from a sample; 2) cloning of the amplification product in the vector according to claim 1 in order to obtain a recombinant vector; 3) transfection of the recombinant vector in competent cells like able to carry out HIV replication; 4) collection and purification of the obtained recombinant HIV virus; 5) infection of cell lines by obtained recombinant HIV viruses which express different receptors and/or co-receptors able to bind HIV V3 sequence. 3. Method according to claim 2 wherein the amplification of the sequence encoding for V3 region from a sample occurs by using the following primers: V3s 5′-TACAGCTGAAGTAATCTGTAGAAAT (SEQ ID NO.1) V3as 5′-TATTCCATTTTGCTCTACTAA. (SEQ ID NO.2) 4. Method according to claim 2 wherein the receptors are CD4s and the co-receptors are CCR5s and CXCR4s. 5. Method according to claim 2 wherein the competent cells are 293T line cells. |
Full-length prostate selective polynucleotides and polypeptides |
The present invention relates to all facets of novel polynucleotides, the polypeptides they encode, antibodies and specific binding partners thereto, and their applications to research, diagnosis, drug discovery, therapy, clinical medicine, forensic science, pathology, and medicine, etc. The polynucleotides are expressed in prostate and are therefore useful in variety of ways, including, but not limited to, as molecular markers, as drug targets, and for detecting, diagnosing, staging, monitoring, prognosticating, preventing or treating, determining predisposition to, etc., diseases and conditions relating to prostate, such as prostate cancers, as well as other disease and conditions. |
1. An isolated polynucleotide comprising, a polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72, or a complement thereto. 2. An isolated polynucleotide of claim 1 which codes without interruption for an amino acid sequence selected from SEQ ID NOS 1-58 and 67-72, or a complement thereto. 3. An isolated polynucleotide comprising, a polynucleotide sequence having 90% or more sequence identity to a polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72 of claim 1 and which codes without interruption for a polypeptide sequence selected from SEQ ID NOS 1-58 and 67-72, or a complement thereto. 4. An isolated polynucleotide consisting of: a polynucleotide fragment which is specific for a polynucleotide selected from SEQ ID NOS 1-58 and 67-72 of claim 1, or a complement thereof. 5. An isolated polypeptide comprising, an amino acid sequence selected from SEQ ID NOS 1-58 and 67-72 of claim 1, or polypeptide fragment thereof which is specific-for a polypeptide selected from SEQ ID NOS 1-58 and 67-72. 6. An isolated polypeptide comprising an amino acid sequence having 90% or more sequence identity to an amino acid sequence selected from SEQ ID NOS 1-58 and 67-72 of claim 1. 7. A method of detecting a nucleic acid coding for a polypeptide selectively expressed in prostate, comprising, contacting a sample comprising nucleic acid with a polynucleotide probe specific for a prostate selective polynucleotide of claim 1 under conditions effective for said probe to hybridize specifically with said nucleic acid, and detecting hybridization between said probe and said nucleic acid. 8. A method of claim 7, wherein said detecting is performed by: Northern blot analysis, polymerase chain reaction (PCR), reverse transcriptase PCR, RACE PCR, or in situ hybridization. 9. (canceled) 10. A method of diagnosing a prostate disease associated with abnormal expression of at least one polynucleotide or polypeptide selected from SEQ ID NOS 1-58 and 67-72 of claim 1, comprising: assessing the expression of at least one polynucleotide or polypeptide selected from SEQ ID NOS 1-58 and 67-72 in a tissue sample comprising prostate cells, or cells derived from prostate. 11. A method of claim 10, wherein assessing is: measuring expression levels of said polynucleotide, determining the genomic structure of said polynucleotide, determining the mRNA structure of transcripts from said gene, or measuring the expression levels of polypeptide coded for by said polynucleotide. 12. A method of claim 11, further comprising: comparing said expression to the expression of a gene of a known normal tissue. 13. (canceled) 14. A method of assessing a therapeutic or preventative intervention in a subject having a prostate disease, comprising, determining the expression levels of a polynucleotide or polypeptide selected from SEQ ID NOS 1-58 and 67-72 of claim 1 in a tissue sample comprising prostate cells, or cells derived from prostate. 15. A method for identifying an agent that modulates the expression of a polynucleotide or polypeptide selected from SEQ ID NOS 1-58 and 67-72 in prostate cells, cells derived from prostate, or prostate progenitor cells, comprising, contacting a cell population with a test agent under conditions effective for said test agent to modulate the expression of a polynucleotide or polypeptide selected from SEQ ID NOS 1-58 and 67-72 of claim 1 in prostate cells, or prostate progenitor cells, and determining whether said test agent modulates said a polynucleotide or polypeptide selected from SEQ ID NOS 1-58 and 67-72. 16. A method of claim 15, wherein said agent is an antisense polynucleotide to a target polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72 and which is effective to inhibit translation of said polynucleotide sequence. 17. A method of detecting polymorphisms in polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72 comprising: comparing the structure of: genomic DNA comprising all or part of a polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72 of claim 1, mRNA comprising all or part of a polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72, or cDNA comprising all or part of a polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72, with the structure of polynucleotide or polypeptide sequence selected from SEQ ID NOS 1-58 and 67-72. 18. A method of claim 17, wherein said polymorphism is a nucleotide deletion, substitution, inversion, or transposition. 19. A non-human, transgenic mammal whose genome comprises a functional disruption of a polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72 of claim 1, or a homolog thereof. 20. A non-human, transgenic mammal of claim 19, whose genome further comprises said polynucleotide operatively linked to an expression control sequence effective to express said gene in prostate cells, cells derived from prostate, or prostate progenitor cells. 21. (canceled) 22. A mammalian cell whose genome comprises a functional disruption of a polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72 of claim 1, or a homolog thereof. 23. A mammalian cell of claim 22, wherein said cell is a prostate, cell derived from prostate, or a prostate progenitor cell. 24. (canceled) 25. (canceled) 26. A non-human, transgenic mammal of claim 20, whose genome further comprises a functional disruption of the endogenous polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72, or a homolog thereof. 27. A method of advertising a polynucleotide sequence selected from SEQ ID NOS 1-58 and 67-72, or a homolog thereof, for sale, commercial use, or licensing, comprising, displaying in a computer-readable medium a polynucleotide selected from SEQ ID NOS 1-58 and 67-72 of claim 1, effective specific fragments thereof, or complements thereto. 28. An antibody which is specific-for a polypeptide selected from SEQ ID NOS 1-58 and 67-72. 29. A method for identifying prostate tissue or cells in a sample, comprising: determining the number of target polynucleotides which are expressed in a sample, wherein said target polynucleotides comprise a polynucleotide of claim 1, whereby said number is indicative of the probability that said sample comprises prostate tissue or cells. |
Optical fiber bundle and method for manufacturing thereof |
An optical fiber bundle that has better ultraviolet resistance characteristics at a wavelength range of 150 to 250 nm and that can be readily and cheaply manufactured with no risk of, for example, explosion during manufacturing and its manufacturing method are provided. In the optical fiber bundle, optical fibers including a core mainly containing silica glass and a cladding containing silica glass and fluorine are bundled and accommodated in a container. This container has optically transparent ends, accommodates hydrogen or deuterium as well as the optical fibers, and is sealed. The capacity of the container is 10 times or less as large as the volume of glass of the optical fibers. The method of manufacturing the optical fiber bundle includes the steps of impregnating the optical fibers with hydrogen or deuterium by keeping the optical fibers in a hydrogen or deuterium atmosphere; bundling the optical fibers and accommodating the bundled optical fibers in the container before the hydrogen or deuterium desorbs from the optical fibers; and sealing the container so that hydrogen or deuterium that has desorbed from the optical fibers can be kept in the container. |
1. An optical fiber bundle comprising: a bundled optical fibers each having a core mainly consisting of silica glass and a cladding consisting of silica glass doped with fluorine, the cladding having a refractive index lower than that of the core; and a container having optically transparent ends, wherein said bundled optical fibers are accommodated together with hydrogen or deuterium in the container and sealed, and wherein the capacity of the container is 10 times or less as large as the volume of glass of the optical fibers. 2. An optical fiber bundle according to claim 1, wherein the partial pressure of the hydrogen or deuterium is 0.03 atm or more. 3. An optical fiber bundle according to claim 1, wherein the core contains an OH or OD group of 100 to 1500 ppm by weight and chlorine of less than 50 ppm by weight. 4. An optical fiber bundle according to claim 1, wherein the core contains fluorine of 0.1% to 2.0% by weight and chlorine of less than 50 ppm by weight. 5. An optical fiber bundle according to claim 1, wherein the ends of the container each comprise a window having air-tightness for hydrogen or deuterium and having an internal transmittance of 99% or more at a wavelength used for the optical fiber bundle. 6. An optical fiber bundle according to claim 5, wherein the material for the windows is selected from silica glass, calcium fluoride, and aluminum oxide, and the windows have a thickness of 0.5 mm or more. 7. A method of manufacturing an optical fiber bundle, comprising the steps of: drawing optical fibers from a glass preform, each including a core mainly consisting of silica glass and a cladding consisting of silica glass and fluorine and having a lower refractive index than the core; impregnating the optical fibers with hydrogen or deuterium by keeping the optical fibers in a hydrogen or deuterium atmosphere; bundling the optical fibers and putting the bundled optical fibers in a container before the hydrogen or deuterium desorbs from the optical fibers; and sealing the container so that the hydrogen or deuterium that has desorbed from the optical fibers can be kept in the container. 8. A method of manufacturing an optical fiber bundle according to claim 7, wherein the core contains an OH or OD group of 100 to 1500 ppm by weight and chlorine of less than 50 ppm by weight before the step of impregnation with hydrogen or deuterium. 9. A method of manufacturing an optical fiber bundle according to claim 7, wherein the core contains fluorine of 0.1% to 2.0% by weight and chlorine of less than 50 ppm by weight before the step of impregnation with hydrogen or deuterium. 10. A method of manufacturing an optical fiber bundle according to claim 7, wherein the optical fibers have a loss of less than 4 dB/m at a wavelength of 245 nm before the step of impregnation with hydrogen or deuterium. 11. A method of manufacturing an optical fiber bundle according to claim 7, wherein the optical fibers are impregnated with hydrogen or deuterium after the optical fibers are bundled. 12. A method of manufacturing an optical fiber bundle according to claim 7, wherein the optical fibers contain hydrogen or deuterium of 5×1018 molecule/cm3 or more after the step of impregnation with hydrogen or deuterium. 13. A method of manufacturing an optical fiber bundle according to claim 7, wherein the volume of glass of the optical fibers, the content of hydrogen or deuterium in the optical fibers, and the capacity of the container are determined so that the partial pressure of hydrogen or deuterium in the container becomes 0.03 atm or more after the step of sealing the container. |
<SOH> BACKGROUND ART <EOH>Ultraviolet light with wavelengths of 150 to 250 nm, which is emitted by deuterium lamps, KrF excimer lasers, ArF excimer lasers, and F 2 excimer lasers, has been increasingly used in the field of micromachining such as photolithography and laser machining and in medical fields, such as for sterilization and disinfection. Accordingly, optical fibers for transmitting ultraviolet light have been researched and developed as a medium for transmitting the ultraviolet light with such wavelengths. Unfortunately, transmission of ultraviolet light deteriorates the glass and increases its transmission loss. Silica glass optical fibers, although having excellent ultraviolet resistance characteristics, are unsatisfactory. The increase in the transmission loss of the silica glass optical fibers in the ultraviolet region is considered to be due to optical absorption caused by defects which the irradiation of the ultraviolet light causes in the silica glass. Consequently, methods of compensating for these defects with hydrogen atoms have been employed to improve the ultraviolet resistance characteristics. Japanese Unexamined Patent Application Publication No. 6-034830 (Ref. 1) discloses a structure such that an optical fiber having a pure quartz core and a fluorine-doped quartz cladding is accommodated in a stainless steel (SUS) pipe, in which a high-pressure hydrogen gas atmosphere of 5 to 10 kg/cm 2 is kept at a high temperature of 100° C. to 150° C. by covering the outside of the SUS pipe with a heating member so that the optical fiber is exposed to the hot, high-pressure hydrogen atmosphere during or after transmission of the ultraviolet light. Japanese Unexamined Patent Application Publication No. 6-056457 (Ref. 2) discloses a method of manufacturing an optical fiber, which is characterized in that an optical fiber drawn from a preform consisting of a pure quartz core and a fluorine-doped quartz cladding is exposed to a hydrogen atmosphere upon drawing from the preform while the optical fiber has a high temperature or to a hot hydrogen atmosphere so as to diffuse a large amount of hydrogen into the optical fiber. Japanese Unexamined Patent Application Publication Nos. 11-029335 (Ref. 3) and 10-316445 (Ref 4) disclose a glass product and its manufacturing method, in which a quartz glass product is irradiated with electromagnetic waves to cause defects in glass and the glass product is then kept in a hydrogen atmosphere so as to substantially prevent the occurrence of an increase in optical absorption in the ultraviolet region. Japanese Unexamined Patent Application Publication No. 2000-214336 (Ref. 5) discloses a quartz glass optical fiber in which microparticles that can store hydrogen are provided over a cladding in dispersedly distributed manner. Japanese Unexamined Patent Application Publication No. 2000-214336 (Ref. 5) discloses a quartz glass optical fiber in which microparticles that can store hydrogen are provided over a cladding in dispersedly distributed manner. The method in Ref 1 unfortunately requires a large apparatus. The methods in Refs. 2, 3, and 4, although effective, gradually lose their effects with increasing defects caused by the ultraviolet light. These methods, therefore, are unsatisfactory for use in devices that emit strong ultraviolet light. In the method in Ref. 5, a sufficient amount of hydrogen-containing material, such as resins and hydrogen-absorbing alloys, is required to be enclosed corresponding to the volume of the optical fibers. Thus, this method is undesirable because a large container for an optical fiber bundle is required in the case where hundreds or thousands of optical fibers are bundled. FIG. 8 shows a known optical fiber bundle 14 including loosely bundled optical fibers 11 , a pipe 13 accommodating the optical fibers 11 , and collets 12 holding the ends of the optical fibers 11 . Referring to FIG. 9 , the optical fiber bundle 14 is produced by drawing optical fibers from an optical fiber glass preform, then bundling and fixing the optical fibers at their ends (bundling), and finally accommodating the bundled optical fibers in a container. A method conceivable as a combination of such techniques as described above is such that a pipe accommodating an optical fiber bundle is filled with a hydrogen-containing atmosphere and completely sealed. This method, however, has a high risk of danger such as explosion because operations involving heat treatment such as welding and sealing must be carried out while the container is filled with a hydrogen-containing atmosphere. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1A is a perspective view of an optical fiber bundle 10 that exemplifies an embodiment of the present invention; FIGS. 1 B 1 and 1 B 2 are sectional views of an end of the optical fiber bundle 10 ; and FIG. 1C is a graph showing an example of the refractive index profile of optical fibers in the optical fiber bundle 10 . FIG. 2 is a flow chart of the manufacturing flow of the optical fiber bundle 10 . FIG. 3A is a graph showing the hydrogen concentration distribution in an optical fiber 1 immediately after impregnation with hydrogen; and FIG. 3 B is a graph showing the hydrogen concentration distribution in the optical fiber 1 and a container during use. FIG. 4A is a graph showing changes in the transmittance of the optical fiber bundle 10 during ArF excimer laser irradiation; and FIG. 4B is a graph showing the transmittance of the optical fiber bundle 10 before and after the ArF excimer laser irradiation. FIG. 5A is a graph showing changes in the transmittance of an optical fiber bundle in a comparative example during ArF excimer laser irradiation; and FIG. 5B is a graph showing the transmittance of the optical fiber bundle in the comparative example before and after the ArF excimer laser irradiation. FIG. 6 is a graph showing the relation between the initial loss of an optical fiber in Example 3 and the transmittance of the optical fiber after ArF excimer laser irradiation. FIG. 7 is a graph showing the transmittance of an optical fiber bundle in Example 3 before and after the ArF excimer laser irradiation. FIG. 8 is a schematic illustration of an optical fiber bundle. FIG. 9 is a flow chart of a known method. detailed-description description="Detailed Description" end="lead"? |
Cosmetologic and anti-ageing stocking or tights impregnated with slow-release natural substances and method for making same |
The invention concerns a cosmetologic and anti-ageing stocking or a pair of tights, or any textile support in direct contact with the skin, impregnated with slow-release natural substances and the method for making same. The combination of biomimetic phospholipid components is as follows: A) GLA Phospholipid (Sodium Borageamidopropyl PG-Dimonium Chloride Phosphate) at 0,5% of the solution; B) PTC Phospholipid (Cocamidopropyl PG-Dimonium Chloride Phosphate) at 1.5% of the solution. Said combination of phospholipid components primarily promotes the fixing or impregnation of the active principles through an electrostatic process and secondarily constitutes an antibacterial agent which controls the bacterial flora. To those two components are added the natural substances to the active principle for a maximum total of 2.10%. The softening and impregnating phase lasts about 35 minutes at a temperature ranging between 35° C. and 37° C. |
1. Cosmetological and anti-aging stockings or tights, or any textile support in direct contact with the skin, characterized by the fact that they are impregnated with slow release natural substances. 2. Cosmetological and anti-aging stockings or tights, or any textile support in direct contact with the skin, according to claim 1, characterized by the fact that the natural substances or active principles are contained in algal and iridaceae extracts, the iridaceae extracts supplying zinc and vitamin A, zinc as a coenzyme taking part in enzymatic reactions associated with cellular growth and the regulation of damaged tissues by activating the cicatrization processes, the algal and iridaceae extracts acting in synergy to have an anti-radical action. 3. Cosmetological and anti-aging stockings or tights, or any textile support in direct contact with the skin, according to claim 2, characterized by the fact that the algal extracts are extracts of ulva lactuca. 4. Cosmetological and anti-aging stockings or tights, or any textile support in direct contact with the skin, according to claim 2, characterized by the fact that among the iridaceae is particularly preferred germanic iris variety florentine, which is rich in polyphenols, flavonoids and anthocyans with high antioxidant action, hence with high antioxidant activity. 5. Process for production which permits impregnating stockings or tights, or any textile support in direct contact with the skin, with natural substances with slow release according to claim 1, characterized by the fact that the process of production consists, after dyeing, with acting during the softening process by incorporating in a conventional softening bath a combination of biomimetic phospholipids, the combination of biomimetic phospholipids being as follows: A) Phospholipid GLA (Sodium Borageamidopropyl PG-Dimonium Chloride Phosphate) at 0.5% of the bath B) Phospholipid PTC (Cocamidopropyl PG-Dimonium Chloride Phosphate) at 1.5% of the bath this combination of phospholipid components having the function first of promoting the fixing or impregnation of the active principles by an electrostatic process and then having the second function of being an antibacterial agent which control the bacterial flora, to these two phospholipid compounds being added natural substances with active principles for a maximum total of 2.10%, the softening and impregnation phase lasting for about 35 minutes at a temperature comprised between 35° C. and 37° C. 6. Process for production according to claim 5, characterized by the fact that the proportion of softening solution, including the phospholipid compounds, the active products, is a proportion of 10 to 1, which is to say for 10 kg of solution, one kilogram of tights or any textile support in direct contact with the skin, must circulate in a bath. 7. Process for production according to claim 5, characterized by the fact that the active principles or natural substances are as follows: a) Marine algae from 0.7% to 1.00% maximum b) Uva Lactuca from 0.3% to 0.5% maximum c) Iris Florentina from 0.3% to 0.5% maximum d) Perfume up to 0.1% for a maximum total of 2.1%. 8. Process for production according to claim 5, characterized by the fact that the active principles are the following: e) Ginseng from 0.25% to 0.35% maximum f) Ginko Biloba from 0.25% to 0.35% maximum g) Hydrocotyl from 0.25% to 0.35% maximum h) Green tea from 0.25% to 0.35% maximum i) Aloes (Aloe Vera) from 0.50% to 0.70% maximum for a total maximum of 2.10%. 9. Process for production according to claim 5, characterized by the fact that solar filters are incorporated in the softening bath and in the active products in a quantity dependent on the degree of ultraviolet protection desired. |
Gene associated with bone disorders |
The present invention relates to identifying genes that are differentially regulated or expressed in bone deposition disorders. Specifically, a novel gene has been identified as being differentially regulated during the maturation of osteoblasts and whose expression can be correlated, for example, with bone deposition disorders such as osteoporosis (including correlation with degrees of severity of the disease). |
1. An isolated nucleic acid molecule selected from the group consisting of: (a) an isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1; (b) an isolated nucleic acid molecule encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2; (c) an isolated nucleic acid molecule that encodes a polypeptide fragment of at least about 1,015 amino acids of SEQ ID NO: 2; and (d) an isolated nucleic acid molecule that encodes a polypeptide that exhibits at least about 75% amino acid sequence identity to SEQ ID NO: 2. 2. The isolated nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises nucleotides 251-4,336 of SEQ ID NO: 1. 3. The isolated nucleic acid molecule of claim 1, wherein the nucleic acid molecule consists of nucleotides 251-4,336 of SEQ ID NO: 1. 4. The isolated nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises nucleotides 251-4333 of SEQ ID NO: 1. 5. The isolated nucleic acid molecule of claim 1, wherein the nucleic acid molecule consists of nucleotides 251-4333 of SEQ ID NO: 1. 6. The isolated nucleic acid molecule of claim 1, wherein said nucleic acid molecule is operably linked to one or more expression control elements. 7. A vector comprising an isolated nucleic acid molecule of claim 1. 8. A host cell transformed to contain the nucleic acid molecule of claim 1. 9. A host cell comprising the vector of claim 8. 10. The host cell of claim 9, wherein said host is selected from the group consisting of prokaryotic host cells and eukaryotic host cells. 11. A method for producing a polypeptide comprising culturing a host cell transformed with the nucleic acid molecule of claim 1 under conditions in which the polypeptide encoded by said nucleic acid molecule is expressed. 12. The method of claim 11, wherein said host cell is selected from the group consisting of prokaryotic host cells and eukaryotic host cells. 13. An isolated polypeptide produced by the method of claim 11. 14. An isolated polypeptide selected from the group consisting of: (a) an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 2; (b) an isolated polypeptide comprising a fragment of at least 1015 amino acids of SEQ ID NO: 2; (c) an isolated polypeptide comprising conservative amino acid substitutions of SEQ ID NO: 2; and (d) an isolated polypeptide exhibiting at least about 75% amino acid sequence identity with SEQ ID NO: 2. 15. The isolated polypeptide of claim [α]14, wherein the polypeptide comprises SEQ ID NO: 2. 16. An isolated antibody that binds to a polypeptide of either claim 14. 17. An antibody of claim 16 wherein said antibody is a monoclonal or a polyclonal antibody. 18. A method of screening for an agent that modulates the differentiation of a population of stem cells into osteoblast cells comprising: (a) exposing a population of stem cells to the agent, and (b) measuring expression or activity of a nucleic acid molecule of claim 1 or a polypeptide encoded by the nucleic acid of claim 1 following exposure to the agent, wherein an decrease in the level of expression or activity is indicative of an agent capable of stimulating stem cells to differentiate into osteoblast cells. 19. A method of screening for an agent that increases bone density comprising: (a) exposing a population of stem cells to the agent; and (b) measuring expression or activity of a nucleic acid molecule of claim 1 or a polypeptide encoded by the nucleic acid of claim 1 following exposure to the agent, wherein a decrease in the level of expression or activity is indicative of an agent capable increasing bone density. 20. A method of diagnosing a condition characterized by abnormal stem cell differentiation comprising detecting in a stem cell sample the level of expression or activity of a nucleic acid molecule of claim 1 or a polypeptide encoded by the nucleic acid of claim 1, wherein abnormal expression or activity is indicative of a condition characterized by abnormal stem cell differentiation. 21. A method of diagnosing a condition characterized by abnormal bone density comprising detecting in a stem cell sample the level of expression or activity of a nucleic acid molecule of claim 1 or a polypeptide encoded by the nucleic acid of claim 1, wherein a decrease in expression or activity is indicative of a condition characterized by abnormal bone density. 22. The method of claim 20 wherein the condition is osteoporosis. 23. A non-human transgenic animal comprising a nucleic acid molecule of claim 1. 24. A non-human transgenic animal that is engineered to not express a protein encoded by a nucleic acid molecule of claim 1. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Living bone tissue is continuously being replenished by the processes of resorption and deposition of bone matrix and minerals. This temporally and spatially coupled process, termed bone remodeling, is accomplished largely by two cell populations, osteoclasts and osteoblasts. The remodeling process is initiated when osteoclasts are recruited from the bone marrow or the circulation to the bone surface to remove a disk-shaped packet of bone producing an area of resorbed surface. A team of osteoblasts recruited to the resorbed bone surface from the bone marrow subsequently replaces the bone matrix and mineral. Among the pathological conditions associated with abnormal bone cell function is osteoporosis, a diseased characterized by reduced amounts of bone (osteopenia) and increased bone fragility. These changes can be the result of increased recruitment and activity of osteoclasts, in combination with reduced recruitment or activity of osteoblasts (Teitelbaum et al. (1997) J. Leukoc. Biol. 61, 381-388; Simonet et al. (1997) Cell 89, 309-319). A very significant patient population that would benefit from new therapies designed to promote bone formation or inhibit resorption are those patients suffering from osteoporosis. Clinically, osteoporosis is segregated into type I and type II. Type I osteoporosis occurs predominantly in middle aged women and is associated with estrogen loss at menopause, while osteoporosis type II is associated with advancing age. An estimated twenty to twenty-five million people are at increased risk for fracture because of site-specific bone loss. The cost of treating osteoporosis in the United States is currently estimated to be in the order of ten billion dollars per year. Demographic trends, i.e., the gradually increasing age of the United States population, suggest that these costs may increase up to three fold by the year 2020 if a safe and effective treatment is not found. Bone resorption is initiated with the destruction of bone matrix by osteoclasts. Following this initial phase of bone destruction, or resorptive phase, formation of new bone protein matrix begins. New bone proteins are deposited, and sometime later, minerals begin to be incorporated into the newly formed matrix. The formation of bone matrix and its subsequent mineralization are exclusive functions of osteoblasts. In theory, either decreased bone formation relative to resorption or increased bone resorption relative to formation can cause the net loss of bone in osteoporosis. Control of the rate of breakdown and synthesis of new bone tissue is critical to the integrity of the skeletal structure. When the rates become unbalanced, serious conditions may result. Although there is always a net excess of bone resorption in osteoporosis, the absolute amounts of bone formation and resorption can vary from case to case. |
<SOH> SUMMARY OF TE INVENTION <EOH>Few treatments are available to modulate the formation and resorption processes of bone maintenance and development. In bone disorders such as osteoporosis, it may be useful to monitor or modify the expression levels or activities of genes involved in bone formation or resorption. The present inventors have examined cell populations comprising precursor stem cells and cell populations comprising precursor stem cells that have been induced to differentiate into osteoblasts and have discovered that the expression of previously unidentified gene changes during this differentiation process. This change in gene expression provides a useful marker for diagnostic and prognostic uses as well as a marker that can be used for drug screening and therapeutic indications. The invention encompasses an isolated nucleic acid molecule selected from the group consisting of: an isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1; an isolated nucleic acid molecule encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2; an isolated nucleic acid molecule that encodes a polypeptide fragment of at least about 1,015 amino acids of SEQ ID NO: 2; and an isolated nucleic acid molecule that encodes a polypeptide that exhibits at least about 75% amino acid sequence identity to SEQ ID NO: 2 over the entire contiguous sequence. In a preferred embodiment of the invention, the isolated nucleic acid comprises nucleotides 251-4,336 of SEQ ID NO: 1. In some embodiments, the isolated nucleic acid molecule is operably linked to one or more expression control elements. The invention also includes a vector comprising an isolated nucleic acid molecule and a host cell transformed to contain the nucleic acid molecule. The host cell may be either eukaryotic or prokaryotic. The invention also encompasses a method for producing a polypeptide comprising culturing a host cell transformed with the aforementioned nucleic acid molecule under conditions in which the polypeptide encoded by said nucleic acid molecule is expressed and the isolated polypeptide produced by this method. The invention further encompasses an isolated polypeptide selected from the group consisting of: an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 2; an isolated polypeptide comprising a fragment of at least 1,015 amino acids of SEQ ID NO: 2; an isolated polypeptide comprising conservative amino acid substitutions of SEQ ID NO: 2; and an isolated polypeptide exhibiting at least about 75% amino acid sequence identity with SEQ ID NO: 2. In some embodiments, the isolated polypeptide comprises amino acids 1 to 348 of SEQ ID NO: 2. The invention includes isolated antibodies that bind to the aforementioned polypeptide. The antibodies may be either monoclonal or polyclonal. The invention encompasses a method of screening for an agent that modulates the differentiation of a population of stem cells into osteoblast cells or is capable of increasing bone density comprising: exposing a population of stem cells to the agent, and measuring expression or activity of a polypeptide encoded by the nucleic acid of the invention following exposure to the agent, wherein an decrease in the level of expression or activity is indicative of an agent capable of stimulating stem cells to differentiate into osteoblast cells or increasing bone density. In yet another embodiment, the invention includes a method of diagnosing a condition characterized by abnormal stem cell differentiation or bone density comprising detecting in a stem cell sample the level of expression or activity of a polypeptide encoded by the nucleic acid of the invention, wherein abnormal expression or activity is indicative of a condition characterized by abnormal stem cell differentiation or bone cell density. In a preferred embodiment, the condition is osteoporosis. |
Aqueous crosslinkable coating compositions based on vinyl fluoropolymer |
Aqueous crosslinkable coating composition suitable for anti-graffiti and heavy duty applications comprising: (A) an aqueous polymer emulsion comprising at least one vinyl fluoropolymer which comprises as a polymerised constituent monomer thereof (i) a fluoromonomer(s) having the formula (1) wherein R1 is CH3 or H, R2 is a per-fluorinated C1-5 alkyl group and n is 1, 2, 3 or 4, (ii) a hydroxyl functional monomer(s) and (iii) a carboxylic acid-functional monomer(s) where the vinyl fluoropolymer has a glass transition temperature Tg within the range of from −50 to 90° C. and (B) at least one hydroxyl-reactive crosslinker material. |
1. Aqueous crosslinkable coating composition suitable for anti-graffiti and heavy duty applications comprising: (A) an aqueous polymer emulsion comprising at least one vinyl fluoropolymer in which: (i) said at least one vinyl fluoropolymer comprises as a polymerised constituent monomer thereof a fluoromonomer(s) having the formula: wherein R1 is CH3 or H, R2 is a perfluorinated C1-5 alkyl group and n is 1, 2, 3 or 4, and wherein said fluoromonomer(s) forms from 5 to 60 weight % of the total monomers used to prepare said at least one vinyl fluoropolymer; (ii) said at least one vinyl fluoropolymer comprises as a polymerised constituent monomer thereof a polymerised hydroxyl functional monomer(s) in an amount to provide or contribute to a hydroxyl value, which said at least one vinyl fluoropolymer possesses, of at least 8 mg KOH/g of solid polymer, preferably within the range of from 8 to 250 mg KOH/g of solid polymer; (iii) said at least one vinyl fluoropolymer comprises as a polymerised constituent monomer(s) thereof a carboxylic acid-functional monomer(s) in an amount to provide or contribute to an acid value, which said at least one vinyl fluoropolymer possesses, of within the range of from 2 to 80 mg KOH/g of solid polymer; (iv) said at least one vinyl fluoropolymer has a glass transition temperature Tg within the range of from −50 to 90° C.; and (B) at least one hydroxyl-reactive crosslinker material. 2. Composition according to claim 1 wherein the amount of fluoromonomer(s) of formula (1) used to prepare said at least one fluoropolymer of component (A) is within the range of from 5 to 50 weight % based on the total amount of monomers employed, more preferably from 6 to 45 weight %. 3. Composition according to claim 1 wherein the fluoromonomer of formula (1) is 2,2,2-trifluoroethyl methacrylate (TFEMA) or 2,2,2,-trifluoroethyl acrylate (TFEA). 4. Composition according to claim 1 wherein the hydroxyl value of said at least one fluoropolymer of component (A) is within the range of from 20 to 175 mg KOH/g of solid polymer, more preferably from 30 to 140 mg KOH/g of solid polymer. 5. Composition according to claim 1 wherein said hydroxy functional monomer(s) of (ii) is selected from one or more of 2-hydroxyethyl methacrylate, 2-hydroxyethyl acrylate, 2-hydroxy-n-propyl methacrylate, 2-hydroxy-n-propyl acrylate, 3-hydroxy-n-propyl methacrylate, 3-hydroxy-n-propyl acrylate and 4-hydroxy-n-butyl acrylate. 6. Composition according to claim 1 wherein the acid value of said at least one fluoropolymer of component (A) is within the range of from 4 to 55 mg KOH/g of solid polymer, more preferably from 6 to 45 mg KOH/g of solid polymer. 7. Composition according to claim 1 wherein said carboxylic acid functional monomer(s) of (iii) is selected from one or more of acrylic acid, methacrylic acid, beta-carboxyethyl acrylate, itaconic acid, crotonic acid, fumaric acid, maleic acid and maleic anhydride, more preferably one or more of acrylic acid methacrylate acid and beta-carboxyethyl acrylate. 8. Composition according to claim 1 wherein said at least one vinyl fluoropolymer of component (A) comprises as a constituent polymerised monomer(s) a non-fluoro, non-hydroxy, non-acid vinyl monomer(s), preferably in an amount of 0 to 93 weight % of the total monomers used to make said fluoropolymer, more preferably 3 to 90 weight %, and still more preferably 17 to 87 weight %. 9. Composition according to claim 8 wherein said non-fluoro, non-hydroxyl, non-acid vinyl monomer(s) of component (A) is selected from one or more esters of acrylic acid and methacrylic acids of formula CH2═CR4CO2R5 wherein R4 is H or methyl and R5 is optionally substituted alkyl of 1 to 20 carbon atoms, (more preferably 1 to 8 carbon atoms) or cycloalkyl of 5 to 12 ring carbon atoms but which exclude fluorine-containing, acid-containing and hydroxy containing groups; styrene; and α-methyl styrene. 10. Composition according to claim 1, wherein said at least one vinyl fluoropolymer of component (A) is derived from a monomer system comprising: 5 to 60 weight % of a fluoromonomer(s) of formula (1), preferably one or both of TFEMA and TFEA, more preferably 5 to 50 weight %, and still more preferably 6 to 45 weight %; 2 to 58 weight % of a non-fluoro, non-acid, hydroxyl functional monomer(s) preferably selected from one or more of 2-hydroxyethyl acrylate and methacrylate, 2-hydroxy-n-propyl acrylate and methacrylate, 3-hydroxy-n-propyl acrylate and methacrylate and 4-hydroxy-n-butyl acrylate and methacrylate, more preferably 5 to 40 weight %, and still more preferably 7 to 32 weight % (and subject to the definition of claim 1 concerning the hydroxyl value of the polymer); 0.2 to 10 weight % of a non-fluoro, non-hydroxy, carboxylic acid functional monomer(s), preferably one or more of acrylic acid, methacrylate acid and beta-carboxyethyl acrylate, preferably 0.3 to 7 weight % and still more preferably 0.4 to 6 weight (and subject to the definition in claim 1 concerning the acid value of the polymer); and 0 to 92% weight % of a non-fluoro, non-acid, non-hydroxyl monomer(s), preferably selected from one or more of C1-C8 alkyl acrylates and methacrylates, preferably methyl methacrylate, n-butyl acylate, n-butyl methacrylate, ethyl acrylate and 2-ethylhexyl acrylate, one or more of cycloalkyl acrylates and methacrylates of 5 to 12 ring C atoms, preferably isobornyl (meth)acrylate and cyclohexyl (meth)acrylate, and one or more of styrenes, preferably styrene itself or a methyl styrene, preferably 3 to 90 weight %, still more preferably 17-89 weight % (all weight % values being based on the total weight of monomers used for the polymerisation). 11. Composition according to claim 1 wherein said at least one vinyl fluoropolymer of component (A) is made using an aqueous emulsion polymerisation process. 12. Composition according to claim 1 wherein the Tg of said at least one vinyl fluoropolymer of component (A) is within the range of from 0 to 60° C. 13. Composition according to claim 1 wherein the average particle size of said at least one vinyl fluoropolymer of component (A) is within the range of from 20 to 500 nm, more preferably from 25 to 350 nm and most preferably from 30 to 250 nm. 14. Composition according to claim 1 wherein the weight average molecular weight of said at least one vinyl fluoropolymer of component (A) is within the range of from 5,000 to 5,000,000 Daltons, more preferably from 7,500 to 1,000,000 Daltons and most preferably from 10,000 to 500,000 Daltons. 15. Composition according to claim 1 wherein said at least one hydroxyl-reactive crosslinker material of component (B) is present in an amount such the ratio of hydroxyl groups from the polymer(s) of component (A) to the hydroxyl-reactive groups of the crosslinker material of component (B) is within the range of from 0.1 to 10, more preferably from 0.2 to 5, still more preferably 0.5 to 2. 16. Composition according to claim 1 wherein said at least one hydroxyl-reactive crosslinker material(s) of component (B) is selected from organic polyisocyanates, organic blocked polyisocyanates, organic isothiocyanates and melamine-based resins, and is preferably an organic polyisocyanate or a melamine-based resin. 17. Composition according to claim 1 wherein the aqueous polymer emulsion of component (A) includes a non-fluoropolymer(s), preferably being a non-fluoro vinyl polymer(s). 18. Composition according to claim 17 wherein said non-fluoropolymer is hydroxyl-functional, and preferably has a hydroxyl value of up to 250 mgKOH/g of solid polymer, more preferably 20 to 175 mg KOH/g of solid polymer. 19. Composition according to claim 17 wherein said non-fluoropolymer is acid-functional, and preferably has an acid value of up to 80 mgKOH/g of solid polymer. 20. Composition according to claim 17 wherein said non-fluoropolymer(s) has an average particle size within the range of from 30 to 600 nm, more preferably 50 to 550 nm, and most preferably from 80 to 500 nm. 21. Composition according to claim 17 wherein said fluoro polymer(s) has an average particle size which is smaller than that of the non-fluoropolymer(s) by at least 10 nm, more preferably by at least 20 nm. 22. Composition according to claim 17 wherein the Tg of the non-fluoropolymers) is in the range of from −50 to 90° C. more preferably 0 to 60° C. 23. Composition according to claim 17 wherein said non-fluoropolymer(s) of component (A) is derived from a monomer system which comprises 32 to 100 weight % of a non-fluoro, non-acid, non-hydroxyl monomer(s), preferably selected from one or more C1-C18 alkyl acrylates and methacrylates, more preferably one or more of methyl methacrylate, n-butyl acrylate, n-butyl methacrylate, ethyl acrylate, and 2-ethylhexyl acrylate, one or more cycloalkyl acrylates and methacrylates of 5 to 12 ring C atoms, preferably isobornyl methacrylate and cyclohexyl methacrylate, and one or more styrenes, preferably styrene itself or α-methyl styrene, more preferably 53 to 95 weight %, still more preferably 62 to 93 weight %; 0 to 58 weight % of a non-fluoro, non-acid, hydroxyl functional monomer(s), preferably selected from one or more of 2-hydroxyethyl acrylate and methacrylate, 2-hydroxyl-n-propyl acrylate and methacrylate, 3-hydroxy-n-propyl acrylate and methacrylate, and 4-hydroxy-n-butyl acrylate and methacrylate, more preferably 5 to 40 weight %, still more preferably 7 to 32 weight %; and 0 to 10 weight % of a non-fluoro, non-hydroxy, carboxylic acid-functional monomer(s), preferably one or more of acrylic acid, methacrylic acid and beta-carboxyethyl acrylate, more preferably 0 to 7 weight %, still more preferably 0.4 to 6 weight % wherein all weight % values are based on the total weight of monomers used for the polymerisation. 24. Composition according to claim 17 wherein the weight ratio of fluoropolymer(s)/non-fluoropolymer(s) is within the range of from 99/1 to 10/90, preferably from 95/5 to 15/85 and more preferably from 60/40 to 20/80. 25. Method of coating a substrate which comprises applying a coating composition according to claim 1 to a substrate, causing or allowing the aqueous carrier medium of the composition to be removed, and developing crosslinking of the coating that has been applied to the substrate. 26. A crosslinked coating derived from a coating composition according to claim 1. 27. Coated substrate which has been prepared using a method according to claim 25. |
Vaccine and method for treatment of motor neurone diseases |
A vaccine for reducing disease progression, and/or protection of motor nerve degeneration, and/or protection from glutamate toxicity in motor neurone disease (MND), particularly amyotrophic lateral sclerosis (ALS), patients, comprising an active agent selected from the group consisting of Cop 1, a Cop 1-related peptide, a Cop 1-related polypeptide, and poly-Glu, Tyr. The active agent is preferably Cop 1 or poly-Glu, Tyr, and can be administered with or without an adjuvant. |
1. A method for reducing disease progression, and/or protection of motor nerve degeneration, and/or protection from glutamate toxicity in a patient suffering from a motor neurone disease (MND), which comprises immunizing said patient with a vaccine comprising a therapeutically effective amount of an active agent selected from the group consisting of Copolymer 1, a Copolymer 1-related-peptide, and a Copolymer 1-related polypeptide. 2. A method according to claim 1, wherein said motor neurone disease is amyotrophic lateral sclerosis (ALS). 3. A method according to claim 1, wherein said motor neurone disease is primary lateral sclerosis (PLS), progressive muscular atrophy (PMA) or progressive bulbar palsy (PBP or bulbar onset). 4. A method according to claim 1, wherein said vaccine comprises the active agent without an adjuvant. 5. A method according to claim 1, wherein said vaccine comprises the active agent emulsified in an adjuvant suitable for human clinical use. 6. A method according to claim 5, wherein said adjuvant is selected from the group consisting of aluminum hydroxide, aluminum hydroxide gel, and aluminum hydroxyphosphate. 7. A method according to claim 6, wherein said adjuvant is amorphous aluminum hydroxyphosphate having an acidic isoelectric point and an Al:P ratio of 1:1. 8. A method according to claim 1, wherein said active agent is Copolymer 1. 9. A method according to claim 1, wherein said active agent is a Copolymer 1-related-peptide or a Copolymer 1-related polypeptide. 10. (canceled) 11. A method according to claim 1, wherein said vaccine is administered at least once a month. 12. A method according to claim 1, wherein said vaccine is administered at least once every 2-3 months. 13. A method according to claim 1, wherein the treatment includes administration of another drug for treatment of MND. 14-39. (canceled) 40. A method according to claim 13, wherein said drug for treatment of MND is Riluzole. 41. A method for treatment of a patient suffering from amyotrophic lateral sclerosis (ALS) which comprises immunizing said patient with a vaccine comprising an amount of Copolymer 1 effective for reducing disease progression in said patient. 42. A method for treatment of a patient suffering from amyotrophic lateral sclerosis (ALS) which comprises immunizing said patient with a vaccine comprising an amount of Copolymer 1 effective for protection of motor nerve degeneration in said patient. 43. A method for treatment of a patient suffering from amyotrophic lateral sclerosis (ALS) which comprises immunizing said patient with a vaccine comprising an amount of Copolymer 1 effective for protection from glutamate toxicity in said patient. 44. An article of manufacture comprising packaging material and a vaccine contained within the packaging material, said vaccine comprising Copolymer 1; and said packaging material includes a label that indicates that Copolymer 1 is therapeutically effective for treating amyotrophic lateral sclerosis (ALS). |
<SOH> FIELD AND BACKGROUND OF INVENTION <EOH>The present invention relates to a vaccine and methods for the treatment of Motor Neurone Diseases (MND), particularly amyotrophic lateral sclerosis (ALS). Motor Neurone Disease (MND) is the name given to a group of related diseases affecting the motor neurones in the brain (upper motor neurons) and spinal cord (lower motor neurons). Motor neurones (or motor neurons) are the nerve cells along which the brain sends instructions, in the form of electrical impulses, to the muscles. Degeneration of the motor neurones leads to weakness and wasting of muscles. This generally occurs in arms or legs initially, some groups of muscles being affected more than others. There are several classifications of MND. In most cases of MD, degeneration of both the upper and lower motor neurones occurs. This condition is called Amyotrophic Lateral Sclerosis (ALS), also known as Lou Gehrig's disease, and is characterized by muscle weakness, stiffness and fasciculations (muscle twitching). There are also less common forms in which a more selective degeneration of either the upper motor neurones (such as Primary Lateral Sclerosis, PLS) or lower motor neurones (such as Progressive Muscular Atrophy, PMA) is observed. Progressive Bulbar Palsy (PBP or Bulbar Onset) is a version of ALS that starts with difficulties in swallowing, chewing and speaking and affects approximately 25% of ALS patients. There is considerable overlap between these forms of MND. People with PMA in time develop upper motor neurone involvement and in both PMA and ALS some people may eventually experience speech and swallowing difficulties in varying degrees (bulbar onset ALS or PMA). ALS, is a chronic, progressive neurodegenerative disease characterized by gradual degeneration of the nerve cells in the central nervous system (CNS) that control voluntary muscle movement. The progressive loss of motor neurons leads to gradual skeletal muscle atrophy and to inevitable death, usually within 2-3 to ten years of the disease onset. Muscular weakness and atrophy and signs of anterior horn cell dysfunction are initially noted most often in the hands and less often in the feet. The site of onset is random, and progression is asymmetric. In the U.S.A. alone, 30,000 people currently have ALS and about 8,000 new cases are diagnosed each year. ALS occurs in sporadic (SALS) and familial (FALS) forms (Mulder et al., 1986; Munsat, 1989). The primary risk factors are mostly unknown, yet 5 to 10% of all ALS patients are familial (FALS). About 20% of all familial forms were found to have mutations in the gene encoding Cu/Zn superoxide dismutase type 1 on chromosome 21 (Rosen et al., 1993; Brown, 1995). SOD is an enzyme that catalyzes the conversion of superoxide anions to hydrogen peroxide, and thus SOD can protect cells against the deleterious effects of these toxic radicals. It appears that the toxicity of different SOD mutants is not due to decreased free-radical scavenging activity since no correlation was found between enzymatic activity, polypeptide half-life and resistance to proteolysis with age of onset or rapidity of human disease progression (for review, see Julien, 2001). Transgenic mice expressing various SOD1 mutants developed motor neuron disease and thus constitute an accepted animal model for testing ALS and other motor neurone therapies. Recently, a new ALS gene has been identified by two independent groups of scientists (Hadano et al., 2001; Yang et al., 2001). This new gene, called ALS2, is located on chromosome 2 and encodes for a protein named alsin. The new ALS2 gene is mutated in both people with juvenile amyotrophic lateral sclerosis (JALS), also known as ALS2, and people with juvenile primary lateral sclerosis (JPLS). Mutations in different regions of the chromosome are associated with different motor neuron diseases. Specifically, a mutation in one region is found in people with ALS, while mutations in two other regions are found in people with JPLS. In the future, transgenic mice carrying these mutations will certainly constitute a further model for testing ALS therapies. Numerous studies over the last decade have been devoted to understanding the etiology, prognosis and progression of the disease. No consensus has been reached, except for admitting that it is a multi-factorial disease in terms of circumstances leading to its progression, while the etiology remains unclear. It is evident today that many of the factors which contribute to the progression of ALS are found in many other chronic and acute neurodegenerative disorders. These factors include oxidative stress, excitotoxicity, deprivation of trophic support, and ionic imbalance. Over the years attempts have been made to halt the progression of ALS, as in other chronic and acute neurodegenerative disorders, by blocking different mediators of cytotoxicity. Most of these clinical trials have had negative results (Turner et al., 2001). Oxidative stress is characterized by accumulation of free radicals that can lead to motor neuron death. Free radicals damage components of the cells' membranes, proteins or genetic material by “oxidizing” them. These free radicals may be generated when the enzyme SOD malfunctions, either because of genetic mutation as occurs in some familial ALS patients or because of the chemical environment of the nerve cells, or they may be generated as a result of glutamate excitotoxicity, or for some other reason. Many ALS patients take Coenzyme Z Q10 and Vitamin E in all effort to neutralize free radicals. Glutamate is one of the most common mediators of toxicity in acute and chronic degenerative disorders (Pitt et al., 2000) like status epilepticus, cerebral ischemia, traumatic brain injury, ALS, Huntington's chorea, lathyrisms and Alzheimer's disease. Glutamate is a primary excitatory neurotransmitter in the human CNS. L-glutamate is present at a majority of synapses and is capable of displaying dual activity: it plays a pivotal role in normal functioning as an essential neurotransmitter, but becomes toxic when its physiological levels are exceeded. For spinal motor neurons, rapid glutamate removal following synaptic activity is accomplished by the glutamate transporter EAAT2 present in astrocytes. Decrease in EAAT2 activity and protein level was found in brain tissue of ALS patients (Rothstein et al., 1992), This could lead to increased extracellular concentration of glutamate and death of motor neurons. Clinically, the beneficial effect of Riluzole, a glutamate release inhibitor, on the course of the disorder in both humans and transgenic mice, led to the approved drug treatment of ALS. However, in neutralizing the toxic effect it is likely to interfere with the physiological functioning of glutamate as a ubiquitous CNS neurotransmitter. The role of immune factors, cellular and molecular, in ALS has been debated over the years. It has been argued, as in many other neurodegenerative diseases, that inflammation is associated with the disease propagation, and the usage of immunosuppressive drugs in ALS has been suggested. Also, in many ALS patients, a correlation was observed with the presence of anti-ganglioside antibodies, which led some researchers to suggest that ALS is an autoimmune disease. However, no conclusive evidence has been provided to support this hypothesis. In the laboratory of the present inventors, it has been recently observed that under neurodegenerative conditions caused by mechanical (axotomy) or biochemical (glutamate, oxidative stress) insults, the immune system plays a critical role. Thus, it has been found that activated T cells that recognize an antigen of the nervous system (NS) promote nerve regeneration or confer neuroprotection. Reference is made to PCT Publication No. WO 99/60021, the entire contents of which is hereby incorporated herein by reference. More specifically, T cells reactive to MBP were shown to be neuroprotective in rat models of partially crushed optic nerve (Moalem et al, 1999) and of spinal cord injury (Hauben et al, 2000). Until recently, it had been thought that the immune system excluded immune cells from participating in nervous system repair. It was quite surprising to discover that NS-specific activated T cells could be used to promote nerve regeneration or to protect nervous system tissue from secondary degeneration which may follow damage caused by injury or disease of the CNS or peripheral nervous system (PNS). It was further observed by the present inventors that stressful conditions in the CNS harness the adaptive immune response to cope with the stress and that this response is genetically controlled. Thus, the survival rate of retinal ganglion cells in adult mice or rats after crush injury of the optic nerve or intravitreal injection of a toxic dosage of glutamate was shown to be up to two-fold higher in strains that are resistant to CNS autoimmune diseases than in susceptible strains. The difference was found to be attributable to a beneficial autoimmune T cell response that was spontaneously evoked after CNS insult in the resistant but not in susceptible strains. Thus, the survival rate of neurons as a result of such an insult is higher when T cell response directed against self is evoked, provided that it is well-regulated. In other words, it was demonstrated that a protective autoimmune response is evoked to oppose the stressful conditions so as to protect the animal from the insult consequences. It was further observed that in animals with an impaired ability to regulate such a response, or in animals devoid of mature T cells (as a result of having undergone thymectomy at birth), the ability to cope with the stressful conditions is reduced. Consequently, the survival rate of neurons following CNS insult in these animals is significantly lower than in animals endowed with an effective mechanism for mounting protective autoimmune T cell-mediated response (Kipnis et al., 2001). It was then further found by the present inventors that vaccination with non-pathogenic synthetic copolymers that resemble self-proteins such as Copolymer 1 (Cop 1 or Glatiramer), a random copolymer composed of the four amino acids: tyrosine-glutamate-alanine-lysine (hereinafter “Cop 1”), and poly-Glu, Tyr (hereinafter “PolyYE”), and by T cells activated thereby, after traumatic CNS insult can be used to boost the protective autoimmunity and thereby to reduce further injury-induced damage, and can further protect CNS cells from glutamate toxicity. Reference is made to our previous U.S. patent application Ser. Nos. 09/756,301 and 09/765,644, both dated 22 Jan. 2001, herein incorporated by reference in their entirety as if fully disclosed herein, corresponding to WO 01/93893, which disclose that Cop 1, Cop 1-related peptides and polypeptides and T cells activated therewith protect CNS cells from glutamate toxicity (U.S. Ser. No. 09/756,301) and prevent or inhibit neuronal degeneration or promote nerve regeneration in the CNS or PNS (U.S. Ser. No. 09/765,644). Reference is further made to our previous U.S. patent application Ser. No. 09/893,344 dated 28 Jun. 2001, herein incorporated by reference in its entirety as if fully disclosed herein, which discloses that the copolymer poly-Glu 50 Tyr 50 , formerly called polyGT and also designated PolyYE, and T cells activated therewith, protect CNS cells from glutamate toxicity and also prevent or inhibit neuronal degeneration or promote nerve regenetion in the CNS or PNS. Specifically, it was shown in said applications that in optic nerve fibers, the number of surviving retinal ganglion cells was significantly higher in the Cop 1-immunized or poly-Glu, Tyr-immunized mice than in the mice injected with PBS. The sole drug approved and currently available for treatment of ALS is Riluzole (2-amino-6-(trifluoromethoxy)benzothiazole), a putative blocker of glutamate release, which appears to have some spasm-reducing effects in this condition, possibly through inhibition of glutamatergic transmission in the CNS. It is administered orally in the form of tablets. Riluzole does not cure the disease or improve symptoms. It exerts a modest to significant effect in ALS patients by elongating their life span for about 3 months, but does not improve muscular strength or neurologic function. It would be highly desirable to provide further medicaments for the treatment of motor neuron diseases, including ALS. Citation or identification of any reference in this section or any other part of this application shall not be construed as an admission that such reference is available as prior art to the invention. |
<SOH> SUMMARY OF THE INVENTION <EOH>It has now been found, in accordance with the present invention, that immunization with Cop 1 can protect transgenic mice overexpressing human SOD1 and mice after facial nerve axotomy, both models for ALS, from motor neuron degeneration. This and the fact that both Cop 1 and PolyYE are effective in protecting retinal ganglion cells from glutamate toxicity, indicates the suitability of these copolymers for the treatment of motor neurone diseases, particularly ALS. The present invention thus relates, in one aspect, to a method for reducing disease progression, for protection of motor neuron degeneration and/or for protection from glutamate toxicity in a patient suffering from a motor neurone disease (MND), which comprises immunizing said patient with a vaccine comprising an active agent selected from the group consisting of Cop 1, a Cop 1-related peptide, a Cop 1-related polypeptide, and PolyYE. The motor neurone disease (MND) is any disease affecting the motor neurones in the brain and spinal cord and includes amyotrophic lateral sclerosis (ALS), both familial (FALS) and sporadic (SALS) ALS, primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), progressive bulbar palsy (PBP or bulbar onset), and combined forms thereof such as bulbar onset ALS and bulbar onset PMA. In one embodiment, the method of the invention includes treatment also with Riluzole or any other drug suitable for treatment of MND, particularly ALS. In another aspect, the present invention provides a vaccine for reducing disease progression, for protection of motor nerve degeneration and/or for protection from glutamate toxicity in a motor neurone disease (MND), particularly ALS, comprising an active agent selected from the group consisting of Cop 1, a Cop 1-related peptide, a Cop 1-related polypeptide, and poly-Glu, Tyr. In a further aspect, the present invention relates to the use of an active agent selected from the group consisting of Cop 1, a Cop 1-related peptide, a Cop 1-related polypeptide, and poly-Glu, Tyr, for the manufacture of a vaccine for reducing disease progression, for protection of motor nerve degeneration and/or for protection from glutamate toxicity in motor neurone disease (ND), particularly ALS. The active agent may be administered without any adjuvant or it may be emulsified in an adjuvant suitable for human clinical use. The adjuvant suitable for human clinical use is selected from aluminum hydroxide, aluminum hydroxide gel, and aluminum hydroxyphosphate. In a preferred embodiment, the vaccine adjuvant is amorphous aluminum hydroxyphosphate having an acidic isoelectric point and an Al:P ratio of 1:1 (herein referred to as Alum-phos). In one preferred embodiment, the active agent of the vaccine of the invention is Cop 1. In another preferred embodiment, the active agent is poly-Glu, Tyr. In addition, the vaccine may be administered in a regimen that includes administration of Riluzole or another drug suitable for treatment of ALS. |
Image processing device and method, program, program recording medium, data structure, and data recording medium |
An image is readily changed in accordance with a user's viewpoint. Original image data of an object, captured with arbitrary points on a curved surface Ω as viewpoints, is stored. Considering a straight line Li connecting a viewpoint P and a point Ri on the object, an intersection of the straight line Li and the curved surface Ω will be denoted as Qi. When the object is viewed from the viewpoint P, a pixel value corresponding to a light ray directed from the point Ri on the object to the viewpoint P coincides with a pixel value corresponding to a light ray directed from the point Ri on the object to the point Qi on the curved surface Ω, and this pixel value corresponding to the light ray directed from the point Ri to the point Qi exists in the original image data. That is, the pixel value for the point Ri on the object as viewed from the viewpoint P can be obtained from original image data captured with the point Qi on the curved surface Ω as a viewpoint. The present invention can be applied, for example, to an image processing apparatus for obtaining an image in accordance with a user's viewpoint. |
1. An image processing apparatus for converting first image data into second image data, the image processing apparatus comprising: setting means for setting a user's viewpoint at a designated position; and converting means for converting the first image data into the second image data as viewed from the user's viewpoint, using light-ray information representing trajectories of light rays for the capture of the first image data and representing pixel values corresponding to the light rays. 2. An image processing apparatus according to claim 1, wherein the setting means detects a position of a user and sets the user's viewpoint at the position detected. 3. An image processing apparatus according to claim 1, wherein the first image data is image data representing a designated object as imaged from a plurality of viewpoints. 4. An image processing apparatus according to claim 1, wherein the first image data is captured by an imaging apparatus for capturing the first image data while moving the imaging apparatus linearly. 5. An image processing apparatus according to claim 1, wherein the converting means converts the first image data into the second image data using, of light-ray information that passes through a predetermined curved surface when the first image data is captured, light-ray information that coincides with light-ray information directed from the user's viewpoint to the predetermined curved surface. 6. An image processing apparatus according to claim 5, wherein the predetermined curved surface is either an open curved surface, or a closed curved surface surrounding a designated object. 7. An image processing apparatus according to claim 1, wherein the converting means comprises intermediate-data converting means for converting intermediate data into the second image data, the intermediate data being image data in a predetermined format, composed of pixel values corresponding to light rays incident on pixels constituting the first image data. 8. An image processing apparatus according to claim 7, wherein the intermediate data is image data in which pixel values of predetermined pixels constituting the first image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point. 9. An image processing apparatus according to claim 7, wherein the intermediate data is image data representing, for each direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays incident in a direction perpendicular to a plane that is perpendicular to a direction of the light rays, for respective points on the plane. 10. An image processing apparatus according to claim 7, wherein the intermediate data is image data representing, for respective points on a plane perpendicular to a direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays in each direction perpendicular to the plane. 11. An image processing apparatus according to claim 7, wherein the intermediate-data converting means uses, as pixel values of pixels on a virtual screen that is a predetermined virtual screen, pixel values corresponding to the light rays that coincide with straight lines connecting the user's viewpoint and the pixels on the virtual screen in the intermediate data, and uses image data composed of the pixel values on the virtual screen as the second image data. 12. An image processing apparatus according to claim 7, wherein the converting means further comprises first image-data converting means for converting the first image data into the intermediate data, and wherein the intermediate-data converting means converts the intermediate data output from the first image-data converting means into the second image data. 13. An image processing apparatus according to claim 12, wherein the first image-data converting means converts the first image data into the intermediate data that is image data in which pixel values of designated pixels constituting the first image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point. 14. An image processing apparatus according to claim 12, wherein the first image-data converting means converts the first image data into the intermediate data that is image data representing, for each direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays incident in a direction perpendicular to a plane that is perpendicular to a direction of the light rays, for respective points on the plane. 15. An image processing apparatus according to claim 12, wherein the first image-data converting means converts the first image data into the intermediate data that is image data representing, for respective points on a plane perpendicular to a direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays in each direction perpendicular to the plane. 16. An image processing apparatus according to claim 12, wherein the intermediate-data converting means uses, as pixel values at intersections of the light rays and a plane perpendicular to the light rays and passing through a predetermined point, pixel values corresponding to the light rays that coincide with straight lines connecting a viewpoint for the capture of the first image data and pixels of the first image data on a virtual screen that is a predetermined virtual screen, and uses image data composed of the pixel values at the intersections on the plane as the intermediate data. 17. An image processing apparatus according to claim 7, wherein the intermediate data is image data in which pixel values of designated pixels constituting the first image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point, and wherein the image processing apparatus further comprises interpolating means for interpolating pixel values at points other than the intersections with the light rays on the plane passing through the predetermined point. 18. An image processing apparatus according to claim 17, wherein the interpolating means interpolates the pixel values at the points other than the intersections with the light rays on the plane passing through the predetermined point, by pixel values at intersections of another plane passing through the predetermined point and light rays perpendicular to the another plane. 19. An image processing apparatus according to claim 7, wherein the intermediate data includes image data of an object as viewed from a position so distant that light rays from the object are substantially parallel, and also includes a direction of the light rays. 20. An image processing apparatus according to claim 1, further comprising display means for displaying the second image data. 21. An image processing method for converting first image data into second image data, the image processing method comprising: a setting step of setting a user's viewpoint at a designated position; and a converting step of converting the first image data into the second image data as viewed from the user's viewpoint, using light-ray information representing trajectories of light rays for the capture of the first image data and representing pixel values corresponding to the light rays. 22. An image processing method according to claim 21, wherein the setting step detects a position of a user and sets the user's viewpoint at the position detected. 23. An image processing method according to claim 21, wherein the first image data is image data representing a designated object as imaged from a plurality of viewpoints. 24. An image processing method according to claim 21, wherein the first image data is captured by an imaging apparatus for capturing the first image data while moving the imaging apparatus linearly. 25. An image processing method according to claim 21, wherein the converting step converts the first image data into the second image data using, of light-ray information that passes through a predetermined curved surface when the first image data is captured, light-ray information that coincides with light-ray information directed from the user's viewpoint to the predetermined curved surface. 26. An image processing method according to claim 25, wherein the predetermined curved surface is either an open curved surface, or a closed curved surface surrounding a designated object. 27. An image processing method according to claim 21, wherein the converting step comprises an intermediate-data converting step of converting intermediate data into the second image data, the intermediate data being image data in a predetermined format, composed of pixel values corresponding to light rays incident on pixels constituting the first image data. 28. An image processing method according to claim 27, wherein the intermediate data is image data in which pixel values of predetermined pixels constituting the first image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point. 29. An image processing method according to claim 27, wherein the intermediate data is image data representing, for each direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays incident in a direction perpendicular to a plane that is perpendicular to a direction of the light rays, for respective points on the plane. 30. An image processing method according to claim 27, wherein the intermediate data is image data representing, for respective points on a plane perpendicular to a direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays in each direction perpendicular to the plane. 31. An image processing method according to claim 27, wherein the intermediate-data converting step uses, as pixel values of pixels on a virtual screen that is a predetermined virtual screen, pixel values corresponding to the light rays that coincide with straight lines connecting the user's viewpoint and the pixels on the virtual screen in the intermediate data, and uses image data composed of the pixel values on the virtual screen as the second image data. 32. An image processing method according to claim 27, wherein the converting step further comprises a first image-data converting step of converting the first image data into the intermediate data, and wherein the intermediate-data converting step converts the intermediate data output from the first image-data converting means into the second image data. 33. An image processing method according to claim 32, wherein the first image-data converting step converts the first image data into the intermediate data that is image data in which pixel values of designated pixels constituting the first image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point. 34. An image processing method according to claim 32, wherein the first image-data converting step converts the first image data into the intermediate data that is image data representing, for each direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays incident in a direction perpendicular to a plane that is perpendicular to a direction of the light rays, for respective points on the plane. 35. An image processing method according to claim 32, wherein the first image-data converting step converts the first image data into the intermediate data that is image data representing, for respective points on a plane perpendicular to a direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays in each direction perpendicular to the plane. 36. An image processing method according to claim 32, wherein the intermediate-data converting step uses, as pixel values at intersections of the light rays and a plane perpendicular to the light rays and passing through a predetermined point, pixel values corresponding to the light rays that coincide with straight lines connecting a viewpoint for the capture of the first image data and pixels of the first image data on a virtual screen that is a predetermined virtual screen, and uses image data composed of the pixel values at the intersections on the plane as the intermediate data. 37. An image processing method according to claim 27, wherein the intermediate data is image data in which pixel values of designated pixels constituting the first image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point, and wherein the image processing method further comprises an interpolating step of interpolating pixel values at points other than the intersections with the light rays on the plane passing through the predetermined point. 38. An image processing method according to claim 37, wherein the interpolating step interpolates the pixel values at the points other than the intersections with the light rays on the plane passing through the predetermined point, by pixel values at intersections of another plane passing through the predetermined point and light rays perpendicular to the another plane. 39. An image processing method according to claim 27, wherein the intermediate data includes image data of an object as viewed from a position so distant that light rays from the object are substantially parallel, and also includes a direction of the light rays. 40. An image processing method according to claim 21, further comprising a display step of displaying the second image data. 41. A program for allowing a computer to execute image processing for converting first image data into second image data, the program comprising: a setting step of setting a user's viewpoint at a designated position; and a converting step of converting the first image data into the second image data as viewed from the user's viewpoint, using light-ray information representing trajectories of light rays for the capture of the first image data and representing pixel values corresponding to the light rays. 42. A program recording medium having recorded thereon a program for allowing a computer to execute image processing for converting first image data into second image data, the program comprising: a setting step of setting a user's viewpoint at a designated position; and a converting step of converting the first image data into the second image data as viewed from the user's viewpoint, using light-ray information representing trajectories of light rays for the capture of the first image data and representing pixel values corresponding to the light rays. 43. An image processing apparatus for converting image data, the image processing apparatus comprising: obtaining means for obtaining the image data captured from a plurality of viewpoints; and converting means for converting the image data into intermediate data, the intermediate data being image data in which pixel values of predetermined pixels constituting the image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point. 44. An image processing apparatus according to claim 43, wherein the converting means converts the image data into the intermediate data that is image data representing, for each direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays incident in a direction perpendicular to a plane that is perpendicular to a direction of the light rays, for respective points on the plane. 45. An image processing apparatus according to claim 43, wherein the converting means converts the image data into the intermediate data that is image data representing, for respective points on a plane perpendicular to a direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays in each direction perpendicular to the plane. 46. An image processing apparatus according to claim 43, wherein the converting means uses, as pixel values at intersections of the light rays and a plane perpendicular to the light rays and passing through a predetermined point, pixel values corresponding to the light rays that coincide with straight lines connecting a viewpoint for the capture of the image data and pixels of the first image data on a virtual screen that is a predetermined virtual screen, and uses image data composed of the pixel values at the intersections on the plane as the intermediate data. 47. An image processing apparatus according to claim 43, wherein the intermediate data is image data in which pixel values of predetermined pixels constituting the image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point, and wherein the image processing apparatus further comprises interpolating means for interpolating pixel values at points other than the intersections with the light rays on the plane passing through the predetermined point. 48. An image processing apparatus according to claim 47, wherein the interpolating means interpolates the pixel values at the points other than the intersections with the light rays on the plane passing through the predetermined point, by pixel values at intersections of another plane passing through the predetermined point and light rays perpendicular to the another plane. 49. An image processing apparatus according to claim 43, wherein the intermediate data includes image data of an object as viewed from a position so distant that light rays from the object are substantially parallel, and also includes a direction of the light rays. 50. An image processing method for converting image data, the image processing method comprising: an obtaining step of obtaining the image data captured from a plurality of viewpoints; and a converting step of converting the image data into intermediate data, the intermediate data being image data in which pixel values of predetermined pixels constituting the image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point. 51. An image processing method according to claim 50, wherein the converting step converts the image data into the intermediate data that is image data representing, for each direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays incident in a direction perpendicular to a plane that is perpendicular to the direction of the light rays, for respective points on the plane. 52. An image processing method according to claim 50, wherein the converting step converts the image data into the intermediate data that is image data representing, for respective points on a plane perpendicular to a direction of the light rays incident on the pixels constituting the first image data, pixel values corresponding to the light rays in each direction perpendicular to the plane. 53. An image processing method according to claim 50, wherein the converting step uses, as pixel values at intersections of the light rays and a plane perpendicular to the light rays and passing through a predetermined point, pixel values corresponding to the light rays that coincide with straight lines connecting a viewpoint for the capture of the image data and pixels of the first image data on a virtual screen that is a predetermined virtual screen, and uses image data composed of the pixel values at the intersections on the plane as the intermediate data. 54. An image processing method according to claim 50, wherein the intermediate data is image data in which pixel values of predetermined pixels constituting the image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point, and wherein the image processing method further comprises an interpolating step of interpolating pixel values at points other than the intersections with the light rays on the plane passing through the predetermined point. 55. An image processing method according to claim 54, wherein the interpolating step interpolates the pixel values at the points other than the intersections with the light rays on the plane passing through the predetermined point, by pixel values at intersections of another plane passing through the predetermined point and light rays perpendicular to the another plane. 56. An image processing method according to claim 50, wherein the intermediate data includes image data of an object as viewed from a position so distant that light rays from the object are substantially parallel, and also includes a direction of the light rays. 57. A program for allowing a computer to execute image processing for converting image data, the program comprising: an obtaining step of obtaining the image data captured from a plurality of viewpoints; and a converting step of converting the image data into intermediate data, the intermediate data being image data in which pixel values of predetermined pixels constituting the image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point. 58. A program recording medium having recorded thereon a program for allowing a computer to execute image processing for converting image data, the program comprising: an obtaining step of obtaining the image data captured from a plurality of viewpoints; and a converting step of converting the image data into intermediate data, the intermediate data being image data in which pixel values of predetermined pixels constituting the image data are pixel values at intersections of light rays incident on the predetermined pixels and a plane perpendicular to the light rays and passing through a predetermined point. 59. A data structure of image data, wherein intersections of light rays incident on predetermined pixels constituting original image data and a plane perpendicular to the light rays and passing through a predetermined point serve as pixels, and wherein pixel values of the pixels are used as pixel values of the predetermined pixels. 60. A data structure according to claim 59, wherein, for each direction of light rays incident on pixels constituting the original image data, pixel values corresponding to the light rays incident in a direction perpendicular to a plane that is perpendicular to the direction of the light rays, for respective points on the plane, are arranged. 61. A data structure according to claim 59, wherein, for respective points on a plane perpendicular to a direction of light rays incident on pixels constituting the original image data, pixel values corresponding to the light rays in each direction perpendicular to the plane are arranged. 62. A data structure according to claim 59, wherein pixel values at points other than the intersections with the light rays on the plane passing through the predetermined point are interpolated. 63. A data structure according to claim 62, wherein the pixel values at the points other than the intersections with the light rays on the plane passing through the predetermined point are interpolated by pixel values at intersections of another plane passing through the predetermined point and light rays perpendicular to the another plane. 64. A data recording medium having recorded image data thereon, wherein intersections of light rays incident on predetermined pixels constituting original image data and a plane perpendicular to the light rays and passing through a predetermined point serve as pixels, and wherein pixel values of the pixels are used as pixel values of the predetermined pixels. 65. An image processing apparatus comprising: intermediate-data output means for outputting intermediate data in a predetermined format, the intermediate data including pixel values corresponding to light rays from an object; viewpoint output means for outputting position information of a viewpoint for the object; and intermediate-data converting means for generating an image of the object as viewed from the viewpoint, using the intermediate data. 66. An image processing apparatus according to claim 65, wherein the intermediate data is data in a predetermined format, in which pixel values corresponding to the light rays from the object and a direction of the light rays are associated with each other. 67. An image processing apparatus according to claim 65, wherein the intermediate data is data in which a direction of the light rays from the object, positions of respective points on a plane that is perpendicular to the direction of the light rays and passing through a predetermined point, and pixel values corresponding to the light rays incident on the respective points in a direction perpendicular to the plane are associated with each other. 68. An image processing apparatus according to claim 67, wherein the intermediate data is image data representing the pixel values for the positions of the respective points with regard to the direction of the light rays. 69. An image processing apparatus according to claim 67, wherein the intermediate data is image data representing the pixel values for the respective points on the plane with regard to each direction of the light rays. 70. An image processing apparatus according to claim 65, wherein the intermediate data includes image data of the object as viewed from a position so distant that light rays from the object are substantially parallel, and also includes a direction of the light rays. 71. An image processing apparatus according to claim 66, wherein the intermediate-data converting means uses, as pixel values of pixels on a virtual screen that is a predetermined virtual screen, pixel values corresponding to the light rays that coincide with straight lines connecting the viewpoint and the pixels on the virtual screen in the intermediate data, and uses image data composed of the pixel values on the virtual screen as an image of the object as viewed from the viewpoint. 72. An image processing apparatus according to claim 67, further comprising interpolating means for interpolating missing pixel values on the plane passing through the predetermined point. 73. An image processing apparatus according to claim 65, further comprising display means for displaying an image of the object as viewed from the viewpoint. 74. An image processing method comprising: an intermediate-data output step of outputting intermediate data in a predetermined format, the intermediate data including pixel values corresponding to light rays from an object; a viewpoint output step of outputting position information of a viewpoint for the object; and an intermediate-data converting step of generating an image of the object as viewed from the viewpoint, using the intermediate data. 75. An image processing method according to claim 74, wherein the intermediate data is data in a predetermined format, in which pixel values corresponding to the light rays from the object and a direction of the light rays are associated with each other. 76. An image processing method according to claim 74, wherein the intermediate data is data in which a direction of the light rays from the object, positions of respective points on a plane that is perpendicular to the direction of the light rays and passing through a predetermined point, and pixel values corresponding to the light rays incident on the respective points in a direction perpendicular to the plane are associated with each other. 77. An image processing method according to claim 76, wherein the intermediate data is image data representing the pixel values for the positions of the respective points with regard to the direction of the light rays. 78. An image processing method according to claim 76, wherein the intermediate data is image data representing the pixel values for the respective points on the plane with regard to each direction of the light rays. 79. An image processing method according to claim 74, wherein the intermediate data includes image data of the object as viewed from a position so distant that light rays from the object are substantially parallel, and also includes a direction of the light rays. 80. An image processing method according to claim 75, wherein the intermediate-data converting step uses, as pixel values of pixels on a virtual screen that is a predetermined virtual screen, pixel values corresponding to the light rays that coincide with straight lines connecting the viewpoint and the pixels on the virtual screen in the intermediate data, and uses image data composed of the pixel values on the virtual screen as an image of the object as viewed from the viewpoint. 81. An image processing method according to claim 76, further comprising an interpolating step of interpolating missing pixel values on the plane passing through the predetermined point. 82. An image processing method according to claim 74, further comprising a display step of displaying an image of the object as viewed from the viewpoint. 83. A program that is executed by a computer, the program comprising: an intermediate-data output step of outputting intermediate data in a predetermined format, the intermediate data including pixel values corresponding to light rays from an object; a viewpoint output step of outputting position information of a viewpoint for the object; and an intermediate-data converting step of generating an image of the object as viewed from the viewpoint, using the intermediate data. 84. A program recording medium having recorded thereon a program that is executed by a computer, the program comprising: an intermediate-data output step of outputting intermediate data in a predetermined format, the intermediate data including pixel values corresponding to light rays from an object; a viewpoint output step of outputting position information of a viewpoint for the object; and an intermediate-data converting step of generating an image of the object as viewed from the viewpoint, using the intermediate data. |
<SOH> BACKGROUND ART <EOH>In conventional displays based on CRTs (Cathod Ray Tubes), liquid crystal panels, or projectors, an image captured, for example, by a video camera (hereinafter simply referred to as a camera when appropriate) is displayed, which is simply as viewed from a camera's position as a viewpoint, as shown in FIG. 1 . Thus, for example, even when a user moves his/her head to change his/her viewpoint for viewing an image displayed on a display, the image displayed on the display remains an image as viewed from a lens center of the camera (hereinafter referred to as a camera's viewpoint when appropriate), and the image displayed on the display does not change in accordance with the change in the user's viewpoint. In view of this situation, as an example of image display method by which an image displayed on a display changes in accordance with a user's viewpoint, a method called zebra imaging is used. However, zebra imaging is a method based on holography. Since an image displayed by zebra imaging is a hologram, a large amount of computation and time is required for generating the image. As another example of image display method by which an image displayed on a display changes in accordance with a user's viewpoint, VR (Virtual Reality) systems based on IPT (Immersive Projection Technology) or IPD (Immersive Projection Display), such as CAVE developed at Illinois University, are known. However, such VR systems are directed to images of CG (Computer Graphics), and it is difficult to display real images captured by video cameras. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 is a diagram showing a conventional method for displaying an image. FIG. 2 is a diagram showing an example configuration of an image display apparatus according to an embodiment of the present invention. FIG. 3 is a block diagram showing an example hardware configuration of a computer 1 . FIG. 4A is a diagram showing a method of displaying an image by the image display apparatus. FIG. 4B is a diagram showing a method of displaying an image by the image display apparatus. FIG. 4C is a diagram showing a method of displaying an image by the image display apparatus. FIG. 5 is a block diagram showing a first example of the functional configuration of a computer as an image processing apparatus. FIG. 6 is a flowchart showing image processing by the image processing apparatus. FIG. 7 is a block diagram showing an example of the functional configuration of an image generating apparatus for capturing (generating) image data to be stored in an image database 2 . FIG. 8 is a flowchart showing an image generating process by the image generating apparatus. FIG. 9 is a diagram showing a motion base system. FIG. 10A is a diagram showing an example of movement of the motion base. FIG. 10B is a diagram showing an example of movement of the motion base. FIG. 11 is a diagram showing a turntable system. FIG. 12 is a perspective view showing an example configuration of a camera 41 . FIG. 13 is a diagram showing omnidirectional image data. FIG. 14 is a diagram showing hyperboloids constituting a condenser 52 . FIG. 15 is a diagram for explaining positional relationship between the condenser 52 and an imager 53 . FIG. 16 is a diagram showing omnidirectional image data. FIG. 17 is a diagram for explaining extraction from the omnidirectional image data. FIG. 18 is a diagram for explaining a distortion in a circumferential direction. FIG. 19 is a diagram for explaining a distortion in a radial direction. FIG. 20 is a diagram for explaining a method for removing the distortion in the radial direction. FIG. 21 is a diagram for explaining a method for removing a distortion in a radial direction. FIG. 22A is a diagram for explaining conversion of omnidirectional image data by which a distortion in a radial direction is removed. FIG. 22B is a diagram for explaining conversion of omnidirectional image data by which a distortion in a radial direction is removed. FIG. 23 is a diagram for explaining a method for calculating a pixel value at a conversion-subject point. FIG. 24 is a diagram showing the principles for converting original image data into presentation image data as viewed from a user. FIG. 25 is a diagram showing the principles for converting original image data into presentation image data as viewed from a user. FIG. 26 is a diagram showing a method for converting original image data into intermediate data. FIG. 27 is a flowchart showing an image-data conversion process for converting original image data into intermediate data. FIG. 28 is a diagram showing an image-data conversion process for converting original image data into intermediate data. FIG. 29A is a diagram showing a format of intermediate data. FIG. 29B is a diagram showing the format of intermediate data. FIG. 30 is a diagram showing image data serving as intermediate data. FIG. 31A is a diagram showing interpolation of image data that serves as intermediate data. FIG. 31B is a diagram showing interpolation of image data that serves as intermediate data. FIG. 32 is a flowchart showing a pixel-value interpolation process for interpolating image data that serves as intermediate data. FIG. 33 is a block diagram showing an example configuration of a classification-adaptation processing apparatus for executing a classification-adaptation process. FIG. 34 is a block diagram of a learning apparatus for learning tap coefficients used in the classification-adaptation process. FIG. 35A is a diagram showing another format of intermediate data. FIG. 35B is a diagram showing the another format of intermediate data. FIG. 36 is a flowchart showing an intermediate-data conversion process for converting intermediate data into presentation image data. FIG. 37 is a diagram showing an intermediate-data conversion process for converting intermediate data into presentation image data. FIG. 38 is a block diagram showing a second example of the functional configuration of the computer 1 as an image processing apparatus. FIG. 39A is a diagram showing the principles for converting original image data into presentation image data. FIG. 39B is a diagram showing the principles for converting original image data into presentation image data. FIG. 40 is a flowchart for explaining image processing executed by the image processing apparatus. FIG. 41 is a diagram showing a method for the capture of original image data stored in the image database 2 . FIG. 42 is a diagram showing how original image data is captured with a camera being moved. FIG. 43 is a diagram showing intermediate data composed of strip images. FIG. 44 is a diagram showing an example of original image data. FIG. 45A is a diagram showing an example of image data that serves as intermediate data. FIG. 45B is a diagram showing an example of image data that serves as intermediate data. FIG. 45C is a diagram showing an example of image data that serves as intermediate data. FIG. 45D is a diagram showing an example of image data that serves as intermediate data. FIG. 45E is a diagram showing an example of image data that serves as intermediate data. FIG. 46 is a flowchart showing an image-data conversion process for converting original image data into intermediate data. FIG. 47 is a diagram showing an image-data conversion process for converting original image data into intermediate data. FIG. 48A is a diagram showing a format of intermediate data. FIG. 48B is a diagram showing the format of intermediate data. FIG. 49 is a flowchart showing a pixel-value interpolation process for interpolating image data that serves as intermediate data. FIG. 50 is a flowchart showing an intermediate-data conversion process for converting intermediate data into presentation image data. FIG. 51 is a diagram showing an intermediate-data conversion process for converting intermediate data into presentation image data. FIG. 52 is a block diagram showing a third example of the functional configuration of the computer 1 as an image processing apparatus. FIG. 53 is a diagram showing a method for calculating imaging conditions. FIG. 54 is a flowchart showing an imaging-condition calculating process for estimating imaging conditions. detailed-description description="Detailed Description" end="lead"? |
Shipping container convertible to dispensing or all around display container |
A shipping container for facilitating the conversion of the shipping container into a dispensing or all-around display container from formed an outer blank (10) having a centrally positioned bottom wall (12), front and rear walls (18, 26), top panels (32, 38), side flaps (14, 16, 22, 24, 28, 30, 34, 36, 40, 42) and an interior divider structure (50) for structural stacking support both during shipping and display modes. |
1. A shipping container convertible to a display container, comprising: an outer wrap including a bottom wall; a front wall connected to a front edge of the bottom wall; a rear wall connected to a rear edge of the bottom wall; a first top panel connected to a top edge of the front wall and extending rearwardly therefrom; a second top panel connected to a top edge of the rear wall and extending forwardly therefrom; first and second front side panels connected to respective side edges of the front wall and extending rearwardly therefrom; first and second rear side panels connected to respective side edges of the rear wall and extending forwardly therefrom; first and second bottom side flaps connected to side edges of the bottom wall and extending upwardly therefrom, the first and second bottom side flaps overlapping lower portions of the first and second front and rear side panels; first and second front top flaps connected to side edges of the front top panel, and extending downwardly therefrom; first and second rear top flaps connected to side edges of the rear top panel, and extending downwardly therefrom; at least one of the front wall, rear wall, first and second top panels, first and second front side panels, and first and second rear side panels including regions of weakness for facilitating removal of portions thereof, for facilitated access to an interior region of the shipping container. 2. The shipping container convertible to a display container, according to claim 1, further comprising: an internal support structure including at least one internal wall member extending vertically between the bottom wall and at least one of the first and second top panels. 3. The shipping container according to claim 2, wherein the internal support structure has an E-shaped top plan configuration. 4. The shipping container according to claim 2, wherein the internal support structure is in the form of a symmetric H-shaped divider. 5. The shipping container according to claim 2, wherein the internal support structure is in the form of an asymmetrical H-shaped divider. 6. The shipping container according to claim 2, wherein the internal support is in the form of a five-cell divider, having an internal diamond-shaped column. 7. The shipping container according to claim 2, wherein the internal support is in the form of a linked “C” four cell support divider. 8. The shipping container according to claim 2, wherein the internal support is in the form of a five cell divider having an internal rectangular columnar support. 9. The shipping container according to claim 2, wherein the internal support is in the form of an asymmetrical three cell divider. 10. The shipping container according to claim 2, wherein the internal support is in the form of single cell “U” shaped support divider. 11. The shipping container according to claim 1, further comprising: an opening disposed in at least one of the front wall and the back wall, extending from one side edge of the wall to an opposite side edge of the wall, dividing the wall into a lower panel having an upper free edge and an upper face panel having a lower free edge. 12. The shipping container according to claim 11, wherein the regions of weakness comprise: a first perforation, extending from the lower free edge of the upper face panel toward a top edge of the upper face panel, adjacent one side edge thereof; a second perforation, extending from the lower free edge of the upper face panel toward the top edge of the upper face panel, adjacent an opposite side edge thereof; and a third perforation, extending along the top edge of the upper face panel, the first, second and third perforations enabling the facilitated removal of the upper face panel from remaining portions of the shipping container. 13. The shipping container according to claim 11, wherein the first and second front top flaps are affixed to the first and second front side panels, respectively, and wherein the regions of weakness comprise: first and second pairs of lines of perforations, disposed in the first and second front side panels, respectively, defining first and second zipper pull tabs, respectively, whereupon removal of the first and second zipper pull tabs, the upper face panel, the front top panel, first and second front top flaps and upper portions of the first and second front side panels are removable as a unit, to provide front and top access to remaining portions of the shipping container. 14. The shipping container according to claim 13, wherein the first and second rear top flaps are affixed to the first and second rear side panels, respectively, and wherein the regions of weakness comprise: first and second pairs of lines of perforations, disposed in the first and second rear side panels, respectively, and extending into and meeting in the rear wall panel, defining at least a third zipper pull tab, respectively, whereupon removal of the first, second, and at least third zipper pull tabs, the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall are removable as a unit, to provide front, top and rear access to remaining portions of the shipping container. 15. The shipping container according to claim 14, wherein the internal support structure is affixed only to at least one of the top wall, the upper face panel, an upper portion of the first front side panel, an upper portion of the second front side panel, an upper portion of the first rear side panel, an upper portion of the second rear side panel, and an upper portion of the rear wall, whereupon removal of the first, second and at least third zipper pull tabs, the internal support structure is removable with the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall, as a unit, leaving an open-topped tray as a remaining structure. 16. The shipping container according to claim 14, wherein the first and second rear top flaps are affixed to the first and second rear side panels, respectively, and wherein the regions of weakness comprise: a tear tape, disposed in the first and second rear side panels, and extending across the rear wall panel, whereupon removal of the first and second zipper pull tabs and the tear tape, the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall are removable as a unit, to provide front, top and rear access to remaining portions of the shipping container. 17. The shipping container according to claim 16, wherein the internal support structure is affixed only to at least one of the top wall, the upper face panel, an upper portion of the first front side panel, an upper portion of the second front side panel, an upper portion of the first rear side panel, an upper portion of the second rear side panel, and an upper portion of the rear wall, whereupon removal of the first and second zipper pull tabs and the tear tape, the internal support structure is removable with the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall, as a unit, leaving an open-topped tray as a remaining structure. 18. The shipping container according to claim 1, wherein the at least one internal wall member extending vertically between the bottom wall and at least one of the first and second top panels, includes at least one outwardly projecting tab, and wherein at least one of the front top panel, the rear top panel, the front wall and the rear wall includes a notch operably configured for insertably receiving the at least one outwardly projecting tab. 19. The shipping container according to claim 1, wherein the internal support structure is fabricated from a blank separate and apart from the outer wrap. 20. A shipping container convertible to a display container, comprising a first blank having: a rectangular bottom wall; a front wall emanating from a front edge of the bottom wall; a rear wall emanating from an opposite rear edge of the bottom wall; a first top panel emanating from an edge of the front wall opposite the front edge of the bottom wall; a second top panel emanating from an edge of the rear wall opposite the front edge of the bottom wall; first and second front side panels emanating from respective first and second side edges of the front wall; first and second rear side panels emanating from respective first and second side edges of the rear wall; first and second bottom side flaps emanating from first and second side edges of the bottom wall, the first and second side edges extending substantially perpendicular to the front and rear edges of the bottom wall; first and second front top flaps emanating from first and second side edges of the front top panel; first and second rear top flaps emanating from first and second side edges of the rear top panel; at least one of the front wall, rear wall, first and second top panels, first and second front side panels, and first and second rear side panels including regions of weakness for facilitating removal of portions thereof, for facilitated access to an interior region of the shipping container. 21. The shipping container according to claim 20, further comprising an internal support structure formed from a blank including first and second center panels, foldably connected along adjacent respective top edges thereof; first and second back panels, foldably connected along first and second collinear fold lines to respective first and second rear edges of the first and second center panels; and first and second side panels, foldably connected along third and fourth collinear fold lines to respective first and second outer edges of the first and second back panels, opposite the first and second collinear fold lines, respectively. 22. The shipping container according to claim 20, wherein the first blank further comprises: an opening disposed in at least one of the front wall and the rear wall, extending from one side edge of the wall to an opposite side edge of the front, dividing the front wall into a lower panel having an upper free edge and an upper face panel having a lower free edge. 23. The shipping container according to claim 22, wherein the regions of weakness comprise: a first perforation, extending from the lower free edge of the upper face panel toward a top edge of the upper face panel, adjacent one side edge thereof; a second perforation, extending from the lower free edge of the upper face panel toward the top edge of the upper face panel, adjacent an opposite side edge thereof; and a third perforation, extending along the top edge of the upper face panel, the first, second and third perforations enabling the facilitated removal of the upper face panel from remaining portions of the shipping container. 24. The shipping container according to claim 23, wherein the regions of weakness comprise: first and second pairs of lines of perforations, disposed in the first and second front side panels, respectively, defining first and second zipper pull tabs, respectively. 25. The shipping container according to claim 23, wherein the regions of weakness comprise: first and second pairs of lines of perforations, disposed in the first and second rear side panels, respectively, and extending into and meeting in the rear wall panel, defining at least a third zipper pull tab. 26. The shipping container according to claim 23, wherein the regions of weakness comprise: a tear tape, disposed in the first and second rear side panels, and extending across the rear wall panel. 27. A shipping container convertible to a display container, comprising: an outer wrap including a bottom wall; a front wall connected to a front edge of the bottom wall; a rear wall connected to a rear edge of the bottom wall; a first top panel connected to a top edge of the front wall and extending rearwardly therefrom; a second top panel connected to a top edge of the rear wall and extending forwardly therefrom; first and second front side panels connected to respective side edges of the front wall and extending rearwardly therefrom; first and second rear side panels connected to respective side edges of the rear wall and extending forwardly therefrom; first and second bottom side flaps connected to side edges of the bottom wall and extending upwardly therefrom, the first and second bottom side flaps overlapping lower portions of the first and second front and rear side panels; first and second front top flaps connected to top edges of the front side panels, and extending rearwardly therefrom; first and second rear top flaps connected to top edges of the rear side panels, and extending forwardly therefrom; at least one of the front wall, rear wall, first and second top panels, first and second front side panels, and first and second rear side panels including regions of weakness for facilitating removal of portions thereof, for facilitated access to an interior region of the shipping container. 28. The shipping container according to claim 27, further comprising: an internal support structure including at least one internal wall member extending vertically between the bottom wall and at least one of the first and second top panels. 29. The shipping container according to claim 28, wherein the internal support structure has an E-shaped top plan configuration. 30. The shipping container according to claim 28, wherein the internal support structure is in the form of a symmetric H-shaped divider. 31. The shipping container according to claim 28, wherein the internal support structure is in the form of an asymmetrical H-shaped divider. 32. The shipping container according to claim 28, wherein the internal support is in the form of a five-cell divider, having an internal diamond-shaped column. 33. The shipping container according to claim 28, wherein the internal support is in the form of a linked “C” four cell support divider. 34. The shipping container according to claim 28, wherein the internal support is in the form of a five cell divider having an internal rectangular columnar support. 35. The shipping container according to claim 28, wherein the internal support is in the form of an asymmetrical three cell divider. 36. The shipping container according to claim 28, wherein the internal support is in the form of single cell “U” shaped support divider. 37. The shipping container according to claim 19, further comprising: an opening disposed in the front wall, extending from one side edge of the front wall to an opposite side edge of the front wall, dividing the front wall into a front lower panel having an upper free edge and an upper face panel having a lower free edge. 38. The shipping container according to claim 27, wherein the regions of weakness comprise: a first perforation, extending from the lower free edge of the upper face panel toward a top edge of the upper face panel, adjacent one side edge thereof; a second perforation, extending from the lower free edge of the upper face panel toward the top edge of the upper face panel, adjacent an opposite side edge thereof; and a third perforation, extending along the top edge of the upper face panel, the first, second and third perforations enabling the facilitated removal of the upper face panel from remaining portions of the shipping container. 39. The shipping container according to claim 38, wherein the first and second front top flaps emanate from the first and second front side panels, respectively, and wherein the regions of weakness comprise: first and second pairs of lines of perforations, disposed in the first and second front side panels, respectively, defining first and second zipper pull tabs, respectively, whereupon removal of the first and second zipper pull tabs, the upper face panel, the front top panel, first and second front top flaps and upper portions of the first and second front side panels are removable as a unit, to provide front and top access to remaining portions of the shipping container. 40. The shipping container according to claim 39, wherein the first and second rear top flaps emanate from the first and second rear side panels, respectively, and wherein the regions of weakness comprise: first and second pairs of lines of perforations, disposed in the first and second rear side panels, respectively, and extending into and meeting in the rear wall panel, defining at least a third zipper pull tab, respectively, whereupon removal of the first, second, and at least third zipper pull tabs, the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall are removable as a unit, to provide front, top and rear access to remaining portions of the shipping container. 41. The shipping container according to claim 40, wherein the internal support structure is affixed only to at least one of the top wall, the upper face panel, an upper portion of the first front side panel, an upper portion of the second front side panel, an upper portion of the first rear side panel, an upper portion of the second rear side panel, and an upper portion of the rear wall, whereupon removal of the first, second and at least third zipper pull tabs, the internal support structure is removable with the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall, as a unit, leaving an open-topped tray as a remaining structure. 42. The shipping container according to claim 40, wherein the first and second rear top flaps emanate from the first and second rear side panels, respectively, and wherein the regions of weakness comprise: a tear tape, disposed in the first and second rear side panels, and extending across the rear wall panel, whereupon removal of the first and second zipper pull tabs and the tear tape, the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall are removable as a unit, to provide front, top and rear access to remaining portions of the shipping container. 43. The shipping container according to claim 42, wherein the internal support structure is affixed only to at least one of the top wall, the upper face panel, an upper portion of the first front side panel, an upper portion of the second front side panel, an upper portion of the first rear side panel, an upper portion of the second rear side panel, and an upper portion of the rear wall, whereupon removal of the first and second zipper pull tabs and the tear tape, the internal support structure is removable with the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall, as a unit, leaving an open-topped tray as a remaining structure. 44. The shipping container according to claim 27, wherein the at least one internal wall member extending vertically between the bottom wall and at least one of the first and second top panels, includes at least one upwardly projecting tab, and wherein at least one of the front top panel and the rear top panel includes a notch operably configured for insertably receiving the at least one upwardly projecting tab. 45. The shipping container according to claim 27, wherein the internal support structure is fabricated from a blank separate and apart from the outer wrap. 46. The shipping container according to claim 27, further comprising markings disposed upon an outer surface of the outer wrap, for indicating locations for manual cutting of the outer wrap. 47. A shipping container convertible to a display container, comprising a blank having: a rectangular bottom wall; a front wall emanating from a front edge of the bottom wall; a rear wall emanating from an opposite rear edge of the bottom wall; a first top panel emanating from an edge of the front wall opposite the front edge of the bottom wall; a second top panel emanating from an edge of the rear wall opposite the front edge of the bottom wall; first and second front side panels emanating from respective first and second side edges of the front wall; first and second rear side panels emanating from respective first and second side edges of the rear wall; first and second bottom side flaps emanating from first and second side edges of the bottom wall, the first and second side edges extending substantially perpendicular to the front and rear edges of the bottom wall; first and second front top flaps emanating from top edges of the first and second front side panels; first and second rear top flaps emanating from top edges of the first and second rear side panels; at least one of the front wall, rear wall, first and second top panels, first and second front side panels, and first and second rear side panels including regions of weakness for facilitating removal of portions thereof, for facilitated access to an interior region of the shipping container. 48. The shipping container according to claim 47, further comprising an internal support structure formed from a second blank including first and second center panels, foldably connected along adjacent respective top edges thereof; first and second back panels, foldably connected along first and second collinear fold lines to respective first and second rear edges of the first and second center panels; and first and second side panels, foldably connected along third and fourth collinear fold lines to respective first and second outer edges of the first and second back panels, opposite the first and second collinear fold lines, respectively. 49. The shipping container according to claim 47, wherein the first blank further comprises: an opening disposed in at least one of the front wall and the rear wall, extending from one side edge of the wall to an opposite side edge of the front wall, dividing the wall into a lower panel having an upper free edge and an upper face panel having a lower free edge. 50. The shipping container according to claim 49, wherein the regions of weakness comprise: a first perforation, extending from the lower free edge of the upper face panel toward a top edge of the upper face panel, adjacent one side edge thereof; a second perforation, extending from the lower free edge of the upper face panel toward the top edge of the upper face panel, adjacent an opposite side edge thereof; and a third perforation, extending along the top edge of the upper face panel, the first, second and third perforations enabling the facilitated removal of the upper face panel from remaining portions of the shipping container. 51. The shipping container according to claim 50, wherein the regions of weakness comprise: first and second pairs of lines of perforations, disposed in the first and second front side panels, respectively, defining first and second zipper pull tabs, respectively. 52. The shipping container according to claim 51, wherein the regions of weakness comprise: first and second pairs of lines of perforations, disposed in the first and second rear side panels, respectively, and extending into and meeting in the rear wall panel, defining at least a third zipper pull tab. 53. The shipping container according to claim 52, wherein the regions of weakness comprise: a tear tape, disposed in the first and second rear side panels, and extending across the rear wall panel. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention The present invention relates to shipping containers, in particular shipping containers that are fabricated at least in part from paper, paperboard and/or corrugated paperboard material. The present invention also relates to such containers that are convertible from a shipping configuration, to a display configuration. 2. The Prior Art In stores which deal with dry goods that are sold in their own individual containers, such as grocery stores, a traditional method for placing the goods on display would be for store personnel to open the shipping containers in which the goods have been shipped from the supplier, and individually place each item on the shelf, and arrange them neatly for presentation. Typically, such containers were often structures dedicated solely to a shipping function, and when opened, were either destroyed, or resulted in an open-topped container not well suited for merchandising functions. However, this process of individual removal of goods from a shipping container, and placement on shelves, is relatively costly to the store in terms of personnel effort, time, wages, etc. Therefore, it has become desirable to reduce costs in converting goods packaged for shipping into a suitable format for display and shopping. This has resulted in the development of a variety of containers which are configured to be convertible from a shipping configuration, to a display configuration, which permits the converted container to be placed directly upon a shelf, or floor display, without having to remove the individual product items from the container. Typically, this is accomplished by providing the container with removable portions of the container that create apertures through which customers may then help themselves to the products within the converted container. Such convertible containers represent a challenge in that they must be readily convertible into a form presentable to customers, while at the same time maintaining certain shipping performance characteristics, suitable for the shipment of non-self-supporting or even fragile products. In order to reduce cost in opening and placement of the converted container, the container should be hand-convertible, without the use of a knife or other implement. At the same time, it is desirable to provide a converted display container that is relatively free of unsightly or inconvenient rough edges or debris. However, such prior art convertible containers often are either lacking in the necessary shipping performance characteristics or, in order to provide such performance, even after conversion, have structural elements that remain in position and make access to the product less convenient than desired. Other container constructions may achieve one or both of the performance or convenience goals, but at the expense of an inefficient or simply excessive use of container material. It is accordingly desirable to provide a shipping container that is convertible to a display configuration, that has improved shipping performance characteristics, together with enhanced ease of conversion, and improved “shopability” for the consumer. These and other desirable characteristics of the present invention will become apparent in view of the present specification and drawings. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention comprises, in part, a shipping container convertible to a display container, comprising an outer wrap including a bottom wall; a front wall connected to a front edge of the bottom wall; a rear wall connected to a rear edge of the bottom wall; a first top panel connected to a top edge of the front wall and extending rearwardly therefrom; a second top panel connected to a top edge of the rear wall and extending forwardly therefrom; first and second front side panels connected to respective side edges of the front wall and extending rearwardly therefrom; first and second rear side panels connected to respective side edges of the rear wall and extending forwardly therefrom; first and second bottom side flaps connected to side edges of the bottom wall and extending upwardly therefrom, the first and second bottom side flaps overlapping lower portions of the first and second front and rear side panels; first and second front top flaps connected to side edges of the front top panel, and extending downwardly therefrom; first and second rear top flaps connected to side edges of the rear top panel, and extending downwardly therefrom; at least one of the front wall, rear wall, first and second top panels, first and second front side panels, and first and second rear side panels including regions of weakness for facilitating removal of portions thereof, for facilitated access to an interior region of the shipping container. The present invention also comprises, in an alternatively embodiment, a shipping container convertible to a display container, comprising an outer wrap including a bottom wall; a front wall connected to a front edge of the bottom wall; a rear wall connected to a rear edge of the bottom wall; a first top panel connected to a top edge of the front wall and extending rearwardly therefrom; a second top panel connected to a top edge of the rear wall and extending forwardly therefrom; first and second front side panels connected to respective side edges of the front wall and extending rearwardly therefrom; first and second rear side panels connected to respective side edges of the rear wall and extending forwardly therefrom; first and second bottom side flaps connected to side edges of the bottom wall and extending upwardly therefrom, the first and second bottom side flaps overlapping lower portions of the first and second front and rear side panels; first and second front top flaps connected to top edges of the front side panels, and extending rearwardly therefrom; first and second rear top flaps connected to top edges of the rear side panels, and extending forwardly therefrom; at least one of the front wall, rear wall, first and second top panels, first and second front side panels, and first and second rear side panels including regions of weakness for facilitating removal of portions thereof, for facilitated access to an interior region of the shipping container. The present invention in a preferred embodiment, may further comprise an internal support structure including at least one internal wall member extending vertically between the bottom wall and at least one of the first and second top panels. The internal support structure may have an E-shaped top plan configuration. Alternatively, the internal support structure is in the form of a symmetric H-shaped divider. In another embodiment, the internal support structure is in the form of an asymmetrical H-shaped divider. In another alternative embodiment, the internal support is in the form of a five-cell divider, having an internal diamond-shaped column. In still another alternative embodiment, the internal support is in the form of a linked “C” four cell support divider. In yet another alternative embodiment, the internal support is in the form of a five cell divider having an internal rectangular columnar support. In still yet another alternative embodiment, the internal support is in the form of an asymmetrical three cell divider. In another embodiment of the invention, the internal support is in the form of single cell “U” shaped support divider. In another embodiment, the shipping container may further comprise an opening disposed in at least one of the front wall and the back wall, extending from one side edge of the wall to an opposite side edge of the wall, dividing the wall into a lower panel having an upper free edge and an upper face panel having a lower free edge. The regions of weakness may comprise a first perforation, extending from the lower free edge of the upper face panel toward a top edge of the upper face panel, adjacent one side edge thereof; a second perforation, extending from the lower free edge of the upper face panel toward the top edge of the upper face panel, adjacent an opposite side edge thereof; and a third perforation, extending along the top edge of the upper face panel, the first, second and third perforations enabling the facilitated removal of the upper face panel from remaining portions of the shipping container. The first and second front top flaps may be affixed to the first and second front side panels, respectively, wherein the regions of weakness may comprise first and second pairs of lines of perforations, disposed in the first and second front side panels, respectively, defining first and second zipper pull tabs, respectively, whereupon removal of the first and second zipper pull tabs, the upper face panel, the front top panel, first and second front top flaps and upper portions of the first and second front side panels are removable as a unit, to provide front and top access to remaining portions of the shipping container. The first and second rear top flaps may be affixed to the first and second rear side panels, respectively, wherein the regions of weakness comprise first and second pairs of lines of perforations, disposed in the first and second rear side panels, respectively, and extending into and meeting in the rear wall panel, defining at least a third zipper pull tab, respectively, whereupon removal of the first, second, and at least third zipper pull tabs, the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall are removable as a unit, to provide front, top and rear access to remaining portions of the shipping container. The internal support structure may be affixed only to at least one of the top wall, the upper face panel, an upper portion of the first front side panel, an upper portion of the second front side panel, an upper portion of the first rear side panel, an upper portion of the second rear side panel, and an upper portion of the rear wall, whereupon removal of the first, second and at least third zipper pull tabs, the internal support structure is removable with the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall, as a unit, leaving an open-topped tray as a remaining structure. The first and second rear top flaps may be affixed to the first and second rear side panels, respectively, wherein the regions of weakness comprise a tear tape, disposed in the first and second rear side panels, and extending across the rear wall panel, whereupon removal of the first and second zipper pull tabs and the tear tape, the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall are removable as a unit, to provide front, top and rear access to remaining portions of the shipping container. The internal support structure may be affixed only to at least one of the top wall, the upper face panel, an upper portion of the first front side panel, an upper portion of the second front side panel, an upper portion of the first rear side panel, an upper portion of the second rear side panel, and an upper portion of the rear wall, whereupon removal of the first and second zipper pull tabs and the tear tape, the internal support structure is removable with the upper face panel, the front top panel, first and second front top flaps, upper portions of the first and second front side panels, the rear top panel, first and second rear top flaps, upper portions of the first and second rear side panels, and an upper portion of the rear wall, as a unit, leaving an open-topped tray as a remaining structure. The at least one internal wall member may be extending vertically between the bottom wall and at least one of the first and second top panels, and may include at least one outwardly projecting tab, and wherein at least one of the front top panel, the rear top panel, the front wall and the rear wall includes a notch operably configured for insertably receiving the at least one outwardly projecting tab. In preferred embodiments of the invention, the internal support structure is fabricated from a blank separate and apart from the outer wrap. The present invention also comprises, in part, a shipping container convertible to a display container, comprising a first blank having a rectangular bottom wall; a front wall emanating from a front edge of the bottom wall; a rear wall emanating from an opposite rear edge of the bottom wall; a first top panel emanating from an edge of the front wall opposite the front edge of the bottom wall; a second top panel emanating from an edge of the rear wall opposite the front edge of the bottom wall; first and second front side panels emanating from respective first and second side edges of the front wall; first and second rear side panels emanating from respective first and second side edges of the rear wall; first and second bottom side flaps emanating from first and second side edges of the bottom wall, the first and second side edges extending substantially perpendicular to the front and rear edges of the bottom wall; first and second front top flaps emanating from first and second side edges of the front top panel; first and second rear top flaps emanating from first and second side edges of the rear top panel; at least one of the front wall, rear wall, first and second top panels, first and second front side panels, and first and second rear side panels including regions of weakness for facilitating removal of portions thereof, for facilitated access to an interior region of the shipping container. The present invention also comprises in part, a shipping container convertible to a display container, comprising a blank having a rectangular bottom wall; a front wall emanating from a front edge of the bottom wall; a rear wall emanating from an opposite rear edge of the bottom wall; a first top panel emanating from an edge of the front wall opposite the front edge of the bottom wall; a second top panel emanating from an edge of the rear wall opposite the front edge of the bottom wall; first and second front side panels emanating from respective first and second side edges of the front wall; first and second rear side panels emanating from respective first and second side edges of the rear wall; first and second bottom side flaps emanating from first and second side edges of the bottom wall, the first and second side edges extending substantially perpendicular to the front and rear edges of the bottom wall; first and second front top flaps emanating from top edges of the first and second front side panels; first and second rear top flaps emanating from top edges of the first and second rear side panels; at least one of the front wall, rear wall, first and second top panels, first and second front side panels, and first and second rear side panels including regions of weakness for facilitating removal of portions thereof, for facilitated access to an interior region of the shipping container. The first blank may further comprise an opening disposed in at least one of the front wall and the rear wall, extending from one side edge of the wall to an opposite side edge of the front, dividing the front wall into a lower panel having an upper free edge and an upper face panel having a lower free edge. The regions of weakness may comprise a first perforation, extending from the lower free edge of the upper face panel toward a top edge of the upper face panel, adjacent one side edge thereof; a second perforation, extending from the lower free edge of the upper face panel toward the top edge of the upper face panel, adjacent an opposite side edge thereof; and a third perforation, extending along the top edge of the upper face panel, the first, second and third perforations enabling the facilitated removal of the upper face panel from remaining portions of the shipping container. The regions of weakness may also comprise first and second pairs of lines of perforations, disposed in the first and second front side panels, respectively, defining first and second zipper pull tabs, respectively. The regions of weakness may alternatively comprise first and second pairs of lines of perforations, disposed in the first and second rear side panels, respectively, and extending into and meeting in the rear wall panel, defining at least a third zipper pull tab. Alternatively, the regions of weakness may comprise a tear tape, disposed in the first and second rear side panels, and extending across the rear wall panel. The first blank may further comprise an opening disposed in at least one of the front wall and the rear wall, extending from one side edge of the wall to an opposite side edge of the wall, dividing the wall into a front lower panel having an upper free edge and an upper face panel having a lower free edge. The shipping containers of the present invention may further comprise markings disposed upon an outer surface of the outer wrap, for indicating locations for manual cutting of the outer wrap. |
Lipid blends and food products containing oleic fatty acid and omega-6 fatty acids, designed to increase the intramyocellular lipid level |
The present invention pertains to nutritional compositions containing specific blends of dietary lipids adapted to specifically influence the level of intramyocellular lipids in muscle tissue towards either higher concentrations or lower concentrations. |
1. A lipid blend, designed to increase the intramyocellular lipid level in an individual, characterized in that it contains oleic acid of from 50-70%, n-6 linoleic acid of from 20-35%, n-6 linolenic acid or longer chain fatty acids of the n-6 family of from 15-25%, stearic and palmitic acids, together in an amount of from 0-15%, and polyunsaturated fatty acids of the n-3 family from 1-10%. 2. A lipid blend designed to decrease the accumulation of intramyocellular lipid in an individual, characterized in that it contains medium-chain fatty acids in an amount of from 40-65%; glycerides with long-chain saturated fatty acids of from 20-50%, and monounsaturated or polyunsaturated fatty acids in an amount of from 0-30%. 3. A food product characterized in that it contains a lipid blend according to claim 1 or claim 2. 4. The food product according to claim 3, characterized in that it contains carbohydrates. 5. The food product according to claim 3 or 4, which further comprises insulinogenic proteins, and optionally additionally amino acids. 6. A food product characterized in that it contains a lipid blend according to claim 5. 7. A food product according to any of the claims 3 to 6, which is selected from milk, yogurt, curd, cheese, fermented milks, milk based fermented products, ice-creams, fermented cereal based products, milk based powders, infant formulae, energy bars, liquid foods, formulae for clinical enteral nutrition, energy drinks and pet food. 8. Use of a lipid blend according to claim 1 or claim 2 for the preparation of a food product 9. The use according to claim 8, wherein the food product is selected from milk, yogurt, curd, cheese, fermented milks, milk based fermented products, ice-creams, fermented cereal based products, milk based powders, infant formulae, energy bars, liquid foods, formulae for clinical enteral nutrition, energy drinks and pet food. 10. A process for the preparation of a food product designed to increase or decrease the intramyocellular lipid level in an individual, which comprises the steps of mixing a lipid blend according to claim 1 or 2 with an ingestable carrier. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The present invention pertains to nutritional compositions containing specific blends of dietary lipids adapted to specifically influence the level of intramyocellular lipids in muscle tissue towards either higher concentrations or lower concentrations. The major energy sources for mammalian muscle cells are carbohydrates, in particular glycogen, and fat. Glycogen, a macromolecule comprised of up to 120.000 glucose monomers is stored in discrete granules in the cytoplasm of muscle and liver cells, which granules also contain the enzymes required for the synthesis or degradation of said polymer. Degradation of glycogen in muscle and liver cells is effected upon an external signal, such as a high energy requirement by muscle cells or a low blood glucose level. In the body glycogen is primarily used for quickly providing energy, since glucose may also be degraded anaerobically. Moreover, apart from providing a constant glucose level in the blood, the concentration of glycogen in the muscles has been shown to be one of the major determinants for endurance capacity. In consequence, for athletes it is important to ingest adequate amounts of carbohydrates before sportive activity to increase endurance. Fat, apart from providing essential fatty acids and a solvent system for vitamins, also represents a major fuel for mammalian daily physical activities. It is available for oxidation in muscle cells both from extramuscular sources, represented by circulating lipids, and intramuscular sources. The intramuscular source is essentially comprised by two distinct lipid compartments. One source is constituted by adipocytes, present in-between muscle fibers and designated extramyocellular lipids (EMCL). Another compartment for lipid storage is represented by discrete lipid droplets in contact with muscle mitochondria, which lipid source is termed intramyocellular lipids (IMCL). Depending on the workload, muscle energy metabolism uses different proportions of carbohydrates and lipids. In the recent past, research has shown that an unexpectedly high proportion of the lipid energy during endurance exercise was being derived from muscle triglycerides. To this end, it has been observed that prolonged sustained exercise enlarges muscle triglyceride stores (Morgan et al., Am. J. Physiol. 216 (1969), 82-86) as well as fatty acid uptake and oxidation (Turcotte et al., Am. J. Physiol. 262 (1992), E791-E799), which fact is deemed to be one of the reasons for sparing glycogen during submaximal periods of an exercise and eventually add to an increased physical performance. On the other hand, the provision of high carbohydrate food material, which is known to be optimal for glycogen loading before activity, might also lead to a reduction in muscle fat stores. In addition, prolonged sustained exercise is considered to essentially lead to a depletion of IMCL (Oberholzer et al., Schweiz Z. Sportmed: 24 (1976), 71-98). It is, therefore, presently deemed that exercise conditions may exist that limit the exercise capacity simply due to a reduced availability of locally stored lipids. Consequently, there is a need in the art for means to influence the intramyocellular lipid level in muscle cells, so as to provide an optimal balance between glycogen and IMCL as energy stores. |
<SOH> SUMMARY OF THE INVENTION <EOH>An object of the present invention resides therefore in providing such means. This problem has been solved by a lipid blend containing particular lipids in an amount such that the level of intramyocellular lipids in muscle cells of the respective individuals is influenced. To this end, the present invention provides a lipid blend, designed to increase the intramyocellular lipid level in an individual, comprising oleic acid from 50-70%, n-6 linoleic acid from 20-35%, n-6 linolenic acid or longer chain fatty acids of the n-6 family from 15-25%, stearic and palmitic acids, together in an amount from 0-15%, and polyunsaturated fatty acids of the n-3 family from 1-10%. Additional features and advantages of the present invention are described in, and will be apparent from, the following Detailed Description of the Invention and the figures. |
Complexed surfactant system |
The present invention relates to a mixed surfactant system, and particularly to a mixed surfactant system which comprises an anionic surfactant and a compound comprising at least one kind of non-ionic group or cationic group, and which thus increases cleaning power of the anionic surfactant, increases stability to hard water, lowers surface tension and cmc, and can control initial foamability and foam stability by the mixing ratio of the non-ionic surfactant and the cationic surfactant that can be added together, and that is therefore very useful for a detergent of solid, liquid, gel, or paste types. |
1. A surfactant system comprising a) an anionic surfactant; b) a cationic compound represented by the following Chemical Formula 1; and c) a non-ionic surfactant: (wherein R1, R2, R3, and R4 are independently or simultaneously C1˜C20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, or hydroxy ethyl groups to which 1 to 20 ethylene oxide or propylene oxide groups are attached; and X is a halogen atom, a sulfate group, or an acetate group). 2. The surfactant system according to claim 1, wherein the mixing ratio of the a) anionic surfactant, the b) cationic compound, and the c) non-ionic surfactant is 1:0.001:0.001˜1:1:1 by mole ratio. 3. The surfactant system according to claim 1, wherein the cationic compound is prepared by a process comprising the step of heat-reacting a tertiary amine with an alkyl halide under an alkaline condition to cause quaternarization. 4. A surfactant system comprising a) an anionic surfactant; and b) a cationic compound represented by the following Chemical Formula 2: (wherein R1, R2, R3, and R5 are independently or simultaneously C1˜C20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, or hydroxy ethyl groups to which 1 to 20 ethylene oxide or propylene oxide groups are attached; R4 is a C1˜C20 alkyl group, an alkyl group to which 1 to 10 ethylene oxide or propylene oxide groups are attached, or an alkyl group to which 1 or more hydroxyl groups are bound; n is an integer of 1 to 20; and X is a halogen atom, a sulfate group, or an acetate group.) 5. The surfactant system according to claim 4, wherein the mixing ratio of the a) anionic surfactant and the b) cationic compound is 1:0.0001˜1:0.5 by mole ratio. 6. The surfactant system according to claim 4, wherein the cationic compound is selected from a group consisting of 1,6-[2-(N-dimethylamino)ethanol]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol]hexane, 1,8-[2-(N-dimethylamino)ethanol]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol]octane, 1,8-[2-(N,N-butylmethylamino)ethanol]octane, 1,8-[2-(N,N-methyloctylamino)ethanol]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol]octane, 1,6-[2-(N-dimethylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(EO)2hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(EO)2]hexane, 1,6-[2-(N-dimethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(EO)4]hexane, 1,8-[2-(N-dimethylamino)ethanol(EO)2]octane, 1,7-[2-(N,N-ethylmethylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(EO)2] octane, 1,8-[2-(N,N-methyloctylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(EO)2]octane, 1,8-[2-(N-dimethylamino)ethanol(EO)4]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(EO)4]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(EO)4]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(EO)4]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(EO)4]octane, 1,6-[2-(N-dimethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N-dimethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(PO)4]hexane, 1,8-[2-(N-dimethylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(PO)2]octane, 1,8-[2-(N-dimethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(PO)4]octane, and a mixture thereof. 7. The surfactant system according to claim 4, wherein the cationic compound comprises one or more kinds of quaternary ammonium salts comprising one or more kinds of hydroxy ethyl groups in a molecule, and one or more kinds of quaternary ammonium salts comprising a functional group in which 2 to 10 moles of ethylene oxide (EO) or propylene oxide (PO) groups are added to the hydroxyl group. 8. The surfactant system according to claim 4, wherein the cationic compound is prepared by a process comprising the steps of i) reacting a secondary amine with an alkyl halide under an alkaline condition to prepare a tertiary amine; and ii) binding a linker represented by the following Chemical Formula 3 to the tertiary amine obtained in step i) to cause quaternarization: X+CH2)n-X [Chemical Formula 3] (wherein n is an integer of 1 to 20; and X is a halogen atom, a sulfate group, or an acetate group.). 9. The surfactant system according to claim 8, wherein the cationic compound is prepared by a process comprising the steps of i) binding the linker of Chemical Formula 3 with a secondary amine under an alkaline condition to prepare a tertiary amine; and ii) binding an alkyl halide to the tertiary amine obtained in step i) to cause quaternarization. 10. The surfactant system according to claim 1, wherein the anionic surfactant is selected from a group consisting of sodium lauryl sulfonate (SLS), sodium lauryl ether sulfonate (SLES), a linear alkyl benzene sulfonate (LAS), monoalkyl phosphate (MAP), acyl isethionate (SCI), an alkyl glyceryl ether sulfonate (AGES), acylglutamate, acyltaurate, a fatty acid metal salt, and a mixture thereof. 11. The surfactant system according to claim 1, wherein the non-ionic surfactant is selected from a group consisting of an ethoxylated fatty alcohol, an ethoxylated fatty acid, an ethoxylated alkyl phenol, an alkanolamide (fatty acid alkanolamide), an ethoxylated fatty acid alkanolamide, a fatty amine oxide, a fatty amido amine oxide, a glyceryl fatty acid ester, sorbitan, an ethoxylated sorbitan ester, an alkyl poly glycoside, an ethylene/propylene oxide copolymer, an ethoxylated-propoxylated fatty alcohol, and a mixture thereof. 12. A surfactant system comprising a) an anionic surfactant; and b) a compound represented by the following Chemical Formula 4: (wherein R1, R2, R3, and R4 are independently or simultaneously C1˜20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, or hydroxy ethyl groups to which 1 to 20 ethylene oxide or propylene oxide groups are added; R5 is a C1˜20 alkyl group, an alkyl group to which 1 to 20 ethylene oxide or propylene oxide groups are added, an alkyl group to which one or more hydroxyl groups are bound, an alkyl group comprising at least one double bond, or an alkyl group comprising at least one ether group; A1 and A2 are independently or simultaneously C1˜20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, hydroxy ethyl groups to which 1 to 20 ethylene oxide or propylene oxide groups are added, or oxygen anions (O—); n is an integer of 0 to 20; X is a halogen atom, a sulfate group, a methyl sulfate group, or an acetate group.). 13. The surfactant system according to claim 12, wherein the mixing ratio of the a) anionic surfactant and the b) compound of Chemical Formula 4 is 1:0.0001˜1:1.0 by mole ratio. 14. A surfactant system comprising a) an anionic surfactant; b) a compound represented by the following Chemical Formula 4; and c) a non-ionic surfactant, a cationic surfactant or a mixture thereof: (wherein R1, R2, R3, and R4 are independently or simultaneously C1˜20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, or hydroxy ethyl groups to which 1 to 20 ethylene oxide or propylene oxide groups are added; R5 is a C1˜20 alkyl group, an alkyl group to which 1 to 20 ethylene oxide or propylene oxide groups are added, an alkyl group to which one or more hydroxyl groups are bound, an alkyl group comprising at least one double bond, or an alkyl group comprising at least one ether group; A1 and A2 are independently or simultaneously C1˜20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, hydroxy ethyl groups to which 1 to 20 ethylene oxide or propylene oxide groups are added, or oxygen anions (O—); n is an integer of 0 to 20; and X is a halogen atom, a sulfate group, a methylsulfate group, or an acetate group.). 15. The surfactant system according to claim 14, wherein the mixing ratio of the a) anionic surfactant, the b) compound of Chemical Formula 4 and the c) non-ionic surfactant is 1:0.0001:0.000 1˜1:1.0:0.5 by mole ratio. 16. The surfactant system according to claim 14, wherein the mixing ratio of the a) anionic surfactant, the b) compound of Chemical Formula 4, and the c) cationic surfactant is 1:0.0001:0.0001˜1:1.0:0.5. 17. The surfactant system according to claim 14, wherein the mixing ratio of the a) anionic surfactant, the b) compound of Chemical Formula 4, and the c) mixture of non-ionic surfactant and cationic surfactant is 1:0.0001:0.0001˜1:1.0:0.5. 18. The surfactant system according to claim 12, wherein the compound of Chemical Formula 4 is a non-ionic compound selected from a group consisting of N,N,N-dimethyllauryl amine oxide; N,N,N-ethylmethyllauryl amine oxide; N,N,N-dimethyldodecyl amine oxide; N,N,N-butylmethyllauryl amine oxide; N,N,N-dimethylhexadecyl amine oxide; N,N,N-dibutyllauryl amine oxide; N,N,N-(2-hydroxyethyllaurylmethyl)amine oxide; N,N,N-(di-2-hydroxyethyllauryl)amine oxide; N,N,N-(2-hydroxyethyllaurylbutyl)amine oxide; N,N,N-(2-hydroxy(EO)5ethyllaurylmethyl)amine oxide; N,N,N-(2-hydroxyethyl(PO)5 1 aurylmethyl)amine oxide; N,N,N-(2-hydroxyethyl(EO)5(PO)5laurylmethyl)amine oxide; N,N,N-(2-hydrxoyethyl(EO)10laurylmethyl)amine oxide; N,N,N-(2-hydrxoyethyl(EO)15laurylmethyl)amine oxide; 1,6-(N,N-butylmethylaminooctyl)hexane; 1,6-(N,N-butylmethylaminooctyl)dipropylether; 1,6-(N,N-butylmethylaminooctyl)-3-hydroxyhexane; 1,6-(N,N-butylmethylaminooctyl) butane; 1,6-(N,N-butylmethylaminooctyl) octane; 1,6-(N,N-butylmethyl amin oxyl)-2-hydroxypropane; 1,6-[2-(N-methylaminooctyl)ethanol]hexane; 1,6-[2-(N-methylaminooctyl)ethanol(EO)5]hexane; 1,6-[2-(N-methylaminooctyl)ethanol(PO)5]hexane; 1,6-[2-(N-methylaminooctyl)ethanol(EO)5(PO)5]hexane; 1,6-[2-(N-methylaminooctyl)ethanol (EO)10]hexane; 1,6-[2-(N-methylaminooctyl)ethanol]dipropylether; 1,6-[2-(N-methylaminooctyl)ethanol]-2-hydroxypropane; 1,6-[2-(N-methylaminooctyl)Ethanol]butane; 1,6-[2-(N-methylaminooctyl)ethanol]octane; and a mixture thereof. 19. The surfactant system according to claim 18, wherein the non-ionic compound is prepared by reacting a tertiary amine with peroxide. 20. The surfactant system according to claim 18, wherein the non-ionic compound is prepared by binding a linker represented by the following Chemical Formula 5 to a secondary amine to obtain a tertiary amine, and then reacting the tertiary amine with hydrogen peroxide: (wherein n is an integer of 1 to 20; X is a halogen atom; and R5 is hydrogen or an alkyl or allyl group comprising at least one double bond, a hydroxyl group, or an ether group.). 21. The surfactant system according to claim 12, wherein the compound of Chemical Formula 4 is a cationic compound selected from a group consisting of dimethyloctylethoxy ammonium, dimethyl decyl ethoxy ammonium, dimethyl lauryl ethoxy ammonium, dimethyloctylethanol (EO)5 ammonium, dimethyldecylethanol (EO)5 ammonium, dimethyllaurylethanol (EO)5 ammonium, dimethyloctylethanol (EO)10 ammonium, dimethyldecylethanol (EO)10 ammonium, dimethyllaurylethanol (EO)10 ammonium, dimethyloctylethanol (EO)15 ammonium, dimethyldecylethanol (EO)15 ammonium, dimethyllaurylethanol(EO)15 ammonium, trimethyloctyl ammonium, tridecyllauryl ammonium, trimethyllauryl ammonium, 1,6-[2-(N-dimethylamino)ethanol]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol]hexane, 1,8-[2-(N-dimethylamino)ethanol]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol]octane, 1,8-[2-(N,N-butylmethylamino)ethanol]octane, 1,8-[2-(N,N-methyloctylamino)ethanol]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol]octane, 1,6-[2-(N,-dimethylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(EO)2]hexane, 1,6-[2-(N-dimethylamino)ethanol(EO)4]hexane, 1,6-[2-(N-dimethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(EO)4]hexane, 1,8-[2-(N-dimethylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(EO)4]octane, 1,8-[p2-(N,N-butylmethylamino)ethanol(EO)4]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(EO)4]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(EO)4]octane, 1,6-[2-(N-dimethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N-dimethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(PO)4]hexane, 1,8-[2-(N-dimethylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(PO)2]octane, 1,8-[2-(N-dimethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(PO)4]octane, and a mixture thereof. 22. The surfactant system according to claim 21, wherein the cationic compound is prepared by a process comprising the steps of i) reacting a secondary amine with a compound represented by the following Chemical Formula 5 under an alkaline condition to prepare a tertiary amine; and ii) binding the tertiary amine with a compound comprising a C1˜20 saturated or unsaturated chain group, a benzyl group, a hydroxy ethyl group, or a hydroxy ethyl group to which 1 to 20 ethylene oxide or propylene oxide groups are added to cause quaternarization: (wherein n is an integer of 1 to 20; X is a halogen atom; R5 is hydrogen, or an alkyl or allyl group comprising at least one double bond, a hydroxyl group, or an ether group). 23. The surfactant system according to claim 21, wherein the cationic compound is prepared by a process comprising the steps of i) binding a compound comprising C1˜20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, or hydroxy ethyl groups to which 1 to 20 ethylene oxide or propylene oxide groups are added to a secondary amine to prepare a tertiary amine; and ii) binding the tertiary amine with the compound of Chemical Formula 4 to cause quaternarization. 24. The surfactant system according to claim 12, wherein the anionic surfactant is selected from a group consisting of sodium lauryl sulfonate (SLS), sodium lauryl ether sulfonate (SLES), a linear alkyl benzene sulfonate (LAS), monoalkyl phosphate (MAP), acyl isethionate (SCI), an alkyl glyceryl ether sulfonate (AGES), acylglutamate, acyltaurate, a fatty acid metal salt, and a mixture thereof. 25. The surfactant system according to claim 14, wherein the non-ionic surfactant is selected from a group consisting of alcohol alkoxylate, alkylphenol ethoxylate, alkylpolyglycosides, amine oxide, alkanolamide, and a mixture thereof. 26. The surfactant system according to claim 14, wherein the cationic surfactant is selected from a group consisting of a compound of an amine salt form, a compound comprising quaternary ammonium, a monoalkyl dimethyl amine derivative, a dialkyl monomethyl amine derivative, an imidazoline derivative, a quaternary ammonium compound of a Geminic form, a cationic surfactant of an oligomeric quaternary ammonium form, and a mixture thereof. 27. A detergent composition of solid, liquid, gel, or paste types comprising the surfactant system of claim 1. 28. A detergent composition of solid, liquid, gel, or paste types comprising the surfactant system of claim 4. 29. A detergent composition of solid, liquid, gel, or paste types comprising the surfactant system of claim 12. 30. The surfactant system according to claim 4, wherein the anionic surfactant is selected from a group consisting of sodium lauryl sulfonate (SLS), sodium lauryl ether sulfonate (SLES), a linear alkyl benzene sulfonate (LAS), monoalkyl phosphate (MAP), acyl isethionate (SCI), an alkyl glyceryl ether sulfonate (AGES), acylglutamate, acyltaurate, a fatty acid metal salt, and a mixture thereof. 31. The surfactant system according to claim 14, wherein the compound of Chemical Formula 4 is a non-ionic compound selected from a group consisting of N,N,N-dimethyllauryl amine oxide; N,N,N-ethylmethyllauryl amine oxide; N,N,N-dimethyldodecyl amine oxide; N,N,N-butylmethyllauryl amine oxide; N,N,N-dimethylhexadecyl amine oxide; N,N,N-dibutyllauryl amine oxide; N,N,N-(2-hydroxyethyllaurylmethyl)amine oxide; N,N,N-(di-2-hydroxyethyllauryl)amine oxide; N,N,N-(2-hydroxyethyllaurylbutyl)amine oxide; N,N,N-(2-hydroxy(EO)5ethyllaurylmethyl)amine oxide; N,N,N-(2-hydroxyethyl(PO)5laurylmethyl)amine oxide; N,N,N-(2-hydroxyethyl(EO)5(PO)5laurylmethyl)amine oxide; N,N,N-(2-hydrxoyethyl(EO)10laurylmethyl)amine oxide; N,N,N-(2-hydrxoyethyl(EO)15laurylmethyl)amine oxide; 1,6-(N,N-butylmethylaminooctyl)hexane; 1,6-(N,N-butylmethylaminooctyl)dipropylether; 1,6-(N,N-butylmethylaminooctyl)-3-hydroxyhexane; 1,6-(N,N-butylmethylaminooctyl) butane; 1,6-(N,N-butylmethylaminooctyl) octane; 1,6-(N,N-butylmethyl amin oxyl)-2-hydroxypropane; 1,6-[2-(N-methylaminooctyl)ethanol]hexane; 1,6-[2-(N-methylaminooctyl)ethanol(EO)5]hexane; 1,6-[2-(N-methylaminooctyl)ethanol(PO)5]hexane; 1,6-[2-(N-methylaminooctyl)ethanol(EO)5(PO)5]hexane; 1,6-[2-(N-methylaminooctyl)ethanol (EO)10]hexane; 1,6-[2-(N-methylaminooctyl)ethanol]dipropylether; 1,6-[2-(N-methylaminooctyl)ethanol]-2-hydroxypropane; 1,6-[2-(N-methylaminooctyl)Ethanol]butane; 1,6-[2-(N-methylaminooctyl)ethanol]octane; and a mixture thereof. 32. The surfactant system according to claim 14, wherein the compound of Chemical Formula 4 is a cationic compound selected from a group consisting of dimethyloctylethoxy ammonium, dimethyl decyl ethoxy ammonium, dimethyl lauryl ethoxy ammonium, dimethyloctylethanol (EO)5 ammonium, dimethyldecylethanol (EO)5 ammonium, dimethyllaurylethanol (EO)5 ammonium, dimethyloctylethanol (EO)10 ammonium, dimethyldecylethanol (EO)10 ammonium, dimethyllaurylethanol (EO)10 ammonium, dimethyloctylethanol (EO)15 ammonium, dimethyldecylethanol (EO)15 ammonium, dimethyllaurylethanol(EO)15 ammonium, trimethyloctyl ammonium, tridecyllauryl ammonium, trimethyllauryl ammonium, 1,6-[2-(N-dimethylamino)ethanol]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol]hexane, 1,8-[2-(N-dimethylamino)ethanol]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol]octane, 1,8-[2-(N,N-butylmethylamino)ethanol]octane, 1,8-[2-(N,N-methyloctylamino)ethanol]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol]octane, 1,6-[2-(N,-dimethylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(EO)2]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(EO)2]hexane, 1,6-[2-(N-dimethylamino)ethanol(EO)4]hexane, 1,6-[2-(N-dimethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(EO)4]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(EO)4]hexane, 1,8-[2-(N-dimethylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(EO)2]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(EO)4]octane, 1,8-[p2-(N,N-butylmethylamino)ethanol(EO)4]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(EO)4]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(EO)4]octane, 1,6-[2-(N-dimethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(PO)2]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(PO)2]hexane, 1,6-[2-(N-dimethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-ethylmethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-butylmethylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-methyloctylamino)ethanol(PO)4]hexane, 1,6-[2-(N,N-dodecylmethylamino)ethanol(PO)4]hexane, 1,8-[2-(N-dimethylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(PO)2]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(PO)2]octane, 1,8-[2-(N-dimethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-ethylmethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-butylmethylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-methyloctylamino)ethanol(PO)4]octane, 1,8-[2-(N,N-dodecylmethylamino)ethanol(PO)4]octane, and a mixture thereof. 33. The surfactant system according to claim 14, wherein the anionic surfactant is selected from a group consisting of sodium lauryl sulfonate (SLS), sodium lauryl ether sulfonate (SLES), a linear alkyl benzene sulfonate (LAS), monoalkyl phosphate (MAP), acyl isethionate (SCI), an alkyl glyceryl ether sulfonate (AGES), acylglutamate, acyltaurate, a fatty acid metal salt, and a mixture thereof. 34. A detergent composition of solid, liquid, gel, or paste types comprising the surfactant system of claim 14. |
<SOH> BACKGROUND OF THE INVENTION <EOH>(a) Field of the Invention The present invention relates to a mixed surfactant system showing superior properties by controlling interfacial properties such as cleaning power, foaming property, stability to hard water, surface tension, etc. (b) Description of the Related Art It is known that all surfactants including anionic, cationic, non-ionic, and amphoteric surfactants exist as single molecules below a critical micelle concentration (hereinafter referred to as ‘cmc’), and they form micelles when reaching a cmc to show unique surface active properties according to each compound. However, since surface active properties shown by one kind of surfactant cannot be superior in every respect, studies for overcoming this are under progress. First, studies on mixing surfactants having the same ionicity were undertaken, and then many studies on mixing ionic surfactants and non-ionic surfactants were done. However, few studies for mixing surfactants with different ionicities have been performed thus far, because it has been known that compounds are neutralized when surfactants with different ionicities are mixed and they do not dissolve in water and therefore they form precipitates. Generally, if anionic and cationic surfactants are simultaneously dissolved in an aqueous solution, they can exist in three forms. First, an anionic surfactant and a cationic surfactant independently exist as free single bodies; second, an anionic surfactant and a cationic surfactant form a complex to become a precipitate; and third, an anionic surfactant and a cationic surfactant form a mixed micelle and are dissolved in the aqueous solution. The complex formed by binding of the anionic and cationic surfactants is called a pseudo-nonionic complex surfactant, and it is known that such a neutral complex can have its solubility increased in water as it has more hydrophilic groups than does a nonionic surfactant. Therefore, these three forms of surfactants are largely influenced by the structure and concentration of the anionic and cationic surfactants. It is known that in order to prevent precipitation, which may occur in the case of an anionic surfactant and a cationic surfactant being mixed to form a mixed surfactant system, and to improve phase stability and physical properties, non-ionic surfactants are mixed. Particularly, it has been reported that in the case of non-ionic surfactants in which an amine oxide, an ethylene oxide, or a propylene oxide as a hydrophilic group are added, superior effects in terms of various surface active effects (for example solubility, cleaning power, emulsifying power, dispersing power, lowering surface tension power, low cmc, etc.) can be obtained, and phase stability of the mixed surfactant can be improved (Surfactant science series vol. 46, mixed surfactant systems). Recently, patents with the object of improving effects of products by mixing an anionic surfactant, a cationic surfactant, and a non-ionic surfactant in a specific ratio have been published. U.S. Pat. No. 5,798,329 disclosed a method for prescribing a detergent showing superior effects in concentrated or common form. The superior effects mean superior foaming property, and satisfactory cleaning power and antibacterial power. According to this method, approximately 1˜40 wt % of one or more kinds of anionic surfactants selected from alkylethercarboxylates or alkylethersulfates; approximately 3˜50 wt % of one or more kinds of non-ionic surfactants selected from alcohol alkoxylates, alkylphenol ethoxylates, alkylpolyglycosides, amine oxides, and alkanolamides; and approximately 1˜25 wt % of cationic surfactants selected from one or more kinds of compounds with quaternary ammonium compounds were used in order to improve cleaning power. The cationic surfactant used in this method was a generally-used quaternary ammonium compound, and the non-ionic surfactant was a presently marketed common surfactant. U.S. Pat. No. 4,576,729 disclosed a method for preparing a liquid detergent with superior phase stability by mixing non-ionic, anionic, and cationic surfactants in a ratio of 2:4:1˜3.5:5:1. U.S. Pat. No. 5,230,823 described a method for mixing anionic and non-ionic surfactants for a gel type dishwashing detergent, and according to this method, a quaternary ammonium surfactant of a specific type is included in the composition as a foam enhancer. However, although these methods asserted that cleaning power is superior, they do not mention other physical properties such as stability to hard water, foaming property, surface tension, etc. Also, the non-ionic surfactants used in the above methods are not compounds prepared in order to improve specific effects, but rather methods combining commonly used compounds to obtain a functional mixing ratio. In addition, Korean Patent Laid Open-Publication No. 2000-10944 disclosed a detergent composition for washing, comprising a dimethyl hydroxyethyl quaternary ammonium surfactant comprising C12˜C14 alkyl groups combined with a polyamine filth-dispersing agent in order to increase fabric washing power. However, the quaternary ammonium surfactant used in this method fixes the length of the alkyl groups as C12˜C14, and this method describes the function of cationic surfactants for improving effects of the polyamine to simply improve filth-removing power when washing synthetic fabrics (for example, polyester) and a detergent composition comprising the same. In addition, U.S. Pat. No. 6,022,844 clarified that a cationic surfactant was added to a conventional detergent prescription to improve oil-removing power and to simultaneously maintain a scent for a long time and prevent color bleeding. However, this method only describes mixing about 0.1˜3% of the cationic surfactant, and it did not apply a novel compound for controlling physical properties. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention is made in consideration of the problems of the prior art, and it is an object of the present invention to provide a compound with a novel structure that can improve physical properties of an anionic surfactant or mixed system of anionic and cationic surfactants. It is another object of the present invention to provide a mixed surfactant system using the compound to show superior effects compared to using an anionic surfactant alone. It is another object of the present invention to provide a surfactant system with superior surface active properties such as cleaning power, initial foaming property, stability to hard water, surface tension, cmc, moisturizing power, foam stability, etc. It is another object of the present invention to provide a detergent composition of a solid, liquid, gel, or paste types comprising the surfactant system, to show effects superior to those of the conventional products. In order to achieve these objects, the present invention provides a surfactant system comprising a) an anionic surfactant; b) a cationic compound represented by the following Chemical Formula 1; and c) a non-ionic surfactant: wherein R 1 , R 2 , R 3 , and R 4 are independently or simultaneously C1˜C20 saturated or unsaturated chain groups, benzyl groups, hydroxylethyl groups, or hydroxy ethyl groups to which 1 to 20 ethylene oxide groups or propylene oxide groups are attached; and X is halogen atom, a sulfate group, or an acetate group. The present invention also provides a surfactant system comprising a) an anionic surfactant; and b) a cationic compound represented by the following Chemical Formula 2 : wherein R 1 , R 2 , R 3 , and R 5 are independently or simultaneously C1˜C20 saturated or unsaturated chain groups, benzyl groups, hydroxylethyl groups, or hydroxylethyl groups to which 1 to 20 ethylene oxide groups or propylene oxide groups are attached; R 4 is a C1˜C20 alkyl group, an alkyl group to which 1˜10 ethylene oxide groups or propylene oxide groups are attached, or an alkyl group to which 1 or more hydroxyl groups are bound; n is an integer of 1 to 20; and X is halogen atom, a sulfate group, or an acetate group. The present invention also provides a surfactant system comprising a) an anionic surfactant; and b) a compound represented by the following Chemical Formula 4: wherein R 1 , R 2 , R 3 , and R 4 are independently or simultaneously C1˜20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, or hydroxy ethyl groups to which 1˜20 ethylene oxide groups or propylene oxide groups are attached; R 5 is a C1˜20 alkyl group, an alkyl group to which 1˜20 ethylene oxide or propylene oxide groups are attached, an alkyl group to which 1 or more hydroxyl groups are bound, an alkyl group comprising at least one double bond, or an alkyl group comprising at least one ether group; A 1 and A 2 are independently or simultaneously C1˜20 saturated or unsaturated chain groups, benzyl groups, hydroxy ethyl groups, hydroxylethyl groups to which 1˜20 ethylene oxide or propylene oxide groups are attached, or oxygen anions (O—); n is an integer of 0 to 20; and X is a halogen atom, a sulfate group, a methylsulfate group, or an acetate group. The present invention also provides a surfactant system comprising; a) an anionic surfactant; b) a compound represented by the above Chemical Formula 4; and c) a non-ionic surfactant, a cationic surfactant, or a mixture thereof. The present invention also provides a detergent composition of a solid, liquid, gel, or paste types comprising the above surfactant systems. detailed-description description="Detailed Description" end="lead"? |
Tetrahedron/pentahedron container |
A container includes at least one triangular surface, a sealing portion formed extending straightly from an angular point of the triangular surface, and an opening structure formed by folding a portion around the angular point of the container. |
1. A container comprising: at lease one triangular surface; a sealing portion formed extending straightly from an angular point of the triangular surface; and an opening structure formed by folding a portion around the angular point of the container. 2. A container of claim 1 wherein the opening structure is formed by first folding lines and second folding lines that are formed in the vicinity of both sides of the triangular surfaces proximal to the, angular point to define a triangular folded surfaces innerwardly of the container. 3. A container of claim 2 wherein a third folding line is formed on the folded triangular surfaces between the first folding lines so as to enhance an opening/close operation of the opening structure. 4. A container of claim 2 wherein fourth folding lines are formed outwardly in the vicinity of the second folding lines. 5. A container of claim 1 wherein a fifth folding line is provided to horizontally connect one ends of the first to fourth folding lines to each other. 6. A container of claim 1 wherein an overlapped portion defined by folding the opening structure and corresponding to the sealing portion is sealed by adhesive. 7. A container of claim, 1 wherein a cutting line is provided to the 5 overlapped portion so that the opening structure can be easily opened. 8. A container of claim 1 wherein the container is formed of a triangular-tetrahedron body. 9. A container of claim 1 wherein the container is formed of a pentahedron body. |
<SOH> BACKGROUND ART <EOH>Generally, to open a conventional container, a portion of top portion thereof should be cut-away using an additional tool such as scissors. Therefore, it is a troublesome for a user to have to use such a tool whenever the user intends to open the container To solve the above problems, containers each having an easy opening structure have been provided for a square/hexahedron container. However, such an easy opening structure cannot be applied to a tetrahedron or pentahedron container due to its structural limitation. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 a is a perspective view of a tetrahedron container according to a first embodiment of the present invention; FIG. 2 is a view illustrating an opening process of a tetrahedron container of the present invention; FIG. 3 is a view illustrating an opened state of a tetrahedron container of the present invention; FIG. 4 is a perspective view of a pentahedron container according to a second embodiment of the present invention; and FIG. 5 is a view illustrating an opened state of a pentahedron container of the present invention. detailed-description description="Detailed Description" end="lead"? |
Arrangement for fixing furniture fittings to frame profiles of plate-type or board type furniture elements |
Arrangement for fixing furniture fittings on frame sections (16) which are preferably extruded and are intended to enclose furniture parts in the form of plates or panels, wherein the said frame sections have an open groove (20) extending in the longitudinal direction of the section and provided to receive and retain a retaining part (36) of the fitting (26) to be fixed. The internal width of the groove is narrowed in the region of its opening by two shoulders (22a, 22b) which are parallel to one another with end faces (24a; 24b) facing one another, wherein the retaining part (36) has a flange portion (38) which can be supported on the free upper face of the shoulders and in which there is provided at least one bore for rotatably retaining the shank (46), which engages in the groove (20), of a clamping element (48) which selectively fixes the retaining part (36) on the frame section (16) or releases it for disassembly or longitudinal displacement in the longitudinal direction of the groove. |
1. Arrangement for fixing furniture fittings on frame sections (16) which are preferably extruded and are intended to enclose furniture parts in the form of plates or panels, wherein the said frame sections have an open groove (20) extending in the longitudinal direction of the section and provided to receive and retain a retaining part (36) of the fitting (26) to be fixed, the internal width of the said groove being narrowed in the region of its opening by two shoulders (22a, 22b) which are parallel to one another with end faces (24a; 24b) facing one another, wherein the retaining part (36) has a flange portion (38) which can be supported on the free upper face of the shoulders and in which there is provided at least one bore (44) for rotatably retaining the shank (46), which engages in the groove (20), of a clamping element (48) which selectively fixes the retaining part (36) on the frame section (16) or releases it for disassembly or longitudinal displacement in the longitudinal direction of the groove, characterized in that the retaining part (36) has in the region of the bores) (44) provided by the shank (46) of the clamping element (48) in each case a strip-like projection (40) which projects from the underside of the flange portion (38) and has on its lower free end a locking tab (42) which projects at right angles and can be inserted below the shoulders (22a, 22b) into the interior of the groove (20) which is widened there, whereby the distance between the underside of the flange portion (38) of the retaining part (36) and the boundary surface of the locking tab (42) which faces it is substantially equal to the distance between the upper and lower boundary surface of the associated shoulder (22a; 22b) which narrows the groove (20), that the shank (46) of the clamping element (48) which is rotatably mounted in the associated bore (44) in the flange portion (38) of the retaining part (36) is of such a diameter that the distance measured above the locking tab (42) between the outer face of the strip-like projection (40) and the free outer face of the shank (46) in the portion lying between the shoulders (22a; 22b) is substantially equal to the distance measured between the end faces (24a; 24b) of the shoulders (22a; 22b) which narrow the groove (20), and that in the region lying between the end faces (24; 24b) of the shoulders (22a; 22b) in the proper fixing position the shank (46) is provided with a flat area (50) which reduces the shank diameter in the flattened region by at least the dimension by which the locking tab (42) projects from the strip-like projection (40). 2. Fixing arrangement as claimed in claim 1, wherein the clamping element (48) is provided on its outer end with a disc-shaped head portion (52) which has an increased diameter relative to the diameter of the bore (44) in the flange portion (38) of the retaining part (36). 3. Fixing arrangement as claimed in claim 2, wherein the radius of the head portion (52) of the clamping element (48) is reduced over a predetermined angular range in the circumferential direction to a dimension between the radius of the shank (46) and the maximum radius of the head portion (52), and that in the region of the bore(s) (44) receiving the shank (46) of the respective clamping element (48) projections (56) are provided which project from the upper face of the flange portion (38) of the retaining part (36) and on which the transition surfaces (54) between the portions of larger and smaller radius of the disc-shaped head portion (52) can be brought into abutment as the clamping element (48) rotates. 4. Fixing arrangement as claimed in claims 1, wherein a recess (cross-slot 57) which enables the application of a turning tool is provided in each case in the outer end face of the clamping element (48). 5. Fixing arrangement as claimed in claims 1, wherein a handle (lever arm 57) which allows the clamping element to be rotated manually is provided on the outer free end of the clamping element (48). 6. Fixing arrangement as claimed in claims 1, wherein in the region of the end of the shank (46) of the clamping element (48) which in the proper fixing position lies within the groove (20) of the frame section (16) a low projection (58) is provided which projects radially from the circumferential surface of the shank (46) and with which is associated a curved low recess (60) in the boundary wall of the strip-shaped projection (40) of the retaining part (36) facing the shank (46). 7. Fixing arrangement as claimed in claim 6, wherein the projection (58) is provided in the region of the circumferential surface of the shank (46) of the clamping element (48) lying diametrically opposite the flat area (50) of the shank (46). 8. Fixing arrangement as claimed in claims 1, wherein a pair of walls (62) which are spaced from one another projects at right angles from the upper face of the flange portion (38) of the retaining part (36) lying opposite the strip-like projection (40), and between these walls the wing-like end of at least one linkage part of the furniture hinge (26) is in each case pivotably mounted on a bearing lug retained in bores (64; 66) in the walls (62). 9. Fixing arrangement as claimed in claim 8, characterized in that the ends on the door leaf side of two hinge linkages (32; 34) or arms of a multi-linkage hinge (26) are pivotably mounted between the walls (62) of the retaining part (36), the other ends thereof being in each case articulated on a hinge arm (28) which can be fixed on the supporting wall of the carcass of a piece of furniture. 10. Fixing arrangement as claimed in claim 8, a projection (68) which can be inserted into a groove or recess (70) in the frame section (16) which has a shape corresponding to the cross-section of the projection (68) projects in each cases paced above the flange portion (38) on the walls (62) projecting from the flange portion (38). 11. Fixing arrangement as claimed in claims 1, wherein the flange portion is formed by two integral flange elements (38a; 38b) which extend at right angles to one another and are in each case provided with a strip-like projection (40) projecting from the underside thereof and a locking tab (42), and that the shank of at least one clamping element (48) is rotatably mounted in each flange elements. |
Gasoline engine with an exhaust system for combusting particulate matter |
A gasoline engine having an exhaust system comprises means for trapping particulate matter (PM) from the exhaust gas and a catalyst for catalysing the oxidation of the PM by carbon dioxide and/or water in the exhaust gas, which catalyst comprising a supported alkali metal. The invention further includes a method of combusting PM from a gasoline engine in CO2 and/or H2O from the exhaust gas at temperatures in excess of 500 ° C., which method comprising trapping the PM and contacting it with a catalyst comprising a supported alkali metal. |
1. A gasoline engine having an exhaust system, which exhaust system comprising a three-way catalyst (TWC), means for trapping particulate matter (PM) of <100 nm from the exhaust gas and a catalyst for catalysing the oxidation of the PM by carbon dioxide (CO2) and/or water (H2O) in the exhaust gas, which catalyst comprising a supported alkali metal, wherein the supported alkali metal is disposed downstream of the TWC. 2. An engine according to claim 1, wherein the alkali metal is selected from the group consisting of lithium, sodium, potassium, rubidium, caesium and mixtures of any two or more thereof. 3. An engine according to claim 2, wherein the mixture is a eutectic mixture. 4. An engine according to claim 1, wherein the elemental alkali metal is present in the catalyst at from 1% to 20% by weight of the total catalyst. 5. An engine according to claim 1, wherein the support is selected from the group consisting of alumina, ceria, zirconia, titania, a silica-alumina, a zeolite, a mixture thereof and a mixed oxide of any two or more thereof. 6. An engine according to claims 1, wherein the support is alumina selected from the group consisting of alpha-alumina, theta-alumina, gamma-alumina and mixtures of any two or more thereof. 7. An engine according to claim 1, wherein the alkali metal is potassium and the support is selected from the group consisting of alpha-alumina, zirconia, ceria and mixtures of any two or more thereof. 8. An engine according to claim 5, wherein the support comprises a mixed oxide and each component of the mixed oxide is present in an amount of from 10 wt % to 90 wt % by total catalyst weight. 9. An engine according to claim 8, wherein the mixed oxide is a binary mixed oxide and the ratio of the cationic components present is in a ratio of from 20:80 to 50:50. 10. An engine according to claim 1, wherein the trapping means comprises a filter. 11. An engine according to claim 10, wherein the filter comprises a wall-flow filter, a foam or a wire mesh. 12. An engine according to claim 11, wherein the wall-flow filter is the foam and the foam is a metal oxide. 13. An engine according to claim 1, wherein the trapping means comprises a discharging electrode and a collecting electrode for electrostatic deposition of the PM and power means for applying a potential difference between the discharging electrode and the collecting electrode. 14. An engine according to claim 13, wherein the trapping means comprises a first cylinder and a wire disposed coaxially therein. 15. An engine according to claim 14, wherein the trapping means further comprises a plurality of wires extending longitudinally relative to the first cylinder, which wires are arranged equidistantly and radially about the coaxially disposed wire. 16. An engine according to claim 14, wherein the first cylinder comprises inner and outer surfaces and an insulating layer is disposed therebetween, which first cylinder is coaxially disposed within a second cylinder, the arrangement being such that the power means is capable of applying a potential difference between the coaxially disposed wire and the inner surface of the first cylinder and between the outer surface of the first cylinder and the second cylinder. 17. An engine according to claim 14, comprising a plurality of first or second cylinders arranged in parallel. 18. An engine according to claim 14 further comprising means for holding the coaxial wire in its coaxial arrangement and any additional wire parallel thereto. 19. An engine according to claim 18, wherein the holding means comprises a ceramic tube. 20. An engine according to claim 14, wherein the cylinder forms part of a pipe for carrying the exhaust gas. 21. An engine according to claim 13, wherein the trapping means comprises a pair of plates arranged in parallel and a plurality of wires arranged equidistantly in parallel to each other and disposed midway between the plates. 22. An engine according to claim 13, wherein the collecting electrode is earthed. 23. An engine according to any claim 13, wherein the power means is capable of applying a potential difference of from −16 kV to +25 kV. 24. An engine according to claim 1, wherein the trapping means is coated, at least in part, with the catalyst. 25. An engine according to claim 13, wherein the collecting electrode is coated, at least in part, with a catalyst according to claim 1. 26. A method of combusting PM of <100 nm from a gasoline engine in CO2 and/or H2O from the exhaust gas at temperatures in excess of 500° C., which method comprising contacting the exhaust gas with a three-way catalyst, trapping the PM and contacting the trapped PM with a catalyst comprising a supported alkali metal. 27. A method according to claim 26, wherein the trapping step is by electrophoresis or filtration. 28. An engine according to claim 1, wherein the alkali metal is potassium. 29. An engine according to claim 7, wherein the support is a mixed oxide of any two or more selected from the group consisting of alpha-alumina, zirconia and ceria. 30. An engine according to claim 7, wherein the support comprises a mixed oxide and each component of the mixed oxide is present in an amount of from 10 wt % to 90 wt % by total catalyst weight. 31. An engine according to claim 30, wherein the mixed oxide is a binary mixed oxide and the ratio of the cationic components present is from 20:80 to 50:50. 32. An engine according to claim 12, wherein the metal oxide is selected from the group consisting of alpha Al2O3, ZrO2/MgO, ZrO2/CaO/MgO and ZrO2/Al2O3. 33. An engine according to claim 15, wherein the first cylinder comprises inner and outer surfaces and an insulating layer is disposed therebetween, which first cylinder is coaxially disposed within a second cylinder, the arrangement being such that the power means is capable of applying a potential difference between the coaxially disposed wire and the inner surface of the first cylinder and between the outer surface of the first cylinder and the second cylinder. 34. An engine according to claim 16, comprising a plurality of second cylinders arranged in parallel. 35. An engine according to claim 1, wherein the elemental alkali metal is present in the catalyst at from 5% to 15% by weight of the total catalyst. 36. An engine according to claim 1, wherein the elemental alkali metal is present in the catalyst at 10% by weight of the total catalyst. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.