text
stringlengths 0
1.67M
|
|---|
1. An airborne reconnaissance system comprising: Gimbals having at least two degrees of freedom; At least one array of light sensors positioned on the gimbals, for being directed by the same within at least two degrees of freedom; Map storage means for storing at least one Digital Elevation Map of an area of interest, divided into portions; Inertial Navigation System for real-time providing to a gimbals control unit navigation and orientation data of the aircraft with respect to a predefined global axes system; Portion selection unit for selecting, one at a time, another area portion from the area of interest; Servo control unit for: A. Receiving from said Digital Elevation Map one at a time, a coordinates set of the selective area portion, said set comprising the x:y coordinates of said area portion, and the elevation z of the center of that portion; B. Receiving continuously from said inertial navigation system present location and orientation data of the aircraft; C. Repeatedly calculating and conveying into a gimbals servo unit in real time and at a high rate signals for: a. during a direction period, signals for directing accordingly the gimbals including said at least one array of light-sensing units towards said x:y:z coordinates of the selected area portion, and; b. during an integration period, in which the array sensors integrates light coming from the area portion, providing to the gimbals unit signals for compensating for the change in direction towards the x:y:z coordinates of the selected portion evolving from the aircraft motion; Gimbals servo for effecting direction of the gimbals in at least two degrees of freedom according to the signals provided from said Servo Control Unit; Sampling means for simultaneously sampling at the end of the integration period pixel levels from each of said array sensors, a set of all of said sampled pixel levels forms an image of said area portion; and Storage means for storing a plurality of area portion images. 2. System according to claim 1, wherein said one or more arrays are selected from at least a visual light-sensitive array, a UV light sensitive-array, an infrared light-sensitive array, a multi/hyper-spectral array, and an active illumination array. 3. System according to claim 1, wherein said navigation data of the aircraft comprises data relating to the 3D location of the aircraft, and its velocity and acceleration vectors with respect to a predefined coordinates system, and its orientation data relating to the orientation of the aircraft with respect to said predefined coordinates system. 4. System according to claim 1, wherein said Inertial Navigation System comprises velocity, acceleration, and orientation sensors, at least some of said sensors being positioned on the gimbals. 5. System according to claim 1, wherein at least some of said arrays of sensors being positioned on the gimbals. 6. System according to claim 1, comprising two Inertial Navigation Systems, the first inertial navigation system being the main Inertial Navigation System of the aircraft and its sensors being positioned within the aircraft, and the second Inertial Navigation System being a system dedicated to the reconnaissance system, at least some of the sensors of said second Inertial Navigation System being positioned on the gimbals unit, measuring navigation and orientation data of the gimbals with respect to the said predefined axes system, for better eliminating misalignments occurring between the gimbals and LOS and the said main Inertial Navigation System of the aircraft due to aero-elastic deflections and vibrations of the aircraft, by using a process of transfer alignment from the said first INS to the said second INS. 7. System according to claim 1, wherein the Digital Elevation Map is a map comprising a grid of the area of interest, the x:y:z coordinate values at each of the nodal points in said grid being provided by said map. 8. System according to claim 1, wherein the portion selecting unit is used for calculating and determining a center of a next area portion that provides a predefined overlap between the said imaged area portion and the adjacent previously imaged area portion. 9. System according to claim 1, wherein in an automatic mode of operation the gimbals are activated to cover in a sequential, step-wise manner, the area of interest, said coverage is made from a predefined starting portion and according to a stored mission plan, thereby sequentially scanning one after the other area portions of the area of interest, and sampling images from each of said portions. 10. System according to claim 1, wherein in a manual mode of the system the pilot of the aircraft defines an area of interest during the flight, said area of interest being automatically divided into at least one area portion, all the area portions being automatically scanned one after the other by means of correspondingly directing to them the on-gimbals array, for capturing images of each of said scanned portions. 11. System according to claim 1, wherein the gimbals comprise two gimbals mechanisms, an external gimbals mechanism and an internal gimbals mechanism. 12. System according to claim 1, wherein the external gimbals mechanism is used for coarse directing the on-gimbals array to the center of a selected area portion. 13. System according to claim 11 wherein the external gimbals mechanism has two degrees of freedom, elevation and roll. 14. System according to claim 10, wherein the internal gimbals mechanism is used for fine directing the on-gimbals array to the center of a selected area portion, particularly for compensating the gimbals direction for the aircraft motion and orientation change during the integration period. 15. System according to claim 11, wherein the internal gimbals mechanism has two degrees of freedom, yaw and pitch. 16. System according to claim 10, wherein the external gimbals mechanism is slaved to the internal gimbals mechanism. 17. System according to claim 1, wherein during the integration period each of the array sensors simultaneously senses light from a corresponding section of the area portion, and at the end of the integration period the data from all the array sensors is read simultaneously, and stored as an image of the area portion. 18. System according to claim 1, wherein the array light sensors are sensitive to light in the range of visual light, IR, UV, multi/hyper-spectral, and/or an active illumination. 19. System according to claim 1, wherein the arrays are focal plane arrays. 20. System according to claim 1, wherein the predefined axes system is a global axes system. 21. System according to claim 1, assembled within a pod attached to the aircraft. 22. System according to claim 1, assembled within a payload installed inside the aircraft with only its windows protruding for obtaining a clear, unobstructed Line of Sight. 23. System according to claim 21, wherein the gimbals are located at the front of the pod, behind a transparent window. 24. System according to claim 1, further comprising a back-scanning mechanism comprising a mirror or prism, positioned on the gimbals and rotatable with respect thereto, light coming from the area portion first passing through said mirror which deflects the same towards the array, and, a. the servo control unit applies to the gimbals a continuous row and/or column scanning movement without stopping; and b. while the direction towards an area portion is being established, applying to said back-scanning mirror during the integration period an opposite direction movement with respect to said row and/or column scanning continuous movement, thereby compensating for that continuous movement and ensuring a fixed orientation relationship of the array with respect to the area portion imaged. 25. A method for carrying out airborne reconnaissance, comprising: a. Providing at least one array of light-sensitive pixels; b. Mounting the at least one array on gimbals having at least two degrees of freedom so that the gimbals can direct the array to a selected Line of Sight; c. Providing a Digital Elevation Map of an area of interest, reconnaissance images from said area are to be obtained; d. Providing an Inertial Navigation System for obtaining at any time during the flight the updated xa:ya:za coordinates of the center of the array with respect to a predefined coordinates system; e. Providing a calculation unit for, given xp:yp location coordinates of a center of specific area portion within the area of interest, and the zp elevation coordinate at said portion center as obtained from said Digital Elevation Map, and the said xa:ya:za coordinates of the array center at same specific time, determining the exact angles for establishing a line of sight direction connecting between the center of the array and the said xp:yp:zp coordinates; f. Given the calculation of step e, directing accordingly the center of the array's Line of Sight to the center of the area portion; g. During an integration period, effecting accumulation of light separately by any of the array light sensors; h. During the integration period, repeating at a high rate the calculation of step e with updated array xa:ya:za coordinates, and repeatedly, following each said calculation, correcting the direction as in step f; i. At the end of the integration period, sampling all the array sensors, and saving in a storage as images of the array portion; j. Selecting new portion coordinates xp:yp:zp within the area of interest, and repeating steps e to j for these new coordinates; k. When the coverage of all the area of interest is complete, terminating the process, or beginning coverage of a new area of interest. 26. Method according to claim 25, wherein: the selection of xp:yp coordinates of a new area portion is performed to assure overlap between adjacent area portions within a predefined range, by calculating the 3-dimensional footprint of the new area portion on the ground, and then projecting it on the footprint of a previous area portion. 27. Method according to claim 26, wherein the overlap assurance is obtained by a trial and error selection, overlap calculation, and correction when necessary, or by an exact analytical calculation. 28. Method according to claim 25, wherein at least some of the sensors of the Inertial Navigation System are positioned on the gimbals, for improving the measuring of the orientation of the array with respect to the selective area portion. 29. Method according to claim 25, wherein at least some of the light sensitive sensors are positioned on the gimbals, for improving the measuring of the orientation of the Line of Sight with respect to the selective area portion. 30. Method according to claim 25, wherein the Inertial Navigation System comprises a dedicated Inertial Navigation System of the reconnaissance system and the main Inertial Navigation System of the aircraft, to improve the measuring of the orientation of the array with respect to the selective area portion, by using a process of transfer alignment from the aircraft Inertial Navigation System to the dedicated reconnaissance system's Inertial Navigation System. 31. A method for providing motion compensation during airborne photographing comprising: a. Providing at least one array of light-sensitive pixels; b. Mounting the at least one array on gimbals having at least two degrees of freedom so that the gimbals can direct its Line of Sight towards a selective area portion; c. Providing a Digital Elevation Map of an area of interest, reconnaissance images from said area are to be obtained; d. Providing an Inertial Navigation System for obtaining at any instant during flight the updated xa:ya:za coordinates of the center of the array with respect to a predefined coordinates system; e. Providing a calculation unit for, given xp:yp location coordinates of a center of specific area portion within the area of interest, and the zp elevation coordinate at said portion center as obtained from said Digital Elevation Map, and the said xa:ya:za coordinates of the array center at same specific time, determining the exact angles for establishing a line of sight direction connecting between the center of the array and the said xp:yp:zp coordinates; f. During an integration period, when the center of the array's Line of Sight is directed to a center of an area portion, effecting accumulation of light separately by any of the array light sensors; g. During the integration period, repeating at a high rate the calculation of step e with updated array xa:ya:za coordinates, and repeatedly, following each said calculation, correcting the direction by keeping the center of the array directed to the center of the selected area portion, therefore compensating for aircraft movement; and h. At the end of the integration period, sampling all the array sensors, and saving in a storage as images of the array portion. 32. A method for carrying out airborne targeting, comprising: a. Providing at least one weapon; b. Mounting the at least one weapon on gimbals having at least two degrees of freedom so that the gimbals can direct the weapon to a selected Line of Sight; c. Providing a Digital Elevation Map of an area of interest, selected objects within said area are to be targeted; d. Providing an Inertial Navigation System for obtaining at any time during the flight the updated xa:ya:za coordinates of the center of the weapon with respect to a predefined coordinates system; e. Providing a calculation unit for, given xp:yp location coordinates of a center of a specific target within the area of interest, and the zp elevation coordinate at said target center as obtained from said Digital Elevation Map, and the said xa:ya:za coordinates of the weapon center at same specific time, determining the exact angles for establishing a Line of Sight direction connecting between the center of the weapon and the said xp:yp:zp coordinates; f. Given the calculation of step e, directing accordingly the center of the weapon Line of Sight to the center of the target; h. During the effective targeting and shooting period, motion compensating for the motion of the aircraft. 33. A method according to claim 32, wherein the motion compensation of step h is carried out by repeating at a high rate the calculation of step e with updated target xa:ya:za coordinates, and repeatedly, following each said calculation, correcting the direction as in step f. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Airborne reconnaissance systems have been widely used for many years now, particularly for obtaining images from the air of areas of interest. Originally, a film camera was used on board aircraft for capturing the images. The main problem of the airborne, film-camera based reconnaissance system is the length of time required for developing the film, an operation that can be performed only after landing. This problem has been overcome in more modern systems by the use of a one-dimensional vector or a two-dimensional array of light-sensitive sensors in the camera for obtaining electronic images that are then electronically stored within the aircraft, and/or transmitted to a ground base station. This is generally done in such systems by scanning by the light-sensitive sensors of the area of interest in the direction of the flight. Airborne reconnaissance systems are generally used to obtain images of hostile areas, and therefore the task of obtaining such images involves some particular requirements, such as: 1. Flying the aircraft at high elevations and speeds in order to reduce the risk of being targeted by enemy weapons, and in order to widen the area captured by each image; 2. Trying to capture as much relevant image information as possible during as short as possible flight; 3. Trying to operate under various visibility conditions, while not compromising the resolution of the images and their quality. 4. Trying to photograph rough terrains (e.g., high mountains, areas having sharp ground variations), in high resolution and image quality. The need for securing the reconnaissance aircraft, while flying above or close to hostile areas has significantly increased flying costs and risks, as sometimes the reconnaissance mission requires escorting of the aircraft by other, fighter aircrafts. Therefore, the need for enabling a short and reliable mission is of a very high importance. There are several other problems generally involved in carrying out airborne reconnaissance. For example, capturing images from a fast-moving aircraft introduces the need for the so-called Forward Motion Compensation (Hereinafter, the term “Forward Motion Compensation” will be shortly referred to as FMC. Motion Compensation in general will be referred to as MC), to compensate for aircraft movement during the opening of the camera shutter (whether mechanical or electronic; in the latter case, the opening of the camera shutter for the purpose of exposure is equivalent to the integration of light photons by the light-sensitive components). When light-sensitive sensors are used in the camera (hereinafter, this type of image capturing will be referred to as “electronic capturing” in contrast to “film capturing”, wherein a film-type camera is used), three major scanning types are used: i. The Along-Track Scanning (also known as “push-broom scanning”)—In a first configuration of the Along-Track Scanning, the light-sensitive sensors are arranged in a one-dimensional vector (row), perpendicular to the flight direction. The scanning of the imaged area is obtained by the progression of the aircraft. In one specific configuration of Along-Track Scanning, generally called Along-Track TDI (Time Delayed Integration) configuration, a plurality of such parallel one-dimensional vectors (pixel-rows) perpendicular to the flight direction are provided at the front of the camera forming a two-dimensional array. In that case, however, the first row of the array captures an area section, while all the subsequent rows are used to capture the same section, but at a delay dominated by the aircraft progression. Then, for each row of pixels, a plurality of corresponding pixels of all the rows in the array, as separately measured, are first added; and then averaged in order to determine the pixel measured light intensity value. More particularly, each pixel in the image is measured N times (N being the number of rows) and then averaged. This Along-Track TDI configuration is found to improve the signal-to-noise ratio, and to improve the image quality and the reliability of measuring. ii. The Across-Track Scanning (also known as “Whiskbroom Scanning”)—In the Across-Track Scanning, a one-dimensional sensing vector of light-sensitive sensors, arranged parallel to the flight direction, is used. The sensing vector is positioned on gimbals having one degree of freedom, which, during the flight, repeatedly moves the whole vector right and left in a direction perpendicular to the direction of flight, while always keeping the vector in an orientation parallel to the direction of flight. Another Across-Track Scanning configuration uses a moving mirror or prism to sweep the line of sight (hereinafter, LOS) of a fixed vector of sensors across-track, instead of moving the vector itself. In such a case, the Across-Track Scanning of the area by the gimbal having one degree of freedom, while maintaining the forward movement of the aircraft, widens the captured area. Another configuration of the Across-Track Scanning is the Across-Track TDI configuration. In this configuration there exists a plurality of vectors (columns) in a direction parallel to the flight direction, forming a two-dimensional array. This Across-Track TDI, in similarity to the Along-Track Scanning TDI, provides an improved reliability in the measuring of pixel values, more particularly, an improvement in the signal-to-noise ratio. iii. Digital Framing Scanning: In Digital Framing Scanning, a two-dimensional array of light-sensitive sensors is positioned with respect to the scenery. In U.S. Pat. No. 5,155,597 and U.S. Pat. No. 6,256,057 the array is positioned such that its column-vectors (a column being a group of the array's columns) are parallel to the flight direction. Forward motion compensation (FMC) is provided electronically on-chip (in the detector focal plane array) by the transferring of charge from a pixel to the next adjacent pixel in the direction of flight during the sensor's exposure time (also called “integration time”). The charge transfer rate is determined separately for each column (or for the whole array as in U.S. Pat. No. 6,256,057 where a slit is moved in parallel to the columns direction), depending on its individual distance (range) from the captured scenery, assuming flat ground. In WO 97/42659 this concept is extended to handle transferring of charge separately for each cell instead of column, a cell being a rectangular group of pixels. In the system of U.S. Pat. No. 5,692,062, digital image correlation between successive frames captured by each column is performed, in order to measure the velocity of the scenery with respect to the array, and the correlation result is used for estimating the average range of each column to the scenery, for the purpose of motion compensation in terrain with large variations. This compensation method requires capturing of three successive frames for each single image, two for the correlation process and one for the final motion-compensated frame. The system of U.S. Pat. No. 5,668,593 uses a 3-axis sightline stepping mechanism for expanding coverage of the area of interest, and it applies a motion compensation technique by means of transferring of charge along columns. U.S. Pat. No. 6,130,705 uses a zoom lens that automatically varies the camera field of view based on passive range measurements obtained from digital image correlation as described above. The field of view is tuned in accordance with prior mission requirements for coverage and resolution. A significant problem which is characteristic of the prior art reconnaissance systems, particularly said electronically scanning Across-Track and Along-Track scanning methods, is the need for predefining for the aircraft an essentially straight scanning leg (and generally a plurality of such parallel straight legs), and once such a leg is defined, any deviation, particularly a rapid or large deviation, from the predefined leg, is not tolerated, as said systems of the prior art are not capable of maintaining a desired line of sight direction during such a fast and/or large deviation from the predefined leg, resulting in image artifacts such as tearing (dislocation of image lines), smearing (elongation of pixels) or substantial gaps in the image information. This is particularly a significant drawback when carrying out a reconnaissance mission above or close to a hostile area, when the need arises for the aircraft to carry out fast maneuvering to escape enemy detection or targeting. Moreover, sometimes, in order to obtain good imaging of a complicated terrain, such as of a curved canyon, it is best to follow the course of the sharply curved edges of the canyon. However, in most cases the reconnaissance systems of the prior art cannot tolerate carrying out such a sharply curved maneuvering, involving sharp changes in the angles of the line of sight with respect to the photographed scenery. Another drawback characteristic of the reconnaissance systems of the prior art, for example, U.S. Pat. No. 5,155,597, U.S. Pat. No. 5,692,062, WO 97/42659, and U.S. Pat. No. 6,256,057, is their need to handle vast amounts of data. The systems of the prior art do not enable an easy, selective imaging of small portions of an area of interest. Once operated, the system scans the entire area to which the camera is directed, with essentially no selection of specific portions of the whole possible. Therefore, even for a small area of interest, the systems of the prior art must handle a huge amount of data, i.e., be capable of storing the full image data obtained during the operation of the camera, and transmission of it to the ground (when such an option is desired). The transmission of a huge amount of data to the ground, sometimes in real-time, requires usage of a very wide bandwidth. Another particular problem which evolves from this limitation is the need for distinguishing and decoding a small data of interest within the said full, huge amount of data obtained. Still another drawback of reconnaissance systems of the prior art, for example, U.S. Pat. No. 5,155,597, U.S. Pat. No. 5,692,062, WO 97/42659, U.S. Pat. No. 6,130,705, and U.S. Pat. No. 6,256,057 is their limited ability to capture images in a wide range of a field of regard. Hereinafter, the term “field of regard” refers to the spatial section within which the camera line of sight can be directed without obscuration. Systems of the prior art sometimes use separate dedicated sensors for different sight directions (e.g. separate sensors for down-looking, side-oblique or forward-oblique). The present invention provides to the aircraft the ability of capturing images, simultaneously from all sensors, of areas forward, backward, sideways and in any other arbitrary direction, and to rapidly switch between these directions. Yet another drawback of reconnaissance systems of the prior art, for example, U.S. Pat. No. 5,155,597, U.S. Pat. No. 5,668,593, U.S. Pat. No. 5,692,062, WO 97/42659, U.S. Pat. No. 6,130,705, and U.S. Pat. No. 6,256,057 is the use of large-sized two-dimensional sensors' arrays, which becomes a necessity for systems having limited or no control over their line of sight. The present invention enables usage of small or medium-sized, two-dimensional sensors' arrays, by taking advantage of the capability to quickly and accurately move the LOS within a large field of regard, to stably fix the LOS on the ground scenery while capturing an image, and to gather photographic image data by a multitude of small/medium frames rather than one single large frame at a time. A small-sized array would typically be up to 1 megapixels (million pixels), and a medium-sized array would typically be up to 5 megapixels. In contrast, large-sized arrays would typically be up to 50 megapixels and even larger. An important feature of the present invention is that both the small and medium-sized arrays are commercially available as universal sensors' arrays, not designed specifically for reconnaissance applications but rather for commercial applications such as stills and video cameras, and therefore they are widely available from a few vendors at low prices. This sensors' technology also benefits from the enormous investment by vendors in such commercial products due to the demands of the commercial market. In contrast, the large-sized reconnaissance sensors' arrays are uniquely developed by reconnaissance systems manufacturers, are complex due to the need for on-chip motion compensation, are expensive, and are not widely available. The limitations of prior art systems are more acute when the sensor is required to operate at the IR range rather than at the visible range, since the current IR array technology does not provide large-sized IR arrays. Another drawback of large-sized arrays is their lower frame rate with respect to small/medium-sized arrays, due to the large amount of pixels processed for each image. Some of the prior art systems employ on-chip motion compensation, for example, as described in U.S. Pat. No. 5,155,597, U.S. Pat. No. 5,692,062, and WO 97/42659. Several drawbacks are associated with the on-chip motion compensation concept. On-chip motion compensation is performed by transferring charges from one column/cell to an adjacent column/cell during the integration time at a specified rate. This process of transferring charges induces electronic noises and creates an ambiguity (resulting in smearing or loss of pixels) at the borders between columns/cells and at the edges of the chip, since the required charge transfer rate may be different between adjacent columns/cells. Some of the prior art systems assume flat and horizontal ground for estimating the range from the sensor to each part of the scenery in the captured image (i.e. longer range for the farther portion of the scenery and shorter range for the closer portion), and calculate the motion compensation rate based on simple aircraft velocity and attitude information with respect to the flat ground. When the terrain has large variations this generally results in substantial smearing as shown in example 1 of the present invention. In some cases, the sensor must be oriented during capturing so that its columns are accurately parallel to the flight direction without rotation, whereby any deviation from that orientation will result in further smearing, thus seriously limiting mission planning. The more advanced prior art systems use digital image correlation between successive frames for each cell in the chip, in order to estimate more accurately the range to the scenery for each cell. This process requires three successive image captures for each usable image, thus wasting system duty cycles. The correlation accuracy is limited by smearing of the first two images when photographing a terrain with large variations. Another problem associated with correlation is the large change of aspect angle with respect to the scenery between the two successive images. For example, an aircraft flying at a velocity of 250 m/s at a range of 15 km to the scenery in side oblique, using a chip with 2 Hz frame rate, will have an LOS angular velocity (sometimes called V/R) of 250/15=16.7 milirad/s, resulting in an aspect angle between successive images of 8.3 milirad. For a typical pixel Instantaneous FOV (IFOV) of 30 microrad this means a shift of 277 pixels in the image. Moreover, since the value of V/R is not constant at any time during the mission, especially when the aircraft is maneuvering, the elapsed time between the two successive images will induce an additional error. Some of the prior art systems employ a step framing method to cover large areas, for example, as described in U.S. Pat. No. 5,668,593. The step framing method does not provide mechanical/optical fixing of the LOS on the scenery during exposure time, and has a limited field of regard. On-chip motion compensation is used, but inaccuracies are induced due to vibrations of the aircraft, and delays in transferring the measurement of the vibrations to the reconnaissance system. It is therefore an object of the present invention to provide a reconnaissance airborne system capable of tolerating and compensating for very sharp maneuvers of the aircraft and for large terrain variations, while still providing high resolution and reliable images of the area of interest, within a very wide field of regard. It is still another object of the present invention to provide a reconnaissance system in which the amount of irrelevant data is significantly reduced, therefore reducing work needed for distinguishing relevant data from the fully obtained data, and reducing airborne and ground image storage and communication requirements. It is still another object of the present invention to enable the defining of very small areas of interest within a large area (i.e., a field of regard), of which images can be obtained. It is still another object of the present invention to reduce the communication load between the aircraft and a ground base station, when communicating images from the aircraft to the ground. It is still another object of the present invention to provide an airborne reconnaissance system with the ability to capture images in a wide range of the angle of sight (i.e., a wide field of regard). It is still another object of the invention to provide a new and efficient manner of obtaining the images required for creating stereoscopic-view images. It is still another object of the invention to provide the capability of combining in the same reconnaissance mission both manual mode operation and automatic mode operation. Other objects and advantages of the present invention will become apparent as the description proceeds. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention relates to an airborne reconnaissance system which comprises: a. Gimbals having at least two degrees of freedom; b. At least one array-of light sensors positioned on the gimbals for being directed by the same within at least two degrees of freedom; c. Map storage means for storing at least one Digital Elevation Map of an area of interest, divided into portions; d. Inertial Navigation System for real-time providing to a gimbals control unit navigation and orientation data of the aircraft with respect to a predefined global axes system; e. Portion selection unit for selecting, one at a time, another area portion from the area of interest; f. Servo control unit for: A. Receiving from said Digital Elevation Map one at a time, a coordinates set of the selective area portion, said set comprising the x:y coordinates of said area portion and the elevation z of the center of that portion; B. Receiving continuously from said inertial navigation system present location and orientation data of the aircraft; C. Repeatedly calculating and conveying into a gimbals servo unit in real time and at a high rate signals for: a. during a direction period, signals for directing accordingly the gimbals including said LOS of at least one array of light-sensing units towards said x:y:z coordinates of the selected area portion, and; b. during an integration period in which the array sensors integrate light coming from the area portion, providing to the gimbals unit signals for compensating for the change in direction towards the x:y:z coordinates of the selected portion evolving from the aircraft motion; g. Gimbals servo for effecting direction of the gimbals in at least two degrees of freedom according to the signals provided from said Servo Control Unit; h. Sampling means for simultaneously sampling at the end of the integration period pixel levels from each of said array sensors, a set of all of said sampled pixel levels forms an image of said area portion; and i. Storage means for storing a plurality of area portion images. Preferably, said one or more arrays are selected from at least a visual light-sensitive array, a WV light sensitive-array, an infrared light-sensitive array, a multi/hyper-spectral array, and an active illumination array. Preferably, said navigation data of the aircraft comprises data relating to the 3D location of the aircraft, and its velocity and acceleration vectors with respect to a predefined coordinates system, and its orientation data relating to the orientation of the aircraft with respect to said predefined coordinate system. Preferably, said Inertial Navigation System comprises velocity, acceleration, and orientation sensors, at least some of said sensors being positioned on the gimbals. Preferably, at least some of said arrays of sensors are positioned on the gimbals. Preferably, the system uses two Inertial Navigation Systems, the first inertial navigation system being the main Inertial Navigation System of the aircraft and its sensors being positioned within the aircraft, and the second Inertial Navigation System being an a system dedicated to the reconnaissance system, at least some of the sensors of said second Inertial Navigation System being positioned on the gimbals unit, measuring navigation and orientation data of the gimbals with respect to the said predefined axes system, for better eliminating misalignments occurring between the gimbals and LOS and the said main Inertial Navigation System of the aircraft due to aero-elastic deflections and vibrations of the aircraft, by using a process of transfer alignment from the said first INS to the said second INS. Preferably, the Digital Elevation Map is a map comprising a grid of the area of interest, the x:y:z coordinate values at each of the nodal points in said grid being provided by said map. Preferably, the portion selecting unit is used for calculating and determining a center of a next area portion such that provides a predefined overlap between the said imaged area portion and the adjacent previously imaged area portion. Preferably, in an automatic mode of operation the gimbals are activated to cover in a sequential, step-wise manner, the area of interest, said coverage is made from a predefined starting portion and according to a stored mission plan, thereby sequentially scanning one after the other area portions of the area of interest, and sampling images from each of said portions. Preferably, in a manual mode of the system the pilot of the aircraft defines an area of interest during the flight, said area of interest being automatically divided into at least one area portion, all the area portions being automatically scanned one after the other by means of correspondingly directing to them the on-gimbals array, for capturing images of each of said scanned portions. Preferably, the gimbals comprise two gimbals mechanisms, an external gimbals mechanism and an internal gimbals mechanism. Preferably, the external gimbals mechanism is used for coarse directing the on-gimbals array to the center of a selected area portion. Preferably, the external gimbals mechanism has two degrees of freedom, elevation and roll. Preferably, the internal gimbals mechanism is used for fine directing the on-gimbals array to the center of a selected area portion, particularly for compensating the gimbals direction for the aircraft motion and orientation change during the integration period. Preferably, the internal gimbals mechanism has two degrees of freedom, yaw and pitch. Preferably, the external gimbals mechanism is slaved to the internal gimbals mechanism. Preferably, during the integration period each of the array sensors simultaneously senses light from a corresponding section of the area portion, and at the end of the integration period the data from all the array sensors is read simultaneously, and stored as an image of the area portion. Preferably, the arrays of light sensors are sensitive to light in the range of visual light, IR, WV, multi/hyper-spectral, and/or an active illumination. Preferably, the arrays are focal plane arrays. Preferably, the predefined axes system is a global axes system. In one embodiment of the invention, the system of the invention is assembled within a pod attached to the aircraft. In another embodiment of the invention, the system of the invention is assembled within a payload installed inside the aircraft with only its windows protruding for obtaining a clear, unobstructed Line Of Sight. Preferably, the gimbals are located at the front of the pod, behind a transparent window. In an embodiment of the invention, the system further comprising a back-scanning mechanism comprising a mirror or prism, positioned on the gimbals and rotatable with respect thereto, light coming from the area portion first passing through said mirror which deflects the same towards the array, and: a. the servo control unit applies to the gimbals a continuous row and/or column scanning movement without stopping; and b. while the direction towards an area portion is being established, applying to said back-scanning mirror during the integration period an opposite direction movement with respect to said row and/or column scanning continuous movement, thereby compensating for that continuous movement and ensuring a fixed orientation relationship of the array with respect to the area portion imaged. The invention further relates to a method for carrying out airborne reconnaissance, which comprises: a. Providing at least one array of light-sensitive pixels; b. Mounting the at least one array on gimbals having at least two degrees of freedom so that the gimbals can direct the array to, a selected Line Of Sight; c. Providing a Digital Elevation Map of an area of interest, reconnaissance images from said area are to be obtained; d. Providing an Inertial Navigation System for obtaining at any time during the flight the updated x a :y a : z a coordinates of the center of the array with respect to a predefined coordinates system; e. Providing a calculation unit for, given x p :y p location coordinates of a center of specific area portion within the area of interest, and the z p elevation coordinate at said portion center as obtained from said Digital Elevation Map, and the said x a :y a :z a coordinates of the array center at same specific time, determining the exact angles for establishing a line of sight direction connecting between the center of the array and the said x p :y p :z p coordinates; f Given the calculation of step e, directing accordingly the center of the array's Line Of Sight to the center of the area portion; g. During an integration period, effecting accumulation of light separately by any of the array light sensors; h. During the integration period, repeating at a high rate the calculation of step e with updated array x a :y a :z a coordinates, and repeatedly, following each said calculation, correcting the direction as in step f; i. At the end of the integration period, sampling all the array sensors, and saving in a storage as images of the array portion; j. Selecting new portion coordinates x p :y p :z p within the area of interest, and repeating steps e to j for these new coordinates; and, k. When the coverage of all the area of interest is complete, terminating the process, or beginning coverage of a new area of interest. Preferably, the selection of x p :y p coordinates of a new area portion is performed to assure overlap between adjacent area portions within a predefined range, by calculating the 3-dimensional footprint of the new area portion on the ground, and then projecting it on the footprint of a previous area portion. Preferably, the overlap assurance is obtained by a trial and error selection, overlap calculation, and correction when necessary, or by an exact analytical calculation. Preferably, at least some of the sensors of the Inertial Navigation System are positioned on the gimbals, for improving the measuring of the orientation of the array with respect to the selective area portion. Preferably, at least some of the light sensitive sensors are positioned on the gimbals, for improving the measuring of the orientation of the Line Of Sight with respect to the selective area portion. Preferably, the Inertial Navigation System comprises a dedicated Inertial Navigation System of the reconnaissance system and the main Inertial Navigation System of the aircraft, to improve the measuring of the orientation of the array with respect to the selective area portion, by using a process of transfer alignment from the aircraft Inertial Navigation System to the dedicated reconnaissance system's Inertial Navigation System. The invention further relates to a method for providing motion compensation during airborne photographing which comprises: a. Providing at least one array of light-sensitive pixels; b. Mounting the at least one array on gimbals having at least two degrees of freedom so that the gimbals can direct its Line Of Sight towards a selective area portion; c. Providing a Digital Elevation Map of an area of interest, reconnaissance images from said area are to be obtained; d. Providing an Inertial Navigation System for obtaining at any instant during flight the updated x a :y a :z a coordinates of the center of the array with respect to a predefined coordinates system; e. Providing a calculation unit for, given x p ;y p location coordinates of a center of specific area portion within the area of interest, and the z p elevation coordinate at said portion center as obtained from said Digital Elevation Map, and the said x a :y a :z a coordinates of the array center at same specific time, determining the exact angles for establishing a line of sight direction connecting between the center of the array and the said. x p :y p :z p coordinates; f. During an integration period, when the center of the array's Line Of Sight is directed to a center of an area portion effecting accumulation of light separately by any of the array light sensors; g. During the integration period, repeating at a high rate the calculation of step e with updated array x a :y a :z a coordinates, and repeatedly, following each said calculation, correcting the direction by keeping the center of the array directed to the center of the selected area portion, therefore compensating for aircraft movement; and h. At the end of the integration period, sampling all the array sensors, and saving in a storage as images of the array portion. The invention further relates to a method for carrying out airborne targeting, which comprises: a. Providing at least one weapon; b. Mounting the at least one weapon on gimbals having at least two degrees of freedom so that the gimbals can direct the weapon to a selected Line Of Sight; c. Providing a Digital Elevation Map of an area of interest, selected targets within said area are to be obtained; d. Providing an Inertial Navigation System for obtaining at any time during the flight the updated x a :y a :z a coordinates of the center of the weapon with respect to a predefined coordinates system; e. Providing a calculation unit for, given x p :y p location coordinates of a center of specific target within the area of interest, and the z p elevation coordinate at said target center as obtained from said Digital Elevation Map, and the said x a :y a :z a coordinates of the weapon center at same specific time, determining the exact angles for establishing a Line of Sight Direction connecting between the center of the weapon and the said x p :y p :z p coordinates; f. Given the calculation of step e, directing accordingly the center of the weapon Line Of Sight to the center of the target; h. During the effective targeting and shooting period, motion compensating for the motion of the aircraft. The motion compensation of the targeting can be made in any conventional manner known in the art. According to an embodiment of the present invention the motion compensation of step h is carried out by repeating at a high rate the calculation of step e with updated target x a :y a :z a coordinates, and repeatedly, following each said calculation, correcting the direction as in step f. |
Process for preparing variant polynucleotides |
The present invention discloses a process for the preparation of variant polynucleotides using a reassembly process of preferably blunt-ended restriction enzyme fragments prepared form a starting population of heterologous polynucleotides in the presence of a thermostable ligase. |
1. A process for the preparation of a variant polynucleotide having a desired property, comprising: subjecting a population of polynucleotides to separate digestions with a restriction enzyme; combining the digests; applying one or more cycles of denaturation, annealing and reassembly in the presence of a ligase; optionally amplifying the reassembled polynucleotides; preparing a library of the resulting variant polynucleotides; screening said library of variant polynucleotides for a variant polynucleotide with a desired property. 2. The process of claim 1, wherein the population of polynucleotides displays homology of at least 70%. 3. The process of claim 1, wherein the population of polynucleotides is selected from the group consisting of a population of different mutants of a parental polynucleotide and a population of different members of a gene family. 4. The process of claim 1, wherein the ligase ligates single-strand nicks in a double stranded polynucleotide. 5. The process of claim 1, wherein the ligase substantially does not ligate blunt-ended polynucleotide fragments. 6. The process of claim 1, wherein the ligase is a thermostable ligase. 7. The process of claim 1, wherein the amplification of the reassembled polynucleotides is performed under error-prone conditions. 8. The process of claim 1, wherein the polynucleotide comprises one or more gene(s) encoding a polypeptide. 9. The process of claim 9, wherein the polypeptide is involved in the biosynthetic pathway of a primary or secondary metabolite. 10. A process for the production of a variant polypeptide comprising expressing the variant polynucleotide prepared according to the process of claim 1 in a suitable host and, optionally, recovering the produced polypeptide. 11. A process for the production of a primary or secondary metabolite comprising expressing the variant polynucleotide prepared according to the process of claim 9 in a suitable host and, optionally, recovering the produced metabolite. 12. The process of claim 1 wherein said enzyme generates blunt-ended fragments. 13. The process of claim 2 wherein said homology is at least 75%. 14. The process of claim 13 wherein said homology is at least 80%. 15. The process of claim 14 wherein said homology is at least 85%. 16. The process of claim 15 wherein said homology is at least 90%. 17. The process of claim 16 wherein said homology is at least 95% |
<SOH> BACKGROUND OF THE INVENTION <EOH>Protein engineering technology includes the creation of novel proteins by targeted modification(s) of known proteins. However, an approach directed to targeted modification is only applicable to proteins or protein families of which the three-dimensional structure of the protein or at least one member protein of the family has been resolved. Furthermore, many attempts to alter the properties of enzymes by this approach have failed because unexpected changes in the structure were introduced. If random mutagenesis is applied to create modified proteins, it appeared that successfully modified proteins often possessed amino acid substitutions in regions that protein modeling could not predict. Various approaches have been developed to mimic and accelerate nature's recombination strategy to direct the evolution of proteins to more beneficial molecules. Direct evolution is a general term used for methods for random in vitro or in vivo homologous recombination of pools of homologous polynucleotides. Several formats are described, for instance random fragmentation followed by polymerase-assisted reassembly (WO 9522625), in vivo recombination (WO97107205, WO98/31837) or staggered extension of a population of polynucleotide templates (WO97/07205, WO98/01581). In this way an accumulation of beneficial mutations in one molecule may be accomplished. The method of the present invention advantageously enables the random combination of mutated positions in a rapid, reproducible and highly controllable way. A further advantage of the method of the invention is that the recombination frequency is high and the chance to re-isolate the starting polynucleotide is low. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 . Schematic illustration of the BERE recombination technique. FIG. 2 . Blunt-end restriction enzyme fragmentation used for the BERE recombination method. FIG. 3 . Agarose gel electrophoresis of the reassembly reaction. The arrow indicates DNA bands of the appropriate size (˜1 kb). 1: Marker 2: Reassembly (+Ampligase), 15 cycles 3: Reassembly (+Ampligase), 30 cycles 4: Starting material (all restriction fragments FIG. 4 . Typical results of the conversion activities of a group of mutants from the KKN05 library selected after the first MTP analysis. detailed-description description="Detailed Description" end="lead"? |
Nucleic acid sequences encoding enantioselective amidases |
The invention relates to a nucleic acid sequence encoding an enantioselective amidase with an amino acid sequence, which amino acid sequence has at least 70% identity with SEQ ID NO: 2. The invention also relates to a prcoess for the fermentation, comprising a batch and a feed phase, of a microorganism in a fermentation medium, wherein the microorganism expresses a nucleic acid according to the invention and wherein between 0.5 and 50 mg/l_fermentation medium Zn2+ is fed during the fermentation. The invention also relates to a process for the preparation of an enantiomerically enriched carboxylic acid and/or an enantiomerically enriched carboxylic acid amide, in which a mixture of the corresponding D- and L-carboxylic acid amides is contacted with an expression product according to the invention in the presence of between 0.01 mM and 100 mM Zn2+, whereby one of the enantiomers of the carboxylic acid amide is enantioselectively hydrolysed to form the corresponding enantiomerically enriched carboxylic acid, while the other enantiomer of the carboxylic acid amide remains unchanged. |
1. A nucleic acid molecule comprising a nucleotide sequence encoding an enantioselective amidase wherein said amidase a) has an amino acid sequence that has at least 70% identity with SEQ ID NO: 2, or b) has an amino acid sequence of SEQ ID NO. 2 with alterations at 15 or less positions, wherein each alteration is independently (i) an insertion of an amino acid, (ii) a deletion of an amino acid or (iii) a substitution of an amino acid; or c) displays immunological cross-reactivity with an antibody raised against a fragment of the amino acid sequence of SEQ ID NO. 2. 2. A nucleic acid molecule encoding an enantioselective amidase comprising a nucleotide sequence that hybridizes under medium stringency conditions with (i) SEQ ID NO. 1, (ii) a genomic DNA sequence comprising SEQ ID NO. 1, or (iii) a complementary strand of (i) or (ii). 3-4. (canceled) 5. The nucleic acid molecule of claim 1 wherein said encoding nucleotide sequence is operatively linked to one or more nucleotide sequences, which encode (a) marker polypeptide(s). 6. A vector comprising a the nucleic acid molecule according to claim 5. 7. Host cells modified to contain the nucleic acid molecule according to claim 5. 8. A process for the preparation of an enantiomerically selective amidase which method comprises culturing the cells of claim 7. 9. The process of claim 8 wherein said culturing comprises a batch and a feed sequence of supplying medium and wherein the medium contains between 0.5 and 50 mg/l Zn2+. 10. A process for the preparation of an enantiomerically enriched carboxylic acid and/or an enantiomerically enriched carboxylic acid amide, which comprises contacting a mixture of the corresponding D- and L-carboxylic acid amides with the amidase encoded by the nucleic acid molecule according to claim 1 in the presence of between 0.01 mM and 100 mM Zn2+, whereby one of the enantiomers of the carboxylic acid amide is enantioselectively hydrolysed to form the corresponding enantiomerically enriched carboxylic acid, while the other enantiomer of the carboxylic acid amide remains unchanged. 11. An enantioselective amidase prepared by the process of claim 8. 12. An enantioselective amidase prepared by the process of claim 9. 13. A process for the preparation of an enantiomerically enriched carboxylic acid and/or an enantiomerically enriched carboxylic acid amide, which comprises contacting a mixture of the corresponding D- and L-carboxylic acid amides with the amidase of claim 11 in the presence of between 0.01 mM and 100 mM Zn2+, whereby one of the enantiomers of the carboxylic acid amide is enantioselectively hydrolysed to form the corresponding enantiomerically enriched carboxylic acid, while the other enantiomer of the carboxylic acid amide remains unchanged. 14. A process for the preparation of an enantiomerically enriched carboxylic acid and/or an enantiomerically enriched carboxylic acid amine, which comprises contacting a mixture of the corresponding D- and L-carboxylic acid amides with the amidase of claim 12 in the presence of between 0.01 mM and 100 mM Zn2+, whereby one of the enantiomers of the carboxylic acid amide is enantioselectively hydrolysed to form the corresponding enantiomerically enriched carboxylic acid, while the other enantiomer of the carboxylic acid amide remains unchanged. |
Process for preparing variant polynucleotides |
The present invention discloses a process for the preparation of variant polynucleotides using a combination of mutagenesis of a starting population of polynucleotides and recombination of the mutated polynucleotides. The process comprises the steps of subjecting a population of polynucleotides to (a series of) two (or more) separate PCR's comprising a first PCR with a forward mutation-specific primer for a position to be mutated and a reverse universal primer and a second PCR with a forward universal primer and a reverse mutation-specific primer for a position to be mutated. The products of the (series of) two (or more) PCR's are assembled by a polymerase, preferably in one tube. |
1. A process for the preparation of a variant polynucleotide having a desired property, comprising: subjecting a population of polynucleotides to two or more separate PCR's, a first PCR with a forward mutation-specific primer for a position to be mutated and a reverse universal primer, a second PCR with a forward universal primer and a reverse mutation-specific primer for a position to be mutated, and, optionally, a third or more PCR with a suitable forward and reverse primer; assembling the products of the two or more PCR's by a polymerase; optionally amplifying the assembled polynucleotides; preparing a library of the resulting variant polynucleotides; screening said library of variant polynucleotides for a variant polynucleotide with a desired property. 2. The process of claim 1, wherein the population of polynucleotides displays homology ranging from of 70-100%. 3. The process of claim 1, wherein the population of polynucleotides is selected from the group consisting of a population of identical polynucleotides, a population of different mutants of a parental polynucleotide and a population of different members of a gene family. 4. The process of claim 1, wherein the mutation-specific primer is a saturated primer. 5. The process of claim 1, wherein the mutation-specific primer is a spiked oligonucleotide. 6. The process of claim 1, wherein the population of polynucleotides is subjected to a series of two or more separate PCR's and the resulting series of separate PCR products is assembled by a polymerase in one tube. 7. The process of claim 1, wherein the population of polynucleotides is subjected to a series of two or more separate PCR's and the resulting series of separate PCR products is separately assembled by a polymerase. 8. The process of claim 1, wherein the assembly is performed in the presence of additionally added universal forward and reverse primer. 9. The process of claim 1, wherein the two or more separate PCR's and/or the amplification of the assembled polynucleotides are performed under error-prone conditions. 10. The process of claim 1, wherein the polynucleotide comprises one or more gene(s) encoding a polypeptide. 11. The process of claim 10, wherein the polypeptide is involved in the biosynthetic pathway of a primary or secondary metabolite. 12. A process for the production of a variant polypeptide comprising expressing the variant polynucleotide prepared according to the process of claim 1 in a suitable host and, optionally, recovering the produced polypeptide. 13. A process for the production of a primary or secondary metabolite comprising expressing the variant polynucleotide prepared according to the process of claim 11 in a suitable host and, optionally, recovering the produced metabolite. 14. The process of claim 2 wherein the population of polynucleotides displays homology of 75-100%. 15. The process of claim 2 wherein the population of polynucleotides displays homology of 80-100%. 16. The process of claim 2 wherein the population of polynucleotides displays homology of 85-100%. 17. The process of claim 2 wherein the population of polynucleotides displays homology of 90-100%. 18. The process of claim 2 wherein the population of polynucleotides displays homology of 95-100%. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Protein engineering technology includes the creation of novel proteins by targeted modificaton(s) of known proteins. However, an approach directed to targeted modification is only applicable to proteins or protein families of which the three-dimensional structure of the protein or at least one member protein of the family has been resolved. Furthermore, many attempts to alter the properties of enzymes by this approach have failed because unexpected changes in the structure were introduced. If random mutagenesis is applied to create modified proteins, it appeared that successfully modified proteins often possessed amino acid substitutions in regions that protein modeling could not predict. Various approaches have been developed to mimic and accelerate nature's recombination strategy to direct the evolution of proteins to more beneficial molecules. Direct evolution is a general term used for methods for random in vitro or in vivo homologous recombination of pools of homologous polynucleotides. Several formats are described, for instance random fragmentation followed by polymerase-assisted reassembly (WO9522625), in vivo recombination (WO97/07205, WO98/31837) or staggered extension of a population of polynucleotide templates (WO97/07205, WO98/01581). In this way an accumulation of beneficial mutations in one molecule may be accomplished. The method of the present invention advantageously enables the mutagenesis of a polynucleotide and the random combination of mutated positions to be performed in one process, without the necessity for prior fragmentation of the polynucleotide. The method is reproducible, highly controllable and very fast. A further advantage of the method of the invention is that the recombination frequency is high and the chance to re-isolate the starting polynucleotide is low. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 . Schematic illustration of (saturated) Mutation Primer PCR DNA Recombination. * mutated position; @ saturated mutation site FIG. 2 . Agarose gel electrophoresis of the single step PCR's. Above 1-9: DNA product after a PCR reaction with the universal 5′ primer and mutation primers 1-9. Under 1′-9′: DNA product after a PCR reaction with the universal 3′ primer and mutation primers 1′-9′. FIG. 3 . Typical results of the conversion activities of a group of mutants from part of the KKN07 library selected after the first MTP analysis. detailed-description description="Detailed Description" end="lead"? |
Clock synchronization in a distributed system |
The present invention provides an improved clock synchronization algorithm for a distributed system intended for real time applications by performing at the same time an off-set correction and a clock read correction at each node of the distributed system. Expensive oscillators can be avoided and synchronization can be established faster and with higher precision. |
1. A method for synchronizing nodes (1) of a distributed system for real time applications, the nodes (1) of the distributed system are interconnected by a communication link (3) and each of the nodes (1) includes a local clock (2) and information indicating when messages are to be received from other nodes (1), each node (1) from at least a subset of all nodes (1) performs the following steps for synchronizing its local clock (2): (a) receiving messages from other nodes (1), (b) determining a set of time deviations between its own local clock (2) and all other nodes (1) of the subset of nodes (1), a time deviation being determined by measuring the difference between an expected receiving time of a received message and an actual receiving time observed based on the time of its own local clock (2), (c) determining a set of clock rate deviations between its own local clock (2) and all other nodes (1) of the subset of nodes (1) based on two subsequently received messages from each of the other nodes (1) of the subset, (d) calculating an off-set correction value based on said determined set of time deviations and calculating a clock rate correction value based on said set of determined clock rate deviations, and (e) adjusting the local clock (2) based on the calculated off set correction value and said calculated clock rate correction value. 2. A method according to claim 1 wherein said first determining step (b) determines a first and a second set of time deviations, and said second determining step (c) calculates said set of clock rate deviations by calculating differences between corresponding time deviations of said first and second set of determined time deviations. 3. A method according to claim 2 wherein said calculation step (d) calculates an off-set correction value based on said second set of determined time deviations. 4. A method according to claim 1 wherein said second determining step (c) determines a clock rate deviation by measuring the difference between an expected time interval and an observed time interval, said expected time interval being a time interval between expected receiving times of subsequently received messages of a particular node and said observed time interval being a time interval between the actual receiving times of the messages observed based on the time of its own local clock (2). 5. A method according to claim 4 wherein said second determining step (c) determines each clock rate deviation of said set of clock rate deviations by performing the steps of (cl) counting a time interval between actual receiving times of subsequently received messages for a particular node (1) of the subset of nodes (1) based on the time of its own local clock (2), and (c2) calculating a clock rate difference between the counted time interval for the particular node (1) and an expected time interval based on the expected receiving times of the messages for the particular node (1). 6. A method according to claim 1 wherein said distributed system is a time triggered system. 7. A method according to claim 1 wherein said information included in the node' (1) defines for every node (1) of the distributedsystem certain time slots in which a particular node. (1) is allowed to send messages on said communication link (3). 8. A method according to claim 1 wherein said information included in the nodes (1) defines access for every node (1) to said communication link (3) once within a predefined time interval. 9. A method according to claim 8 wherein a time interval having the same predefined temporal access pattern for the nodes (1) of the distributed system to the communication link (3) is continuously repeated. 10. A method according to claim 8 wherein each of the nodes (1) transmits own messages when having access to said communication link (3) according to said predefined access pattern. 11. A method according to claim 1 wherein said calculating step (d) calculates said clock rate correction value based on two clock rate deviations of said set of determined clock rate deviations according to a first predetermined rule. 12. A method according to claim 11, wherein said first predetermined rule selects two clock rate deviations which have the largest difference with respect to each other. 13. A method according to claim 11 wherein said first predetermined rule excludes clock rate deviations according to a second predetermined rule. 14. A method according to claim 1 wherein said calculating step (d) calculates said clock rate correction value by incrementing the clock rate correction value applied during the previous adjusting step with the currently calculated clock rate correction value. 15. A method according to claim 1 further comprising a step of changing the clock rate correction value provided by said calculating step (d) according to a third predetermined rule. 16. A method according to claim 15 wherein said third predetermined rule replacing said calculated clock rate correction value by a value having a slightly reduced amount. 17. A method according to claim 1 wherein said adjusting step (e) for adjusting the local clock (2) based on the calculated clock rate correction value and the calculated off-set correction value is performed for both correction values after a predetermined number of time intervals each of which defining access for every node to said communication link (2) once per time interval. 18. A computer program comprising code means adapted to perform the method according to claim 1. 19. A synchronizing unit for synchronizing a node (1) in a distributed system for real time applications, the nodes (1) in the distributed system are interconnected by a communication link (3), the synchronizing unit comprises: a local clock (2), a memory (6) for storing information indicating when messages are to be received from particular nodes (1), a deviation detector for determining a set of time deviations between its own local clock (2) and other nodes (1), a time deviation being determined by measuring the difference between an expected receiving time of a received message and the receiving time observed based on the time of its own local clock (2), and for determining a set of clock rate deviations between its own local clock (2) and other nodes (1) based on two subsequently received messages for a node (1), a correction calculation unit for calculating an off-set correction value based on said determined set of time deviations and for calculating a clock rate correction value based on said determined set of clock rate deviations, and an adjusting unit for adjusting the local clock based on the calculated offset correction value and on the calculated clock rate correction value. 20. A synchronizing unit according to claim 19 wherein said deviation detector being adapted to determine a first and a second set of time deviations and to determine said set of clock rate deviations by calculating differences between corresponding time deviations of said first and second set of time deviations. 21. A synchronizing unit according to claim 20 wherein said correction calculation unit calculates an off-set correction value based on said second set of determined time deviations. 22. A synchronizing unit according to claim 19 wherein said deviation detector being adapted to determine a clock rate deviation by measuring the difference between an expected time interval and an observed time interval, said expected time interval being a time interval between expected receiving times of subsequently received messages of a particular node and said observed time interval being a time interval between the actual receiving times of the messages observed based on the time of its own local clock (2). 23. A synchronizing unit according to claim 22 wherein said deviation detector comprises a counter for counting a time interval between actual receiving times of subsequently received messages for a particular node (1) based on the time of its own local clock (2). 24. A synchronizing unit according to claim 19 wherein said memory (6) storing information defining for every node (1) of the distributed system a certain temporal access pattern allowing a particular node (1) to send messages on said communication link (3). 25. A synchronizing unit according to claim 19 wherein said information included in the nodes (1) defines access for every node (1) to said communication link (3) once within a predefined time interval. 26. A synchronizing unit according to claim 19 wherein each node further comprises a transmitter for transmitting own messages when having access to said communication link (3) according to said predefined access pattern. 27. A synchronizing unit according to claim 19 further comprising a deviation memory for storing time deviations determined between the local clock (2) and the clocks (2) of other nodes (1). 28. A synchronizing unit according to claim 27 wherein said memory being adapted to store two sets of time deviations. 29. A synchronizing unit according to claim 19 further comprising a drift protection means for changing the clock rate correction value provided by said correction calculating unit and forwarding a changed clock rate correction value to said adjusting unit |
Method for the production of a metal tube, in particular a gas distributor tube for vehicle airbags |
The invention relates to a method for the production of a metal tube, particularly a gas distributor tube for vehicle airbags. The tube mantle is punched out as a planar metal blank, the outside contour of which corresponds to the developed view of the tube. The planar metal blank is then formed into a profile having a U-shaped cross-section. The U-shaped profile is pressed to form a tube-shaped semi-finished piece that still has an open longitudinal slit. The longitudinal slit, which extends without interruption with an essentially constant gap width over the entire length of the tube, is finally welded closed. In the production of gas distributor tubes, the outside contour of the metal blank corresponds to a developed view of the gas distributor tube, whereby the parting plane for the developed view is laid through the exit openings. |
1. Method for the production of a metal tube, which has at least one change in cross-section, wherein the tube mantle is punched out as a planar metal blank (4), the outside contour of which corresponds to the developed view of the tube (1, 1′), the planar metal blank (4) is formed into a profile (5) having a U-shaped cross-section, the U-shaped profile (5) is pressed to form a tube-shaped semi-finished piece (7) that still has an open longitudinal slit, and the longitudinal slit, which extends without interruption with an essentially constant gap width over the entire length of the tube, is welded closed. 2. Method according to claim 1, characterized in that the metal blank (4) has segments of different width, which are connected by means of constant transition segments. 3. Method according to claim 1 or 2, characterized in that the metal blank is punched out in a width that corresponds to the outside diameter of the tube, multiplied by the number π. 4. Method according to one of claims 1 to 3, characterized in that press die-plates (6, 6′) configured as half-shells are used for the production of the tube-shaped semi-finished piece (7) and that the shank ends of the U-shaped profile (5) are held at a distance that forms the longitudinal slit, by means of a tongue (8), during the shaping. 5. Method according to one of claims 1 to 4, characterized in that a welding tool, for example one controlled by an automatic welding machine, is guided along the longitudinal slit of the tube-shaped semi-finished piece (7), which follows the spatial progression and the contour of the tube and welds the longitudinal seam closed. 6. Method according to one of claims 1 to 5, characterized in that within the course of the deformation of the metal blank (4), functional elements (9) are inserted, which are fixed in place with a positive lock, by means of the wall profile, after completion of the tube (1, 1′). 7. Method according to claim 6, characterized in that projections are formed on the lengthwise sides of the metal blank (4), which form an annular space for holding a functional element (9), after deformation to produce a tube-shaped semi-finished piece, and that the contour forming the annular space is finished with external shaping tools. 8. Method according to claim 6 or 7, characterized in that projections are formed on the lengthwise sides of the metal blank (4), which form a bead-shaped widened tube region to hold a disk (10), after deformation to produce a tube-shaped semi-finished piece (7), and that the widened tube region is pressed to form a collar (11), using shaping tools, in which the disk (10) is fixed in place with a positive lock. 9. Method according to one of claims 6 to 8, characterized in that a flow insert (9) arranged between two support disks (10) is laid into the profile within the course of the deformation process, and that the support disks are fixed in place, with a positive lock, in collars (11) that are formed during the course of the deformation of the metal blank (4), and finished using shaping tools. 10. Method according to one of claims 1 to 9, characterized in that the lengthwise edges of the metal blank (4) have a profile with back-sets (16), which complement one another during the deformation of the metal blank (4) to form a tube (1′), to form exit openings (13) on the mantle, which are in a row in the longitudinal direction. 11. Method according to one of claims 1 to 10, characterized in that the lengthwise edges of the metal blank (4) have a profile with projections (15), from which a collar (3) and a connector cuff (2) are formed during the deformation of the metal blank (4) to form a tube (1′). 12. Method according to one of claims 1 to 11, characterized in that the metal blank (4) has a segment with a lesser width, which forms a narrowed cross-section of the tube after deformation of the metal blank. 13. Method according to one of claims 10 to 12, characterized in that the metal blank (4) is punched out of a piece of sheet metal, in segments, whereby the length of the segments is selected to be such that the transitions lie in the region of the back-sets (16) on the edges of the metal blank (4) that form the exit openings (13). 14. Method according to one of claims 1 to 13, characterized in that the tube that has been produced from the planar metal blank (4) and welded longitudinally is given a predetermined spatial progression adapted to the application, by means of bending. 15. Method according to one of claims 1 to 13, characterized in that a bending deformation that shapes the work piece in the longitudinal direction takes place at the same time with deformation of the metal blank (4) and/or with the subsequent pressing to form a tube-shaped semi-finished piece (7), and that in this way, the work piece is given a spatial progression adapted to the application, before the longitudinal slit of the tube-shaped semi-finished piece (7) is welded closed. 16. Method according to claim 15, characterized in that the metal blank (4) is deformed into a work piece having a U-shaped cross-section, by means of bending in a forging die or edge rolling, which piece is curved in the longitudinal direction and subsequently pressed into a tube shape using press die-plates (6, 6′), the shaping cavity of which is adapted to the shape of the work piece. 17. Method according to claim 15 or 16, characterized in that segments curved in arc shape are deformed subsequently, by means of bending of the tube that has already been shaped three-dimensionally and welded at the longitudinal seam. |
Fat-emulsions |
The invention provides water continuous or bicontinuous fat emulsions, comprising fat, protein, humectants aid relatively low amounts of water and which emulsions display an water activity of 0.6 to 0.8 and have a shelf life at ambient temperature of more than 6 months. A method of preparing the emissions is also provided. |
1. Water continuous or bicontinuous fat emulsion comprising: (i) 40 to 85 wt % of a vegetable or animal fat; (ii) 1 to 10 wt % of proteins (iii) 1 to 35 wt % of at least one humectant selected from the group consisting of carbohydrates, polyalcohols and edible inorganic salts; (iv) 5 to 15 wt % of water, and which emulsion displays a water activity (Aw) of 0.6 to 0.8. 2. An emulsion according to claim 1, wherein the emulsion displays a water activity of from 0.6 to 0.7. 3. An emulsion according to claim 1, wherein the emulsion has a non-transparent white colour and a consistency of a paste, displaying a Stevens value between 25-200 grams, and/or a viscosity between 50-400 Pa.s and/or a conductivity higher than 1 micro Siemens/cm. 4. An emulsion according to claim 1, wherein the emulsion comprises 52 to 67 wt % of a vegetable or animal fat. 5. An emulsion according to claim 1, wherein the fat is selected from at least one fat of the group consisting of palm oil and hardened palm oil or factions thereof; soy bean oil and hardened soy bean oil or fractions thereof; sunflower oil and hardened sunflower oil or fractions thereof; rape seed oil and hardened rape seed oil or fractions thereof; cotton seed oil and hardened cotton seed oil or fractions thereof, arachidic oils and hardened arachidic oil or fractions thereof and mixtures of one or more of these fats. 6. An emulsion according to claim 5, wherein the fat is selected from palm kernel oil and hardened palm kernel oil or fractions thereof; coconut oil and hardened coconut oil or fractions thereof and mixtures of one or more of these fats. 7. An emulsion according to claim 1, wherein the emulsion comprises 5 to 8 wt % of proteins. 8. An emulsion according to claim 1 wherein the protein is derived from animal dairy or vegetable proteins. 9. An emulsion according to claim 8, wherein the protein is caseinate. 10. An emulsion according to claim 1, wherein the carbohydrate is selected from the group consisting of mono, di and polysaccharides, hydrolysed polysaccharides, chemically or enzymatically modified polysaccharides. 11. An emulsion according to claim 1, wherein the polyalcohol is glycerol. 12. An emulsion according to claim 1, wherein the edible inorganic salt is an alkali or alkali earth metal salt of a halogenide. 13. An emulsion according to claim 1, wherein the emulsion comprises 11 to 15 wt % of water. 14. An emulsion according to claim 1, wherein the emulsion comprises a preservative. 15. An emulsion according to claim 14, wherein the preservative is selected from the group consisting of potassium sorbate; sulphur dioxide, hydroxybenzoic acid or C1-C4 alkyl esters thereof, sodium hydrogensulphite or potassium hydrogensulphite or meta sulphites from alkali metals. 16. An emulsion according to claim 1, wherein the emulsion has a shelf life at 20 to 35° C. of more than 6 months. 17. A method for the preparation of a water continuous or a bicontinuous emulsion comprising a vegetable or animal fat, proteins, at least one humectant and water, wherein the method comprises the steps; (i) white coconut meat is grated and subjected to pressing to produce coconut milk with a water content of from about 45 to 70 wt %, (ii) the coconut milk obtained is sieved to remove particles with a size of more than 150 microns, (iii) one or more humectants are added to the product from (ii), (iv) the product obtained from (iii) is pasteurised, (v) the pasteurised product from (iv) is subjected to an evaporation under reduced pressure at relatively low temperature resulting in a product with a water content of from 5 to 15 wt %, (vi) optionally a protein and a humectant, are added to the product obtained after step (v), (vii) the product is collected. 18. A method according to claim 17 wherein the evaporation in step (v) is performed at a pressure of from 10 to 50 mm Hg and at a temperature of from 40 to 70° C. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Coconut paste is disclosed in U.S. Pat. No. 3,899,606. The product typically contains about 3.5 wt % moisture; about 65 wt % fat; about 7.2 wt % protein; about 3.9 wt % fibers and about 19 wt % carbohydrate or other fiber materials. The product is made by a process wherein coconut meat is washed with water and the washed meat is collected and treated with an acid to disrupt the cells, whereupon a fat solution is separated from a residue and the residue is neutralized and dewatered resulting in a dewatered product as the paste. This process has the disadvantage that a treatment of the coconut meat with acid and a subsequent neutralization are necessary, complicating the process. Moreover the product obtained is not a water continuous or bicontinuous fat emulsion, and the water activity of this emulsion will be very low (about 0.4 to 0.5) so that the emulsion is not very physically stable above 250° C. From U.S. Pat. No. 2,147,751 a coconut product is known that comprises up to 5 wt % of water. This product is made by a process wherein copra is dehydrated before subjecting it to a grinding operation; otherwise a waxy non-meltable product is produced which cannot be used in the preparation of food products. The product obtained is a fat continuous emulsion and thus has the same disadvantages as mentioned above for the paste according to U.S. Pat. No. 3,899,606. U.S. Pat. No. 5,599,575 discloses creamed coconut products with improved storage stability and organoleptic properties, which product contains finely divided coconut particles with a particle size of less than 30 microns and more than 50 wt % fat. This product will also be fat continuous because of its very low water content (1.5 to 3.5 wt % cf col 1, 1.36) and its preparation methodology. Therefore this product has similar defects as the products discussed above. U.S. Pat. No. 4,098,912 discloses coconut cream that is pasteurised and homogenised. The cream is made by a process wherein coconut meat is pressed and the juice obtained is later recombined with part of the pulp separated during the pressing after this has been comminuted in a mill. This process probably results in a water continuous emulsion, which can be slightly thickened by the addition of a thickener. However, this emulsion is not a paste but a liquid and will display a water activity of more than 0.85. Therefore the microbiological stability, and the shelf life, of this product are insufficient for commercial use. EP 78 8747 discloses mayonnaise-like products with a pH from 2 to 5 and comprising 55 to 85 wt % fat, denatured proteins, sugar, salt and 0.1 to 20 wt % vinegar. The emulsions however have water activity values of above 0.9. U.S. Pat. No. 3,892,873 discloses emulsified oil dressings prepared with a serum protein emulsified obtained from egg yolk. The emulsions have water activity values of above 0.9. JP 2000 093070 discloses a method for preparing a cookie by preparing an oil in water emulsion. When the emulsion comprises protein (from added flour) the percentage of oil in the emulsion is then no more than about 35 wt %. U.S. Pat. No. 4,948,617 discloses a low cholesterol mayonnaise substitute. The water activity of the emulsion is above 0.9. EP 509 579 discloses whippable non-dairy creams. The creams have high levels of water, and water activities are accordingly about 0.9. JP 07255 376 discloses oil-in-water emulsion compositions to be used at the top or bottom of a dessert food. The emulsions contain high levels of water. JP 02 145165 discloses emulsions for use in baking and confectionery. The emulsions comprise relatively high levels of water and high levels of either sugars and/or oils or have Aw of about 0.95. JP 2000/139346 discloses emulsions comprising water, protein and high levels of oil. However, a humectant is not included. JP 63 044841 discloses in broad terms highly viscous oil-in-water emulsions which comprise up to 70 wt % of edible fat or oil. The emulsions comprise about 30 wt % water even though they are highly viscous. The process to produce the emulsions involves an ultra high temperature treatment step. JP 11 146756 discloses water in oil emulsions comprising high levels of water and also comprising proteins. U.S. Pat. No. 5,698,254 discloses coconut cream alternatives which are water continuous fat emulsions comprising up to 30% vegetable fat and about 70 or 80 wt % of water. However, these type of emulsions, in general, have insufficient microbial stability and too short a shelf life and thus the properties of these emulsions are not as desired. It is an object of the invention to address at least one of the aforementioned problems. In particular, it is an object of the invention to provide fat emulsion which can be easily dispersed in un-heated water (i.e. water at ambient temperature, typically having a temperature of up to about 25 or 30° C.). Furthermore, the invention provides a fat emulsion, especially a coconut paste, that combines good water dispersibility with excellent storage properties and which can be made by a simple process. |
<SOH> SUMMARY OF THE INVENTION <EOH>It has been found that when a water continuous or bicontinuous fat emulsion is formulated in a given way, and the water activity (Aw) of that emulsion is controlled to within given limits, that one or more of the above technical problems is addressed. The invention therefore provides, according to a first aspect, a water continuous or bicontinuous fat emulsion comprising: (i) 40 to 85 wt % of a vegetable or animal fat, (ii) 1 to 10 wt % of proteins, (iii) 1 to 35 wt % of at least one humectant selected from the group consisting of carbohydrates, polyalcohols and edible inorganic salts, (iv) 5 to 15 wt % of water, and which emulsion displays a water activity (Aw) of 0.6 to 0.8. The emulsions of the invention have the advantages that they are easily dispersible in un-heated water, have good storage stability at 20-30° C. and can be made by a simple process. The invention also provides according to a second aspect a method for the preparation of a water continuous or a bicontinuous emulsion comprising a vegetable or animal fat, proteins, at least one humectant and water, wherein the method comprises the steps; (i) white coconut meat is grated and subjected to pressing to produce coconut milk with a water content of from about 45 to 70 wt %, (ii) the coconut milk obtained is sieved to remove particles with a size of more than 150 microns, (iii) one or more humectants are added to the product from (ii), (iv) the product obtained from (iii) is pasteurised, (v) the pasteurised product from (iv) is subjected to an evaporation under reduced pressure at relatively low temperature resulting in a product with a water content of from 5 to 15 wt %, (vi) optionally a protein and a humectant, are added to the product obtained after step (v), (vii) the product is collected. A further advantage of the emulsions of the invention is that when they are exposed to the air, e.g. when packed in a closed container which is subsequently opened, the emulsions are not subject to rapid microbiological spoilage because of their low water activity. Except in the operating and comparative examples, or where otherwise explicitly indicated, all numbers in this description indicating amounts of material or conditions of reaction, physical properties of materials and/or use are to be understood as modified by the word “about.” All amounts are by weight, unless otherwise specified. detailed-description description="Detailed Description" end="lead"? |
Method of and apparatus for controlling flashback in an introducer needle and catheter assembly |
A method is provided for controlling the fluid flow rate in an extension tube of an introducer needle assembly for use as confirmation flashback. The introducer needle assembly has a catheter attached to a catheter hub with a side port, an extension tube attached to the side port on the catheter hub, and an introducer needle with a notch adapted to be inserted into a bore in the catheter. A lumber extends through the needle and Is in fluid communication with the notch. The needle has an outer diameter smaller than the diameter of the bore such that an annular space is defined between the catheter and the needle. The fluid, typically blood, is at a pressure and has a viscosity when the needle accesses it. A preferred minimum fluid velocity of the fluid through the extension tube is selected (preferably at least 1 inch per minute though the extension tube in certain applications). The notch and the annular space are sized based, at least in part, on the viscosity of the fluid and the pressure of the fluid to achieve the preferred flow rate though the extension tube. |
1. A method of controlling the fluid flow rate in an extension tube of an introducer needle assembly for confirmation flashback, the introducer needle assembly having a catheter attached to a catheter hub with a side port, an extension tube attached to the side port on the catheter hub, and an introducer needle with at least one notch adapted to be inserted into a bore in the catheter, wherein the needle has an outer diameter smaller than the diameter of the bore such that an annular space is defined between the catheter and the needle and wherein the fluid is at a pressure and has a viscosity when it is accessed by the needle, the method including: selecting a preferred fluid flow rate of a fluid through the extension tube; and sizing the notch and the annular space based, at least in part, on the viscosity of the fluid and the pressure of the fluid to achieve the preferred flow rate. 2. The method of claim 1 wherein a porous material is located in the extension tube at a location remote from the side port, further including selecting the porosity of the material to achieve the preferred flow rate. 3. The method of claim 1 wherein the preferred flow rate is at least 1 inch per minute through the extension tube. 4. The method of claim 1 wherein the notch is about 0.013 inch by 0.016 inch, the needle has an outer diameter of about 0.028 inch and the catheter has a bore with a diameter of 0.034 inch. 5. The method of claim 4 wherein the extension tube has an internal diameter of between 0.045 and 0.052 inches. 6. The method of claim 5 wherein the fluid is at a pressure of about 30-50 mmHg and has a viscosity of 1.8 times that of water. 7. The method of claim 6 further comprising reducing the size of the notch to reduce the flow rate in the extension tube. 8. The method of claim 6 further comprising reducing the size of the annular space to reduce the flow rate in the extension tube. 9. The method of claim 6 wherein sizing the notch and the annular space is based, at least in part, on the length of the catheter. 10. The method of claim 6 wherein a porous material is located in the extension tube at a location remote from the side port, further including selecting the porosity of the material to achieve the preferred flow rate. 11. A method of accessing a blood vessel comprising: providing an introducer needle assembly having a catheter attached to a catheter hub with a side port, an extension tube attached to the side port on the catheter hub, and an introducer needle with a notch adapted to be inserted into the catheter such that the notch is disposed within the catheter; inserting the tip of the introducer needle into the blood vessel; confirming insertion of the introducer needle in the blood vessel by observing blood in the catheter near the notch; positioning the tip of the catheter at a desired location within the blood vessel; confirming positioning of the needle tip in the blood vessel by observing blood flow through the extension tube; wherein the flow rate of blood through the extension tube is at a predetermined rate based upon, at least in part, the size of the notch, the size of the internal bore of the catheter and the outer diameter of the needle. 12. The method of claim 11 further including controlling the flow rate based, at least in part, on the pressure of the blood and the viscosity of the blood. 13. The method of claim 11 further comprising selecting the flow rate through the extension tube based, at least in part, on the internal cross section of the extension tube. 14. The method of claim 12 wherein the flow rate through the extension tube is at least 1 inch per minute. 15. The method of claim 11 wherein the notch is more than one aperture. 16. A method of controlling flashback in an extension tube of an introducer needle assembly, including: providing a translucent catheter having a proximal end, a distal end and a central bore extending from the proximal end to the distal end, wherein the bore has a cross sectional area; providing a catheter hub in fluid communication with the central bore and having a proximal end and a distal end connected to the proximal end of the catheter and a side port in fluid communication with the catheter hub; providing an extension tube in fluid communication with the side port; providing an introducer needle having a proximal end and a distal end, and having a needle hub having a distal end and a proximal end, the proximal end of the introducer needle connected to the distal end of the needle hub, the introducer needle adapted to be positioned within the catheter in an insertion position wherein the distal end of the introducer needle extends distally past the distal end of the catheter; a seal affixed to the catheter hub and located proximal of the side port, the seal sealing the proximal end of the catheter hub; the introducer needle having a cross sectional area that is less than the cross sectional area of the central bore such that an annular space is defined between the introducer needle and the catheter; a notch at the distal end of the introducer needle located within the catheter when the introducer needle is in the insertion position such that fluid can communicate between the notch at the distal end of the introducer needle and the side port but is prevented from passing out of the proximal end of the catheter hub by the seal; wherein the introducer needle, the notch and the central bore are sized to control the flow of fluid through the annular space, thereby controlling the flow of fluid through the extension tube to a predetermined rate. 17. The method of claim 16 wherein the notch has an area of about 0.0002 inches2, the annular space is about 0.0012 inches2, the extension tube has an internal diameter of 0.05 inches, the fluid is at 30-50 mmHg and has a viscosity of about 1.8 times that of water. 18. An introducer needle assembly for accessing a patient's vein comprising: a translucent catheter having a central bore, a distal end and a proximal end; a needle disposed in the central bore of the catheter, the needle having a tip and a notch disposed near the tip, wherein the needle tip extends out beyond the distal end of the catheter and the notch is disposed completely within the catheter; an annular space defined between the needle and the catheter such that blood flowing through the notch passes into the annular space to provide visual confirmation to a caregiver that the needle tip has accessed the vein; a translucent extension tube having an interior chamber with a cross section, which chamber is in fluid communication with the annular space, wherein the cross section of the interior chamber of the extension tube is selected to achieve a predetermined flow rate of blood through the extension tube, thereby providing visual confirmation to the caregiver that the needle tip remains in the vein. 19. The introducer needle assembly of claim 18 in which the annular space has a cross sectional area smaller than the cross sectional area of the internal chamber of the extension tube. 20. The introducer needle assembly of claim 18 in which the notch has an area smaller than the cross sectional area of the internal chamber of the extension tube. 21. The introducer needle of claim 18 further comprising a plug inserted in the extension tube at a location remote from the catheter, wherein the plug has a porosity such that it permits the flow of air through the plug but prevents the flow of blood through the plug. 22. The introducer needle assembly of claim 21 wherein the plug has a porosity selected to control the flow of blood through the extension tube. 23. An introducer needle assembly for accessing a patient's vein comprising: a translucent catheter having a central bore, a distal end and a proximal end; a needle disposed in the central bore of the catheter, the needle having a tip and a notch disposed near the tip, wherein the needle tip extends out beyond the distal end of the catheter and the notch is disposed within the catheter; an annular space defined between the needle and the catheter; a translucent extension tube having an interior chamber with a cross section, which chamber is in fluid communication with the annular space, wherein the caregiver receives visual confirmations that the needle tip is in the vein by controlled blood flow through the extension tube, the cross section of the interior chamber of the extension tube is selected to achieve a predetermined flow rate of blood through the extension tube, thereby providing visual confirmation to the caregiver that the needle tip remains in the vein. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Catheters, particularly intravenous (IV) catheters, are used for directing fluid into or withdrawing fluid from a patient. The most common type of IV catheter is an over-the-needle IV catheter. As its name implies, an over-the-needle IV catheter is mounted over an introducer needle having a sharp distal tip. With the distal tip of the introducer needle extending beyond the distal tip of the IV catheter, the assembly is inserted through the patient's skin into a vein. Once placement of the assembly in the vein is verified by flashback of blood in the needle, the needle is withdrawn, leaving the IV catheter in place. In certain circumstances, the caregiver may move the needle within the vein, or may displace the catheter with respect to the needle, to locate the catheter in a desired position before fully withdrawing the needle. The proximal end of the IV catheter typically has a hub that is designed to be connectable to an IV fluid supply line after insertion of the IV catheter in a patient. In other applications, an IV set (known as an “extension set”) is attached before insertion into the patient. Although typical IV catheter and introducer needle assemblies generally perform their functions satisfactorily, they do have certain drawbacks. For example, certain IV catheter and introducer needle assemblies typically require a flashback chamber located on the proximal end of the needle. This location is inconvenient for the healthcare worker because, during insertion of the assembly into a patient, the healthcare worker's attention is directed to the distal tip of the needle. Thus, in order to determine if the needle is properly placed in a vein, the healthcare worker has to divert his attention away from the point of insertion of the IV catheter and introducer needle assembly into the patient. Even in devices that permit visual confirmation of flashback at a location near the needle tip, there is no distinct confirmation that the needle remains in the vein as it is positioned by the caregiver. Typically, flashback chambers are immediately filled with blood upon the initial access of the vein and cannot be used to confirm that the catheter assembly has maintained (or achieved again) access to the vein. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is therefore an object of one aspect of this invention to provide a method for controlling the flashback rate in an extension tube. It is an object of another aspect of the invention to provide a method of making an introducer needle and catheter assembly that includes a controlled, visible flashback rate in an extension tube. Specifically, catheter assembly may be designed to achieve initial flashback at the needle tip, as well as distinct confirmation flashback at a controlled rate when the catheter is located within the patient's vein. It is an object of another aspect of the invention to provide an introducer needle assembly that permits initial flashback at the needle tip, as well as distinct confirmation flashback at a controlled rate when the needle assembly is located within the patient's vein. It is an object of another aspect of this invention to provide a method of inserting a catheter into a patient's vein that permits initial flashback at the needle tip, as well as distinct confirmation flashback at a controlled rate over a predetermined period of time while the catheter is located within the patient's vein. In accord with one aspect of the invention, a method is provided for controlling the fluid flow rate in an extension tube of an introducer needle assembly for use as confirmation flashback. The introducer needle assembly has a catheter attached to a catheter hub with a side port. An extension tube is attached at one end to the side port on the catheter hub. The other end of the extension tube is plugged with a porous material that permits air to pass but restricts liquid flow. An introducer needle with a notch is adapted to be inserted into a bore in the catheter. A chamber extends through the needle and is in fluid communication with the notch. The needle has an outer diameter smaller than the diameter of the catheter bore such that an annular space is defined between the catheter and the needle. The liquid or fluid, typically blood, is at a pressure and has a viscosity when the needle accesses it. A fluid flow path is created from the patient's blood vessel, through the needle tip and through center of the hollow needle, through the notch in the needle to the annular space, along the annular space to the catheter hub and out the side port, and into the extension tube. In use, the caregiver inserts the introducer needle and catheter assembly into the patient's vein. During insertion of the assembly, the notch is maintained within the catheter. An initial flashback is visible near the tip of the translucent catheter (and thus near the point of insertion) as blood flows through the notch and into the annular space. As the blood continues to flow, it passes through to the extension tube where the caregiver can observe the flow of blood in the extension tube (confirmation flashback) at a controlled rate (referred to herein as the “visual flow front rate”), as discussed below. During design of the introducer needle and catheter assembly, the geometry and materials of the assembly are selected to achieve a desired visual flow front rate through the extension tube. Particularly, it is desirable to control the flow rate such that confirmation flashback occurs for a relatively long period of time, permitting the caregiver to know for a longer period of time that the tip of the catheter is within and in fluid communication with the vein, as well as to understand the nature of the blood vessel accessed. In one implementation of the instant invention for use in connection with an integrated catheter assembly (that is, a catheter assembly including an extension tube attached to the catheter hub before insertion) intended for vascular access, a desired minimum fluid flow rate of the fluid visible through the extension tube (that is, the visual flow front rate) is selected to be around 1 inch per minute. The determination is then made as to which component of the catheter assembly is to be employed as the “throttle,” that is, the controlling element in the catheter assembly. The geometry (and materials, in certain circumstances) can then be designed to achieve the desired visual flow front rate. In another implementation of the invention, the notch and the annular space are sized so that the size of the central chamber within the needle acts as the throttle. Specifically, both the notch and the annular space are designed to have cross-sectional areas greater than the cross sectional area of the chamber running through the needle. Consequently, the needle chamber acts as the throttle. In the case of a 20 gauge needle, the needle chamber has a diameter of 0.016 inches and a cross sectional area of about 0.00020 in 2 (that is, π*0.008 2 =0.0002in 2 ). The annular space and the notch are sized appropriately to have larger cross sectional areas. A 20 gauge needle has an outer diameter of 0.028 inches. A catheter appropriate for such a needle would be an 18 gauge catheter which has a bore with a diameter of 0.034 inches. Consequently, the annular space has a cross sectional area of about 0.0003 square inches. The notch is also sized to have a minimum area greater than the needle's central chamber. In the case of a notch formed by grinding out a straight-sided opening in the needle wall (resulting in a rectangular notch) through to the center of the needle, the notch has a width equal to the diameter of the needle chamber (i.e., 0.016 inches). The notch length in the axial direction is selected to be equal to or greater than the cross-sectional area of the chamber divided by the diameter of the chamber. Consequently, in this case, the length is preferably at least 0.0125 inches (that is, 0.0002 inches 2 /0.016 inches=0.0125 inches). In such an assembly, the extension tube may be selected to have an internal diameter of 0.05 inches, resulting in a cross-sectional area of about 0.002 in. When used for peripheral vascular access, the fluid is at a pressure between 10 mmHg-250 mmHg is (typically about 45 mmHg) and has a viscosity of about 1.8 times that of water at normal body temperature of 98.6° F. when the needle tip accesses it. The visual flow front rate is then typically about 1 inch per minute through the extension tube. Different blood pressure and blood viscosity will affect the visual flow front rate. In other implementations, it is desirable to size the annular space between the needle and the catheter (based, at least in part, on the viscosity of the fluid and the pressure of the fluid) to act as a throttle, restricting (and thereby controlling) the flow through the flow path and achieving the preferred flow rate through the extension tube. Alternatively, the notch may be sized such that it acts as the throttle. Further, the porosity of the plug in the extension tube may be designed such that it permits air to flow out of the tube at a rate which acts as a throttle by preventing the blood from entering the tube any faster. In accord with aspects of certain implementations of the instant invention, an integrated introducer needle and catheter assembly is provided including a controlled flow rate through the extension tube. A flow path is created by the introducer needle assembly from the vein to the extension tube. The flow path extends from the tip of the needle, through the needle chamber, through the notch, into and along the annular space between the needle and the catheter, and then into the central chamber of the extension tube via a catheter hub. The porous plug permits air in the extension tube to pass out as the chamber fills with blood. The geometry and material properties of the assembly are selected to achieve a desired visual flow front rate in the extension tube which can be observed by a caregiver but which does not restrict flow in a manner that would interfere with the delivery of fluids by the assembly after insertion. Currently, it is preferred that the flow rate be selected such that the extension tube fills at a rate of at least 1 inch per minute, but other rates may be desirable depending on the application. Further, it will be appreciated that various modifications of the geometry and material properties may be employed and still practice aspects of the invention. In accord with another aspect of the invention, a method of accessing a blood vessel is provided. An introducer needle assembly has a catheter attached to a catheter hub with a side port, an extension tube attached to the side port on the catheter hub, and an introducer needle with a notch adapted to be inserted into the catheter. The tip of the introducer needle is inserted into the blood vessel thereby positioning the tip of the catheter in the blood vessel as well. Insertion of the introducer needle in the blood vessel is confirmed by observing blood in the catheter near the notch. The positioning of the needle tip in the blood vessel is further confirmed by observing blood flow through the extension tube. The visual fluid flow front rate of blood through the extension tube is a predetermined rate based upon, at least in part, the size of the notch, the size of the internal bore of the catheter and the outer diameter of the needle. Additionally or alternatively, the flow rate is controlled based, at least in part, on the pressure of the blood and the viscosity of the blood, and on the internal cross section of the extension tube. In accord with yet another aspect of the invention, a method is provided for controlling flashback in an extension tube of an introducer needle assembly. A translucent catheter is provided having a proximal end, a distal end and a central bore extending from the proximal end to the distal end. A catheter hub is in fluid communication with the central bore and has a proximal end and a distal end connected to the proximal end of the catheter and a side port in fluid communication with the catheter hub. An extension tube is in fluid communication with the side port. The proximal end of an introducer needle extends from the distal end of a needle hub. The introducer needle adapted to be positioned within the catheter in an insertion position wherein the distal end of the introducer needle extends distally past the distal end of the catheter. A seal is affixed to the catheter hub and located proximal of the side port, sealing the proximal end of the catheter hub. The introducer needle has a cross sectional area that is less than the cross sectional area of the central bore such that an annular space is defined between the introducer needle and the catheter. A notch at the distal end of the introducer needle is located within the catheter when the introducer needle is in the insertion position such that fluid can communicate between the notch at the distal end of the introducer needle and the side port but is prevented from passing out of the proximal end of the catheter hub by the seal. The introducer needle, the notch and the central bore are sized to control the flow of fluid through the annular space, thereby controlling the flow of fluid through the extension tube. |
Novel variants and exons of the glyt1 transporter |
The present invention provides polypeptide and polynucleotide sequences for novel splice variants of the sodium and chloride-dependent glycine transporter type 1 (GlyT1). These polypeptides and polynucleotides are useful in the treatment and diagnosis of disorders such as neurological and psychiatric disorders including schizophrenia. The invention also provides antibodies directed specifically against these novel polypeptides, and kits comprising the herein-described polynucleotides, polypeptides, and/or antibodies. |
1. An isolated, purified, or recombinant polynucleotide comprising any of the nucleic acid sequences shown as SEQ ID NOs:2-9 or 14-21, or a sequence complementary to any of these sequences. 2. An isolated, purified, or recombinant polynucleotide encoding a functional glycine transporter, wherein said polynucleotide comprises a nucleic acid sequence comprising at least about 90% identity to any of the sequences shown as SEQ ID NOs:14-21. 3. An isolated, purified, or recombinant polynucleotide which encodes a polypeptide comprising any of the amino acid sequences shown as SEQ ID NOs:26-33. 4. The polynucleotide of claim 1, wherein said polynucleotide is attached to a solid support. 5. An array of polynucleotides comprising the polynucleotide of claim 1. 6. The array of claim 5, wherein said array is addressable. 7. The polynucleotide of claim 1, further comprising a label. 8. The polynucleotide of claim 1, wherein said polynucleotide is operably linked to a promoter. 9. A recombinant vector comprising the polynucleotide of claim 8. 10. A host cell comprising the recombinant vector of claim 9. 11. A non-human host animal or mammal comprising the recombinant vector of claim 9. 12. An isolated, purified, or recombinant polypeptide comprising any of the amino acid sequences shown as SEQ ID NOs:26-33. 13. An isolated, purified, or recombinant polypeptide, wherein said polypeptide comprises an amino acid sequence encoded by any of the nucleic acid sequences shown as SEQ ID NOs:2-9 or 14-21. 14. A method of producing a GlyT1 polypeptide, said method comprising the following steps: a) providing a host cell comprising a nucleic acid encoding any one of the polypeptides shown as SEQ ID NO:26-33, operably linked to a promoter; b) cultivating said host cell under conditions conducive to the expression of said polypeptide; and c) isolating said polypeptide from said host cell. 15. An isolated or purified antibody capable of selectively binding to an epitope-containing fragment of a polypeptide encoded by any one of the sequences shown as SEQ ID NOs: 2-9. 16. A method of binding an anti-GlyT1 antibody to a polypeptide of claim 12, said method comprising contacting said antibody with said polypeptide under conditions in which said antibody can specifically bind to said polypeptide. 17. A diagnostic kit comprising the polynucleotide of claim 1. 18. A method of detecting the expression of a GlyT1 gene within a cell, said method comprising the steps of: a) contacting said cell or an extract from said cell with either of: i) a polynucleotide that hybridizes under stringent conditions to a polynucleotide of claim 1, 2, or 3; or ii) a compound that specifically binds to the polypeptide of claim 12; and b) detecting the presence or absence of hybridization between said polynucleotide and an RNA species within said cell or extract, or the presence or absence of binding of said compound to a protein within said cell or extract; wherein a detection of the presence of said hybridization or of said binding indicates that said GlyT1 gene is expressed within said cell. 19. The method of claim 18, wherein said polynucleotide is an oligonucleotide primer, and wherein said hybridization is detected by detecting the presence of an amplification product comprising the sequence of said primer. 20. The method of claim 18, wherein said compound is an anti-GlyT1 antibody. 21. A method of identifying a candidate modulator of a GlyT1 polypeptide, said method comprising: a) contacting the polypeptide of claim 12 with a test compound; and b) determining whether said compound specifically binds to said polypeptide; wherein a detection that said compound specifically binds to said polypeptide indicates that said compound is a candidate modulator of said GlyT1 polypeptide. 22. The method of claim 21, further comprising testing the activity of said GlyT1 polypeptide in the presence of said candidate modulator, wherein a difference in the activity of said GlyT1 polypeptide in the presence of said candidate modulator in comparison to the activity in the absence of said candidate modulator indicates that the candidate modulator is a modulator of said GlyT1 polypeptide. 23. A method of identifying a modulator of a GlyT1 polypeptide, said method comprising: a) contacting the polypeptide of claim 12 with a test compound; and b) detecting the activity of said polypeptide in the presence and absence of said compound; wherein a detection of a difference in said activity in the presence of said compound in comparison to the activity in the absence of said compound indicates that said compound is a modulator of said GlyT1 polypeptide. 24. The method of claim 22 or 23, wherein said polypeptide is present in a cell or cell membrane, and wherein said activity comprises glycine tranport activity. 25. A method for the preparation of a pharmaceutical composition comprising a) identifying a modulator of a GlyT1 polypeptide using the method of any one of claims 21 to 24; and b) combining said modulator with a physiologically acceptable carrier. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Neurotransmitter transporters play a critical role in the regulation of synaptic transmission. These transporters, which are located on the pre-synaptic terminal and surrounding glial cells, sequester neurotransmitter from the synapse, thereby regulating the synaptic concentration of neurotransmitter and influencing the duration and magnitude of synaptic transmission. Transporters also help to limit the extent of synaptic transmission by preventing the spread of transmitter to neighboring synapses. In view of the important role played by these transporters in neurological function, they represent attractive targets for pharmacological modulation, potentially providing novel methods of treatment for any of a number of psychological and neurological conditions. The amino acid glycine functions at both inhibitory and excitatory synapses in the central and peripheral nervous systems of mammals. The excitatory and inhibitory functions of glycine are mediated by two different types of receptor, each of which is associated with a different type of glycine transporter. At excitatory synapses, glycine acts as an obligatory co-agonist at a class of glutamate receptors called N-methyl-D-aspartate (NMDA) receptors. Activation of these receptors in neurons increases sodium and calcium conductance, thereby depolarizing the neuron and increasing the likelihood that the neuron will fire an action potential. The class of glycine transporter thought to be involved in excitatory synapses in conjunction with NMDA receptors is Glyt-1. At least four variants of GlyT-1 (GlyT-1a, GlyT-1b, GlyT-1c, and Glyt-1d), have been described. Both GlyT1 and GlyT2 transporters are members of a broader family of sodium- and chloride-dependent neurotransmitter transporters, the members of which typically have 12 transmembrane domains (Olivares et al. (1997) J. Biol. Chem. 272:1211-1217; Uhl, Trends in Neuroscience 15: 265-268, 1992; Clark et al, BioEssays 15: 323-332, 1993). Both the N- and C-termini of the members of this family are thought to be intracellular. NMDA receptor activity has been implicated in a large number of psychological and neurological functions, such as learning and memory, and in a large number of diseases and conditions, including schizophrenia, dementias, attention-deficit hyperactive disorder, and various neurodegenerative disorders. Thus, modulators of GlyT1 proteins can used to treat these and other conditions. The present invention addresses these and other needs. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention pertains to polynucleotides and polypeptides corresponding to cDNA sequences encoding 8 novel splice variants of the GlyT1 glycine transporter. Oligonucleotide probes or primers hybridizing specifically with the novel cDNA sequences are also part of the present invention, as are DNA amplification and detection methods using said primers and probes. A further object of the invention consists of recombinant vectors comprising any of the nucleic acid sequences described herein, as well as of cell hosts and transgenic non human animals comprising these nucleic acid sequences or recombinant vectors. The invention is also directed to methods for the screening of substances or molecules that interact with any of the present polypeptides or that modulate the activity of any of the present polypeptides. As such, in one aspect, the present invention provides an isolated, purified, or recombinant polynucleotide comprising a nucleic acid sequence that is at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a contiguous span of at least 12, 25, 50, 100, 250, 500, 1000, or more nucleotides of any of the nucleic acid sequences shown as SEQ ID NOs:2-9 or 14-21, or a sequence complementary to any of these sequences. In another aspect, the present invention provides an isolated, purified, or recombinant polynucleotide comprising a nucleic acid sequence that encodes a functional GlyT1 transporter and which specifically hybridizes under stringent or moderate conditions with any of the nucleic acid sequences shown as SEQ ID NOs:2-9 or 14-21. In another aspect, the present invention provides an isolated, purified, or recombinant polynucleotide comprising a nucleic acid sequence that is at least about 70%, 75%, 80%, 85%, 90%, 95% or more identical to any of the sequences shown as SEQ ID NOs:14-21, wherein the polynucleotide comprises a sequence at least about 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the sequences shown as SEQ ID NOs:2-9. In another aspect, the present invention provides an isolated, purified, or recombinant polynucleotide encoding a glycine transporter, wherein said polynucleotide hybridizes under stringent or moderate hybridization conditions with a nucleic acid comprising any of the sequences shown as SEQ ID NOs:14-21, and wherein said polynucleotide comprises any of the sequences shown as SEQ ID NOs:2-9. In another aspect, the present invention provides an isolated, purified, or recombinant polynucleotide which encodes a polypeptide comprising an amino acid sequence that is at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical to a contiguous span of at least 6, 12, 25, 50, 100, 200, 300, 400, 500 or more amino acids of any of SEQ ID NOs:26-33. In one embodiment, the polypeptide comprises any of the amino acid sequences shown as SEQ ID NOs:26-33. In another aspect, the present invention provides a method of producing a GlyT1 polypeptide, said method comprising the following steps: a) providing a host cell comprising a nucleic acid encoding any one of the polypeptides shown as SEQ ID NO:26-33, operably linked to a promoter; b) cultivating said host cell under conditions conducive to the expression of said polypeptide; and c) isolating said polypeptide from said host cell. In one embodiment, the polynucleotide is attached to a solid support. In another embodiment, the polynucleotide further comprises a label. In another embodiment, the polynucleotide is operably linked to a promoter. In another aspect, the present invention provides a biologically active fragment of any of the herein-described polynucleotides. In another aspect, the present invention provides an array of polynucleotides comprising at least one of the herein-described polynucleotides. In one embodiment, the array is addressable. In another aspect, the present invention provides a recombinant vector comprising any of the herein-described polynucleotides. In another aspect, the present invention provides a host cell comprising any of the herein-described recombinant vectors or polynucleotides. In another aspect, the present invention provides a non-human host animal or mammal comprising any of the herein-described recombinant vectors or polynucleotides. In another aspect, the present invention provides an isolated, purified, or recombinant polypeptide comprising an amino acid sequence that is at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical to a contiguous span of at least 6, 12, 25, 50, 100, 250, 500, or more amino acids of any of the sequences shown as SEQ ID NOs:26-33. In one embodiment, the polypeptide comprises any of the sequences shown as SEQ ID NOs:26-33. In another aspect, the present invention provides an isolated, purified, or recombinant polypeptide, wherein the polypeptide comprises an amino acid sequence encoded by any of the nucleic acid sequences shown as SEQ ID NOs:2-9 or 14-21. In another aspect, the present invention provides a biologically active fragment of any of the herein-described polypeptides. The invention further relates to methods of making the polypeptides of the present invention. In another aspect, the present invention provides an isolated or purified antibody capable of selectively binding to an epitope-containing fragment of any of the herein-described polypeptides, such as the polypeptides encoded by any of the sequences shown as SEQ ID NOs: 2-9 or 14-21, or the polypeptides comprising any of the amino acid sequences shown as SEQ ID NOs:26-33. In another aspect, the present invention provides a method of binding an anti-GlyT1 antibody to any of the herein-described polypeptides, e.g. polypeptides encoded by any of SEQ ID NOs:2-9 or 14-21, or comprising any of the sequences shown as SEQ ID NOs:26-33, said method comprising contacting said antibody with said polypeptide under conditions in which said antibody can specifically bind to said polypeptide. The present invention further relates to transgenic plants or animals, wherein said transgenic plant or animal is transgenic for a polynucleotide of the present invention and expresses a polypeptide of the present invention, or in which a polynucleotide of the present invention has been specifically disrupted or replaced with an inactive version of the polynucleotide, or with a substitute version having altered properties. In another aspect, the present invention provides a diagnostic kit comprising any of the herein described polynucleotides, polypeptides, or antibodies. The invention also provides kits, uses and methods for detecting the expression and/or biological activity of any of the herein-described GlyT1 variants, e.g., in a biological sample. One such method involves assaying for expression using the polymerase chain reaction (PCR), e.g., RT-PCR, to detect mRNA encoding any of the variants. In another method, Northern blot hybridization is used. Alternatively, a method of detecting gene expression in a test sample can be accomplished using a compound which binds to any of the herein-described polypeptides, e.g. a GlyT1-specific antibody, preferably a variant-specific anti-GlyT1 antibody. In another aspect, the present invention provides a method of detecting the expression of a GlyT1 gene within a cell, said method comprising the steps of: a) contacting said cell or an extract from said cell with either of: i) a polynucleotide that hybridizes under stringent conditions to any of the herein-described GlyT1 polynucleotides; or ii) a compound that specifically binds to any of the herein-described GlyT1 polypeptides; and b) detecting the presence or absence of hybridization between said polynucleotide and an RNA species within said cell or extract, or the presence or absence of binding of said compound to a protein within said cell or extract; wherein a detection of the presence of said hybridization or of said binding indicates that said GlyT1 gene is expressed within said cell. In one embodiment, said polynucleotide is an oligonucleotide primer, and wherein said hybridization is detected by detecting the presence of an amplification product comprising the sequence of said primer. In another embodiment, said compound is an anti-GlyT1 antibody. In another aspect, the present invention provides a method of identifying a candidate modulator of a GlyT1 polypeptide, said method comprising: a) contacting any of the herein-described GlyT1 polypeptides with a test compound; and b) determining whether said compound specifically binds to said polypeptide; wherein a detection that said compound specifically binds to said polypeptide indicates that said compound is a candidate modulator of said GlyT1 polypeptide. In one embodiment, the method further comprises testing the activity of said GlyT1 polypeptide in the presence of said candidate modulator, wherein a difference in the activity of said GlyT1 polypeptide in the presence of said candidate modulator in comparison to the activity in the absence of said candidate modulator indicates that the candidate modulator is a modulator of said GlyT1 polypeptide. In another aspect, the present invention provides a method of identifying a modulator of a GlyT1 polypeptide, said method comprising: a) contacting any of the herein-described polypeptides with a test compound; and b) detecting the activity of said polypeptide in the presence and absence of said compound; wherein a detection of a difference in said activity in the presence of said compound in comparison to the activity in the absence of said compound indicates that said compound is a modulator of said GlyT1 polypeptide. In one embodiment of these methods, said polypeptide is present in a cell or cell membrane, and wherein said activity comprises glycine tranport activity. In another aspect, the present invention provides a method for the preparation of a pharmaceutical composition comprising a) identifying a modulator of a GlyT1 polypeptide using any of the herein-described methods; and b) combining said modulator with a physiologically acceptable carrier. The present invention also relates to diagnostic methods and uses of the present polynucleotides and polypeptides for identifying humans or non-human animals having elevated or reduced levels of expression of any one or combination of the herein-described variants, which individuals are likely to benefit from therapies to suppress or enhance the expression of the variant or variants, respectively, and to methods of identifying individuals or non-human animals at increased risk for developing, or at present having, diseases or disorders associated with expression or biological activity of any one or combination of the herein-described variants. The present invention also relates to kits, uses and methods for screening compounds for their ability to modulate (e.g. increase or inhibit) the activity or expression of any of the present variants. Uses of such compounds are also within the scope of the present invention. The present invention also relates to pharmaceutical or physiologically acceptable compositions comprising, an active agent, the polypeptides, polynucleotides or antibodies of the present invention, as well as, typically, a pharmaceutically acceptable carrier. The present invention also provides the use of any of the herein-described GlyT1 polynucleotides, polypeptides, antibodies, modulators, or kits, in the diagnosis or treatment of any disorder, preferably a neurological or psychiatric disorder such as schizophrenia, or in the preparation of a medicament for the treatment of any disorder including neurological or psychiatric disorders such as schizophrenia. In another aspect, the present invention provides a computer readable medium having stored thereon a sequence selected from the group consisting of a nucleic acid code comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, or 1000 nucleotides of any of the sequences shown as SEQ ID NOs:2-9 or 14-21. In another aspect, the present invention provides a computer readable medium having stored thereon a sequence consisting of a polypeptide code comprising a contiguous span of at least 6, 8, 10, 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of any of the amino acid sequences shown as SEQ ID NOs:26-33. In another aspect, the present invention provides a computer system comprising a processor and a data storage device, wherein said data storage device comprises any of the herein-described computer readable media. In one embodiment, the computer system further comprises a sequence comparer and a data storage device having reference sequences stored thereon. In another embodiment, the computer system further comprises an identifier which identifies features in said sequence. |
Apparatus for measuring fruit properties including a function for automatically controlling the intensity of light from a light source |
An apparatus for measuring fruit properties, in order to classify fruit according to internal qualities, measures the sweetness of a fruit sample using near-infrared spectroscopy. The apparatus includes a pair of waveguides (12), a pair of optic emitter/sensor assemblies (14), a light-interrupting unit (20), and a light detector (40). The light detector calculates the intensity of light, transmitted from a light source and received by the optical emitter/sensor assemblies, thus allowing spectral analysis and interpretation for the determination of sweetness and acidity of a variety of fruits. The light detector controls the light-interrupting unit to interrupt the optical path when the light intensity is reduced. The apparatus is suitable for use in an automated line, for effective and reliable measurement of internal fruit properties, to improve operational efficiency and precision in fruit selection. |
1. An apparatus for measuring internal qualities of fruits with a function of automatically controlling the intensity of light from a light source, comprising: light guiding parts to guide light radiated from the light source to a position of a fruit sample to be measured; a light radiating and receiving assembly to radiate the light transmitted through the light guiding parts placed at a position near the fruit sample to fresh of the fruit sample so that the light is dispersed by the fresh of the fruit sample, and to receive the light deflected by the fresh of the fruit sample; a light interrupting unit installed between the light guiding parts coupled to the light radiating and receiving assembly which receives the light deflected by the fresh of the fruit sample, so as to selectively interrupt an optical path of the light deflected by the fresh of the fruit sample; and a light detector to calculate the intensity of light, radiated from the light source and received by the light radiating and receiving assembly, thus allowing analysis and interpretation of a spectrum for determination of sweetness and acidity of fruits, said light detector setting a detected signal, which is detected without any fruit sample, as a high level reference signal, and controlling the light interrupting unit to interrupt an optical path of light from the light source, thus setting a low level reference signal, when the intensity of the received light varies gradually. 2. The apparatus as set forth in claim 1, wherein the light interrupting unit is comprised of: a solenoid actuator operated with a power of 12V to repeatedly move at a predetermined rotational angle; a light interrupting board operated in conjunction with the solenoid actuator to selectively interrupt light from the light source or allow the light to pass through the optical path; a casing housing both the solenoid actuator and the light interrupting board; a power terminal provided outside the casing and applying electric power of 12V to said solenoid actuator; and a second light guiding part coupled to the casing, one side of which is exposed with an optical fiber so as to interrupt the light with the light interrupting board, and directing the light passing through it to the light detector. |
<SOH> BACKGROUND ART <EOH>As well known to those skilled in the art, the sugar content (sweetness) of a given fruit is typically determined by experienced workers relying upon their senses of sight, touch, and smell. This process, which is based on the subjectivity of individual workers, is inherently inconsistent and inaccurate, thus reducing the reliability of fruit quality claims and rendering impossible the reliable selection of fruit according to a grade of sweetness. It takes several years for a worker to attain an acceptable level of competence to gauge the sweetness of a given type of fruit. In an attempt to solve these problems, near-infrared spectroscopy has been used, with which internal qualities of fruit, such as sweetness or acidity, can be precisely determined. An operator positions in a light path a fruit sample selected from target fruits, and the intensity of light emitted from a near-infrared light source is sensed with respect to the positioned fruit, to determine a deflection value and a transmission value and thereby grade individual pieces of fruit according to sugar content. Here, the deflection value is the ratio of the intensity of light from the light source relative to the intensity of light deflected by the fruit sample, and the transmission value is the ratio of the intensity of light from the light source relative to the intensity of deflected light, and the transmission is a ratio of the intensity of light from a light source relative to the intensity of transmitted light. Preferably, the light source maintains a constant intensity of light, irrespective of the passage of time. However, output of the light source used for measuring the sweetness of fruits is reduced as time passes while it is in operation, and accordingly, the error in measuring the sweetness increases as time passes. To reduce the error in measurement, light is radiated from a light source to a reference sample (compressed solid block of barium sulfide or Teflon) for measurement of light transmission or deflection at time intervals of one hour, and the energy of light transmitted through or deflected by the sample is set as the intensity of the light source. However, this method needs an additional step of measuring the light energy transmitted through or deflected by such a reference sample at regular time intervals, thus causing an inconvenience in operation. In addition, the internal qualities such as sweetness or acidity of a fruit vary even within the same fruit according to portions thereof, that is, top and bottom, left and right portions, etc., and thus, it is difficult to precisely judge the internal qualities of fruits. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which: FIG. 1 is a top plan view showing the construction of an apparatus for measuring the internal qualities of fruits with a function of automatically controlling the intensity of light from a light source according to the present invention; FIG. 2 is a top plan view showing a bundle of optical fibers included in the apparatus of the present invention; FIG. 3 a is a top plan view of a light interrupting unit included in the apparatus of this invention when the unit measures both the intensity of light deflected by a sample and the intensity of light emitted from the light source. FIG. 3 b is a side sectional view of the light interrupting unit of FIG. 3 a: FIG. 4 a is a top plan view of the light interrupting unit of this invention when it interrupts light emitted from the light source; FIG. 4 b is a side sectional view of the light interrupting unit of FIG. 4 a. detailed-description description="Detailed Description" end="lead"? |
Power steering device |
An electric power steering apparatus wherein desired steering assist force can be stably provided by positively precluding actuation of an electric motor while it is rotating in a reverse direction so as to prevent demagnetization of the electric motor. This apparatus includes motor reverse rotation detecting means for detecting whether or not the electric motor is rotating in the reverse direction and motor actuation control means for actuating the electric motor when a condition for actuating the electric motor is fulfilled and on condition that the electric motor is not rotating in the reverse direction. |
1. A power steering apparatus, comprising: an electric motor; a pump which is driven by the electric motor and provides hydraulic pressure generated thereby to a steering mechanism as a steering assist force; motor reverse rotation detecting means for detecting whether or not the electric motor is rotating in a reverse direction; and motor actuation control means for actuating the electric motor when a predetermined condition for actuating the electric motor is fulfilled and on condition that reverse rotation of the electric motor is not detected by the motor reverse rotation detecting means. 2. A power steering apparatus according to claim 1, wherein detection of reverse rotation of the electric motor by the motor reverse rotation detecting means is effected within an initial check period. 3. A power steering apparatus according to claim 1, wherein when the predetermined condition for actuating the electric motor is fulfilled, the motor actuation control means actuates the electric motor after expiration of a predetermined standby period following a determination that reverse rotation of the electric motor is not detected by the motor reverse rotation detecting means. 4. A power steering apparatus according to claim 3, wherein a time for detection by the motor reverse rotation detecting means and the predetermined standby period are set so that the predetermined standby period expires within the initial check period. 5. A power steering apparatus according to claim 3, wherein the predetermined standby period is set so that the duration thereof is sufficiently long for the electric motor to come to a halt when the electric motor is coasting at a rotation speed lower than a predetermined rotation speed. 6. A power steering apparatus according to any of claims 3, further comprising motor normal rotation detecting means for detecting whether or not the electric motor is rotating in a normal direction, wherein in a case where reverse rotation of the electric motor is not detected by the motor reverse rotation detecting means, the motor actuation control means immediately actuates the electric motor upon detection of normal rotation of the electric motor by the motor normal rotation detecting means, and only in a case where neither normal nor reverse rotation of the electric motor is detected, the motor actuation control means actuates the electric motor after expiration of the standby period. 7. A power steering apparatus according to any of claims 1, wherein the predetermined condition for actuating the electric motor includes that a steering speed is equal to or more than a predetermined level. 8. A power steering apparatus according to any of claims 1, wherein the predetermined condition for actuating the electric motor includes detection of recovery of the electric motor from a state of failure after stoppage thereof caused by a fail-safe function. 9. A power steering apparatus according to claim 2, wherein when the predetermined condition for actuating the electric motor is fulfilled, the motor actuation control means actuates the electric motor after expiration of a predetermined standby period following a determination that reverse rotation of the electric motor is not detected by the motor reverse rotation detecting means. 10. A power steering apparatus according to claim 4, wherein the predetermined standby period is set so that the duration thereof is sufficiently long for the electric motor to come to a halt when the electric motor is coasting at a rotation speed lower than a predetermined rotation speed. 11. A power steering apparatus according to any of claim 4, further comprising motor normal rotation detecting means for detecting whether or not the electric motor is rotating in a normal direction, wherein in a case where reverse rotation of the electric motor is not detected by the motor reverse rotation detecting means, the motor actuation control means immediately actuates the electric motor upon detection of normal rotation of the electric motor by the motor normal rotation detecting means, and only in a case where neither normal nor reverse rotation of the electric motor is detected, the motor actuation control means actuates the electric motor after expiration of the standby period. 12. A power steering apparatus according to any of claim 5, further comprising motor normal rotation detecting means for detecting whether or not the electric motor is rotating in a normal direction, wherein in a case where reverse rotation of the electric motor is not detected by the motor reverse rotation detecting means, the motor actuation control means immediately actuates the electric motor upon detection of normal rotation of the electric motor by the motor normal rotation detecting means, and only in a case where neither normal nor reverse rotation of the electric motor is detected, the motor actuation control means actuates the electric motor after expiration of the standby period. 13. A power steering apparatus according to any of claim 2, wherein the predetermined condition for actuating the electric motor includes that a steering speed is equal to or more than a predetermined level. 14. A power steering apparatus according to any of claim 3, wherein the predetermined condition for actuating the electric motor includes that a steering speed is equal to or more than a predetermined level. 15. A power steering apparatus according to any of claim 4, wherein the predetermined condition for actuating the electric motor includes that a steering speed is equal to or more than a predetermined level. 16. A power steering apparatus according to any of claim 5, wherein the predetermined condition for actuating the electric motor includes that a steering speed is equal to or more than a predetermined level. 17. A power steering apparatus according to any of claim 6, wherein the predetermined condition for actuating the electric motor includes that a steering speed is equal to or more than a predetermined level. 18. A power steering apparatus according to any of claim 2, wherein the predetermined condition for actuating the electric motor includes detection of recovery of the electric motor from a state of failure after stoppage thereof caused by a fail-safe function. 19. A power steering apparatus according to any of claim 3, wherein the predetermined condition for actuating the electric motor includes detection of recovery of the electric motor from a state of failure after stoppage thereof caused by a fail-safe function. 20. A power steering apparatus according to any of claim 4, wherein the predetermined condition for actuating the electric motor includes detection of recovery of the electric motor from a state of failure after stoppage thereof caused by a fail-safe function. 21. A power steering apparatus according to any of claim 5, wherein the predetermined condition for actuating the electric motor includes detection of recovery of the electric motor from a state of failure after stoppage thereof caused by a fail-safe function. 22. A power steering apparatus according to any of claim 6, wherein the predetermined condition for actuating the electric motor includes detection of recovery of the electric motor from a state of failure after stoppage thereof caused by a fail-safe function. 23. A power steering apparatus according to any of claim 7, wherein the predetermined condition for actuating the electric motor includes detection of recovery of the electric motor from a state of failure after stoppage thereof caused by a fail-safe function. |
<SOH> FIELD OF THE INVENTION <EOH>The present invention relates to a power steering apparatus which applies a steering assist force to a steering mechanism by a hydraulic pressure generated by a pump driven by an electric motor. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is an object of the present invention to provide a power steering apparatus in which desired steering assist force can be stably provided by positively precluding actuation of an electric motor while it is rotating in a reverse direction so as to prevent demagnetization of the electric motor. A power steering apparatus according to the present invention, which is adapted to generate a steering assist force by a hydraulic pressure generated by a pump ( 26 ) driven by an electric motor ( 27 ) comprises motor reverse rotation detecting means ( 15 , 31 , S 5 ) for detecting whether or not the electric motor is rotating in a reverse direction and motor actuation control means ( 31 , S 7 -S 10 , S 2 , S 3 ) for actuating the electric motor when a predetermined condition for actuating the electric motor is fulfilled and on condition that reverse rotation of the electric motor is not detected by the motor reverse rotation detecting means. Incidentally, the alphanumeric characters in the parentheses represent the corresponding elements and the like in the embodiment later described. However, this is not intended to be construed as limiting the invention to the embodiment. With this arrangement, even when the predetermined condition for actuating the electric motor is fulfilled, actuation of the electric motor is disabled while the electric motor is rotating in the reverse direction. That is, the motor actuation control means actuates the electric motor only in a case where the electric motor is at a standstill or normally rotating in a predetermined direction. By this arrangement, actuation of the electric motor can be positively precluded while it is rotating in the reverse direction, so that demagnetization of the electric motor does not occur. As a result, the electric motor is able to generate the exact output as specified, thereby favorable steering assist can be accomplished. The aforementioned motor actuation control means may be arranged so that, when the predetermined condition for actuating the electric motor is fulfilled, it actuates the electric motor after expiration of a predetermined standby period following a determination that reverse rotation of the electric motor is not detected by the motor reverse rotation detecting means. With this arrangement, even when it is determined that the electric motor is not rotating in the reverse direction, the electric motor is actuated after expiration of a predetermined standby period. In a case, for example, where the rotation of the electric motor is detected by means of outputs of sensors such as hall sensors, there are times when reverse rotation of the electric motor cannot be exactly detected unless the electric motor is rotating in the reverse direction at a rotation speed not lower than a predetermined rotation speed. Therefore, according to this invention, the arrangement is made such that the electric motor is actuated after expiration of a predetermined standby period that is sufficiently long for the electric motor coasting at a rotation speed lower than a predetermined rotation speed to come to a halt. It is thus possible to more positively preclude actuation of the electric motor while it is rotating in the reverse direction. In addition, the arrangement may be made such that when the electric motor is not rotating in the reverse direction, whether or not the electric motor is rotating in a normal direction is further detected, and upon detection of normal rotation of the electric motor, the electric motor is immediately actuated, and only in a case where neither normal nor reverse rotation of the electric motor is detected, the process waits for expiration of the predetermined standby period. Detection of reverse rotation of the electric motor by the motor reverse rotation detecting means may be effected within an initial check period. With this arrangement, since a detection of reverse rotation of the electric motor completes within the initial check period, the time required for the process for actuating the electric motor is not prolonged. It is preferred that the time for detection by the motor reverse rotation detecting means and the predetermined standby period are set so that the predetermined standby period expires within the initial check period. Also with this arrangement, the time required for the process for actuating the electric motor is not prolonged. The predetermined condition for actuating the electric motor may include, for example, a steering speed reaching a predetermined level. Furthermore, the predetermined condition for actuating the electric motor may include a detection of recovery of the electric motor from a state of failure after stoppage thereof caused by a fail-safe function or the like. The above stated or further objects, features and advantages of this invention will be better understood by the following description of a specific embodiment with reference to the accompanying drawings. |
Cylindrical developer carrier and production method thereof |
A cylindrical developer carrier capable of fully charging a toner compound on a developing sleeve via frictional force even after being used repeatedly. The cylindrical developer carrier includes an electrically conductive substrate having an evenly roughened surface, and an alumite layer formed on the roughened surface, wherein the alumite layer has a uniform distribution of minute holes that reach the substrate surface. A method for manufacturing the cylindrical developer carrier includes roughening the electrically conductive substrate surface by blasting it with spherical fine particles, forming the alumite layer on the roughened surface by an anodizing method, and blasting the surface of the alumite-layer with amorphous fine particles that a diameter greater than that of the spherical fine particles. |
1-12. (canceled) 13. A cylindrical developer carrier comprising an electrically conductive substrate having an evenly roughened surface; and an alumite layer formed on said surface, wherein said alumite layer has a uniform distribution of minute holes respectively reaching said substrate surface. 14. A cylindrical developer carrier according to claim 13, wherein said electrically conductive substrate is formed primarily of an aluminum-group metallic material. 15. A cylindrical developer carrier according to claim 13, wherein said alumite layer comprises an alumite layer formed by an anodizing method. 16. A cylindrical developer carrier according to claim 15, further comprising nickel acetate sealing said alumite layer. 17. A cylindrical developer carrier according to claim 13, further comprising nickel acetate sealing said alumite layer. 18. A cylindrical developer carrier according to claim 17, wherein said alumite layer has a thickness in the range of 2 μm to 5 μm. 19. A cylindrical developer carrier according to claim 13, wherein said alumite layer has a thickness in the range of 2 μm to 5 μm. 20. A cylindrical developer carrier according to claim 19, wherein said minute holes, as a whole, account for 10% to 50% of the total area of the alumite layer. 21. A cylindrical developer carrier according to claim 13, wherein said minute holes, as a whole, account for 10% to 50% of the total area of the alumite layer. 22. A method for manufacturing a cylindrical developer carrier comprising the steps of: roughening an electrically conductive substrate surface by blasting spherical fine particles onto the substrate surface; forming an alumite layer on the roughened surface by an anodizing method; and blasting the surface of the alumite-layer with amorphous fine particles each having a diameter greater than that of the spherical fine particles. 23. A method for manufacturing a cylindrical developer carrier according to claim 22, wherein the blasting the spherical fine particles includes blasting the electrically conductive substrate surface with glass beads, and the blasting the surface of the alumite layer with amorphous fine particles includes blasting the alumite layer surface with amorphous fine particles formed primarily of aluminum oxide, each of the amorphous fine particles having a diameter greater than that of the spherical fine particles. 24. A method for manufacturing a cylindrical developer carrier according to claim 23, wherein the step of blasting said electrically conductive substrate surface with spherical fine particles includes a step of blasting the substrate surface with spherical fine particles consisting solely of glass beads, so as to form a number of projections and recesses each having a mean surface roughness rated at Ra=0.8 μm to 1.5 μm, and the blasting the surface of the alumite layer with amorphous fine particles includes blasting the alumite layer surface with amorphous fine particles formed primarily of aluminum oxide, each of the amorphous fine particles having a diameter greater than that of the spherical fine particles. |
<SOH> DESCRIPTION OF BACKGROUND ARTS <EOH>Conventionally, any electrophotographic apparatus, such as a laser printer, LED printer, or copying machine using normal paper, executes the formation of images through application of a so-called Carlson process. The Carlson process is a method for forming an image via the output of a toner image transcribed and fixed on copy paper or the like every cycle of an electrophotographic process executed via components for performing an electrification (i.e., charging), an exposure, a toner development, an image transcription, and an electrical discharge. Such components respectively are disposed on the circumferential surface of a cylindrical photoconductor provided with a photosensitive layer. In the course of executing the above processes, when a static latent image formed on the surface of the photoconductor via the above electrifying and exposing steps is converted into a positive image in the following toner developing step, toner compound stored in a developer unit is held and carried to an area close to the surface of the photoconductor through the application of a static electrical force via a cylindrical developer carrier, i.e., via a developing sleeve, before the static latent image present on the surface of the photoconductor is eventually developed into a positive image. In order to secure a satisfactory image via the above developing method, it is extremely important that the toner compound on the developing sleeve be held and carried as a leveled layer free from the generation of deflection. Likewise, when an excessively thick or thin toner layer is formed on the developing sleeve, in terms of developing density, a satisfactory image cannot be obtained. To prevent this, aside from the need to separately provide the system with a specific member for regulating toner thickness on the developing sleeve, in uniformly distributing toner compound over the entire developing sleeve, surface conditions of the developing sleeve are also quite important. A fully smoothed surface is not always the optimal choice. It is, rather, conventionally considered to be more advantageous to provide the surface of the developing sleeve with projections and recesses each having appropriate magnitude so as to enable optimum friction force to be generated between the developing sleeve and the toner compound. On the other hand, depending on the hardness of the developing sleeve, these projections and recesses are subject to wear after repeated use. This causes the quality of images to be gradually degraded, thus leading to a problem. To cope with this problem, an improvement in wear-resistance properties has been sought by those concerned. In cases in which a developing sleeve is made of an aluminum alloy, its Vickers hardness is rated to be as low as approximately 70 Hv. Thus, it is known that wear-resistance properties can be improved through the formation of an alumite surface layer generated by anodization with a Vickers hardness as high as approximately 200 to 400 Hv after completing formation of projections and recesses on its surface (refer to the Laid-Open Japanese Patent Publication No. HEISEI 5-46008/1993). On the other hand, in cases in which an alumite layer has been formed on the surface of the developing sleeve, due to the insulation characteristics of the alumite layer, its surface resistance rises. However, in the case of a high surface resistance value, the charge borne by the toner compound in the area corresponding to the spot for forming an image applied during the preceding developing process is apt to remain as it is without fully shifting onto the surface of the photoconductor from the developing sleeve. As a result, the amount of charge in a specific area of the developing sleeve corresponding to the above-described spot becomes greater than the amount of charge in those areas without the formation of images. As a result, when another image is formed in the ensuing developing step, in the above specific area of the developing sleeve corresponding to the spot at which the last image was formed, developing-agent is further drawn toward another specific area of the developing sleeve containing a higher charge. Thereby, the toner compound becomes more difficult to shift onto the surface of the photoconductor. This in turn leads to another problem in that a difference in depth is apt to be generated on the developed image of the photoconductor through the generation of a specific pattern corresponding to the image generated during the last developing process. In other words, a so-called “ghost image” is apt to be generated. In summary, the above symptom of a defect may be defined as the difference in the developing capability in correspondence with the toner development history (hereinafter also referred to as “memory”). In consideration of the technical problems described thus far, the invention aims at providing a novel cylindrical developer carrier and a method for manufacturing it, wherein the cylindrical developer carrier is capable of fully charging a toner compound on a developing sleeve via friction force even after being used repeatedly. The invention also aims to provide a cylindrical developer carrier wherein toner compound in the form of a leveled (even) layer can be properly held and carried, and the cylindrical developer carrier does not generate even the slightest difference in developing capability in correspondence with the toner development history. |
<SOH> SUMMARY OF THE INVENTION <EOH>According to the invention, the above-specified object has been achieved through the provision of a novel cylindrical developer carrier incorporating an alumite layer coated on a uniformly roughened surface of an electrically conductive substrate. The alumite layer uniformly incorporates minute holes reaching the above-described conductive substrate. According to another aspect of the invention, the cylindrical developer carrier is provided with an electrically conductive substrate consisting primarily of an aluminum-group metallic material. According to a further aspect of the invention, the cylindrical developer carrier is composed of an alumite layer formed through the application of an anodizing method. According to still another aspect of the invention, the cylindrical developer carrier is composed of an alumite layer having minute holes sealed with nickel acetate. The alumite layer may have a thickness of 2 μm to 5 μm. According to a further aspect of the invention, the minute holes account for 10% to 50% of the total area of the formed alumite layer that constitutes the cylindrical developer carrier. According to an embodiment of the invention, a first method for manufacturing the inventive cylindrical developer carrier includes the following steps: Initially, the surface of an electrically conductive substrate is roughened uniformly by blasting spherical fine particles onto the surface. An alumite layer is formed using anodization. The surface is blasted with amorphous fine particles, each having a diameter greater than that of said spherical fine particles. According to another embodiment of the invention, a second method for manufacturing the cylindrical developer carrier includes the following steps: Initially, spherical fine particles, including glass beads, are blasted onto the surface of an electrically conductive substrate. An alumite layer is formed by anodization. Then the surface is blasted with amorphous fine particles consisting primarily of aluminum oxide, with each particle having a diameter greater than that of the spherical fine particles. According to a further embodiment of the invention, a third method for manufacturing the cylindrical developer carrier includes the following steps: Initially, spherical fine particles, including glass beads, are blasted onto the surface of an electrically conductive substrate. Projections and recesses are formed each being provided with a mean surface roughness in a specific range expressed in terms of Ra=0.8 μm to 1.5 μm. An alumite layer is formed by anodization. Lastly, the surface is blasted with amorphous fine particles consisting primarily of aluminum oxide, and each particle has a diameter greater than that of said spherical fine particles. |
Method of regenerating bone/chondral tissues by transferring transcriptional factor gene |
This invention provides a method of rapid and adequate culture of cells isolated from a body to effectively construct bone/cartilage tissues and implants containing the bone/cartilage tissues constructed by the aforementioned method. In this method, osteo-/chondro-inducible transcription factor genes are transfected into bone-marrow-derived cells isolated from a body using an adenoviral or a retroviral vector to grow on adequate scaffolds. The constructed bone/cartilage tissues are transplanted into a body together with the scaffolds. Thus, they can be used as substitutional bone/cartilage implants. |
1 A method for constructing bone/cartilage tissues, wherein an osteo-/chondro-inducible transcription factor gene is transfected into isolated cells, and the isolated cells are allowed to differentiate and proliferate. 2 The method according to claim 1, wherein the cells are derived from bone marrow. 3 The method according to claim 2, wherein the bone-marrow-derived cells are mesenchymal stem cells. 4 The method according to claim 2, wherein the bone-marrow-derived cells are osteoblasts. 5 The method according to any one of claims 1 to 4, wherein the cells are primary cells. 6 The method according to claim 5, wherein the cells are isolated from a patient. 7 The method according to any one of claims 1 to 4, wherein the osteo-/chondro-inducible transcription factor is at least one member selected from the group consisting of Cbfa1, Dlx-5, Bapx1, Msx2, Scleraxis, and Sox9. 8 The method according to any one of claims 1 to 4, wherein the osteo-/chondro-inducible transcription factor gene is transfected into the cells using an adenoviral or a retroviral vector. 9 The method according to any one of claims 1 to 4, wherein the cells transfected by the osteo-/chondro-inducible transcription factor genes proliferate in at least one scaffold selected from the group consisting of porous ceramics, collagen, polylactic acid, polyglycolic acid, and a complex thereof. 10 A method for constructing bone/cartilage tissues comprising the following procedures of: 1) inducing differentiation of bone-marrow-derived cells isolated from a body with the aid of at least one member selected from the group consisting of dexamethasone, immunosuppressive factors, bone morphogenetic proteins, and osteogenic cytokines; 2) transfection of the osteo-/chondro-inducible transcription factor gene into the cells using an adenoviral or retroviral vector; and 3) proliferation of the cells in at least one scaffold selected from the group consisting of porous ceramics, collagen, polylactic acid, polyglycolic acid, and a complex thereof. 11 Implants containing the bone/cartilage tissues constructed by the method according to any one of claims 1 to 4. 12 The implants according to claim 11, which further contain at least one scaffold selected from the group consisting of porous ceramics, collagen, polylactic acid, polyglycolic acid, and a complex thereof. 13 Implants containing cells, in which the osteo-/chondro-inducible transcription factor gene is transfected, and at least one member selected from the group consisting of porous ceramics, collagen, polylactic acid, polyglycolic acid, and a complex thereof. |
<SOH> BACKGROUND ART <EOH>Recently, in the field of regenerative medicine, in vitro culture and organization of cells from a body have been attempted for reconstructing tissues that are as similar as possible to those in the body and replacing the tissues in the body. In such tissue regeneration, the provision of scaffolds for cell proliferation and acceleration of cell differentiation are indispensable, along with the preservation of cells. In general, cells exist in a body by adhering to the extracellular matrix, which plays as a scaffold for differentiation and proliferation. Accordingly, suitable scaffolds for cell proliferation and differentiation are necessary in addition to cells, for in vitro culture and complete three-dimensional tissue organization. Up to the present, the use of porous biodegradable materials such as porous ceramics as scaffolds has provided sufficient results in the regeneration of hard tissues such as bone and cartilage tissues. In contrast, a method for rapid differentiation into target tissues in vitro is important in the tissue engineering approach for tissue regeneration. Formally, however, cytokines (humoral factors) responsible for cell differentiation have been directly donated to cells or an expression vector carrying cDNA of the target cytokine has been transfected into cells by lipofection method and so on. A certain level of success has been achieved by such methods. Transfection of cell growth factors, however, did not provide sufficient results by several problems. For example, the target cytokine did not always fully and specifically affect the tissue, and the transfection efficiency was almost 0 in primary cells although gene transfection by lipofection was somewhat successful in established cell lines. Recently, many researchers have found that transcription factors, particularly transcription factors of runt and Helix-Loop-Helix (HLH) types, play significant roles in osteoblast differentiation. For example, a runt transcription factor, Pebp2alphaA (Pebp2αA)/Cbfa1, and an HLH transcription factor, such as Scleraxis, Id-1, and I-mfa, have been reported to have significant roles in osteoblast differentiation (e.g., Kunikazu Tsuji et al., “Runt transcription factor associated with osteoblast differentiation, Cbfa1/Pebp2αA, and Sox9 function in osteogenesis and chondrogenesis and unusual osteogenesis” Experimental Medicine, 16(11), 25-32, 1998). Special attempts in tissue regeneration utilizing functions of these transcription factors, however, have not yet been reported. The present inventors have conducted concentrated studies. As a result, they have found that cells can be efficiently induced to differentiate into bone/cartilage tissues by transfecting osteo-/chondro-inducible transcription factors into bone-marrow-derived cells and having them express therein. Further, use of an adenoviral or a retroviral vector for the transfection of a transcription factor results in effective infection to the primary adhesive cells such as bone/cartilage cells, and very effective induction of differentiation at approximately 99% can be achieved. This has led to the completion of the present invention. The present invention provides the following (1) to (13). (1) A method for constructing bone/cartilage tissues, wherein an osteo-/chondro-inducible transcription factor gene is transfected into isolated cells, and the isolated cells are allowed to differentiate and proliferate. (2) The method according to (1) above, wherein the cells are derived from bone marrow. (3) The method according to (2) above, wherein the bone-marrow-derived cells are mesenchymal stem cells. (4) The method according to (2) above, wherein the bone-marrow-derived cells are osteoblasts. (5) The method according to any one of (1) to (4) above, wherein the cells are primary cells. (6) The method according to (5) above, wherein the cells are isolated from a patient. (7) The method according to any one of (1) to (6) above, wherein the osteo-/chondro-inducible transcription factor is at least one member selected from the group consisting of Cbfa1, Dlx-5, Bapx1, Msx2, Scleraxis, and Sox9. (8) The method according to any one of (1) to (7) above, wherein the osteo-/chondro-inducible transcription factor gene is transfected into the cells using an adenoviral or a retroviral vector. (9) The method according to any one of (1) to (8) above, wherein the cells transfected by the osteo-/chondro-inducible transcription factor genes proliferate in at least one scaffold selected from the group consisting of porous ceramics, collagen, polylactic acid, polyglycolic acid, and a complex thereof. (10) A method for constructing bone/cartilage tissues comprising the following procedures of: 1) inducing differentiation of bone-marrow-derived cells isolated from a body with the aid of at least one member selected from the group consisting of dexamethasone, immunosuppressive factors, bone morphogenetic proteins, and osteogenic cytokines; 2) transfection of the osteo-/chondro-inducible transcription factor gene into the cells using an adenoviral or retroviral vector; and 3) proliferation of the cells in at least one scaffold selected from the group consisting of porous ceramics, collagen, polylactic acid, polyglycolic acid, and a complex thereof. (11) Implants containing the bone/cartilage tissues constructed by the method according to any one of (1) to (10) above. (12) The implants according to (11) above, which further contain at least one scaffold selected from the group consisting of porous ceramics, collagen, polylactic acid, polyglycolic acid, and a complex thereof. (13) Implants containing cells, in which the osteo-/chondro-inducible transcription factor gene is transfected, and at least one member selected from the group consisting of porous ceramics, collagen, polylactic acid, polyglycolic acid, and a complex thereof. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 is a diagram showing constructions of type I Cbfa1 (pebp2αA) and type II/III Cbfa1 (til-1). FIG. 2 is a diagram showing a construction of pAxCALNLw cosmid for the Cbfa1 gene transfection. FIG. 3 is a photograph showing the results of X-gal staining for the evaluation of the LacZ expression level in rat osteoblasts. FIG. 4 is a graph showing the results obtained by quantifying the expression level of LacZ in rat osteoblasts. FIG. 5 is a graph showing in the increase of alkaline phosphatase activity in rat osteoblasts after the infection with recombinant adenovirus. FIG. 6 is a graph showing in the increase of the calcium level in rat osteoblasts after the infection with recombinant adenovirus. FIG. 7 is an image showing the results of expression level detection regarding Cbfa1 genes by northern hybridization. FIG. 8 is a graph showing the proliferation of rat osteoblasts after the infection with recombinant adenovirus FIG. 9 is a photograph showing the results of observation of calcification in rat osteoblasts after the infection with recombinant adenovirus by Von Kossa staining. FIG. 10 is a photograph showing the results of observation of calcification in rat osteoblasts after the infection with recombinant adenovirus by Alizarin Red staining. FIG. 11 is a photograph showing the results of hematoxylin-eosin staining of a tissue section obtained from the block 4 weeks after transplantation into rat's back subcutaneously. FIG. 12 is a photograph showing the results of hematoxylin-eosin staining of a tissue section obtained from the block 8 weeks after transplantation into rat's back subcutaneously. FIG. 13 is a graph showing in the increase of alkaline phosphatase activity in the block after transplantation into rat's back subcutaneously. FIG. 14 is a graph showing in the increase of the osteocalcin level in the block after transplantation into rat's back subcutaneously. FIG. 15 is a photograph showing the results of hematoxylin-eosin staining of a tissue section obtained from the block after transplantation into rat's back subcutaneously and femur, wherein A-a represents conditions 3 weeks after transplantation of the control into the back; A-b represents conditions 5 weeks after transplantation of the control into the back; A-c represents conditions 3 weeks after transplantation of the Cbfa1 (til-1)-infected cells into the back; A-d represents conditions 5 weeks after transplantation of the Cbfa1 (til-1)-infected cells into the back; B-a represents conditions 3 weeks after transplantation of the control into the femur; B-b represents conditions 8 weeks after transplantation of the control into the femur; B-c represents conditions 3 weeks after transplantation of the Cbfa1 (til-1)-infected cells into the femur; and B-d represents conditions 8 weeks after transplantation of the Cbfa1 (til-1)-infected cells into the femur. FIG. 16 is a graph showing in the increase of alkaline phosphatase activity in the block after it has been transplanted into rat's back subcutaneously. FIG. 17 is a graph showing in the increase of the osteocalcin level in the block after transplantation into rat's back subcutaneously. detailed-description description="Detailed Description" end="lead"? This description includes a part or all of the contents as disclosed in the description of Japanese Patent Application No. 2001-227979, which is a priority document of the present application. |
Method of and apparatus for communication via multiplexed links |
A communication structure and method which allows connection-like and connectionless communications to be provided on a multiplexed link is provided. The structure and method can make efficient use of available transmission capacity and/or network resources while providing both types of communication and hybrids. Connection-like communications can be provided by a dedicated code division multiplexed channels having allocated transmission capacity dedicated to the communication while connectionless communication can be provided by a shared orthogonal frequency division multiplexed channel through which data can be transmitted to subscribers. In an embodiment, the shared channel transmits inverse fast fourier transformed frequency sub-bands allocated to one or more of the subscribers. The allocation of the sub-bands can be fixed, or dynamically quantized or proportional. |
1. A communications structure for communicating between at least one network node and at least two subscriber stations through a multiplexed link, said structure comprising: a plurality of code division multiple access (CDMA) channels, each channel having allocated to it a portion of the transmission power budget of said link to provide communication between said network node and one of said at least two subscriber stations; and a shared orthogonal frequency division multiplex (OFDM) channel having allocated to it a portion of the transmission power budget of said link, said shared channel providing a plurality of sub-bands for transmission of data from said network node to said at least two subscriber stations; whereby the shared OFDM channel, providing a relatively high data rate, overlaps the CDMA channels to maintain compatibility therewith. 2. A structure as claimed in claim 1 wherein one sub-band of said plurality of sub-bands is allocated for data communication to one of said at least two subscriber stations. 3. A structure as claimed in claim 2 wherein said one sub-band is allocated in dependence upon demand for data communication to one of said at least two subscriber stations. 4. A structure as claimed in claim 3 wherein demand is assessed during a predetermined time interval. 5. A structure as claimed in claim 4 wherein the time interval is 10 ms. 6. A structure as claimed in claim 1 wherein said shared orthogonal frequency division multiplexed channel includes said plurality of sub-bands and each sub-band includes a plurality of chips. 7. A structure as claimed in claim 6 wherein said plurality of sub-bands includes 36 sub-bands. 8. A structure as claimed in claim 7 wherein said plurality of chips includes 1024 chips. 9. A method of communicating between at least one network node and at least two subscriber stations through a multiplexed link, said method comprising the steps of: while maintaining a dedicated code division multiplexed communications channel to each of said at least two subscriber stations, monitoring demand for transmission of data from said network node to any of said at least two subscriber stations; and responsive to determining such demand, allocating at least one sub-band of a shared orthogonal frequency division multiplexed channel providing a plurality of sub-bands for transmission of data from said network node to said at least two subscriber stations to one subscriber station. 10. A method as claimed in claim 9 wherein the step of monitoring include the step of determining data bit queue length for each subscriber terminal. 11. A method as claimed in claim 9 wherein the step of allocating includes allocating sub-bands in proportion to the demand. 12. A method as claimed in claim 11 wherein the step of allocating includes the steps of distributing a subset of sub-bands to each subscriber station and allocating remaining sub-bands in proportion to the demand. 13. A communications network comprising: at least two subscriber stations; and a base station having means for maintaining a dedicated code division multiplexed communications channel to each of said at least two subscriber stations, means for monitoring demand for transmission of data from said network node to any of said at least two subscriber stations; and means, responsive to determining such demand, allocating at least one sub-band of a shared orthogonal frequency division multiplexed channel providing a plurality of sub-bands for transmission of data from said network node to said at least two subscriber stations to one subscriber station. 14. A network as claimed in claim 13 wherein the means for monitoring includes a request queue. 15. A network as claimed in claim 14 wherein the means for allocating includes logic to determine how to service the request queue. 16. A method of communicating between at least one network node and at least two subscriber stations through a multiplexed link, said method comprising the steps of: monitoring service requests from the at least two subscriber stations; and responsive to a request providing one of: (a) a dedicated code division multiplexed communications channel to each of said at least two subscriber stations; (b) a shared orthogonal frequency division multiplexed channel; and (c) while maintaining a dedicated code division multiplexed communications channel to each of said at least two subscriber stations, monitoring demand for transmission of data from said network node to any of said at least two subscriber stations; and responsive to determining such demand, allocating at least one sub-band of a shared orthogonal frequency division multiplexed channel providing a plurality of sub-bands for transmission of data from said network node to said at least two subscriber stations to one subscriber station. 17. A method as claimed in claim 16 wherein the step of monitoring include the step of determining data bit queue length for each subscriber terminal. 18. A method as claimed in claim 16 wherein the step of allocating includes allocating sub-bands in proportion to the demand. 19. A method as claimed in claim 18 wherein the step of allocating includes the steps of distributing a subset of sub-bands to each subscriber station and allocating remaining sub-bands in proportion to the demand. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Many communications systems are known. Early communications systems were connection-based, in that a connection was physically established through the system between the communicating nodes. For example, in the early versions of the public switched telephone network (PSTN), users were provided a point-to-point connection to other users through switchboards, switches and trunks. More recently, the PSTN has employed multiplexed lines that are shared, through at least some part of the network, by multiple users, but which still provide a fixed amount of bandwidth and network capacity to each user for their connection, these bandwidth and network capacities being selected as meeting the anticipated maximum requirements for a common telephone voice conversation, typically referred to as toll quality. Data communications systems have also been built which are connectionless. Connectionless systems generally operate on a best effort and/or statistical basis to deliver data via a suitable, but not necessarily fixed, route between the users, at best effort transmission rates and/or error rates. An example of a connectionless system is a packet network such as the Internet wherein the network capacity is shared amongst the users. More recently, attempts have been made to combine connectionless and connection-like services in a single communication system. For example, much interest has been expressed recently in voice over IP (VoIP) through the Internet. However, it has proven difficult and/or costly to create a communication system which can meet both the connection-like requirements of VoIP (utilizing a moderate data rate and having some tolerance for errors, but requiring low latency) and connectionless data (often utilizing a high, bursty data rate and having a relatively high tolerance to latency but little tolerance for errors). Attempts have been made to provide a connection-like mechanism via the Internet. One such attempt is the ReSerVation (RSVP) Protocol proposed by some vendors and which allows network capacity to be “reserved” at routers and switches to establish a “virtual” connection through the Internet to better ensure that desired quality of service (QoS) levels will be met for the virtual connection. However, support for RSVP must explicitly be implemented within an application and at each switch and/or router involved in the virtual connection, which has been difficult to achieve to date. Further, there is a significant amount of time and overhead required to set up an RSVP connection which can negate the benefits of an RSVP connection for connections of relatively short duration. Even when implemented, RSVP does not typically result in an efficient usage of network capacity as the maximum anticipated bandwidth and/or network capacity requirements must be reserved for the duration of the connection, even if they are not used, or are not used continuously. Thus, in many circumstances, reserved network resources are sitting idle, or are under utilized, for some portion of time. Further, RSVP does not include any incentive mechanism by which applications/users are encouraged to only make effective use of network resources, i.e.—unreasonable requests for resources can be made by a user or application as there are no economic or other disincentives for doing so. Such difficulties are exacerbated when the links on which the network, or a portion of the network, is implemented involve a multiplexed link of expensive and/ or limited bandwidth. In such cases efficient utilization of bandwidth and/or network resources is very important and RSVP or similar strategies have difficulty in meeting desired efficiencies. As used herein, the term multiplex and/or multiplexed link are intended to comprise any system or method by which a link is shared amongst users. Examples of such multiplexed links include wired or wireless links employing multiplexing systems such as TDMA, CDMA, FDMA or other arrangements. A specific prior art example of a communication system providing digital voice transmission over a multiplexed wireless link is a PCS (Personal Communication System) cellular system. Such systems can employ a multiplexing technique such as CDMA, TDMA, hybrid systems such as GSM, or other strategies to allow multiple callers to share the wireless link between the cellular base station and the PCS mobile units in both the upstream (mobile to base station) and downstream (base station to mobile) directions. One popular such system is the CDMA-based IS-95 cellular system in use in North America, South Korea and Japan. More recently, so-called third generation wireless proposals have been developed by groups interested in providing higher data rates for wireless communications. One such group is the 3 rd Generation Partnership Project (3GPP). The 3GPP have been working to extend the work done on the Global System for Mobile communication (GSM) to extend the radio access technologies, Universal Terrestrial Radio Access (UTRA) for both frequency division duplex (FDD) and time division duplex (TDD) modes. The FDD and TDD modes are to be used on a cell basis, that is a given cell is either operating in an FDD mode or a TDD mode. It is therefore desired to have a communications apparatus and method of providing data communications, including voice data, over wireless or other multiplexed links. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is an object of the present invention to provide a method of and apparatus for communication via a multiplexed link. According to an aspect of the present invention, there is provided a communications structure for communicating between at least one network node and at least two subscriber stations through a multiplexed link, said structure comprising a plurality of code division multiple access (CDMA) channels, each channel having allocated to it a portion of the transmission power budget of said link to provide communication between said network node and one of said at least two subscriber stations and a shared orthogonal frequency division multiplex (OFDM) channel having allocated to it a portion of the transmission power budget of said link, said shared channel providing a plurality of sub-bands for transmission of data from said network node to said at least two subscriber stations, whereby the shared OFDM channel, providing a relatively high data rate, overlaps the CDMA channels to maintain compatibility therewith. According to another aspect of the present invention, there is provided a method of communicating between at least one network node and at least two subscriber stations through a multiplexed link, said method comprising the steps of while maintaining a dedicated code division multiplexed communications channel to each of said at least two subscriber stations, monitoring demand for transmission of data from said network node to any of said at least two subscriber stations and responsive to determining such demand, allocating at least one sub-band of a shared orthogonal frequency division multiplexed channel providing a plurality of sub-bands for transmission of data from said network node to said at least two subscriber stations to one subscriber station. According to yet another aspect of the present invention, there is provided a communications network comprising at least two subscriber stations, and a base station having means for maintaining a dedicated code division multiplexed communications channel to each of said at least two subscriber stations, means for monitoring demand for transmission of data from said network node to any of said at least two subscriber stations; and means, responsive to determining such demand, allocating at least one sub-band of a shared orthogonal frequency division multiplexed channel providing a plurality of sub-bands for transmission of data from said network node to said at least two subscriber stations to one subscriber station. According to a further aspect of the present invention, there is provided a method of communicating between at least one network node and at least two subscriber stations through a multiplexed link, said method comprising the steps of monitoring service requests from the at least two subscriber stations and responsive to a request providing one of a dedicated code division multiplexed communications channel to each of said at least two subscriber stations, a shared orthogonal frequency division multiplexed channel and while maintaining a dedicated code division multiplexed communications channel to each of said at least two subscriber stations, monitoring demand for transmission of data from said network node to any of said at least two subscriber stations, and responsive to determining such demand, allocating at least one sub-band of a shared orthogonal frequency division multiplexed channel providing a plurality of sub-bands for transmission of data from said network node to said at least two subscriber stations to one subscriber station. The present invention provides a communication apparatus for and method of connection-like and connectionless communications on a multiplexed communication link. The apparatus and method can make efficient use of available bandwidth and/or network resources while providing both types of communication. Connection-like communications can be provided by a shared channel having allocated power dedicated to the communication while connectionless communication can be provided by allocating portions of a frequency band that is allocated a portion of the power budget for the communications link. In an embodiment, the frequency band is divided into sub-bands also known as bins and the bins are allocated on a demand basis. Orthogonal Frequency Division Multiplexing.(OFDM) is used to transmit data to the users who have been allocated one or more sub-bands. |
Gmg-2 polynucleotides and polypeptides and uses thereof |
The present invention relates to the field of obesity research. Obesity is a public health problem that is serious and widespread. A compound, homotrimer of GMG-2 polypeptide fragment comprising globular domain and all or part of GMG-2 collagen-like region, has been identified that has utility for reducing body mass, for maintaining weight loss, and for treating obesity-related diseases and disorders. These obesity-related diseases and disorders include hyperlipidemias, atherosclerosis, diabetes, and hypertension. |
1-9. (canceled) 10. A gGMG-2 polypeptide fragment comprising all or part of the collagen-like domain region of the amino acid sequence depicted in SEQ ID NO:2, 4 or 6 characterized in that the cysteine in the N-terminally disposed unique region is substituted with an amino acid selected from the group consisting of alanine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucin, lysine, leucine, methionine, asparagin, proline, glutamine, arginine, serine, threonine, valine, tryptophane and tyrosine. 11. The gGMG-2 polypeptide fragment according to claim 10 selected from the group consisting of: a) a gGMG-2 polypeptide fragment consisting essentially of at least 6 and not more than 288 consecutive amino acids of SEQ ID NO:2; b) a gGMG-2 polypeptide fragment consisting essentially of at least 6 and not more than 278 consecutive amino acids of SEQ ID NO:4; and c) a gGMG-2 polypeptide fragment consisting essentially of at least 6 and not more than 259 consecutive amino acids of SEQ ID NO:6; characterized in that the cysteine at position 66, 69 or 70 of SEQ ID NO:2, the cysteine at position 56, 59 or 60 of SEQ ID NO:4 or the cysteine at position 37, 40 or 41 of SEQ ID NO:6 is replaced. 12. The gGMG-2 polypeptide fragment according to claim 10 selected from the group consisting of: a) a gGMG-2 polypeptide fragment consisting of the amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 62-288, 63-288, 64-288, 65-288, 143-288, 144-288, 145-288, 146-288, 147-288, 148-288, 149-288, 150-288, 151-288, 152-288, 153-288, 154-288, 155-288, 156-288, 157-288, 158-288, 159-288, 160-288, 161-288 or 162-288 of SEQ ID NO:2 wherein the cysteine at positions 66, 69 or 70 is substituted; b) a gGMG-2 polypeptide fragment consisting of the amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 52-278, 53-278, 54-278, 55-278, 133-278, 134-278, 135-278, 136-278, 137-278, 138-278, 139-278, 140-278, 141-278, 142-278, 143-278, 144-278, 145-278, 146-278, 147-278, 148-278, 149-278, 150-278, 151-278 or 152-278 of SEQ ID NO:4 wherein the cysteine at position 56, 59 or 60 is substituted; and c) a gGMG-2 polypeptide fragment consisting of the amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 33-259, 34-259, 35-259, 36-259, 114-259, 115-259, 116-259, 117-259, 118-259, 119-259, 120-259, 121-259, 122-259, 123-259, 124-259, 125-259, 126-259, 127-259, 128-259, 129-259, 130-259, 131-259, 132-259 or 133-259 of SEQ ID NO:6, wherein the cysteine at position 37, 40 or 41 is replaced. 13. The gGMG-2 polypeptide fragment according to claim 10 comprising an amino acid sequence selected from the group consisting of: a) a gGMG-2 polypeptide fragment which is at least 80% identical to the amino acids 57-288 of SEQ ID NO:2; b) a gGMG-2 polypeptide fragment which is at least 75% identical to the amino acids 47-278 of SEQ ID NO:4; and c) a gGMG-2 polypeptide fragment which is at least 75% identical to the amino acids 28-259 of SEQ ID NO:6. 14. The gGMG-2 polypeptide fragment according to any one of the claims 10 to 13, wherein the gGMG-2 polypeptide fragment is fused to: a) a compound to increase the half-life of the fragment such as polyethylene glycol; b) IgG Fc; c) a leader or secretory sequence; and/or d) a sequence employed for purification of the fragment. 15. An isolated polynucleotide, or complement thereof, encoding the gGMG-2 polypeptide fragment according to any one of the claims 10 to 13. 16. A vector comprising an isolated polynucleotide sequence encoding the gGMG-2 polypeptide fragment according to claim 15. 17. A transformed host cell comprising the vector according to claim 16. 18. A pharmaceutical composition comprising a carrier and a) the gGMG-2 polypeptide fragment according to any one of the claims 10 to 13, b) a said gGMG-2 polypeptide fragment based to according to i) a compound to increase the half-life of the fragment such as polyethylene glycol; ii) IgG Fc; ii) a leader or secretory sequence; and/or iv) a sequence employed for purification of the fragment, c) an isolated polynucleotide encoding said gGMG-2 polypeptide fragment, or d) a vector comprising said isolated polynucleotide. 19. A method of using a gGMG-2 polypeptide fragment according to claim 10, comprising administering said gGMG-2 polypeptide fragment to a patient in need thereof for lowering circulating free fatty acid levels in an individual. 20. A method of using a gGMG-2 polypeptide fusion fragment according to claim 14, comprising administering said gGMG-2 polypeptide fusion fragment to a patient in need thereof for lowering circulating free fatty acid levels in an individual. 21. A method of using the polynucleotide according to claim 15, comprising administering said polynucleotide to a patient in need thereof for lowering circulating free fatty acid levels in an individual. 22. A method of using the vector according to claim 16, comprising administering said vector to a patient in need thereof for lowering circulating free fatty acid levels in an individual. 23. A method of using the pharmaceutical composition according to claim 18 for comprising administering said pharmaceutical composition to a patient in need thereof for lowering circulating free fatty acid levels in an individual. 24. The use of claim 19, wherein the medicament further reduces body mass. 25. A method of using a gGMG-2 polypeptide fragment according to any of the claims 10 to 13, comprising administering said gGMG-2 polypeptide fragment to a patient in need thereof. 26. A method of using the gGMG-2 polypeptide fusion fragment according to claim 14, comprising administering said gGmG-2 polypeptide fusision to a patient in need thereof. 27. A method of using the polynucleotide according to claim 15, comprising administering said polynucleotide to a patient in need thereof. 28. A method of using the vector according to claim 16, comprising administering said gGmG-2 polypeptide fragment to a patient in need thereof. 29. A method of using the pharmaceutical composition according to claim 18 for the treatment of an obesity-related disease including but not limited to obesity, impaired glucose tolerance, insulin resistance, atherosclerosis, atheromatous disease, heart disease, hypertension, stroke, Syndrome X Noninsulin Dependent Diabetes Mellitus and Insulin Dependent Diabetes Mellitus, comprising administering said gGmG-2 polypeptide fragment to a patient in need thereof. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The following discussion is intended to facilitate the understanding of the invention, but is not intended nor admitted to be prior art to the invention. Obesity is a public health problem that is serious, widespread, and increasing. In the United States, 20 percent of the population is obese; in Europe, a slightly lower percentage is obese [Friedman (2000) Nature 404:632-634]. Obesity is associated with increased risk of hypertension, cardiovascular disease, diabetes, and cancer as well as respiratory complications and osteoarthritis [Kopelman (2000) Nature 404:635-643]. Even modest weight loss ameliorates these associated conditions. Maintenance of weight gain or loss is associated with compensatory changes in energy expenditure that oppose the maintenance of a body weight that is different from the usual weight [Leibel et al. (1995) N Engl J Med 332:621-8]. These changes may account, in part, for the poor long-term efficacy of obesity treatments [Wadden (1993) Ann Intern Med 229:688-93]. Further, the decreased insulin sensitivity after weight gain and the beneficial effects of even modest amounts of weight reduction on carbohydrate metabolism and insulin sensitivity in some patients are well documented [Olefsky et al. (1974) J Clin Invest 53:64-76]. While still acknowledging that lifestyle factors including environment, diet, age and exercise play a role in obesity, twin studies, analyses of familial aggregation, and adoption studies all indicate that obesity is largely the result of genetic factors [Barsh et al. (2000) Nature 404:644-651]. In agreement with these studies, is the fact that an increasing number of obesity-related genes are being identified. Some of the more extensively studied genes include those encoding leptin (ob) and its receptor (db), pro-opiomelanocortin (Pomc), melanocortin-4-receptor (Mc4r), agouti protein (A y ), carboxypeptidase E (fat), 5-hydroxytryptamine receptor 2C (Htr2c), nescient basic helix-loop-helix 2 (Nhlh2), prohormone convertase 1 (PCSK1), and tubby protein (tubby) [rev'd in Barsh et al. (2000) Nature 404:644-651]. |
<SOH> SUMMARY OF THE INVENTION <EOH>The instant invention is based on the discovery that fragments of the full-length GMG-2 polypeptide comprising the globular domain, termed gGMG-2 polypeptide fragments, form homotrimers having unexpected effects in vitro and in vivo, including utility for weight reduction, prevention of weight gain, and control of blood glucose levels in humans and other mammals. The invention is further based on the discovery that multimers of gGMG-2 homotrimer formed through disulfide linkage at the cysteine residue within the N-terminally disposed unique region have lower specific activity for the activities disclosed herein than does non-multimeric gGMG-2 homotrimer. The instant invention is yet further based on the discovery that gGMG-2 polypeptide fragments comprising all or part of the collagen-like region form more stable gGMG-2 homotrimers having the activities disclosed herein. These unexpected effects of homotrimeric gGMG-2 polypeptide fragment administration in mammals also include reduction of elevated free fatty acid levels caused by administration of epinephrine, i.v. injection of “intralipid”, or administration of a high fat test meal, as well as increased fatty acid oxidation in muscle cells, and weight reduction in mammals consuming a high fat/high sucrose diet. These effects are unexpected and surprising given that administration of multimers of gGMG-2 homotrimer typically has no effect or a significantly reduced effect in vivo or in vitro depending on the specific biological activity and the amount administered. To the extent that any effect is observed following administration of multimers of gGMG-2 homotrimer, the levels of multimeric gGMG-2 homotrimer required for an effect render it unfeasible in most instances as a potential treatment for humans at this time. In contrast, non-multimeric gGMG-2 homotrimer of the invention is radically more effective and thus can be provided at levels that are feasible for treatments in humans. Thus, the invention is drawn to gGMG-2 polypeptide fragments, polynucleotides encoding said gGMG-2 polypeptide fragments, vectors comprising said gGMG-2 polynucleotides, and cells recombinant for said gGMG-2 polynucleotides, as well as to pharmaceutical and physiologically acceptable compositions comprising said gGMG-2 polypeptide fragments and methods of administering said gGMG-2 pharmaceutical and physiologically acceptable compositions in order to reduce body weight or to treat obesity-related diseases and disorders, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region, and further wherein said gGMG-2 polypeptide fragment does not comprise the cysteine residue within the N-terminally disposed unique region either because said cysteine residue has been substituted with an amino acid other than cysteine or because said fragment does not span said cysteine residue. Assays for identifying agonists and antagonists of obesity-related activity are also part of the invention. Antagonists of homotrimeric gGMG-2 polypeptide fragment activity should be effective in the treatment of other metabolic-related diseases or disorders of the invention including cachexia, wasting, AIDS-related weight loss, cancer-related weight loss, anorexia, and bulimia. In preferred embodiments, said individual is a mammal, preferably a human. In a first aspect, the invention features a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment forms homotrimers having unexpected activity, wherein unexpected said activity is selected from the group consisting of lipid partitioning, lipid metabolism, and insulin-like activity, wherein said gGMG-2 polypeptide comprises all or part of the collagen-like region, and wherein said gGMG-2 polypeptide fragment comprises a substitution of an amino acid other than cysteine for the cysteine within the N-terminally disposed unique region selected from the group consisting of alanine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, methionine, asparagines, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine, preferably wherein said substituted amino acid is serine. In preferred embodiments, said polypeptide fragment comprises, consists essentially of, or consists of, at least 6 and not more than 288 consecutive amino acids of SEQ D NO:2 wherein said polypeptide fragment comprises all or part of the collagen-like region, and wherein the cysteines at positions 66, 69 or 70 are replaced by said substitute amino acid(s); or at least 6 and not more than 278 consecutive amino acids of SEQ ID NO:4 wherein said polypeptide comprises all or part of the collagen-like region, and wherein the cysteines at positions 56, 59 or 60 are replaced by said substitute amino acid(s); or at least 6 and not more than 259 consecutive amino acids of SEQ ID NO:6 wherein said polypeptide comprises all or part of the collagen-like region, and wherein the cysteines at positions 37, 40 or 41 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 62-288, 63-288, 64-288, 65-288, 143-288, 144-288, 145-288, 146-288, 147-288, 148-288, 149-288, 150-288, 151-288, 152-288, 153-288, 154-288, 155-288, 156-288, 157-288, 158-288, 159-288, 160-288, 161-288 or 162-288 of SEQ ID NO:2 wherein the cysteines at positions 66, 69 or 70 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 52-278, 53-278, 54-278, 55-278, 133-278, 134-278, 135-278, 136-278, 137-278, 138-278, 139-278, 140-278, 141-278, 142-278, 143-278, 144-278, 145-278, 146-278, 147-278, 148-278, 149-278, 150-278, 151-278 or 152-278 of SEQ ID NO:4, wherein the cysteine at position 56, 59 or 60 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 33-259, 34-259, 35-259, 36-259, 114-259, 115-259, 116-259, 117-259, 118-259, 119-259, 120-259, 121-259, 122-259, 123-259, 124-259, 125-259, 126-259, 127-259, 128-259, 129-259, 130-259, 131-259, 132-259 or 133-259 of SEQ ID NO:6, wherein the cysteine at position 37, 40 or 41 are replaced by said substitute amino acid(s). In a further preferred embodiment, GMG-2 polypeptide fragments having unexpected activity are selected from amino acids about 57-288, 58-288, 59-288, 60-288, 61-288, 143-288, 144-288, 152-288, 153-288, 161-288 or 162-288 of SEQ ID NO: 2; or 47-278, 48-278, 49-278, 50-278, 51-278, 133-278, 134-278, 142-278, 143-278, 151-278 or 152-278 of SEQ ID NO: 4; or 28-259, 29-259, 30-30-259, 31-259, 32-259, 114-259, 114-259, 115-259, 123-259, 124-259, 132-259 or 133-259 of SEQ ID NO: 6. In most preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are human. In other further preferred embodiments, said polypeptide fragment comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding consecutive amino acids of SEQ ID NOs:2, 4 or 6. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. In other highly preferred embodiments, the invention features an GMG-2 polypeptide fragment wherein said GMG-2 polypeptide fragment forms homotrimers having unexpected activity selected from the group consisting of lipid partitioning, lipid metabolism, and insulin-like activity, wherein said GMG-2 polypeptide fragment comprises, consists essentially of, or consists of a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region, and wherein said gGMG-2 polypeptide fragment comprises a substitution of an amino acid other than cysteine for the cysteine within the N-terminally disposed unique region selected from the group consisting of alanine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, methionine, asparagines, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine, preferably wherein said substituted amino acid is serine. In preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 62-288, 63-288, 64-288, 65-288, 143-288, 144-288, 145-288, 146-288, 147-288, 148-288, 149-288, 150-288, 151-288, 152-288, 153-288, 154-288, 155-288, 156-288, 157-288, 158-288, 159-288, 160-288, 161-288 or 162-288 of SEQ ID NO:2 wherein the cysteines at positions 66, 69 or 70 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 52-278, 53-278, 54-278, 55-278, 133-278, 134-278, 135-278, 136-278, 137-278, 138-278, 139-278, 140-278, 141-278, 142-278, 143-278, 144-278, 145-278, 146-278, 147-278, 148-278, 149-278, 150-278, 151-278 or 152-278 of SEQ ID NO:4, wherein the cysteine at position 56, 59 or 60 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 33-259, 34-259, 35-259, 36-259, 114-259, 115-259, 116-259, 117-259, 118-259, 119-259, 120-259, 121-259, 122-259, 123-259, 124-259, 125-259, 126-259, 127-259, 128-259, 129-259, 130-259, 131-259, 132-259 or 133-259 of SEQ ID NO:6, wherein the cysteine at position 37, 40 or 41 are replaced by said substitute amino acid(s). In most preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are human. Alternatively, said gGMG-2 polypeptide fragment comprises, consists essentially of, or consists of, an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding amino acids 57-288 of SEQ ID NO:2 or at least 75% identical to amino acids 47-278 of SEQ ID NO:4 or 28-259 of SEQ ID NO:6. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. In other highly preferred embodiments, the invention features a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment forms homotrimers having unexpected activity, wherein unexpected said activity is selected from the group consisting of prevention of weight gain, weight reduction, and maintenance of weight loss, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region, and wherein said gGMG-2 polypeptide fragment comprises a substitution of an amino acid other than cysteine for the cysteine within the N-terminally disposed unique region selected from the group consisting of alanine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, methionine, asparagines, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine, preferably wherein said substituted amino acid is serine. In preferred embodiments, said polypeptide fragment comprises, consists essentially of, or consists of, at least 6 and not more than 288 consecutive amino acids of SEQ ID NO:2 wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region and wherein the cysteines at positions 66, 69 or 70 are replaced by said substitute amino acid(s), or at least 6 and not more than 278 consecutive amino acids of SEQ ID NO:4 wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region and wherein the cysteines at positions 56, 59 or 60 are replaced by said substitute amino acid(s), or at least 6 and not more than 259 consecutive amino acids of SEQ ID NO:6 wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region and wherein the cysteines at position 37, 40 or 41 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 62-288, 63-288, 64-288, 65-288, 143-288, 144-288, 145-288, 146-288, 147-288, 148-288, 149-288, 150-288, 151-288, 152-288, 153-288, 154-288, 155-288, 156-288, 157-288, 158-288, 159-288, 160-288, 161-288 or 162-288 of SEQ ID NO:2 wherein the cysteines at positions 66, 69 or 70 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 52-278, 53-278, 54-278, 55-278, 133-278, 134-278, 135-278, 136-278, 137-278, 138-278, 139-278, 140-278, 141-278, 142-278, 143-278, 144-278, 145-278, 146-278, 147-278, 148-278, 149-278, 150-278, 151-278 or 152-278 of SEQ ID NO:4, wherein the cysteine at position 56, 59 or 60 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 33-259, 34-259, 35-259, 36-259, 114-259, 115-259, 116-259, 117-259, 118-259, 119-259, 120-259, 121-259, 122-259, 123-259, 124-259, 125-259, 126-259, 127-259, 128-259, 129-259, 130-259, 131-259, 132-259 or 133-259 of SEQ ID NO:6, wherein the cysteine at position 37, 40 or 41 are replaced by said substitute amino acid(s). In most preferred embodiments, gGMG-2 polypeptide fragment having unexpected activity is human. In other further preferred embodiments, said polypeptide fragment comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding consecutive amino acids of SEQ ID NOs: 2, 4 or 6. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. In other highly preferred embodiments, the invention features an GMG-2 polypeptide fragment wherein said GMG-2 polypeptide fragment forms homotrimers having unexpected activity selected from the group consisting of prevention of weight gain, weight reduction, and maintenance of weight loss and wherein said polypeptide fragment comprises, consists essentially of, or consists of a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region, and wherein said gGMG-2 polypeptide fragment comprises a substitution of an amino acid other than cysteine for the cysteine within the N-terminally disposed unique region selected from the group consisting of alanine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, methionine, asparagines, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine, preferably wherein said substituted amino acid is serine. Preferably, said gGMG-2 polypeptide fragment comprises, consists essentially of, or consists of, at least 6 consecutive amino acids of amino acids 57-288 of SEQ ID NO:2 wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region and wherein the cysteines at positions 66, 69 or 70 are replaced by said substitute amino acid(s), or at least 6 consecutive amino acids of amino acids 47-278 of SEQ ID NO:4 wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region wherein the cysteines at positions 56, 59 or 60 are replaced by said substitute amino acid(s), or at least 6 consecutive amino acids of amino acids 28-259 of SEQ ID NO:6 wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region wherein the cysteines at positions 37, 40 or 41 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 62-288, 63-288, 64-288, 65-288, 143-288, 144-288, 145-288, 146-288, 147-288, 148-288, 149-288, 150-288, 151-288, 152-288, 153-288, 154-288, 155-288, 156-288, 157-288, 158-288, 159-288, 160-288, 161-288 or 162-288 of SEQ ID NO:2 wherein the cysteines at positions 66, 69 or 70 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 52-278, 53-278, 54-278, 55-278, 133-278, 134-278, 135-278, 136-278, 137-278, 138-278, 139-278, 140-278, 141-278, 142-278, 143-278, 144-278, 145-278, 146-278, 147-278, 148-278, 149-278, 150-278, 151-278 or 152-278 of SEQ ID NO:4, wherein the cysteine at position 56, 59 or 60 are replaced by said substitute amino acid(s). In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 33-259, 34-259, 35-259, 36-259, 114-259, 115-259, 116-259, 117-259, 118-259, 119-259, 120-259, 121-259, 122-259, 123-259, 124-259, 125-259, 126-259, 127-259, 128-259, 129-259, 130-259, 131-259, 132-259 or 133-259 of SEQ ID NO:6, wherein the cysteine at position 37, 40 or 41 are replaced by said substitute amino acid(s). In most preferred embodiments, gGMG-2 polypeptide fragment having unexpected activity is human. Alternatively, said gGMG-2 fragment comprises, consists essentially of, or consists of, an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding amino acids 57-288 of SEQ ID NO:2 or at least 75% identical to amino acids 47-278 of SEQ ID NO:4 or 28-259 of SEQ ID NO:6. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. In yet other highly preferred embodiments, the invention features a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment forms homotrimers having unexpected activity, wherein unexpected said activity is selected from the group consisting of lipid partitioning, lipid metabolism, and insulin-like activity, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region, and wherein said gGMG-2 polypeptide fragment does not span the cysteine residue within the N-terminally disposed unique region. In preferred embodiments, said polypeptide fragment comprises, consists essentially of, or consists of, at least 6 and not more than 288 consecutive amino acids of SEQ D NO:2 or at least 6 and not more than 278 consecutive amino acids of SEQ ID NO:4, or at least 6 and not more than 259 consecutive amino acids of SEQ ID NO:6. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 143-288, 144-288, 152-288, 153-288, 161-288 or 162-288 of SEQ ID NO: 2. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 133-278, 134-278, 142-278, 143-278, 151-278 or 152-278 of SEQ ID NO: 4. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 114-259, 114-259, 115-259, 123-259, 124-259, 132-259 or 133-259 of SEQ ID NO: 6. In most preferred embodiments, gGMG-2 polypeptide fragment having unexpected activity is human. In other further preferred embodiments, said polypeptide fragment comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding consecutive amino acids of SEQ ID NOs: 2, 4 or 6. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. In other highly preferred embodiments, the invention features an GMG-2 polypeptide fragment wherein said GMG-2 polypeptide fragment forms homotrimers having unexpected activity selected from the group consisting of lipid partitioning, lipid metabolism, and insulin-like activity, wherein said GMG-2 polypeptide fragment comprises, consists essentially of, or consists of a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region and wherein said gGMG-2 polypeptide fragment does not span the cysteine residue within the N-terminally disposed unique region. In preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 143-288, 144-288, 152-288, 153-288, 161-288 or 162-288 of SEQ ID NO: 2. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 133-278, 134-278, 142-278, 143-278, 151-278 or 152-278 of SEQ ID NO: 4. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 114-259, 114-259, 115-259, 123-259, 124-259, 132-259 or 133-259 of SEQ ID NO: 6. In most preferred embodiments, gGMG-2 polypeptide fragment having unexpected activity is human. Alternatively, said gGMG-2 polypeptide fragment comprises, consists essentially of, or consists of, an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding amino acids 57-288 of SEQ ID NO:2 or at least 75% identical to amino acids 47-278 of SEQ ID NO:4, or at least 75% identical to amino acids 28-259 of SEQ ID NO:6. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. In other highly preferred embodiments, the invention features a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment forms homotrimers having unexpected activity, wherein unexpected said activity is selected from the group consisting of prevention of weight gain, weight reduction, and maintenance of weight loss, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region and wherein said gGMG-2 polypeptide fragment does not span the cysteine residue within the N-terminally disposed collagen region. In preferred embodiments, said polypeptide fragment comprises, consists essentially of, or consists of, at least 6 and not more than 288 consecutive amino acids of SEQ ID NO:2 or at least 6 and not more than 278 consecutive amino acids of SEQ ID NO:4 or at least 6 and not more than 259 consecutive amino acids of SEQ ID NO:6. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 143-288, 144-288, 152-288, 153-288, 161-288 or 162-288 of SEQ ID NO: 2. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 133-278, 134-278, 142-278, 143-278, 151-278 or 152-278 of SEQ ID NO: 4. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 114-259, 114-259, 115-259, 123-259, 124-259, 132-259 or 133-259 of SEQ ID NO: 6. In most preferred embodiments, gGMG-2 polypeptide fragment having unexpected activity is human. In other further preferred embodiments, said polypeptide fragment comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding consecutive amino acids of SEQ ID NOs: 2, 4 or 6. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. In other highly preferred embodiments, the invention features an GMG-2 polypeptide fragment wherein said GMG-2 polypeptide fragment forms homotrimers having unexpected activity selected from the group consisting of prevention of weight gain, weight reduction, and maintenance of weight loss and wherein said polypeptide fragment comprises, consists essentially of, or consists of a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region and wherein said gGMG-2 polypeptide fragment does not span the cysteine residue within the N-terminally disposed unique region. Preferably, said gGMG-2 polypeptide fragment comprises, consists essentially of, or consists of, at least 6 consecutive amino acids of amino acids 57-288 of SEQ ID NO:2 comprising all or part of the collagen-like region, or at least 6 consecutive amino acids of amino acids 47-278 of SEQ ID NO:4 comprising all or part of the collagen-like region, or at least 6 consecutive amino acids of amino acids 28-259 of SEQ ID NO:6 comprising all or part of the collagen-like region. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 57-288, 58-288, 59-288, 60-288, 61-288, 143-288, 144-288, 152-288, 153-288, 161-288 or 162-288 of SEQ ID NO: 2. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 47-278, 48-278, 49-278, 50-278, 51-278, 133-278, 134-278, 142-278, 143-278, 151-278 or 152-278 of SEQ ID NO: 4. In other preferred embodiments, gGMG-2 polypeptide fragments having unexpected activity are selected from amino acids 28-259, 29-259, 30-259, 31-259, 32-259, 114-259, 114-259, 115-259, 123-259, 124-259, 132-259 or 133-259 of SEQ ID NO: 6. In most preferred embodiments, gGMG-2 polypeptide fragment having unexpected activity is human. Alternatively, said gGMG-2 fragment comprises, consists essentially of, or consists of, an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding amino acids 57-288 of SEQ ID NO:2 or at least 75% identical to amino acids 47-278 of SEQ ID NO:4, or at least 75% identical to amino acids 28-259 of SEQ ID NO:6. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. In other highly preferred embodiments, the invention features a purified, isolated, or recombinant gGMG-2 polypeptide fragment, wherein said gGMG-2 polypeptide fragment forms homotrimers having significantly greater activity than a monomeric gGMG-2 polypeptide fragment, wherein unexpected said activity is selected from the group consisting of inhibiting smooth muscle proliferation, inhibiting expression of proinflammatory cytokines, inhibiting expression of cell adhesion molecules, and inhibiting expression of tissue factor, wherein said gGMG-2 polypeptide fragment comprises all or part of the collagen-like region, and wherein said gGMG-2 polypeptide fragment comprises a substitution of an amino acid other than cysteine for the cysteine within the N-terminally disposed unique region selected from the group consisting of alanine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, methionine, asparagines, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine, preferably wherein said substituted amino acid is serine. In a further preferred embodiment, the gGMG-2 polypeptide fragment forms homotrimers able to lower circulating (either blood, serum or plasma) levels (concentration) of: (i) free fatty acids, (ii) glucose, and/or (iii) triglycerides. Further preferred gGMG-2 polypeptide fragments form homotrimers that demonstrate free fatty acid level lowering activity, glucose level lowering activity, and/or triglyceride level lowering activity, have an activity that is significantly greater than full-length GMG-2 at the same molar concentration, have a greater than transient activity and/or have a sustained activity. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that maintain weight loss, preferably in individuals who were previously “obese” and are now “healthy” (as defined herein). Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that significantly stimulate muscle lipid or free fatty acid oxidation as compared to full-length GMG-2 polypeptides at the same molar concentration. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that cause C2C12 cells differentiated in the presence of said fragments to undergo at least 10%, 20%, 30%, 35%, or 40% more oleate oxidation as compared to untreated cells or cells treated with full-length GMG-2. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that are at least 30% more efficient than full-length GMG-2 at increasing leptin uptake in a liver cell line (preferably BPRCL mouse liver cells (ATCC CRL-2217)). Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that significantly reduce the postprandial increase in plasma free fatty acids, particularly following a high fat meal. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that significantly reduce or eliminate ketone body production, particularly following a high fat meal. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that increase glucose uptake in skeletal muscle cells. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that increase glucose uptake in adipose cells. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that increase glucose uptake in neuronal cells. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that increase glucose uptake in red blood cells. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that increase glucose uptake in the brain. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that significantly reduce the postprandial increase in plasma glucose following a meal, particularly a high carbohydrate meal. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that significantly prevent the postprandial increase in plasma glucose following a meal, particularly a high fat or a high carbohydrate meal. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that improve insulin sensitivity. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that inhibit the progression from impaired glucose tolerance to insulin resistance. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that increase muscle mass, preferably those that increase muscle cell number, more preferably those that increase muscle fiber number. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that promote an increase in body girth, preferably fragments that promote an increase in muscle mass. Further preferred gGMG-2 polypeptide fragments promote growth rate, preferably promoting an increase in growth rate greater than an average growth rate in the absence of gGMG-2 polypeptide fragments. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that promote growth rate in newborn mammals, preferably cow, goat, sheep, rabbit, mouse, rat, pig, dog, or human newborns, more preferably human newborns between the ages of 0-6 months of age, most preferably human newborn between the ages of 0-3 months. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers that promote growth rate in newborn underweight or premature mammals, preferably cow, goat, sheep, rabbit, mouse, rat, pig, dog, or human underweight or premature newborns, more preferably human underweight or premature newborns between the ages of 0-6 months of age, most preferably human underweight or premature newborns between the ages of 0-3 months of age. Further preferred gGMG-2 polypeptide fragments are those that form homotrimers in vitro and/or in vivo. More preferred gGMG-2 polypeptide fragments are those that form homotrimers in vitro and/or in vivo, wherein at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of said gGMG-2 polypeptide fragment comprises said homotrimer. Most particularly preferred gGMG-2 polypeptide fragments are those that form homotrimers in vitro and/or in vivo having activity selected from the group consisting of lipid partitioning, lipid metabolism, and insulin-like activity. Also most particularly preferred gGMG-2 polypeptide fragments are those that form homotrimers in vitro and/or in vivo having activity selected from the group consisting of prevention of weight gain, weight reduction, and maintenance of weight loss. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. Further preferred embodiments include heterologous polypeptides comprising a gGMG-2 polypeptide fragment of the invention. More preferred is said heterologous polypeptide comprised of a signal peptide N-terminally fused to said gGMG-2 polypeptide of the invention. In yet more preferred embodiment, said signal peptide is human zinc-alpha 2-glycoprotein signal peptide of amino acid sequence MVRMVPVLLSLLLLLGPAVP, preferably encoded by the polynucleotide of sequence atggtaagaatggtgcctgtcctgctgtctctgctgctgcttctgggtcctgctgtcccc. In a second aspect, the invention features a purified, isolated, or recombinant polynucleotide encoding said gGMG-2 polypeptide fragment or full-length GMG-2 polypeptide described in the first aspect, or the complement thereof. In further embodiments the polynucleotides are DNA, RNA, DNA/RNA hybrids, single-stranded, and double-stranded. In a third aspect, the invention features a recombinant vector comprising, consisting essentially of, or consisting of, said polynucleotide described in the second aspect. In a fourth aspect, the invention features a recombinant cell comprising, consisting essentially of, or consisting of, said recombinant vector described in the third aspect. Preferred said recombinant cell is prokaryotic or eukaryotic recombinant cell. Preferred said prokaryotic recombinant cell is E. coli recombinant cell. Preferred said eukaryotic recombinant cell is mammalian recombinant cell. Particularly preferred mammalian recombinant cell is selected from the group consisting of COS recombinant cell, Chinese hamster ovary (CHO) recombinant cell, human embryonic kidney (HEK) recombinant cell, and 3T3-L1 adipocyte recombinant cell. A further embodiment includes a host cell recombinant for a polynucleotide of the invention. Preferred said host cell is prokaryotic or eukaryotic host cell. Preferred said prokaryotic host cell is E. coli host cell. Preferred said eukaryotic host cell is mammalian host cell. Particularly preferred mammalian host cell is selected from the group consisting of COS host cell, Chinese hamster ovary (CHO) host cell, human embryonic kidney (HEK) host cell, and 3T3-L1 adipocyte host cell. In a fifth aspect, the invention features a pharmaceutical or physiologically acceptable composition comprising, consisting essentially of, or consisting of, said gGMG-2 polypeptide fragment described in the first aspect and, alternatively, a pharmaceutical or physiologically acceptable diluent. More preferred said pharmaceutical or physiologically acceptable composition comprises, consists essentially of, or consists of homotrimer of said gGMG-2 polypeptide fragment described in the first aspect and, alternatively, a pharmaceutical or physiologically acceptable diluent. In said pharmaceutical or physiologically acceptable composition, preferably at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of said gGMG-2 polypeptide fragment of the first aspect comprises homotrimer. In a sixth aspect, the invention features a method of reducing body mass comprising providing or administering to individuals in need of reducing body mass said pharmaceutical or physiologically acceptable composition described in the fifth aspect. Further preferred is a method of reducing body fat mass comprising providing or administering to individuals in need thereof said pharmaceutical or physiologically acceptable composition described in the fifth aspect. Further preferred is a method of increasing lean body mass comprising providing or administering to individuals in need thereof said pharmaceutical or physiologically acceptable composition described in the fifth aspect. Further preferred is a method of increasing the growth rate of body girth or length comprising providing or administering to individuals in need thereof said pharmaceutical or physiologically acceptable composition described in the fifth aspect. In a further preferred embodiment, the present invention may be used in complementary therapy of obese patients to improve their weight in combination with a weight reducing agent. Examples of the weight reducing agent include lipase inhibitors, such as orlistat, and serotonin reuptake inhibitors (SSRI) and noradrenaline reuptake inhibitor, such as sibutramine. In further preferred embodiments, the invention features a method of maintaining a reduced body mass comprising providing or administering to individuals in need of maintaining a reduced body mass said pharmaceutical or physiologically acceptable composition described in the fifth aspect. Further preferred is a method of maintaining a reduced body fat mass that comprises, providing or administering to individuals in need thereof said pharmaceutical or physiologically acceptable composition described in the fifth aspect, returning energy intake to a normal level in said individual, and maintaining increased energy expenditure in said individual. Preferrably, said individual is able to maintain a stable weight that is 10-20% below their obese weight (as described herein). In other preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used in combination with reduced energy intake and/or increased energy expenditure as a method of maintaining weight loss. In yet further preferred embodiments, the identification of said individuals in need of reducing body mass to be treated with said pharmaceutical or physiologically acceptable composition comprises genotyping GMG-2 single nucleotide polymorphisms (SNPs) or measuring GMG-2 polypeptide or mRNA levels in clinical samples from said individuals. Preferably, said clinical samples are selected from the group consisting of plasma, urine, and saliva. Preferably, a gGMG-2 polypeptide fragment of the present invention is administered to an individual with at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in blood, serum or plasma levels of full-length GMG-2 or the naturally proteolytically cleaved GMG-2 fragment as compared to healthy, non-obese patients. In a seventh aspect, the invention features a method of preventing or treating an obesity-related disease or disorder comprising providing or administering to an individual in need of such treatment said pharmaceutical or physiologically acceptable composition described in the fifth aspect. In preferred embodiments, the identification of said individuals in need of such treatment to be treated with said pharmaceutical or physiologically acceptable composition comprises genotyping GMG-2 single nucleotide polymorphisms (SNPs) or measuring GMG-2 polypeptide or mRNA levels in clinical samples from said individuals. Preferably, said clinical samples are selected from the group consisting of blood, serum, plasma, urine, and saliva. Preferably, said obesity-related disease or disorder is selected from the group consisting of obesity, impaired glucose tolerance, insulin resistance, atherosclerosis, atheromatous disease, heart disease, hypertension, stroke, Syndrome X, Noninsulin Dependent Diabetes Mellitus (NIDDM, or Type II diabetes) and Insulin Dependent Diabetes Mellitus (IDDM or Type I diabetes). Diabetes-related complications to be treated by the methods of the invention include microangiopathic lesions, ocular lesions, retinopathy, neuropathy, and renal lesions. Heart disease includes, but is not limited to, cardiac insufficiency, coronary insufficiency, and high blood pressure. Other obesity-related disorders to be treated by compounds of the invention include hyperlipidemia and hyperuricemia. Yet other metabolic-related diseases or disorders of the invention including cachexia, wasting, AIDS-related weight loss, cancer-related weight loss, anorexia, and bulimia. In preferred embodiments, said individual is a mammal, preferably a human. In a related aspect, the invention features a method of preventing or treating an inflammation-related disease or disorder comprising providing or administering to an individual in need of such treatment said pharmaceutical or physiologically acceptable composition described in the fifth aspect. In preferred embodiments, the identification of said individuals in need of such treatment to be treated with said pharmaceutical or physiologically acceptable composition comprises genotyping GMG-2 single nucleotide polymorphisms (SNPs) or measuring GMG-2 polypeptide or mRNA levels in clinical samples from said individuals. Preferably, said clinical samples are selected from the group consisting of blood, serum, plasma, urine, and saliva. Preferably, said inflammation-related disease or disorder is selected from the group consisting vascular disorders, diseases and injuries, particularly those caused by excessive inflammatory responses, such as atherosclerosis, angina pectoris, myocardial infarction, deep vein thrombosis, peripheral arterial occlusion, coronary heart disease (CDH), coronary artery disease (CAD), heart failure, transient ischemic attack, post-angioplasty restenoses, myelopoiesis, and disseminated intravascular coagulation (DIC). In preferred embodiments, said individual is a mammal, preferably a human. In related aspects, embodiments of the present invention includes methods of causing or inducing a desired biological response in an individual comprising the steps of: providing or administering to an individual a composition comprising a polypeptide of the first aspect, wherein said biological response is selected from the group consisting of: (a) lowering circulating (either blood, serum, or plasma) levels (concentration) of free fatty acids; (b) lowering circulating (either blood, serum or plasma) levels (concentration) of glucose; (c) lowering circulating (either blood, serum or plasma) levels (concentration) of triglycerides; (d) stimulating muscle lipid or free fatty acid oxidation; (c) increasing leptin uptake in the liver or liver cells; (e) reducing the postprandial increase in plasma free fatty acids, particularly following a high fat meal; and, (f) reducing or eliminating ketone body production, particularly following a high fat meal; (g) increasing tissue sensitivity to insulin, particularly muscle, adipose, liver or brain; (h) inhibiting the progression from impaired glucose tolerance to insulin resistance; (i) increasing muscle cell protein synthesis; (j) reducing adipocyte triglyceride content; (k) increasing utilization of energy from foodstuffs or metabolic stores; (l) increasing growth rate, preferably growth in girth or length; (m) increasing muscle growth; and (n) increasing skeletal growth; and further wherein said biological response is significantly greater than, or at least 10%, 20%, 30%, 35%, or 40% greater than, the biological response caused or induced by a full-length GMG-2 polypeptide at the same molar concentration; or alternatively wherein said biological response is greater than a transient response; or alternativley wherein said biological response is sustained. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to control blood glucose in some persons with Noninsulin Dependent Diabetes Mellitus (NIDDM, Type II diabetes) in combination with insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to control blood glucose in some persons with Insulin Dependent Diabetes Mellitus (IDDM, Type I diabetes) in combination with insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to control body weight in some persons with Noninsulin Dependent Diabetes Mellitus (NIDDM, Type II diabetes) in combination with insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to control body weight in some persons with Insulin Dependent Diabetes Mellitus (IDDM, Type I diabetes) in combination with insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to control blood glucose in some persons with Noninsulin Dependent Diabetes Mellitus (NIDDM, Type II diabetes) alone, without combination of insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to control blood glucose in some persons with Insulin Dependent Diabetes Mellitus (IDDM, Type I diabetes) alone, without combination of insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to control body weight in some persons with Noninsulin Dependent Diabetes Mellitus (NIDDM, Type II diabetes) alone, without combination of insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to control body weight in some persons with Insulin Dependent Diabetes Mellitus (IDDM, Type I diabetes) alone, without combination of insulin therapy. In a further preferred embodiment, the present invention may be used in complementary therapy of NIDDM patients to improve their weight or glucose control in combination with an oral insulin secretagogue or an insulin sensitising agent. Preferably, the oral insulin secretagogue is 1,1-dimethyl-2-(2-morpholino phenyl)guanidine fumarate (BTS67582) or a sulphonylurea selected from tolbutamide, tolazamide, chlorpropamide, glibenclamide, glimepiride, glipizide and glidazide. Preferably, the insulin sensitising agent is selected from metformin, ciglitazone, troglitazone and pioglitazone. The present invention further provides a method of improving the body weight or glucose control of NIDDM patients alone, without an oral insulin secretagogue or an insulin sensitising agent. In a further preferred embodiment, the present invention may be used in complementary therapy of IDDM patients to improve their weight or glucose control in combination with an oral insulin secretagogue or an insulin sensitising agent. Preferably, the oral insulin secretagogue is 1,1-dimethyl-2-(2-morpholino phenyl)guanidine fumarate (BTS67582) or a sulphonylurea selected from tolbutamide, tolazamide, chlorpropamide, glibenclamide, glimepiride, glipizide and glidazide. Preferably, the insulin sensitising agent is selected from metformin, ciglitazone, troglitazone and pioglitazone. The present invention further provides a method of improving the body weight or glucose control of IDDM patients alone, without an oral insulin secretagogue or an insulin sensitising agent. In a further preferred embodiment, the present invention may be administered either concomitantly or concurrently, with the oral insulin secretagogue or insulin sensitising agent for example in the form of separate dosage units to be used simultaneously, separately or sequentially (either before or after the secretagogue or either before or after the sensitising agent). Accordingly, the present invention further provides for a composition of pharmaceutical or physiologically acceptable composition and an oral insulin secretagogue or insulin sensitising agent as a combined preparation for simultaneous, separate or sequential use for the improvement of body weight or glucose control in NIDDM or IDDM patients. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition further provides a method for the use as an insulin sensitiser. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to improve insulin sensitivity in some persons with Noninsulin Dependent Diabetes Mellitus (NIDDM, Type II diabetes) in combination with insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to improve insulin sensitivity in some persons with Insulin Dependent Diabetes Mellitus (IDDM, Type I diabetes) in combination with insulin therapy. In further preferred embodiments, the present invention of said pharmaceutical or physiologically acceptable composition can be used as a method to improve insulin sensitivity in some persons with Noninsulin Dependent Diabetes Mellitus (NIDDM, Type II diabetes) without insulin therapy. In an eighth aspect, the invention features a method of making the gGMG-2 polypeptide fragment described in the first aspect, wherein said method is selected from the group consisting of: proteolytic cleavage, recombinant methodology and artificial synthesis. In a ninth aspect, the present invention provides a method of making a recombinant gGMG-2 polypeptide fragment or a full-length GMG-2 polypeptide, the method comprising providing a transgenic, non-human mammal whose milk contains said recombinant gGMG-2 polypeptide fragment or full-length protein, and purifying said recombinant gGMG-2 polypeptide fragment or said full-length GMG-2 polypeptide from the milk of said non-human mammal. In one embodiment, said non-human mammal is a cow, goat, sheep, rabbit, or mouse. In another embodiment, the method comprises purifying a recombinant mature GMG-2 polypeptide absent the signal peptide from said milk, and further comprises cleaving said protein in vitro to obtain a desired gGMG-2 polypeptide fragment. In a tenth aspect, the invention features a use of the polypeptide described in the first aspect for treatment of obesity-related diseases and disorders and/or reducing body mass. Preferably, said obesity-related diseases and disorders are selected from the group consisting of obesity, impaired glucose tolerance, insulin resistance, atherosclerosis, atheromatous disease, heart disease, hypertension, stroke, Syndrome X, Noninsulin Dependent Diabetes Mellitus (NIDDM, or Type II diabetes) and Insulin Dependent Diabetes Mellitus (IDDM or Type I diabetes). Diabetes-related complications to be treated by the methods of the invention include microangiopathic lesions, ocular lesions, retinopathy, neuropathy, and renal lesions. Heart disease includes, but is not limited to, cardiac insufficiency, coronary insufficiency, and high blood pressure. Other obesity-related disorders to be treated by compounds of the invention include hyperlipidemia and hyperuricemia. In preferred embodiments, said individual is a mammal, preferably a human. The invention further features a use of the polypeptide of the first aspect for prevention of weight gain, for weight reduction, and/or for maintenance of weight loss. In preferred embodiments, said individual is a mammal, preferably a human. In an eleventh aspect, the invention features a use of the polypeptide described in the first aspect for the preparation of a medicament for the treatment of obesity-related diseases and disorders and/or for reducing body mass. Preferably, said obesity-related disease or disorder is selected from the group consisting of obesity, impaired glucose tolerance, insulin resistance, atherosclerosis, atheromatous disease, heart disease, hypertension, stroke, Syndrome X, Noninsulin Dependent Diabetes Mellitus (NIDDM, or Type II diabetes) and Insulin Dependent Diabetes Mellitus (IDDM or Type I diabetes). Diabetes-related complications to be treated by the methods of the invention include microangiopathic lesions, ocular lesions, retinopathy, neuropathy, and renal lesions. Heart disease includes, but is not limited to, cardiac insufficiency, coronary insufficiency, and high blood pressure. Other obesity-related disorders to be treated by compounds of the invention include hyperlipidemia and hyperuricemia. Yet other metabolic-related diseases or disorders of the invention including cachexia, wasting, AIDS-related weight loss, cancer-related weight loss, anorexia, and bulimia. In preferred embodiments, said individual is a mammal, preferably a human. The invention further features a use of the polypeptide of the first aspect for the preparation of a medicament for prevention of weight gain, for weight reduction, and/or for maintenance of weight loss. In preferred embodiments, said individual is a mammal, preferably a human. In a twelfth aspect, the invention provides a polypeptide of the first aspect of the invention, or a composition of the fifth aspect of the invention, for use in a method of treatment of the human or animal body. In a thirteenth aspect, the invention features methods of reducing body weight comprising providing to an individual said pharmaceutical or physiologically acceptable composition described in the fifth aspect, or the polypeptide described in the first aspect. Where the reduction of body weight is practiced for cosmetic purposes, the individual has a BMI of at least 20 and no more than 25. In embodiments for the treatment of obesity, the individual may have a BMI of at least 20. One embodiment for the treatment of obesity provides for the treatment of individuals with BMI values of at least 25. Another embodiment for the treatment of obesity provides for the treatment of individuals with BMI values of at least 30. Yet another embodiment provides for the treatment of individuals with BMI values of at least 40. Alternatively, for increasing the body weight of an individual, the BMI value should be at least 15 and no more than 20. In a related aspect, the invention features methods of maintaining weight loss comprising providing to an individual said pharmaceutical or physiologically acceptable composition described in the fifth aspect, or the polypeptide described in the first aspect. Where the maintenance of weight loss is practiced for cosmetic purposes, the individual has a BMI of at least 20 and no more than 25. In embodiments for the treatment of obesity by means of maintaining weight loss, the individual may have a BMI of at least 20. One embodiment for the treatment of obesity by means of maintaining weight loss provides for the treatment of individuals with BMI values of at least 25. Another embodiment for the treatment of obesity by means of maintaining weight loss provides for the treatment of individuals with BMI values of at least 30. In a fourteenth aspect, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect for reducing body mass and/or for treatment or prevention of obesity-related diseases or disorders. Preferably, said obesity-related disease or disorder is selected from the group consisting of obesity, impaired glucose tolerance, insulin resistance, atherosclerosis, atheromatous disease, heart disease, hypertension, stroke, Syndrome X, Noninsulin Dependent Diabetes Mellitus (NIDDM, or Type II diabetes) and Insulin Dependent Diabetes Mellitus (IDDM or Type I diabetes). Diabetes-related complications to be treated by the methods of the invention include microangiopathic lesions, ocular lesions, retinopathy, neuropathy, and renal lesions. Heart disease includes, but is not limited to, cardiac insufficiency, coronary insufficiency, and high blood pressure. Other obesity-related disorders to be treated by compounds of the invention include hyperlipidemia and hyperuricemia. Yet other obesity-related diseases or disorders of the invention include cachexia, wasting, AIDS-related weight loss, cancer-related weight loss, anorexia, and bulimia. In preferred embodiments, said individual is a mammal, preferably a human. In preferred embodiments, the identification of said individuals to be treated with said pharmaceutical or physiologically acceptable composition comprises genotyping GMG-2 single nucleotide polymorphisms (SNPs) or measuring GMG-2 polypeptide or mRNA levels in clinical samples from said individuals. Preferably, said clinical samples are selected from the group consisting of blood, serum, plasma, urine, and saliva. In a related aspect, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect for reducing an inflammatory response, preferrably an inflammatory response related to a vascular disorder or injury, and/or for treatment or prevention of inflammation-related diseases or disorders. Preferably, said inflammation-related disease or disorder is selected from the group consisting of vascular disorders, diseases and injuries, particularly those caused by excessive inflammatory responses, such as atherosclerosis, angina pectoris, myocardial infarction, deep vein thrombosis, peripheral arterial occlusion, coronary heart disease (CDH), coronary artery disease (CAD), heart failure, transient ischemic attack, post-angioplasty restenoses, myelopoiesis, and disseminated intravascular coagulation (DIC). In preferred embodiments, said individual is a mammal, preferably a human. In preferred embodiments, the identification of said individuals to be treated with said pharmaceutical or physiologically acceptable composition comprises genotyping GMG-2 single nucleotide polymorphisms (SNPs) or measuring GMG-2 polypeptide or in RNA levels in clinical samples from said individuals. Preferably, said clinical samples are selected from the group consisting of blood, serum, plasma, urine, and saliva. In a fifteenth aspect, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect for reducing body weight for cosmetic reasons. In a related aspect, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect for maintaining weight loss for cosmetic reasons. In a sixteenth aspect, the invention features methods of treating insulin resistance comprising providing to an individual said pharmaceutical or physiologically acceptable composition described in the fifth aspect, or the polypeptide described in the first aspect. In a seventeenth aspect, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect in a method of treating individuals with normal glucose tolerance (NGT) who are obese or who have fasting hyperinsulinemia, or who have both. In further preferred embodiments, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect in a method of treating individuals with gestational diabetes. Gestational diabetes refers to the development of diabetes in an individual during pregnancy, usually during the second or third trimester of pregnancy. In further preferred embodiments, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect in a method of treating individuals with impaired fasting glucose (IFG). Impaired fasting glucose (IFG) is that condition in which fasting plasma glucose levels in an individual are elevated but not diagnostic of overt diabetes, i.e. plasma glucose levels of less than 126 mg/dl and greater than or equal to 110 mg/dl. In further preferred embodiments, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect in a method of treating impaired glucose tolerance (IGT) in an individual. In other further preferred embodiments, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect in a method of preventing IGT in an individual. By providing therapeutics and methods for reducing or preventing IGT, i.e., for normalizing insulin resistance, the progression to NIDDM can be delayed or prevented. Furthermore, by providing therapeutics and methods for reducing or preventing insulin resistance, the invention provides methods for reducing and/or preventing the appearance of Insulin-Resistance Syndrome. In further preferred embodiments, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect in a method of treating a subject having polycystic ovary syndrome (PCOS). PCOS is among the most common disorders of premenopausal women. Insulin-sensitizing agents have been shown to be effective in PCOS. Accordingly, the invention provides methods for reducing insulin resistance, normalizing blood glucose thus treating and/or preventing PCOS. In further preferred embodiments, the invention features the pharmaceutical or physiologically acceptable composition described in the fifth aspect in a method of treating a subject having insulin resistance. In still further preferred embodiments, a subject having insulin resistance is treated according to the methods of the invention to reduce or cure the insulin-resistance. As insulin resistance is also often associated with infections and cancer, prevention or reducing insulin resistance according to the methods of the invention may prevent or reduce infections and cancer. In further preferred embodiment, the methods of the invention are used to prevent the development of insulin resistance in a subject, e.g., those known to have an increased risk of developing insulin-resistance. In an eighteenth aspect, the invention features a method of using homotrimeric gGMG-2 polypeptide fragment in a method of screening compounds for one or more antagonists of homotrimeric gGMG-2 polypeptide fragment activity, wherein said activity is selected from but not restricted to weight reduction, maintenance of weight loss, lipid partitioning, lipid metabolism, and insulin-like activity. In preferred embodiment, said compound is selected from but is not restricted to small molecular weight organic or inorganic compound, protein, peptide, carbohydrate, or lipid. In a nineteenth aspect, the present invention provides a mammal, preferably a newborn human, with a supplement to promote, improve, enhance or increase the assimilation, utilization or storage of energy and other nutrients present in foodstuffs consumed by newborn mammals, particularly newborn humans, and particularly energy and other nutrients in infant formula or breast milk. A further preferred embodiment of the present invention is to provide a mammal, preferably a newborn human, with a supplement to promote, improve, enhance, or increase growth rate. Preferred methods of supplementation with a polypeptide of the first aspect include but are not limited to: (a) direct addition of a polypeptide of the first aspect to synthetic infant formula or to breast milk; (b) administration of the pharmaceutical or physiologically acceptable composition described in the fifth aspect prior to feeding, preferably 1-15 minutes prior to feeding, more preferably 1-5 minutes prior to feeding; and (c) administration of the pharmaceutical or physiologically acceptable composition described in the fifth aspect following feeding, preferably 1-15 minutes following feeding, more preferably 1-5 minutes following feeding; wherein routes of administration of a polypeptide of the first aspect or the pharmaceutical or physiologically acceptable composition described in the fifth aspect are selected from oral, buccal, nasal and intramuscular routes, preferably oral routes. A further preferred embodiment is directed to using a polypeptide of the first aspect in methods to promote, improve, enhance or increase the assimilation, utilization or storage of energy and other nutrients present in foodstuffs consumed by newborn mammals, particularly newborn humans, and particularly energy and other nutrients in infant formula or breast milk. A further preferred embodiment is directed to using a polypeptide of the first aspect in methods to promote, improve, enhance or increase the growth rate of a newborn mammal, preferably a human newborn. Further preferred are compositions comprising a polypeptide of the first aspect which can be used in methods to promote, improve, enhance or increase the assimilation, utilization or storage of energy and other nutrients present in foodstuffs consumed by newborn mammals, particularly newborn humans, and particularly energy and other nutrients in infant formula or breast milk. Further preferred are compositions comprising a polypeptide of the first aspect which can be used in methods to promote, improve, enhance or increase the growth rate of a newborn mammal, preferably a human newborn. A still further preferred embodiment of the present invention is directed to compositions comprising synthetic infant milk formula and a polypeptide of the first aspect. Another embodiment of the invention is to provide compositions comprising a polypeptide of the first aspect useful for enhancing or improving the nutritional value of synthetic infant milk formulas or breast milk. Further preferred are compositions useful for incorporation into the diet of a newborn mammal so as to enhance and improve the nutritional value of the diet. Still another embodiment of the invention is to provide techniques and routines for improving the diet and feeding of newborn mammals, particularly premature, underweight or very-low-birth-weight newborns, preferably human newborns. In preferred aspects of the methods of the invention disclosed herein, the amount of gGMG-2 polypeptide fragment or polynucleotide administered to an individual is sufficient to bring circulating (blood, serum, or plasma) levels (concentration) of GMG-2 polypeptides to their normal levels (levels in non-obese individuals). “normal levels” may be specified as the total concentration of all circulating GMG-2 polypeptides (full-length GMG-2 and fragments thereof) or the concentration of all circulating proteolytically cleaved GMG-2 polypeptides only. In preferred embodiments of the compositions of the invention disclosed herein, compositions of the invention may further comprise any combination of gGMG-2 polypeptide fragment of the first aspect, insulin, insulin secretagogues or insulin sensitising agents such that the composition produces a biological effect greater than the expected effect for said gGMG-2 polypeptide fragment administered alone rather than in combination with insulin, insulin secretagogues or insulin sensitising agents. In a further embodiment, said biological function includes, but is not limited to, free fatty acid level lowering activity, glucose level lowering activity, triglyceride level lowering activity, stimulating adipose lipolysis, stimulating muscle lipid or free fatty acid oxidation, increasing leptin uptake in a liver cell line, significantly reducing the postprandial increase in plasma free fatty acids or glucose due to a high fat meal, significantly reducing or eliminate ketone body production as the result of a high fat meal, increasing glucose uptake in skeletal muscle cells, adipose cells, red blood cells or the brain, increasing insulin sensitivity, inhibiting the progression from impaired glucose tolerance to insulin resistance, reducing body mass, decreasing fat mass, increasing lean muscle mass, preventing or treating an metabolic-related disease or disorder, controlling blood glucose in some persons with Noninsulin Dependent Diabetes Mellitus or Noninsulin Dependent Diabetes Mellitus, treating insulin resistance or preventing the development of insulin resistance. Any gGMG-2 polypeptide fragment that forms homotrimers with activity, as described above, may be excluded. |
Closure system for a fuel tank filler pipe and method for opening this pipe |
A closure head for a fuel tank filler pipe allowing automatic opening of a shutter under action of thrust of a nozzle on a device integrated into the top of the filler pipe and closing of the shutter when the nozzle is withdrawn. The locking of the shutter is achieved by a mechanism connected to a bodywork flap such that locking and squashing of a seal are achieved upon the closing of the bodywork flap and the opening of the bodywork flap cannot unlock the shutter without the nozzle additionally being introduced into the system. A method for opening a filler head employs the device. |
1-9. (canceled) 10. A closure system integrated with a fuel tank filler head, comprising: a shutter enabling automatic opening of a pipe by action of a nozzle, according to which the shutter is retractable under action of a thrust force directed against the shutter along an axis parallel to an axis of the filler head; a return spring enabling the shutter to be kept in a closed position; and wherein the shutter is fitted with blocking means that can be released by the thrust force parallel to the axis of the filler head, wherein the blocking means includes a spider for locking rotation of a ring that can be engaged, with clamping, with the shutter. 11. The system according to claim 10, wherein the ring comprises a truncated-cylinder bezel configured to turn about its axis and that is flattened on both of lower and upper faces. 12. The system according to claim 11, wherein the clamping engagement is produced by a bayonet device with interacting parts arranged, respectively, on an inner cylindrical surface of the bezel and on a periphery of the shutter. 13. The system according to claim 12, wherein the parts of the bayonet device include flattened lugs whose thickness varies in a form of a bevel and that are arranged inverted one on top of another. 14. The system according to claim 11, further comprising a torsion spring configured to enable the bezel to be kept in an unlocked and unclamped position when the shutter is open. 15. The system according to claim 11, further comprising a rod configured to connect the bezel to a bodywork flap protecting the filler head and to enable a torsion spring to be tensioned and the bezel to be rotated as far as a locked position when the bodywork flap is closed. 16. The system according to claim 14, further comprising a rod configured to connect the bezel to a bodywork flap protecting the filler head and to enable the torsion spring to be tensioned and the bezel to be rotated as far as a locked position when the bodywork flap is closed. 17. The system according to claim 15, wherein the rod is fastened to the bezel, constituting a slider of a slot in an oblong piece in a form of a slideway borne by a tongue integral with the bezel, the slideway being dimensioned such that an opening of the bodywork flap from a closed position has no effect on the locked position of the bezel. 18. The system according to claim 16, wherein the rod is fastened to the bezel, constituting a slider of a slot in an oblong piece in a form of a slideway borne by a tongue integral with the bezel, the slideway being dimensioned such that the opening of the bodywork flap from a closed position has no effect on the locked position of the bezel. 19. A method for opening a fuel tank filler head by introduction of a nozzle, wherein, after opening a bodywork flap protecting the filler head, forceful introduction of the nozzle in a direction parallel to an axis of the filler head against a spider causes first unlocking of a bezel in a form of a rotationally mobile flattened ring, then unblocking and unclamping of a shutter followed by its tilting and its opening by retraction, an introduction thrust force being sufficient to overcome a return force exerted by a spring, and the unlocking of rotation of the bezel and opening of the shutter being carried out by a method comprising: a) exerting a thrust force on the spider in a direction parallel to the axis of the filler head, which causes the unblocking of the rotation of the bezel and then gradual opening of a bayonet tending to unblock and unclamp the shutter; b) relaxing a torsion spring, tensioned in torsion and a first end of which is fixed and a second end of which is integral with the bezel, to drive the bezel in rotation in a direction favourable to opening of the bayonet; c) under effect of rotation, bevel-cut lugs arranged on an internal cylindrical face of the bezel disengage from analogous inverted bevels situated around the shutter, to disunite the bezel and the shutter previously assembled with force by clamping; and d) decompressing a compressible circular seal arranged at a periphery of the shutter, between the shutter and the bezel, to thereby tilt the shutter. 20. The method according to claim 19, wherein after opening the filler head is closed off again and locked by closing of the bodywork flap, by a lateral movement of a rod, a first end of which is articulated at a point situated at a base of the bodywork flap and a second end of which serves as a slider of a slot in an oblong piece in a form of a slideway borne by a tongue that extends the bezel, movement of the rod causing the bezel to turn in a direction favourable to closing the bayonet, to clamping the seal and to the blocking of the rotation of the bezel by the spider. |
Markers and screens |
Provided are in vivo and in vitro methods for identifying or detecting a synapse which has been activated, or assessing the level of activation of a synapse, which method comprises: (i) determining the presence and\or amount, in a morphologically specialised postsynaptic site in the synapse (e.g. a dendritic spine), of a detectable cellular component associated with the activation (which is a ‘tag’ or ‘marker’ for the activation e.g. an actin-cytoskeleton interacting protein such as profilin II or gelsolin), and (ii) correlating the result of the determination with synaptic activation. Such assays can be useful in identifying processes involved in LTP, and also more generally in identifying modulators of synaptic activation or transmission, and hence cognitive function. |
1-40. (Canceled) 41. A method for identifying or detecting a synapse which has been activated, or assessing the level of activation of a synapse, which method comprises: (i) determining the presence and\or amount, in a morphologically specialised postsynaptic site in the synapse, of a detectable cellular component associated with the activation, and (ii) correlating the result of the determination with synaptic activation. 42. A method as claimed in claim 41 wherein the cellular component is a detectable tag or marker the amount of which is increased in activated synapses. 43. A method as claimed in claim 41 wherein the cellular component is present in the neuron cytoplasm and is not detectably present in the synapse prior to activation but localizes into the synapse when the synapse is activated. 44. A method as claimed in claim 41 wherein the determination is a qualitative. 45. A method as claimed in claim 41 wherein the synapse is an excitatory glutamatergic synapse. 46. A method as claimed in claim 41 wherein the determination of the presence and\or amount of the cellular component in the postsynaptic site in the synapse is preceded by exposing the synapse to a putative or known activation stimulus. 47. A method as claimed in claim 46 wherein the activation stimulus is via an NMDA receptor agonist. 48. A method as claimed in claim 41 wherein the postsynaptic site is a dendritic spine. 49. A method as claimed in claim 48 wherein the cellular component is targeted to the spine head. 50. A method as claimed in claim 49 wherein the cellular component is targeted to punctate sites at the surface of the spine head. 51. A method as claimed in claim 41 wherein the cellular component is an endogenous protein or a derivative thereof which includes a detectable label. 52. A method as claimed in claim 51 wherein the endogenous protein is an actin-regulating protein. 53. A method as claimed in claim 52 wherein the actin-regulating protein is selected from: gelsolin, cofilin, Actin Depolymerizing Factor, profilin II. 54. A method as claimed in claim 51 wherein the cellular component is a labelled derivative of an endogenous protein. 55. A method as claimed in claim 54 wherein the labelled derivative is detectable photometrically. 56. A method as claimed in claim 55 wherein the label is selected from: GFP, YFP. 57. A method as claimed in claim 54 wherein the determination of the presence and\or amount of the cellular component in the postsynaptic site in the synapse is preceded by introducing the labelled derivative into one or more of the neurons forming the synapse. 58. A method as claimed in claim 57 wherein the labelled derivative is expressed from nucleic acid encoding therefor introduced into the neuron or a progenitor thereof. 59. A method as claimed in claim 58 wherein the labelled derivative is expressed from an expression construct or vector. 60. A method as claimed in claim 59 wherein the vector is a eukaryotic expression plasmid containing a β-actin promoter 61. A method as claimed in claim 58 wherein the nucleic acid is stably expressed in the neuron. 62. A method as claimed in claim 41 wherein the synapse is present in a cultured spine-bearing hippocampal neuron. 63. A method as claimed in claim 62 wherein a population of synapses is assessed. 64. A method as claimed in claims 58 wherein the synapse is present in, or is extracted from, a non-human transgenic mammal, the cells of which express said labelled derivative. 65. A method as claimed in claim 64 wherein the presence and\or amount of the detectable cellular component in the morphologically specialised postsynaptic site in the synapse is detected in the intact mammal. 66. A method as claimed in claim 64 wherein the presence and\or amount of the detectable cellular component in the morphologically specialised postsynaptic site in the synapse is detected in brain tissue removed from the mammal. 67. A method as claimed in claim 64 wherein the synapse is electrically stimulated in brain tissue removed from the mammal. 68. A method as claimed in claim 64 wherein the synapse is physiologically stimulated in the mammal. 69. A method as claimed in claim 64 wherein the pattern of activated synapses in the brain of the mammal is correlated to a particular disease state. 70. A method for determining whether a synapse or group of synapses are involved in learning and\or memory comprising performing the method of claim 68, wherein the physiological stimulus is involved in learning and/or memory. 71. A method for assessing the ability of an agent to modulate synaptic activation or transmission, comprising the steps of: (a) contacting the synapse, or neurons forming it, with one or more agents which it is desired to assess, (b) comparing the activation of the synapse in the presence or absence of said agents by use of the method of claim 61, (c) optionally, correlating the values obtained in step (b) with the activity of the agent as a modulator. 72. A method as claimed in claim 71 wherein the method includes the steps of: (i) determining the presence and\or amount, in a morphologically specialised postsynaptic site in the synapse, of the detectable cellular component, (i bis) exposing the neurons forming the synapse to the agent, (i ter) measuring the presence and\or amount, in the morphologically specialised postsynaptic site in the synapse, of the detectable cellular component in the presence of the agent, (ii) comparing the determinations made in (a) and (c). 73. A method as claimed in claim 72 wherein step (i bis) is performed by perfusing the synapse with the agent. 74. A method for assessing the ability of an agent to modulate synaptic activation or transmission, comprising the steps of: (a) measuring profilin II translocation to actively ruffling membrane in non-neuronal cells, (b) exposing said cells to the agent, (c) measuring profilin II translocation to actively ruffling membrane in said cells in the presence of the agent, (d) correlating an increased value in step (c) compared to step (d) with the ability of the agent to stimulate synaptic activation. 75. A method for screening for compounds for the potential to modulate cognitive function, which method comprises assessing the ability of said compounds to modulate synaptic activation by use of the method of claim 71. 76. A method for screening for compounds for the treatment of epilepsy, neurodegeneration, ischemia, migraine, schizophrenia or depression, which method comprises assessing the ability of said compounds to modulate synaptic activation by use of a method of the method of claim 71. 77. A method for screening for compounds for the potential to modulate cognitive function, which method comprises assessing the ability of said compounds to modulate synaptic activation by use of the method of claim 74. 78. A method for screening for compounds for the treatment of epilepsy, neurodegeneration, ischemia, migraine, schizophrenia or depression, which method comprises assessing the ability of said compounds to modulate synaptic activation by use of a method of the method of claim 74. |
<SOH> BACKGROUND ART <EOH>It is known that experimental manipulations of experience produce changes in the shape and number of dendritic spines that form the postsynaptic contact sites for excitatory synapses in the brain (1). A wide variety of ideas about the function of dendritic spines have been proposed. These include that they exist solely to increase the surface area of the neuron available for receiving synaptic contacts, that their role is to protect neurons from excessive excitation, that they act as electrophysiological compartments independent of the dendrite or as biochemical compartments. Evidence that the numbers or shapes of dendritic spines can change according to the sensory input of animals during development or with an animal's behavioural status has led to the proposal that they may be involved in learning and memory (2). Recent live cell imaging studies support this hypothesis by showing both spontaneous and activity-dependent changes in spine shape and number (3-6). This morphological plasticity is associated with high concentrations of actin in spines (7-9) and the appearance of actin-rich, motile protrusions on the surfaces of spine heads (3, 4). Drugs that inhibit actin dynamics block dendritic spine motility (3, 4) and also interfere with the maintenance phase of long-term potentiation (LTP) (10, 11) suggesting that actin may serve as a link between activity-induced modulation of synaptic transmission and long-term changes in synaptic morphology associated with memory consolidation. Nonetheless, actin itself is already present in spines even prior to activation—although some spines acquire more actin when “activated”, at other spines it stays the same and in others it declines. It is known in the art that there is a mismatch in timing between the electrophysiological effects of LTP, which appear immediately, and the associated morphological changes, which require some 30 min to develop. Indeed this temporal gap is one element in a general puzzle concerning the relationship between the electrophysiological signs of synaptic plasticity and the encoding of long term memory (38, 40) namely, how is synaptic specificity maintained during the consolidation process that turns an initially labile memory into an enduring long-term memory trace? It seems that some record of prior activity is needed in order to determine whether a particular pattern of synaptic activation will give a short-lasting or long-lasting LTP i.e. the setting of a “tag” to mark an activated synapse as the future recipient of the consolidation process (38, 41), possibly by sequestering plasticity related proteins. However, although such a distinctive tag has been mooted (41) it has not been identified to date. Naisbitt et al. (1999) Neuron 23: 569-582 describes ‘Shank’, a protein that binds to NMDA receptor complexes. This publication asserts that when synapses are activated by glutamate, the co-localization of shank and cortactin increases from about 5 to 25%. However both shank and cortactin are present in the synapse in both stimulated and unstimulated states and therefore their presence within the synapse is not per se a tag for activation. Ehlers (2000) Neuron 28: 511-525 refers to glutamate receptors (AMPA receptors; AMPAR) being present at high concentrations at the postsynaptic membrane. Whereas synaptic stimulation with glutamate results in rapid loss of AMPARs, induction of LTP causes translocation of AMPAR subunit GluR1 into dendritic spines and synapses. However the fact that the AMPA receptors turn over at the synapse suggests that they are not durable markers of activation and may in any case be present in even non-activated mature synapses. It is therefore of considerable interest in the art to be able to readily identify synapses which have been activated with a “tag” which is a durable marker, the detectable presence of which in the synapse is closely correlated with the activation thereof. Using electrophysiological approaches only very small numbers of neurons (typically 60) can be studied simultaneously and individual synapses lie below the level of resolution. However the identification of a marker tag would permit the identification of populations of synapses involved in conducting a particular patter of stimuli through a neural network either in vitro or in vivo. It would also, inter alia, facilitate the identification of compounds which modulate synaptic activation, and hence downstream neurochemical and neurophysiological events. After the presently claimed priority date, Murase et al (2002, Neuron 35: 91-105) discussed activity-induced changes in β-catenin, which moves from dendritic shafts into spines upon depolarization, apparently influencing synaptic size and strength. This molecule mediates interactions between cadherins and the actin cytoskeleton. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.